Dr Sgamma

SOPs

1. DNA extraction and purification

In order to conduct molecular analysis on materials, the DNA must first be extracted. This DNA must be
sufficiently pure to allow further reactions to take place, such as PCR.
The main kit used is the Bioline Isolate II Plant DNA Kit.
The initial procedure differs depending on the type of starting material (fresh leaf/root/dried material
etc.) but is consistent after tissue lysis is complete. Here are listed the protocols for initial disruption
techniques, the standard DNA extraction method common to all extractions, and two different DNA
purification procedure.

Before you start check:

Wash Buffer PAW2 has ethanol. If not: Add 96-100% ethanol to Wash Buffer PAW2 Concentrate: 24
mL for the 10 prep kit, 100 mL for the 50 prep kit and 200 mL for the 250 prep kit. Important note:
Mark bottle label to indicate ethanol was added. Wash Buffer PAW2 at is stable at room temperature
(18-25°C) for at least one year
RNase A stock solution. Reconstitute lyophilized RNase A in nuclease-free water: 150 µL for the 10
prep kit, 0.6 mL for the 50 prep kit and 1.5 mL x 2 for the 250 prep kit. Store RNase A solution at 4°C
for up to 3 months. For long-term storage of up to 1 year, divide into small aliquots and store at -20°C
Note:
Elution Parameters Elute DNA using Elution Buffer PG (supplied). In general, two consecutive elutions
increases DNA yield compared to a single elution at the same total buffer volume. This is particularly
important for small buffer volumes. However, large volumes of elution buffer or the use of two
consecutive elutions will result in low DNA concentration. The standard elution procedure is already
optimized to yield 80-90% after two elution steps at elevated temperatures. The elution protocol can be
modified to improve yield, concentration or increase elution speed: • Standard elution: dispense 50 µL
Elution Buffer PG, incubate for 5 min at 65°C and repeat (85-90% yield). • Maximum yield: dispense
100 µL Elution Buffer PG, incubate for 5 min at 65°C and repeat (95-100% yield). • High concentration:
dispense 25 µL Elution Buffer PG, incubate for 5 min at 65°C and repeat (75% yield). • Rapid elution:
dispense 100 µL Elution Buffer PG, incubate for 1-5 min at room temperature or 65°C (60-70% yield)

1
1.1 Disruption Techniques

1.1.1 Fresh Plant Material

1. Turn on water bath at 40°C and heat block to 65°C. Incubate the AP2 buffer bottle at 40°C in the
water bath for several minutes and thoroughly mix until SOS precipitate is re-dissolved
completely and thoroughly mix until SOS precipitate is re-dissolved completely.
2. Preheat Elution Buffer PG to 65°C.
3. Wash plant material in 10% bleach solution by submerging, do not rip or bruise the material.
Rinse with distilled water to remove any bleach.
4. Place in a labelled weigh boat and cut into small pieces using scissors/scalpel/razor blade.
5. Place a labelled round bottomed 1.5ml tube on the balance and set to 0.
6. Remove the tube from the balance, add plant material and weigh. Repeat until a minimum of
0.1g (up to 100 mg wet weight) is reached.
7. Pestle and mortar and liquid nitrogen can be used for grinding the material. In this case, after
grinding, transfer the powder in an 1.5ml tube Eppendorf
8. Wash Pestle and mortar with bleach solution in between samples.
9. Add 300μl Buffer AP2, 10μl RNase A stock solution and thoroughly mix sample. Incubate at
65°C for 10 min. Note: For certain plants, increasing incubation time to 30-60 min may be
required.
Note: If sample does not resuspend easily e.g. due to plant powder absorbing too much buffer,
add more Lysis Buffer PA2. The volumes of RNase A, Precipitation Buffer PL3, and Binding
Buffer PB however, have to be increased proportionally.
10. Add 75 µL Precipitation Buffer PL3, mix thoroughly and incubate for 5 min on ice to precipitate
SDS completely.
11. Continue with the Standard DNA extraction procedure
1.1.2 Dried Plant Material (including capsule contents)
1. Turn on water bath at 40°C and heat block to 65°C. Incubate the AP2 buffer bottle at 40°C in the
water bath for several minutes and thoroughly mix until SOS precipitate is re-dissolved
completely and thoroughly mix until SOS precipitate is re-dissolved completely.
2. Preheat Elution Buffer PG to 65°C.
3. Place some sample material into labelled a weigh boat.
4. Place a labelled round bottomed 1.5ml tube on the balance and set to 0.
5. Remove the tube from the balance, add plant material and weigh. Repeat until a minimum of
0.02g is reached (up to 20 mg dry weight (lyophilized) plant material).
6. Pestle and mortar can be used for grinding the material. In this case, after grinding, transfer the
powder in an 1.5ml tube Eppendorf
7. Wash Pestle and mortar with bleach solution in between samples.
8. Add 300μl Buffer AP2, 10μl RNase A stock solution and thoroughly mix sample. Incubate at
65°C for 10 min. Note: For certain plants, increasing incubation time to 30-60 min may be
required.
Note: If sample does not resuspend easily e.g. due to plant powder absorbing too much buffer,
add more Lysis Buffer PA2. The volumes of RNase A, Precipitation Buffer PL3, and Binding
Buffer PB however, have to be increased proportionally.

2
 9. Add 75 µL Precipitation Buffer PL3, mix thoroughly and incubate for 5 min on ice to precipitate
SDS completely.
10. Continue with the Standard DNA extraction procedure

1.2 Standard DNA extraction procedure using Bioline Isolate II Plant DNA Kit.
Filter crude lysate
Place an ISOLATE II Filter (violet) into a new Collection Tube (2 mL) and load lysate onto column.
Centrifuge for 2 min at 11,000 x g. Collect the clear flow-through and discard the ISOLATE II Filter.
Repeat the centrifugation step if not all liquid has passed through the filter.
If a pellet is visible in the flow-through, transfer the clear supernatant without disturbing the pellet to a
new 1.5 mL microcentrifuge tube (not supplied).

Adjust DNA binding conditions

Add 450 µL Binding Buffer PB. Mix thoroughly by pipetting up and down 5 times or by vortexing.

Bind DNA
Place an ISOLATE II Plant DNA Spin Column (green) into a new Collection Tube (2 mL) and load
sample (max. of 700 µL). Centrifuge for 1 min at 11,000 x g and discard the flow-through. The
maximum loading capacity of the ISOLATE II Plant DNA Spin Column is 700 µL. For higher volumes
repeat the loading and centrifugation steps.

Wash and dry silica membrane

• Add 400 µL Wash Buffer PAW1 to the ISOLATE II Plant DNA Spin Column. Centrifuge for 1 min at
11,000 x g and discard
flow-through.
Note: Although washing with Wash Buffer PAW1 increases purity, it can in certain cases reduce the
final yield slightly.
Wash Buffer RW1 will inactivate the DNase I.
• Add 700 µL Wash Buffer PAW2 to the ISOLATE II Plant DNA Spin Column. Centrifuge for 1 min at
11,000 x g and discard
flow-through.
• Add another 200 µL Wash Buffer PAW2 to the ISOLATE II Plant DNA Spin Column. Centrifuge for
2 min at 11,000 x g in order to
remove wash buffer and to dry the silica membrane completely.

Elute DNA

Place the ISOLATE II Plant DNA Spin Column into a new 1.5 mL microcentrifuge tube (not supplied).
Pipette 50 µL Elution Buffer PG (65°C) onto the membrane. Incubate the ISOLATE II
Plant DNA Spin Column for 5 min at 65°C. Centrifuge for 1 min at 11,000 x g to elute the DNA.
Repeat this step with another 50 µL Elution Buffer PG (65°C) and elute into the same tube.

3
1.3 DNA Purification

1.3.1 Isopropanol Clean up

1. For 50µl of DNA add 35µl of isopropanol. Please note that the solution will go cloudy, so mix
by pipetting.
2. Centrifuge the solution at 15,000 × g for 30 minutes at 4°C.
3. Remove the supernatant and gently tap the rest out of the tube taking care not to disturb the
pellet.
4. Re-suspend the pellet in 200µl of ethanol.
5. Centrifuge the solution at 15,000 × g for 10 minutes at room temperature.
6. Remove the supernatant and allow all the ethanol to evaporate, this takes approximately 20
minutes.
7. Re-dissolve the pellet in 50µl of elution buffer.
1.3.2 Ethanol DNA clean up
Reagents Needed:
• 3 M sodium acetate pH 5.2 or 5 M ammonium acetate
• DNA
• 100% ethanol
• 70% ethanol

Protocol
1. Measure the volume of the DNA sample.
2. Add 1/10 volume of sodium acetate, pH 5.2, (final concentration of 0.3 M)
These amounts assume that the DNA is in TE only; if DNA is in a solution containing salt, adjust
salt accordingly to achieve the correct final concentration.
3. Mix well.
4. Add 2 to 2.5 volumes of cold 100% ethanol (calculated after salt addition).
5. Mix well.
6. Add 1µl glycogen (5 mg/ml)
7. Mix well
8. Place at -80 degrees C for 50-60 minutes (or O/N)
9. Spin a maximum speed in a microfuge 10-15 min at 4C.
10. Carefully decant supernatant.
11. Add 1 ml 70% ethanol. Mix. Spin briefly. Carefully decant supernatant.
12. Air dry (circa 20 mins) or briefly vacuum dry pellet.
13. Resuspend pellet in the appropriate volume of elution buffer or water

1.3.3 DNA Precipitation: Ethanol vs. Isopropanol

DNA is less soluble in isopropanol so it will fall out of solution faster and at a lower concentration, but
the downside is that the salt will too. With ethanol, the DNA needs to be at a higher concentration to
flocculate but the salt tends to stay soluble, even at cold temperatures.

4
DNA falls out of solution in 35% isopropanol and 0.5M salt. Using ethanol, the final concentration
needs to be around 75% with 0.5M salt. So for the typical precipitation protocol, isopropanol is added
from between 0.7-1 volumes of sample and ethanol is added at 2-2.5 volumes of sample.

The choice of which solvent to use depends largely on the volume of sample you need to precipitate.

If you are precipitating small volumes of DNA, and you can fit the required amount of solvent into the
sample tube, then ice cold ethanol is the preferred choice. You can chill it (some people use liquid
nitrogen or -80C to accelerate the precipitation) and precipitate more DNA without the salt
contamination that would occur from chilling isopropanol. Afterwards you need to wash the pellet with
70% ethanol to remove salt.

Isopropanol use useful for precipitations where you have a large sample volume (e.g. the eluate you get
after using a Qiagen plasmid Maxi Kit) because less solvent is needed, so you can fit the whole lot in the
(15ml) tube. But because salts are generally less soluble in isopropanol than in ethanol, they have more
of a tendancy to co-precipitate with the DNA. So to lessen the chances of salt precipitation, isopropanol
precipitations are carried out at room temperature with minimal incubation times. Once the DNA or
RNA pellet is recovered from the isopropanol, you’ll want to wash it with cold 70% ethanol to remove
excess salt and to exchange the isopropanol with the more volatile ethanol. It is ok to chill the
isopropanol precipitated sample, if you are sure that it is not excessively salty.

Because DNA is less soluble in isopropanol, isopropanol allows precipitation of larger species and lower
concentrations of nucleic acids than ethanol, especially if you incubate it cold and long. If you do this,
just remember to wash the pellet several times in 70% ethanol after pelleting, to reduce the amount of
salt you carry over.

So how do you choose when to use isopropanol and when to use ethanol?

Use ethanol if:

You have room to fit two volumes of ethanol to sample in your tube
The sample needs to be stored for a long period of time and will be chilled
You need to precipitate very small pieces of DNA or you have a very low concentration of sample so
you want to chill it longer and colder.

Use Isopropanol if:

You have limited in space in your tube and can fit only 1 volume of sample
You need large molecular weight species because incubation at room temperature for short periods of
time will not be conducive to precipitating small species of nucleic acid
You are in a hurry and want to accelerate the precipitation of nucleic acids at room temperature

Finally, for dry DNA pellets, heating the sample in buffer at 50-60C will help the DNA dissolve faster
and won’t damage the DNA. For RNA, heating can be used too (in water) at temps around 42C.
Overdried DNA and RNA will take longer to dissolve so make sure not to speed vac for too long.

5
2. DNA Quantification

2.1 Nanodrop
1. Wipe pedestals with tissue and sterile distilled water.
2. Blank instrument by selecting DNA from home screen (assay type)
3. Pipette 1.5 µl blanking buffer onto lower pedestal (TE buffer from extraction kit is in a tube by
machine)
4. Lower arm, press blank
5. Once measurement is complete, raise arm and wipe buffer with a tissue
6. Repeat step 3, 4, 5
7. Now samples may be loaded:
8. Pipette 1.5 µL sample onto lower pedestal , close arm and press Measure
9. Write values onto spreadsheet and on tube
10. Wipe pedestals with a tissue in between each sample.

Figure 1 Nanodrop screen

Blank machine every 30 minutes as per step 2.

When sampling is finished the instrument must be cleaned:

1. Pipette 3 µl sterile deionised distilled water onto bottom pedestal
2. Lower arm and leave for 2-3 mins
3. Wipe away water from both pedestals with dry tissue

6
3. How to store DNA
Once the DNA has been extracted and the quantity and quality of the sample noted using the
Nanodrop, it must be aliquoted and stored as following.
Long term storage: at -80°C
Short term storage: at -20°C
Working stock: at 4°C
Each tube must be labelled.

4. Polymerase Chain Reaction (PCR)

PCR is the method by which a particular region of DNA is amplified. The primers used define the
region that will be copied, and therefore the length of the amplicon produced. Different reagents can be
used for specific purposes but the general kit used is the Bioline MyTaq Red Mix.

4.1 PCR Experiment Design

1. Identify the number of PCRs required; this is normally the number of samples plus a positive and
negative control. An extra reaction is also allowed for to account for losses while pipetting.
2. Multiply the quantities in Table 1 by this number; this is the recipe for your master mix.
3. The DNA will not be added to the master mix, but to each reaction tube individually.
4. Calculate and list the volume of master mix to add to each reaction, and the volume of DNA.
5. Positive and negative amplification controls should be setup last.
6. List the label of each of the PCR tubes, and which DNA sample or primers will be added to that
reaction.
7. Double check the figures and the quantities of each reagent required.

Table 1 Recipe for standard PCR with BioLine MyTaq reagents

Component Concentration Final Amount

Concentration
MyTaq Red Mix 2x 25 µl 5.0 µl
Forward Primer 10µM each 0.2µM 1 µl 0.2 µl
Reverse Primer 10µM each 0.2µM 1 µl 0.2 µl
Template DNA 2 µl 0.5 µl
Distilled Water 21 µl 4.1 µl
Total 50 µl 10 µl

Note: When planning PCRs for sequencing always conduct 50µL reactions, otherwise depending
on the motive for the PCR experiment, it may well be advisable to use 10 µl final volume. This
enables more reactions to be carried out by using less consumable per experiment. Small aliquots
of specific oligo (primers) stocks and MyTaq Red Mix stock can be kept in individual boxes in your
freezer compartment.

7
4.2 PCR Setup
1. Assemble the required reagents and samples
2. Assemble and label the tubes for each PCR (0.2ml) and master mix (1.5ml).
3. Pipette the components of the master mix as required using the dedicated pipettes and tips. If
necessary, centrifuge briefly to bring the reagents together at the base of the tube.
4. Divide the PCR master mix between the PCR tubes.
5. Add the DNA.
6. Briefly vortex each tube, followed by centrifugation if necessary to ensure that all the
components are mixed and amalgamated.
7. Put all of the reagents and cold racks back into the fridge/freezer.
8. Take the rack containing PCRs to the PCR machine.

8
 4.2.1 Primers dilution from vendor to PCR
Each new primer received from the vendor must be logged in logged in into the Primer inventory
excel spreadsheet allocated in the BTG file on the shared drive and will be stored at -20°C in the
Primer bank.
In the laminar flow hood, reconstitute the dried oligos in molecular biology grade water to make a 100
µM (micro-molar) stock solution. Always take great care not to contaminate the original primer stock
(use filter Tips). Prepare the 100 µM primer stock solution in the tube containing the pellet. This tube
will be used to make working primer solutions as needed and will be stored at -20°C in the Primer bank.
To prepare stock:
1. Determine how many nmoles of primer is in the tube (usually written on the tube or on
information accompanying primer order).
2. Resuspend the pellet in water generate the 100 µM stock solution.
(An easy way to do this is to multiply the nmole value by 10 and add that volume in ul to the
pellet
e.g. If primer pellet is 28.3 nm, you will add 283 µl of water to the pellet to resuspend it. The
final concentration of primer is 100 µM.
The 100 µM stock solution will be dispensed in a small 0.5 eppendorf tube to be used for making the
working solution.

To prepare the 10 µM working solution, take 10 µl from the stock solution (100 µM) and add to 90 µl
water. This tube can be stored in your box.

From this, use 1 µl in a typical 50 µl PCR reaction. This will give you a final concentration of 0.2 µM in
a PCR reaction.

9
Typical primers and cycling program:

ITS

Table 2: Primers for the amplification of the ITS region

Primer Sequence
ITS1 TCCGTAGGTGAACCTGCGG
ITS4 TCCTCCGCTTATTGATATGC

Cycling programme: 2min at 94oC initial denaturation step, 35 cycles consisting of 45s at 94oC, 30s at
60oC and 30s at 72oC, final extension period of 2min at 72oC.

After thermal cycling, the reactions can be stored in the freezer for later analysis via gel
electrophoresis.

When working with Specie specific primers other settings will be used.

10
5. Gel Electrophoresis

5.1 TBE
TBE is the buffer that is used in gel electrophoresis. It is also used to make the actual gel.

Table 3: 1 × TBE Recipe

Compound Amount
Tris Base 10.8 g
Boric Acid 5.5 g
EDTA 0.584 g
Distilled Water 1L

5.2 Agarose gel method

The percentage of the gel will depend on what you are analysing. Refer to the table below for guidance.

Table 4: Percentages of gels

Expected Product Size Agarose Concentration (w/v) TBE Concentration

< 150 bp 3% 1X
150 - 300 bp 2% 1X
> 300 bp 1% 1X

Start by adding the appropriate amount of agarose powder to 1 × TBE, for example a 300 bp PCR
product will require a 1% gel. This will involve adding 1g of agarose powder to 100ml of TBE or 0.5g
of agarose powder to 50ml of TBE. Dissolve the agarose powder in the TBE using the microwave. This
takes approximately 50 seconds, it is ready when the solution is clear and all the agarose has dissolved.
Leave to cool and then add an appropriate amount of 10,000 × SYBR safe DNA stain. For a 100ml gel
2µL is required. Pour the gel mixture into a cast with comb(s) placed and leave to set. Once the gel has
set carefully remove the comb(s), place in the tank in the right orientation and cover with buffer (1 x
TBE).
Carefully pipette an appropriate amount of sample to each well. If the sample is not already coloured
(i.e. if you have not used the MyTaq red mix) you need to add 2µl of the gel loading buffer to your
sample. This buffer is available in the molecular weight ladder box. Connect the power pack and leave
running at 90V for approximately 25 minutes. Different voltages and different times will be required
depending upon the size and nature of the PCR product.
When required, load a DNA ladder onto the gel for size interpretation.

11
6. Preparing and Sending Samples for Sequencing

6.1 Preparing Samples for Sequencing

Samples that are to be sequenced must go through several processes. First the region of interest must be
amplified via PCR and checked on a gel. Once you have at least 40µL of good quality sample it is ready
to be sent off for sequencing, so when planning PCRs for sequencing always conduct 50µL reactions.
Good quality is indicated by a crisp, bright, single band on the gel. If multiple bands are present then
DNA sequencing is unlikely to work.
The service provider will then conduct a clean-up of the PCR, removing all components other than the
amplicons. This target is then put into a cycle sequencing reaction which is similar to PCR but only uses
one primer and incorporates fluorescently labelled ddNTPS. The primer should match one of those used
in the original PCR (unless you have chosen to use nested primers). The product of this reaction is then
analysed via capillary electrophoresis, creating a ‘read’ for that region which will either be forward or
reverse depending on the primer used. To create high quality data, three reads are required including at
least one forward and one reverse. Each read must be ordered separately and the data carefully collected
and recorded ready for analysis when all three reads are complete.

6.2 Sending Samples for Sequencing

The following protocol is followed when sending samples to Macrogen:

Once the PCRs have been prepared, an order form spread sheet is filled out with information including
the name of the PCR product, the primers used, the sequence of the primers and the size of the product
in base pairs.

The PCR samples (40 µl) should be transferred to 0.5mL tubes, labelled, and Nescofilm wrapped around
the lid to prevent spillage. The tubes must be clearly labelled with the numbers on the sequencing order
form generated by Macrogen and nothing else. NOTE: Make proper notes of which sample you’re
sending.

7. Gel imaging
The gel is photographed using a Gel Doc EZ imager in H1.15. Turn on power to the imager using the
switch (image 1) on the side of the instrument. The gel is removed from the cast and placed onto an
appropriate tray (Blue or UV). Open the imager door and place your gel on the sample tray and insert it
into the imager until the magnet grabs the tray. Default protocols are created in My documents>Gel
images>Protocol1 (for blue tray) or Protocol2 (for UV tray). Select suitable protocol & press the green
button on the front of the instrument or ‘run protocol’ on computer.

12
 Power switch
Figure 2: Overview of Gel Doc EZ imager

An image of the gel will appear on the computer. Make sure the gel is appearing straight. If the gel is
appearing overexposed, adjust the exposure setting for the manual expose.

The following illustration (Image 2) shows the Image Lab software main window.
The paragraphs below image describe the main software elements:

13
 Figure 3: Image Lab software main window

Main Window
Image Lab software displays a single main window. All image and protocol dialog boxes that present
choices open in the workspace, which is the grey area of the main window.

Toolbar
Many Image Lab software tools can be selected by clicking toolbar icons. The
Snapshot tool enables you to send a screen capture of your image to the clipboard or to save it as a file.

14
Display Toolbox
The Display Toolbox near the top of every image enables you to display your images in the most useful
ways.

Analysis Tool Box

The Auto Analysis button quickly analyzes images.

The remaining tools customize the analyzed data.
Note: An image file must be selected (on a Windows computer, the title bar is dark
blue) to make analysis tools available.
Image Tools enable you to flip, rotate, and crop images, and to transform the
image files.
Lane and Band controls the detection function, enabling you to resize, adjust, and
bend lanes, and to detect, adjust, add, or delete bands.
MW (Molecular Weight) Analysis Tools enable you to choose standard samples,
assign standard lanes, and choose a regression method.
Quantity Tools enable you to automatically quantitate bands using either relative
or absolute values.
Annotation Tools are useful for labelling & drawing attention to any area of a gel
of interest.
Volume Tools enable you to manually quantify an object inside a boundary that
you define.

15