Neuroscience Letters 462 (2009) 58–63

Contents lists available at ScienceDirect

Neuroscience Letters
journal homepage: www.elsevier.com/locate/neulet

Synchronized diurnal and circadian expressions of four subtypes of melatonin

receptor genes in the diencephalon of a puffer fish with lunar-related
spawning cycles
Taro Ikegami a , Eiji Motohashi a , Hiroyuki Doi b , Atsuhiko Hattori c , Hironori Ando a,∗
a
Laboratory of Advanced Animal and Marine Bioresources, Graduate School of Bioresource and Bioenvironmental Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku,
Fukuoka 812-8581, Japan
b
Shimonoseki Marine Science Museum “Kaikyokan”, Shimonoseki Academy of Marine Science, Yamaguchi 750-0036, Japan
c
Department of Biology, College of Liberal Arts and Sciences, Tokyo Medical and Dental University, Ichikawa, Chiba 272-0827, Japan

a r t i c l e i n f o a b s t r a c t

Article history: Multiple subtypes of melatonin receptors are expressed in neural and peripheral tissues to mediate mela-
Received 10 April 2009 tonin actions on the regulation of circadian rhythms in vertebrates. To elucidate molecular basis of “circa”
Received in revised form 9 June 2009 rhythms in the grass puffer Takifugu niphobles, which spawns synchronously with semilunar cycles, tis-
Accepted 21 June 2009
sue distribution of four melatonin receptor subtype mRNAs (Mel1a 1.4, Mel1a 1.7, Mel1b , and Mel1c ) were
examined, and diurnal and circadian changes in their absolute amounts were examined in the retina,
Keywords:
diencephalon, and optic tectum. Mel1a 1.4, Mel1a 1.7, and Mel1b mRNAs were widely distributed in vari-
Circadian rhythm
ous brain regions, retina, pituitary, and peripheral tissues, whereas Mel1c mRNA was mainly detected in
Diencephalon
Melatonin receptor
the nervous tissues and pituitary. All subtype genes showed diurnal expressions with one or two peaks
Optic tectum during nighttime. When the fish were reared under constant darkness, the retinal expressions of Mel1a
Retina 1.7, Mel1b , and Mel1c genes were markedly diminished but still showed circadian variations. In contrast,
Puffer increased and synchronized expressions of the four subtype genes were noticeable with one peak at cir-
cadian time 18 in the diencephalon. The circadian expression profiles in the optic tectum were different
among the subtypes. The present results suggest that melatonin receptor gene expression is regulated
by circadian clock and light, but the effects of light are different among the tissues. The synchronized
expressions of the four subtype genes in the diencephalon may be related to the exertion of reproductive
rhythmicity in this puffer species.
© 2009 Elsevier Ireland Ltd. All rights reserved.

Melatonin acts as a neuroendocrine message involved in the regu-
lation of circadian and seasonal biological rhythms [2,13]. These
actions of melatonin are mediated via melatonin receptors that
belong to the G protein-coupled receptor superfamily [15]. There
are three melatonin receptor types, Mel1a (MT1), Mel1b (MT2), and
Mel1c , in vertebrates. Mel1a and Mel1b have been identified in all
vertebrate species investigated, whereas Mel1c is found only in non-
mammalian species [1,14]. In addition, two subtypes of Mel1a have
been identified in zebrafish [14], rainbow trout [8], and goldfish [6].
Accordingly, phylogenetic analyses have shown that there are four
subtypes of melatonin receptors in fish [14].
These subtype genes are considered to be expressed to mediate
various physiological functions of melatonin in nervous and periph-
eral tissues. Relatively higher expression levels of these genes have
been reported in the retina and retinorecipient brain regions such as
∗ Corresponding author. Tel.: +81 92 642 7373; fax: +81 92 642 7373.
E-mail address: hando@brs.kyushu-u.ac.jp (H. Ando).
diencephalon, mesencephalon, and optic tectum [8,16]. We recently
examined their expressions in the retina and optic tectum of gold-
fish and found that all four genes were expressed in these tissues,
though their expression levels were different [6]. In the retina of
sea bass, Mel1a 1.7 and Mel1b were expressed in different cell layers
[16]. Therefore, differences in expression levels and distribution of
melatonin receptor subtypes are most likely important for under-
standing molecular basis of melatonin action.
In mammals, the expression levels of melatonin receptors show
diurnal and circadian variations in the suprachiasmatic nucleus
(SCN) and therefore melatonin receptors are considered to play a
key role in conveying photoperiodic information to the SCN [7]. In
fish, diurnal variations in the density of melatonin binding sites
have been reported in the brain [3]. The melatonin receptor gene
expression also showed diurnal variations in the brain and retina
[6,10–12,17]. Although the diurnal variations of melatonin receptor
genes may be important for the actions of melatonin, regulatory
mechanisms of the diurnal expressions of melatonin receptor genes
are largely unknown. Since circadian variations in the levels of

0304-3940/$ – see front matter © 2009 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.neulet.2009.06.076
 T. Ikegami et al. / Neuroscience Letters 462 (2009) 58–63
melatonin receptor mRNAs have been reported in the whole brain
and retina of rabbitfish [10–12], circadian regulation of melatonin
receptor genes is most probably important for the diurnal varia-
tion. Furthermore, Park et al. [10,11] showed that light exposure in
the subjective nighttime decreased the levels of melatonin receptor
mRNAs in the pineal gland, suggesting that the light-induced sup-
pression of melatonin receptor gene expression is involved in the
diurnal expressions of melatonin receptor genes.
In order to clarify the molecular basis of melatonin actions on the
photoperiodic rhythmicity, we chose grass puffer Takifugu niphobles
as an experimental model. Grass puffer exhibits lunar-synchronized
spawning rhythm: spawning occurs on beach several hours before
high tide only for several days around new moon and full moon
[19]. Thus, the spawning of grass puffer may be associated with
both circadian and circalunar rhythms. Takemura et al. [18] showed
that in the golden rabbitfish, which spawns once a month around
the first quarter moon, the plasma melatonin levels at mid-night
of the new moon was higher than those of the full moon, and the
alteration of lightness during night affected the spawning. There-
fore, the intensity of moonlight may be involved in the regulation
of lunar-synchronized reproductive activities through lunar-related
variations of the plasma melatonin concentrations.
As a first step to investigate the possible role of melatonin recep-
tor in the lunar-synchronized spawning of grass puffer, we first
determined the nucleotide sequences of four subtypes of melatonin
receptor cDNAs, and examined distribution of these mRNAs in the
various brain regions and peripheral tissues by reverse transcrip-
tion (RT)-polymerase chain reaction (PCR). Then, the diurnal and
circadian variations were examined in the retina, diencephalon, and
optic tectum by real-time PCR.
Grass puffer of both sexes was caught by a settled net on the
coast of Shimonoseki, Yamaguchi, Japan. They were transferred to
the Fishery Research Laboratory station, Kyushu University, and left
in indoor tanks (500 L) at 17–22 ◦ C under natural photoperiod for 1
week. To examine tissue distribution of melatonin receptor mRNAs,
the fish (35.3 ± 5.9 g in body weight (BW), n = 3) were anesthetized
in 0.03% tricaine methanesulfate (MS222, Sigma–Aldrich, USA) and
killed by decapitation around mid-night. The brain and eyeball were
removed and soaked in RNAlater (Ambion, USA). The brains were
trimmed to prepare the telencephalon, diencephalon, optic tectum,
cerebellum, and medulla oblongata. The retina was removed from
the eyeballs. The pituitary, kidney, spleen, liver, intestine, muscle,
testis, and ovary were removed and immediately frozen in liquid
nitrogen and stored at −80 ◦ C.
For examination of diurnal variations, the fish (27.7 ± 1.3 g in BW,
n = 49) were transferred to indoor tanks (60 L) and kept under nat-
ural photoperiod (LD 13:11) for 6 days. The retina, diencephalon,
and optic tectum were collected on day 7 at zeitgeber time (ZT) 3,
ZT6, ZT9, ZT12, ZT15, ZT18, ZT21, and ZT24 (n = 5–7) as described
above. For examination of circadian variations, the fish (31.9 ± 1.8 g
in BW, n = 41) were acclimated in the indoor tanks (60 L) under nat-
ural photoperiod for 5 days, and then placed under constant dark
(DD) condition on day 6. The retina, diencephalon, and optic tec-
tum were collected on day 9 at circadian time (CT) 3, CT6, CT9,
CT12, CT15, CT18, CT21, and CT24 (n = 5–6). All experimental proce-
dures followed the guidance for Animal Experiments in the Faculty
of Agriculture and in the Graduate Course of Kyushu University.
To isolate partial genes encoding grass puffer melatonin recep-
tors, the putative melatonin receptor genes were determined from
the tiger puffer genome database (http://www.fugu-sg.org/). PCR
primers corresponding to the region encompassing the trans-
membrane domain 2–7 were designed based on these sequences
(Table 1). PCR amplification, cloning, and nucleotide sequence
determination were performed as described previously [6]. The
overall sequences of grass puffer melatonin receptor genes have
been deposited in DDBJ database (Mel1a 1.4, AB492763 (739 bp);
59
Table 1
Primers used in cloning, RT-PCR, and real-time PCR.
Forward primer Reverse primer
Cloning primer
Mel1a 1.4 CTTCGTGGTGAGCCTGGCTC GGACCGAGCAGTGGTCTCAG
Mel1a 1.7 AAAGTTCAGCGAGCGTGGAC CTCAGACCGAGTCCACTTTC
Mel1b GACGCGTGATCGGGCTGTTG CGTTAGCTGGCGCACGGATC
Mel1c AGGACTCCATAACCTGGAGCAG TCATGACGTTGGTCAACACG
RT-PCR and real-time PCR primer
Mel1a 1.4 GGCTCTTCACAGCCAGCTA CGGAACTTGAAGACGATCAG
Mel1a 1.7 TGGACTCGGTCTGAGCCAG TCACGAAGCACCATGGTACAG
Mel1b CCATAGATCCGTCCCACGTA TGTTGAGCAGGCCATAGATG
Mel1c ACGGAGACGTCGCGTTG TCATGACGTTGGTCAACACG
␤-Actin AGCATCATGAAGTGCGACG TGCATCCTGTCGGCAATG
Mel1a 1.7, AB492764 (1657 bp); Mel1b , AB492765 (2573 bp); Mel1c ,
AB492766 (2085 bp)).
To examine tissue distribution of the melatonin receptor mRNAs,
total RNA was extracted from the nervous and peripheral tissues
and used for synthesis of first strand cDNA with Multiscribe Reverse
Transcriptase (Applied Biosystems, USA). PCR amplification was
performed with specific primer sets (Table 1) using a HotStar Taq
Master Mix Kit (QIAGEN, Japan). PCR condition was: denaturation
at 95 ◦ C for 15 min, followed by 35 cycles of 94 ◦ C for 30 s, 60 ◦ C for
30 s and 72 ◦ C for 1 min, and finally 72 ◦ C for 10 min. Amplification
of ␤-actin mRNA was also conducted to verify the quality of the RT
products using a primer set for tiger puffer ␤-actin cDNA (Table 1,
U37499). PCR products were electrophoresed on 3% agarose gels,
detected by staining with ethidium bromide and visualized by illu-
mination with UV light.
To examine diurnal and circadian variations, total RNA (1.25 ␮g)
of the retina, diencephalon, and optic tectum was reverse tran-
scribed as described above. To determine absolute amounts of
mRNAs, standard sense RNAs were synthesized in vitro by a MAXI-
script kit (Ambion, TX). The serially diluted standard RNAs were
reverse transcribed and used as standard cDNA to establish stan-
dard curves. Real-time PCR was carried out with an ABI Prism
7700 Sequence Detection System (PE Applied Biosystems, USA).
PCR reaction mixture (10 ␮l) contained 2 ␮l of sample or stan-
dard cDNA, 0.2 ␮M of forward and reverse primers (Table 1) and
5 ␮l of SYBR Premix Ex Taq (Takara, Japan). Amplification was car-
ried out at 95 ◦ C for 30 s, followed by 40 cycles at 95 ◦ C for 5 s,
and 60 ◦ C for 20 s. Specific amplification of each subtype cDNA
was verified by melting curve analysis, gel electrophoresis of the
product, and cross-reactivity test. The cross-reactivity with other
subtype mRNAs was less than 0.29% in all cases. Intra-assay coef-
ficient variations (CVs) were 2.6–4.7%, and inter-assay CVs were
6.0–16.3%. The mRNA values are expressed as means ± SEM. Data
were analyzed by ANOVA followed by Tukey’s post hoc test to
assess statistically significant differences among the different time
points.
The RT-PCR analysis showed that the four subtype genes were
expressed in all brain regions examined (Fig. 1). Particularly, intense
bands were obtained in the telencephalon, diencephalon, and optic
tectum. In addition, all four genes were expressed in the retina and
pituitary. In the peripheral tissues, Mel1a 1.4 and Mel1a 1.7 genes
were expressed in all tissues examined, whereas Mel1b gene was
expressed in the kidney, spleen, intestine, testis, and ovary, but not
in the liver, and muscle. Mel1c gene was weakly expressed in the
kidney, spleen, and testis.
The real-time PCR analyses clearly showed diurnal and circadian
expressions of the four subtype genes. In the retina, statistically
significant differences among time were observed under LD con-
ditions for all subtype genes (Fig. 2). The mRNA amounts peaked
during nighttime except for Mel1a 1.4, and the time of peak was
variable among the subtype mRNAs. The levels of expressions were
60 T. Ikegami et al. / Neuroscience Letters 462 (2009) 58–63

Fig. 1. Tissue distribution of four subtypes of melatonin receptor mRNAs in grass
puffer. ␤-Actin mRNA was amplified to verify the integrity of each mRNA sample. M,
DNA size marker.
also variable among the subtypes. The amounts of Mel1a 1.4 mRNA
were extremely low when compared to other subtypes. Interest-
ingly, the amounts of Mel1a 1.7, Mel1b and Mel1c mRNAs markedly
decreased when the fish were kept under DD conditions, but still
showed circadian variations with similar changes under the LD con-
ditions. The amounts of Mel1a 1.4 mRNA did not change under the
DD conditions, but its peak shifted from ZT 12 to CT21.
In the diencephalon, the four subtype mRNAs showed syn-
chronous variations both under LD and DD conditions (Fig. 3).
Under the LD conditions, the amounts of four subtype mRNAs were
comparable and peaked at ZT15, although the change in Mel1a 1.4
mRNA was not statistically significant. Their amounts significantly
increased under the DD conditions. In particular, the peak amounts
of Mel1a 1.4 mRNA increased 10-fold. In addition, the peaks of the

Fig. 2. Diurnal and circadian variations in the amounts of four subtypes of melatonin receptor mRNAs in the retina. Probability values (P) of ANOVA for statistically significant
difference among time are indicated. Values with different characters are significantly different among time points (P < 0.05, Tukey’s test).
 T. Ikegami et al. / Neuroscience Letters 462 (2009) 58–63 61

four subtype mRNAs shifted to CT18. It was likely that there was
another peak at CT3 for Mel1a 1.4, Mel1b , and Mel1c .
In the optic tectum, there were two peaks at ZT18 and ZT24
under LD conditions for Mel1a 1.4 and Mel1a 1.7 (Fig. 4). Under DD
conditions, the amounts of Mel1a 1.4 and Mel1b mRNAs increased
three- to fivefold, whereas those of Mel1a 1.7 and Mel1c mRNAs
varied in the similar range observed in the LD conditions. Further-
more, the circadian expression patterns were different among the
four subtype mRNAs.
The expressions of multiple melatonin receptor genes have been
demonstrated in various fish species [3,8,6,10–12,14,16,17]. The
present results are basically consistent with these studies showing
high expression in the retina and brain regions that are involved in
processing visual information. In grass puffer, Mel1a 1.4, Mel1a 1.7,
and Mel1b genes were expressed both in the nervous and periph-
eral tissues, whereas Mel1c gene was exclusively expressed in the
nervous tissues. Since the present results were obtained from fish
samples collected at one time point (around mid-night), differ-
ent expression patterns cannot be excluded at other time point.
Nevertheless, the predominant expressions of melatonin receptor
genes in the visual system reinforce their roles in processing visual
information. In addition, the four subtype genes were expressed in
the pituitary. In the pituitary, melatonin has been shown to mod-
ulate release of pituitary hormones such as luteinizing hormone,
prolactin, and growth hormone [2]. Therefore, these results sup-
port the notion that the four subtypes of melatonin receptors are
involved in the photoperiodic control of neuroendocrine function
[2].

Fig. 3. Diurnal and circadian variations in the amounts of four subtypes of melatonin receptor mRNAs in the diencephalon. Probability values (P) of ANOVA for statistically
significant difference among time are indicated. Values with different characters are significantly different among time points (P < 0.05, Tukey’s test).
62 T. Ikegami et al. / Neuroscience Letters 462 (2009) 58–63

The expressions of multiple subtypes of melatonin receptors in
the retina have been reported [6,10–12,14,16]. In the sea bass retina,
the melatonin receptor subtype genes were differentially expressed
in three nuclear layers (the outer nuclear, inner nuclear, and gan-
glion cell layers) and the pigmented epithelium [16]. These results
suggest that melatonin is an autocrine (neural retina) and paracrine
(retinal pigment epithelium) regulator of retinal function, such as
cyclic biosynthesis of melatonin and circadian activity of photore-
ceptor cells [16]. The diurnal expressions of the melatonin receptor
genes are most possibly important for the circadian regulation of
the retinal functions.
The present study revealed the marked decrease in the absolute
amounts of melatonin receptor mRNAs under the DD conditions in
the retina, suggesting that the expressions of melatonin receptor
genes are regulated by light. In addition, despite the low amounts
of mRNAs, the circadian variations were still visible under the DD
conditions. Thus, both light and circadian clock may be responsible
for the diurnal expressions of melatonin receptor genes. Consid-
ering the drastic fall in the mRNA amount induced by the light
conditions, the retinal expressions of melatonin receptor genes are
highly dependent on light, which may enhance the expressions.
This is a striking contrast to the diencephalon, in which the four
subtype mRNA amounts were significantly increased under the DD
conditions. Light-induced suppression of melatonin receptor gene
expression has been reported in the pineal gland of golden rabbit-
fish [10,11]. Light may influence melatonin receptor gene expression
differently depending on tissues through regulation by melatonin
[4,5]. Further study will be required to determine possible roles of

Fig. 4. Diurnal and circadian variations in the amounts of four subtypes of melatonin receptor mRNAs in the optic tectum. Probability values (P) of ANOVA for statistically
significant difference among time are indicated. Values with different characters are significantly different among time points (P < 0.05, Tukey’s test).
 T. Ikegami et al. / Neuroscience Letters 462 (2009) 58–63
light and/or melatonin in the control of melatonin receptor gene
expression.
This is the first report showing that the multiple subtypes of
melatonin receptor genes are synchronously expressed in the dien-
cephalon. The expressions of the four subtype genes oscillated
synchronously both under the LD and DD conditions and their
amounts peaked at ZT 15 and CT18, respectively. In mammals, the
SCN, a primary circadian oscillator, is located in the hypothalamus
and shows a high density of melatonin receptors. Melatonin influ-
ences the molecular clock to phasing its circadian activity. Although
it is not known whether the SCN of fish is a circadian oscillator, the
master clocks are possibly located in the hypothalamus in addition
to the eyes and pineal organ [2]. Furthermore, the hypothalamus
contains neurosecretory neurons of peptide hormones involved
in the control of reproductive activities [9]. Although the local-
ization of melatonin receptor-expressing neurons and relation to
neurosecretory neurons remain to be determined, this study pro-
vides the possible link between melatonin and lunar-synchronized
reproductive activity. In golden rabbitfish, the circulating melatonin
was suggested to function as a periodical signal for the lunar-
synchronized spawning [18]. In grass puffer, the responsiveness to
melatonin is highly dependent on time because of the diurnal and
circadian variations in the melatonin receptor gene expression. This
photoperiodic information mediated by melatonin receptors may
be important for the seasonal and cyclic reproductive functions.
In the optic tectum, the four subtype genes showed differ-
ent diurnal and circadian expression patterns. In rainbow trout,
Mel1b mRNAs were localized in the stratum periventriculare that
appeared to send apical dendrites to other tectum layers that are
terminal field of retinal fibers [8]. Thus, the major function of mela-
tonin in the optic tectum is considered to be the visual signal
transduction. Based on the variable expression patterns, the four
melatonin receptor subtypes seem to be differently involved in
mediating the action of melatonin. The localization of these recep-
tor subtypes in the optic tectum will provide important information
to further assess the significance of their variable expressions.
In conclusion, all subtype genes for melatonin receptors were
predominantly expressed in the retina and retinorecipient brain
regions. They showed diurnal and circadian variations in the
retina, diencephalon, and optic tectum. In the diencephalon, the
synchronized diurnal and circadian expressions of these subtype
genes were noticeable and may be important in the regulation of
semilunar-synchronized spawning of grass puffer. In addition, light
may be differently involved in the melatonin receptor gene expres-
sion in these tissues.
Acknowledgement
This study was supported by Grants-in-Aid from the Ministry of
Education, Science, Sports, Science and Technology, Japan.
63
References
[1] T. Ebisawa, S. Karne, M.R. Lerner, Expression cloning of a high-affinity melatonin
receptor from Xenopus dermal melanophores, Proc. Natl. Acad. Sci. U.S.A. 91
(1994) 6133–6137.
[2] J. Falcón, L. Besseau, S. Sauzet, G. Boeuf, Melatonin effects on the
hypothalamo-pituitary axis in fish, Trends Endocrinol. Metab. 18 (2007) 81–
88.
[3] P. Gaildrat, B. Ron, J. Falcón, Daily and circadian variations in 2-[125 I]-
iodomelatonin binding sites in the pike brain (Esox lucius), J. Neuroendocrinol.
10 (1998) 511–517.
[4] H.Y. Guerrero, F. Gauer, C. Schuster, P. Pévet, M. Masson-Pévet, Melatonin reg-
ulates the mRNA expression of the mt1 melatonin receptor in the rat pars
tuberalis, Neuroendocrinology 71 (2000) 163–169.
[5] M. Iigo, K. Furukawa, A. Hattori, M. Hara, R. Ohtani-Kaneko, T. Suzuki, M. Tabata,
K. Aida, Effects of pinealectomy and constant light exposure on day-night
changes of melatonin binding sites in the goldfish brain, Neurosci. Lett. 197
(1995) 61–64.
[6] T. Ikegami, K. Azuma, M. Nakamura, N. Suzuki, A. Hattori, H. Ando, Diurnal
expressions of four subtypes of melatonin receptor genes in the optic tec-
tum and retina of goldfish, Comp. Biochem. Physiol. Part A 152 (2009) 219–
224.
[7] M.I. Masana, S. Benloucif, M.L. Dubocovich, Circadian rhythm of mt1 melatonin
receptor expression in the suprachiasmatic nucleus of the C3H/HeN mouse, J.
Pineal Res. 28 (2000) 185–192.
[8] D. Mazurais, I. Brierley, I. Anglade, J. Drew, C. Randall, N. Bromage, D. Michel, O.
Kah, L.M. Williams, Central melatonin receptors in the rainbow trout: compar-
ative distribution of ligand binding and gene expression, J. Comp. Neurol. 409
(1999) 313–324.
[9] E. Motohashi, T. Hamabata, H. Ando, Structure of neurohypophysial hormone
genes and changes in the levels of expression during spawning season in grass
puffer (Takifugu niphobles), Gen. Comp. Endocrinol. 155 (2008) 456–463.
[10] Y.J. Park, J.G. Park, N. Hiyakawa, Y.D. Lee, S.J. Kim, A. Takemura, Diurnal and cir-
cadian regulation of a melatonin receptor, MT1, in the golden rabbitfish, Siganus
guttatus, Gen. Comp. Endocrinol. 150 (2007) 253–262.
[11] Y.J. Park, J.G. Park, H.B. Jeong, Y. Takeuchi, S.J. Kim, Y.D. Lee, A. Takemura, Expres-
sion of the melatonin receptor Mel1c in neural tissues of the reef fish Siganus
guttatus, Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 147 (2007) 103–
111.
[12] Y.J. Park, J.G. Park, S.J. Kim, Y.D. Lee, M.S. Rahman, A. Takemura, Melatonin recep-
tor of a reef fish with lunar-related rhythmicity: cloning and daily variations, J.
Pineal Res. 41 (2006) 166–174.
[13] R.J. Reiter, The melatonin rhythm: both a clock and a calendar, Experientia 49
(1993) 654–664.
[14] S.M. Reppert, D.R. Weaver, V.M. Cassone, C. Godson, L.F. Kolakowski Jr., Mela-
tonin receptors are for the birds: molecular analysis of two receptor subtypes
differentially expressed in chick brain, Neuron 15 (1995) 1003–1015.
[15] S.M. Reppert, D.R. Weaver, C. Godson, Melatonin receptors step into the
light: cloning and classification of subtypes, Trends Pharmacol. Sci. 17 (1996)
100–102.
[16] S. Sauzet, L. Besseau, P. Herrera Perez, D. Covès, B. Chatain, E. Peyric, G. Boeuf, J.A.
Muñoz-Cueto, J. Falcón, Cloning and retinal expression of melatonin receptors in
the European sea bass, Dicentrarchus labrax, Gen. Comp. Endocrinol. 157 (2008)
186–195.
[17] Q. Shi, H. Ando, S.L. Coon, S. Sato, M. Ban, A. Urano, Embryonic and post-
embryonic expression of arylalkylamine N-acetyltransferase and melatonin
receptor genes in the eye and brain of chum salmon (Oncorhynchus keta), Gen.
Comp. Endocrinol. 136 (2004) 311–321.
[18] A. Takemura, E.S. Susilo, M.D. Rahman, M. Morita, Perception and possible
utilization of moonlight intensity for reproductive activities in a lunar-
synchronized spawner, the golden rabbitfish, J. Exp. Zool. 301A (2004) 844–
851.
[19] K. Yamahira, How do multiple environmental cycles in combination determine
reproductive timing in marine organisms? A model and test, Funct. Ecol. 18
(2004) 4–15.