The Laryngoscope
Lippincott-Raven Publishers, Philadelphia
01997 The American Larvngolodcal,
Rhinological and Otological Soci& Inc.
Expression of the RETIPTC Fusion Gene
as a Marker for Papillary Carcinoma in
Hashim0to’s Thyroiditis
Ari Wirtschafter; Richard Schmidt, MD; David Rosen, MD; Nandita Kundu; Massimo Santoro, PhD;
Alfred0 FUSCO,
PhD; Hinke Multhaupt, PhD; Joseph P. Atkins, MD; Marc R. Rosen, MD;
William M. Keane, MD; Jay L. Rothstein, PhD
Hashimoto’s thyroiditis is an inflammatory dis-
ease of the thyroid gland with autoimmune etiology.1
Patients afflicted with Hashimoto’s have a higher
risk of thyroid malignancies such as papillary thy-
roid carcinoma.2 In the present study, we investigat-
ed the frequency of papillary thyroid carcinoma spe-
cific genes in patients diagnosed with Hashimoto’s
disease. The newly identified oncogenes RETIPTCI
andRETIPTC3 provide useful and specific markers of
the early stages of papillary carcinoma as they are
highly specific for malignant cells. Using a sensitive
and specific reverse transcriptase-polymerasechain
reaction (RT-PCR)assay, we found messenger RNA
(mRNA)expression for the RETIPTC1 and RETIPTC3
oncogenes in 95%of the Hashimoto’s patients stud-
ied. All Hashimoto’s patients presenting without
histopathologic evidence of papillary thyroid cancer
showed molecular genetic evidence of cancer. These
data suggest that multiple, independent occult tu-
mors exist in these patiens at high frequency.
Key Words: Hashimoto’s thyroiditis-Thyroid
gland-Papillary thyroid carcinoma-RETPTC fu-
sion gene-oncogene.
Laryngoscope, 1OR95-100,1997
INTRODUCTION
Hashimoto’s thyroiditis is an inflammatory dis-
ease of suspected autoimmune etiology and the most
common cause of hypothyroidism. Women in the third
Presented a t the 99th Annual Meeting of the American Laryngologi-
cal, Rhinological and Otological Society, Inc., Orlando, Fla., May 7,1996.
From the Department of Otolaryngology-Head and Neck Surgery
(A.w.,R.s.,D.R.,N.K., J.P.A.,M.R.R.,w.M.K., thomas mas JeffersonUniversi-
ty, Jefferson Medical College, Kimmel Cancer Center, Philadelphia; Diparti-
mento di Biologie e Patologia Cellilare (M.s., A.F.), Facolta di Medicina e
Chirurgia, Napoli, Italy; and the Department of Pathology (H.M.), The Penn-
sylvania Hospital, Philadelphia.
Send Reprint Requests to Jay L. Rothstein, PhD, Department of Oto-
laryngology-Head and Neck Surgery, Thomas Jefferson University, Jeffer-
son Medical College, Kimmel Cancer Center, Philadelphia, PA 19107.
Laryngoscope 107: January 1997
and fourth decades suffer more frequently than men
and are often concurrently afflicted with other dis-
eases such as Addison’s, diabetes mellitus, pernicious
anemia, and myasthenia gravis. Although certain
HLA types are more commonly associated with Hashi-
moto’s, and a high iodide intake may trigger the devel-
opment of the disease, no clear mechanism has been
established. On pathologic examination, thyroids
from Hashimoto’s patients show extensive and chron-
ic infiltration of lymphocytes and natural killer (NK)
cells, resulting in localized tissue damage. In addition,
circulating thyroid-specific autoantibodies are com-
monly found in patients with Hashimoto’s disease.1
Specifically, antibodies are frequently found with re-
activity to the thyroid-specific proteins, thyroid perox-
idase (TPO),and thyroglobulin.1
The most common clinical sequelae of Hashimo-
to’s thyroiditis is hypothyroidism.1 Consequently,
treatment consists of thyroid hormone replacement
with L-thyroxine and, depending on the severity of the
disease, corticosteroids to alleviate local inflamma-
tion. Although the effect of hormone replacement is to
decrease the cellular hypertrophy, in cases of persis-
tent goiter or suspected malignancy, partial or total
thyroidectomy is indicated.1 When considering sur-
gery, one complicating issue is the observed 10% to
40% increased risk of papillary thyroid cancer in pa-
tients diagnosed with Hashimoto’s disease.2.3 In addi-
tion, Hashimoto’s patients have an unusually high
risk of low- and high-grade lymphomas.2 Thus, many
investigators would recommend a more complete ex-
tirpation of the thyroid gland.
Recently, several chromosomal translocations
and inversions involving the proto-oncogene c-RET
have been identified in association with papillary
thyroid carcinoma.66 In papillary carcinoma, the c-
RET gene becomes activated in thyroid follicular
Wirtschafter et al.: Hashimoto’s Thyroiditis
95
cells as a fusion protein resulting from the chromo-
somal translocation or inversion of the c-RET gene
to one of three constituitively expressed genes.
These fusion genes, named RETIPTC -1, -2, and -3,
are highly specific for papillary thyroid carcinoma as
no other forms of thyroid cancer have been found to
express them.4-8 Furthermore, neither normal thy-
roid tissue nor abnormal nonneoplastic cells show
RETIPTC expression.718 Although the c-RET gene
is not expressed in adult tissues, it is hypothesized to
function in the control of neural crest cell migration
and in the differentiation of neuroectodermal deriv-
atives during embryonic development.gJ0 Conse-
quently, the mechanism through which the
RETI PTC fusion proteins cause cellular transfor-
mation is likely related to the reactivation of the fe-
tal c-RET kinase domain present in all c-RET fusion
proteins.7.8 Interestingly, previous studies have
demonstrated the presence of the RETIPTC fusion
gene in at least 11%to 25% of papillary thyroid le-
sions by Southern blot analysis,4 whereas recent
studies have shown that as many as 60%of papillary
carcinomas express the fusion protein messenger
RNA (mRNA) analyzed by reverse transcriptase-
polymerase chain reaction (RT-PCR) (B. Broker et
al. manuscript in preparation). These data are also
in agreement with recent studies using immunocy-
tochemical methods to detect RETIPTC
expression.11In all, the high specificity ofRETIPTC
gene expression for papillary tumors makes these
genes ideal markers to detect thyroid cell transfor-
mation.
Since no causative link between Hashimoto’s
disease and thyroid cancer has been established, the
molecular analysis of thyroid cancer will help eluci-
date the genetic basis for neoplastic transformation
in patients afflicted with Hashimoto’s thyroiditis.
The potential role of oncogenes in autoimmunity has
been suggested, however no causative link has been
established.12 Thus, the analysis of papillary carci-
noma-specific oncogene expression in Hashimoto’s
specimens may define the suspected link between
these two disease entities.
MATERIALS AND METHODS
Specimens.
Paraffin-embedded tissue specimens derived from pa-
tients with a diagnosis of Hashimoto’s thyroiditis were
obtained from the archives at Pennsylvania Hospital and
Thomas Jefferson Medical College, Philadelphia. Hema-
toxylin and eosin-stained slides corresponding to each tis-
sue block (2 two specimens per patient) were evaluated by
a board-certified pathologist a t each institution to assure
the presence of tumor within selected specimens. Corre-
sponding discharge summaries, operative reports, and
pathology reports were obtained with informed consent
from the medical records departments or physician’s of-
fices a t both hospitals.
Laryngoscope 107:January 1997
96
Deparamnization
Formalin-fixed, paraffin-embedded (FFPE) specimens
were received either in 50-pm sections (five) or as entire
blocks of tissue. In the latter case, representative sections
were cut from the blocks and placed into 1.5-mL centrifuge
tubes. With the use of a sterile scalpel, excess paraffin was
trimmed from the cut sections and placed into sterile, 1.5-
mL centrifuge tubes. The scalpel was cleaned five times with
xylene between specimens. Specimens were crushed and
each centrifuge tube was filled with 500 pL of xylene, heated
for 30 minutes at 57”C, and centrifuged for 10 minutes at
12,000revolutions per minute (RPM).The supernatant was
discarded, and the pellet was treated with xylene as above
for two additional cycles. After the third xylene wash, the
samples were washed with 70% ethanol to remove the xy-
lene residue.
RNA Purification and Extraction
Specimen total RNA was isolated as described else-
where.4 Briefly, the deparfinized specimens were resus-
pended in 500 pL of lysis buffer (0.02 mob%TRIS-HCl [pH
7.51, 0.02 m o m EDTA [pH 81, 2% sodium dodecylsulfate
[SDSI) containing 100 pg of proteinase K and placed in a
65°C water bath for 3 days. An additional 100 pg of pro-
teinase K was added after 24 and 48 hours. After the 48-hour
incubation step the samples were removed from the bath
and centrifuged at 12,000 RPM for 20 minutes, and the su-
pernatant was removed. Each supernatant was extracted
with a phenol-chloroformmixture (1:lratio), vortexed, and
centrifuged for 10 minutes at 3000 RPM. The aqueous layer
was removed and a single extraction with chloroform was
performed. If a visible interface remained after the second
extraction, a third extraction was performed. Nucleic acids
were precipitated in 0.3 mol/L NaOAC using 2.5 volumes
100% ethanol, followed by centrifugation. The nucleic acid
precipitate was washed with 70% ethanol and resuspended
in 80 pL of water. DNAse treatment of the extracted nucleic
acid was performed using the 80 pL sample along with 20 pL
of 5X DNAse buffer (250 mmol/L TRIS-HC1, pH 7.5,l mom
NaC1, 50 mmol/L MgCl,, 25 mmol/L CaCl,), 8 units of
DNAse (RNAse free, Boehringer-Mannheim Biochemicals)
and incubated at 37°C for 30 minutes.13 Followingthis incu-
bation, 50 pg of proteinase K was added, and the specimen
was incubated at 56°C for 15 minutes. Subsequent phenol-
chloroform (1:l)and chloroform extractions, ethanol precipi-
tation, and washing were performed as described above. The
resulting RNA precipitates were resuspended in 30 to 45 pL
of RNAse-free water, and ODz6, measurements of the solu-
tion were used to calculate the concentration of total RNA.
Copy DNA (cDNA) Synthesis
Conversion of messenger RNA to cDNA was performed
by adding 5 pg of RNA to a mixture of random hexamers (2
ng/pL), Poly dT primers (40 ng/pL), deoxyribonucleoside
triphosphates (dNTPs) (1mmol/L), in a total of 25 pL of 1X
first strand buffer (GIBCOBRL).This mixture was heated
to 42°C for 90 minutes, followed by 5 minutes a t 95°C and
centrifuged at 8000 RPM for 15 seconds.13
Primers
Genetic analyses for the expression of the mRNAs for
the RETIPTCl and RETI PTC3 translocation fusion genes
Wirtschafteret al.: Hashimoto’sThyroiditis
 TABLE I.
Summary of Hashimoto’sPatient Data.
Patient
No. Aae Sex HistooatholoaicalDiaanosis’ PTClt PTC3*
1 43 M Hashimoto’sthyroiditis - +
2 32 F Papillary carcinoma + +
3 36 F Thyroid free of tumor, nodal + +
metastases contain PTC
4 35 F Hashimoto’sthyroiditis - +
5 64 F Microscopicfollicularadenoma + +
6 52 F Papillary microcarcinomasand - -
multinodulargoiter
7 55 F Hashimoto’sthyroiditis + +
8 49 F Hashimoto’sthyroiditis + +
Fig. 1. Reverse transcriptase-polymerase chain reaction (RT-PCR)of 9 40 F Hashimoto’sthyroiditis + +
RETPTC7 and RETPTC3expressing control cell lines. Total RNA (5 10 28 F Hashimoto’sthyroiditis + +
pg) derived from M28 (lanes 1 and 2) or Gimeret (lanes3 and 4) was 11 71 F Hashimoto’sthyroiditis + +
converted to circular DNA (cDNA) and amplified using RET/PTC7- 12 38 F Papillary carcinoma and adeno- + -
specific primers (lanes2 and 4) or RET/PTCSspecificprimers (lanes1 matous nodule
and 3). PCR products were resolved on a 2.0% agarose gel. Molecular 13 26 F Focal papillarycarcinoma and + +
weight marker (lane M) is $x174 Hae Ill-digested DNA. Appropriate- adenomatoid nodule
sized PCR products using RET/PTC7 (305 bp) and RET/PTC3 (329 14 40 F Hashimoto’lthyroiditis - +
bp) primer sets are shown. Amplified DNA authenticity was verified by F Hashimoto’sthyroiditis + +
15 53
sequence analysis of gel-purified PCR products (notshown).
16 50 F Hurthle cell adenoma + +
17 47 F Hashimoto’sthyroiditis - +
18 68 F Follicular adenoma + +
were performed for each specimen. In addition, each speci- 19 32 F Papillarycarcinoma + +
men was analyzed for the expression of hypoxanthine phos- 20 38 F Papillary microcarcinoma and + +
adenomatous nodule
phoribosyltransferase (HPRT)to verify adequate and equiv- 21 49 F Hashimoto’sthyroiditis + +
alent usage of cDNA in each analysis. Primer sequences for
RETIPTC fusion genes were as follows: RETIPTCl ‘Histopathological diagnosis determined by hematoxylin-eosinstaining o f t
2 thyroid specimens from each patient and interpreted by a board-certified
(GAACGGCGAGATGACAAT) which represents nucleotides 196 pathologist.
to 213 of the H4 gene,7 and the internal H4 primer (for nest- tPresence of the RET/PTCI oncogene mRNA in thyroid specimen as
ed PCR, GAGGAGCTCACCAACCGCCTG), RETI PTC3 (TGGA- determined by RT-PCR (cf. “Materials and Methods”).
GAAGAGAGGCTGTATC)which represents nucleotides 561 to *Presence of the RET/PTC3 oncogene mRNA in thyroid specimen as
580 of the elel gene,s and the internal elel primer (for nested determined by RT-PCR (cf. ”Materials and Methods”).
PCR, ACCGTGGTGTACCCTGCTCTG). For all RETI PCR ampli-
fications an oligonucleotide was used which served as a com-
mon 3‘ end primer (CTITCAGCATCTTCACGG) derived from nu- luted product was then added to a PCR reaction mixture as
cleotides 2198 to 2215 of the c-RET gene5 and for nested described above using the nested PCR primers for
PCR amplifications an internal c-RET primer was used (AC- RETI PTCl and RETI PTC3 listed above. The specificity of
CGTGGTGTACCCTGCTCTG).The 5’and 3’ primer sequences for PCR products was determined by sequencing andlor South-
HPRT are TTTGGGCGGATTGTTGTTTA and GATGCTGTCTTTGAT- ern blotting of the agarose gels using internal RETI PTCl or
GTGAA, respectively. Primer specificity was verified in each RETI PTC3 oligonucleotides (data not shown).
assay by using control cDNA synthesized from an estab-
lished cell line known to express the RETI PTCl (M-28) and
RETIPTC3 (Gimeret) translocation mRNAs (a gift of A. RESULTS
Fusco). PCR product sizes are 305,329, and 253 bp for the To evaluate the presence of thyroid microcarcino-
RETI PTCl, RETI PTC3, and HPRT genes, respectively. mas in Hashimoto’s patients, we developed a
RETIPTC fusion-genespecific assay. Specifically,to de-
PCR and Nested PCR Assay tect the expression of the RETIPTCl and RETIPTC3
The polymerase chain reaction was performed by oncogenes in thyroid specimens, an RT-PCR assay was
adding 5 pL of cDNA to a reaction mixture with a total vol- developed using primers specific for each fusion gene.
ume of 25 pL (lx PCR buffer, 0.2 mmollL dNTPs, 3’ and 5 ’ Figure 1 demonstrates that the primers specific for
primers [4 nglpL each], and 2.0 units of Tuq polymerase).l3 RETIPTCl and RETIPTC3 genes amplified the ap-
The specimens were then placed into a thermocycler and propriate PCR products from cDNA derived from the
subjected to 40 cycles of denaturation at 94°C for 30 seconds, M28 (RETIPTCl expressing) and Gimeret
annealing at 60°C for 30 seconds, and elongation at 72°C for (RETI PTC3 expressing) control cell lines. Sequence
60 seconds. After the PCR reaction was performed on the
specimens for RETIPTCl and RETIPTC3, a second “nest-
analysis of these PCR products verified their authentic-
e d PCR reaction was performed. If a band was present for ity (data not shown). Expression of RETIPTC fusion
the gene of interest in the primary amplification reaction as genes in FFPE specimens from patients (Table I) diag-
determined by agarose gel electrophoresis, the product was nosed with either Hashimoto’s thyroiditis exclusively,
diluted 1:250; if a band was not visualized the primary PCR or those with coexistent cancer, was determined by the
reaction product was diluted 150. Two microliters of this di- RT-PCR assay. RNA control amplifications for each

Laryngoscope 107: January 1997 Wirtschafter et al.:Hashirnoto’sThyroiditis

97
Fig. 2. RETP TC expression analysis of archival Hashimoto’s thyroiditis specimens using a nested PCR assay. Fig. 3. REJPJC expression
Hashimoto’s thyroiditis specimens derived from formalin-fixed, paraffin-embedded (FFPE) blocks were obtained analysis of archival Hashimo-
and processed as described in “Materials and Methods.” Total RNA (5 pg) was reverse transcribed and cDNA was to’s thyroiditis in patient 19 us-
ing a nested PCR assay. Total
amplified using RETPTC7 primers (top), R E T P TC3 primers (center), and hypoxanthine phosphoribosyltrans- RNA (5 pg) was reverse tran-
ferase (HPRT) primers (bottom) in a modified PCR assay as described in the Figure 1 legend and in ”Materials and scribed and cDNA was ampli-
Methods.” Lanes 1 to 10 represent PCR products derived from samples from patients 1 through 10 (Table 1). The ap- fied using FIEJPJC3 primers
propriate size (cf. Figure 1 legend) of the amplified RETPTCcDNAs are shown. The HPRT (control) PCR product is (top), RET/PTCI primers (cen-
235 bp. Molecular weight marker (lane M) is +xl74 Hae Ill-digested DNA. ter), and HPRT primers (bot-
tom) in a modified PCR assay
as described in Figure 1 and in
“Materials and Methods.” Lane
specimen were established using primers directed press RETIPTC at a high fre- 1, PCR results from cDNA de-
against the widely expressed HPRT gene (Fig. 2). Fig- quency.11 Overall, 76% of the rived from the right lobe of the
ure 2 shows the results of RETIPTC and HPRT PCR Hashimoto’s patients ex- thyroid which contained no
histopathologic evidence of
analysis from a representative 10 of the 21 Hashimoto’s pressed the fusion gene papillary carcinoma; lane 2,
patients. Further, the data presented in Figure 2 show RETIPTC1 and 90% (19121) PCR results from cDNA derived
that a high percentage of specimens express either one expressed the fusion gene from the left lobe which con-
tained papillary carcinoma.
or both RETIPTC genes. The expression of multiple RETIPTC3 (Table 11). Those
RETIPTC fusion genes in Hashimoto’s thyroiditis is expressing both fusion genes
consistent with a similar finding of gene expression in numbered 15 (71%) and those that expressed either or
papillary carcinoma(Broker et al. manuscript in prepa- both numbered 20 (95%).Several of the patients diag-
ration, 1996). In addition, recent reports have demon- nosed with Hashimoto’s disease had histopathological
strated that occult papillary tumors of the thyroid ex- evidence of concurrent papillary carcinoma. Interest-

Laryngoscope 107:January 1997 Wirtschafter et al.: Hashimoto’s Thyroiditis

98
 TABLE 11.
Expression of RETP TCin Hashimoto’s samples.
RET/PTC Hashimoto’sl Papillary Non-thyroid
Fusion Gene* Hashimoto’st No PTCS Carcinoma5 Tumors11
RETPTC7 76% (16121) 73% (11/15) 83% (5/6) 0% (0/3)
RETP TC3 90% (19/21) 100% (15/15) 67% (4/6) 0% (0/3)
Both 71Yo (15/21) 73% (11/15) 67% (4/6) 0% (0/3)
Any 95% (20/21) 100%(15/15) 83% (5/6) 0% (0/3)
*Expression of the appropriate RET/PTC fusion gene transcript as
measured by the RT-PCR assay described in ”Materials and Methods.” “Both”
indicates coexpression of RET/PTCl and RET/PTCS; “any” indicates expres-
sion of RET/PTCl and/or RET/PTCB.
tEvidence of Hashirnoto’s thyroiditis was determined by histopathological
diagnosis using hernatoxylin-eosin staining as described in “Materials and
Methods.”
*Evidence of Hashirnoto’s thyroiditis and papillary carcinoma were
determined by histopathologicaldiagnosis using hematoxylin-eosinstaining as
described in “Materials and Methods.”
§Evidence of papillary carcinoma was determined by histopathological
diagnosis using hematoxylin-eosin staining as described in “Materials and
Methods.”
jlThe three non-thyroid tumors consisted of an invasive ductal breast
carcinoma and two epithelioid hemangioendotheliomas (iliac crest) as
determined by histopathological diagnosis of hernatoxylin-eosin-stained
specimens.
ingly, the patients diagnosed with Hashimoto’s disease,
but without histopathological evidence of papillary car-
cinoma, expressed RETI PTCl or RETI PTC3 100%of
the time (TablesI, 11,and Fig. 2).
One advantage of the PCR technique utilized in
this study is the ability to evaluate entire organs or
specific regions for the presence or absence of tumor.
Frequently the issue for the clinician is the possibility
that tumor cells identified in one lobe of the thyroid
may have infiltrated the other lobe at a level not de-
tectable by histopathological analysis. To address this
issue we investigated RETI PTC expression in a thy-
roid node from a patient that was positive for papillary
carcinoma in only one of the two thyroid lobes (Fig. 3).
The specimens taken from patient 19 are derived from
independent biopsies derived from separate lobes of
the thyroid. One lobe demonstrated RETI PTCl and 3
expression (Fig. 3, lane 2) consistent with the histo-
pathologic diagnosis of papillary carcinoma in this
tissue. Interestingly, the other lobe was considered
tumor free by histological analysis but shows evidence
of RETI PTC3 expression, a finding consistent with
cellular transformation. Thus, although only one thy-
roid lobe had histopathologic evidence of papillary car-
cinoma, both had molecular evidence of papillary car-
cinoma as measured by the expression ofRET f PTC.
DISCUSSION
The incidence of thyroid cancer in Hashimoto’s
thyroiditis is a widely debated issue. Although Hashi-
moto’s thyroiditis was first described in 1912, it was
not until 1955 that an association between Hashimo-
to’s and thyroid carcinoma was found.2 In this study
the authors demonstrated a statistically significant
correlation between the two disease states.3 The dis-
covery of this association and the debate as to what ex-
Laryngoscope 107: January 1997
tent this association holds has led to a disagreement
over how best to treat these patients. Treatments
range from total thyroidectomy to observation with
thyroid stimulating hormone (TSH) suppression. To
date, studies demonstrating a relationship between
Hashimoto’s and papillary thyroid cancer report an
increase in cancer incidence of less than 1%to as high
as 40%.2 The high variation in this association likely
comes from the difference in the pathological analysis
and interpretation of thyroid specimens. In some cas-
es it is difficult to histopathologically distinguish be-
tween Hashimoto’s and coexistent thyroid carcinoma.
Indeed, thyroid cancers have been known to induce an
antithyroid antibody response normally associated
with thyroiditis.2 Thus, using molecular markers to
definitively identify tumor tissue in Hashimoto’s dis-
ease is an important advance enabling clinicians to
more precisely evaluate cancer risk.
Although the function of the c-RET gene product
is still unknown, it is expressed predominantly in the
developing nervous and excretory systems, suggesting
a role in renal organogenesis and enteric neurogene-
sis.gJ0 Insofar as tumors are concerned, altered forms
of the c-RET gene are expressed in neuroblastomas,
pheochromocytomas, and medullary thyroid carcino-
mas, all of which originate from cells derived from
neuroectoderm. Physiologically, c-RET is expressed
during embryogenesis in neural crest derived cells in-
cluding those that may be present in the thyroid.gJ0
However, the pathological expression of the c-RET ty-
rosine kinase receptor in tumors and its role in cellu-
lar transformation is not known. Additionally, func-
tional and antigenic changes in cellular proteins
resulting from c-RET mediated transformation have
not been studied. One hypothesis is that the changes
leading to cellular transformation also alter the anti-
genicity of the thyroid cells, making them both stimu-
lants and targets for immune destruction. The role of
oncogenes in autoimmunity is consistent with this hy-
pothesis.12 Previous studies have identified the acti-
vation of other proto-oncogenes during autoimmune
diseases.12 Examples include c-ras and c-myc expres-
sion in systemic lupus erythematosus (SLE),Sjogren’s
syndrome, progressive systemic sclerosis, and der-
matomyositis.12
While the role of oncogene activation in autoim-
mune disease is not clear, the frequent expression of
RETIPTC gene in patients with Hashimoto’s thy-
roiditis suggests that multiple, independent, occult
papillary carcinomas should be a consideration when
evaluating patients for an appropriate treatment
regime. Indeed, rare, multiple synchronous primary
tumors arising in vivo have been reported and may
provide evidence for the “field cancerization” effect
thought to yield independent tumors.14 In evaluating
the consequence of uniform tissue damage in this
model, molecular genetic tools are necessary. Al-
though the etiology of multiple primary tumors in thy-
Wirtschafter et al.: Hashimoto’s Thyroiditis
99
roid patients is not known, prior head and neck irradi-
ation has been implicated.16 Thus, the use of
DNA/RNA amplification techniques has been useful
in examining thyroid tumor tissue.15
A sensitive and specific assay is required to accu-
rately assess the presence of multiple primary thy-
roid tumors in patients with Hashimoto’sthyroiditis.
As shown in this study, thyroid specimens deter-
mined to be free of tumor by histopathologicalexami-
nation may test positive for the presence of microcar-
cinomas when evaluated using the sensitive PCR
assay. However, the decision to utilize a surgical ap-
proach based on the presence of one or more of the
RETIPTC genes remains controversial. Studies
evaluating the relationship between RET I PTC onco-
gene expression and clinical course will assist in
identifying patients with thyroid pathology. Never-
theless, the ability to utilize and to assess genetic al-
terations in fine-needle aspirates may support a role
for PCR analysis in the diagnosis and treatment of
patients with thyroid disease.
BIBLIOGRAPHY
1. Becker KL. Principles and Practices of Endocrinology and Me-
tabolism. 2nd ed. Philadelphia: J.B. Lippincott Co., 1995:
414-417.
2. Ott RA,McCall AR, McHenry C, et al. The incidence of thyroid
carcinoma in Hashimoto’s thyroiditis. Am Surg. 1987;53:
442-445.
3. Dailey ME, Lindsay S, Skahen R. Relation of thyroid neo-
plasms to Hashimoto’s disease of the thyroid gland. AMA
Arch Surg. 1955;70:291-297.
4. Jhiang SM, Mazzafemi EL. The RETIPTC oncogene in papil-
lary thyroid carcinoma. J Lab Clin Med. 1994;123:331-337.
Laryngoscope 107:January 1997
100
5. Bongarzone I, Butti MG, Coronelli S, e t al. Frequent activation
of RET protooncogene by fusion with a new activating gene
in papillary thyroid carcinomas. Cancer Res. 1994;54:2979-
2985.
6. Mulligan LM, Kwok JBJ, Healey CS, et al. Germ-line muta-
tions of the c-RET proto-oncogene in multiple endocrine neo-
plasia type 2A. Nature. 1993;363:458-460.
7. Santoro M, Carlomagno F, Hay ID, et al. Ret oncogene activa-
tion in human thyroid neoplasms is restricted to the papil-
lary cancer subtype. JClinInvest. 1992;89:1517-1522.
8. Bongarzone I, Butti MG, Coronelli S, et al. Frequent activation
of ret protooncogene by fusion with a new activating gene in
papillary thyroid carcinomas. Cancer Res. 1994;54:2979-
2985.
9. Tsuzuki T, Takahashi M, Asai N, et al. Spatial and temporal
expression of the c-RET proto-oncongene product in embry-
onic, infant and adult rat tissues. Oncogene. 1995;10:191-
198.
10. Pachnis V, Mankoo B, Constantini F. Expression of the c-RET
proto-oncogene during mouse embryogenesis. Development.
1993~119:1005-1017.
11. Viglietto G, Chiappetta G, Martinez-Tello FJ, e t al. RETIPTC
oncogene activation is a n early event in thyroid carcinogene-
sis. Oncogene. 1995;11:1207-1210.
12. Sibbitt WL Jr. Oncogenes, growth factors, and autoimmune
diseases (review).Anticancer Res. 1991;11:97-114.
13. Rothstein JL, Johnson D, Skowronski J, et al. Construction of
primary and subtracted cDNA libraries from early embryos.
Methods Enzymol. 1993;225:587-610.
14. Sozzi G, Miozzo M, Pastorino U, et al. Genetic evidence for an
independent origin of multiple preneoplastic and neoplastic
lung lesions. Cancer Res. 1995;55:135-140.
15. Jhiang SM, Smanik PA, Mazzaferri EL. Development of a sin-
gle-step duplex RT-PCR detecting different forms of ret acti-
vation and identification of the third form of in vivo ret acti-
vation in human papillary thyroid carcinoma. Cancer Lett.
1994;78:69-76.
16. Fugazzola L, Pilotti S, Pinchera A, et al. Oncogenic rearrange-
ments of the RET proto-oncogene in papillary thyroid carci-
nomas from children exposed to the Chernobyl nuclear acci-
dent. Cancer Res. 1995:55:5617-5620.
Wirtschafteret al.:Hashimoto’sThyroiditis