Oral Microbiology Book

Xuedong
Zhou
Yuqing Li Editors
Atlas of Oral
Microbiology: From
Healthy Microflora
to Disease
Second Edition
Atlas of Oral Microbiology: From Healthy
Microflora to Disease
Xuedong Zhou • Yuqing Li
Editors
Atlas of Oral
Microbiology: From
Healthy Microflora to
Disease
Second Edition
Editors
Xuedong Zhou Yuqing Li
State Key Laboratory of Oral Diseases, State Key Laboratory of Oral Diseases,
National Clinical Research Center National Clinical Research Center for
for Oral Diseases, West China Hospital Oral Diseases, West China Hospital of
of Stomatology Stomatology
Sichuan University Sichuan University
Chengdu, Sichuan, China Chengdu, Sichuan, China
Associate Editors
Xian Peng Biao Ren
State Key Laboratory of Oral Diseases, State Key Laboratory of Oral Diseases,
National Clinical Research Center for National Clinical Research Center for
Oral Diseases, West China Hospital Oral Diseases, West China Hospital
of Stomatology of Stomatology
Sichuan University Sichuan University
Chengdu, Sichuan, China Chengdu, Sichuan, China
ISBN 978-981-15-7898-4 ISBN 978-981-15-7899-1 (eBook)

https://doi.org/10.1007/978-981-15-7899-1
Jointly published with Zhejiang University Press
# Zhejiang University Press 2020

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or
part of the material is concerned, specifically the rights of translation, reprinting, reuse of
illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way,
and transmission or information storage and retrieval, electronic adaptation, computer software, or
by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this
publication does not imply, even in the absence of a specific statement, that such names are
exempt from the relevant protective laws and regulations and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in
this book are believed to be true and accurate at the date of publication. Neither the publisher nor
the authors or the editors give a warranty, expressed or implied, with respect to the material
contained herein or for any errors or omissions that may have been made. The publisher remains
neutral with regard to jurisdictional claims in published maps and institutional affiliations.
This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd.
The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore
189721, Singapore
Preface
The human body is home to a diverse range of microorganisms, including a

variety of bacteria, archaea, fungi, and viruses, estimated to outnumber human
cells in a healthy adult by tenfold. The importance of characterizing human
microbiota for understanding health and disease is highlighted by the recent
launch of the Human Microbiome Project (HMP) by the National Institutes of
Health. Changes in colonization sites or imbalance of normal microflora may
lead to the occurrence of disease. The mouth harbors a diverse, abundant, and
complex microbial community, and oral microorganisms are often closely
related to many infectious diseases.
This book is keeping up with the advanced edge of the international
research field of microbiology. For the first time, it innovatively gives us a
complete description of the oral microbial systems according to different oral
ecosystems. This book collects a large number of oral microbial pictures,
including color pictures, colonies photos, and electron microscopy photos. It
is by far the most abundant oral microbiology atlas, containing the largest
number of pictures. In the meantime, it also describes in detail a variety of
experimental techniques, including microbiological isolation, culture, and
identification. It is a monograph with strong practical function.
This book is the first professional and comprehensive color atlas of oral
microbiology and it has important academic and application value. The
editors and writers have long been engaged in teaching and research work
in oral microbiology and oral microecology; they had completed the first color
atlas of the oral microbial morphology and ultrastructure, which was written
in Chinese. They all have solid theoretical foundation and rich experience in
oral microbiological research.
This book deserves a broad audience, and it will meet the needs of
researchers, clinicians, teachers, and students major in biology, stomatology,
basic medicine, or clinical medicine. It can also be used to facilitate teaching
and international academic exchanges.
Chengdu, Sichuan, China Xuedong Zhou

Yuqing Li
v
Contents
1 Basic Biology of Oral Microbes . . . . . . . . . . . . . . . . . . . . . . . 1

Yuqing Li, Xian Peng, Xuedong Zhou, Biao Ren, Liying Xiao,
Yan Li, Mingyun Li, and Qiang Guo
2 Techniques for Oral Microbiology . . . . . . . . . . . . . . . . . . . . . 25
Xian Peng, Biao Ren, Yuqing Li, Xuedong Zhou, Jing Xie,
Chenchen Zhou, Demao Zhang, Xin Zheng, and Xinxuan Zhou
3 Supragingival Microbes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
Xuedong Zhou, Yuqing Li, Xian Peng, Biao Ren, Jiyao Li,
Xin Xu, Jinzhi He, and Lei Cheng
4 Subgingival Microbes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 145
Quan Yuan, Chenchen Zhou, Jing Xie, Demao Zhang,
Liwei Zheng, Yuqing Li, Biao Ren, Xian Peng,
and Xuedong Zhou
5 Oral Mucosal Microbes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211
Biao Ren, Lei Cheng, Xian Peng, Yuqing Li, Yan Li,
Yujie Zhou, Chengguang Zhu, and Xi Chen
6 New Oral Microbial Isolations . . . . . . . . . . . . . . . . . . . . . . . . 253
Yuqing Li, Xian Peng, Biao Ren, Boyu Tang, Tao Gong,
Zhengyi Li, and Xuedong Zhou
7 The Oral Microbiome Bank of China . . . . . . . . . . . . . . . . . . . 287
Xian Peng, Xuedong Zhou, Xin Xu, Yuqing Li, Yan Li,
Jiyao Li, Xiaoquan Su, Shi Huang, Jian Xu, and Ga Liao
8 Invasion of Oral Microbiota into the Gut . . . . . . . . . . . . . . . . 301
Bolei Li, Yang Ge, Lei Cheng, Benhua Zeng, Jinzhao Yu,
Xian Peng, Jianhua Zhao, Wenxia Li, Biao Ren, Mingyun Li,
Hong Wei, and Xuedong Zhou
9 Mycobiome Dysbiosis in Oral Lichen Planus . . . . . . . . . . . . . 315
Yan Li, Kun Wang, Bo Zhang, Qichao Tu, Yufei Yao,
Bomiao Cui, Biao Ren, Jinzhi He, Xin Shen,
Joy D. VanNostrand, Jizhong Zhou, Wenyuan Shi,
Liying Xiao, Changqing Lu, and Xuedong Zhou
vii
viii Contents
10 Intestinal Microbiota and Osteoporosis . . . . . . . . . . . . . . . . . 333

Xin Xu, Xiaoyue Jia, Longyi Mo, Chengcheng Liu,
Liwei Zheng, Quan Yuan, and Xuedong Zhou
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 359
Editors and Contributors
Associate Editors
Xian Peng State Key Laboratory of Oral Diseases, National Clinical

Research Center for Oral Diseases, West China Hospital of Stomatology,
Sichuan University, Chengdu, Sichuan, China
Biao Ren State Key Laboratory of Oral Diseases, National Clinical Research
Center for Oral Diseases, West China Hospital of Stomatology, Sichuan
University, Chengdu, Sichuan, China
Contributors
Lei Cheng State Key Laboratory of Oral Diseases, National Clinical

Sichuan University, Chengdu, China
Department of Cariology and Endodontics, West China Hospital of
Stomatology, Sichuan University, Chengdu, China
Xi Chen State Key Laboratory of Oral Diseases, National Clinical Research
University, Chengdu, China
Bomiao Cui State Key Laboratory of Oral Diseases, National Clinical
Yang Ge State Key Laboratory of Oral Diseases, Sichuan University,
Chengdu, China
National Clinical Research Center for Oral Diseases, Sichuan University,
Chengdu, China
Tao Gong State Key Laboratory of Oral Diseases, National Clinical
ix
x Editors and Contributors
Qiang Guo State Key Laboratory of Oral Diseases, National Clinical

Jinzhi He State Key Laboratory of Oral Diseases, National Clinical Research
Shi Huang Single-Cell Center, CAS Key Laboratory of Biofuels and
Shandong Key Laboratory of Energy Genetics, Qingdao Institute of
BioEnergy and Bioprocess Technology, Chinese Academy of Sciences,
Qingdao, Shandong, China
Xiaoyue Jia State Key Laboratory of Oral Diseases, West China Hospital of
Department of Operative Dentistry and Endodontics, West China Hospital of
Ga Liao State Key Laboratory of Oral Diseases, National Clinical Research
Bolei Li State Key Laboratory of Oral Diseases, Sichuan University,
Chengdu, China
Chengdu, China
Jiyao Li State Key Laboratory of Oral Diseases, National Clinical Research
State Key Laboratory of Oral Diseases, National Clinical Research Center for
Oral Diseases, Department of Cariology and Endodontics, West China Hos-
pital of Stomatology, Sichuan University, Chengdu, China
Mingyun Li State Key Laboratory of Oral Diseases, National Clinical
Chengcheng Liu State Key Laboratory of Oral Diseases, West China Hos-
pital of Stomatology, Sichuan University, Chengdu, China
Department of Periodontics, West China Hospital of Stomatology, Sichuan
Wenxia Li Department of Laboratory Animal Science, College of Basic
Medical Sciences, Third Military Medical University, Chongqing, China
Yan Li State Key Laboratory of Oral Diseases, National Clinical Research
Editors and Contributors xi
Yuqing Li State Key Laboratory of Oral Diseases, National Clinical

Zhengyi Li State Key Laboratory of Oral Diseases, National Clinical
Changqing Lu Department of Anatomy, West China School of Basic Medi-
cal and Forensic Medicine, Sichuan University, Chengdu, China
Longyi Mo State Key Laboratory of Oral Diseases, West China Hospital of
Xin Shen State Key Laboratory of Oral Diseases, National Clinical Research
Wenyuan Shi The Forsyth Institute, Cambridge, MA, USA
Xiaoquan Su Single-Cell Center, CAS Key Laboratory of Biofuels and
Shandong Key Laboratory of Energy Genetics, Qingdao Institute of
BioEnergy and Bioprocess Technology, Chinese Academy of Sciences,
Qingdao, Shandong, China
Boyu Tang State Key Laboratory of Oral Diseases, National Clinical
Qichao Tu Institute of Marine Science and Technology, Shandong Univer-
sity, Qingdao, China
Institute for Environmental Genomics, Department of Microbiology and Plant
Biology, University of Oklahoma, Norman, OK, USA
Joy D. VanNostrand Institute for Environmental Genomics, Department of
Microbiology and Plant Biology, University of Oklahoma, Norman, OK,
USA
Kun Wang State Key Laboratory of Oral Diseases, National Clinical
Hong Wei Department of Laboratory Animal Science, College of Basic
Liying Xiao State Key Laboratory of Oral Diseases, National Clinical
Jing Xie State Key Laboratory of Oral Diseases, National Clinical Research
xii Editors and Contributors
Jian Xu Single-Cell Center, CAS Key Laboratory of Biofuels and Shandong

Key Laboratory of Energy Genetics, Qingdao Institute of BioEnergy and
Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong,
China
Xin Xu State Key Laboratory of Oral Diseases, West China Hospital of
Department of Operative Dentistry and Endodontics, West China Hospital of
Yufei Yao State Key Laboratory of Oral Diseases, National Clinical
Quan Yuan Department of Dental Implantology, West China Hospital of
Oral Diseases, West China Hospital of Stomatology, Sichuan University,
Chengdu, China
Jinzhao Yu State Key Laboratory of Oral Diseases, Sichuan University,
Chengdu, China
Chengdu, China
Benhua Zeng Department of Laboratory Animal Science, College of Basic
Bo Zhang State Key Laboratory of Oral Diseases, National Clinical
Demao Zhang State Key Laboratory of Oral Diseases, National Clinical
Jianhua Zhao Shanghai Majorbio Bio-pharm Technology Co., Ltd, Shang-
hai, China
Liwei Zheng Department of Pediatric Dentistry, West China Hospital of
Oral Diseases, West China Hospital of Stomatology, Sichuan University,
Chengdu, China
Xin Zheng State Key Laboratory of Oral Diseases, National Clinical
Chenchen Zhou State Key Laboratory of Oral Diseases, National Clinical
Editors and Contributors xiii
Jizhong Zhou Institute for Environmental Genomics, Department of

Microbiology and Plant Biology, University of Oklahoma, Norman, OK,
USA
Xinxuan Zhou State Key Laboratory of Oral Diseases, National Clinical
Xuedong Zhou State Key Laboratory of Oral Diseases, National Clinical
Yujie Zhou State Key Laboratory of Oral Diseases, National Clinical
Chengguang Zhu State Key Laboratory of Oral Diseases, National Clinical
Basic Biology of Oral Microbes
1
Yuqing Li, Xian Peng, Xuedong Zhou, Biao Ren, Liying Xiao,
Yan Li, Mingyun Li, and Qiang Guo
Abstract morphology, microbial cell structure, micro-

The cell is the fundamental unit of all living bial physiology, and microbial genetics.
organisms. Various subunit structures and
chemical substances found on and inside the Keywords
cell make complex cellular functions possible. Microbial morphology · Microbial cell
Understanding the morphology and structures structure · Microbial physiology · Microbial
of microorganisms is of great significance to genetics
study their physiological activities and patho-
genicity, to identify different microorganisms,
and to diagnose and prevent diseases. The 1.1 Cytological Basis
morphological structure, physiological metab- of Microorganisms
olism, pathogenicity, and drug resistance of
microorganisms are determined by genes. The cell is the fundamental unit of all living
The heredity of microorganism guarantees organisms. Various subunit structures and chemi-
the stability of species, while the variation cal substances found on and inside the cell make
produces the variety or new species, which is complex cellular functions possible. Microbes
beneficial to the evolution of species. The can be divided into three major groups according
main contents of this chapter include cytologi- to their morphological structure, degree of differ-
cal basis of microorganisms, microbial entiation, and chemical composition: eukaryote,
prokaryote, and acellular microorganisms
(Figs. 1.1, 1.2, 1.3, and 1.4).
Y. Li (*) · X. Peng · B. Ren · L. Xiao · Y. Li · M. Li ·
Q. Guo
State Key Laboratory of Oral Diseases, National Clinical 1.2 Microbial Morphology
Research Center for Oral Diseases, West China Hospital of
e-mail: liyuqing@scu.edu.cn Microorganisms, also known as microbes, are tiny
X. Zhou organisms that are only visible under an optical
State Key Laboratory of Oral Diseases, National Clinical microscope or an electron microscope. They are
Research Center for Oral Diseases, West China Hospital of small in size and simple in structure. Microbes
Stomatology, Sichuan University, Chengdu, China reproduce quickly, can tolerate a wide range of
Department of Cariology and Endodontics, West China environmental conditions, are widely distributed
Hospital of Stomatology, Sichuan University, Chengdu, and highly variable, and tend to congregate.
China
# Zhejiang University Press 2020 1

X. Zhou, Y. Li (eds.), Atlas of Oral Microbiology: From Healthy Microflora to Disease,
https://doi.org/10.1007/978-981-15-7899-1_1
2 Y. Li et al.
Fig. 1.1 Eukaryotic

microbes (Saccharomyces,
SEM)
The eukaryotic cell has a
high degree of nuclear
differentiation; it has a
nuclear membrane,
nucleoli, and chromosomes.
There is a complete
complement of structured
organelles in the cytoplasm,
and cellular reproduction
takes place by mitosis.
Examples include fungi and
algae
Fig. 1.2 Prokaryotic

microbes (bacteria)
1 Basic Biology of Oral Microbes 3
Fig. 1.3 Prokaryotic

microbes (Mycoplasma)
The prokaryotic cell has a
primitive nucleoplasm and
cell membrane; it has no
nuclear membrane,
nucleolus, or organelles.
Prokaryotes include
bacteria such as
Mycoplasma, Chlamydia,
and Rickettsia
Fig. 1.4 Acellular

microorganisms (herpes
simplex virus)
Acellular microorganisms
are the smallest
microorganism with no
typical cell structure and no
enzymatic energy-
production system. They
consist merely of a nucleic
acid genome (DNA/RNA)
and a protein coat (the
capsid). Acellular
microorganisms can only
reproduce inside a living
cell. Examples include
viruses and subviral agents
4 Y. Li et al.
Fig. 1.5 Microbial size

1. Staphylococcus 1000 nm
2. Rickettsia 450 nm
3. Chlamydia 390 nm
4. Tobacco mosaic virus
300 15 nm
5. Escherichia coli
bacteriophages, head
65 95 nm, tail
12 100 nm
6. Adenovirus 70 nm
7. Poxvirus 300 230 nm
8. Influenza virus 100 nm
9. Poliovirus 30 nm
10. Japanese encephalitis
virus 40 nm
11. Molecule of egg protein
10 nm
1.2.1 Microbial Size structure of microbes, as it provides us with a

better understanding of microbial physiology,
As many types of microbes exist, they vary pathogenic mechanisms, and antigenic features
widely in their size. Generally, the units used to and allows us to identify them by species. Also,
measure microbes are μm and nm. Most cocci are knowledge of microbial morphology can be help-
1 μm in diameter. Bacilli can be further divided ful in diagnosing disease and in preventing micro-
into coccobacillus, brevibacterium, and long bial infections.
bacilli and measure approximately 1–10 μm in
1. Bacteria Bacteria are complex and highly vari-
length and 0.3–1 μm in width. Spirochetes mea-
able microbes. They come in four basic shapes:
sure approximately 6–20 μm in length and
spherical (cocci), rod-shaped (bacilli), arc-shaped
0.1–0.2 μm in width. Fungi are several times
(vibrio), and spiral (spirochete) (Fig. 1.6).
larger than bacteria. Most viruses are smaller
2. Fungi Fungi are divided into unicellular and
than 150 nm and only visible under the electron
multicellular according to the number of cells
microscope. The same microbe can change in size
that make up the organism. Unicellular fungi,
depending on their environment or age (Fig. 1.5).
such as Saccharomyces and other yeast-like
fungi, are usually round or oval. Multicellular
fungi have hyphae and spores. The hypha and
1.2.2 Microbial Morphology spores of different fungi are shaped differently
(Figs. 1.7 and 1.8).
Different types of microbes have different, but 3. Virus Many viruses are spherical or almost
characteristic shapes. Under suitable conditions, spherical; some are rod-shaped (often seen in
the shape and size of microbes are relatively plant viruses), filamentous (e.g., freshly
stable. It is important to know the morphological isolated influenza virus), bullet-shaped (e.g.,
Fig. 1.6 Basic shape of

bacteria
Fig. 1.7 Fungal spores

6 Y. Li et al.
Fig. 1.8 Fungal hyphae
Fig. 1.9 Morphology and structure of viruses virus, 8. herpes virus, 9. T2 bacteriophage, 10. reovirus,
1. Poxvirus, 2. paramyxovirus, 3. orthomyxovirus, 4. coro- 11. papovavirus, 12. picornavirus, 13. picodnavirus, 14.
navirus, 5. Togaviridae, 6. adenovirus, 7. bullet-shaped tobacco mosaic virus
rabies virus), brick-shaped (e.g., poxvirus), 1.3.1.1 Cell Wall

and tadpole-shaped (e.g., bacteriophage) The cell wall is the outermost structure of the
(Fig. 1.9). bacterial cell and is located outside the cell mem-
brane. It is transparent, tough, and flexible. The
average thickness ranges from 15 to 30 nm. It
1.3 Microbial Cell Structure mainly consists of peptidoglycan, which is also
called mucopeptide, glycopeptides, or murein.
Although different microbes possess different Bacteria are classified into Gram-positive and
cellular structures, there are certain Gram-negative based on the appearance of the
commonalities within groups of microbes. cells after Gram stain. The peptidoglycan of
Gram-positive bacteria is composed of a glycan
backbone, tetrapeptide side chains, and a penta-
1.3.1 Basic Bacterial Structures peptide cross-linking bridge (Fig. 1.11). The pep-
tidoglycan of Gram-negative bacteria is
The architecture of bacterial cells consists of basic composed of a glycan backbone and a
and special structures. Basic structures include tetrapeptide side chain (Fig. 1.12).
the cell wall, cell membrane, cytoplasm, nuclear Gram-positive and Gram-negative bacteria
material, ribosome, plasmid, etc. Special have unique structures other than peptidoglycan
structures, which are only found in some bacteria, in their cell walls (Figs. 1.13 and 1.14). Other
include the flagellum, pilus, capsule, spore, etc. substances, such as compound polysaccharide,
(Fig. 1.10). surface protein, protein M and G of
Fig. 1.10 Schematic representation of bacterial cell structure
Fig. 1.11 Schematic

representation of
Staphylococcus aureus cell
wall peptidoglycan
M, N-acetylmuramic
acid; G,
N-acetylglucosamine; O,
β-1,4 glycosidic bond; a,
L-alanine; b, D-aspartic
acid; c, L-lysine; d,
D-aspartic acid; x, glycine
Streptococcus, protein A of Staphylococcus physical, chemical, or biological factors. When

aureus, etc., are found on the outer layer of the Gram-positive bacteria lack a cell wall, the cyto-
cell wall of some Gram-positive bacteria. plasm is surrounded by the cell membrane, and
the entire structure is known as a protoplast.
1.3.1.2 Cell Wall-Deficient Bacteria When Gram-negative bacteria do not have a cell
(Bacterial L Form) wall, the cytoplasm is protected by the outer
Cell wall-deficient bacteria are strains of bacteria membrane, and the entire structure is called a
that lack cell walls. The peptidoglycan that makes spheroplast. Bacteria that have lost their cell
up the cell wall can be destroyed or inhibited by wall are still capable of growing and dividing as
8 Y. Li et al.
Fig. 1.12 Schematic

representation of
Escherichia coli cell wall
peptidoglycan
M, N-acetylmuramic
acid; G,
N-acetylglucosamine; Ala,
Alanine; Glu, glutamic
acid; DAP,
diaminopimelic acid
Fig. 1.13 Schematic of Gram-positive bacteria cell wall wall. It is a polymer consisting of ribitol or glycerin
Gram-positive bacteria have a thick (20–80 nm) cell wall residues that are bound by phosphodiester bonds into a
composed of 15–50 layers of peptidoglycan, many long-chain, which is then anchored in peptidoglycan.
teichoic acids, and some teichuroic acid. Teichoic acids Teichoic acids are classified into cell wall teichoic acids
are unique to Gram-positive bacterial cell walls and con- and membrane teichoic acids (also known as
stitute a class of important antigens related to the serotype lipoteichoicacid, LTA) according to the cellular structure
classification of certain bacterial species. Teichoic acid to which they are anchored
accounts for about 50% of the dry weight of the cell
cell wall-deficient bacteria. Examples of these bacteria give rise to a variety of cell morphologies
were first isolated in 1935 by Emmy and sizes and can be spherical, rod-shaped, fili-
Klieneberger-Nobel, who named them form, etc [1]. The rate of growth and division of
“L-forms” after the Lister Institute in London L-form bacteria is slow. They also form distinc-
where she was working at the time. L-form tive bacterial colonies when plated on agar. Some
Fig. 1.14 Schematic representation of the cell wall of Gram-negative bacteria cell wall and accounts for approx-
Gram-negative bacteria imately 80% of the dry weight of the cell wall. The outer
Gram-negative bacteria have a comparatively thin cell membrane is composed of three layers: lipoprotein, lipid
wall, approximately 10–15 nm in thickness. It is made bilayer, and lipopolysaccharide (LPS) ordered from the
up of 1–2 layers of peptidoglycan and other complex interior to the exterior. OMP outer membrane protein, PP
structures. On the outside of the peptidoglycan is the porin, BP nutrient binding protein, CP carrier protein,
outer membrane, which is the main component of the M N-acetylmuramic acid, G N-acetylglucosamine
L-form strains have a tendency to revert to the The cell membrane of some bacteria can form
normal phenotype when the conditions that were invaginations into the cytoplasm called
used to produce the cell wall deficiency are mesosomes.
reduced. L-from bacteria are difficult to stain or
stain unevenly. In a Gram stain test, L-form bac-
1.3.1.4 Cytoplasm
teria always show up as Gram-negative, due to
The cytoplasm is the gel-like substance enclosed
the lack of a cell wall.
within the cell membrane, which is made up of
water, protein, lipid, nucleic acid, inorganic salts,
1.3.1.3 Cell Membrane etc. Most metabolic activities take place within
The cell membrane is a selectively permeable the cytoplasm, and subcellular structures, such as
biological membrane found inside the cell wall ribosomes, plasmids, cytoplasmic granules, and
and surrounding the cytoplasm. It is made of a others, are located in the cytoplasm.
lipid bilayer. The cell membrane is compact and Ribosomes are found in cytoplasm. They are
flexible and measures approximately 7.5 nm in approximately 15–20 nm in diameter and are com-
thickness. It accounts for 10–30% of the bacterial posed of a small (30S) and a large (50S) subunit.
cell dry weight. The structure of the bacterial cell The association between subunits requires the
membrane resembles that of eukaryotic cell presence of Mg2+. Ribosomes are made up of
membranes, except it is deficient in cholesterol. 30% ribosomal proteins and 70% ribosomal RNA.
The lipid bilayer is embedded with carrier Plasmids are small, circular, double-stranded
proteins and zymoprotein, which possess specific DNA molecules and are extrachromosomal
functions. genetic material. They can replicate
10 Y. Li et al.
Fig. 1.15 Capsule of

S. pneumoniae (Murs
staining method)
Bacterial cells are stained
red and the capsule around
the cell appears as blue
transparent circles
independently of chromosomal DNA and trans- 1.3.2 Special Bacterial Structures

mit genes encoding drug resistance, bacteriocins,
and toxins and more from one bacterium to 1.3.2.1 Capsule
another via conjugation and transduction. The capsule is a layer of slime that lies outside the
Cytoplasmic granule is a general term refer- bacterial cell wall. It is secreted by bacteria and
ring to many types of cytoplasmic inclusion diffuses into the surrounding medium. Based on
granules. They are an intracytoplasmic (inside its appearance when examined by light micro-
the cytoplasm of a cell) form of storing nutrients scope, the bacterial capsule is classified into two
and energy and include molecules such as types: micro-capsule, which is less than 0.2 μm in
polysaccharides, lipids, phosphate, etc. They are thickness and escapes optical detection, and cap-
not essential or permanent structures in cells. sule or large capsule, which is over 0.2 μm in
Cytoplasmic granules are also known as meta- thickness, binds tightly to the cell wall, and
chromatic granules because they may stain into presents an obvious boundary under optical
different colors than other bacterial cell microscope. The capsule shows up as negatively
structures. stained when ordinary staining techniques are
used. It appears as a clear halo around the bacte-
1.3.1.5 Nuclear Material rium when stained samples are examined by light
The bacterial nuclear material is also called the microscope. Using special staining, the capsule
nucleoid. It is a piece of double-stranded DNA can be stained differently from the bacterial cell
devoid of nuclear membrane, nucleolus, or (Fig. 1.15). Most bacterial capsules are composed
histones and is the bacterial equivalent of chro- of polysaccharides, but a few capsules are made
matin. The function of the nucleoid is similar to of polypeptides.
that of the nucleus in eukaryotic cells and encodes Capsular polysaccharides are highly hydrated
genes necessary for activities and traits such as molecules in which water accounts for more than
growth, metabolism, reproduction, heredity, 95% of the composition. They bind to
mutation, etc.
Fig. 1.16 Schematic of Escherichia coli flagellum and has a sharp bend (about 90 ) from which filaments
(1) Basal body: Located at the base of the flagellum. The protrude
basal body, embedded in the cell wall and cell membrane, (3) Filament: This filiform structure protrudes from the
is the output device. It acts as an engine to provide energy bacterial cell. It is a hollow tube made of the protein
for locomotion. The nearby switch determines the direc- flagellin. It acts like a ship or plane’s propeller to move
tion of rotation the bacterial cell
(2) Hook: This structure points directly away from the cell
Fig. 1.17 Examples of

bacterial flagellar
arrangement
12 Y. Li et al.
Fig. 1.18 Periplasmic

flagella (flagella staining)
The bacterial cell is stained
red, and the flagellum is
stained light red around the
bacterial cell
phospholipids or lipid A on the cell surface the small intestine to reach the epithelium and
through covalent bonds. The capsule is consid- produce toxin.
ered as an important virulence factor because it Flagella can be classified as monotrichous,
protects bacteria from engulfment by eukaryotic amphitrichous, lophotrichous, and peritrichous
immune cells and desiccation and helps bacteria according to their number and location.
adhere to surfaces.
1.3.2.3 Pilus
1.3.2.2 Flagellum The pilus is a hair-like structure associated with
The flagellum is a lash-like appendage that bacterial adhesion and related to bacterial coloni-
protrudes from the cell body and usually zation and infection. Pili are primarily composed
measures 5–20 μm in length and 10–30 nm in of oligomeric pilin proteins, which arrange heli-
diameter. It is the locomotive organelle of motile cally to form a cylinder. New pilin protein
bacteria such as Selenomonas and Wolinella molecules insert into the base of pilus. Pili are
succinogenes. The flagellum is composed of antigenic, and genes encoding pili can be located
three parts: basal body, hook, and filament in the bacterial chromosome or in plasmids. Pili
(Fig. 1.16). Different bacteria can have anywhere are not locomotive structures. They are classified
from one or two flagella to hundreds of flagella into ordinary pilus or sex pilus according to their
(Fig. 1.17). It only can be observed directly by morphology, distribution, and function.
electronic microscope or by light microscope The pilus is found on the surface of many
after special staining (Fig. 1.18). The flagellum Gram-positive bacteria and some Gram-negative
is involved in the pathogenesis of some diseases bacteria. It is thinner and shorter than the flagel-
and is antigenic (e.g., antigen H). Examples of lum. Ordinary pili are 0.3–1.0 μm in length and
flagellate bacteria include Vibrio cholerae and about 7 nm in diameter and are distributed all
Campylobacter jejuni, which use multiple flagella over the bacterial cell surface. Sex pili can be
to propel themselves through the mucus lining of found in a handful of Gram-negative bacteria.
Fig. 1.19 Schematic

representation of the
bacterial spore
These pili are longer and thicker than ordinary bacterial cell, forming a drumstick-like structure,
pili, and each bacterial cell can have from 1 to as the spore is located at the tip of the bacterial
4 sex pili. cell (Fig. 1.20).
1.3.2.4 Spore
The spore is a small round or oval body that forms 1.3.3 Basic Virus Structure
in bacteria due to cytoplasmic dehydration under
unfavorable conditions (Fig. 1.19). It is Viruses are a kind of acellular microbe consisting
surrounded by multiple membrane layers and mainly of nucleic acid and proteins. Some viruses
has low permeability. Only Gram-positive bacte- are composed of a small amount of lipids and
ria can form spores, including species such as polysaccharides. The basic structure of virus is
Bacillus subtilis, Clostridium tetani (Fig. 1.20), made up by the viral core, viral capsid, as well as
etc. The spore contains a complete karyoplasm a membrane envelope in some viruses (Fig. 1.22).
and enzymatic system and can maintain all the The size, morphology, and structure of viruses
essential activities for the bacteria to remain alive. play important roles in viral taxonomy and in
The multiple membrane layers of the spore are, diagnosing viral infections.
from the exterior to the interior, as follows: spore
coating, spore shell, outer membrane, cortex, cell
(1) Viral core: namely, the nucleic acid compo-
wall of spore, and inner membrane, which
nent, which makes up the genome of the
surrounds the nucleus of the spore.
virus. The viral core provides genetic infor-
Spores are difficult to stain due to their thick
mation that determines pathogenicity, antige-
cell wall. Special staining is required to stain the
nicity, proliferation, heredity, variation, etc.
spore and distinguish it from the bacterial cell
The chemical components of the viral core
(Fig. 1.20).
are DNA or RNA, based on whether the virus
The size, morphology, and location of the
is classified as a DNA virus or a RNA virus.
spore differ between bacterial species and can be
Nucleic acid can be single or double stranded.
used to help identify bacteria (Fig. 1.21). For
The relative molecular mass of the viral core
example, the Clostridium tetani spore is round
is 2–160 106.
and larger than the transverse diameter of the
14 Y. Li et al.
Fig. 1.20 Spore stain of

Clostridium tetani (fuchsin-
methylene blue stain)
Fig. 1.21 Size,

morphology, and location
of bacterial spores
(2) Viral capsid: it is a protein shell that process when certain viruses bud out from the
surrounds and protects the nucleic acid of cell membrane. Therefore, the envelope can
the virus. The viral capsid is sometimes be composed of the host cell membrane
associated with the viral nucleic acid, and and/or the nuclear membrane. The surface of
this structure is known as the nucleocapsid. some viral envelopes carries protein
In virions without an envelope, the nucleo- protrusions called as peplomers or spikes.
capsid makes up the entirety of the virus. The
viral capsid is composed of repeated protein
subunits known as capsomeres, which is
1.4 Microbial Physiology
made of one or more proteins known as the
chemical subunit or structural subunit.
Bacterial cells are synthesis machines that multi-
(3) Envelope: this is the one or two layers of
ply themselves. The growth and division of bac-
membrane that surround the capsid of some
teria include approximately 2000 different types
viruses, which is a structure unique to the
of biochemical reactions that mediate energy con-
class of viruses known as enveloped viruses.
version or enzymatic biosynthesis.
The envelope is formed during the maturation
collected information, it is possible to generate a

growth curve using culture time as the horizontal
axis and the logarithmic number of viable cells in
the culture as the vertical axis (Fig. 1.26). Growth
curves can generally be divided into four major
sections.
1. Lag phase: During this process, the bacteria

are adapting to their new environment. The
volume of bacterial cells increases and their
metabolism is active, but cell division is slow
and reproduction is minimal.
Fig. 1.22 Basic structure of a virus 2. Logarithmic phase: In this period, bacteria
grow rapidly, and they divide and reproduce
1.4.1 Binary Fission Reproduction at a constant speed. The number of bacteria
increases exponentially and the number of via-
Binary fission is a process by which many ble cells increases logarithmically.
prokaryotes reproduce from a single cell into 3. Stationary phase: The bacterial growth rate
two new cells (Fig. 1.23). Bacteria reproduce gradually decreases, and the number of dead
asexually by binary fission. Cocci can divide bacteria increases. The number of newly pro-
from different planes to form different duced bacteria is approximately equal to the
arrangements. Bacilli divide along their horizon- number of dying bacteria, and the number of
tal axis; however, some bacterial species such as viable cells remains relatively stable.
Mycobacterium tuberculosis occasionally spilt by 4. Decline phase: Bacterial growth rate slows and
branching. stops, and the number of dead bacteria is
During cell division, the cell volume increases higher than that of viable cells. Cells become
and a diaphragm is generated where the cell divi- polymorphic, showing morphologies such as
sion is to take place. Then, a single cell will divide cell deformation, swelling, or autolysis.
into two cells (Figs. 1.24 and 1.25). Under suit-
able conditions, the majority of bacteria divide
quickly, about 20–30 min for one division. How-
1.5 Microbial Genetics
ever, the growth of some bacterial species can be
relatively slow. For example, Mycobacterium
Like the other living organisms, microorganisms
tuberculosis takes 18–20 h to complete one
have heredity and variable characteristics. Hered-
round of division.
ity keeps microbial genetic traits relatively stable
to ensure the reproduction of the species, while
variations produce changes in the
1.4.2 Bacterial Growth microorganisms that are useful for microbial sur-
vival and evolution and ultimately lead to the
Mastering the fundamentals of bacterial growth generation of new species.
allows the researcher to change culture conditions
artificially, adjust the bacterial phases of growth
and reproduction, and use beneficial bacteria 1.5.1 Heredity
more efficiently. Bacterial growth involves
inoculating a certain number of bacteria into a Heredity is the similarity in biological traits
suitable liquid medium and checking the number between offspring and its parent. Cells can be
of viable cells at different time intervals. With the considered as a chemical plant in which
16 Y. Li et al.
Fig. 1.23 Binary fission in

bacilli
information can be stored and transformed into a

useful product. Enzymes are the molecular
machines that catalyze specific chemical
reactions. The information is stored DNA,
which exists in the cell as two long molecular
coiled chains (DNA double helix). The intracel-
lular genetic information is replicated, tran-
scribed, and translated by enzymes, which then
leads to protein synthesis (Fig. 1.27).
1.5.2 Variation
Variation refers to the differences between off-

spring and its parent under certain conditions,
including variations in morphology and structure,
virulence, drug resistance, and so on. The
variability of microorganisms is divided into
genetic variation and non-genetic variation. The
Fig. 1.24 Synthesis of Gram-positive bacterial cell wall
During cell division, the volume of the cell increases, and a former is due to changes in bacterial gene struc-
new cell wall is formed. New cell wall materials are added ture. The new characteristics can be stably trans-
to the pre-existing cell wall to maintain structural integrity mitted to future generations, which is why this
Fig. 1.25 Division of

Gram-positive bacteria
(SEM)
Cell division in
Streptococcus gordonii,
showing a clear division
Fig. 1.26 The growth

curve of Escherichia coli
type of variation is called genotype variation, as effect of environmental factors. These variations
the change is mostly irreversible (Fig. 1.28). The can revert with the removal of the stimulating
latter is caused by the influence of certain envi- environmental factors.
ronmental conditions that do not change the
genetic structure of bacteria. The change is not
transmitted to the offspring and is therefore called 1.5.3 Genetic Material of Bacteria
a phenotypic variation. Genetic variation is rarely
influenced by external environmental factors. Nucleic acids are the basis of organismal hered-
Therefore, genetic variation tends to occur in ity. Two types of nucleic acid exist: DNA and
individual bacterial cells, while phenotypic varia- RNA. DNA is the genetic material in prokaryotic
tion tends to occur in a bacterial flora due to the and eukaryotic organisms, while the genetic
18 Y. Li et al.
Fig. 1.27 The processes of

replication, transcription,
translation of intracellular
genetic information, and
protein synthesis
Fig. 1.28 DNA mutation
material in viruses is DNA and RNA. The genetic Bacteriophages, known as phage for short, can
material found in microorganisms includes only reproduce in specific host strains and have
chromosomes, plasmids, bacteriophages, and high specificity for their host. The specificity is
transposable elements. related to phage cell binding molecules and the
Bacteriophages are viruses that infect bacteria, structure and complementarity of the host bacte-
fungi, actinomycetes, mycoplasma, and rial strain’s surface receptor molecules.
spirochetes. They inject their genetic material Since phages are small, they can only be
into the infected host cell and can induce bacterial observed under electron microscope. They can
cell lysis under certain conditions. be divided into three basic morphologies:
sequence. These changes are stable and heritable.

Mutations can generally be classified as gene
mutations and chromosomal aberrations. The
spontaneity and randomness of microbial
mutations can be tested by using fluctuation test
or replica plating (Figs. 1.31 and 1.32).
1.5.5 Gene Transfer

and Recombination
Gene transfer is a process by which exogenous

genetic material from a donor cell is transferred to
the receptor cell. However, simply the process of
transferring genetic material is not enough, as the
recipient cell must be able to accommodate exog-
Fig. 1.29 The structural model of a phage
The phage head is icosahedral is approximately
enous genes. Integration between the transferred
80 100 nm in size. It is consisted of the capsid protein gene and the DNA of the recipient cell is a pro-
which surrounds the internal nucleic acid. The tail is a cess known as recombination, whereby the recip-
tubular structure composed of protein, including the tail ient cell acquires certain characteristics of the
whiskers, tail collar, tail tube, tail sheath, tail fibers, and
tail baseplate
donor strain. Gene transfer and recombination in
bacteria can take place through processes such as
transformation, conjugation, transduction, cell
fusion, and lysogenic conversion.
tadpole-shaped, spherical, and rod-shaped. Most
1.5.5.1 Transformation
phages are tadpole-shaped and are made up of a
Transformation takes place when donor bacteria
head and a tail (Fig. 1.29).
DNA is cleaved and free DNA fragments are
The relationship between the phage life cycle
directly taken up by receptors. As a result, recipi-
and its host bacteria is shown in Fig. 1.30. Phages
ent cells acquire certain genetic traits from the
that infect bacteria can produce two outcomes.
donor cell. This phenomenon was confirmed in
The first, observed in virulent phage, involves
Streptococcus pneumoniae, Staphylococcus, and
phage multiplication resulting in the production
Haemophilus influenzae [8–10]. Griffith first
of many progeny phages, bacterial cell lysis, and
showed that bacterial transformation takes place
cell death. This cycle is known as the lytic cycle.
by infecting mice with Streptococcus
The second outcome is lysogeny, observed in
pneumoniae in 1928 [2]. An outline of the exper-
temperate phages. It involves the integration of
iment is shown in Fig. 1.33.
phage nucleic acid with the bacterial chromo-
some, resulting in the formation of a prophage.
1.5.5.2 Conjugation
The phage genetic material is reproduced when
Conjugation [3] is the method by which bacteria
the bacterial cell divides.
physically connect with one another through their
pilus to transfer genetic material (mainly plasmid
DNA). Plasmid transfer from the donor to the
1.5.4 Mechanism of Microbial recipient cell results in that the recipient cell
Variation acquires some of the genetic traits of the donor
cell. Plasmids that can be transferred through
Genetic variation in microorganisms has its basis conjugation are called conjugative plasmids,
in mutations caused by changes in their genetic which include the F, R, Col, and virulence
20 Y. Li et al.
Fig. 1.30 Lysogenic and

lytic cycles of lysogenic
phage
Fig. 1.31 Fluctuation test the same conditions, the bacterial cultures from the large
The fluctuation test shows that mutations pre-exist in a and small tubes were plated onto phage-containing plates,
population of bacteria in the absence of selection. This was and the number of colonies was measured. The results
tested by Luria and Delbruck [4] using naturally existing typically showed that of 50 phage-coated plates inoculated
phage-resistant mutations in bacterial populations. A given with bacteria from the large test tube, the fluctuation in the
concentration (103/ml) of Escherichia coli sensitive to colony number was small (3–7). On the other hand, when
specific phages were inoculated in two equal volumes the 50 small tubes were plated onto 50 plates, the number
(10 ml) of broth medium. One inoculum was concentrated of the colonies tended to fluctuate significantly, from zero
in a large test tube, and the other was evenly distributed colonies to several hundreds
into 50 small test tubes. After 24–36 h incubation under
Fig. 1.32 Replica plating the antibiotics are completely suppressed, but drug-
Replica plating (Lederberg et al. 1952) [5] involves plating resistant colonies will be visible on the plate. We can
antibiotic-susceptible strains on agar plates in the absence find colonies corresponding to drug-resistant colonies on
of antibiotics until scattered single colonies grow. Using a the original plates lacking antibiotics. The drug-resistant
block covered with sterile velvet, gently press the velvet colonies can then be transplanted to culture broth
onto the surface of the agar plates so that bacterial colonies containing the appropriate antibiotics to observe bacterial
are imprinted onto the sticky velvet surface. Then, press to growth. Although the bacterial colonies on the original
the velvet surface onto an agar plate containing antibiotics. agar plate have never been in contact with antibiotics,
After an appropriate culture time, bacteria susceptible to they are nonetheless resistant to antibiotic drugs
plasmids. The F plasmid encodes the pilus and Streptococcus, Bacillus subtilis), and the phe-
controls pilus formation and whether or not the nomenon has also been observed in Streptomyces.
pilus enables conjugation (Fig. 1.34).
Plasmids that cannot be transferred between 1.5.5.3 Transduction
bacteria through a pilus are called Transduction uses a temperate phage as the vehi-
non-conjugative plasmids. The non-conjugative cle by which DNA from a donor cell is transferred
plasmid ColE1 is relatively low in molecular into a recipient cell [6, 7]. Transduction can trans-
mass and does not encode the necessary gene fer larger fragments of DNA than transformation.
required for it to be transferred from one cell to According to the genes involved in transduction,
another. However, if there is another conjugative the process can be divided into generalized trans-
plasmid in the host cell, ColE1 can tag along and duction and restricted transduction (Figs. 1.36
be transferred from one cell to another. For exam- and 1.37).
ple, the F plasmid which encodes the genes nec- Generalized transduction can transfer
essary for pilus formation can help ColE1 transfer plasmids. The transduction of plasmid R in
from one cell to another (Fig. 1.35). Staphylococcus aureus is a very important clini-
Conjugation is widespread in Gram-negative cal feature.
bacteria and can be observed in almost members In generalized transduction, the packaged
of the Enterobacteriaceae. Some Gram-positive DNA can be from any part of the donor strain
bacteria have been reported to conjugate (e.g., chromosome. When phages exit the lysogenic
22 Y. Li et al.
Fig. 1.33 Streptococcus pneumoniae transformation in until they were no longer active. These dead type III-S
mice bacteria were injected into mice, and the mice survived.
Streptococcus pneumoniae with a polysaccharide capsule However, when dead type III-S bacteria and live type II-R
belong to the virulent type III strain. These colonies are bacteria were both injected into the same mice, the mice
smooth (S) in appearance. Streptococcus pneumoniae died, and type III-S bacteria were isolated from their
without the polysaccharide capsule belong to the avirulent blood. This experiment showed that the live type II
type II strain and appear as rough (R) type colonies. In the R-type bacteria were able to obtain genetic material from
classic Griffith experiment, type II-R bacteria and type dead type III-S bacteria that transformed them from an
III-S bacteria were injected into mice. Mice that received avirulent strain to a virulent one. It also suggests that the
the type II-R bacteria survived and those that received the genetic material encoded the capsule virulence factor from
type III-S bacteria died. The type III-S bacteria were type III-S bacteria
isolated from the blood of the dead mice and were heated
Fig. 1.34 The transfer and replication of the F plasmid is formed. Plasmid DNA from the F+ bacteria break at the
during conjugation origin of transfer (oriT), and the 5 ‘end extends through the
Bacteria possessing the F plasmid and F-pili are the male channel into the F bacteria. Single-stranded DNA in both
equivalent strain (F+), while bacteria lacking the F plasmid bacterial cells replicate by rolling circle replication, and
and F-pili are the female equivalent strain (F ). When the each cell forms a complete F plasmid. Therefore, the donor
F+ and F strains are present in the same environment, the cell has not lost its F plasmid after the transfer and the
F-pilus from the F+ bacterial cell conjugates to the F recipient cell becomes F+ strain bacteria after receiving the
surface receptor. The F-pilus gradually shortens so that F plasmid
the two cells are pulled close to one another and a channel
Fig. 1.35 Non-conjugative plasmid (ColE1) induced to encoded by the mobA gene. When both F and ColE1
transfer by F plasmid plasmids are present in the same bacterial cell, the mobA
The ColE1 plasmid can be induced to transfer from a gene is transcribed and its product creates a single strand
donor to a recipient cell. This process requires two genes break at the bom locus to form a gap. As a result, the
encoded on the ColE1 plasmid: the specific site bom on ColE1 plasmid goes from a supercoiled plasmid to an
ColE1 DNA (also known as the nic locus) and the nuclease open loop
Fig. 1.36 Generalized

mode of transduction
phase, the prophage will excise itself from the thereby transferring DNA from one bacterial cell
bacterial chromosome and enter lytic phase. In to another.
the late stages of the lytic phase, phage DNA is Restricted transduction, or specific transduc-
replicated in large quantities, and errors can occur tion, describes the process in which transduction
during phage assembly. Approximately one in is restricted to specific genes from the chromo-
105–107 phages will contain bacterial DNA some of the donor strain. If phage λ is transferred
fragments that have been mistakenly packaged into Escherichia coli K12 while it is in the lyso-
into the phage head; these results in the formation genic phase, the phage DNA is integrated into a
of a transducting phage. Transducting phages can specific site in the Escherichia coli chromosome,
infect another host bacterium and inject the DNA between the galactose (gal) and biotin (bio)
fragment it is carrying into the recipient cell, genes.
24 Y. Li et al.
Fig. 1.37 Restricted mode

of transduction
6. Morse ML, Lederberg EM, Lederberg J. Transduction

References in Escherichia coli K-12. Genetics. 1956;41
(1):142–56.
1. Joseleau-Petit D, Liebart JC, Ayala JA, D’Ari 7. Morse ML, Lederberg EM, Lederberg
R. Unstable Escherichia coli L forms revisited: growth J. Transductional heterogenotes in Escherichia coli.
requires peptidoglycan synthesis. J Bacteriol. Genetics. 1956;41(5):758–79.
2007;189(18):6512–20. 8. Straume D, Stamsås GA, Håvarstein LS. Natural trans-
2. Griffith F. The significance of pneumococcal types. J formation and genome evolution in Streptococcus
Hyg (Lond). 1928;27(2):113–59. pneumoniae. Infect Genet Evol. 2015;33:371–80.
3. Lederberg J, Tatum EL. Gene recombination in E. coli. 9. Marraffini LA, Sontheimer EJ. CRISPR interference
Nature. 1946;158(4016):558. limits horizontal gene transfer in staphylococci by
4. Luria SE, Delbruck M. Mutations of bacteria from targeting DNA. Science. 2008;322(5909):1843–5.
virus sensitivity to virus resistance. Genetics. 10. Poje G, Redfield RJ. Transformation of Haemophilus
1943;28(6):491–511. influenzae. Methods Mol Med. 2003;71:57–70.
5. Lederberg J, Lederberg EM. Replica plating and indi-
rect selection of bacterial mutants. J Bacteriol. 1952;63
(3):399–406.
Techniques for Oral Microbiology
2
Xian Peng, Biao Ren, Yuqing Li, Xuedong Zhou, Jing Xie,
Chenchen Zhou, Demao Zhang, Xin Zheng, and Xinxuan Zhou
Abstract stain techniques, isolation, incubation and

In recent years, with the rapid development of identification techniques, microscopy
molecular biology, microecology, systems techniques, oral microecology techniques,
biology, and other disciplines, oral microbiol- and oral microbiome techniques.
ogy has been transformed from the traditional
microbiology which is based on isolation and Keywords
culture to a modern oral microbiology which is Smear and stain · Isolation and identification ·
interdisciplinary and multi-scale. The continu- Microscopy techniques · Oral microecology
ous development of microscope technologies techniques · Oral microbiome techniques
has made it possible for us to understand the
cell structure, biofilm structure, and ecological
interactions of oral microorganisms. With the 2.1 Smear and Stain Techniques
application of 16S rDNA gene sequencing
technology, metagenomics technology, and Smear test and slide stain are basic techniques for
pyrosequencing technology being gradually microbial identification and are primarily used for
improved, it has laid a foundation for morphological observation. The combination of
elucidating the composition of oral smear and stain is widely used in oral microbiol-
microbiome and the correlation between oral ogy research to differentiate between spirochetes,
microbes and human diseases. The main bacteria, fungi, and protozoa, as well as to iden-
contents of this chapter include smear and tify specific cellular structures including spore,
capsule, flagellum, and others. Currently, some
X. Peng (*) · B. Ren · Y. Li · J. Xie · C. Zhou · D. Zhang · of the commonly used techniques for cellular
X. Zheng · X. Zhou morphology examination are direct smear test
State Key Laboratory of Oral Diseases, National Clinical and stained smear test, including Gram stain and
Stomatology, Sichuan University, Chengdu, China Congo red staining. The procedure for smear test
e-mail: pengx@scu.edu.cn is shown in Fig. 2.1.
X. Zhou Specific stains can be used to observe the
State Key Laboratory of Oral Diseases, National Clinical specific microbial structures, including the bacte-
Research Center for Oral Diseases, West China Hospital of rial spore, capsule, flagellum, fungal hypha,
Stomatology, Sichuan University, Chengdu, China chlamydospore, etc.
Department of Cariology and Endodontics, West China
Hospital of Stomatology, Sichuan University, Chengdu,
China

https://doi.org/10.1007/978-981-15-7899-1_2
26 X. Peng et al.
Fig. 2.1 Procedure of smear test
2.1.1 Kopeloff’s Modification of Gram relatively fewer lipids. Thus, Gram-positive

Stain microbes cannot be easily decolorized and
become deeply stained in purple. In contrast,
Gram stain is a commonly used method for the Gram-negative microbes have a thin membrane
identification of bacteria and fungi. After Gram with high lipid content and little peptidoglycan.
staining, bacterial species can be generally The precipitated dye-iodine complex can there-
differentiated into Gram-positive and Gram- fore be easily dissolved and leave the cell. As a
negative groups, and most clinical anaerobic result, the cell is stained red from the counterstain.
microbes can be differentiated by their typical cel-
lular morphology. In addition, mycoplasma with
2.1.1.2 Preparation of Gram Stain
their ring shape can also be identified. Kopeloff’s
Reagents (Commercially
modification of Gram stain is recommended by the
Available)
Virginia Polytechnic Institute (VPI) for better visu-
1. Crystal violet
alization and differentiation of microbes.
Liquid A (add 10 g crystal violet to 100 0 ml
distilled water and mix well)
2.1.1.1 Mechanism
Liquid B (add 50 g NaHCO3 to 1000 ml dis-
Many theories have been proposed to explain the
tilled water and mix well)
mechanism of Gram staining, including isoelec-
tric point theory, chemical theory, and permeation 2. Gram’s iodine
theory. Among them, permeation theory has
Dissolve 4 g NaOH into 25 ml distilled water
gained wide acceptance. It is believed that crystal
and add 20 g iodine and 1 g KI. After everything is
violet placed on the microbe smear slides during
completely dissolved, add 975 ml distilled water,
staining interacts with aqueous iodine to form
mix well, and store the liquid in a brown bottle.
insoluble precipitates within the cell. During
decolorization, alcohol and acetone can dissolve 3. Decolorizers
the lipid in the outer membrane and leach the
Add 300 ml acetone to 700 ml 95% alcohol
precipitated dye-iodine complex out of the micro-
and mix well.
bial cell. Gram-positive microbes have a thick cell
wall with highly cross-linked peptidoglycans and 4. Fuchsin counterstain
2 Techniques for Oral Microbiology 27
Add 5–10 g basic fuchsin to 100 ml 95% 2.1.1.4 Reporting Results

alcohol to form a supersaturated liquid. Mix Examine the slide under a light microscope using
10 ml of the supersaturated liquid with 90 ml oil immersion. Gram-positive bacteria appear
5% carbolic acid solution followed by the addi- purple (Figs. 2.3 and 2.4), while Gram-negative
tion of 900 ml water. Mix well and filter thorough bacteria appear pinkish red (Figs. 2.5 and 2.6).
filter paper. (Safranin solution can also be used in
place of fuchsin solution for counterstain: add 2.1.1.5 Precautions
20 g safranin to 100 ml 95% alcohol and adjust 1. Smear only a monolayer of cells on the slide.
the volume to 1000 ml with distilled water.) 2. Avoid over-heating of the smear slide.
3. Slightly prolong the time of decolorization if
2.1.1.3 Staining Procedure the smear layer is thick.
Gram stain procedure is shown in Fig. 2.2. 4. Old cultures of Gram-positive bacteria may
appear as Gram-negative bacteria.
1. Add crystal violet Liquid A onto the fixed

smear slide. After 5 s, add Liquid B and gently 2.1.2 Staining Bacterial Spores
shake the slide to mix Liquids A and B for
30 s. Gently rinse off the crystal violet with tap Gram stain and fuchsin-methylene blue are com-
water (Fig. 2.2a). monly used to observe bacterial spores.
2. Flood the smear slide with Gram’s iodine for
30 s. Gently rinse off the iodine with tap water 2.1.2.1 Gram Stain
(Fig. 2.2b). The Gram stain procedure is the same as
3. Add decolorizer to the smear while holding the described above. The result of Gram stain is
slide at an angle to allow the decolorizer to shown in Fig. 2.7.
drain. Gently shake the slide for 5–10 s until
crystal violet leaches out. Gently rinse off the 2.1.2.2 Fuchsin-Methylene Blue Stain
decolorizer with tap water (Fig. 2.2c). Reagent preparation:
4. Flood the smear with fuchsin or safranin coun-
terstain for 5–10 s. Gently rinse off any excess 1. Fuchsin solution: Add 5–10 g basic fuchsin to
fuchsin or safranin with tap water. Drain and 100 ml 95% alcohol to form a supersaturated
air-dry the slide before observation (Fig. 2.2d). liquid. Mix 10 ml of the supersaturated liquid
with 90 ml 5% carbolic acid solution followed
by 900 ml water.
2. Methylene blue solution:
Liquid A: add 0.3 g methylene blue to 30 ml
95% alcohol
Liquid B: add 0.01 g KOH to 100 ml distilled
water
Mix Liquids A and B
3. Decolorizer: 95% alcohol
Stain procedure: Flood the smear slide with
fuchsin solution. Heat the slide on the alcohol
burner to steam for 3–5 min (avoid drying out
the smear slide and add fuchsin solution when
necessary). Cool off the slide and rinse off excess
fuchsin under tap water. Flood the slide with
Fig. 2.2 Gram stain procedure
decolorizer for 1 min and rinse. Stain the slide
28 X. Peng et al.
Fig. 2.3 Gram-positive

bacteria (Actinomyces
naeslundii)

yeast (Candida albicans)
with methylene blue solution for 0.5 min and 2.1.3 Staining the Bacterial Capsule
rinse. Observe the slide under microscope using
oil immersion. Results of spore staining are The bacterial capsule can be stained using a vari-
illustrated in Fig. 2.8. ety of methods, including the Murs stain, ink
Fig. 2.5 Gram-negative

bacteria (Eikenella
corrodens)

bacteria (mycoplasmal
pneumonia)
methylene blue stain, Hiss copper sulfate stain, 2.1.3.1 Murs Stain
Ott safranin stain, etc. Encapsulated bacteria that Preparation of staining solutions:
are found in the oral cavity include Streptococcus
1. Staining solution (carbol fuchsin solution):
pneumoniae, Porphyromonas gingivalis, and
add 1 g basic fuchsin to 10 ml 95% ethanol
others.
30 X. Peng et al.
Fig. 2.7 Bacillus subtilis

(Gram stain)
Under light microscope
with oil immersion,
bacterial sporex appear
colorless with strong
refraction. They are located
toward the center (central
spore) or ends of the cell
(terminal spore) with round
or ovoid shape
Fig. 2.8 Spore stain with

Clostridium tetani (fuchsin-
methylene blue stain)
The cell appears blue and
the spore appears red. A
round spore is located at the
end of the cell, giving the
cell a drumstick appearance
solution, and then add 40 ml 5% aqueous (K2SO412H2O), and 100 ml 7% saturated

carbolic acid solution and mix. mercuric chloride.
2. Mordant staining solution: mix 100 ml 2% 3. Counterstaining solution (alkaline methylene
tannic acid, 250 ml 10% potassalumite blue solution): add 0.3 g methylene blue to
Fig. 2.9 Capsule of S.

pneumoniae (Murs staining
method)
Bacterial cells are stained
red, and the capsule around
the cell shows up as blue
transparent circles
30 ml 95% ethanol solution, and then add methanol to the mortar to dissolve the eosin
100 ml 0.01% potassium hydroxide solution. Y until fully dissolved. Add 20 ml methanol,
4. Destaining solution: 95% ethanol. mix, and allow to stand for a moment. Decant
the liquid into a clean storage bottle, add meth-
Staining protocol: Prepare a smear sample
anol to the mortar, mix, and repeat several
using physiological saline and fixed. Heated
times until all of the stain is dissolved. Sixty
carbol fuchsin solution is used to stain the smear
milliliters of methanol should be used for 0.1 g
for 1 min. Flush with water after destaining using
stain. Shake and seal the storage bottle, and
95% ethanol. Stain with mordant staining solu-
store it in the dark at room temperature.
tion for 0.5 min, and destain with 95% ethanol for
2. Phosphate buffer (pH 6.4–6.8): 30 ml 1%
0.5 min. Stain with alkaline methylene blue solu-
KH2PO4, 73.5 ml M/15 KH2PO4, 20 ml 1%
tion for 0.5 min, and then flush the stain solution
Na2HPO4, 26.5 ml M/15 Na2PO4, complete
with water. Examine microscopically after
with H2O to1000 ml).
air-drying. Typical results are shown in Fig. 2.9.
Staining protocol: Prepare a smear using the
conventional method and allow to air dry. Place
2.1.3.2 Wright’s Stain
4–6 drops of Wright’s stain onto the smear and
Bacterial capsules can also be stained with the
allow to staining for 1 min. Add an equal amount
Wright’s staining method. Furthermore, the
of phosphate buffer (pH 6.4–6.8). Shake gently to
Wright’s staining method can be used to stain
allow the phosphate buffer and the staining solu-
Rickettsia and spirochetes, which appear purple
tion to mix evenly. Let the stain stand for 6–8 min
after staining.
and flush with water. The smear should appear
Preparation of staining solutions:
pink (if the smear appears bluish violet, it can be
1. Wright stain solution: Weigh out 0.1 g dry destained using by 20% hydrochloric acid metha-
Wright’s stain (same as eosin methylene blue nol solution). A typical result is shown in
stain). Grind eosin Y using mortar and pestle Fig. 2.10.
until it becomes a fine powder. Add 10 ml
32 X. Peng et al.
Fig. 2.10 Capsules of

Histoplasma capsulatum
(Wright’s stain)
Bacterial cytoplasm is
stained light blue, and the
capsules surrounding the
cells are colorless
transparent circles
2.1.4 Flagellar Stain farthest away from the original streak and resus-
pend in a small tube in sterile distilled water.
Flagellar stain is used to observe whether bacteria Keep the small tube at room temperature for
have flagella, as well as the number and location 20–30 min, or keep it in a 37 C incubator for
of flagella. It is a helpful tool for bacterial identi- 4–5 min to allow the culture to become fully
fication. Flagellar staining is of great importance resuspended. Remove a loop of the bacterial sus-
in identifying motile oral bacteria. For example, pension with a disposable sterile loop, and place it
Selenomonas can have up to 16 flagella, while gently on a clean slide. Tilt the slide gently or
straight Campylobacter only has one polar push the bacterial suspension with the loop. Then
flagellum. allow the smear to dry naturally at room tempera-
ture or in the 37 C incubator.
2.1.4.1 Preparation of Staining
Solutions 2.1.4.3 Staining Protocol
Liquid A: 20 ml 2% tannic acid solution Drop the Liquid A and Liquid B mixture onto a
dissolved in heated water bath, 20 ml 20% potas- dry smear and allow to stain for 1–2 min. Flush
sium solution (heat to dissolve), 50 ml 5% aque- the slide with water. When the smear is dry,
ous solution of carbolic acid; mix all three observe the result under an oil immersion lens
solutions. (Fig. 2.11).
Liquid B: alkaline fuchsin ethanol saturated
liquid (same as in Gram stain solution). Mix
30 ml Liquid A with 10 ml Liquid B and filter. 2.1.5 Staining Procedure for Special
Keep the filtrate for 6–10 h at room temperature Fungal Structures
for optimum results.
Gram stain and lactophenol cotton blue stain are
2.1.4.2 Smear Preparation used to visualize certain fungal structures that are
Flagellar staining requires correct preparation of significant for identification. These include the
the smear. Pick a small, young agar culture germinal tube, hyphae, and spores and are
Fig. 2.11 Periplasmic

flagella (flagella staining)
The bacterial cell is stained
red, and the light red
flagella can be seen around
the bacterial cell
especially important in clinical analyses of oral Staining protocol: Place a drop of

mucosal diseases. For example, in the identifica- lactatophenol cotton blue staining solution onto
tion of thrush, angular stomatitis closely related to a clean slide and mix the fungal culture or clinical
Candida albicans. The checking specimen is sample with the staining solution. Place a cover-
originated from albuginea or focal secretion of slip on top and heat gently. Press the coverslip
oral mucosa. Gram staining and acid phenol cot- gently to remove any bubbles. Observe the slide
ton blue stains are often used to verify the under an oil immersion lens (Figs. 2.14 and 2.15).
structures in fungi such as germ tubes, hyphae,
and spores, especially for oral mucosal diseases
such as thrush and angular cheilitis-related Can-
2.1.6 Giemsa Stain for Mycoplasma
dida albicans. Most specimens are taken from the
oral mucosa lesions albuginea and secretions.
Giemsa stain is used to observe Mycoplasma
(Fig. 2.16).
2.1.5.1 Crystal Violet Stain
Crystal violet staining solution is prepared in the
same way as Liquid A used in Gram stain. Take a
small quantity of culture and mix with physiolog- 2.1.7 Negative Congo Red Staining
ical saline to prepare a smear. Stain the smear of Plaque Bacteria
with crystal violet solution. Observe under oil
immersion lens (Figs. 2.12 and 2.13). Due to the simplicity of this method in producing
high-quality stained smears, the Congo red
2.1.5.2 Lactophenol Cotton Blue Stain staining method has been widely used in the
Preparation of staining solution: Dissolve 20 g examination of periodontitis and other oral clini-
carbolic acid (solid), 20 ml lactic acid, and cal specimens.
40 ml glycerol into 20 ml distilled water (heat as 1. Sample: Saliva, plaque, other oral specimens.
gently as possible). Add 0.05 g cotton blue, shake 2. Staining solution: 2% Congo red solution.
until well-mixed, and filter before storing.
34 X. Peng et al.
Fig. 2.12 Germinal tube

and blastospore of Candida
albicans (crystal violet
stain)
The germinal tube and
blastospore appear purple
when Candida albicans is
incubated in 0.5–1 ml
human serum or in sheep
serum for 2–4 h at 37 C
and stained by the crystal
violet staining method
Fig. 2.13 Pseudohypha

chlamydospore of Candida
albicans (crystal violet
stain)
Pseudohypha
chlamydospores of Candida
albicans appear purple
when stained with crystal
violet. The chlamydospores
are big, spherical, and
thick-walled, and they are
located at the tip or side
wall of unevenly stained
pseudohypha
3. Staining procedure: Place a drop of the 2% concentrated hydrochloric acid until the red
Congo red solution on a clean slide. Mix the smear turns blue.
specimen and the staining solution and spread 4. Results: The blue smear is examined under
the mixture thinly with a slide. After the smear light microscope under oil immersion lens
dries naturally, smoke it over a bottle of (Fig. 2.17).
Fig. 2.14 Germinal tube

and blastospore of Candida
albicans (lactatophenol
cotton blue stain)
Germinal tube and
blastospores are stained
bright blue after Candida
albicans are incubated in
0.5–1 ml human serum or in
sheep serum for 2–4 h at
37 C and stained with
lactatophenol cotton blue
stain

chlamydospore of Candida
albicans (lactophenol
cotton blue stain)
Pseudohypha
chlamydospores of Candida
albicans are bright blue; the
big, spherical, thick-walled
chlamydospore is at the tip
or side wall of the
pseudohypha
36 X. Peng et al.
Fig. 2.16 Mycoplasma

(Giemsa stain)
Typical ring-shaped
mycoplasma cells stain
purple
Fig. 2.17 Negative Congo

red stain of plaque bacteria
The background is blue
while the bacteria remain
unstained (bright white
with different shapes),
creating what is called a
negative stain. (a) coccoid
cells; (b) short bacilli; (c)
fusiform bacilli; (d) long
bacilli; (e) filamentous
bacilli; (f) curved rods; (g)
spirochetes
Listgarten classification is generally used in 1. Coccoid cells: Cell diameter from 0.5 to
negative Congo red staining and dark-field 1.0 μm, including several kinds of
microscopy to classify the observed plaque bacte- coccobacilli.
ria. The method involves selecting an evenly 2. Straight rods: Cells measure approximately
spread field, counting 200 bacterial cells, and 0.5–1.5 μm in width, 1.0–1.9 μm in length.
reporting the percentage of different species Some types of mycobacteria are included.
according to their morphology.
3. Filaments: Cells measure 0.5–1.5 μm in width 2.2 Isolation, Incubation,

and the ratio of length to width is greater than and Identification Techniques
6. Most bacteria are shaped as irregular long
filamentous cells. The isolation and identification of oral microor-
4. Fusiform cells: Cells measure approximately ganism can be difficult. Because oral microorgan-
0.3–1.0 μm in diameter, 10 μm in length, and ism are great in number and composed of diverse
show tapered ends. species, new genera and species are constantly
5. Curved rods: Cells are similar in dimension to being discovered, while the classification of
straight rods, but are curved or crescent- some previously discovered species change with
shaped. time. Therefore, it is currently impossible to iso-
6. Spirochetes: Cells have a spiral shape and late and identify all the microbes in an oral speci-
measure 0.2–0.5 μm in width and 10–20 μm men. Phenotypic identification of organisms is
in length. the most basic and important part of microbiol-
ogy. Classical methods for bacteria identification
require observation of the phenotypic
2.1.8 Protozoan Smears characteristics of a pure bacterial culture, includ-
ing characteristic colonies (size, color, shape,
Entamoeba gingivalis and Trichomonas tenax are etc.), cell characteristics (size, shape, arrange-
the main protozoans found in the oral cavity. Wet ment, and stain), special structures (with or with-
smears can be prepared using fresh specimens to out spores, capsule, pili, and flagellum), culture
observe the morphology and mobility of the characteristics (sensitivity to oxygen, optimum
protozoans. Giemsa stain can be used on a fixed growth temperature, pH, requirements for
specimen to observe the cellular structure. nutrients and growth factors, etc.), metabolites,
etc. Bergey’s Manual of Systematic Bacteriology
is an authoritative reference book for bacterial
2.1.8.1 Wet Smear for Fresh Samples isolation.
Mix gingival margin plaque samples or
subgingival plaque with saline to prepare fresh
wet smears. Examine the shape and mobility of
the protozoans under the microscope immedi- 2.2.1 Collection and Transportation
ately. Trophozoites of Trichomonas tenax are of Samples
lively pear-shaped parasites which move faster
than Trichomonas vaginalis. Examination of 2.2.1.1 Sample Collection
fresh smears should preferably be performed at 1. Collection of saliva samples: Saliva samples
room temperatures above 20 C and should be include stimulated salivary and unstimulated
completed within 30 min after smear preparation salivary samples. Stimulated salivary samples
in order to avoid any influence from the lower are collected when subjects are chewing paraf-
temperature of the room or the time spent on the fin or a rubber block, while unstimulated sali-
slide on the motility of the protozoan. vary samples are secreted naturally by the
subjects. More saliva is collected by stimula-
tion, but at the same time, it can influence the
2.1.8.2 Giemsa Staining mucosa, oral plaque, and the oral microflora.
Place a drop of saline solution onto a clean slide Saliva samples for microbiological examina-
and mix it with the clinical sample (e.g., tion should preferably be fresh unstimulated
subgingival plaque). Stain the air-dried specimen salivary samples. The best time for collection
with Giemsa stain solution, and examine it with a is early in the morning upon waking and
light microscope under oil immersion. before the teeth are brushed, or alternatively,
38 X. Peng et al.
samples can be collected between meals 4. Collection of oral mucosal diseases samples:
(around 10:00 or 16:00). Subjects should White membranous materials are usually col-
gently rinse their mouths with warm water to lected with curettes or cotton swabs. To collect
remove any food residue. Anywhere from 0.5 the quantitative samples, filter papers of a spe-
to 1 ml of naturally secreted saliva is collected cific size are used.
into a sample tube, or saliva samples can be
directly taken from the oral cavity using sterile
2.2.1.2 Sample Transportation
pipette tips.
Fungal species, aerobic bacteria, and general fac-
2. Collection of plaque samples: As plaque
ultative anaerobic bacteria can be collected by
microbes are complex in their composition,
cotton swab sampling and transported in sterile
plaque samples should be collected in different
tubes. For most anaerobic bacteria or
ways depending on specific clinical
microaerophilic bacteria, samples must be sent
requirements and purposes. If necessary,
to the laboratory as soon as possible and
plaque indicators should be used to show den-
maintained in an anaerobic environment. With
tal plaque. Plaque samples can be found on
the exception of pus or saliva samples that can
adjacent surfaces and fissures in occlusal
be inserted directly into the sterile rubber stopper
surfaces. Before sample collection, subjects
of the syringe needle used to collect the sample
should gargle with warm water to remove
for transportation, most anaerobic samples must
any food residue. Then, sterile gauze or a
be placed in pre-reduced culture media and for
yarn ball should be used to absorb saliva,
transportation to the laboratory immediately after
while plaque samples are collected. A sterile
acquisition. This is to minimize the death of
probe is commonly used in plaque collection
oxygen-sensitive bacteria during transportation.
from occlusal surface fissures. Plaque found
Chairside inoculation and anaerobic transporta-
on adjacent surfaces can be collected with
tion can help improve the detection rate of obli-
sterile probe, dental floss, or fine orthodontic
gate anaerobic bacteria.
wire. Sterile curettes can be used to collect root
Transportation in pre-reduced medium
surface plaque samples. Plaque samples on the
requires that samples be placed immediately in a
gum or in the gingival margin can be collected
small covered tube with containing pre-reduced
using a spoon scaler. Subgingival plaque is
liquid transportation medium. In order to reduce
divided into attached plaque and unattached
the infiltration of oxygen during transportation,
plaque. Collection using the MooreOO bacte-
sterile liquid paraffin can be placed on the
ria taker or using a sterile paper point is cur-
pre-reduced medium to isolate it from air.
rently the most widely used and the easiest
For clinical specimens that cannot be exam-
way to collect subgingival plaque. Plaque
ined in a timely manner or that must be
samples from infected root canals are usually
transported over a long distance, anaerobic bags
collected with sterile paper point.
(commercially available) or pre-reduced liquid
3. Collection of other samples of infected tis-
medium in a spiral tube sealed with liquid paraffin
sue: In samples of infected tissue such as lip
can be used for transportation.
carbuncle, aerobic bacteria and facultative
anaerobes such as Staphylococcus aureus are
the main pathogens and are generally collected
with sterile cotton swabs. Samples of purulent 2.2.2 Suspension and Dilution
fluid from a periodontal abscess can be col- of Samples
lected with sterile syringes. Tissues in the
alveolar socket are generally collected as Clinical oral infections are mixed infections
samples of dry socket developed after tooth involving many different species of bacteria
extraction. within a concentrated plaque mass. In order to
obtain pure cultures of individual bacteria, oral
Fig. 2.19 Sample dispersion (ultrasonic generator)
difficult to avoid oxygen infiltration during ultra-

sonic dispersion, which can lead to the death of
anaerobic bacteria in the sample.
Fig. 2.18 Sample dispersion (vortex generator)

2.2.2.2 Sample Dilution
As oral clinical samples are mixed bacterial
clinical specimens usually require processing and samples containing a great number and variety
dilution after inoculation. of bacteria, proper dilution with the correct dilu-
ent must be performed prior to inoculation to
2.2.2.1 Sample Suspension in Solution obtain single colonies after sample suspension.
Generally, two methods are used for sample sus- The solution in which the sample was
pension: spiral vortex oscillation (Fig. 2.18) and transported can be used as a diluent; otherwise,
ultrasonic dispersion (Fig. 2.19). Spiral vortex phosphate buffer (pH 7.2) can also be used. A
oscillation is widely used because of its ease of tenfold dilution series is generally performed.
operation and low cost. All that is required is for Under aseptic conditions, 0.1 ml of the specimen
the sample collection tube to be placed on the sample is added to 0.9 ml diluents. After thorough
vortex generator and allowed to oscillate for mixing, 0.1 ml of the mixture (101) is added to a
10–20 s. Adding 5–6 small sterile glass beads tube containing 0.9 ml diluent and mixed again.
(110–150 μm) into the small tube can help Using this method, tenfold dilutions are made in
improve sample dispersion. Ultrasonic dispersion series (Fig. 2.20). Due to differences in sample
yields superior sample suspension, but the disad- bacteria content, different samples require differ-
vantage is that a sonicator, which is an expensive ent dilutions. For example, saliva samples should
piece of equipment, is required and the microbial be diluted to 104–106, gingival groove plaque
detection rate can drop because spirochetes, should be diluted to 101–102, while mixed
Porphyromonas, Prevotella, and other Gram- plaque should be to 103–105.
negative bacteria are easily lysed. It is also
40 X. Peng et al.
Fig. 2.20 Sample dilution (tenfold serial dilution)
Fig. 2.21 Spread method protocol
2.2.3 Inoculation and Incubation bacilli. To culture most aerobic and facultative
of Samples anaerobic bacteria, the blood agar (BA) is used.
In addition to selecting the appropriate medium 2.2.3.2 Sample Inoculation

for inoculation, other considerations include Spread method, drop method, and spiral inocula-
degree of dilution before inoculation, method of tion method are used for oral clinical bacteriology
inoculation, incubation environment, time needed samples. Appropriate dilutions of the specimen
for colony establishment, purpose of incubation, solution are quantitatively inoculated onto the
and microbial species. agar plate.
2.2.3.1 Choice of Medium 1. Spread method: Ten microliters from appropri-

The medium commonly used for oral bacteria ately diluted samples are taken with a
include brain-heart infusion (BHI) medium, micropipettor and placed on the surface of
trypticase soy medium (TSA), and TPY medium. the agar medium. The sample is then evenly
These can be used to cultivate most bacteria from coated on the agar surface using a sterile glass
an oral sample. Five percent defibrinated blood spreader (triangle rod and L-shaped rod). At
(or 5% serum), chlorinated hemoglobin, and vita- the appropriate dilution, each bacterial cell
min K1 must be supplied to the culture medium from the specimen should form a single colony
for some obligate anaerobic Gram-negative after incubation (Figs. 2.21 and 2.22).
Fig. 2.22 Colonies on a

plate using spread method
(periodontal bag samples)
Fig. 2.23 Drop method

protocol
2. Drop method: Twenty-five or 50 μl samples at 2.2.3.3 Sample Incubation

the appropriate dilution are dropped onto the Media containing clinical samples are incubated
surface of the agar using a micropipettor. according to the requirements of each specific
Then, the plates are placed directly into the sample, including oxygen requirement, tempera-
dry incubator (Figs. 2.23 and 2.24). ture, and time. Oral clinical specimens such as
3. Spiral plater method: The spiral plater the most infected root canal, pericoronitis infection,
advanced method for inoculating bacteria for samples taken after tooth extraction, and
the purpose of counting colony forming units. subgingival periodontitis plaque samples, which
The sample liquid is automatically diluted and are mostly mixed bacterial samples, may involve
inoculated using a needle tip on the surface of different oxygen requirements, as there are a vari-
the agar plate by the instrument, and the bac- ety of microorganisms each with their respective
teria colonies grow uniformly along the spiral requirements. Some bacteria require incubation
trajectory after incubation (Fig. 2.25). As a under the anaerobic conditions, while others
result, sample counting and bacterial colony require incubation under aerobic conditions. The
observation is more accurate and reproducible. variability in culture conditions requires the
Details are included in Sect. 2.4 of this chapter. researcher to become familiar with and to master
42 X. Peng et al.

plate using drop method
(saliva samples)

plate using spiral plater
(plaque samples)
the growth characteristics of bacteria in the mouth H2, with a temperature of 36 C–37 C and
to avoid mistakes in the incubation. Usually, approximately 48–72 h culture time. Some oral
anaerobic cultures grow best in atmospheric bacteria, such as forsyth steiner bacterium, Trep-
conditions with 80% N2, 10% CO2, and 10% onema, and others, require 1 week of anaerobic
Fig. 2.26 Anaerobic

glove box
culture. Commonly used anaerobic incubation biochemical tests include tests for carbohydrate
devices include the anaerobic glove box, anaero- fermentation (Fig. 2.34), methyl red (Fig. 2.35),
bic incubator, anaerobic bag, etc. (Fig. 2.26). citric acid utilization (Fig. 2.36), and hydrogen
The initial steps of bacterial identification sulfide production (Fig. 2.37).
involve observing colonies morphologies follow- Microbial biochemistry tests shorten the time
ing incubation and performing Gram stain. After required to identify microbes, reduce costs, and
this, a second round of purification is carried out ensure or enhance the accuracy of identification
to further complete phenotypic and genotypic of an unknown sample. It is the fastest developing
identification using routine protocols for micro- trend in microbial identification. In recent years,
bial separation and identification. For certain the rapid commercial test kits for anaerobic bac-
microorganisms, special separation, cultivation, teria have become available in China and abroad.
and other identification techniques may be The most representative biochemical test kits
adopted. are the Minitek identification system using paper
substrates, API-20A system using dry powder
substrates, PIZYMAN-IDENT rapid enzyme
2.2.4 Growth Characteristics activity assay system using primary materials,
and Identification RaPID-ANA systems, and fully automated
microbial identification systems.
2.2.4.1 Growth Characteristics The aforementioned microbial biochemistry
Bacterial colony morphology can be described in reaction plate includes 30 biochemical matrices
terms of its size, color, shape, growth pattern, and and their related biochemical test indicators,
other characteristics. Hemolysis is one of the phosphate buffered saline (PBS), bacterial turbid-
basic tests used for bacterial identification. Some ity standard tube, and a few of identification series
bacteria produce hemolysis (Figs. 2.27, 2.28, (Table 2.1).
2.29, 2.30 and 2.31), some produce gas Due to the different types of experiments
(Fig. 2.32), and some exhibit specific growth performed, the readouts for results are different.
patterns, such as the migration of Proteus For example, esculin hydrolysis can be directly
(Fig. 2.33). observed: black is positive, while colorless is
negative. For sugar and alcohol fermentation
acid test, BM (bromothymol blue-methyl red,
2.2.4.2 Biochemical Tests BTB-MR) must be added to the result as a pH
Biochemical tests are among the most important indicator. Red or yellow indicate a positive
methods for microbial identification. Routine
44 X. Peng et al.
Fig. 2.27 β-Hemolytic

reaction
Fig. 2.28 α-Hemolytic

reaction
Fig. 2.29 White pigment

(Staphylococcus
epidermidis)
Fig. 2.30 Green pigment

(Pseudomonas aeruginosa)
reaction, while green or blue indicate a negative working principle behind a spiral plater is the
reaction (Figs. 2.38 and 2.39). use of a tip to dispense the liquid inoculum onto
a Petri dish in a spiral pattern. The spiral plater
deposits a known volume of sample onto a rotat-
ing agar plate so that the sample forms a spiral
2.2.5 Instruments for Microbiological
pattern with highest concentration at the center
Identification
and lowest concentration at the outside of the
spiral. Colony counting can be performed manu-
2.2.5.1 Spiral Plater
ally counting or by using automatic colony
A spiral plater (Fig. 2.40) is used to inoculate
counters.
plates to determine viable bacteria count. The
46 X. Peng et al.
Fig. 2.31 Black pigment

(Porphyromonas
gingivalis)
With a high degree of automation, simplicity 2.2.5.3 Microbial Identification System

of operation, and high reproducibility, spiral Microbial cells produce different enzymes during
platers can significantly improve the efficiency their metabolism of different carbon sources. The
and accuracy of bacteria counting while saving MicroStation automated microbial identification
manpower, time, and culture space (Fig. 2.41). system is based on the differences in color and in
turbidity that occur when these enzymes react
with four azole substances (e.g., TTC, TV, etc.).
2.2.5.2 Microbiology Analyzer
With the use of a unique technology that detects
The automated microbiology analyzer provides
the characteristic fingerprint of each microorgan-
results by capturing images with a high-definition
ism and based on a large number of experiments
digital camera and analyzing them using its built-
and mathematical models, the corresponding
in software. Microbiology analyzers can be used
database between the fingerprints and microbial
for automatic colony counting, inhibition zone
species has been established. Identification results
measurement to test antibiotic sensitivity test,
can be derived through comparisons between the
and measurement of the hemolytic zone
unidentified microbial species and the reference
(Fig. 2.42).
database by software (Fig. 2.43).
Microbiology analyzers are simple to operate,
The MicroStation automated microbial identi-
fast, and accurate and provide highly reproducible
fication system is used for microbial identification
results. The instruments have a special lighting
in clinical settings, food, dairy, pharmaceutical,
system suitable for various types of agar and
and cosmetics industries and environmental
plates. Other features include powerful analysis
microbial identification (in rivers, oceans, plants,
software and vivid full-color images which can be
animals, and insects). It can also be used to ana-
saved digitally or printed out, with results labeled
lyze microbial communities and aid in ecological
beside the images and automatically recorded.
research in the analysis of carbon utilization and
lenses. Two beams are separated by intermediate

objectives at an angle of about 12–15 which is
called the stereo angle and then are imaged by
their corresponding optical lens. The beams are
not parallel but at an angle, providing a three-
dimensional image to both eyes by two separate
optical paths. The magnification changes when
the distance between intermediate objectives is
changed.
The digital imaging system connected to the
computer to analyze and process images is com-
posed of the stereomicroscope, a variety of digital
ports, digital cameras, electronic optical lenses,
and the image analysis software.
Before using the stereomicroscope, the instru-
ment should be adjusted for focus, diopter, and
interpupil distance for each user in order to
acquire the best image.
The stereomicroscope is used to observe
microbial colony morphology (Figs. 2.45, 2.46,
2.47, 2.48 and 2.49) and microbial distribution
(Figs. 2.50, 2.51, 2.52 and 2.53).
2.3.2 Scanning Electron Microscopy
The scanning electron microscope (SEM,

Fig. 2.54) is mainly used to observe the topogra-
Fig. 2.32 Production of gas (E. coli)
phy of the cells in the samples over a large range
of magnification. Sample preparation for SEM is
metabolism. There are four types of microplates simple. It is adaptable to various samples and
specifically designed for the analysis of microbial does not require producing ultrathin slices. SEM
communities and ecosystems research. is already a routine method in medical research
and is especially crucial for studies on the
morphologies and interactions of oral bacteria.
2.3 Microscopy Techniques SEM can be used to analyze and interpret
observations on a micron or nanometer scale.
2.3.1 Stereomicroscopy The resolution of a field emission scanning elec-
tron microscope can reach as little as 1 nm.
The stereomicroscope (Fig. 2.44) is an optical Another important feature of the scanning elec-
microscope that produces a three-dimensional tron microscope is that it can be used to observe
visualization of the sample being examined. The and analyze samples three-dimensionally due to
instrument is also known as a stereoscopic micro- its deep depth of field. The greater the depth of
scope or dissecting microscope. field, the more sample information is provided. In
The optical structure of the stereomicroscope microbial identification, SEM is utilized to
includes one shared primary objective and two observe and detect surface morphology and struc-
sets of intermediate objective lenses or zoom tural characteristics of microbial cells.
48 X. Peng et al.
Fig. 2.33 Migrating

growth (Proteus)
Fig. 2.34 Carbohydrate

fermentation test
Fig. 2.35 Methyl red test
Fig. 2.36 Citric acid

utilization test
50 X. Peng et al.
Fig. 2.37 Hydrogen

sulfide production test
Table 2.1 Microbial biochemistry test identification series

Main classification series Sub-classification series
Gram-positive anaerobic cocci I. Staphylococci and micrococci
II. Streptococcus
Gram-negative anaerobic cocci
Gram-positive anaerobic non-spore bacillus
Gram-negative anaerobic non-spore bacillus I. Does not produce black pigment
II. Produces black pigment
Gram-negative anaerobic Clostridium or Enterobacter
Gram-negative facultative anaerobic bacillus
Gram-negative Campylobacter
2.3.2.1 Mechanism sample surface, the signals will change according

The scanning electron microscope is used to scan to the surface topography. The limited emission
sample areas or micro-volumes with a fine of secondary electrons within the volume close to
focused beam of electrons, producing various the electron focusing area results in high image
signals including secondary electrons, back- resolution. The three-dimensional appearance of
scattered electrons, Auger electrons, characteris- images come from the deep depth of field and
tic X-rays, and photons carrying different levels shadow effect of secondary electron contrast.
of energy. When the electron beam scans the

anaerobic cocci series II
(Streptococcus series)
(Streptococcus mutans)

anaerobic non-spore
bacillus series II (black
pigment produced)
(Porphyromonas
gingivalis)
2.3.2.2 Operating Procedure 2. Sample washing and fixation: Wash sample

1. Bacterial sample preparation: Culture bacteria twice with phosphate buffer or saline, fix sam-
at 37 C for 48 h; identify cells as pure culture ple for 2 h (at 4 C) with 2.5% or 3% glutaral-
by morphological and biochemical tests; make dehyde, and then wash twice with phosphate
bacterial suspension with 0.2 mol/L phosphate buffer or saline.
buffer (pH 7.2).
52 X. Peng et al.
Fig. 2.40 WASP spiral

plater
Fig. 2.41 The colonies on

a plate prepared by spiral
plater
After inoculation on a 9 cm
plate, the sample will be
1000-fold diluted on the
outside track and the
colonies will be evenly
distributed
3. Gradual dehydration: Dehydrate samples with 20 min, 90% ethanol for 20 min, and finally
ethanol using a concentration gradient: 30% 100% ethanol for 20 min twice.
ethanol for 20 min, 50% ethanol for 20 min, 4. Liquid exchange: Place dehydrated samples
70% ethanol for 20 min, 80% ethanol for into 100% amyl acetate solution for 20 min
for exchange.
Fig. 2.42 Synbiosis

automated microbiology
analyzer
Fig. 2.43 MicroStation

automated microbial
identification system
5. Critical point drying: Place samples into a CO2 characteristics of oral microbial cells, as shown
critical point dryer for CO2 critical point in the following examples (Figs. 2.55, 2.56, 2.57,
drying. 2.58, 2.59, 2.60, 2.61, 2.62 and 2.63).
6. Metal coating: Coat the dried samples with ion
sputter coater.
2.3.3 Transmission Electron
2.3.2.3 Sample Observation Microscopy
Observe processed samples using the scanning
electron microscope. The authors used the Inspect Transmission electron microscope (TEM,
F field emission scanning electron microscope to Fig. 2.64) is mainly used to observe the cell’s
observe surface morphologies and structural internal structures using ultrathin sections.
54 X. Peng et al.
Fig. 2.44 Stereomicroscope
Fig. 2.45 Isolated bacteria from dental plaque sample A: Actinomyces israelii colonies; B: Fusobacterium nucleatum
colonies (BHI blood agar, anaerobic culture for 48 h, stereomicroscopy)
Fig. 2.46 Characteristic

colonies of saliva bacteria
A: Prevotella oris (pink
colonies); B: Actinomyces
odontolyticus (red colonies)
(BHI blood agar, anaerobic
culture for
48, stereomicroscopy)
Fig. 2.47 Diffusively

growing colonies of
Capnocytophaga sputigena
(BHI blood agar,
stereomicroscope)
2.3.3.1 Preparation of Bacterial are harvested by centrifugation at 3000 r/min for

Samples 20 min and the supernatant is removed. The pellet
Oral bacteria culture is centrifuged at 3000 r/min is rinsed with 2.5% glutaraldehyde (prepared with
for 20 min, and the supernatant is removed. The sodium cacodylate buffer) and sodium cacodylate
pellet is washed three times with saline and a buffer and fixed with 1% osmic acid. The sample
small amount of serum is added. The bacteria was sealed with a series of 50%, 70%, 90%, and
56 X. Peng et al.

colonies of Streptococcus
gordonii (BHI blood agar,
stereomicroscope)
Fig. 2.49 Candida

albicans colonies (BHI
blood agar,
stereomicroscope)
100% ethanol dehydration and embedded with ultrathin slice technology and includes the
epoxy resin to make ultrathin slices. collecting samples, fixing, rinsing, dehydrating,
penetrating, embedding, sectioning, and dyeing.
Compared with optical microscopy, the process
2.3.3.2 Section
of sample preparation for TEM is more sophisti-
Ultrathin sections are defined as sections with a
cated and stringent.
thickness between 10 nm and 100 nm. The tech-
nology with which these slices are made is called
Fig. 2.50 Bacterial

colonies from saliva sample
(BHI blood agar,
stereomicroscope)
Fig. 2.51 Bacterial

colonies from gingival
margin sample (BHI blood
agar, stereomicroscope)
2.3.3.3 Uranium Staining 2.3.4 Confocal Laser Scanning

and Observation Microscopy
Professional workers use a TEM to observe the
inner structure of cells via ultrathin sections Confocal laser scanning microscopy (CLSM) was
(Fig. 2.65). developed in the late 1980s [1]. With the
58 X. Peng et al.
Fig. 2.52 Bacterial

colonies from non-adhesive
subgingival plaque (BHI
blood agar,
stereomicroscope)
Fig. 2.53 Bacterial

colonies from periodontal
pocket sample (BHI blood
unparalleled advantages of high resolution, ease and 3D reconstruction, and spatial positioning of
of sample preparation, dynamic recording with- the target, CLSM has become widely used in
out damaging the living cell, acquisition of three- almost all areas of cell research in medicine and
dimensional sample images through tomography biology (Fig. 2.66).
Fig. 2.54 Scanning

electron microscope
Fig. 2.55 Proliferating

cells of β-hemolytic
streptococcus (SEM)
60 X. Peng et al.
Fig. 2.56 Division phase

of α-hemolytic
streptococcus cells (SEM)

cells of Streptococcus
gordonii (SEM)

state of Lactobacillus
fermentum cell (SEM)
Fig. 2.59 Self-aggregating

cells of Rothia
dentocariosa (SEM)
62 X. Peng et al.
Fig. 2.60 Cell aggregation

of Capnocytophaga
sputigena (SEM)
Fig. 2.61 Massive

extracellular matrix of
Porphyromonas gingivalis
(SEM)
Fig. 2.62 Budding cells of

Candida albicans (SEM)
Fig. 2.63 Spirochetes in

gingival margin plaque
(SEM)
64 X. Peng et al.
Fig. 2.64 Transmission

electron microscope
2.3.4.1 Principles of CLSM different focal planes within the sample and opti-
A confocal laser scanning microscope is made up cal cross sectional images (also known as optical
of the optical system, the laser light source, the sectioning) can be analyzed one by one. Using
detection system, and the scanning device. computer image processing and three-
The optics behind this type of imaging is a dimensional image reconstruction software, a
laser emitted from the light source that becomes high-resolution three-dimensional image can be
a parallel beam of expanded diameter when it obtained from the sample. Cell structure, cell
passes through the pinhole aperture, encounters content, and dynamic changes can be analyzed
the dichromatic mirror, and is reflected onto the by continuous scanning on the same plane. The
objective lens. The light beam is reflected 90 optical path of a confocal laser scanning micro-
when it hits the dichromatic mirror and is focused scope is shown in Fig. 2.67.
onto the desired focal plane on the sample when it
passes through the objective lens. The
2.3.4.2 Application in Dental Plaque
fluorescence-emitting sample fluoresces in all
Research
directions under excitation from the laser. Part
Through a special fluorescent staining, dental
of the fluorescence becomes focused at the focal
plaque in its natural hydration status can be stud-
point of the objective once it passes through the
ied directly. Through this process, dead and via-
objective lens, dichromatic mirror, and focusing
ble bacteria in dental plaque can be observed in
lens. The fluorescent light passes through a pin-
situ, and the relationship between bacteria during
hole at the focal point and can then be picked up
the formation of dental plaque can be observed as
by the detector. When a laser scans the sample
well. Images of a single cell, a group of cells, or
point by point, the photomultiplier tube behind
different levels within tissues can be obtained by
the pinhole receives the corresponding point-by-
scanning biofilm of a given thickness continu-
point confocal optical image. Accordingly,
ously using CLSM. A complete 3D structure of
Fig. 2.65 Adenovirus Ad-

hTR-si in HEK293 cell
(TEM)
plaque can be generated by 3D image reconstruc- detect changes under the natural state or after
tion (Fig. 2.68). stimulation by certain factors. Quantitative and
Compared with SEM, CLSM requires less qualitative measurements can be made regarding
sample preparation steps before the composition the perimeter or area or a sample, average fluo-
and structure of dental plaque can be studied. rescence intensity of cells, in situ determination of
During sample preparation in SEM, structural cellular contents, composition and distribution of
damage to the sample can accumulate during lysosomes, mitochondria, endoplasmic reticulum,
steps such as dehydration, fixing, embedding, cytoskeleton, structural proteins, DNA, RNA,
and dyeing. enzymes, cellular receptors, etc. Physiological
Moreover, CLSM can be used to observe signals can be dynamically monitored, including
structures, specific molecules, and biological quantitative analysis of various ions (mainly cal-
ionic changes in living cells. The technique can cium ions) with millisecond time resolutions
also be used to track structural changes and phys- using fluorescent probes.
iological processes within living cells over time to
66 X. Peng et al.
Fig. 2.66 Confocal laser scanning microscopy
a single cell. The rate of growth, defined as the

2.4 Oral Microecology Techniques
change in cell number over time, is closely related
to the growth cycle, which can be divided into
2.4.1 Methods for Measuring
four phases: lag phase, logarithmic
Microbial Growth Curves
(or exponential) phase, stationary phase, and
decline phase, according to the characteristics of
In microbiology, growth generally refers to the
the growth curve. The rate of growth differs dur-
increase in cell number, rather than the volume of
ing these distinct phases. We commonly use the
growth curve to portray dynamic changes in bac-
terial cell number during the growth cycle
(Fig. 2.69).
Lag phase: Bacterial reproduction is slow.
Logarithmic phase: Bacterial reproduction is
fast, and the number of viable cells exponentially
increases.
Stationary phase: The rate of growth
decreases gradually, while the number of dead
cells increases.
Decline phase: The growth gradually slows
down until it stops completely, the dead cells
outnumber viable ones, and the cells show abnor-
mal phenotypes and autolysis.
2.4.1.1 Protocol
Fig. 2.67 The optical path of a confocal light scanning Inoculate cells into fresh medium and cultivate
microscope under desired growth conditions. The number of
Fig. 2.68 Biofilm of Streptococcus mutans (CLSM)
Fig. 2.69 Typical example of a growth curve
bacterial cells will constantly change during the 1. Turbidimetry: After inoculation, measure the
growth cycle. Graph the growth curve using the optical density (OD) of the cell culture during
number of bacterial cells as the Y-axis and the cultivation. Graph the growth curve using the
time of growth as the X-axis. OD value as the Y-axis and the cultivation
time as the X-axis.
2.4.1.2 Methods 2. Viable count method: In microbial ecology
Turbidimetry and viable count methods are com- research, the number of viable cells reflects
monly used to determine the growth curve. dynamic changes in bacterial growth.
68 X. Peng et al.
Fig. 2.70 Protocol of the pouring method
Generally, the cells are plated and colonies are appropriate concentration. The diluted cells
counted (more details in “methods for measur- should then be quantitatively inoculated onto a
ing colony forming units”) to measure the suitable agar plate, placed in a 37 C incubator
number of viable cells, which are the only after the correct atmospheric conditions and cul-
cells in the culture that can undergo cell divi- ture time are determined according to the species.
sion and reproduce. After inoculation and a After incubation, every viable cell in the sample
certain period of cultivation, inoculate a cer- will form a visible colony. Count the number of
tain volume of the cell culture onto the agar colonies, and calculate the number of viable cell
plate. Graph the growth curve using the loga- in the sample based on the degree of dilution.
rithm of the number of colonies number as the
Y-axis and the growth time as the X-axis.
2.4.2.2 Methods
Plating methods for colony-counting can be
divided into the spread method, drop method,
2.4.2 Methods for Measuring Colony pour method, and the spiral plater method, based
Forming Units on the approach taken to inoculate a liquid culture
of bacteria onto the plate. They share the same
Quantification of spatiotemporal changes in the basic protocols for sample collection, transporta-
number of organisms in an ecosystem, especially tion, dilution, inoculation, incubation, and colony
the percentage of viable cells, is an important part counting, but are different when it comes to the
of microecological studies. Plate colony-counting specifics of sample dilution and inoculation. For
methods have been adopted for widespread use more details on the spread method, drop method,
internationally to measure the percentage of via- and spiral plater method, see Sect. 2.2.3.2. These
ble cells in a sample, rather than more traditional are the most commonly used plate-based colony-
absolute viable count methods. Most commonly counting methods. In addition, several published
used methods for plating samples include spread reports have shown that the pour method may be a
method, drop method, and spiral plating. In addi- viable option as well (Fig. 2.70). Figures 2.71,
tion, there are several reports of the pouring 2.72, 2.73, and 2.74 show the appearance of
method being a viable way to measure colony- colonies formed by the spread method and drop
forming units. method.
The spiral plater uses a spiral plater instrument
2.4.2.1 Protocol to automatically perform sample dilution and
After collecting samples from the desired inoculation. After incubation the colonies grow
locations and at the appropriate time points, the along the spiral trajectory, and colony counting
sample is transported to the laboratory under suit- can be performed manually or using an automatic
able conditions, suspended, and diluted to an

plate prepared with the
spread method (gingival
marginal plaque sample)

plate prepared with the drop
method (plaque sample)
colony counter. For more details, see Sect. mixture into a sterile plate (90 mm in diame-
2.2.3.2. ter), making sure that the mixture is evenly
distributed. After incubation, count the
1. Pouring method: Mix the bacterial diluent and
the 50 C soft agar in a sterile bottle. Pour the
70 X. Peng et al.

method (saliva sample)

method (subgingival plaque
sample)
Fig. 2.75 Protocol for measuring adhesion strength liquid scintillation detector, and express the adhesion
Place medium into a known quantity of culture, and add a capacity in scintillation counts per minute (CPM). The
known quantity of bacterial suspension. After incubation adhesion rate (%) ¼ (experimental group CPM negative
under appropriate conditions, wash the adhesion medium control CPM/positive control CPM negative control
3–4 times with KCl buffer to remove non-adhered surface CPM) 3 100%
bacteria. Measure adhesion capacity using an isotope
colonies on the surface and within the agar strength can be improved, and the quality of the
medium. results can be improved.
2. Drop method: Drop a certain volume of the
appropriately diluted sample (105 CFU/ml, 104 2.4.3.2 Measuring the Rate of Adhesion
CFU/ml, 103 CFU/ml) onto the surface of agar Inhibition
plates (three replicates for each concentration). Measuring the rate of adhesion inhibition allows
Count the colonies after incubation. the researcher to quantify the inhibition of bacte-
rial adhesion by drugs or other reagents. The
method is identical to that used to measure adhe-
2.4.3 Measurement of Adhesion sion described in the previous section. However,
Strength and Rate of Adhesion inhibitors of adhesion must be added to the exper-
Inhibition imental group (Fig. 2.76).
Microbial adhesion is the basis of colonization

and pathogenesis. Measurement of adhesion 2.4.4 Techniques for the Detection
strength and the rate of adhesion inhibition con- of Plaque Biofilm
tribute to the understanding of mechanisms of
bacterial pathogenesis and control. In nature, many bacteria are attached to the sur-
face of living and inanimate objects, where they
2.4.3.1 Measurement of Adhesion survive and grow in the form of biofilm. Biofilms
Strength are groups of bacteria attached to a surface and
Medium Adhesion Choose slide, glass rod, enclosed in a secreted adhesive matrix and are
hydroxylapatite, or teeth as medium for adhesion. functional, interacting, and growing bacterial
communities. Dental plaque is a typical kind of
Method Collect adhesive substance on the sur- biofilm formed on the tooth surface by oral
face of the medium surface to evaluate adhesion microbes. Microbes inside the biofilm survive as
by measuring the quantity of bacteria (Fig. 2.75). a group with interdependence and mutual compe-
By adding artificial saliva or collagen solution tition. They also form a complex ecological rela-
into the culture, or by coating the medium for tionship. Technologies used to detect biofilm are
adhesion with saliva or collagen, adhesion used to analyze the natural state of bacteria, the
relationship between different bacterial species
72 X. Peng et al.
Fig. 2.76 Protocol for measuring the rate of adhesion control CPM] 3 100%. When the CPM of the experimen-
inhibition tal group is less than that of the negative control group, the
Adhesion inhibition rate ¼ [1 Experimental CPM neg- rate of adhesion inhibition is defined to be 100%
ative control CPM/positive control CPM negative
and the host, pathogenic mechanisms, effects of polysaccharides. Biofilm structure can be
antibacterial reagents, etc. observed clearly with this technology (Fig. 2.81).
2.4.4.1 Biofilm Formation Assay

The biofilm formation assay is the basis of a series 2.5 Oral Microbiome Techniques
of biofilm detection technologies and can be used
to detect single species biofilm or mixed species The oral microbiome refers specifically to
biofilm formation as well as their structural microorganisms (e.g., bacteria, archaea, fungi,
characteristics, conditions for formation, and mycoplasma, protozoa, and viruses) that inhabit
factors that influence their formation. The assay the human oral cavity. Among them, oral bacteria
lays the foundation for further studies on make up the largest proportion of the oral
relationships between bacterial species, microbiome and are also the most complex in
mechanisms of pathogenesis, and preventative organization. So far, more than 250 oral bacteria
measures. The early steps of the assay involve species have been isolated, cultivated, and
steps that are identical to those in adhesion named. Over 450 species have been identified
strength measurements, particularly when it by culture-independent approaches. These bacte-
comes to bacterial culture. However, the structure ria can be classified into different categories
and other features of biofilms are evaluated using based on their Gram stain results (Gram-positive
scanning electron microscopy (SEM) and confo- or Gram-negative bacteria), their shape (coccus,
cal laser scanning microscope. bacillus, or spirochetes), and their tolerance to
Currently there is a commercially available oxygen (aerobic, facultative anaerobes, micro-
micro-well plate for biofilm detection named the aerobic, or obligate anaerobes).
96 MBECTM-Device (MBEC Biofilm Technol-
ogy Ltd., Calgary, Alberta, Canada, U.S Patent),
shown in Fig. 2.77. 2.5.1 Denaturing Gradient Gel
Electrophoresis
2.4.4.2 Biofilm Detection and Analysis and Temperature Gradient Gel
By scanning electron microscopy (SEM) and Electrophoresis
laser confocal microscopy, characteristic biofilm
morphology, structure, and extracellular Denaturing gradient gel electrophoresis (DGGE)
polymers can be detected. Using SEM, biofilm [2, 8] and temperature gradient gel electrophore-
growth can be observed at different times and sis (TGGE) [3] are forms of gel electrophoresis
under different conditions (Figs. 2.78, 2.79 and that use either a chemical gradient or a tempera-
2.80). ture gradient to separate samples as they move
The combined use of fluorescence staining and across an acrylamide gel. DGGE was introduced
laser confocal microscopy is a common method to microbial ecology by Muyzer et al. [4]. Within
to study biofilm structure and extracellular a short period of time, this method has become
Fig. 2.77 Biofilm

detection micro-well plate
(MBECTM-Device)
The MBECTM-Device has
96 removable pegs
(adhesion medium) in on its
plate cover that sit in the
96 micro-wells in the
corresponding base.
Biofilm formation on the
96 pegs can be detected at
the same time, but every
peg can also be removed
when the biofilm on that
peg must be analyzed
independently
widely used in the analysis of microbial diversity variations within these melting domains cause
in various complex samples including samples the melting temperatures to vary, and molecules
from the oral cavity. In both DGGE and TGGE, with different sequences will stop migrating at
DNA fragments of the same length but with dif- different positions in the denaturing or tempera-
ferent sequences can be separated. Separation is ture gradient gel, therefore becoming separated.
based on the reduced electrophoretic mobility of DNA bands in DGGE and TGGE profiles can be
partially melted double-stranded DNA molecules visualized using ethidium bromide, SYBR
in polyacrylamide gels that contain either a linear Green I, or silver stain (Fig. 2.82).
gradient of DNA denaturants (a mixture of form-
amide and urea) in the case of DGGE or a linear
temperature gradient in the case of TGGE. Melt-
2.5.2 Sanger Sequencing
ing domains, i.e., stretches of base-pairs with
identical melting temperatures (Tm), lead to the
Sanger sequencing, also known as the chain ter-
melting of DNA fragments within discrete
mination method, is a technique for DNA
domains. Once a domain with the lowest Tm
sequencing based upon the selective
reaches its Tm at a particular position in the
incorporation of chain-terminating
denaturing or temperature gradient gel, and that
dideoxynucleotides (ddNTPs) by DNA polymer
segment of the DNA double helix transitions to
ase during in vitro DNA replication. It was devel-
melted single-stranded DNA, migration of the
oped by Frederick Sanger and Coulson [5]. It was
DNA molecule will virtually stop. Sequence
the most widely used sequencing method for
74 X. Peng et al.
Fig. 2.78 Thirty-six-hour

biofilm in dentin of
Actinomyces viscosus
(SEM)
approximately 25 years before it was replaced by light or autoradiography, and the DNA sequence
next-generation sequencing methods. can be directly read off the gel image or the X-ray
Classical Sanger sequencing requires a single- film (Fig. 2.83). The ddNTPs may also be radio-
stranded DNA template, a DNA polymerase, a actively or fluorescently labeled for detection in
DNA primer, normal deoxynucleosidetri- automated sequencing machines. The four
phosphates (dNTPs), and modified nucleotides reactions can be incorporated into one reaction
(ddNTPs) that terminate DNA strand elongation. run, and the DNA sequence can be read from
These ddNTPs lack a 30 -OH group that is required radioactive or fluorescent labels.
for the formation of a phosphodiester bond
between two nucleotides, causing the extension
of the DNA strand to stop when a ddNTP is
2.5.3 Next-Generation Sequencing
added. The DNA sample is divided into four
separate sequencing reactions, containing all
Sanger sequencing enabled scientists to elucidate
four of the standard dNTPs (dATP, dGTP,
genetic information from a variety of biological
dCTP, and dTTP), the DNA polymerase, and
systems. However, wide use of this technology
only one of the four ddNTPs (ddATP, ddGTP,
has been hampered due to inherent limitations of
ddCTP, or ddTTP) for each reaction. After rounds
throughput, scalability, speed, and resolution.
of template DNA extension, the DNA fragments
Next-generation sequencing (NGS) [9], also
that are formed are denatured and separated by
known as massively parallel sequencing or deep
size using gel electrophoresis with each of the
sequencing, have been developed to overcome
four reactions in one of four separated lanes.
these barriers.
The DNA bands can then be visualized by UV
Fig. 2.79 Forty-eight hour

biofilm in dentin of
Actinobacillus
actinomycetemcomitans
(SEM)
Fig. 2.80 Biofilm from

infected root canal (SEM)
76 X. Peng et al.
Fig. 2.81 Biofilm

structure of Streptococcus
mutans
Under a laser confocal
microscope (green laser,
504–511 nm), biofilms
appear as a multilayer
superimposed image due to
yellow fluorescent staining
of bacterial colonies and the
plaque biofilm structure.
The three-dimensional
structure of biofilm is
mushroom-like, full of
channels and pores. Against
the dark background,
microbial colonies appear
as green fluorescence, while
dead bacteria show up as
red fluorescence.
Fig. 2.82 Negative image

of an ethidium bromide
stained DGGE gel loaded
with 16S rRNA gene
fragments
In principle, NGS technology is based on 2.5.3.1 Pyrosequencing

sequentially identifying bases in a small fragment Pyrosequencing is a method of DNA sequencing
of DNA using emitted signals, while each frag- based on the “sequencing by synthesis” principle
ment is re-synthesized from a DNA template [6]. It relies on the detection of pyrophosphate
strand. NGS proceeds in a massively parallel release along with nucleotide incorporation.
fashion, which enables rapid sequencing of large Sequences in each sample are tagged with a
stretches of DNA spanning entire genomes. unique barcode either by ligation or by using a
Fig. 2.83 Sanger sequencing
barcoded primer when amplifying each sample by and a single bead. The sequence of the single-
PCR. The method amplifies DNA inside water stranded DNA sequence can be determined by the
droplets in an oil solution (emulsion PCR), and light emitted upon incorporation of the comple-
each droplet contains a single DNA template mentary nucleotide because only one of four of
attached to a single primer-coated bead. The the possible A/T/C/G nucleotides can comple-
sequencing machine contains many picoliter-vol- ment the DNA template. The technique uses lucif
ume wells each containing sequencing enzymes erase to generate light for detection of the
78 X. Peng et al.
Fig. 2.84 Pyrosequencing
individual nucleotides, and the combined data are Sanger sequencing. This can make the process
used to generate the template sequence. of genome assembly more difficult, particularly
Pyrosequencing was commonly used for for sequences containing a large amount of repeti
genome sequencing or resequencing during the tive DNA (Fig. 2.84).
last decade. It was widely used in the analysis of
the oral microbiome. However, a limitation of the 2.5.3.2 Illumina Sequencing
method is that the length of individual DNA reads Illumina sequencing is based on the incorporation
is approximately 300–500 nucleotides, shorter of reversible dye-terminators that enable the iden-
than the 800–1000 that can be obtained using tification of single bases as they are incorporated
Fig. 2.85 Illumina sequencing
into DNA strands [7, 10]. The basic procedure is multiple strands at once and obtain actual
as follows. DNA molecules are first attached to sequencing data quickly. In addition, this method
primers on a slide and amplified so that local only utilizes DNA polymerase in contrast with
clusters are formed. The four types (A/T/C/G) of multiple, expensive enzymes required by
reversible terminating nucleotides are added, and pyrosequencing (Fig. 2.85).
each nucleotide is fluorescently labeled with a
different color and attached to a blocking group.
The four nucleotides then compete for binding
References
sites on the template DNA to be sequenced, and
non-incorporated molecules are washed away. 1. Pawley JB. Handbook of biological confocal micros-
After each synthesis, a laser is applied to remove copy. 3rd ed. Berlin: Springer; 2006.
the blocking group and the probe. A detectable 2. Fischer SG, Lerman LS. DNA fragments differing by
fluorescent color specific to one of the four bases single base-pair substitutions are separated in
denaturing gradient gels: correspondence with melting
then becomes visible, allowing for sequence iden- theory. Proc Natl Acad Sci USA. 1983;80(6):1579–83.
tification and initiating the beginning of the next 3. Thatcher DR, Hodson B. Denaturation of proteins and
cycle. The process is repeated until the entire nucleic acids by thermal-gradient electrophoresis.
DNA molecule is sequenced. Biochem J. 1981;197(1):105–9.
4. Muyzer G, de Waal EC, Uitterlinden AG. Profiling of
This technique offers some advantages over complex microbial populations by denaturing gradient
traditional sequencing methods such as Sanger gel electrophoresis analysis of polymerase chain reac-
sequencing. The automated nature of Illumina tion- amplified genes coding for 16S rRNA. Appl
sequencing makes it possible to sequence Environ Microbiol. 1993;59(3):695–700.
80 X. Peng et al.
5. Sanger E, Coulson AR. A rapid method for determin- 8. Strathdee F, Free A. Denaturing gradient gel electropho-
ing sequences in DNA by Primed synthesis with DNA resis (DGGE). Methods Mol Biol. 2013;1054:145–57.
polymerase. Mol Biol. 1975;94(3):441–8. 9. Mardis ER. Next-generation sequencing platforms. Annu
6. Ronaghi M, Uhlen M, Nyren P. A sequencing method Rev Anal Chem (Palo Alto, Calif). 2013;6:287–303.
based on real-time pyrophosphate. Science. 1998;281 10. Meyer M, Kircher M. Illumina sequencing library
(5375):363–5. preparation for highly multiplexed target capture and
7. http://www.illumina.com/technology/next-generation- sequencing. Cold Spring Harb Protoc. 2010;2010(6):
sequencing/solexa-technology.html pdb.prot5448.
Supragingival Microbes
3
Xuedong Zhou, Yuqing Li, Xian Peng, Biao Ren, Jiyao Li,
Xin Xu, Jinzhi He, and Lei Cheng
Abstract Bifidobacterium, Lactobacillus, Rothia, Staph-

This chapter mainly introduces the common ylococcus, and Streptococcus, and Gram-
microbes in supragingival plaque. negative bacteria, including Leptotrichia and
Supragingival plaque refers to the plaque Veillonella, were introduced in this chapter.
above the gingival margin of the tooth neck, Gram staining, plate culture, colony, and scan-
including groove plaque, smooth surface ning electron microscope (SEM) images of
plaque, adjacent surface plaque, and cervical each microorganism were also provided.
margin plaque. The main bacteria of
supragingival plaque are Gram-positive cocci Keywords
and bacilli. With the maturity of dental plaque Actinomyces · Bifidobacterium ·
biofilm, the number of Gram-negative cocci, Lactobacillus · Rothia · Streptococcus ·
bacilli, and filamentous bacteria increased. The Veillonella
biological and pathogenic characteristics of
Gram-positive bacteria, including Actinomyces,
3.1 Gram-Positive Bacteria
X. Zhou (*) · L. Cheng
State Key Laboratory of Oral Diseases, National Clinical 3.1.1 Actinomyces
Stomatology, Sichuan University, Chengdu, China Actinomyces are irregular Gram-positive bacilli
Department of Cariology and Endodontics, West China and are also commonly found anaerobic bacteria
Hospital of Stomatology, Sichuan University, Chengdu, in oral samples. When they were first discovered,
China actinomycetes were believed to be fungi or were
e-mail: zhouxd@scu.edu.cn
grouped as “other microorganism.” Recently,
Y. Li · X. Peng · B. Ren · J. Li · J. He numerous studies have shown that actinomycetes
State Key Laboratory of Oral Diseases, National Clinical
Research Center for Oral Diseases, West China Hospital of have general characteristics common to bacteria
Stomatology, Sichuan University, Chengdu, China and were classified as prokaryotic organisms. In
X. Xu the 1984 edition of the book Bergey’s Manual of
State Key Laboratory of Oral Diseases, West China Determinative Bacteriology, Actinomyces were
Hospital of Stomatology, Sichuan University, Chengdu, included in the group of Gram-positive irregular
China bacilli. Common members of the Actinomyces
Department of Operative Dentistry and Endodontics, West genus in oral microbiology are A. israelii,
China Hospital of Stomatology, Sichuan University, A. naeslundii, A. odontolyticus, and A. viscosus.
Chengdu, China

https://doi.org/10.1007/978-981-15-7899-1_3
82 X. Zhou et al.
They are characterized by a relatively high GC all under ordinary atmospheric environment. Bac-
content (GC content is the percentage of nitroge- terial growth can be inhibited by 4%–6% NaCl,
nous bases on a DNA molecule that are either 20% bile, or 0.005% crystal violet. Characteristic
guanine or cytosine) in their DNA, ranging from colonies are shown in Figs. 3.4, 3.5, and 3.6. The
57 to 69% (Tm method). The type species of this DNA G + C content ranges from 57% to 65% when
genus is A. bovis. analyzed using the Tm method. The type strain is
The shape and size of bacterial cells can vary ATCC12102 (WVU46, CDCX523, W855).
greatly, but are often found to be irregular The main habitat of this species is the oral
branched bacilli with a diameter of 0.2–1.0 μm cavity. A. israelii often colonizes the tonsils and
and a length of about 5.0–10.0 μm. The cells are plaque, but can also be detected in the human gut
usually rod-shaped, but can occasionally be club- and the female reproductive tract. This bacterium
shaped with irregular arrangements including sin- is mainly a pathogen of the face and neck and
gle, paired, chain, clusters, and fence-shaped. The causes lung and abdominal actinomycosis. It can
cells produce no spores, show no motility, and also also infect the lachrymal sac and conjunctiva. It is
do not produce conidia. The main distinguishing detected in oral mixed infections such as gingivi-
characteristic of Actinomyces cells is that the cell tis, periodontitis, and pericoronitis, but the link
wall does not contain DAP and glycine. between A. israelii and the infections is unclear.
There are differences at the species level A. israelii always display branching rods and
regarding oxygen sensitivity, but a primary cul- short filamentous with no spores; Gram stain is
ture of Actinomyces requires an anaerobic envi- negative.
ronment. Spider-like micro-colonies or branched Young colonies of A. israelii are typical fila-
mycelia can form on agar plates after 18–24 h of mentous micro-colonies. Mature colonies are char-
incubation. These typical spider web-shaped acteristically less than 2 mm in diameter, raised,
colonies can help identify the genus of bacteria. white, opaque, and molar-shaped. The species
All strains of actinomycetes can ferment glu- shows no β-hemolytic reaction on blood agar.
cose and fructose to produce acid, without pro-
ducing gas. Other tests, including fermentation of 3.1.1.2 Actinomyces naeslundii
raffinose, xylose, cellobiose, laetrile, ribose, and A. naeslundii is a Gram-positive irregular bacillus
salicin; catalase production; reduction test using (Figs. 3.7 and 3.8). Under aerobic conditions with-
nitrate and nitrite; urea hydrolysis; or gelatin out CO2, the culture may not grow. However,
hydrolysis, can help identify different species. cultures can be grown in an anaerobic environment
Actinomycetes are normal members of the oral without CO2. Some strains can be grown at 45 C.
flora and are the dominant bacteria in dental plaque Growth can be inhibited by 6% NaCl. Characteris-
[1]. A. israelii, A. naeslundii, A. odontolyticus, and tic colonies are shown in Figs. 3.9 and 3.10, and
A. viscosus can be detected in human dental plaque, broth culture is shown in Fig. 3.11. The DNA
dental calculus, and saliva. The main colonization G + C content is approximately 63%–69% using
site of A. mai is in the gingival sulcus. Clinical and the Tm method. The type strain is ATCC12104
epidemiological investigations indicate that (NCTC10301, WVU45, CDCX454).
A. israelii can cause actinomycosis, conjunctivitis, A. naeslundii is a member of the normal
and lachrymal and other diseases of the face, neck, human oral flora and can be found on the tonsils
lung, and abdomen. A. naeslundii and A. mai can be and in dental plaque. It can take part in mixed
detected in clinical samples of gingivitis, periodonti- bacteria infections and is one of the pathogenic
tis, pulp periapical infection, and pericoronitis. bacteria in root caries. It is often detected in
A. viscosus is suspected to be a cariogenic bacterium. clinical specimens of periodontitis or infected
root canals, but the pathogenesis is unclear. This
3.1.1.1 Actinomyces israelii bacterium can lead to actinomycosis at many
A. israelii are Gram-positive irregular bacilli locations, such as the face, neck, chest, abdomen,
(Figs. 3.1, 3.2, and 3.3). The culture atmosphere and eye, and can cause infection of the female
requires CO2, as the culture grows poorly or not at genital tract and knee joint empyema.
3 Supragingival Microbes 83
Fig. 3.1 A. israelii cells

(Gram stain)
Fig. 3.2 A. israelii cells

(SEM)
A. naeslundii cells are mainly irregular Young colonies of A. naeslundii can appear as
branched rods or short filaments without spores. filiformed micro-colonies. Mature colonies are
The cells are Gram-negative. convex or flat and rough or smooth without center
84 X. Zhou et al.
Fig. 3.3 A. israelii branch

cells (SEM)
Fig. 3.4 A. israelii

colonies (BHI blood agar)
Fig. 3.5 A. israelii molar-

shaped colonies
(stereomicroscope)
Fig. 3.6 A. israelii

colonies detached from
plaque samples
(stereomicroscope)
sag. The colonies show no hemolytic reaction on an anaerobic environment unless CO2 is added.
blood agar. The culture is muddy in broth culture Growth can be inhibited by 5%–20% bile or
and sticks to the flask wall. 0.005% crystal violet. Characteristic colonies are
shown in Figs. 3.14, 3.15, and 3.16. The DNA
3.1.1.3 Actinomyces odontolyticus G + C content is 62% when analyzed by Tm
A. odontolyticus is a Gram-positive irregular method. The type strain is ATCC17929
bacillus (Figs. 3.12 and 3.13). It cannot grow in (NCTC9935, WVU867, CDCX363).
86 X. Zhou et al.
Fig. 3.7 A. naeslundii

cells (Gram stain)

cells (SEM)
Dental plaque and dental calculus are the main actinomycosis. The relationship between
habitats. This species is often involved in eye A. odontolyticus and periodontosis and dental
infections and is occasionally seen in advanced caries remains to be confirmed.


colonies
(stereomicroscope)
3.1.1.4 Actinomyces viscosus common atmospheric conditions. Some cells can

A. viscosus is a Gram-positive irregular bacillus grow at temperatures up to 45 C. Characteristic
(Figs. 3.17, 3.18, and 3.19). Primary cultures colonies are shown in Figs. 3.20 and 3.21. The
grow under anaerobic conditions and CO2 can DNA G + C content ranges from 59% to 70%
stimulate its growth. Subcultures can grow in
88 X. Zhou et al.

liquid culture (BHI broth)
Fig. 3.12 A. odontolyticus

cells (Gram stain)
using the Tm method. The type strain is 3.1.2 Bifidobacterium

ATCC15987 (WVU745, CDCX603, A828).
Humans’ and other warm-blooded animals’ Bifidobacterium is a genus of bacteria with vari-
oral cavities, including subgingival plaque, trans- ous forms and non-motile; they are Gram-
parent plaque, and dental calculus, are the main positive, non-sporulating, anaerobic bacilli.
sites of growth. A. viscosus is one of the cario- These bacteria were first isolated from infant
genic bacteria found in root caries and is related to feces and attracted attention because of their
periapical infections, dacryosolenitis, and abdom- important physiological significance to the host
inal and faciocervical actinomycosis. organism. Species that are important human gut

cells (SEM)
A. odontolyticus cells are
mainly irregularly
rod-shaped. Ball-like rods,
branched rods, or filiform
cells can also be observed.
The cells are Gram-positive

90 X. Zhou et al.
Fig. 3.15 Red colonies of

A. odontolyticus
(stereomicroscope)
Fig. 3.16 A. odontolyticus colonies (stereomicroscope) filamentous edge. The important identifying feature of this
A. odontolyticus can generate filiformed micro-colonies. species is that the colony turns dark red after 2 days of
The mature colonies on the surface of BHI agar measures culture on the surface of blood agar under an anaerobic
are less than or equal to 2 mm in diameter. They are white environment. The color clears after the cells are placed at
or gray-white and opaque and do not show a central sag or room temperature
bacteria include B. bifidum, B. infantis, percent G + C in Bifidobacterium DNA ranges

B. adolescentis, and B. longum. Bacteria isolated from 55% to 67% when analyzed by the Tm or Bd
from the oral cavity belonging to the method. The type species is B. bifidum.
Bifidobacterium spp. include mainly B. dentium, The bacterial cells are short and thin, with
B. breve, B. inopinatum, and B. denticolenu. The pointed ends, and are irregular. They also appear
Fig. 3.17 A. viscosus cells

(Gram stain)

(SEM)
as long cells with many branches and slightly bacteria belonging to this genus. For example,
branching spoon-shaped cells. Cells are arranged B. bifidum appear as flask-shaped cells, while
as single cells, chains, polymer-shaped, B. asteroides are star-shaped. All members of
V-shaped, or palisade-shaped. Their distinct cell this genus are Gram-positive.
morphology can be helpful in differentiating
92 X. Zhou et al.

(SEM)
A. viscosus cells are mainly
irregular short- or
moderate-length
rod-shaped without spores.
Branch rods or short
filiform also can be seen;
Gram stain is positive
Fig. 3.20 A. viscosus

Fig. 3.21 A. viscosus

colonies
(stereomicroscope)
A. viscosus can generate
filiformed micro-colony.
The mature colony do not
have center sag. The typical
colony is big and sticky
Bifidobacterium are anaerobes and most type species is ATCC27534 (reference

strains cannot grow under 90% air and 10% strains B764).
CO2. Colonies formed on agar plates are convex, The cells are anaerobic Gram-positive irregu-
creamy or white, glossy, smooth, neat-edged, lar bacilli (Fig. 3.22). Some strains are resistant to
sticky, and soft. oxygen in the presence of CO2. The optimum
The main terminal acid products in liquid cul- temperature for the growth of this bacterium is
ture medium containing glucose are acetic acid 37–41 C, and the optimum pH value ranges from
and lactic acid, but a few species also make 6.5 to 7.0. TPY culture medium supplemented
formic acid and succinic acid. However, no with neomycin, kanamycin, and various salt
butyric acid or propionic acid is formed, and no solutions is commonly used as the selective cul-
CO2 is generated (with the exception of gluconate ture medium. Characteristic colonies are shown in
degradation). Bifidobacterium can ferment Figs. 3.23, 3.24, and 3.25.
carbohydrates to produce acid and generally do B. dentium is biochemically active. It can fer-
not reduce nitrate or produce urease. They test ment D-ribose, L-arabinose, lactose, sucrose, cel-
positive using the catalase test. lobiose, trehalose, raffinose, melibiose, mannitol,
salicin, starch, galactose, maltose, fructose,
3.1.2.1 Bifidobacterium dentium xylose, mannose, and glucose to produce acid,
Originally, B. dentium was isolated from pus but cannot ferment sorbitol and inulin. It cannot
specimens and named B. appendicitis. Later, reduce nitrate and tests negative for both the
researchers isolated similar bacteria from the urease test and the catalase test.
adult dental caries, feces, and vagina, and they The distribution of the bacteria in the oral
were then named A. eriksonii or grouped into cavity and its pathogenic mechanism are not
B. adolescentis. According to later research, clearly characterized.
these bacteria make up an independent branch
on the phylogenetic tree, and the species was 3.1.2.2 Bifidobacterium breve
named B. dentium [2] in the 1970s. The percent B. breve is an anaerobic Gram-positive irregular
G + C in their DNA is 61% (Tm method), and the bacillus [3] (Figs. 3.26, 3.27, and 3.28). Its culture
94 X. Zhou et al.
Fig. 3.22 B. dentium cells

(Gram stain)
Fig. 3.23 B. dentium


colonies (B. dentium
selective agar)

colonies
(stereomicroscope)
B. dentium forms colonies
that can be described as
spherical, lustrous, smooth,
convex, gray-white, sticky,
and soft when plated on
BHI blood agar and
Bifidobacterium selective
culture medium
96 X. Zhou et al.
Fig. 3.26 B. breve cells

(Gram stain)

(SEM)

(SEM)
B. breve cells are thin and
short bacilli and
non-sporulated, non-motile,
and Gram-positive
Fig. 3.29 B. breve

characteristics are similar to those of B. dentium, B. breve DNA is 58% by the Tm method, and
and characteristic colonies are shown in the type species is ATCC15700.
Figs. 3.29 and 3.30. The percent G + C in
98 X. Zhou et al.
Fig. 3.30 B. breve

colonies
(stereomicroscope)
B. breve on agar plates form
colonies that are spherical,
smooth, translucent, gray-
white, sticky, and soft
B. breve can ferment D-ribose, lactose, and at the ends when compared with other Gram-
raffinose, but does not ferment L-arabinose and positive non-sporulating bacilli. They produce
starch. no spores and no capsules and stain Gram-
positive.
Surface culture on a solid medium is best when
3.1.3 Lactobacillus performed in anaerobic or microaerophilic
conditions. However, some species must be
Lactobacillus is a group of anaerobic or micro- cultivated under anaerobic conditions. Some
aerobic Gram-positive bacilli that do not produce members of this genus can grow within the
spores. Bacteria of this genus form part of the 15 C to 45 C range, in the presence of 5%–
normal flora of the human oral cavity and intesti- 10% CO2, which promotes bacterial growth. As
nal tract. This genus is cariogenic, as they are acid-producing bacteria, low pH Rogosa agar is
detected in decayed oral cavity materials. This the culture medium of choice for many strains of
genus includes 44 species according to Bergey’s Lactobacillus. The optimum pH for growth is
Manual of Systemic Bacteriology and also 5.5–6.2.
contains 7 subspecies. The common species The colonies are round, white or gray, and
found in the in oral cavity include transparent or non-transparent with a diameter
L. acidophilus, L. salivarius, L. plantarum, from pinprick-sized to 2 mm on the agar surface.
L. fermentum, L. brevis, and L. casei. The per- Smooth colonies are soft, raised, and lustrous, and
centage G + C in the DNA is 40% (by either Tm the edge of the colony is neat. The surface of
method or Bd method). The type species is Ger- rough colonies is dry, flat, and lackluster, and
man type Lactobacillus. the edge is not neat. The bacteria normally do
The shapes and sizes of the bacterial cells can not produce pigment.
vary greatly. They can be vimineous, stubbed, Lactobacilli can ferment glucose to produce
bent, bacilliform, clavate, club-shaped, etc. How- acid and are negative for catalase, urease, and
ever, most Lactobacillus cells are fairly regular cytochrome enzyme. They do not produce
with no branching. The cells are square or obtuse benzpyrole, cannot reduce nitrate, cannot
Fig. 3.31 L. acidophilus

cell (Gram stain)
hydrolyze gelatin, and cannot produce H2S. Sugar of bacteria found in their mouth decreases gradu-
fermentation test and arginine hydrolysis test can ally, until at age 2, only a very small amount of
help identify the genus of bacteria. L. acidophilus can be detected. The main site of
The bacteria can promote the development of colonization of L. acidophilus in the mouth is
tooth decay, as its detection is significantly dental plaque; it is relatively rare in saliva, on
increased in deep caries material. the tongue, or in the gingival sulcus. As it is
often found in material from deep caries,
3.1.3.1 Lactobacillus acidophilus L. acidophilus is believed to be associated with
These are Gram-positive regularly shaped bacte- the development of dental caries.
ria (Figs. 3.31 and 3.32) that grow well under
anaerobic conditions. Cells grow well at 45 C, 3.1.3.2 Lactobacillus casei
but do not grow at 15 C. BHI blood agar and L. casei was originally divided into four subspe-
Rogosa agar are the commonly used media, and cies: L. casei subsp. casei, L. casei subsp.
the latter is a selective medium. Characteristic pseudoplantarum (now known as L. paracasei
colonies are shown in Figs. 3.33, 3.34, 3.35, subsp. paracasei), L. casei subsp. rhamnosas
3.36, and 3.37. (now known as L. rhamnosus), and L. casei
L. acidophilus are obligate homofermentative subsp. toleons (now known as L. paracasei
bacteria [4]. They can produce D- or L-lactic acid subsp. tolerans). A newly added subspecies is
and ferment glucose, and most strains can also L. casei subsp. alactosus (now known as
ferment starch. L. acidophilus cannot produce L. paracasei subsp. paracasei).
ammonia from arginine. The G + C content in The cells stain Gram-positive (Figs. 3.38 and
its genomic DNA is 32%–37% (by Tm method or 3.39). Cultures grow well under anaerobic
Bd method). The type strain is ATCC4356. conditions [5]. BHI blood agar and Rogosa agar
L. acidophilus is mainly isolated from the gas- are the commonly used media, while the latter is a
trointestinal tract of humans and animals, human selective medium. Characteristic colonies are
mouths, and the human vagina. L. acidophilus shown in Figs. 3.40, 3.41, and 3.42. The percent
can be isolated from a minority of neonates’ G+ C in its genomic DNA is 45%–47%
mouths. As the children grow older, the number
100 X. Zhou et al.
Fig. 3.32 L. acidophilus

cell (SEM)
Cells of L. acidophilus
measure
0.3–0.4 1.5–4.0 μm in
size. They are arranged as
single cells, in pairs, or as
short chains. They have
rounded ends and no
muramic acid in the cell
wall. Cells stain Gram-
positive
Fig. 3.33 Colonies of

L. acidophilus (BHI blood
agar)

L. acidophilus (Rogosa
agar)
Fig. 3.35 Rough colonies

of L. acidophilus
(stereomicroscope)
(Bd method). The type strain is ATCC393 products. The main site of colonization in the
(L. casei subsp. casei). mouth is in dental plaque. As it is often found in
The main colonization sites of L. casei are the material from deep caries, it is believed to be a
human intestine, mouth, and vagina. The bacteria pathogen of dental caries.
can also be detected in milk and other dairy
102 X. Zhou et al.
Fig. 3.36 Smooth colonies

of L. acidophilus
(stereomicroscope)
Fig. 3.37 Surface features

of the L. acidophilus rough
colonies
(stereomicroscope)
L. acidophilus colonies can
be separated into rough and
smooth type. Hair-like
structures can be observed
under the stereomicroscope.
Colonies do not produce
pigment
L. casei is a facultative heterofermentative 3.1.3.3 Lactobacillus fermentum

bacterial species. Other than the subspecies L. fermentum is a Gram-positive bacterium
L. casei subsp. rhamnosas, other subspecies (Figs. 3.43, 3.44, and 3.45). Commonly used
grow well at 15 C, but do not grow at 45 C. media to culture this species are BHI blood agar
and Rogosa agar, where the latter is a selective
Fig. 3.38 L. casei cell

(Gram stain)
Fig. 3.39 L. casei cell

(SEM) L. casei cells
measure 0.7–1.1 μm
2.0–4.0 μm 1.5–5.0 μm
and are arranged in a chain.
Individual cells usually
have rounded ends. Cells
stain Gram-positive
104 X. Zhou et al.
Fig. 3.40 colonies of

L. casei (BHI blood agar)

L. casei (Rogosa agar)
Fig. 3.42 cheese colonies

of L. casei
(stereomicroscope)
L. casei can form milky
white colonies about 1 mm
in diameter. Colony
morphology is rounded,
smooth, and
non-transparent on BHI
blood agar and Rogosa agar
Fig. 3.43 L. fermentum

cell (Gram stain)
medium. Characteristic colonies are shown in diseases such as dental caries and root canal
Figs. 3.46, 3.47, and 3.48. infections.
Since this species can be detected in the human L. fermentum usually grows well at 45 C and
mouth and in yeast, dairy products, sourdough, does not grow at 15 C. Obligate heterofer-
and fermented plants, L. fermentum is considered mentative bacteria. Calcium pantothenate, nico-
to be related to the occurrence of oral infectious tinic acid, and thiamine are required for growth,
106 X. Zhou et al.

cell (SEM)

cell (SEM)
The L. fermentum cell is
0.5–0.9 μm in diameter, but
its length can vary quite
significantly. The ends of
the cells are square or
obtuse. Most bacterial cells
are arranged as a single cell
or in pairs. They do not
produce spores and are
non-motile. L. fermentum
stains Gram-positive

L. fermentum (BHI blood
agar)
Fig. 3.47 Concentric

circle structure of
L. fermentum colonies
(stereomicroscope)
but vitamin B2, pyridoxal, and folic acid are not 3.1.4 Rothia
required. The percent G + C in its genomic DNA
is 52%–54% (analyzed by the Bd method or Tm Rothia are Gram-positive facultative anaerobic
method). The type strain is ATCC14931. bacilli that do not produce spores.
108 X. Zhou et al.
Fig. 3.48 Surface of smooth colonies and rough, lined, L. fermentum colonies is the concentric circle structure at
myxoid colonies of L. fermentum (stereomicroscope) the center of the colony when observed under stereomi-
L. fermentum can form gray-white colonies about 1 mm in croscope. The smooth spherical colonies are convex and
diameter. The shape of the colony is convex or slightly have neat edges, while rough myxoid colonies are slightly
convex, the surface is smooth, and the colonies are convex, have irregular edges, and have a granular surface
non-transparent on BHI blood agar. A striking feature of
R. dentocariosa is the type species of the Rothia tolerant. Bacterial cells as viewed by SEM are
genus. shown in Figs. 3.50 and 3.51.
Rothia dentocariosa is a Gram-positive bacil- These bacteria are facultative anaerobes. They
lus that does not produce spores. The characteris- grow well in an aerobic environment, although
tic appearance of the cells is shown in Figs. 3.49, primary cultures require incubation under anaero-
3.50, and 3.51. The G+ C content of its DNA is bic conditions (80% N2, 10% H2, 10% CO2). The
47–57% (Tm method). The type strain is optimum growth temperature is 35–37 C. When
ATCC17931. cultured for 18–24 h under anaerobic conditions,
The bacteria cells can be spherical, pleomor- young colonies are always filamentous and
phic (similar to Corynebacterium diphtheria), or appear as spider-like colonies. When inoculated
filamentous. Cells stain as Gram-negative. The under aerobic conditions, young colonies can
cell diameter is generally 1.0 μm, but cells are reach a diameter of 1 mm. The colony surface is
irregular in shape, and the ends can reach a diam- smooth or grainy and often shows an umbrella
eter of 5.0 μm. Cells appear almost filamentous edge. After 2 d of culture, mature colonies can
following culture on solid media, while they reach a diameter of 2–6 mm, with a milky, glossy,
appear spherical in broth media. Cells become and smooth appearance (Fig. 3.50). Smooth
almost completely spherical after growing for colonies and rough colonies can co-exist on the
2–3 days in stale broth media, but the coccoid same agar plate, which may also show loose,
morphology can be easily altered. crumbly, or sticky colonies. A handful of rough-
R. dentocariosa does not produce spores or a type colonies may also take on a dry coil shape.
capsule. They are non-motile and are not acid
Fig. 3.49 R. dentocariosa

cells (Gram stain)

cells (SEM)
Characteristic colonies are shown in Figs. 3.52 can ferment glucose, maltose, sucrose, trehalose,
and 3.53. fructose, and salicylate to produce acid. Cells test
The main acid product is lactic acid, and positive for catalase, but do not produce indole.
R. dentocariosa does not produce propionic acid They are able to reduce nitrate and nitrite and can
when inoculated into PYG broth. R. dentocariosa hydrolyze esculin, starch, and casein. It is unclear
110 X. Zhou et al.

cells (SEM)
The bacteria cells are
spherical, similar to
Corynebacterium
diphtheriae in morphology,
but can also be filamentous;
however, they mostly exist
as mixed morphologies.
The cell diameter is
generally 1.0 μm, but is
irregular, as the apical ends
of the rod can reach a
diameter of 5.0 μm. The
culture is almost
filamentous on solid media
and spherical in broth
medium. It is a Gram-
negative species

Fig. 3.53 R. dentocariosa colonies (Stereomicroscope) colonies can exist simultaneously on the same agar plate,
When inoculated under aerobic conditions, young colonies while colonies can also appear loose, crumbly, or sticky. A
can reach a diameter of 1 mm. The colony surface is small number of rough-type colonies may also exhibit a
smooth or grainy and often presents an umbrella-like dry coil shape. When cultured for 18–24 h under anaerobic
edge. After 2 days of culture, mature colonies can reach conditions, young colonies are always filamentous and
a diameter ranging from 2 to 6 mm, with a milky, glossy, appear as spider-like colonies
and smooth appearance. Smooth colonies and rough
whether R. dentocariosa can hydrolyze gelatin. It early 1980s, analysis of biochemical reactions
is positive for urease activity and can produce (e.g., mannitol fermentation) and cellular
H2S in triple sugar iron agar. components (e.g., the availability of coagulase)
R. dentocariosa are detected in the human oral resulted in the division of the Staphylococcus
cavity. Its main sites of colonization are the saliva genus into subgroups of pathogenic and
and subgingival plaque. They are non-pathogenic non-pathogenic species. In Bergey’s Manual of
members of the human oral microflora and have Systematic Bacteriology [7], members of the
no confirmed relationship to oral infections. As an Staphylococcus genus are divided into 4 groups
opportunistic pathogen, it has been detected from and 19 species based on cell wall composition
in endocarditis samples [6] and other clinical and nucleic acid analysis.
infected specimens. The cells of Staphylococcus are characterized
as being spherical (0.5–1.5 μm in diameter),
Gram-positive, aflagellar, and non-motile cocci
3.1.5 Staphylococcus organized as single cells, pairs, tetrads, and
clusters. However, they tend to form botryoid
Members of the Staphylococcus genus are Gram- clusters. As is the case with other Gram-positive
positive cocci and belong to the Micrococcus bacteria, peptidoglycan and teichoic acid are the
family. The organisms are widely spread in the two main components of the Staphylococcus cell
environment. Early on, three species were wall. The genomic G + C content of this genus
isolated from clinical samples: S. aureus, ranges from 30% to 39%.
S. epidermidis, and S. saprophyticus. In the
112 X. Zhou et al.
Fig. 3.54 S. epidermidis

cells (Gram stain)
Staphylococci are facultative anaerobes, with sensitive to novobiocin, with the minimum inhib-
the exception of S. saccharolyticus, which is an itory concentration at no more than 0.2 mg/L.
anaerobic bacterium. The optimum temperature
for the growth of Staphylococcus is between
18 C and 40 C. Most members of the Staphylo- 3.1.6 Streptococcus
coccus genus can grow in media containing 10%
NaCl. The type species of Staphylococcus is The Streptococcus genus makes up the most com-
S. aureus. mon Gram-positive facultative anaerobic cocci,
Staphylococcus epidermidis is a Gram- and its members are the predominant bacteria in
positive bacterium. Their cell wall teichoic acid the oral cavity. The name Streptococcus was
formed by polymerized glycerol, glucose, and given because the bacteria belonging to this
N-acetyl glucosamine. Cellular characteristics genus always arrange themselves into chains. In
are shown in Figs. 3.54 and 3.55. The G + C clinical bacteriology, members of Streptococcus
content of its genomic DNA ranges from 30% to are divided into three categories based on their
37%, and the type strain is ATCC14990. ability to induce hemolysis: α-hemolytic Strepto-
S. epidermidis is a facultative anaerobe, but coccus (also known S. viridans), β-hemolytic
also grows well under aerobic conditions Streptococcus, and γ-hemolytic Streptococcus
(Figs. 3.56 and 3.57). Culture conditions for (also known non-hemolytic Streptococcus). In
S. epidermidis are similar to those of S. aureus the 2004 edition of Bergey’s Manual of System-
(see 5.1.1), but S. epidermidis grows slowly in atic Bacteriology, 89 species were attributed to
medium with 10% NaCl. the Streptococcus genus.
S. epidermidis mainly colonizes human skin The most prevalent species in the oral cavity
and is a health concern due to its involvement in are S. salivarius, S. sanguinis, S. mutans,
hospital-acquired infections [8]. The organisms S. sobrinus, S. oralis, S. mitis, and S. gordonii.
are frequently detected in saliva and dental plaque
and are thought to be associated with periodonti- 3.1.6.1 Streptococcus salivarius
tis, acute and chronic pulpitis, pericoronitis, dry S. salivarius is a Gram-positive coccus (Figs. 3.58
socket, and angular stomatitis. S. epidermidis is and 3.59). Most strains of S. salivarius belong to
Fig. 3.55 S. epidermidis

cells (SEM)
S. epidermidis cells are
spherical (0.5–1. 5 μm in
diameter) and Gram-
positive. The cocci organize
into tetrads and clusters.
Single cells are
occasionally observed

S. epidermidis incubated on
agar plate
114 X. Zhou et al.

S. epidermidis
(stereomicroscope)
Colonies of S. epidermidis
are round, raised, shiny, and
gray and have complete
edges. The diameter is
approximately 2.5 mm.
They usually do not
produce a hemolytic zone.
Strains that can produce
mucus form translucent
sticky colonies
Fig. 3.58 S. salivarius

cells (Gram stain)
the Lancefield group K. Their genomic G + C grow at 45 C. Cultures require nutrient-rich com-
content is 39%–42%, and the type strain is plex media, such as TS or TPY. The final pH of
ATCC7073. glucose broth incubated with S. salivarius usually
S. salivarius are facultative anaerobes, but the falls between pH 4.0 and 4.4. Colony morphol-
optimal atmosphere condition for bacterial ogy is shown in Figs. 3.60, 3.61, 3.62, and 3.63.
cultures should contain a low percentage of oxy-
gen with 5–10% carbon dioxide. S. salivarius Biochemical Reactions S. salivarius can fer-
grows quickly at 37 C, although it can also ment glucose, sucrose, maltose, raffinose, inulin,
Fig. 3.59 S. salivarius

cells (SEM)
The cells of S. salivarius are
spherical or oval
(0.8–1.0 μm in diameter)
Gram-positive cocci
organized in short or long
chains
Fig. 3.60 α-hemolytic

zone of S. salivarius
incubated on blood BHI
agar plate
116 X. Zhou et al.
Fig. 3.61 Rice ball-like

colonies of S. salivarius
incubated on MS agar

S. salivarius observed
under stereomicroscope
(incubated on blood BHI
agar plate)
salicin, trehalose, and lactic acid. It cannot fer- and urea, but not arginine. Meanwhile, most
ment glycerol, mannitol, sorbitol, xylose, and strains can produce acetoin from glucose.
arabinose. Most strains can hydrolyze esculin

S. salivarius isolated from
saliva (stereomicroscope)
The ability to synthesize
extracellular
polysaccharides determines
whether colonies of
S. salivarius are smooth or
rough. On agar plates with
sucrose, most strains
synthesize soluble fructan
and form sticky rice ball-
like colonies, a
characteristic that can be
used to identify
S. salivarius. Very few
strains produce α- or
β-hemolytic zones when
incubated on agar
containing starch or horse
blood
Fig. 3.64 S. sanguinis

cells (Gram stain)
Colonization Characteristics S. salivarius is on gnotobiotic animals showed that S. salivarius

mainly isolated from the oral cavity of human is cariogenic.
and animals, and it is part of the normal flora of
tongue and saliva microbial communities. More- 3.1.6.2 Streptococcus sanguinis
over, S. salivarius is also detected in fecal and S. sanguinis is a Gram-positive coccus (Figs. 3.64
blood samples of endocarditis patients. Research and 3.65). Most strains of S. sanguinis belong to
118 X. Zhou et al.
Fig. 3.65 S. sanguinis

cells (SEM)
S. sanguinis cells are
spherical or oval
(0.8–1.2 μm in diameter),
Gram-positive cocci that
are organized in medium or
long chains. Occasionally,
the bacteria are rod-shaped
or pleomorphic

S. sanguinis incubated on
blood BHI agar plate
Fig. 3.67 Smooth colonies

of S. sanguinis incubated on
MS agar plate
Lancefield group H. The genomic G + C content Colonization Characteristics S. sanguinis is the

is between 40% and 46% [9], and the type strain main component of dental plaque and is only
is ATCC10556 (NCTC 7863). isolated from oral cavities with erupted teeth.
S. sanguinis is a facultative anaerobe and the This organism is considered to be helpful to the
optimum atmospheric condition for cultures colonization and reproduction of S. mutans due to
should contain 5–10% carbon dioxide. its ability to synthesize PABA. Meanwhile,
S. sanguinis grows quickly at 37 C, and it cannot S. sanguinis is regarded as a key probiotic in the
grow at 45 C. Bacterial cultures require nutrient- oral ecosystem and is associated with healthy
rich complex media. Blood BHI and TPY media periodontal tissues, owing to its ability to synthe-
are used for S. sanguinis isolation, and MS size H2O2.
medium is used for selective culture (Figs. 3.66,
3.67, and 3.68). S. sanguinis colonies are either smooth or
rough, and the diameter of colonies is between
Biochemical Reactions S. sanguinis can ferment 0.7 and 1.0 mm. When incubated under aerobic
glucose, maltose, sucrose, trehalose, and salicin conditions, an α-hemolytic zone can be observed
to produce acid. Occasionally, it also ferments around the colonies of most strains, while a
inulin, raffinose, and sorbitol. S. sanguinis does β-hemolytic zone can be observed around the
not ferment xylose, arabinose, glycerol, and man- colonies of a few strains. A large number of
nitol. More than 50% of S. sanguinis strains strains that make up S. sanguinis harbors the
hydrolyze esculin. The final pH of glucose broth capacity to produce extracellular polysaccharides
incubated with S. sanguinis is approximately above or surrounding their colonies. A liquid-like
pH 4.6–5.2. Ammonia is produced from arginine structure composed of polysaccharides can be
hydrolysis and H2O2 synthesis can be used to observed on these colonies. S. sanguinis colonies
distinguish this bacterium from S. mutans. grown on agar containing a high concentration of
sucrose are sticky, hard, and rough. These
colonies, with a ground-glass appearance, seem
120 X. Zhou et al.

zone of S. sanguinis
incubated on blood BHI
agar plate
(stereomicroscope)
to stretch into the surrounding agar. However, The α-hemolytic zone can be observed
colonies on agar with low sucrose concentration surrounding S. gordonii colonies incubated on
or without sucrose are round, soft, and smooth. blood agar. Some strains harbor the ability to
synthesize extracellular polysaccharides on top
of or surrounding their colonies. This layer of
3.1.6.3 Streptococcus gordonii
polysaccharides appears as a liquid-like structure.
S. gordonii was classified as S. sanguinis serotype
In addition, colonies grown on agar containing
II in the past. However, S. gordonii lacks the
high sucrose concentration are sticky, hard, and
IgA1 protease. It is a Gram-positive coccus
rough. These colonies have a ground-glass
(Figs. 3.69, 3.70, and 3.71). The cell wall
appearance and seem to stretch into the
components are mainly glycerol, teichoic acid,
surrounding agar. However, colonies grown on
and rhamnose, while its peptidoglycan type is
agar with low sucrose concentration or without
Lys-Ala. The genomic G + C content is 40%–
sucrose are round, soft, and smooth.
43%, and the type strain is ATCC10558 (NCTC
7865).
S. gordonii is a facultative anaerobe. Zones of 3.1.6.4 Streptococcus mutans
α- or γ-hemolysis can be observed on blood agar, S. mutans, S. sobrinus, S. rattus, S. ferus,
and a green hemolytic zone can be seen on choc- S. cricetus, and S. macacae are collectively
olate agar. This species includes three biotypes known as mutans streptococci. These bacteria
and all three do not synthesize catalase. Colonies formerly belonged to serotypes a, b, c, d, e, f, g,
are shown in Figs. 3.72, 3.73, and 3.74. or h of S. mutans. Their genomic G + C content is
between 36% and 38% [10] and the type strain is
Colonization Characteristics S. gordonii ATCC25175.
mainly inhabits the oral cavity and pharynx. S. mutans is Gram-positive and its colony
morphology is shown in Figs. 3.75, 3.76, 3.77,
3.78, and 3.79.
Fig. 3.69 Spherical cells

of S. gordonii (Gram stain)
Fig. 3.70 Spear-shaped

cells of S. gordonii (Gram
stain)
S. mutans is a facultative anaerobe, but the used for selective culture (Figs. 3.80, 3.81, and
optimal atmospheric condition for cultures should 3.82). Cells tend to clump or attach to the bottom
be anaerobic or contain only a low percentage of of the tube when incubated in glucose broth
oxygen with 5–10% carbon dioxide. S. mutans (Fig. 3.83), and the final pH of bacterial culture
grows quickly at 37 C and some strains can grow in glucose broth is usually between pH 4.0 and
at 45 C. S. mutans cultures require nutrient-rich 4.3.
complex media, such as TS and TPY. MSB is
122 X. Zhou et al.

cells of S. gordonii (SEM)
S. gordonii cells are
spherical or spear-shaped
and organize into chains.
The cells are non-motile
and non-sporulating

zone of S. gordonii
incubated on blood
BHI agar
Fig. 3.73 γ-Hemolytic

zone of S. gordonii
incubated on blood
BHI agar
Fig. 3.74 Sticky colonies

of S. gordonii incubated on
blood BHI agar
(stereomicroscope)
Biochemical Reactions Most strains ferment do not ferment arabinose, xylose, glycerol, and
mannitol, sorbitol, raffinose, lactose, inulin, sali- melezitose. S. mutans hydrolyzes esculin, but not
cin, mannose, and trehalose to produce acid, but
124 X. Zhou et al.
Fig. 3.75 Spherical cells

of S. mutans (Gram stain)
Fig. 3.76 Long chain-

shaped cells of S. mutans
(Gram stain)
arginine, hippurate, and gelatin. S. mutans does water-soluble glucan production, S. mutans has
not produce H2O2. long been regarded as one of the main oral
pathogens. It also involved in other secondary
Colonization Characteristics S. mutans is infections such as bacteremia and endocarditis.
mainly isolated from the surface of teeth. It
synthesizes a variety of extracellular Colonies of S. mutans grown on blood agar
polysaccharides, including water-soluble and after 48 h anaerobic incubation are either regular
non-water-soluble glucan and fructan from and smooth or irregular, hard, and sticky. The
sucrose. These polysaccharides promote bacterial diameter of colonies is 0.5–1.0 mm. Zones of α-
colonization and are key virulence factors in the or γ-hemolysis can be observed around colonies
formation dental caries. Due to their adhesive of most strains, while β-hemolytic zones can also
capacity, acid production, acid tolerance, and be observed with the colonies of a few strains. On
Fig. 3.77 S. mutans in

short chains (SEM)
Fig. 3.78 S. mutans in

long chains (SEM)
126 X. Zhou et al.
Fig. 3.79 Self-curing cells

of S. mutans (SEM)
S. mutans are spherical
(0.5–0.75 μm in diameter),
Gram-positive cocci in
pairs or chains. Long chains
form in broth and short
rod-shaped cells
(0.5–1.0 μm in length) can
be detected in acidic broth
and on some solid media.
The phenomenon of self-
curing bacterial cells can be
detected under SEM

S. mutans incubated on
blood BHI agar

S. mutans incubated on
MS agar
Fig. 3.82 Smooth and

rough colonies of S. mutans
incubated on MS agar
(stereomicroscope)
agar containing sucrose, most strains form surrounding the colonies. MS is the commonly
stacked colonies (about 1 mm in diameter) with used selective medium, and both smooth and
drop-like or myxoid glucan products above or rough colonies can be observed on the same plate.
128 X. Zhou et al.
Fig. 3.83 Bacterial culture

of S. mutans incubated in
TPY broth
3.1.6.5 Streptococcus sobrinus aesculin and do not synthesize obvious amounts

S. sobrinus was originally classified as serotypes of extracellular polysaccharide.
d and g of S. mutans, and it is named based on its
close relationship with S. mutans. Research has Colonization Characteristics The main site of
shown that S. sobrinus has the second highest rate colonization of S. sobrinus is on the surface of
of cariogenicity after S. mutans [11]. The G + C human teeth.
content of the S. sobrinus genome is 44%–46%
(by Tm method), and its type strain is S. sobrinus can form stacked and rough
ATCC33478 (SL). colonies (about 1 mm in diameter) on sucrose
The cells are Gram-positive cocci (Figs. 3.84, agar plates. Liquid-like glucan products can be
3.85, and 3.86). Cultures of S. sobrinus grow observed above or surrounding these colonies. On
under similar conditions as those used to culture TPY agar plates or BHI blood agar plates,
S. mutans and their colony characteristics are S. sobrinus can form smooth sticky colonies,
shown in Figs. 3.87, 3.88, and 3.89. and α-hemolysis can also be detected for some
strains growing on blood agar plates.
Biochemical Reactions S. sobrinus is able to
ferment mannitol, inulin, and lactose to produce 3.1.6.6 Streptococcus oralis
acid, but its ability to ferment sorbitol, The cells of S. oralis are Gram-positive
D-melibiose, and raffinose varies by strain. More- (Fig. 3.90), spherical, and arranged in short
over, most strains of S. sobrinus can produce chains. In addition, S. oralis cells are
H2O2, but cannot metabolize arginine to produce non-motile, have no capsule, and do not form
ammonia. Most strains also cannot hydrolyze spores. The genomic G + C content of S. oralis
Fig. 3.84 S. sobrinus cells

(Gram stain)

(SEM)
The cells of S. sobrinus are
Gram-positive, spherical
(about 0.5 μm in diameter),
are arranged in pairs or in
chains, and often form long
chains
130 X. Zhou et al.

(SEM)

S. sobrinus (TPY agar
plate)

S. sobrinus (BHI blood agar
plate)
Fig. 3.89 Alpha-

hemolytic colonies of
S. sobrinus (BHI blood agar
plate, stereomicroscope)
is 40% (Tm method) and its type strain is of this species can grow in medium containing
NCTC11427 (LUG1, PB182). 0.0004% crystal violet, and α-hemolytic reaction
S. oralis is a facultative anaerobe and most can be detected when colonies are grown on
commonly grown on TPY agar (Fig. 3.91). Cells
132 X. Zhou et al.
Fig. 3.90 Cells of S. oralis

(Gram-positive coccus)

S. oralis (TPY agar plate)

S. oralis (BHI agar plate)

S. oralis (stereomicroscope)
blood agar plates (Fig. 3.92). Characteristic isolated from the human oral cavity and is a
S. oralis colonies are shown in Fig. 3.93. common member of the oral microflora.
S. oralis can reduce tetrathionate, but does not Streptococci are clinically divided into three
produce catalases. In fact, S. oralis is relatively major categories: α-hemolytic, β-hemolytic, and
biochemically inactive. This species is mainly γ-hemolytic.
134 X. Zhou et al.
Fig. 3.94 Cells of

α-hemolytic streptococcus
(Gram stain)
3.1.6.7 a-Hemolytic Streptococcus streptococci and have the highest pathogenicity.

Streptococci that fall in to the α-hemolytic group These are the causative agents of various oral
include all Streptococcus species that form a infectious diseases, including phlegmon in the
grass-green hemolytic zone around their colonies maxillofacial region, acute tonsillitis, and peri-
when grown on blood agar plates. This category odontal abscess.
included species such as S. sanguis, S. mitis, and Like other Streptococcus species, cells of
S. vestibularis. β-hemolytic streptococci are Gram-positive
Like other streptococci, α-hemolytic cells are (Fig. 3.98), rounded, and non-motile, and the
Gram-positive (Fig. 3.94), spherical, and great majority organize themselves into short
non-motile. The great majority of cells are chains. However, most cells in liquid culture
organized in pairs or short chains. Cells observed form long chains. Cells observed by SEM are
by SEM are shown in Fig. 3.95. shown in Fig. 3.99.
Alpha-hemolytic streptococci are facultative Beta-hemolytic streptococci are facultative
anaerobes and form a characteristic α-hemolytic anaerobes that form a broad and completely trans-
zone on blood agar plates. The α-hemolytic zone parent hemolytic zone around colonies grown on
appears as a narrow grass-green zone that is blood agar plates (Fig. 3.100). Colonies observed
observed around colonies (Fig. 3.96). Members by stereomicroscope are shown in Fig. 3.101.
of this group are also known as grass-green
streptococci. Colonies observed by stereomicro-
scope are shown in Fig. 3.97. 3.2 Gram-Negative Bacteria
3.2.1 Leptotrichia
3.1.6.8 b-Hemolytic Streptococcus
Streptococcal species that fall into the
Leptotrichia is a Gram-negative anaerobic bacil-
β-hemolytic category include all species that can
lus and is a very commonly observed genus in the
form a β-hemolytic zone, including S. pyogenes
human oral cavity.
and S. agalactiae. Beta-hemolytic streptococci
The genus Leptotrichia was first found in 1896
are also known as pyogenic hemolytic
and was named Leptothrix as it was isolated from
Fig. 3.95 Cells of

(SEM)

(BHI blood agar plate)
136 X. Zhou et al.

(stereomicroscope)
Fig. 3.98 Cells of

β-hemolytic streptococcus
(Gram stain)
the rabbit uterus. For a long time, Leptotrichia The Leptotrichia cell measures
were considered opportunistic pathogens until 0.8–1.5 5–20 μm. They can be straight or
recent reports that indicated that they may be curved rod shapes. The ends of the cell (either
pathogenic [12]. Leptotrichia can be isolated one or both ends) can be sharp or rounded. Cells
from the oral cavity and are mainly found in normally organize as pairs or in a chain
bacterial biofilms. It can also separate from the (Figs. 3.102, 3.103, and 3.104). The cells do not
vagina and the uterus of pregnant women. produce spores and are non-motile. Fresh cultures
can be stained Gram-positive. Under the light
Fig. 3.99 Cells of

(SEM)

(BHI blood agar plate)
138 X. Zhou et al.

(stereomicroscope)
Fig. 3.102 Leptotrichia

cells (Gram stain)
microscope, both Gram-negative and Gram-posi- Leptotrichia grow best under anaerobic
tive cells can be observed on a single slide. conditions. Cultures require 5%–10% CO2. The
After culturing in anaerobic blood agar for ideal temperature for culture growth is between
1–2 days, Leptotrichia can form 1–2 mm, raised, 35 C and 37 C, while Leptotrichia cells stop
and transparent colonies with smooth and fila- growing temperatures drop below 25 C. The
mentous edges (Fig. 3.105). Sometimes polymor- ideal pH for culturing these cells is between
phous colonies are also formed.

cells (SEM)
pH 7.0 and 7.4. Growth is not inhibited by detected in oral cavities include V. parvula,
20% bile. V. atypica, and V. dispar.
Leptotrichia is biochemically active. They can
ferment amygdalin, cellobiose, fructose, glucose,
3.2.2.1 Veillonella parvula subsp.
maltose, mannose, melezitose, salicin, sucrose,
parvula
and trehalose to produce acid [13]. The terminal
V. parvula subsp. parvula are Gram-negative
products of lactose and starch fermentation are
anaerobic cocci and are among the most common
variable. Leptotrichia does not ferment arabinose,
bacteria in the oral cavity [14]. Cell
dulcitol, glycerol, inositol, inulin, mannitol,
characteristics are shown in Figs. 3.106 and
melibiose, raffinose, rhamnose, ribose, sorbitol,
3.107. The DNA G + C content is 38% when
and xylose. The cells do not produce indole,
analyzed by Tm or 41% when analyzed by
catalase, urease, H2S, phospholipase, and
Bd. The type strain is ATCC10790.
ammonia gas.
V. parvula subsp. parvula is a strict anaerobe.
The percent G + C in Leptotrichia DNA is
Several strains require putrescine and cadaverine
25% (by Tm or Bd). The type strain is
in their growth medium. Characteristic colonies
ATCC14201.
are shown in Figs. 3.108 and 3.109.
The cells are relatively biochemically inactive
when tested using classical biochemical tests.
3.2.2 Veillonella They are unable to ferment carbohydrate to acid
and do not produce indole. They appear negative
Veillonella are Gram-negative anaerobic cocci with the catalase test, but are able to reduce nitrate
and belong to the family Veillonellaceae. Strains to nitrite.
140 X. Zhou et al.

cells (SEM)

colonies
V. parvula subsp. parvula is detected in saliva, and are thus considered as beneficial bacteria in
on the tongue, and in plaques. They are able to dental plaques. They form part of the normal
utilize lactate produced by Streptococcus mutans human gut flora.
Fig. 3.106 V. parvula

subsp. parvula cells (Gram
stain)

subsp. parvula cells (SEM)
V. parvula subsp. parvula
cells are spherical and often
arranged in piles or clumps.
The cells are Gram-
negative, but can show up
as Gram-positive in
immature cultures
142 X. Zhou et al.

subsp. parvula colonies
(BHI blood agar)

subsp. parvula colonies
(stereomicroscope)
V. parvula subsp. parvula
require strictly anaerobic
condition, forming small
gray-white colonies on the
surface of BHI blood agar
References 7. Vos P, Garrity G, Jones D, Krieg NR, Ludwig W,

Rainey FA, Schleifer KH, Whitman W. Bergey’s man-
ual of systematic bacteriology, vol. 3. New York:
1. Madigan M, Martinko J. Brock biology of
Springer; 2009.
microorganisms. 11th ed. Upper Saddle River: Pren-
8. Levinson W. Review of medical microbiology and
tice Hall; 2005.
immunology. 11th ed. New York: MCGraw-Hill Med-
2. Ventura M, Turroni F, Zomer A, Foroni E,
ical; 2010. p. 94–9.
Giubellini V, Bottacini F, Canchaya C, Claesson MJ,
9. Xu P, Alves JM, Kitten T, Brown A, Chen Z, Ozaki
He E, Mantzourani M, Mulas L, Ferrarini A, Gao B,
LS, Manque P, Ge X, Serrano MG, Puiu D,
Delledonne M, Henrissat B, Coutinho P, Oggioni M,
Hendricks S, Wang Y, Chaplin MD, Akan D, Paik S,
Gupta RS, Zhang Z, Beighton D, Fitzgerald GF,
Peterson DL, Macrina FL, Buck GA. Genome of the
O’Toole PW, van Sinderen D. The Bifidobacterium
opportunistic pathogen Streptococcus sanguinis. J
dentium Bd1 genome sequence reflects its genetic
Bacteriol. 2007;189(8):3166–75.
adaptation to the human oral cavity. PLoS Genet.
10. Ajdic D, McShan WM, MCLaughlin RE, Savic G,
2009;5(12):e1000785.
Chang J, Carson MB, Primeaux C, Tian R, Kenton S,
3. Bottacini E, O’Connell Motherway M, Kuczynski J,
Jia H, Lin S, Qian Y, Li S, Zhu H, Najar F, Lai H,
O’Connell KJ, Serafini E, Duranti S, Milani C,
White J, Roe BA, Ferretti JJ. Genome sequence of
Turroni E, Lugli GA, Zomer A, Zhurina D, Riedel C,
Streptococcus mutans UA159, a cariogenic dental
Ventura M, van Sinderen D. Comparative genomics of
pathogen. Proc Natl Acad Sci U S A. 2002;99
the Bifidobacterium breve taxon. BMC Genomics.
(22):14434–9.
2014;15:170.
11. Conrads G, de Soet JJ, Song L, Henne K, Sztajer H,
4. Altermann E, Russell WM, Azcarate-Peril MA,
Wagner-Dobler I, Zeng AP. Comparing the cariogenic
Barrangou R, Buck BL, McAuliffe O, Souther N,
species Streptococcus sobrinus and S. mutans on
Dobson A, Duong T, Callanan M, Lick S,
whole genome level. J Oral Microbiol. 2014;6:26189.
Hamrick A, Cano R, Klaenhammer TR. Complete
12. Eribe ER, Olsen I. Leptotrichia species in human
genome sequence of the probiotic lactic acid bacterium
intections. Anaerobe. 2008;14(3):131–7.
Lactobacillus acidophilus NCFM. Proc Natl Acad Sci
13. Thompson J. Pikis, a metabolism of sugars by geneti-
USA. 2005;102(11):3906–12.
cally diverse species of oral Leptotrichia. Mol Oral
5. Maze A, Boel G, Zuniga M, Bourand A, Loux V,
Microbiol. 2012;27(1):34–44.
Yebra MJ, Monedero V, Correia K, Jacques N,
14. Gronow S, Welnitz S, Lapidus A, Nolan M,
Beaufils S, Poncet S, Joyet P, Milohanic E,
Ivanova N, Glavina Del Rio T, Copeland A, Chen E,
Casaregola S, Auffray Y, Perez-Martinez G, Gibrat
Tice H, Pit- luck S, Cheng JF, Saunders E, Brettin T,
JF, Zagorec M, Francke C, Hartke A, Deutscher
Han C, Detter JC, Bruce D, Goodwin L, Land M,
J. Complete genome sequence of the probiotic Lacto-
Hauser L, Chang YJ, Jeffries CD, Pati A,
bacillus casei strain BL23. J Bacteriol. 2010;192
Mavromatis K, Mikhailova N, Chen A,
(10):2647–8.
Palaniappan K, Chain P, Rohde M, Goker M,
6. Ricaurte JC, Klein O, Labombardi V, Martinez V,
Bristow J, Eisen JA, Markowitz V, Hugenholtz P,
Serpe A, Joy M. Rothia dentocariosa endocarditis
Kyrpides NC, Klenk HP, Lucas S. Complete genome
complicated by multiple intracranial hemorrhages.
sequence of Veillonella parvula type strain (Te3).
South Med J. 2001;94(4):438–40.
Stand Genomic Sci. 2010;2(1):57–65.
Subgingival Microbes
4
Quan Yuan, Chenchen Zhou, Jing Xie, Demao Zhang,
Liwei Zheng, Yuqing Li, Biao Ren, Xian Peng,
and Xuedong Zhou
Abstract the supragingival plaque to the periodontal

This chapter mainly introduces the common pocket and attaches to the root surface of
microbes in subgingival plaque. Subgingival the tooth. Its structure is similar to the
plaque refers to the plaque located below supragingival plaque, mainly Gram-positive
the gingival margin and distributed in the cocci, bacilli, and filamentous bacteria, and
gingival groove or periodontal pocket. It can a small number of Gram-negative short
be divided into adherent subgingival plaque bacillus and spirochetes can be seen.
and nonadherent subgingival plaque. The Nonadherent subgingival plaque is located
adherent subgingival plaque extends from on the surface of adherent subgingival
plaque, with loose structure, and is mainly
Gram-negative anaerobe. The biological and
Q. Yuan pathogenic characteristics of Gram-positive
Department of Dental Implantology, West China Hospital bacteria, including Enterococcus, Eubacte-
of Stomatology, Sichuan University, Chengdu, China rium, Peptostreptococcus, and Propioni-
State Key Laboratory of Oral Diseases, National Clinical bacterium, and Gram-negative bacteria
Research Center for Oral Diseases, West China Hospital of including Bacteroides, Capnocytophaga,
Eikenella, Fusobacterium, Helicobacter,
C. Zhou · J. Xie · D. Zhang · Y. Li · B. Ren · X. Peng Aggregatibacter, Prevotella, Porphyromonas,
State Key Laboratory of Oral Diseases, National Clinical
and Treponema, were introduced in this
Stomatology, Sichuan University, Chengdu, China chapter. Gram staining, plate culture, colony,
and scanning electron microscope (SEM)
L. Zheng
Department of Pediatric Dentistry, West China Hospital of images of each microorganism were also
Stomatology, Sichuan University, Chengdu, China provided.
State Key Laboratory of Oral Diseases, West China
Hospital of Stomatology, Sichuan University, Chengdu, Keywords
China
Bacteroides · Fusobacterium ·
X. Zhou (*)
State Key Laboratory of Oral Diseases, National Clinical Aggregatibacter · Prevotella ·
Research Center for Oral Diseases, West China Hospital of Porphyromonas · Treponema
China

https://doi.org/10.1007/978-981-15-7899-1_4
146 Q. Yuan et al.
4.1 Gram-Positive Bacteria E. faecalis can ferment most carbohydrates.

The main acid produced by glucose fermentation
4.1.1 Enterococcus is lactic acid. E. faecalis can also hydrolyze argi-
nine to produce ammonia.
Enterococci are facultative Gram-positive cocci
and belong to Lancefield group D. E. faecalis is
also called Streptococcus faecalis and is the most 4.1.2 Eubacterium
common species in the genus Enterococcus. In
recent years, it has been closely studied due to its Eubacterium is a genus of Gram-positive
high detection rate in infected root canals. non-sporulating strictly anaerobic bacilli. The
E. faecalis cells are Gram-positive, oval name of the genus is still disputed. Bergey’s
(0.5–1 μm in diameter), and non-motile. Most Manual of Systematic Bacteriology volume
cells are arranged in pairs or as short chains 2 (1986) points out that the Greek prefix “eu”
(Fig. 4.1). Cellular morphology by SEM is means good and useful, rather than “true.” There-
shown in Fig. 4.2. The G + C content of its fore, the author believes that that “Eubacterium”
DNA is 33.5% [1]. The type strain is NCTC775 is the more appropriate name. Currently, bacteria
(ATCC19433, NCDO5681). species detected in oral cavity that belong to this
E. faecalis is a facultative anaerobe. Cells of genus include E. alactolyticum, E. saburreum,
this species can form smooth, non-transparent, E. lentum, E. limosum, E. nodatum, E. brachy,
white or creamy, spherical colonies on common E. timidum, E. saphenus, and E. minutum.
nutrient agar plates (Fig. 4.3). However, colonies Cells can be homogeneous or polymorphously
formed on PSE agar plates containing cholate, rod-shaped. No spores are produced. Cells are
esculin, and sodium azide (the selective agar Gram-positive, but Gram staining old cultures
medium for Pfizer Enterococci) are brownish and cultures that have produced acid in the culture
black with brown aureole (Fig. 4.4). This can be medium will yield negative results.
used as a characteristic to distinguish E. faecalis Eubacteria are strictly anaerobic. Culturing
from other bacteria. Colonies observed by stereo- cells can be difficult due to its strict anaerobic
microscope are shown in Fig. 4.5. demands, and some strains can only grow in
Fig. 4.1 Cells of

E. faecalis (Gram-positive
cocci)
4 Subgingival Microbes 147
Fig. 4.2 Cells of

E. faecalis (SEM)

E. faecalis (common
nutrient agar plate)
148 Q. Yuan et al.

E. faecalis (PSE agar plate)

E. faecalis
(stereomicroscope)
pre-reduced medium. The optimum growth tem- mainly consist of butyric acid, acetic acid, and
perature is 37 C, while the optimum pH is 7.0. formic acid.
Eubacteria are chemoheterotrophs and pro- Most eubacteria from the oral cavity are rela-
duce energy from mixed organic acids produced tively biochemically inactive. In most cases, cells
by carbohydrates or protein metabolism. These test negative for catalase and do not hydrolyze
hippurate. Carbohydrate fermentation, indole gelatin. Ammonia can be produced from arginine,
production, nitrate reduction, esculin hydrolysis, and H2O2 can be produced from agar medium
and other biochemical tests can help differentiate containing 1% arginine. Under anaerobic
the different species in the genus. conditions, the bacteria can produce H2S in the
Eubacteria mainly colonize the saliva and beveled bottom of triple sugar iron agar, but can-
plaque as a member of the normal oral microflora. not produce H2S in SIM culture medium. The
E. lentum and E. limosum can be detected in the G + C is 62% in DNA, and the type strain is
oral cavity. E. nodatum, E. brachy, E. timidum, JCM 9979
E. saphenus, and E. minutum are new species (¼DSM2243 ¼ ATCC25559 ¼ NCTC11813).
isolated from subgingival plaque of patients
with periodontitis and are considered as potential
periodontal pathogens. The G + C content in 4.1.3 Peptostreptococcus
Eubacterium DNA is 30–55% (analyzed by
Tm), and the percentage in the type species is Peptostreptococcus is the most common Gram-
47% (by Tm). positive anaerobic coccus in the human oral cav-
In 1999, Kageyama et al. called for a change in ity and in the clinic. P. anaerobius and P. micros
the classification of E. lentum and proposed for it are the most commonly encountered species in
to be grouped with Eggerthella lenta, the type this genus.
species of genus Eggerthella [2]. The cells of P. anaerobius are Gram-positive
E. lentum is Gram-positive, irregular, (Fig. 4.10), spherical, approximately 0.5–0.6 μm
non-sporulating, strictly anaerobic bacillus in diameter, and arranged in pairs or chains. Cells
(Figs. 4.6 and 4.7). As a strict anaerobe, most in early cultures have been observed to form long
strains can grow between 30 and 45 C, while chains. Cells observed by SEM are shown in
some strains can grow at 25 C. Arginine can Fig. 4.11. The G + C content of the P. anaerobius
promote bacterial growth. Characteristic colonies genome is 33%–34%, and its type strain is
are shown in Figs. 4.8 and 4.9. ATCC27337.
E. lentum does not ferment carbohydrates. The The optimal temperature for P. anaerobius
cells do not hydrolyze aesculin, hippurate, and growth is 37 C, and cells of this species do not
Fig. 4.6 E. lentum cells

(Gram stain)
150 Q. Yuan et al.
Fig. 4.7 E. lentum cells

(SEM)
Fig. 4.8 E. lentum

Fig. 4.9 E. lentum

colonies
(stereomicroscope)
E. lentum on horse blood
agar forms surface colonies
that are 0.5–2 mm in
diameter, rounded or
convex, low, dim and dark
or lustrous, translucent or
opaque, and smooth,
wedge-shaped, or neat-
edged. A striped
appearance can be observed
under incident light
Fig. 4.10 Cells of

P. anaerobius (Gram stain)
grow well at 25 or 30 C and do not grow at all at colonies with a smooth surface, without hemo-
45 C. Growth is stimulated by 0.02% lytic zone (Fig. 4.12). Colonies formed on the
polysorbate-80. P. anaerobius cells form surface of BHI supplemental medium without
pinpoint-like or rounded (about 1 mm in diame- addition of blood are gray. Broth cultures of
ter), raised, white, glossy, non-transparent P. anaerobius are usually not muddy, and
152 Q. Yuan et al.
Fig. 4.11 Cells of

P. anaerobius (SEM)

P. anaerobius (BHI blood
agar plate)

P. anaerobius
(stereomicroscope)
granulated or viscous precipitates can be The cells are polymorphic in form, many have
observed. Colonies observed by stereomicro- two rounded ends, and others are shaped like
scope are shown in Fig. 4.13. Corynebacterium diphtheria, with one rounded
P. anaerobius is relatively biochemically end and one tapered end. Cells are 0.5–0.8 μm
inactive, and cells usually do not ferment in diameter and 1–5 μm in length and form two
carbohydrates. The main acidic metabolic branches or branched rods. Cocci are observed in
end-products in PVG liquid culture of the type old cultures, arranged as single cells, in pairs, in
strain are acetic acid, isobutyric acid, butyric acid, chains, or in “Y”- or “V”-shaped branched
isovaleric acid, and isocaproic acid. P. anaerobius chains. Cells are Gram-positive, but some cells
can produce CO2 and H2 from pyruvates under can also stain Gram-negative.
anaerobic conditions. In deep glucose agar, Members of this genus are anaerobic or
P. anaerobius can produce a large amount of gas microaerophilic bacteria. The highest rate of
and generate ammonia from peptone. growth takes place 48 h after inoculation. The
Dental plaque and gingival sulcus are the main propionibacteria are chemoheterotrophic bacteria
habitats for P. anaerobius in the oral cavity. that need a complex nutritional medium such as
Moreover, P. anaerobius is often detected in BHI agar in order to be cultured. Most species can
clinical samples of periodontitis, pulpitis, and grow in dextrose broth containing 20% bile or
pericoronitis. 6.5% NaCl. P. acnes colonies on the surface of
agar can produce colorful pigmentation including
white, gray, pink, red, or yellow.
The main acid metabolites are propionic acid
4.1.4 Propionibacterium
and acetic acid when cultured in PYG broth. The
production of a significant quantity of propionic
Propionibacterium is a genus of Gram-positive
acid is the identifying feature of this genus when
polymorphic bacilli that do not sporulate. The
attempting to differentiate them from other Gram-
genus can be divided into two groups: one that
positive non-sporulating anaerobic bacteria. They
lives on the skin, including inside the oral and
can also produce some isovaleric acid, formic
intestinal tracts, named the sores and blisters
acid, succinic acid, and lactic acid.
group or P. acnes and another that lives in dairy
All the species in this genus can use glucose to
products, cheese, or green fodder named dairy
produce acid. They test positive for catalase. Spe-
group or typical propionibacteria.
cies of Propionibacterium are distinguished using
154 Q. Yuan et al.
indole production, nitrate test, aesculin hydroly- 4.2 Gram-Negative Bacteria

sis, gelatin liquification, and other biochemical
tests such as the fermentation of sucrose, maltose, 4.2.1 Bacteroides
and mannitol.
The G+ C content of Propionibacterium DNA Bacteroides is a genus of Gram-negative, obligate
is 53%–57% by Tm method. The type species is anaerobic, non-sporulating bacilli that belong to
P. freudenreichii. the family Bacteroidaceae. Members of this
P. acnes is a Gram-positive irregular bacillus genus are chemoheterotrophs and can use
[3] (Figs. 4.14, 4.15, and 4.16). It is either anaer- carbohydrates, peptone, and other intermediate
obic or microaerophilic. A medium with low bacterial metabolites.
redox potential is required for primary cultures. Bacteroides are naturally found in the mouth,
Characteristic colonies are shown in Figs. 4.17 tongue, intestinal tract, and vagina. All strains
and 4.18. Culture in dextrose broth is cloudy or that can tolerate bile (20% oxgall salts) fall col-
clear with fine granular precipitates. In old broth, lectively into the B. fragilis group, including
the culture exhibits light red precipitation. The B. fragilis, B. thetaiotaomicron, etc., that are
final pH value of a culture is 4.5–5.0 in PYG detected in cultures from appendicitis, peritonitis,
broth. The terminal acid metabolites are propionic and cervicitis clinical specimens. Other species
acid and acetic acid. that cannot tolerate bile and that produce melanin
P. acnes is part of the normal microflora, but were reclassified to the genera Porphyromonas
the number of cells varies greatly between differ- and Prevotella.
ent individuals. P. acnes can be separated from Cells measure 0.8–1.8 0.8–1.6 μm when
the secretions from acne, wounds, blood, pus, and grown in glucose broth, often showing visible
intestinal contents. The G+ C content of the bac- vacuoles or darker stain at the ends. Cells are
terial DNA is about 57%–60% (by Tm method). arranged singly or in pairs with no spores. Many
The type strain is ATCC6919 (NCTC737). strains are encapsulated.
Fig. 4.14 P. acnes cells

(Gram stain)

(SEM)

(SEM)
P. acnes cells are
polymorphic, but are
mainly thin and long
rod-shaped cells. Sero
variant type II cells are
mainly spherical with no
spores. Cells stain Gram-
positive but some can stain
Gram-negative
156 Q. Yuan et al.
Fig. 4.17 P. acnes

Fig. 4.18 P. acnes

colonies
(stereomicroscope)
P. acnes can generate
pinprick-sized colonies to
colonies 0.5 mm in
diameter, white or gray,
glossy, translucent or
opaque, and pad-shaped or
neat-edged 2–3 days post-
inoculation on the surface
of horse blood or rabbit
blood agar. On rabbit blood
agar, 68% of Sero variant
type I strains can generate
hemolytic reaction, while
Sero variant type II strains
cannot
4.2.1.1 Bacteroides fragilis chlorinated hemoglobin and vitamin K1. Growth

B. fragilis are Gram-negative bacilli (Figs. 4.19, is inhibited by 20% bile. Optimum growth takes
4.20, and 4.21). They are obligate anaerobes and place at pH 7.0. Characteristic colonies are shown
grow well in nutrient agar supplemented with in Figs. 4.22 and 4.23.
Fig. 4.19 B. fragilis

(Gram stain)

(SEM)
The cells mainly produce succinic acid and acid, formic acid, benzene, and acetic acid are
acetic acid in PYG liquid medium, but lactic also produced. This species is biochemically
acid, propionic acid, isovaleric acid, isobutyric active and is capable of fermentating glucose,
158 Q. Yuan et al.

(SEM)
B. fragilis appears rounded
on both ends, with visible
vacuoles or darker stain at
the ends. The cells are
approximately
0.8–1.3 1.6–8.0 μm when
grown in glucose broth. The
cells are can be single or in
pairs; they form no spores
and are Gram-negative

Fig. 4.23 B. fragilis colonies (stereomicroscope) B. fragilis can form gray colonies about 1–3 mm in diameter. The
colonies are rounded, smooth, translucent, or semi-transparent on blood agar
lactose, maltose, fructose, raffinose, and other 4.2.2 Capnocytophaga

carbohydrates, hydrolyzing esculin. B. fragilis
tests negative with the indole test. Capnocytophaga are Gram-negative, facultative
The percent G + C in B. fragilis DNA is 41%– anaerobic bacteria. They were the earliest bacteria
44% (using the Tm method). The type strain is to be isolated and named from the human
ATCC25285 (NCTC9343). subgingival plaque. Common Capnocytophaga
species are C. ochracea, C. sputigena,
C. gingivalis, C. granulosa, and C. haemolytica.
4.2.1.2 Bacteroides thetaiotaomicron
Capnocytophaga cells are
This species is Gram-negative (Figs. 4.24 and
0.42–0.6 2.5–2.7 μm in size and are shaped
4.25) and its morphology under SEM is shown
like bent rods or filaments, usually with rounded
in Figs. 4.26 and 4.27.
or slightly pointed ends. The length of the cells
B. thetaiotaomicron are obligate anaerobes
varies. In liquid culture, cells are polymorphic or
and have similar growth requirements and
take on a long, filamentous morphology, and tight
characteristics as B. fragilis. Characteristic
clumps can be observed. The bacteria produce no
colonies are shown in Figs. 4.28 and 4.29.
capsule and no sheath. They do not form spores,
Cells exhibit active biochemistry and are able
have no flagella, but have sliding motility.
to ferment glucose, lactose, maltose, fructose,
Capnocytophaga are facultative anaerobes,
raffinose, arabinose, cellobiose, rhamnose, and
but do not grow under aerobic conditions.
other carbohydrates. Cells can hydrolyze esculin
Cultures grow well in a CO2 added anaerobic
and test positive for indole. Cells grow well in
environment. Primary cultures should be
medium containing 20% bile. The genomic G + C
performed in an aerobic environment with CO2
content is 40%–43% (by Tm). The type strain is
added.
ATCC29148 (NCTC10582).
160 Q. Yuan et al.
Fig. 4.24 B. thetaiotaomicron cells (Gram stain)
Fig. 4.25 B. thetaiotaomicron cells (Gram stain)
Species in this genus often form colonies of colonies become 2–4 mm in diameter and take
wet, thin, flat, diffuse growth with ragged edges on the appearance of bumps. Some colonies may
on TS blood agar and BHI blood agar. After 24 h become recessed into the agar. Aside from hemo-
of incubation at 35–37 C, the size of colonies is lytic Capnocytophaga (which produces
like pinpricks. After incubation for 48–96 h, β-hemolysis), other species are not hemolytic on
Fig. 4.26 B. thetaiotaomicron cells (SEM)
blood agar. The concentration of agar in the saliva and sputum, and throat specimens. These
medium affects the force of sliding motility. bacteria are often detected in mixed bacterial
Capnocytophaga cultures can produce a special infections, such as juvenile periodontitis, infected
smell, similar to caramel or a bitter almond flavor. root canal, dry socket after tooth extraction, oral
Colonies on the agar surface can produce ulcers, and other clinical specimens, and can also
white to pink or orange yellow pigmentation. be isolated from bacteremia; soft tissue
Centrifuged cells appear to be an orange yellow infections; injuries and abscesses at various
clump. locations; cerebrospinal fluid; vaginal, cervical,
Capnocytophaga does not produce indole; can and amniotic fluid; trachea; and eyes.
ferment glucose, lactose, maltose, mannose, and The G+ C content of Capnocytophaga geno-
sucrose acid; and does not ferment mannitol and mic DNA is 33%–41% (by Tm method). The type
xylose. It can hydrolyze esculin and tests negative species is yellowish Capnocytophaga.
for catalase and oxidase, while testing positive for
ONPG and benzidine. Nitrate reduction, dextran
4.2.2.1 Capnocytophaga gingivalis
hydrolysis, starch or gelatin hydrolysis, and other
This Gram-negative bacterium is shown in
biochemical tests can help identify this genus of
Figs. 4.30, 4.31, and 4.32. Characteristic colonies
bacteria.
are shown in Figs. 4.33 and 4.34.
Member of the normal microflora of humans
C. gingivalis does not ferment lactose, galac-
and primates, this genus is mainly found to colo-
tose, amygdalin, salicin, cellobiose, esculin, and
nize the oral cavity. They are common oral bacte-
glycogen. It also does not hydrolyze starch, dex-
ria and can be obtained from various parts of the
tran, and gelatin. Only 8% of the strains can
oral cavity, including plaque, gingival sulcus,
reduce nitrate.
162 Q. Yuan et al.
Fig. 4.27 B. thetaiotaomicron cells (SEM) 0.7–1.1 1.3–8.0 μm when grown in glucose broth and
B. thetaiotaomicron appears spherical or rounded on both are arranged as single cells or in pairs. Cells stain Gram-
ends, with visible dark stain at the ends. Cells are negative
Fig. 4.28 B. thetaiotaomicron colonies (BHI blood agar)

Fig. 4.29 B. thetaiotaomicron colonies (stereomicro- on blood agar. An orange peel-like appearance can be
scope) observed on the colony surface under stereomicroscope
B. thetaiotaomicron colonies are about 1–3 mm in diame-
ter. They form bumpy, glossy, soft, white, round colonies
Fig. 4.30 Cells of C. gingivalis (Gram stain)

164 Q. Yuan et al.
Fig. 4.31 Cells of

C. gingivalis (SEM)
Fig. 4.32 Cells of

C. gingivalis (SEM)
Cells of C. gingivalis are
fusobacterium-shaped; the
ends are usually rounded.
Cells are often arranged in
an orderly manner and stain
negative by Gram stain

C. gingivalis (BHI blood
agar)

C. gingivalis
(stereomicroscope)
Colonies of C. gingivalis on
BHI blood agar are
irregular, gray colonies,
with ragged edges. Typical
hair-like diffuse colonies
can be seen under the
stereomicroscope
The G + C content in C. gingivalis DNA is 4.2.2.2 Capnocytophaga sputigena

40% (by method). The type strain is This species is a Gram-negative bacillus
ATCC33624. (Figs. 4.35, 4.36, and 4.37). Characteristic
colonies are shown in Figs. 4.38 and 4.39.
166 Q. Yuan et al.
Fig. 4.35 Cells of

C. sputigena (Gram stain)
Fig. 4.36 Cells of

C. sputigena (SEM)
The cells can ferment lactose, glucose, malt- does not hydrolyze starch and dextran. The
ose, and sucrose, but do not ferment mannitol, hydrolysis of gelatin and nitrate reduction are
cellobiose, glycogen, and xylose. C. sputigena the most important features by which this species
Fig. 4.37 Cells of

C. sputigena (SEM)
Cells of C. sputigena are
bent bacilli, usually with
rounded ends. They
produce no spores and stain
Gram-negative

C. sputigena (BHI blood
agar)
168 Q. Yuan et al.
Fig. 4.39 Mesh-like

structure on the surface of
colonies of C. sputigena
(stereomicroscope)
Colonies of C. sputigena on
BHI blood agar surface are
flat, spread orange colonies.
Typical hair-like diffuse
structure can be seen under
the stereomicroscope
can be distinguished from other members of the E. corrodens does not grow well in liquid
genus. C. sputigena may be involved in juvenile media. Broth supplemented with 0.2% agar, cho-
periodontitis. lesterol (10 mg/L), and 3% serum can promote its
The G + C content of C. sputigena DNA is growth. Under aerobic conditions, 5% to 10%
33%–38% (Tm method). The type strain is bile can inhibit growth. However under anaerobic
ATCC33612. conditions, up to 10% bile can be tolerated.
E. corrodens is biochemically inactive. It does
not ferment glucose and other carbohydrates or
produce acid. It tests negative for catalase, urease,
4.2.3 Eikenella
arginine dehydrogenase, and indole, but is posi-
tive for nitrate reduction, as well as oxidase and
Eikenella is a genus of Gram-negative facultative
lysine decarboxylase.
anaerobic bacteria that do not produce spores.
E. corrodens is a member of the normal flora
E. corrodens was thus named because it
in the human oral cavity and intestinal tract. It can
produces typical colonies which can erode agar.
also be isolated from the upper respiratory tract
It is also known as Bacteroides corrodens and is
and urogenital tract. As an opportunistic patho-
the only species in the genus Eikenella [4]. Cells
gen, it is often associated with other bacterial
stain Gram-negative (Figs. 4.40, 4.41, and 4.42).
pathogens to cause mixed bacterial infections,
E. corrodens is a facultative anaerobe, and
especially in the mouth and respiratory tract. Its
primary cultures require anaerobic conditions or
detection rate is higher in lesions of active adult
supplementation with 5%–10% CO2. It is essen-
periodontitis and specimens of dry socket after
tial to add hemin (5–25 mg/L) to the culture when
tooth extraction; it is suspected to be related to
grown under aerobic conditions. The optimum
periodontitis.
growth temperature is from 35 to 37 C, the
The G + C content in its genomic DNA is
optimum pH is 7.3, and cultures require sufficient
56%–58% (by Tm method). The type strain is
humidity. Characteristic colonies are shown in
ATCC23834 (NCTC10596).
Figs. 4.43, 4.44, and 4.45.
Fig. 4.40 Cells of

E. corrodens (Gram-
negative)
Fig. 4.41 Cells of

E. corrodens (SEM)
170 Q. Yuan et al.
Fig. 4.42 Cells of

E. corrodens (SEM)
Cells of E. corrodens are
0.3–0.4 1.5–4.0 μm in
size and are rounded at the
ends. They are mostly
rod-shaped, short
rod-shaped, or club-shaped
and can sometimes be
found in the shape of a short
wire rod. The cells do not
non-motile. “Tremor-
shaped movement” can be
seen on the surface of the
agar. Cells stain Gram-
negative

E. corrodens (BHI blood
agar)
Fig. 4.44 Colonies of E. corrodens (stereomicroscope)
Fig. 4.45 A pearlescent ring can be observed at the center from 0.5 to 1.0 mm (after 48 h culture). Colonies are light
of colonies of E. corrodens (stereomicroscope) yellow and opaque, and the center of the colony has a clear
Agar cultures of E. corrodens have a bleach-like smell, pearlescent ring. The edge of the colony is rough and
similar to Haemophilus and Pasteurella cultures on agar. refractive and has a hair-like diffuse edge; “tremor-shaped
Colonies do not produce hemolytic reactions on blood movement” can be seen on the surface of the agar. The
agar, but a light green ring can be seen around colonies. non-invasive phenotype forms colonies with a diameter of
Two different types of colonies can form on blood agar: 0.5–1 mm. The colonies are hemispherical and translucent,
invasive phenotype and non-invasive phenotype. The with no hair-like diffuse edge. They do not invade agar,
invasive strain forms on the surface of blood agar when show no adhesion to the agar, and have no “tremor-shaped
conditions are 36 C, with 15% CO2 and 100% humidity. movement”
Colony diameter ranges 0.2–0.5 mm (after 24 h culture) or
172 Q. Yuan et al.
4.2.4 Fusobacterium The genomic G + C content of this genus is

26%–34% (Tm). The type species is
Fusobacterium is a group of Gram-negative obli- F. nucleatum.
gate anaerobic bacteria that do not form spores.
They belong to the family Bacteroidaceae. Spe-
4.2.4.1 Fusobacterium nucleatum
cies mainly found in the oral cavity are
The species F. nucleatum contains five subspe-
F. nucleatum, F. necrophorum, and F. varium.
cies: F. nucleatum animal subspecies
Most fusobacteria are spindle-shaped cells.
(F. nucleatum subsp. animalis), fusiform subspe-
They may also appear polymorphous. Polymor-
cies (F. nucleatum subsp. fusiforme), nuclear sub-
phic fusobacteria can form globular or long fili-
species (F. nucleatum subsp. nucleatum),
form cells. F. necrophorum can take on many
polymorphic subspecies (F. nucleatum subsp.
other morphologies, including irregular spherical
polymorphum), and Vincent subspecies
swollen cells and linear cells. The cells are
(F. nucleatum subsp. vincentii).
non-motile, do not form spores, and stain Gram-
The cells are Gram-negative spindle-shaped
negative.
coli. Cell morphologies are shown in Figs. 4.46,
These obligate anaerobes can be grown in
4.47, and 4.48. F. nucleatum is an obligate anaer-
aerobic conditions on agar plates when 5%–10%
obe, but can grow under atmospheric conditions
CO2 is added to the culture conditions. Their
with >6% oxygen by volume. The cells are viable
sensitivity to oxygen depends on the specific bac-
even after 100 minutes of exposure to the air.
terial species, the quantity of cells inoculated, and
Characteristic colonies are shown in Figs. 4.49,
the type of culture medium.
4.50, and 4.51.
Fusobacterium can be detected in clinical
F. nucleatum is not biochemically active. They
specimens of pus or gangrene infections.
do not transform lactate into propionate. They can
F. nucleatum has a high prevalence in saliva and
produce indoles and DNase, but do not produce
dental plaque and is considered to be one of the
phosphatase. Most of the strains produce H2S and
bacteria involved in mixed infections of peri-
can agglutinate red blood cells from both humans
odontitis, root canal infection, and postextraction
and animals.
infection.
Fig. 4.46 F. nucleatum

cells (Gram stain)

cells (SEM)

cells (SEM)
F. nucleatum measure
0.4–0.7 3–10 μm in
diameter in glucose broth
culture, with a fusiform or
tapered end. Swelling can
often be observed at the
center of the cell, and
Gram-positive particles can
be observed inside the cell.
Cell length is generally
associated with growth
conditions. They have no
pili and no flagella. Cells
stain Gram-negative
174 Q. Yuan et al.
Fig. 4.49 F. nucleatum colonies (BHI blood agar)
Fig. 4.50 F. nucleatum “breadcrumb” colonies (stereo- colonies. F. nucleatum generally do not produce hemolytic
microscope) reactions on horse and rabbit blood agar. There is visible
F. nucleatum can form colonies 1–2 mm in diameter. flocculent or particle precipitation in glucose broth
Colonies are rounded or slightly irregular, bumpy, cultures, but the broth does not necessarily become turbid.
pad-shaped, translucent, and with odor on blood agar The culture has a foul smell, and the final pH value is of a
plates. Colonies commonly appear to have spots of light glucose broth culture is pH 5.6–6.2
that shine through. These are referred to as “breadcrumbs”

isolated from saliva
samples (stereomicroscope)
F. nucleatum are mainly found on transparent can also be found. The final pH value of a culture
gingiva and the gingival groove and make up the in glucose or fructose broth is 5.6–6.3. A few
oral normal flora. They can also be isolated from strains have a final pH value of 5.8–5.9 in maltose
upper respiratory tract and chest infections and cultures.
occasionally from wounds and other sites of F. necrophorum can agglutinate red blood
infection. F. nucleatum has a high rate of detec- cells from human, rabbit, and guinea pig blood,
tion in destructive periodontal disease and infec- but not blood from cattle. It cannot hydrolyze
tious dental pulp, as it assists other pathogens in glucan. Neither phosphatase, superoxide
establishing oral infectious diseases. dismutase, nor lysine decarboxylase is detected,
The genomic G + C content is 27%–28%. The but it can produce DNase.
type strain is ATCC25586 [5]. F. necrophorum is mainly isolated from some
clinical disease specimens from the human and
4.2.4.2 Fusobacterium necrophorum animal body, including abscess, blood, and
There are two subspecies of F. necrophorum: necrotic lesions, and especially in liver abscess.
F. necrophorum fundamental form subspecies The bacteria can be also detected in the mouth.
(F. necrophorum subsp. funduliforme) [6] and The genomic G + C content is 31%–34%. The
F. necrophorum necrosis subspecies type strain is ATCC25286.
(F. necrophorum subsp. necrophorum).
F. necrophorum is a Gram-negative bacillus, 4.2.4.3 Fusobacterium varium
with diverse cellular morphologies (Figs. 4.52, This Gram-negative species’ cell morphology is
4.53, 4.54, 4.55, and 4.56). Heptose and KDO shown in Figs.4.62, 4.63, and 4.64. Heptose and
are among the cell wall lipopolysaccharides. KDO make up its cell wall lipopolysaccharides.
F. necrophorum is an obligate anaerobe. Cul- F. varium is an obligate anaerobe. Its culture
ture requirements are similar to related species. conditions are similar to other related species.
Characteristic colonies are shown in Figs. 4.57, Characteristic colonies are shown in Figs. 4.65
4.58, 4.59, 4.60, and 4.61. and 4.66.
When cultured in glucose broth medium, F. varium cannot hydrolyze glucan and does
F. necrophorum appears muddy, and smooth, not produce phosphatase, but it does produce
flocculent particles or filamentous precipitation lysine dehydrogenase and DNase.
176 Q. Yuan et al.
Fig. 4.52 Filament of

F. necrophorum (Gram
stain)
Fig. 4.53 Filament of

F. necrophorum with
particle content (Gram
stain)
F. varium can be isolated from the human 4.2.5 Helicobacter

mouth and human feces; it can also be detected
in suppurative infectious wounds, the upper respi- Helicobacter is a genus of Gram-negative, curved
ratory tract, and peritonitis; but its pathogenicity rod-shaped bacteria with polar flagella. Because
is not yet well-defined. of the differences in their ultrastructure, fatty acid
The genomic G + C content is 26%–28%. The composition, morphology, growth characteristics,
type strain is ATCC8501 (NCTC10560). enzyme activity, and 16 s rRNA sequence when
Fig. 4.54 F. necrophorum

bacillus (Gram stain)

cells (SEM)
compared to the genus Campylobacter, the spe- H. pylori was first isolated and cultivated
cies in this genus were classified as Helicobacter. in vitro from the gastric mucosal tissue of patients
The type species is H. pylori. with chronic gastritis in 1983 by Marshall and
178 Q. Yuan et al.

cells (SEM)
F. necrophorum is
morphologically diverse.
The cell length can vary
significantly and can be
spheroids, rod-shaped to
filaments more than 100 μm
long. Although cells are
approximately 0.5–0.7 μm
in diameter, when cultured
in glucose broth, they may
swell to more than 1.8 μm
in length, with round or
pointed ends. Filamentous
material containing
particles are commonly
seen in broth cultures, while
coliform cells are found in
old cultured cells or on
agar. Cells stain Gram-
negative
Warren [7]. The organism is associated with gas- H. pylori grow under microaerophilic
tritis, duodenal and gastric ulcers, and gastric conditions and have high nutritional
cancer, as well as a number of diseases at distant requirements. They grow well on Columbia
sites. The World Health Organization/Interna- blood agar medium containing 5% defibrinated
tional Agency for Research on Cancer blood or on brain heart infusion blood agar at
(WHO/IARC) listed H. pylori as a Class A car- 37 C, 95% humidity, and under 10% carbon
cinogen in 1994. dioxide, 5% oxygen, and 85% nitrogen. Because
H. pylori are non-sporulating, slender, curved of the long growth period, primary cultures
rods measuring approximately 2.5–- require 3–7 days, and subcultures need 2–4 days
4.0 μm 0.5–1.0 μm. They are pleomorphic to grow. Colonies are pinprick-sized, circular,
and can typically be found as spiral, S-shaped, neat, raised, colorless, and translucent and mea-
or gull-shaped cells (Figs. 4.67, 4.68, and 4.69). sure approximately 0.5–1 mm in diameter
Cells stain Gram-negative with one or more (Figs. 4.70 and 4.71). Resistance of H. pylori to
flagella. Sometimes rods or coccoid forms can various stressors is weak, as they survive for less
be found in addition to the typical cellular than 3 h in air and no more than 1 day at 4 C.
morphologies when grown on solid culture Cultures are sensitive to heat, and the only way to
medium. Under electron microscope, the bacteria preserve cells for the long-term is by cryopreser-
have 2–6 flagella that are approximately 30 nm in vation at –80 C.
thickness and 1–1.5 times longer than the bacte- H. pylori is not biochemically active. It usually
rial cell. Flagella play a role in cellular movement does not produce acid from sugar. Although there
and anchor cells during adhesion. have been a few reports of acid production, it only

colonies producing
α-hemolysis (BHI blood
agar)

colonies producing
β-hemolysis (BHI blood
agar)
180 Q. Yuan et al.

colonies (BHI sheep-blood
agar)

zigzag colonies with
mosaic internal structure
(BHI sheep-blood agar,
stereomicroscope)
Fig. 4.61 F. necrophorum colonies with thread structure light. Most strains can produce α- or β-hemolysis on rabbit
(stereomicroscope) blood agar. In general, β-hemolytic strains are positive for
F. necrophorum forms colonies that are 1–2 mm in diam- lipase (on egg yolk agar), while α-hemolytic and
eter, rounded, raised above the surface, cream-colored, and non-hemolytic strains are negative for lipase and do not
translucent to opaque, with a fan-like or serrated edge on produce lecithin enzyme
blood agar. A mosaic internal structure can be seen in the
Fig. 4.62 F. varium cells (Gram stain)

182 Q. Yuan et al.
Fig. 4.63 F. varium cells

(SEM)
Fig. 4.64 F. varium cells

(SEM)
F. varium cells measure
0.3–0.7 0.7–2.0 μm.
They are polymorphic.
Both cocci and bacilli can
be observed and cells are
present as single cells or in
pairs. Cells stain Gram-
negative, but also show
uneven staining
Fig. 4.65 F. varium

Fig. 4.66 F. varium

colonies
(stereomicroscope)
F. varium forms pinprick-
sized colonies to colonies
1 mm in diameter. They
appear rounded, low, flat,
and convex, with a gray
center and a colorless,
translucent, and neat edge
on blood agar
becomes apparent in media containing a low con- concentrations of bile salts can inhibit culture
centration of peptone. Sugar is not usually the growth. H. pylori produces a large quantity of
sole carbon source. highly active extracellular urease, producing
H. pylori cellular vitality significantly weakens more than 400 times the urease activity than Pro-
at pH 3.5 and below, while physiological teus. H. pylori can also produce oxidase, catalase,
184 Q. Yuan et al.
Fig. 4.67 H. pylori cells

(Gram stain)
Gram-negative cells are
shaped like curved,
S-shaped, or gull-
shaped rods

(SEM)

(SEM)
Fig. 4.70 H. pylori

are tiny pinprick colonies
(circular, neat, raised,
colorless, translucent), and
about 0.5–1 mm in diameter
and almost do not produce
hemolytic reaction
alkaline phosphatase, γ-GGTP, etc. Six positive The infection rate with H. pylori is over 50%
enzymatic reactions are used as the basis for worldwide. The infection does not resolve itself
H. pylori biochemical identification. These are and is sensitive to antibiotic treatment, but the
oxidase, catalase, urease, alkaline phosphatase, recurrence rate is high. The oral cavity is consid-
γ-GGTP, and leucine peptidase. ered to be a secondary site of colonization of
186 Q. Yuan et al.
Fig. 4.71 H. pylori

colonies
(stereomicroscope)
H. pylori and may be associated with its high 4.2.6 Aggregatibacter

recurrence rate. H. pylori has been found in
supragingival plaque or subgingival plaque and Formerly classified as Actinobacillus actinomyce-
saliva, the decayed teeth, infected root canals, and temcomitans, this species was subsequently
mucous membranes of the tongue and buccal and named Haemophilus actinomycetemcomitans,
palatal mucosa by a large number of researchers as is now known as Aggregatibacter actinomyce-
using various molecular technologies. Isolating temcomitans. It is a major pathogen in juvenile
H. pylori using the traditional culturing method periodontitis [9].
is particularly difficult, as there are many different These are Gram-negative bacteria and the mor-
kinds of bacteria in the oral cavity that form the phology of bacterial cells is shown in Figs. 4.72,
dental plaque biofilm. The complex mutually 4.73, an130d 4.74. A. actinomycetemcomitans is
beneficial relationship of coexistence and compe- a facultative anaerobe and grows well in the
tition that is present within the biofilm makes it microaerophilic environment of 5%–10% CO2.
relatively stable environment resistant to external Its optimum growth temperature is 37 C and it
stimuli. As a result, oral H. pylori can more easily does not grow at 22 C. Characteristic colonies
evade drug treatments. are shown in Figs. 4.75, 4.76, and 4.77.
Oral H. pylori infections may be related to oral Cells ferment fructose, glucose, maltose, and
infectious diseases such as periodontal disease, mannose and product acid, but do not ferment
tooth decay, oral ulcer, etc. Studies confirmed sucrose, trehalose, lactose, raffinose, melibiose,
that periodontal disease is more likely to arise in and arabinose. A. actinomycetemcomitans tests
H. pylori-positive patients and the rate of infec- positive for oxidase and catalase, can reduce
tion in H. pylori-positive patients is positively nitrate, does not hydrolyze esculin and hippurate
correlated with the degree of inflammation. Triple sodium, and does not produce H2S and indole.
therapy combining basic periodontal treatment The main colonization site of this species is
(supragingival and subgingival scaling) can subgingival plaque. It is detected both in normal
enhance the eradication of H. pylori and reduce oral bacteria and in lesions of juvenile periodon-
the recurrence rate of H. pylori. titis patients at a higher detection rate. Therefore,
The genome size of H. pylori is about A. actinomycetemcomitans is considered an
1.67 106 bp and the G + C content is 37% important pathogen.
[8]. The type strain is ATCC43504.
Fig. 4.72 Cells of

A. actinomycetemcomitans
(Gram stain)
Fig. 4.73 Cells of

A. actinomycetemcomitans
(SEM)
188 Q. Yuan et al.
Fig. 4.74 Cells of A. actinomycetemcomitans (SEM) arrange as single cells, in pairs, or in piles. They produce
A. actinomycetemcomitans are 0.5–0.8 0.6–1.4 μm in no spores, are non-motile, and do not form capsule. Cells
size. Cells are spherical, club-shaped, or rod-shaped. stain Gram-negative
Rod-shaped cells are common in agar cultures. The cells
Fig. 4.75 A. actinomycetemcomitans colonies (BHI blood agar)

Fig. 4.76 A. actinomycetemcomitans colonies (stereomicroscope)
Fig. 4.77 A. actinomycetemcomitans colonies (stereomi- the agar surface. Typical colonies are star-shaped or
croscope) shaped like crossed cigars, with irregular edges. In broth
On the surface of the agar, A. actinomycetemcomitans culture, the growth shows small particle-like opacity and
forms small colonies, with a diameter of approximately often sticks to the flask wall. However, some strains grow
0.5–1.0 mm. Primary cultures are often difficult to lift off into a homogeneously turbid culture after repeated cultures
190 Q. Yuan et al.
The genomic G + C content is 43% (by Tm Species of this genus ferment glucose and hydro-
method). The type strain is NCTC9710. lyze gelatin. They are sensitive to bile salt and can
thus be distinguished from other bacteroides that
can tolerate bile salts.
Prevotella are dominant bacteria in the human
4.2.7 Prevotella
gingival groove and are also the suspected
pathogens behind periodontitis.
Prevotella is a genus named after the French
microbiologist A. R. Prevol. These bacteria
belong to the genus Bacteroides and include 4.2.7.1 Prevotella intermedia
bile-sensitive strains and melanin-producing, P. intermedia is a Gram-negative, black-
sugar-metabolizing strains. pigmented, anaerobic bacterium [10]. Typical
The main species of Prevotella found in the cell morphologies are shown in Figs. 4.78, 4.79,
oral cavity are P. intermedia, P. melaninogenica, and 4.80.
P. loescheii, P. nigrescens, P. denticola, and As an obligate anaerobe, cultures require
P. corporis. hemin and vitamin K. Most species grow well in
The most frequently found cell morphology is temperatures between 25 and 45 C. For other
short bacillus, but long bacilli are sometimes cultural demands, refer to the genus Prevotella.
observed. The cells are non-sporulating, are Characteristic colonies are shown in Figs. 4.81
non-motile, and stain Gram-negative. and 4.82. Culture in glucose broth is cloudy, with
Bacteria belonging to this genus are obligate even precipitation and sticky or slightly sticky
anaerobes and most cultures require deposits at times. The final pH value of in glucose
supplementing with hemin and vitamin K. On broth ranges from pH 4.9 to 5.4.
blood agar, Prevotella spp. produce melanin to P. intermedia can produce indole and hydro-
form black colonies. In PYG liquid medium, lyze gelatin, but not esculin. Cells ferment glu-
these bacteria can produce acetic acid and cose and sucrose, but not arabinose, larch sugar,
succinic acid as the major terminal acid products. cellobiose, rhamnose, galactose, and salicin. Cells
Fig. 4.78 P. intermedia cells (Gram stain)

Fig. 4.79 P. intermedia

cells (SEM)
Most P. intermedia cells
form short rods and
measure
0.4–0.7 1.5–2 μm, while
some cells can measure up
to 12 μm in diameter. Cells
stain Gram-negative
Fig. 4.80 P. intermedia

cells (SEM)
192 Q. Yuan et al.
Fig. 4.81 P. intermedia colonies (BHI blood agar)
Fig. 4.82 P. intermedia colonies (stereomicroscope) 48 h under anaerobic conditions, colonies may appear
Most strains of P. intermedia form colonies 0.5–2.0 mm in gray, brown, or black. Colonies can produce a hemolytic
diameter. Colonies are round, low, convex, and translu- ring on rabbit blood agar. One-third of P. intermedia
cent, with a smooth surface. Colonies show hemolytic strains can produce dark brown to black colonies within
reaction on the surface of blood agar, while aging or 2 days. Colonies fluoresce brick red when exposed to long-
large colonies may appear opaque. After incubation for wavelength UV light
can produce superoxide dismutase, but do not Most strains ferment glucose, maltose,
hydrolyze dextran. sucrose, and maltodextrin to produce acid. They
The site of colonization is the gingival sulcus, also produce indole, hydrolyze starch, and hydro-
but cells also can be found in saliva, dental calcu- lyze gelatin. In liquid medium containing glu-
lus, and other plaque specimens. Previous cose, these bacteria can produce acetic acid,
research has shown that this species is the main succinic acid, isobutyric acid, and isovaleric acid.
pathogenic bacteria in pregnancy-related gingivi- The genomic G + C content is 40%–44%. The
tis. In addition, the bacteria can also be isolated type strain is ATCC33563 (namely NCTC9336,
from pericoronitis, the focus of infection after VPI8944).
tooth extraction, infected root canals, infections
of the head and neck, and pleural infection.
4.2.7.3 Prevotella melaninogenica
P. intermedia is occasionally isolated from
P. melaninogenica is a Gram-negative,
blood, abdominal, or pelvic specimens.
non-sporulating, melanin-producing obligate
The genomic G + C content is 41%–44%. The
anaerobic bacterium [11]. Bacterial cells are
type strain is ATCC25611.
shown in Figs. 4.87 and 4.88.
Most strains require hemin (1 mg/L) and vita-
4.2.7.2 Prevotella nigrescens
min K (0.1 mg/L) to grow and can grow at pH 8.5
Originally, this species was classified as a strain
and 25 C. Characteristic colonies are shown in
of P. intermedia. However, since it does not pro-
Figs. 4.89, 4.90, and 4.91.
duce lipase, it can be thus distinguished from
Usually, glucose broth culture turns turbid and
P. intermedia.
is accompanied by smooth or filamentous precip-
P. nigrescens is a Gram-negative,
itation. The final pH value range is from pH 4.6 to
non-sporulating, melanin-producing, obligate
5.0.
anaerobe. Cell morphologies are shown in
Clinical specimens are isolated from the
Figs. 4.83 and 4.84.
gingival sulcus.
For culture requirements, refer to the informa-
The genomic DNA G+ C content is 36%–
tion on P. intermedia. Characteristic colonies are
40%. The type strain is ATCC25845.
shown in Figs. 4.85 and 4.86.
Fig. 4.83 P. nigrescens

cells (Gram stain)
194 Q. Yuan et al.

cells (SEM)
Most cells of P. nigrescens
is a coccobacillus. In broth
culture the cells are
0.3–0.4 1–2 μm in size.
Some cells can measure up
to 6–10 μm. Cells stain
Gram-negative

Fig. 4.86 P. nigrescens colonies (stereomicroscope) brown or black pigment. The edge of the colony is usually
P. nigrescens colonies on horse blood agar after 72 h. The black; the center is cream-colored to dark brown. Most
colony diameter is 0.5–2 mm and appears circular, with a strains produce weak hemolytic reaction. Few strains pro-
neat edge and low convex, and smooth and produces duce a ring indicative of α-hemolysis
Fig. 4.87 P. melaninogenica cells (Gram stain)

196 Q. Yuan et al.
Fig. 4.88 P. melaninogenica cells (SEM)

P. melaninogenica cells are coccobacilli and measure 0.5–0.8 0.9–2.5 μm. Occasionally, cells longer than 10 μm are
observed. Cells stain Gram-negative
Fig. 4.89 P. melaninogenica colonies (BHI blood agar)

Fig. 4.90 P. melaninogenica colonies (stereomicroscope)
Fig. 4.91 P. melaninogenica colonies (stereomicro- with a neat edge. The centers of colonies are usually black
scope) and the edges are gray to light brown. After 5–14 d of
P. melaninogenica colonies on blood agar are 0.5–2.0 mm culture, colonies become completely black. Few strains
in diameter. Colonies appear round, convex, and glossy, produce β-hemolytic reaction on rabbit blood agar
4.2.7.4 Prevotella corporis Growth of P. corporis requires chlorinated

P. corporis is a Gram-negative non-sporulating, hemoglobin and vitamin K1. A 10% final concen-
melanin-producing obligate anaerobe. Examples tration of serum can promote growth and improve
of cells are shown in Figs. 4.92 and 4.93. fermentation in some strains. Characteristic
198 Q. Yuan et al.
Fig. 4.92 P. corporis cells

(Gram stain)
Fig. 4.93 P. corporis cells

(SEM)
P. corporis cells grown in
glucose broth culture are
measured
0.9–1.6 1.6–4.0 μm in
size. Cells arrange singly, in
pairs, or in short chains.
Coccoid cells are also
commonly seen, and long
filamentous cells can
sometimes be observed.
Cells stain Gram-negative
Fig. 4.94 P. corporis

Fig. 4.95 P. corporis

colonies
(stereomicroscope)
P. corporis cultured under
anaerobic conditions on
blood agar form colonies
ranging from pinprick-sized
to 1.0 mm. Colonies are
rounded bumps with neat
edges. After 48 h to 72 h of
incubation, colonies can
turn light yellow with
brownish edges, and
colonies cultured for 4 d–7
d turn dark brown
colonies are shown in Figs. 4.94 and 4.95. Glu- P. corporis can be detected in specimens of all
cose broth cultures turn cloudy and often have types of clinical infection, including the oral
smooth or coarse precipitates adhered to the bot- cavity.
tom flask. The final pH value of glucose broth The genomic G + C content is 43%–46%. The
cultures is 4.8–5.1. type strain is ATCC33457.
200 Q. Yuan et al.
Fig. 4.96 P. loescheii cells

(Gram stain)

(SEM)
4.2.7.5 Prevotella loescheii anaerobic bacteria. Typical cells are shown in

P. loescheii is a species of Gram-negative, Figs. 4.96, 4.97, and 4.98.
non-sporulating, melanin-producing, obligate

(SEM)
Cells of P. loescheii grown
in glucose broth culture are
0.4–0.6 0.8–15 μm in
size. They are mostly
coccobacilli, but can also be
club-shaped and long rods.
Cells organize into single
cells, in pairs, or in a chain-
like arrangement. Cells
stain Gram-negative
Cultures of P. loescheii require chlorinated However, they were similar in their ability to
hemoglobin, while the addition of 10% serum ferment carbohydrates to produce melanin.
enhances fermentation. Colonies observed by ste- These species, namely, B. asaccharolyticus,
reomicroscope are shown in Figs. 4.99 and 4.100. B. gingivalis, and B. endodontalis, have been
Glucose broth cultures turn cloudy and are placed into a new genus: Porphyromonas.
accompanied by a smooth deposit. The final pH Members of this genus most commonly found in
value of cultures grown in glucose broth is the oral cavity are P. gingivalis and
between pH 4.9 and 5.4. P. loescheii does not P. endodontalis.
produce H2S in SIM medium. But the hydrolysis Broth-cultured cells are typically small rods
of esculin and the ability to ferment cellobiose approximately 0.5–0.8 1.0–3.5 μm in size;
help distinguish this species from occasionally cells can be found that measure
P. melaninogenica and P. denticola. 4–6 μm long. These bacteria produce no spores,
The genomic G + C content is 46% (type are non-motile, and are Gram-negative.
strain). The type strain is ATCC15930 Porphyromonas are obligate anaerobes with
(NCTC11321) [12]. an optimum growth temperature of 37 C. On
blood agar plates, they can form colonies
1–3 mm in diameter that are protuberant, lustrous,
and with smooth surface (very few with rough
4.2.8 Porphyromonas
surface) .
The primary endpoint product in PYG medium
In 1998, three species of Bacteroides were found
is butyric acid and acetic acid. There is a small
to have significantly different biological
characteristics than other Bacteroides species.
202 Q. Yuan et al.
Fig. 4.99 P. loescheii

Fig. 4.100 P. loescheii

colonies
(stereomicroscope)
P. loescheii cultures grown
on blood agar under
anaerobic condition form
colonies 1.0 to 2.0 mm in
diameter. Colonies are
rounded, low convex,
lustrous, and translucent,
with a smooth surface and
neat edges. On agar plates
containing whole blood,
colonies turn white or
yellow after 48 h. When
anaerobic culture is
continued for 14 d, colonies
turn light brown. Some
strains do not produce
obvious dark brown or
black colonies
amount of propionic acid, isobutyric acid, and 4.2.8.1 Porphyromonas gingivalis

isoamyl propionate produced. P. gingivalis are Gram-negative, obligate anaero-
The genomic G + C content of this bic bacteria that do not form spores and produce
genus is 46%–54%. The type species is melanin, as shown in Figs. 4.101 and 4.102. Its
P. asaccharolytica. cell wall peptidoglycan contains lysine, while the
Fig. 4.101 P. gingivalis

cells (Gram stain)

cells (SEM)
P. gingivalis cells are
0.5 1–2 μm rods or
coccobacilli; cells on solid
medium form coccobacilli
or very short rods. Cells
stain Gram-negative
main respiratory quinone has nine isoprene units media. Hemoglobin is the main product of por-
of unsaturated methyl naphthalene quinones. phyrin. Characteristic colonies are shown in
As an obligate anaerobe, chlorinated hemoglo- Figs. 4.103 and 4.104.
bin and vitamin K1 are required in the growth
204 Q. Yuan et al.


colonies
(stereomicroscope)
P. gingivalis form colonies
1–2 mm in diameter on
blood agar. Colonies are
rounded and lustrous, with
a smooth (or occasionally
rough) surface. After
4–8 days of culture,
melanin spreads from the
edge to the center of the
colony to form black
colonies. A small number
of colonies do not produce
melanin
When grown in BM or PYG media, the main P. gingivalis produces indoles, does not pro-
terminal acids produced by P. gingivalis are duce alpha fucosidase, does not reduce nitrate to
butyric acid and acetic acid, with a small amount nitrite, and does not hydrolyze aesculin and
of propionic acid, isobutyric acid, isoamyl propi- starch. Cells test positive for MDH and glutamate
onate, and phenylacetic acid produced as well. dehydrogenase and negative for glucose
phosphate dehydrogenase and glucose Cells test negative for sheep cell agglutination
6-phosphate acid salt dehydrogenase. These (SCAT), but are positive for MDH and glutamate
enzymatic characteristics as well as its ability to dehydrogenase. P. endodontalis is negative for
produce acetic acid are the important features that glucose phosphate dehydrogenase and glucose
differentiate P. gingivalis from other morpholog- 6-phosphate dehydrogenase.
ically similar bacteria. The genomic G + C content is 49%–51%. The
Its DNA G + C content is 46%–48%. The type type strain is ATCC 35406.
strain is ATCC33277 [13].
4.2.8.2 Porphyromonas endodontalis 4.2.9 Treponema

This Gram-negative, obligate anaerobe produces
melanin [14]. Cells do not form spores. Examples Spirochetes are a type of slender, curved spiral,
of bacterial cells are shown in Figs. 4.105 and highly motile Gram-negative bacteria. Common
4.106. Chlorinated hemoglobin and vitamin K1 genera of spirochetes are Spirochaeta,
are required for culture growth. Characteristic Cristispira, Treponema, and Borrelia.
colonies are shown in Figs. 4.107 and 4.108. Here we introduce the Treponema in details.
The primary terminal acid products are Treponema is a genus of commonly found oral
N-butyric acid and acetic acid, but a small amount bacteria that are closely related to periodontitis
of propionic acid, isobutyric acid, and isoamyl and the etiology of implant periarthritis. Species
propionate are also produced. The cells do not commonly detected in the oral cavity are
produce phenylacetic acid. P. endodontalis can T. denticola, T. scaliodontum, T. macrodentium,
hydrolyze gelatin and arginine. Its protein hydro- T. oralis, T. intermedia, T. maltophilum,
lysis activity is extremely low. It does not hydro- T. socranskii, and T. vincentii. In addition, the
lyze aesculin and starch and can produce indoles gastrointestinal tract and the vagina are also
and hydrogen sulfide. It does not produce alpha major colonization sites for bacteria of this
fucosidase and does not reduce nitrate to nitrite. genus in humans.
Fig. 4.105 P. endodontalis cells (Gram stain)

206 Q. Yuan et al.
Fig. 4.106 P. endodontalis cells (SEM)

P. endodontalis organizes as single cells approximately 0.4–0.6 1.0–2.0 μm in size. They do not form spores, are
non-motile, and are Gram-negative
Fig. 4.107 P. endodontalis colonies (BHI blood agar)

Fig. 4.108 P. endodontalis colonies (stereomicroscope) pigmentation (hemoglobin is the main product of porphy-
P. endodontalis on blood agar forms rounded, lustrous rin) after culturing for 4–7 days. Most strains form solid
colonies with a smooth surface. The colonies have a neat adhesion to the surface of blood agar, but are slow growing
edge and gain progressively deeper dark brown or black in liquid medium
Clinical samples of Treponema are ideally the cell wall contains muramic acid, glucosamine,
observed with a dark field or a phase contrast and ornithine. Peptidoglycan accounts for 10% of
microscope. Treponema cells are Gram-negative, the dry weight of the cell.
but most of the strains do not take up stain easily The genus Treponema consists of obligate
by Gram staining or Giemsa staining. Silver anaerobes, but those species that are pathogenic
impregnation stain and Ryu’s stain are better for to humans may be microaerophiles. Treponema
the observation of Treponema cells. Presently, we are heterotrophic bacteria that mainly metabolize
commonly use the Congo red negative stain through fermentation. They can use a variety of
method, as it is not only economic and simple, carbohydrates and amino acid as their carbon
but the helical cells are also very easy to observe source and energy. Treponema species are diffi-
(Fig. 4.109). The morphology of the bacterial cult to grow in artificial culture media, the growth
cells can be seen under SEM (Figs. 4.110 and of some species requires long-chain fatty acids
4.111). from serum, and other species require branched-
The outer membrane of Treponema cells is chain fatty acids. T. denticola, T. vincentii, and
similar to the outer membrane of Gram-negative T. scaliodontum require cocarboxylase in serum.
bacteria cells. The content includes lipids, The genomic G + C content of most Trepo-
proteins, and carbohydrates. The lipids are mainly nema species ranges from 25% to 54% (by Tm).
made up of phospholipids and glycolipids, while The type species is T. pallidum [15].
208 Q. Yuan et al.
Fig. 4.109 Plaque

samples of Treponema cells
(Congo red negative
staining)
Fig. 4.110 Plaque

samples of large, medium
and small Treponema cells
(SEM)
Fig. 4.111 Plaque

samples of Treponema and
Borrelia cells (SEM)
Treponema cells measure
0.1–0.4 5–20 μm. They
form a spiral rod and can be
either a tight, regular, or
irregular spiral. Cells have
one or more axial flagella
inserted into the plasma
membrane at opposite ends
of the rod. In old cultures,
huge bubbles and spiral
spheres can be observed.
Large, medium, and small
spirochetes can be observed
in clinical samples. The
spiral-shaped cells measure
0.2–0.5 3–20 μm and
form regular or irregular
loose spirals. The cells stain
Gram-negative
Chaga O, Goltsman E, Bernal A, Larsen N,

References D'Souza M, Walunas T, Pusch G, Haselkorn R,
Fonstein M, Kyrpides N, Overbeek R. Genome
1. Qin X, Galloway-Pena JR, Sillanpaa J, Roh JH, sequence and analysis of the oral bacterium
Nallapareddy SR, Chowdhury S, Bourgogne A, Fusobacterium nucleatum strain ATCC 25586. J
Choudhury T, Muzny DM, Buhay CJ, Ding Y, Bacteriol. 2002;184(7):2005–18.
Dugan-Rocha S, Liu W, Kovar C, Sodergren E, 6. Calcutt MJ, Foecking MF, Nagaraja TG, Stewart
Highlander S, Petrosino JE, Worley KC, Gibbs RA, GC. Draft genome sequence of Fusobacterium
Weinstock GM, Murray BE. Complete genome necrophorum subsp. funduliforme bovine liver abscess
sequence of Enterococcus faecium strain TX16 and isolate B35. Genome Announc. 2014;2(2):e00412-14.
comparative genomic analysis of Enterococcus 7. Marshall BJ, Warren JR. Unidentified curved bacilli in
faecium genomes. BMC Microbiol. 2012;12:135. the stomach of patients with gastritis and peptic ulcer-
2. Kageyama A, Benno Y, Nakase T. Phylogenetic evi- ation. Lancet. 1984;1(8390):1311–5.
dence for the transfer of Eubacterium lentum to the 8. Tomb JE, White O, Kerlavage AR, Clayton RA,
genus Eggerthella as Eggerthella lenta gen. nov, Sut-ton GG, Fleischmann RD, Ketchum KA, Klenk
comb. nov. Int J Syst Bacteriol. 1999;49 HP, Gill S, Dougherty BA, Nelson K, Quackenbush J,
(pt4):1725–32. Zhou Kirkness EE, Peterson S, Loftus B,
3. Bruggemann H, Henne A, Hoster E, Liesegang H, Richardson D, Dodson R, Khalak HG, Glodek A,
Wiezer A, Strittmatter A, Hujer S, Durre P, Gottschalk McKenney K, Fitze-gerald LM, Lee N, Adams MD,
G. The complete genome sequence of Propioni- Hickey EK, Berg DE, Gocayne JD, Utterback TR,
bacterium acnes, a commensal of human skin. Sci- Peterson JD, Kelley JM, Cotton MD, Weidman JM,
ence. 2004;305(5684):671–3. Fujii C, Bowman C, Wat-they L, Wallin E, Hayes WS,
4. Eiken M. Studies on an anaerobic, rod-shaped, gram- Borodovsky M, Karp PD, Smith HO, Fraser CM,
negative microorganism: Bacteroides corrodens N. sp. Venter JC. The complete genome sequence of the
Acta Pathol Microbiol Scand. 1958;43(4):404–16. gastric pathogen Helicobacter pylori. Nature.
5. Kapatral V, Anderson I, Ivanova N, Reznik G, Los T, 1997;388(6642):539–47.
Lykidis A, Bhattacharyya A, Bartman A, Gardner W, 9. Slots J. The predominant cultivable organisms in juve-
Grechkin G, Zhu L, Vasieva O, Chu L, Kogan Y, nile periodontitis. Scand J Dent Res. 1976;84(1):1–10.
210 Q. Yuan et al.
10. Ruan Y, Shen L, Zou Y, Qi Z, Yin J, Jiang J, Guo L, genomic comparison with strain W83 revealed exten-
He L, Chen Z, Tang Z, Qin S. Comparative genome sive genome rearrangements in P. gingivalis. DNA
analysis of Prevotella intermedia strain isolated from Res. 2008;15(4):215–25.
infected root canal reveals features related to pathoge- 14. van Winkelhoff AJ, van Steenbergen TJ, de Graaff
nicity and adaptation. BMC Genomics. 2015;16 J. Porphyromonas (Bacteroides) endodontalis: its role
(1):122. in endodontal infections. J Endod. 1992;18(9):431–4.
11. Harding GK, Sutter VL, Finegold SM, Bricknell 15. Fraser CM, Norris SJ, Weinstock GM, White O,
KS. Characterization of Bacteroides melaninogenicus. Sutton GG, Dodson R, Gwinn M, Hickey EK,
J Clin Microbiol. 1976;4(4):354–9. Clayton Y, Ketchum KA, Sodergren E, Hardham JM,
12. Koreeda Y, Hayakawa M, Ikemi T, Abiko Y. Isolation McLeod MP, Salzberg S, Peterson J, Khalak H,
and characterisation of dipeptidyl peptidase IV from Richardson D, Howell JK, Chidambaram M,
Prevotella loescheii ATCC 15930. Arch Oral Biol. Utterback T, McDonald L, Artiach P, Bowman C,
2001;46(8):759–66. Cotton MD, Fujii C, Garland S, Hatch B, Horst K,
13. Naito M, Hirakawa H, Yamashita A, Ohara N, Roberts N, Sandusky M, Weidman J, Smith HO, Ven-
Shoji M, Yukitake H, Nakayama K, Toh H, ter JC. Complete genome sequence of Treponema
Yoshimura F, Kuhara S, Hattori M, Hayashi T, pallidum, the syphilis spirochete. Science. 1998;281
Nakayama K. Determination of the genome sequence (5375):375–88.
of Porphyromonas ginsialis strain ATCC 33277 and
Oral Mucosal Microbes
5
Biao Ren, Lei Cheng, Xian Peng, Yuqing Li, Yan Li, Yujie Zhou,
Chengguang Zhu, and Xi Chen
Abstract infection, chlamydia infection, and rickettsial

This chapter mainly covers the microbes infection according to the different pathogenic
that cause mucosal infection. Many microorganisms. The biological and patho-
microorganisms can invade the oral mucosa, genic characteristics of representative Gram-
causing infectious stomatitis. Infectious sto- positive bacteria, Gram-negative bacteria,
matitis is classified as primary and secondary. mycoplasma, fungi, and virus were introduced
The former refers to the inflammatory diseases in this chapter. Gram staining, plate culture,
that occur on the oral mucosa due to the direct colony, and scanning electron microscope
invasion of pathogenic microorganisms, such (SEM) images of each microorganism were
as coccal stomatitis, necrotizing gingival sto- also provided.
matitis, and acute gangrenous stomatitis.
The latter refers to the manifestation of Keywords
systemic infection caused by pathogenic Staphylococcus · Moraxella · Neisseria ·
microorganisms in the oral mucosa, such as Mycoplasma · Fungi · Virus
diphtheria and staphylococcal sepsis. Both
primary and secondary infections can be
divided into bacterial infection, viral infec- 5.1 Gram-Positive Bacteria
tion, fungal infection, spirochetes infection,
actinomycetes infection, mycoplasma 5.1.1 Staphylococcus
Staphylococcus aureus is Gram-positive species

B. Ren (*) · X. Peng · Y. Li · Y. Li · Y. Zhou · C. Zhu · of bacteria [1]. Its peptidoglycan structure is
X. Chen L-Lys-Gly5-6, and the cell wall teichoic acid
State Key Laboratory of Oral Diseases, National Clinical is formed by ribitol polymerization. Cellular
Stomatology, Sichuan University, Chengdu, China morphology is shown in Figs. 5.1 and 5.2. The
e-mail: renbiao@scu.edu.cn genomic G + C content is 32–36%, and the type
L. Cheng strains are ATCC126000, NCTC8352, and
State Key Laboratory of Oral Diseases, National Clinical CCM885.
Research Center for Oral Diseases, West China Hospital of S. aureus is a facultative anaerobe but also
Stomatology, Sichuan University, Chengdu, China grows well under aerobic conditions (Figs. 5.3,
Department of Cariology and Endodontics, West China 5.4, and 5.5). After incubation on semisolid
Hospital of Stomatology, Sichuan University, Chengdu, thioglycollate medium, colonies grow rapidly
China

https://doi.org/10.1007/978-981-15-7899-1_5
212 B. Ren et al.
Fig. 5.1 S. aureus cells

(Gram stain)
Fig. 5.2 S. aureus cells

(SEM)
The cells of S. aureus are
characterized as being
spherical (0.5–1.5 μm in
diameter), Gram-positive
cocci arranged as single
cells, pairs, tetrads, and
clusters
are uniform and dense. The final pH of glucose S. aureus is associated with human infections,
broth incubated with S. aureus is always between such as facial furuncle and carbuncle, loose con-
pH 4.3 and 4.6. nective tissue inflammation, and tumor postoper-
ative wound infections.
5 Oral Mucosal Microbes 213
Fig. 5.3 Golden pigment

of S. aureus incubated on
common agar plate
Fig. 5.4 β-hemolytic zone

of S. aureus incubated on
blood BHI agar plate
214 B. Ren et al.

S. aureus
(stereomicroscope)
S. aureus is able to produce
golden pigments on
common agar plate. The
colonies are round, raised,
and shiny opaque and have
a smooth surface and a
whole edge. The diameter is
2–3 mm. A β-transparent
hemolytic zone surrounds
the colony when S. aureus
is incubated on blood
BHI agar
Fig. 5.6 Cells of S. mitis

(Gram stain)
5.1.2 Streptococcus (Fig. 5.6). The G + C content of the S. mitis

genome is 38–39%, and its type strain is
5.1.2.1 Streptococcus mitis NCTC3165.
S. mitis cells are Gram-positive and spherical or S. mitis cells grow variably at 45 C and the
elliptical in shape (about 0.6–0.8 μm in diameter) final pH value of a culture in glucose broth is
[2]. They can form long chains in broth culture around pH 4.2–5.8. Cells in broth culture change

S. mitis (TPY agar plate)

S. mitis (BHI agar plate)
from rough to smooth following subculture and Significant α-hemolytic reaction can be observed
cells that are grown under aerobic conditions can when S. mitis is grown on blood agar plates
be smooth or rough. TPY agar is the common (Fig. 5.8). S. mitis forms small broken-glass-like
medium on which S. mitis is grown (Fig. 5.7). colonies on sucrose agar plates, and very few
216 B. Ren et al.

S. mitis (stereomicroscope)
Fig. 5.10 Cells of

S. pyogenes (Gram stain)
strains can form the typical sticky colonies. Colonization characteristics: S. mitis can be
Colonies observed by stereomicroscope are detected in human saliva, oral mucosa, sputum, or
shown in Fig. 5.9. excrement. It is a common oral streptococcus and
Biochemical reactions: S. mitis can ferment a member of the oral microflora.
glucose, maltose, sucrose, lactose, and salicin to
produce acid, and some strains can also ferment
5.1.2.2 Streptococcus pyogenes
raffinose and trehalose to produce acid. However,
S. pyogenes belongs to Lancefield group A and is
inulin, mannitol, sorbitol, glycerol, arabinose, and
Gram-positive (Fig. 5.10). Cells of this species
xylose cannot be fermented by S. mitis.
have a diameter of 0.5–1.0 μm and are usually
Fig. 5.11 Cells of

S. pyogenes (SEM)
spherical. However, cells from old cultures may S. pyogenes can produce several pathogenic
be oval. Moreover, S. pyogenes cells are often virulence factors, including bacteriocins, hemoly-
arranged in short, medium, or long chains, but sin 0, streptokinase, NADH enzyme, hyaluroni-
most cells in broth culture form long chains. Cells dase, and antigen of M protein [3]. The main sites
of clinical isolates are usually arranged in pairs. of colonization for S. pyogenes are the dental
S. pyogenes cells observed by stereomicroscope plaque, hypopharynx, and the upper respiratory
are shown in Fig. 5.11. The G + C content of the tract. Clinical samples can be isolated from skin
S. pyogenes genome is 34.5–38.5% (Tm method), lesions, inflammatory secretions, or blood.
and its type strain is ATCC12344. S. pyogenes can also be found in loose connective
S. pyogenes is a facultative anaerobes and the tissue inflammation in the maxillofacial region,
optimal temperature for growth is 37 C. A pulpitis, or infection after exelcymosis.
nutrient-rich medium is required for S. pyogenes
growth, and both blood and serum can promote 5.1.2.3 Streptococcus pneumoniae
its growth. Colonies growing on MS agar are S. pneumoniae cells are spherical or elliptic
shown in Fig. 5.12. Cells from overnight blood- (about 0.5–1.25 μm in diameter) and mostly
agar plate culture have three different colony arranged in pairs. They can occasionally be
types (Figs. 5.13, 5.14, and 5.15): found in short chains or as single cells. Typical
cells of this species are lanceted and arranged in
1. Colonies with β-hemolytic zone
pairs, and the extracellular capsule can be
2. Mucoid colonies
observed by capsule staining. However, cells
3. Lackluster colonies
can easily form chains after continuous culture.
In fact, the type of colonies is mainly related to Cells of S. pneumoniae are Gram-positive, but
the growth condition and production of can change to be Gram-negative when aged
hyaluronidases. (Figs. 5.16 and 5.17). S. pneumoniae cells
218 B. Ren et al.

S. pyogenes (MS agar plate)

S. pyogenes with
β-hemolytic zone
(BHI-blood agar plate)
Fig. 5.14 Mucoid colonies

of S. pyogenes (BHI-blood
agar plate,
stereomicroscope)
Fig. 5.15 Lackluster

colonies of S. pyogenes
(BHI-blood agar plate,
stereomicroscope)
observed by SEM are shown in Fig. 5.18. The S. pneumoniae is a kind of facultative anaer-
G + C content of the S. pneumoniae genome is obe, but could generate a substantial amount of
30% (by Tm method) or 42% (by Bd method), H2O2 under aerobic conditions. Growth of
and its type strain is NCTC7465. S. pneumoniae requires a complex medium rich
in nutrients, including blood, serum, or ascites, as
220 B. Ren et al.
Fig. 5.16 Cells of

S. pneumoniae (Gram stain)
Fig. 5.17 Capsule of

S. pneumoniae cells
(capsule stain)
well as vitamin B. Cells of this species grow well S. pneumoniae cells observed by stereomicro-
on BHI-blood agar plates and form rooflike, scope are shown in Fig. 5.21. The final pH value
reflective, and smooth colonies or rugose, of a culture in glucose broth is pH 5.0. Compared
mycelium-like, rough colonies (Fig. 5.19). Cells to other streptococci, the addition of bile or cho-
of S. pneumoniae can generate a great deal of late is required for the isolation and identification
capsular polysaccharides and therefore often of S. pneumoniae.
form sticky colonies (Fig. 5.20). In fact, this cap- S. pneumoniae carries out metabolic reactions
sular polysaccharide is the species-specific anti- through fermentation. Cells of this species can
gen and virulence factor of S. pneumoniae (SSS). ferment glucose, galactose, fructose, sucrose,
Fig. 5.18 Cells of

S. pneumoniae (SEM)

S. pneumoniae (BHI-blood
agar plate)
222 B. Ren et al.

S. pneumoniae (BHI-blood
agar plate,
stereomicroscope)

S. pneumoniae
(stereomicroscope)
maltose, raffinose, and inulin to produce acid, and amygdalitis, pneumonia, meningitis, and otitis
some strains can also ferment mannitol, but not media [4]. However, the colonization, distribu-
dulcite and sorbitol. Bacteriolysis of tion, and pathogenicity of this species in oral
S. pneumoniae cells by bile is positive, and this cavity are still unknown.
characteristic is helpful in distinguishing
S. pneumoniae from other streptococci.
5.1.2.4 Streptococcus vestibularis
S. pneumoniae mainly inhabits the upper
S. vestibularis gets its name because this species
respiratory tracts of healthy individuals or live-
was first isolated from the vestibule of the human
stock and can be isolated from clinical samples of
oral cavity. The cells of S. vestibularis are Gram-
Fig. 5.22 Cells of

S. vestibularis (Gram-
positive coccus)
Fig. 5.23 Cells of

S. vestibularis (SEM)
positive, spherical (about 1 μm in diameter), and G + C content of S. vestibularis genome is

arranged in chains (Fig. 5.22). S. vestibularis cells 38–40%, and its type strain is TC12166
observed by SEM are shown in Fig. 5.23. The (¼MM1).
224 B. Ren et al.

S. vestibularis (MS agar
plate)
S. vestibularis is a facultative anaerobe and the mannitol, melezitose, D-Melibiose, raffinose,

optimal temperature for growth is 37 C, but cells ribitol, sorbitol, starch, and xylose. The majority
of this species can also still grow at 10 and 45 C. of strains of this species can ferment cellulose and
Except the type strain MM, the majority of strains amygdalin to produce acid, and a minority of
belonging to this species can grow in media strains of this species can ferment trehalose and
containing 10% bile. However, the species cannot D-glucosamine to produce acid. S. vestibularis
grow in medium containing 4% NaCl, 0.004% can also generate urease and H2O2, but not extra-
crystal violet, or 40% bile. Alpha-hemolysis can cellular or intracellular polysaccharides. It also
be detected for all strains of this species growing does not generate ammonia from arginine. In
on horse blood agar plates. In addition, black addition, the majority strains of this species can
blue, lackluster, and umbilicate colonies (about produce butanone with two hydroxyl groups and
2–3 μm in diameter) with wavy edges can be can hydrolyze aesculin and starch [5].
observed when cells are grown on MS agar plates S. vestibularis is mainly isolated from the
under anaerobic conditions (37 C, 72 h culture), mucosa or vestibule of the human oral cavity.
while black blue, glossy, and raised colonies
(about 1–2 μm in diameter) with neat edges can
be observed when cells are grown on MS agar
5.2 Gram-Negative Bacteria
plates under aerobic conditions (Fig. 5.24).
Colonies observed by stereomicroscope are
5.2.1 Escherichia
shown in Fig. 5.25.
S. vestibularis can ferment
Here we introduce Escherichia coli in details.
N-acetylglucosamine, myricitrin, fructose, galac-
Commonly known as E. coli, this is the most
tose, glucose, lactose, maltose, mannose, salicin,
common bacteria belonging to the family
and sucrose to produce acid, but they do not
Enterobacteriaceae found in the human body.
ferment adonitol, arabinose, dextrin, dulcite,
E. coli is the first Gram-negative bacillus detected
fucose, glycerol, glycogen, inositol, inulin,

S. vestibularis
(stereomicroscope)
Fig. 5.26 E. coli cells

(Gram stain)
in the neonatal oral cavity and is thought to be under aerobic condition. Characteristic colonies
transmitted from the mother during vaginal birth. are shown in Figs. 5.28 and 5.29.
E. coli is a Gram-negative bacillus (Figs. 5.26 E. coli occasionally can cause maxillofacial
and 5.27). It is a facultative anaerobe with low infections.
nutritional requirement, which can grow well
226 B. Ren et al.
Fig. 5.27 E. coli cells

(SEM)
The size of E. coli cell is
(0.4–0.7) (1–3) μm.
Gram stain is negative
Fig. 5.28 E. coli colonies

(BHI blood agar)
Fig. 5.29 E. coli colonies

(stereomicroscope)
E. coli colonies are soft
gray white with a diameter
of 2–3 mm
5.2.2 Haemophilus Haemophilus are chemoorganotrophic bacte-

ria. After 48 h culture on blood agar surface at
Haemophilus is a genus of Gram-negative facul- 37 C, most species will form flat or raised, col-
tative anaerobic bacilli, named due to their orless or pale yellow, smooth colonies with a
requirement for blood during growth. Most bac- diameter of 0.5–2.0 mm. A few species like
teria of this genus are part of the normal micro- H. parainfluenzae form rough colonies.
flora of the oral cavity and of the nasopharynx in H. parahaemolyticus, and H. paraprohaemolyticus
human and animals. The main colonization site can produce β-hemolytic reaction on blood agar. In
within the oral cavity is dental plaque, followed broth containing glucose, the terminal acid
by saliva and soft palate. metabolites are acetic acid, lactic acid, and
Species detected in the oral cavity include succinic acid.
H. actinomycetemcomitans, H. influenzae, Most oral strains of Haemophilus are
H. parainfluenzae, H. aphrophilus, non-pathogenic members of the normal human
H. paraphrophilus, H. parahaemolyticus, oral mucosa and upper respiratory tract. Occa-
H. paraprohaemolyticus, and H. segnis. In the sionally, they can cause mixed infections such
latest classification, H. actinomycetemcomitans, as periodontal abscess or jaw infection as condi-
H. aphrophilus, and H. segnis were classified tional pathogens.
into a new genus, Aggregatibacter, and renamed The genomic G + C content ranges from 37%
A. actinomycetemcomitans, A. aphrophilus, and to 44% (by Tm method). The type species is
A. segnis, respectively. H. influenzae [6].
Generally, Haemophilus cells are club-shaped H. influenzae is a Gram-negative bacillus. Cell
or rod-shaped and less than 1 μm in width. The morphology is shown in Figs. 5.30 and 5.31.
length of cells can be short to medium. Some- H. influenzae is facultative anaerobe. Atmo-
times cells are filamentous and can be sphere supplemented with 5–10% CO2 is the
pleiomorphic. Bacteria of this genus are Gram- most suitable growth environment. Cultures
negative, do not produce spores, have no capsule, require growth factors from blood, especially fac-
and are non-motile. tor X and factor V. Chocolate agar is the preferred
228 B. Ren et al.
Fig. 5.30 H. influenzae

cells (Gram stain)

cells (SEM)
H. influenzae cells are
Gram-negative, club-
shaped, or small rods, with
dimensions of
0.3–0.5 0.5–3.0 μm. The
cells have no spores or
capsule and are non-motile
growth medium. Characteristic colonies are They can also reduce nitrate, but not nitrite. The
shown in Figs. 5.32, 5.33, and 5.34. species tests positive for catalase, while the
H. influenzae can ferment glucose and sucrose o-nitrophenyl-β-D-galactopyranoside (ONPG)
to produce acid, but fermentations of galactose, test show up negative.
fructose, maltose, and xylose do not produce acid.


viscous colonies
(stereomicroscope)
H. influenzae can be detected in the nasophar- detection rate of capsule-producing strains in the
ynx of up to 75% of healthy children. However, healthy nasopharynx is only 3–7%.
the infection rate in adults is very low. The
230 B. Ren et al.

colonies
(stereomicroscope)
After cultivation on
chocolate agar for 24 h,
convex, gray, translucent
smooth colonies form with
a diameter of 0.5–1 mm.
Strains with capsule usually
form 1–3 mm large viscous
colonies
The genomic G + C content is 39% (by Tm but can cause catarrhal inflammation, such as
method). The type strain is NCTC8143 acute pharyngitis and otitis media.
(biological variant type II without capsule). The genomic G + C content is 40–43%. The
type strain is ATCC25238 (NCTC11020).
5.2.3 Moraxella
5.2.4 Neisseria
Moraxella, Neisseria, and Kingella all belong to
the family Neisseriaceae. Neisseria are aerobic Gram-negative diplococci
Here we introduce Moraxella catarrhalis in belonging to the family Neisseriaceae, which
details. mainly colonize the human oral cavity and naso-
M. catarrhalis are common bacteria belonging pharynx. Most Neisseria are members of the nor-
to the genus Moraxella found in the oral cavity. mal microflora of the human body and are usually
They were previously known as Neisseria non-pathogenic. However, N. meningitidis and
catarrhalis and Branhamella catarrhalis. N. gonorrhoeae are important pathogens.
The cells are Gram-positive cocci and are Common Neisseria in the oral cavity are
shown in Figs. 5.35 and 5.36. N. sicca and N. subflava.
M. catarrhalis are aerobic and can grow on Neisseria are less nutrition-demanding aerobic
agar medium. However, cultures grow better on bacteria that can grow easily on agar medium.
blood agar. Characteristic colonies are shown on Most Neisseria cells are spherical, but occasion-
Figs. 5.37 and 5.38. ally short rods are observed with a diameter of
The main site of colonization is the upper 0.6–1.0 μm. Many are arranged in pairs with a flat
respiratory tract [7] which is the main habitat. adjacent surface. Neisseria cells may have a cap-
This species generally does not cause disease sule and pili, but no endospores and flagella.
Fig. 5.35 M. catarrhalis

cells (Gram stain)

cells (SEM)
M. catarrhalis cells are
spheres or short rods and
are typically kidney-
shaped. Nearly kidney-
shaped diplococci are
observed in clinical
specimens. The cells do not
non-motile. Cells stain
Gram-negative
Also known as meningococcus, this is the grow better under 5–8% CO2. Growth requires
pathogen behind meningococcal meningitis [8]. nutrient agar with blood serum or blood. Typical
N. meningitides are Gram-negative cocci colonies are shown in Figs. 5.41, 5.42, and 5.43.
(Figs. 5.39 and 5.40). They are aerobic, but
232 B. Ren et al.


colonies
(stereomicroscope)
After 48 h culture on blood
agar, smooth, opaque,
relatively flat, gray colonies
form with a diameter of
about 2 mm
Fig. 5.39 N. meningitides

cells (Gram stain)

cells (SEM)
N. meningitidis cells are
ovoid or spherical, kidney-
shaped, or bean-shaped
diplococci; Gram stain is
negative
234 B. Ren et al.


colonies (BHI chocolate
agar)

colonies
(stereomicroscope)
The colony size of
N. meningitides depends on
medium on which they are
grown. After 18–24 h
culture, the colony diameter
reaches 1.0–1.5 mm on the
surface of nutrient-rich
blood agar. They appear as
round, smooth, transparent,
dew-like colonies without
hemolysis. The colonies
grow best on chocolate
blood agar. On Mueller-
Hinton agar, colonies are
round, smooth, shiny, and
translucent
The genomic G + C content is 50–52% (by Tm environment for initial isolation is atmospheric
method). The type strain is ATCC13077. conditions supplemented with 5% CO2 or anaer-
obic conditions with 5% CO2 and 95% N2.
Mycoplasma colonies are small and can only
be observed under a light microscope at low
5.3 Mycoplasma
magnification or a dissecting microscope. Char-
acteristic colonies are shown in Figs. 5.46 and
Mycoplasma can live independently with no cell
5.47.
wall. They are the smallest prokaryotic microbial
Mycoplasma and L type bacteria are similar:
cells and can be isolated from normal human and
1. they both lack a cell wall and the cell is pleo-
animal respiratory mucosa. In the oral cavity,
morphic; 2. they can both pass through an antimi-
M. pneumoniae, M. oralis, M. salivalis, and
crobial filter. The main difference between the
M. nominis can be isolated.
two are as follows: 1. Mycoplasma are indepen-
Mycoplasma are the smallest of all prokaryotic
dent microbes and L type bacteria are variants of
microbial cells (Figs. 5.44 and 5.45).
normal bacterial cells that have a cell wall (most L
Mycoplasma have high nutritional demands
type cells will revert to their original form when
and can grow on PPLO agar with beef heart
the induction factor is eliminated); 2. Mycoplasma
infusion and 10–20% horse serum. The serum
growth requires cholesterol (10–20% serum in the
provides Mycoplasma with the cholesterol and
medium), while the growth of L-type bacterial
long-chain fatty acids required for growth. The
does not; 3. L-type bacteria fade easily after
optimum pH for Mycoplasma culture is pH
Diane staining while Mycoplasma do not fade
7.8–8.0. Cells may die when the pH drops
easily.
below pH 7.0.
Mycoplasma usually colonize the throat, bac-
Mycoplasma are aerobic or facultative anaero-
terial biofilm, or tartar found in the oral cavity.
bic microorganisms, but they usually grow better
M. pneumoniae is one of the common causes of
in an aerobic environment. The best culture
236 B. Ren et al.
Fig. 5.44 M. pneumoniae

cells (Gram stain)
The signet-ring-shaped cell
of Mycoplasma is Gram-
negative, and the size of the
cell is 0.2–0.3 μm and is
normally smaller than
1.0 μm. Cells have no cell
wall. Protein and lipids
form the outer cell
membrane and the cells are
obviously pleomorphic,
with spherical, rod-like,
bar-like, and filamentous
morphologies visible under
the microscope. The typical
cell is shaped like a signet-
ring. Cells are Gram-
negative, light purple with
Giemsa stain
Fig. 5.45 M. pneumoniae

signet-ring cell (Giemsa
stain)
M. pneumoniae cell is light
purple with Giemsa stain
acute respiratory infections [9]. Although previ-

5.4 Fungi
ous studies reported that Mycoplasma can be
separated from root canal infections, gingivitis,
5.4.1 Saccharomyces
and periodontitis clinical specimens, the distribu-
tion and pathogenicity in the oral cavity are still
The family Saccharomycetaceae belongs to the
unclear.
phylum Ascomycota and includes the common
Fig. 5.46 M. pneumoniae omelet -like colonies
Fig. 5.47 Mulberry-shaped colonies of M. pneumoniae semi-transparent area. Other characteristic colonies of the
Typical colonies of the Mycoplasma are omelet-like in Mycoplasma include as mulberry-shaped colonies of
shape. Colony diameter is about 10–15 μm, the center is M. pneumoniae. Mycoplasma from the mouth and saliva
round and opaque and extends into the medium; the edge form visible comet-like colonies in semi-solid medium
of the colony is thin and flat, forming a transparent or (mostly in the middle and bottom of the culture medium)
238 B. Ren et al.
Fig. 5.48 C. albicans cells

(Gram-positive)
genera Candida and Saccharomyces. Common candidiasis and other oral Candida infections
species that can be detected in the mouth include are often secondary infections in AIDS patients.
C. albicans, S. tropicalis, S. candidaglabrata, The Candida cell is large and spherical and
S. parapsilosis, S. krusei, S. guilliermondii, and stains Gram-positive (Fig. 5.48). The cell in its
S. dulbilin, the most commonly detected of these budding form can be visualized by SEM
is C. albicans. (Figs. 5.49 and 5.50). Other strains are shown in
Saccharomyces is common symbiotic yeast Figs. 5.51, 5.52, and 5.53.
that inhabits the gastrointestinal tract, respiratory Candida is an aerobic microorganism and
tract, and the vaginal mucosa and can only infect grows best in temperatures ranging from 30 to
the host under specific conditions. Therefore, they 37 C, with 24–48 h incubation time. Sabouraud
are known as conditional pathogens. agar is the standard medium used for its cultiva-
The thallus of this group of yeast is circular or tion (Figs. 5.54, 5.55, and 5.56). CHROMagar
ovoid and consists of a cell wall, cell membrane, Candida agar is a commonly used selective
cytoplasm, and nucleus. They reproduce by bud- medium, as different strains form colonies with
ding. Spore elongate into the germ tube, but do different colors on the surface of the medium,
not detach from the thallus and form long which can be used to identify strains from a clinic
pseudohyphae. sample (Fig. 5.57). C. albicans colonies are
shown in Figs. 5.58 and 5.59. C. tropicalis
5.4.1.1 Candida albicans colonies and cells are shown in Fig. 5.60.
C. albicans is common fungus found in the oral C. glabrata colonies and cells are shown in
cavity [10] and can be detected in the oral cavity Fig. 5.61 and 5.62. C. krusei colonies and cells
of 30–35% of healthy adults. The percentage of are shown in Figs. 5.63 and 5.64.
detection is even higher in the neonate oral cavity. Germ tube formation assay (Figs. 5.65 and
The main sites of colonization are the mucosa 5.66) and thick-walled spore formation assay
(buccal mucosa, palate, etc.), saliva, oral prosthet- (Figs. 5.67, 5.68, and 5.69) are commonly used
ics, dentures, etc. C. albicans can cause acute or to identify the C. albicans strains in a sample.
chronic oral candidiasis such as Candida can ferment glucose, maltose, and
pseudomembranous candidiasis (thrush), denture sucrose and produces acid, but does not ferment
stomatitis, and Candida leukoplakia. Oral lactose.

(SEM)

(SEM)
The yeast cell is 2 4 mm
in size, ovoid or spherical,
Gram-positive. The
budding cell is visible under
SEM
240 B. Ren et al.
Fig. 5.51 C. tropicalis

cells (Gram stain)
Fig. 5.52 C. glabrata cells

(Gram stain)
virus, cytomegalovirus, and Epstein-Barr virus

5.5 Virus
are related to human oral mucosal infections.
These viruses share a icosahedral protein nucleo-
Here we introduce herpes simplex virus (HSV) in
capsid formed by 162 subunits that protects the
details.
double-stranded linear DNA There is a lipopro-
Herpesvirus is an enveloped DNA virus of
tein envelope surrounding the nucleocapsid. The
medium size. More than 100 strains have been
discovered. Of these, HSV, Varicella-zoster
Fig. 5.53 C. krusei cells

(Gram stain)
Fig. 5.54 C. albicans

colonies (Sabouraud’s agar)
outer diameter of the virus is approximately Research has shown that 30–90% of humans pos-
150–200 nm. sess antibodies against HSV, indicating that they
HSV is the type virus of the herpesviruses. It have previously been infected. HSV can easily
causes vesicular lesions of the skin and mucosa invade ectodermal tissues including neurons,
and is a common virus found in humans [11]. skin, and mucosal layers.
242 B. Ren et al.

colonies (Sabouraud’s agar
slant)

colonies (Sabouraud’s agar,
stereomicroscope)
C. albicans grow well in
Sabouraud’s agar and form
milk white, smooth surface,
and softer yeast-like colony
and yeast smell. When the
hatching time extended, it
can form rough surface and
faviform or folding rough
colony
The double-stranded DNA contained within nucleocapsid is made up of protein subunits,

the HSC core encodes the genetic information each of which measures 9.5 12.5 nm, with a
necessary for virus production. The DNA consists 4 nm hole at the center. The envelope is a lipid
of two fragments, one long and one short, linked structure rich in proteoglycans and lipoproteins,
by a covalent bond. The long fragment makes up within which six viral antigens are located: gB,
82% of the viral genetic material and the short gC, gD, gE, gG, and gH.
fragment, 18%. The percentage GC content is In humans, HSV infection is very common,
approximately 68%, which is fairly high. The and patients and healthy carriers can be sources

colonies (CHROMagar
Candida agar)

green colonies
(CHROMagar Candida
agar)
244 B. Ren et al.

colonies (CHROMagar
Candida agar,
stereomicroscope)
Fig. 5.60 C. tropicalis

blue colonies
(CHROMagar Candida
agar)
of infection. Infection is mainly caused by from oral squamous cell carcinoma, and there is
droplets or coming into contact with saliva or evidence to support that HSV may be an impor-
other herpesvirus-containing fluids. The fetus tant factor in oral precancerous lesions or squa-
can be infected by passage through the birth mous cell carcinoma. The proliferation of HSV in
canal. In oral leukoplakia, HSV can be isolated Vero cells is shown in Figs. 5.70 and 5.71.
Fig. 5.61 S. C. glabrata

purple colonies
(CHROMagar Candida
agar)
Fig. 5.62 S. C. glabrata

purple colonies
(CHROMagar Candida
246 B. Ren et al.
Fig. 5.63 C. krusei pink

colonies (CHROMagar
Candida agar)
Fig. 5.64 C. krusei pink

colonies (CHROMagar
Candida agar,
stereomicroscope)

sprouting spores and germ
tube (Crystal violet stain)

sprouting spores and germ
tube (lactophenol stain)
Germ tube formation assay
involves inoculating the
isolated strain on 0.5–1 ml
human or sheep serum.
Incubate for 2–4 h at 37 C,
stain with crystal violet
stain or lactophenol stain,
and observe under the
microscope. Sprouting
spores and germ tubes are
visible under oil immersion
248 B. Ren et al.

colonies (1% Twain
cornmeal agar)

and chlamydospores of
C. albicans (1% Twain
cornmeal agar, crystal
violet stain)

and chlamydospores of
C. albicans (1% Twain
cornmeal agar, lactophenol
staining)
Fig. 5.70 Proliferation of

HSV in Vero cells (inverted
microscope)
250 B. Ren et al.
Fig. 5.71 Proliferation of

HSV in Vero cells (TEM)
4. Tettelin H, Nelson KE, Paulsen IT, Eisen JA, Read

References TD, Peterson S, Heidelberg J, DeBoy RT, Haft DH,
Dodson RJ, Durkin AS, Gwinn M, Kolonay JF, Nel-
1. Kuroda M, Ohta T, Uchiyama I, Baba T, Yuzawa H, son WC, Peterson JD, Umayam LA, White O,
Kobayashi I, Cui L, Oguchi A, Aoki K, Nagai Y, Salzberg SL, Lewis MR, Radune D, Holtzapple E,
Lian J, Ito T, Kanamori M, Matsumaru H, Khouri H, Wolf AM, Utterback TR, Hansen CL,
Maruyama A, Murakami H, Hosoyama A, Mizutani- McDonald LA, Feldblyum TV, Angiuoli S,
Ui Y, Takahashi NK, Sawano T, Inoue R, Kaito C, Dickinson T, Hickey EK, Holt IE, Loftus BJ,
Sekimizu K, Hirakawa H, Kuhara S, Goto S, Yang E, Smith HO, Venter JC, Dougherty BA,
Yabuzaki J, Kanehisa M, Yamashita A, Oshima K, Morrison DA, Hollingshead SK, Fraser
Furuya K, Yoshino C, Shiba T, Hattori M, CM. Complete genome sequence of a virulent isolate
Ogasawara N, Hayashi H, Hiramatsu K. Whole of Streptococcus pneumoniae. Science. 2001;293
genome sequencing of meticillin-resistant Staphylo- (5529):498–506.
coccus aureus. Lancet. 2001;357(9264):1225–40. 5. Delorme C, Abraham AL, Renault P, Guedon
2. Denapaite D, Bruckner R, Nuhn M, Reichmann P, E. Genomics of Streptococcus salivarius, a major
Hen- rich B, Maurer P, Schahle Y, Selbmann P, human commensal. Infect Genet Evol. 2014; https://
Zimmermann W, Wambutt R, Hakenbeck R. The doi.org/10.1016/j.meegid.2014.10.001. pii: s1567-
genome of Streptococcus mitis B6-what is a commen- 1348(14)00372-4
sal? PLoS One. 2010;5(2):e9426. 6. Hood DW. The genome sequence of Haemophilus
3. Ferretti JJ, McShan WM, Ajdic D, Savic DJ, Savic G, influenzae. Methods Mol Med. 2003;71:147–59.
Lyon K, Primeaux C, Sezate S, Suvorov AN, 7. de Vries SP, van Hijum SA, Schueler W, Riesbeck K,
Kenton S, Lai HS, Lin SP, Qian Y, Jia HG, Najar Hays JP, Hermans PW, Bootsma HJ. Genome analysis
EZ, Ren Q, Zhu H, Song L, White J, Yuan X, Clifton of Moraxella catarrhalis strain BBH18, a human
SW, Roe BA, McLaughlin R. Complete genome respiratory tract pathogen. J Bacteriol. 2010;192
sequence of an M1 strain of Streptococcus pyogenes. (14):3574–83.
Proc Natl Acad Sci U S A. 2001;98(8):4658–63.
8. Schoen C, Kischkies L, Elias J, Ampattu 10. Hellstein J, Vawter-Hugart H, Fotos P, Schmid J, Soll
BJ. Metabolism and virulence in Neisseria DR. Genetic similarity and phenotypic diversity of
meningitidis. Front Cell Infect Microbiol. 2014;4:114. commensal and pathogenic strains of Candida
9. Loens K, Goossens H, Ieven M. Acute respiratory albicans isolated from the oral cavity. J Clin
infection due to Mycoplasma pneumoniae: current sta- Microbiol. 1993;31(12):3190–9.
tus of diagnostic methods. Eur J Clin Microbiol Infect 11. Arduino PG, Porter SR. Herpes simplex virus type
Dis. 2010;29(9):1055–69. 1 infection: overview on relevant clinico-pathological
features. J Oral Pathol Med. 2008;37(2):107–21.
New Oral Microbial Isolations
6
Yuqing Li, Xian Peng, Biao Ren, Boyu Tang, Tao Gong,
Zhengyi Li, and Xuedong Zhou
Abstract Gram staining, plate culture, colony, and scan-

More than 700 different species of bacteria, ning electron microscope (SEM) images of
viruses, fungi, mycoplasma, and chlamydia each microorganism were also provided.
live in the human oral cavity, collectively
known as the oral microbiome. The ecological Keywords
imbalance of oral microbiome can induce oral Leuconostoc lactis · Stenotrophomonas
infectious diseases, such as dental caries and maltophilia · Chryseobacterium indologenes ·
periodontal disease. Oral microorganisms are Elizabethkingia anophelis · Klebsiella
also closely related to tumors, diabetes, rheu- pneumoniae · Campylobacter jejuni
matoid arthritis, cardiovascular diseases, pre-
mature delivery, and other systemic diseases,
which have a significant impact on human 6.1 Gram-Positive Bacteria
health. So far, more than 65% of oral
microbiota can be cultured in vitro. In order 6.1.1 Leuconostoc lactis
to better study the relationship between oral
microbes and human health, several human Leuconostoc lactis is one of the species of
oral microbiome collection and oral Leuconostoc belonging to Leuconostocaceae
microbiome database have been established. family [1]. It is the only Leuconostoc species
In this chapter, the biological and pathogenic that does not hydrolyze esculin. L. lactis is a
characteristics of several newly isolated oral Gram-positive facultative anaerobic bacteria
microbes from dental plaque were introduced. (Fig. 6.1). L. lactis requires a rich and complex
media to grow well at 25 C. They are generally
Y. Li · X. Peng · B. Ren · B. Tang · T. Gong · Z. Li ovoid cocci and often form chains (Fig. 6.2).
State Key Laboratory of Oral Diseases, National Clinical Compared to staphylococci, L. lactis is intrinsi-
Stomatology, Sichuan University, Chengdu, China cally resistant to vancomycin and are catalase-
negative. It is mainly employed in the food indus-
X. Zhou (*)
State Key Laboratory of Oral Diseases, National Clinical try, but also reported to cause osteomyelitis at
Research Center for Oral Diseases, West China Hospital of times. These bacteria are generally slime-
Stomatology, Sichuan University, Chengdu, China forming. Blood brain heart infusion (BHI) media
Department of Cariology and Endodontics, West China is used for L. lactis isolation (Figs. 6.3 and 6.4).
Hospital of Stomatology, Sichuan University, Chengdu, Its genomic GC content is 37–40% (mol%), and
China the type strain is L. lactis ATCC15520.

https://doi.org/10.1007/978-981-15-7899-1_6
254 Y. Li et al.
Fig. 6.1 Cells of L. lactis

(Gram stain)
Fig. 6.2 Cells of L. lactis

(SEM)
6 New Oral Microbial Isolations 255

L. lactis (BHI blood agar)

L. lactis (stereomicroscope)
Biological characteristics: L. lactis can be and is not hemolytic. Moreover, it cannot

heterofermentative and produce dextran from reduce nitrate to nitrite, and the final pH of its
sucrose. Its catalase is negative and arginine culture in liquid glucose medium is between 4.4
cannot be hydrolyzed. It cannot produce indole and 5.0.
256 Y. Li et al.
Fig. 6.5 Cells of

C. argentoratense (Gram
stain)
Colonization characteristics: Colonies are gen- tyrosine, gelatin, DNA, esculin, and urea are not
erally less than 1.0 mm, smooth, round, and gray- degraded or hydrolyzed. Acid is produced from
white. In blood BHI media, the colonies have D-glucose and fructose but not from sucrose,
gray-white concentric outer ring and dull yellow maltose, lactose, galactose, D-xylose, trehalose,
pigmented ring at the center. glycogen, or D-mannitol. Acidification from
ribose occurs variably.
Colonization characteristics:
6.1.2 Corynebacterium C. argentoratense forms creamy colonies (2 mm
argentoratense diameter) at 37 C, with an absence of hemolysis
on blood BHI media.
Corynebacterium argentoratense, one of the
species of Corynebacterium genus, is an irregu-
lar, Gram-positive rod-shaped bacterium [2, 3] 6.2 Gram-Negative Bacteria
(Figs. 6.5 and 6.6). It contains a type IV cell
wall and short-chain mycolic acids. Its cell 6.2.1 Stenotrophomonas maltophilia
wall contains arabinose, galactose, and meso-
diaminopimelic acid. The bacterium is Stenotrophomonas maltophilia is an aerobic,
non-lipophilic and has typical coryneform non-fermentative, Gram-negative bacterium
morphology. Blood BHI media was used (Figs. 6.9 and 6.10) that is ubiquitously found in
for C. argentoratense isolation (Figs. 6.7 and aqueous environments, soil and plants. However,
6.8). Its genomic GC content is 60–61% (mol it also is the third most common nosocomial
%), and the strain type is IBS B10697 (CIP pathogen with multidrug resistance [4, 5]. It was
104296). called as Pseudomonas maltophilia according
Biological characteristics: C. argentoratense to its flagellum characteristics in 1961 and
is a catalase-positive, oxidase-negative, and fac- Xanthomonas maltophilia in 1983 according to
ultative anaerobe. Nitrate is not reduced, and its nucleic acid homology and cellular fatty acid
Fig. 6.6 Cells of

C. argentoratense (SEM)
composition. In 1993, however, it was renamed in color, with a diameter of 0.5–1 mm and central
as Stenotrophomonas maltophilia as protuberance.
Xanthomonas would imply plant pathogenicity.
Blood BHI media is used for S. maltophilia
isolation at 37 C (Figs. 6.11 and 6.12).
6.2.2 Chryseobacterium indologenes
S. maltophilia is a common conditional pathogen
in clinic infection that is difficult to treat in immu-
Chryseobacterium indologenes is a yellow
nocompromised patients. Its genomic GC content
pigmented, Gram-negative, filamentous
is 66.7% (mol%), and the type strain is
(Fig. 6.13), nonmotile, rod-shaped bacteria that
S. maltophilia ATCC 13637.
can be found in soil, plants, food material, water
Biological characteristics: S. maltophilia can
sources, and hospitals [6]. It is approximately
reduce nitrate to nitrite and is oxidase negative. It
0.5 μm in diameter and 1.0–3.0 μm in length,
can hydrolyze gelatin, and it has potent lipolytic
with rounded ends and parallel sides (Fig. 6.14).
properties. It is DNase, aescin, and lysine decar-
C. indologenes is a non-fastidious and
boxylase positive. In the oxidative fermentation
chemoorganotrophic organism that can rapidly
experiment, S. maltophilia ferments maltose, but
grow at 37 C. Blood BHI media can be used
acid is produced very slowly and not evidently.
for the isolation of C. indologenes (Figs. 6.15 and
S. maltophilia contains beta-lactamase and can be
6.16). Its genomic GC content is 37–39% (mol
naturally resistant to imipenem.
%), and the type strain is C. indologenes ATCC
Colonization characteristics: S. maltophilia
29897.
can give out a strong odor of ammonia in the
Biological characteristics: C. indologenes can
blood plate and show no hemolysis. The colonies
survive in anaerobic conditions with nitrate or
are smooth edged, pale yellow, or grayish-white
fumarate used as the terminal electron acceptor.
258 Y. Li et al.

C. argentoratense (BHI
blood agar)

C. argentoratense
(stereomicroscope)
Fig. 6.9 Cells of

S. maltophilia (Gram stain)
Fig. 6.10 Cells of

S. maltophilia (SEM)
C. indologenes ferments D-fructose, D-glucose, ethanol, sucrose, or D-xylose. Catalase, oxidase,

glycerol, maltose, trehalose, glycogen, and man- and phosphatase are observed in C. indologenes,
nose to produce acid, but not lactose, L-arabinose, as well as strong proteolytic activities and
260 Y. Li et al.

S. maltophilia (BHI blood
agar)

S. maltophilia
(stereomicroscope)
oxidation of carbohydrates. However, glycerol and Tween 80 and produces indole. It does not,
and trehalose are not oxidized. C. indologenes is however, produce β-galactosidase or
also capable of degrading esculin, DNA, starch, L-phenylalanine deaminase.
Fig. 6.13 Cells of

C. indologenes (Gram
stain)
Fig. 6.14 Cells of

C. indologenes (SEM)
262 Y. Li et al.

C. indologenes (BHI blood
agar)

C. indologenes
(stereomicroscope)
Colonization characteristics: Colonies are deep yellow in color and thinner in the central
circular, convex, entire, smooth with up to portion than in the periphery.
2 mm diameter and aromatic odor. They are a
Fig. 6.17 Cells of

E. anophelis (Gram stain)
6.2.3 Elizabethkingia anophelis boundary, round colonies which are transparent

or translucent. In blood BHI media, no zone of
Elizabethkingia anophelis, belonging of the hemolysis is observed.
Flavobacteriaceae family, is a slightly
yellow-pigmented, nonmotile, non-spore-
forming, Gram-negative, rod-shaped bacterium
6.2.4 Klebsiella pneumoniae
(Figs. 6.17 and 6.18). It can grow well at
30–31 C and 37 C. It is a dominant resident in
Klebsiella pneumoniae is a facultative anaerobic
the gut of the malaria vector mosquito Anopheles
Gram-negative bacterium. It is rod-shaped and
gambiae. Its type strain is R26(T) (¼ CCUG
measures 2 0.5 μm (Figs. 6.21 and 6.22). It
60038(T) ¼ CCM 7804(T)). Blood BHI media
can be single, in pairs, or in short chains. It has no
can be used for its isolation (Figs. 6.19 and 6.20).
spores and no flagella, but has thick capsule layer
E. anophelis has natural antibiotic resistance to
surrounding the bacterium. It can be found in
several antibiotics, including β-lactam antibiotics
surface water, sewage, and soil. As a pathogen,
and fluoroquinolones. However, recent clinical
K. pneumoniae can cause pneumonia which can
cases have reported that it’s developing multidrug
cause destructive changes to human and animal
resistance [7–9].
lungs, if aspirated, specifically in alveoli,
Biological characteristics: E. anophelis can
resulting in bloody sputum. In recent years, Kleb-
ferment fructose, glucose, lactose, maltose, man-
siella species have become an important pathogen
nitol, and trehalose to produce acid and hydrogen
in nosocomial infections [12]. Its genomic GC
sulfide. However, arabinose, raffinose, salicin,
content is about 57% (mol%), and the type strain
sucrose, and xylose cannot be metabolized by
is ATCC13883.
E. anophelis. It cannot make use of malonic acid
Biological characteristics: K. pneumoniae is
and can hydrolyze aescin. It cannot reduce nitrate
negative for oxidase test. It can ferment glucose,
to nitrite.
lactose, and sucrose. The result of triple sugar
Colonization characteristics: E. anophelis
iron is A/A. Indole, methyl red, motility, orni-
forms smooth, slightly yellow-pigmented, clear
thine decarboxylase, and arginine dihydrolase
264 Y. Li et al.
Fig. 6.18 Cells of

E. anophelis (SEM)

E. anophelis (BHI blood
agar)

E. anophelis
(stereomicroscope)
Fig. 6.21 Cells of

K. pneumoniae (Gram
stain)
tests are negative, whereas the Voges-Proskauer, Colonization characteristics: Colonies are
citrate utilization, nitrate reduction, urease, and round, convex, gray-white colored,
lysine decarboxylase tests are positive. non-hemolytic, and mucoid in blood BHI media
266 Y. Li et al.
Fig. 6.22 Cells of

K. pneumoniae (SEM)
after 18–24 h of culturing at 37 C (Figs. 6.23 and Biological characteristics: E. coli can thrive on
6.24). a wide variety of substrates and uses mixed-acid
fermentation in anaerobic conditions, producing
lactate, succinate, ethanol, acetate, and carbon
dioxide. In mixed-acid fermentation, many
6.2.5 Escherichia coli
pathways produce hydrogen; its levels are
required to be low, such as in the case of E. coli
Escherichia coli is a Gram-negative, facultative
which colonies with hydrogen-consuming
anaerobic, rod-shaped, coliform bacterium of the
organisms, like methanogens or sulfate-reducing
genus Escherichia (Figs. 6.25 and 6.26). It is
bacteria.
commonly found in the lower intestine of warm-
Colonization characteristics: Colonies are
blooded organisms (endotherms). Most E. coli
off-white or beige in color with a shiny texture
strains are harmless, but some serotypes can
(Figs. 6.27 and 6.28).
cause serious food poisoning in their hosts and
are occasionally responsible for product recalls
due to food contamination. The harmless strains
are part of the normal microbiota of the gut and 6.2.6 Campylobacter jejuni
can benefit their hosts by producing vitamin K2
and preventing colonization of the intestine with Campylobacter jejuni is one of the most common
pathogenic bacteria, having a symbiotic relation- causes of food poisoning in Europe and the
ship. E. coli is expelled into the environment via United States. The vast majority of these cases
fecal matter. The bacterium grows massively in occur as isolated events, and not as a part of
fresh fecal matter under aerobic conditions for recognized outbreaks. A surveillance by the
3 days, but its numbers decline slowly then after. Foodborne Diseases Active Surveillance

K. pneumoniae (BHI blood
agar)

K. pneumoniae
(stereomicroscope)
Network (FoodNet) indicated that about 14 cases oxidase-positive and grows optimally between
are diagnosed each year for every 100,000 37 and 42 C. When exposed to atmospheric
persons in the population. oxygen, C. jejuni is able to change into a coccal
Biological characteristics: C. jejuni is a form. This species of pathogenic bacteria is one of
helical-shaped, non-spore-forming, Gram-nega- the most common causes of human gastroenteritis
tive, microaerophilic, and non-fermenting bacte- [10, 11].
rium, forming motile rods with a single polar Colonization characteristics: The colonies are
flagellum (Figs. 6.29 and 6.30). It is also small, mucoid, usually grayish in coloration, flat
268 Y. Li et al.
Fig. 6.25 Cells of E. coli

(Gram stain)
Fig. 6.26 Cells of E. coli

(SEM)
with irregular edges, and non-hemolytic at in diameter that are convex, and glistening.
24–48 h of culturing (Figs. 6.31 and 6.32). An Colonies tend to spread or swarm, especially
alternate colonial morphology that appears to be when initially isolated from fresh clinical
strain related consists of round colonies 1–2 mm specimens.

E. coli (BHI agar)

E. coli (stereomicroscope)
270 Y. Li et al.
Fig. 6.29 Cells of

C. jejuni (Gram stain)
Fig. 6.30 Cells of

C. jejuni (SEM)

C. jejuni (BHI blood agar)

C. jejuni
(stereomicroscope)
272 Y. Li et al.
Fig. 6.33 Cells of

V. atypica (Gram stain)
6.2.7 Veillonella atypica round to oval and approximately 2–6 μm in size

(Figs. 6.37 and 6.38). It is more likely to be found
Veillonella atypica is a lactate fermenting bacteria in tropical climate, where the temperature and
(Figs. 6.33 and 6.34). It is a normal bacterium of humidity enhance its adaptability. It is a wide-
the intestines and oral mucosa in mammals. In spread species of yeast that colonizes in food,
humans, they have been known to cause osteo- plants, gastrointestinal tract, and the mucocutane-
myelitis and endocarditis. The relative abundance ous membranes of humans causing a variety of
of V. atypica found in the gut of endurance diseases. C. tropicalis has a strong vitality and is
athletes is associated with increased treadmill highly infectious. It is responsible for approxi-
run-time performance. This effect was found to mately half of the beyond-surface Candida
be due to the propionate metabolite produced by infections with the second most virulence
the organism from lactic acid. observed in Candida species. It is more often
Biological characteristics: Lactate is fermented associated with deep fungal infections than nor-
by V. atypica to propionate and acetate by the mal mucosa and can be easily identified using
methylmalonyl-CoA pathway, and a small phenotypic and molecular methods. Antifungal
amount of ATP is produced in this process due agents can be used to treat the infections caused
to high substrate affinity. by C. tropicalis. The size of the diploid genome is
Colonization characteristics: Colonies are approximately 14 Mb, with 33.2% GC content.
round, convex, white, non-hemolytic, and mucoid Biological characteristics: Candida tropicalis
in blood BHI media after 18–24 h of culturing at reproduces asexually by the production of
37 C (Figs. 6.35 and 6.36). blastoconidia through budding. It can survive in
high salt concentration and can develop fungal
persistence in saline environments. The optimum
pH value for the growth of C. tropicalis is 5.5,
6.3 Fungi
and the optimum temperature ranges from 25 to
35 C. There are different media on which
6.3.1 Candida tropicalis
C. tropicalis can grow effectively. The most com-
mon medium used is the Sabouraud agar and
Candida tropicalis is an asexual, diploid, oppor-
Corn Meal Agar.
tunistic pathogen, with a shape ranging from
Fig. 6.34 Cells of

V. atypica (SEM)

V. atypica (BHI agar)
274 Y. Li et al.

V. atypica
(stereomicroscope)
Fig. 6.37 Cells of

C. tropicalis (Gram stain)
Colonization characteristics: Colony of 35 C for 48 h, approximately 1.5-mm-sized

C. tropicalis are white, smooth, and butyrous iron blue colonies could be found according to
with a fringed border (Figs. 6.39 and 6.40). the enzyme substrate method.
When cultured on CHROMagar™ Candida at
Fig. 6.38 Cells of

C. tropicalis (SEM)

C. tropicalis
276 Y. Li et al.

C. tropicalis
(stereomicroscope)
6.3.2 Candida glabrata conditions required are same as most of the Can-
dida species, i.e., on Sabouraud medium and
Candida glabrata, formerly known as Torulopsis Corn Meal Agar, except for the slow growth. It
glabrata, is a species of opportunistic pathogens should be noted that C. glabrata ferments and
(Figs. 6.41 and 6.42). It is often considered as the assimilates only glucose and trehalose, which
second most common cause of candidiasis and could be used for its identification. The frequent
also a commensal of human mucosal tissues. genome rearrangements contribute to its fitness to
Unlike C. albicans, C. glabrata is a species of thrive under stressful conditions, helping the fun-
haploid yeast with 13 chromosomes, whose mat- gus to tightly adhere and develop a resistance
ing types are common. The genome of to the drugs. C. glabrata has innate tolerance to
C. glabrata undergoes frequent rearrangements, most azoles; however, it is vulnerable to
contributing to high resistance to antifungal polyenes. Its resistance to echinocandin is gradu-
agents such as azoles. The identification of ally increasing, making its treatment more
C. glabrata usually requires culturing for several difficult.
days. Thorough treatment is difficult to accom- Colonization characteristics: The growth on
plish as the infection spreads rapidly and drug Sabouraud medium is slow. Colony of
resistance. The median total length of the genome C. glabrata are small, gray, and smooth after
size is approximately 12 Mb, with 38.6% median 2–3 days of incubation (Figs. 6.43 and 6.44).
GC content. Pseudohyphae and chlamydospore cannot be
Biological characteristics: C. glabrata do not formed on 1% Tween80-Corn Meat Agar
form hyphae. The culturing methods and Medium. However, when cultured on
Fig. 6.41 Cells of

C. glabrata (Gram stain)
Fig. 6.42 Cells of

C. glabrata (SEM)
278 Y. Li et al.

C. glabrata

C. glabrata
(stereomicroscope)
CHROMagar™ Candida at 35 C for 48 h, 6.3.3 Candida parapsilosis

approximately 2-mm-sized lavender colonies
could be found. Candida parapsilosis is a species of clinically
important yeast-like fungus, previously known
Fig. 6.45 Cells of

C. parapsilosis (Gram
stain)
Fig. 6.46 Cells of

C. parapsilosis (SEM)
as Monilia parapsilosis, and was considered non- species of Candida from blood cultures in Asia,
pathogenic (Figs. 6.45 and 6.46). It is considered Europe, Canada, and Latin America. It is most
an important emerging nosocomial pathogen, commonly isolated from the human skin.
which often infects patients via catheters and C. parapsilosis is not an obligate human pathogen
internal medical devices in the hospitals. It is and is widely distributed in the environment.
now the second most common non-C. albicans Immunocompromised individuals and those
280 Y. Li et al.

C. parapsilosis
undergoing surgery of the gastrointestinal tract 6.3.4 Candida krusei

can contribute to C. parapsilosis colonization.
Treatment of invasive candidiasis includes the Candida krusei is species of opportunistic patho-
removal of foreign bodies and the administration gen, but also yeast used in food processing
of antifungal agents. The median total length of (Figs. 6.49 and 6.50). Candida krusei is also
genome size of C. parapsilosis is approximately referred to as Pichia kudriavzevii, Issatchenkia
13 Mb, with 38.6% median GC content. orientalis, and Candida glycerinogenes known
Biological characteristics: The shape of as an industrial yeast. Candida krusei is an
C. parapsilosis cell is oval, round, or cylindrical emerging fungal nosocomial pathogen with
under microscope. It can exist in yeast phase or higher mortality than C. albicans, result in
pseudohyphal form, meaning not forming a true patients that obtain this fungus, got the lowest
hyphae. It can produce active molecules to exert 90-day survival period among all Candida spe-
cytotoxic effects on the other organisms. As it is cies, as mainly found in the immunocompromised
an unobligated human pathogen, C. parapsilosis and patients with hematological malignancies.
is frequently encountered in nature than the other The identification of C. krusei becomes easy
species of Candida and is usually transmitted by with its typical colony characteristics on
external sources. Sabouraud medium and 2.5–5.5 7.5–21.5 μm
Colonization characteristics: Colonies are gen- “long-grain rice” appearance on microscopy.
erally white, creamy, and shiny on Sabouraud Voriconazole, polyenes, and echinococcins
medium (Figs. 6.47 and 6.48). C. parapsilosis is could be administrated in the treatment of
smooth or cratered in yeast form, while wrinkled C. krusei, except fluconazole, to which the fungus
or concentric in pseudohyphal form. The colonies has natural resistance. The median total length of
may appear white or lavender when cultured on genome size is approximately 11 Mb, with
CHROMagar™ Candida at 35 C for 48 h. 38.33% median GC content.

C. parapsilosis
(stereomicroscope)
Fig. 6.49 Cells of

C. krusei (Gram stain)
Biological characteristics: C. krusei could be complex varieties of fatty acids and also produce
cultured on Sabouraud agar and Corn Meal Agar a number of short-chain carboxylic acids when
with the maximum temperature of 43–45 C. cultured in saliva containing glucose.
Interestingly, C. krusei is the only Candida that Colonization characteristics: In contrast to the
can grow in vitamin-free media. Grown in media other Candida species, C. krusei demonstrate sig-
containing lactose, C. krusei could metabolize nificantly different spreading colonies with a
282 Y. Li et al.
Fig. 6.50 Cells of

C. krusei (SEM)
matte or a rough whitish yellow surface on of the A. fumigatus has become a priority. It is
Sabouraud dextrose agar (Figs. 6.51 and 6.52). estimated that A. fumigatus could be responsible
Cultured on CHROMagar™ Candida at 35 C for for over 600,000 deaths annually, with a mortality
48 h, approximately 4–5 mm, larger pink colonies rate of 25–90%. The life cycle of A. fumigatus
could be recognized as C. krusei. consists of two phases: a hyphal growth phase
and a sporulation phase. The colonies of this
fungus are produced from conidiophores, and
the spores are ubiquitous in the atmosphere.
6.3.5 Aspergillus fumigatus
Once the immune functions are impaired, the
conidia emerge from dormancy and undergo a
Aspergillus fumigatus is a common fungus of
morphological switch to hyphae by germinating
Aspergillus species that is widespread in the
in the warm, moist, nutrient-rich environment in
nature and playing an important role in the carbon
the human body. This in turn could result in
and nitrogen recycling (Figs. 6.53 and 6.54).
intravascular thrombosis and localized tissue
It is widely distributed in areas with distinct
infarction. Current treatment consists of a class
climates and environment; however, it
of drugs, known as azoles, which have good
demonstrates low genetic variation and lacks pop-
antifungal activity. Aspergillus fumigatus has a
ulation genetic differentiation.
stable haploid genome of 29.4 million base
Aspergillus fumigatus is also a species of
pairs, and median GC content is 49.5%.
opportunistic pathogens, causing a range of
Biological characteristics: Aspergillus
diseases termed as aspergillosis, especially in
fumigatus is a highly aerobic organism, capable
lungs of immunocompromised individuals. With
of growing at 37–50 C, with its conidia surviv-
its increasing prevalence, invasive aspergillosis
ing even at 70 C. The spores are ubiquitous in
has overtaken candidiasis as the most frequent
the atmosphere. Czapek-Dox medium is a growth
fungal infection in the world. Therefore, a study

C. krusei

C. krusei
(stereomicroscope)
medium for propagating fungi and other short stalk, and one segment bulges to form a
organisms, which is conducive for the growth of parietal capsule, which is like a green-colored
A. fumigatus. When this fungus is incubated on flask under microscope. In 80% of capsule, the
Sabouraud agar for 24–72 h, the spores are spores are arranged in a beaded manner in radial
formed with a change of color. Conidia have a pattern, attached to the stalk.
284 Y. Li et al.
Fig. 6.53 Cells of

A. fumigatus
Fig. 6.54 Cells of

A. fumigatus (SEM)

A. fumigatus

A. fumigatus
(stereomicroscope)
Colonization characteristics: On Sabouraud the spores are formed, the colonies are floured,
agar, colonies are white, flocculent, and alike, with color changing from pale gray, green, dark
initially (Figs. 6.55 and 6.56). However, once green, and then smoky green to black.
286 Y. Li et al.
References 6. Imataki O, Uemura M. Chryseobacterium

indologenes, a possible emergent organism resistant
to carbapenem antimicrobials after stem cell transplan-
1. Moon JS, Choi HS, Shin SY, Noh SJ, Jeon CO, Han
tation. Clin Case Rep. 2016;5(1):22–5.
NS. Genome sequence analysis of potential probiotic
7. Janda JM, Lopez DL. Mini review: New pathogen
strain Leuconostoc lactis EFEL005 isolated from kim-
profiles: Elizabethkingia anophelis. Diagn Microbiol
chi. J Microbiol. 2015;53(5):337–42.
Infect Dis. 2017;88(2):201–5.
2. Fernández-Natal I, Sáez-Nieto JA, Rodríguez-
8. Chew KL, Cheng B, Lin RTP, Teo JWP.
Lázaro D, Valdezate-Ramos S, Parras-Padilla T,
Elizabethkingia anophelis Is the Dominant
Medina MJ, Rodríguez-Pollán RH, Blom J, Tauch A,
Elizabethkingia Species Found in Blood Cultures in
Soriano F. Phenotypic, molecular characterization,
Singapore. J Clin Microbiol. 2018;56(3):e01445-17.
antimicrobial susceptibility and draft genome
9. Raygoza Garay JA, Hughes GL, Koundal V, Rasgon
sequence of Corynebacterium argentoratense strains
JL, Mwangi MM. Genome Sequence of
isolated from clinical samples. New Microbes New
Elizabethkingia anophelis Strain EaAs1, Isolated
Infect. 2016;10:116–21.
from the Asian Malaria Mosquito Anopheles
3. Bomholt C, Glaub A, Gravermann K, Albersmeier A,
stephensi. Genome Announc. 2016;4(2):e00084-16.
Brinkrolf K, Rückert C, Tauch A. Whole-genome
10. Young KT, Davis LM, Dirita VJ. Campylobacter
sequence of the clinical strain Corynebacterium
jejuni: molecular biology and pathogenesis. Nat Rev
argentoratense DSM 44202, isolated from a human
Microbiol. 2007;5(9):665–79.
throat specimen. Genome Announc. 2013;1(5):
11. Davis L, DiRita V. Growth and laboratory mainte-
e00793-13.
nance of Campylobacter jejuni. Curr Protoc
4. Brooke JS. Stenotrophomonas maltophilia: an
Microbiol. 2008., Chapter 8:Unit;10:8A.1.1–7.
emerging global opportunistic pathogen. Clin
12. Chen L, Mathema B, Chavda KD, DeLeo FR, Bonomo
Microbiol Rev. 2012;25(1):2–41.
RA, Kreiswirth BN. Carbapenemase-producing Kleb-
5. An SQ, Berg G. Stenotrophomonas maltophilia.
siella pneumoniae: molecular and genetic decoding.
Trends Microbiol. 2018;26(7):637–8.
Trends Microbiol. 2014;22(12):686–96.
The Oral Microbiome Bank of China
7
Xian Peng, Xuedong Zhou, Xin Xu, Yuqing Li, Yan Li, Jiyao Li,
Xiaoquan Su, Shi Huang, Jian Xu, and Ga Liao
Abstract
The Human Microbiome Project (HMP) pro-

moted further understanding of human oral
microbes. However, research on the human
X. Peng · Y. Li · Y. Li · G. Liao (*) oral microbiota has not made as much progress
State Key Laboratory of Oral Diseases, National Clinical as research on the gut microbiota. Currently,
Research Center for Oral Diseases, West China Hospital of the causal relationship between the oral
Stomatology, Sichuan University, Chengdu, China microbiota and oral diseases remains unclear,
X. Zhou (*) and little is known about the link between the
State Key Laboratory of Oral Diseases, National Clinical oral microbiota and human systemic diseases.
Stomatology, Sichuan University, Chengdu, China To further understand the contribution of the
oral microbiota in oral diseases and systemic
Hospital of Stomatology, Sichuan University, Chengdu, diseases, a Human Oral Microbiome Database
China (HOMD) was established in the USA. The
e-mail: zhouxd@scu.edu.cn HOMD includes 619 taxa in 13 phyla, and
X. Xu most of the microorganisms are from Ameri-
State Key Laboratory of Oral Diseases, West China can populations. Due to individual differences
Hospital of Stomatology, Sichuan University, Chengdu, in the microbiome, the HOMD does not reflect
China
the Chinese oral microbial status. Herein, we
Department of Operative Dentistry and Endodontics, West established a new oral microbiome database—
China Hospital of Stomatology, Sichuan University,
Chengdu, China the Oral Microbiome Bank of China (OMBC,
http://www.sklod.org/ombc). Currently, the
J. Li
State Key Laboratory of Oral Diseases, National Clinical OMBC includes information on 289 bacterial
Research Center for Oral Diseases, West China Hospital of strains and 720 clinical samples from the Chi-
Stomatology, Sichuan University, Chengdu, China nese population, along with lab and clinical
State Key Laboratory of Oral Diseases, National Clinical information. The OMBC is the first curated
Research Center for Oral Diseases, Department of description of a Chinese-associated
Cariology and Endodontics, West China Hospital of microbiome; it provides tools for use in
investigating the role of the oral microbiome
X. Su · S. Huang · J. Xu in health and diseases and will give the com-
Single-Cell Center, CAS Key Laboratory of Biofuels and
Shandong Key Laboratory of Energy Genetics, Qingdao munity abundant data and strain information
Institute of BioEnergy and Bioprocess Technology, for future oral microbial studies.
Chinese Academy of Sciences, Qingdao, Shandong, China

https://doi.org/10.1007/978-981-15-7899-1_7
288 X. Peng et al.
Keywords colonized in saliva and plaque, respectively

[15, 18, 19].
Human Microbiome Project · Oral As early as 1891, Miller proposed the theory
microbiome · Oral diseases · Systemic that oral lesion infection may cause a variety of
diseases · 16s rRNA sequence systemic diseases due to oral microorganisms
entering other parts of the body through oral
infection [20]. In recent years, with in-depth
7.1 Introduction study of the microbiome, the correlation between
the oral microbiome and various systemic
With the development of microbiome research in diseases has gradually been confirmed, including
recent years, studies have found that the human digestive system diseases, cardiovascular
microbiome is closely related to systemic diseases diseases, tumours, premature birth, diabetes and
[1–4]. At the end of 2007, the NIH launched the rheumatoid arthritis [9, 21–25]. It has been
Human Microbiome Project (HMP), which aimed reported that an increased intracellular
to resolve microorganisms by mapping the C-reactive protein levels caused by bacterial
genomes of five major parts of the human body infections in the mouth have an important corre-
(buccal, nasal, vaginal, gut and skin lation with the development of atherosclerotic
microbiomes) [5, 6]. The oral microbial commu- vascular disease [26, 27]. C-reactive protein
nity and oral and systemic health are closely levels in saliva can predict the occurrence of
related; they can induce not only dental caries, acute myocardial infarction, which will benefit
apical periodontal disease, periodontal disease, the early diagnosis and control of disease
pericoronitis, oral mucosal disease and other [28, 29]. Lactobacilli and streptococci, which
oral diseases but also many systemic diseases are closely related to dental caries, are involved
[7–12]. in the pathogenesis of infective endocarditis
Based on the clinical features of oral disease [30, 31]. Among them, the early colonization of
diagnosis and treatment, the oral microbiome has oral biofilm—Streptococcus sanguinis in patients
more advantages than other parts of the body in with the highest detection rate of the endocar-
terms of convenience, ease of operation and num- dium—and endocarditis are closely related to
ber of patients. Currently, the Human Oral the occurrence and development of infective
Microbiome Database (HOMD, http://www. endocarditis [32, 33]. Currently, the pathogenesis
homd.org) includes 619 taxa in 13 phyla, 65% occurs with the formation of thrombus-like pro-
of which can be cultured in the laboratory cesses on the surface of normal vascular endothe-
[13, 14]. The human oral cavity is a complex lial cells, promoting bacterial adhesion, which in
ecological niche, containing both exfoliated turn leads to infection [34, 35]. Researchers found
surfaces (mucosa) and non-shedding solid that the expression of Streptococcus gordonii
surfaces (tooth surfaces), and contains fluid virulence-associated factor was significantly
saliva. Therefore, the oral microflora colonized increased in the process of endocardial infection,
on different surfaces have significant spatial spec- which may play a vital role in the endocarditis
ificity [15, 16]. In the process of individual devel- model [32, 36]. In patients with severe periodon-
opment and growth, the oral microbiome changes tal infection, the oral microbiome interacts with
dynamically; as age increases and dentition the immune system in a complex manner, produc-
changes, physiological changes occur in the oral ing persistent chronic inflammation, and some
microbiome, and the composition of oral microbes can also enter the bloodstream
microorganisms in different age groups has large [24, 37–39]. A large number of studies have
specificity [2, 12, 17]. Keijser et al. found that confirmed that diabetes and chronic inflammation
oral microorganisms covered 318 genera of in the human body related to periodontitis can
22 phyla, 5600 and 10,000 of which were lead to systemic inflammatory cytokines, such as
cytokines TNF-α, IL-1β and IL-6, and can
7 The Oral Microbiome Bank of China 289
increase the body’s oxidative stress, affecting first goal of this study was to develop a provi-
insulin sensitivity and glucose metabolism sional taxonomic scheme for unnamed Chinese
[38, 40–43]. Human chronic inflammation caused oral bacterial isolates and phylotypes and provide
by periodontal microbial infections is likely to be this information in an online publicly available
one of the mechanisms that contributes to the database, namely, the Chinese Oral Microbiome
development of diabetes [15, 44–46]. Moreover, Bank of China (OMBC) (http://www.sklod.org/
a recent study showed that periodontal pathogens ombc). The second goal was to analyse the 16S
involved in the occurrence of rheumatoid arthritis rRNA gene oral clone sequences to determine the
(RA) also exhibit a certain correlation number of clones observed for each Chinese oral
[47]. Actinobacillus actinomycetemcomitans can taxon and to identify additional taxa that were not
induce the dysregulation of PAD activity in host included in the initial setup of the OMBC.
neutrophils by the secretion of toxin P or toxin A
(LtxA), leading to a high degree of citrullination
of proteins in neutrophils and the formation of 7.2 Results
autoantigens [48]. LtxA also alters neutrophil
morphology, mimicking neutrophil extracellular 7.2.1 Overview of the Online
trapping nets and causing neutrophil lysis, even- Database
tually releasing massive citrullinated antigens
[43, 49]. Unlike Porphyromonas gingivalis, The Chinese Oral Microbiome Database has two
which synthesizes bacterial PAD, Actinobacillus main parts currently; one component is bacterial
actinomycetemcomitans induces autoantigen for- strain information in the Chinese population,
mation by inducing endogenous PAD activity, which is based on the 16S rRNA gene sequences
leading to the formation of ACPA and rheuma- that were used to define individual Chinese oral
toid factor and the development of RA [30, 50]. In taxa and create the taxonomic structures in the
addition, the oral microbiome may also serve as a database. The other component is clinical sample
“fingerprint” for the development and treatment information, which was obtained through second-
of rheumatoid arthritis [51]. A recent study found generation sequencing and multi-omics analysis
that there is significant ecological imbalance in to collect biological information on samples for
the oral microbiome of patients with rheumatoid correlation analysis.
arthritis, which can be recovered by the treatment Currently, information on a total of 289 bacte-
of rheumatoid arthritis. Based on a metagenomic rial strains was stored in our online database,
association analysis between the oral and gut and we also collected multidimensional
microflora, a diagnostic classification model of characteristics of the bacterial strains by
the human population in the diagnosis of healthy identifying their biochemistry and molecular
people and rheumatoid arthritis patients was built properties. At the time of writing, the online data-
with a diagnostic accuracy of nearly 100%, base contained 60 (20.76%) 16S rRNA-
suggesting that the oral microorganism group is sequenced bacterial strains, 102 (35.29%) of
linked to the occurrence, development and prog- which had biochemical evidence and
nosis of RA [51]. 117 (40.48%) of which had biochemical
The human oral microbiome constantly descriptions. A detailed exhibition of the
interacts and evolves with the human body, and phylogenies of the 289 bacteria can be seen in
the composition of the human oral microbiome the phylogenetic tree (Fig. 7.1). The evolutionary
varies greatly in different ethnicities and regions; tree was inferred using the Neighbour-Joining
studying the oral microbiome in the Chinese pop- method [52]. The bootstrap consensus tree
ulation is indispensable. Given the importance of inferred from 1000 replicates was assumed to
the oral microbiome and with the aims to further represent the evolutionary history of the analysed
study the Chinese oral microbiology group and taxa [53]. Branches corresponding to the
serve oral microbiology researchers in China, the partitions reproduced in less than 50% bootstrap
290 X. Peng et al.
Fig. 7.1 Evolutionary relationships of cultured bacteria. final dataset. Evolutionary analyses were conducted in
All positions containing gaps and missing data were MEGA7
eliminated. There was a total of 1255 positions in the
replicates are collapsed. The evolutionary contain ten families, Micrococcaceae, Actinomy-
distances were computed using the Kimura cetaceae, Neisseriaceae, Enterobacteriaceae,
two-parameter method [54] and are in the units Pseudomonadaceae, Moraxellaceae, Staphylo-
of number of base substitutions per site. The coccaceae, Lactobacillaceae, Streptococcaceae
name of each bacteria is followed by its and Veillonellaceae. It is remarkable that all the
designated OMBC accession number. An over- 289 bacteria have been cultured and phenotypi-
view of the phylogenetic distribution of these cally analysed, including their colony colonial
289 bacteria is shown in Table 7.1. Three phyla, morphology, Gram staining and image recording
Firmicutes, Proteobacteria, and Actinobacteria, through a scanning electron microscope,
Table 7.1 Phylogenetic distribution of 289 bacteria in OMBC

Phylum/number Class/number Order/number Family/number
NULL 195 NULL 195 NULL 195 NULL 195
Actinobacteria 22 Actinobacteridae 22 Actinomycetales 22 Micrococcaceae 3
Actinomycetaceae 19
Proteobacteria 12 Betaproteobacteria 5 Neisseriales 5 Neisseriaceae 5
Gammaproteobacteria 7 Enterobacteriales 4 Enterobacteriaceae 4
Pseudomonadales 3 Pseudomonadaceae 1
Moraxellaceae 2
Firmicutes 60 Bacilli 57 Bacillales 5 Staphylococcaceae 5
Lactobacillales 52 Lactobacillaceae 2
Streptococcaceae 50
Clostridia 3 Clostridiales 3 Veillonellaceae 3
transmission electron microscope and laser con- comprehensive analysis system and bacterial
focal microscope (Fig. 7.2). Furthermore, our strain application system, are under development.
database supports views, queries and basic local
alignment search tool (BLAST), and free
7.2.1.1 Web-Accessible Functions
downloads of the information on bacterial strains
The upper navigation menu provides entries for
are available. New services, such as a
each of the functions of the database. Registration
Fig. 7.2 Phenotypic records of a cultured microorganism, staining. (d) Scanning electron microscopy. (e) Transmis-
a Streptococcus mutans strain (COCC139), are shown. (a) sion electron microscopy. (f) Observation of extracellular
Separated microbe on a Mitis Salivarius (MS) Agar plate. polysaccharides (red) and bacterial cells (green) by confo-
(b) Different colony forms on a blood agar plate. (c) Gram cal laser scanning microscopy
292 X. Peng et al.
Fig. 7.3 Description of the functions of the database. (a) Layout of the OMBC homepage; (b) layout of the query and
view database page; (c & d) BLAST function and result page
and login functions are located at the upper right. (Fig. 7.3b). Clicking on the bacteria library ID
A quick start of the database view and database or separate ID leads to the detailed information
query is located in the middle of the page, follow- page of a particular bacterial strain, and this page
ing the overall statistics of the datasets, which is displays the most important characteristics of the
updated real time (Fig. 7.3a). bacterial strain, which includes the following
The layout of the view database page contains fields:
a search module and list of bacteria by taxa
Bacteria_Library_Id/Separate_Id: The official
ID. Bacterial information can be searched using
library ID and original separate ID of the
a keyword, and the search results can be listed in
isolated microorganisms
ascending or descending order by genus, family
Bacteria_Name: The name of the isolated
or order. The results are listed by four main
microorganisms in both Latin and Chinese
variables, including unique taxa ID, separate
Description: Description of the physiological
no., bacteria name and disease association status.
characteristics of the isolated microorganisms
Clicking on the taxa ID or separate ID will lead to
Kingdom/Phylum/Class/Order/Family/Genus:
the detailed information page of a particular bac-
The official biological classification of the
terial strain. Clicking each of the keywords
isolated microorganisms
(underlined phrase) of the bacterial strain name
Separate_Method/Separate_Source: The separate
and health association status column within the
method and source of the isolated
result list can trigger a new set of results in the
microorganisms
same category with the same keyword. A very
Identify_Method: The method used for the iden-
convenient function is to determine bacterial
tification of the isolated microorganisms
strains that have the same characteristics
Relativity_Healthy: The health status of the diagnosis and prognosis of systemic diseases
individuals from whom the isolated was demonstrated through applications in studies
microorganisms were isolated from on rheumatoid arthritis [50, 85].
Hemolysis/Gram_Stain/H2O2_Enzyme/Oxidase: The oral cavity is an interactive environment.
The metabolic abilities of the isolated Oral diseases, such as oral lichen planus and oral
microorganisms cavity cancer, are closely related to oral
16S_Sequence/Molecule_Confidence: The microorganisms. Therefore, it is of great signifi-
sequence of 16S rRNA and the identity of the cance for multifactor studies on oral diseases to
16S rRNA sequence construct a comprehensive oral microbial data-
base. By combining the clinical data of oral
microbial communities and the microbiological
metagenomics data of healthy and Chinese
7.3 Discussion
patients from multiple regions, ethnicities and
ages, the OMBC was established, and clinical
Currently, aside from traditional microbiome
samples were collected, isolated and identified.
research techniques, many new high-throughput
The OMBC is the first publicly available human
analytical techniques have been developed and
oral microbiome database for the Chinese popu-
adopted in modern microbiome metagenomic
lation. Moreover, the OMBC has several key
studies. We now have a completely new under-
features. First, this well-organized database was
standing of oral microbes from analysing the
built according to industrial standards for maxi-
characteristics of the oral microbiome samples
mum expansion and migration capacity, and
of twins [46, 55, 56], newborns [57, 58], infants
regulations regarding microbial data management
[59, 60] and children [61–64], adolescents
were established. Second, the OMBC contains all
[65, 66], adults [56, 67–69] and the elderly [70–
kinds of metadata, such as 16S rRNA sequencing
72]. The new concept of the “oral core
data and key property information on the
microbiome” suggests that this phenomenon
microbiome, and can compare bacterial 16S
should be personalized in accordance with the
rRNA sequences and predict oral microbial
ecological characteristics of the oral environment
classifications and related clinical information
in certain populations at different ages or grades
based on clinical sample gene sequences. Third,
of disease [15, 16, 39, 73]. By monitoring the
the taxa ID that we created can be used as a
dynamic changes in the structure and function of
unique identifier of the Chinese oral microbiome
microorganisms, the relationship between oral
to facilitate connections and communication
bacterial flora and these diseases, such as peri-
among different studies. Fourth, all data can be
odontal disease [22, 74, 75] and lichen planus
filtered and sorted in many precise methods to
[76, 77], was revealed.
maximize query efficiency. Lastly, all of the
By studying the oral microbiome of patients
data can be downloaded freely via our website.
with systemic diseases, the role of the oral
However, there are still many limitations of
microbiome in the occurrence and development
our database. The current quantity of the
of systemic diseases (leukemia [42, 78], head and
microbiome is to be improved as more samples
neck cancer [79–81], HIV [82, 83], diabetes
and data are collected continuously. Additional
[42, 84], etc.) was clarified. Chinese researchers
registries will make this database more useful for
also proposed that the microbial indices of caries
future multicentre studies and will more accu-
(MiC), the microbial indices of gingivitis (MiG)
rately reflect the overall distribution and evolution
and the relative microbial recovery indices
trends of the microbiome of the Chinese popula-
(RMRI) were used to evaluate gingival healthcare
tion. In addition, we also plan to expand our data
programmes based on the distribution pattern of
dimension by adding more detailed data and
bacteria in different sites within the oral cavity.
external data in addition to the current datasets.
The potential role of oral microbes in the
In the meantime, we will improve data quality.
294 X. Peng et al.
To improve the visibility and usability of the samples on the gum or gingival margin were
OMBC, we are working to carry out extensive big collected by a spoon scaler.
data studies with the database to obtain more Collection of other infection samples: Infec-
profound insights into the oral microbiome, such tion samples were generally sampled with sterile
as interaction networks among bacteria. It is also cotton swabs. A purulent fluid sample of the
our mission and responsibility to build this data- periodontal abscess was collected with sterile
base into a national platform as an important syringes. The tissue pieces in the alveolar socket
component of the world microbiome field and to were generally collected as samples of dry
benefit global microbiome investigators. The sockets developed after tooth extraction.
characteristics and commonality of microbiome- Collection of oral mucosal diseases samples:
related phenomena are receiving more and more White membrane materials were collected with
attention. Understanding microbiomes closely curettes or cotton swabs. To collect quantitative
related to humans helps us better understand samples, filter papers with a particular area
human beings and comprehensive studies on the are used.
microbiome help with the prevention, diagnosis Sample delivery: Among oral clinical
and treatment of many major human diseases in specimens, the detection of specimens of fungus,
modern precision medicine. aerobic bacteria and general facultative anaerobic
bacteria was cotton swab-sampled and sent in
sterile tubes directly. For the detection of most
anaerobic bacteria or microaerophilic bacteria,
7.4 Materials and Methods
samples were sent to the laboratory as soon as
possible in an anaerobic way. In addition, a pus or
7.4.1 Collection and Transport
saliva sample was inserted directly into the nee-
of Samples
dlepoint sterile rubber stopper of a syringe needle
tube for transport; most of the samples were put in
Collection of saliva samples: Unstimulated sali-
the prereduction of anaerobic culture media and
vary samples were collected as described previ-
transported to the lab after immediate acquisition
ously, which was followed by a gentle rinse with
in order to reduce the death of bacteria that were
warm water to remove the food residue. In addi-
sensitive to oxygen in the carrying process. Vac-
tion, 0.5–1.0 mL of naturally secreted saliva was
cination beside the chair and anaerobic delivery
collected, or saliva samples in the oral cavity were
were used to improve the detection rate of obli-
absorbed directly by the sterile pipette tips of a
gate anaerobic bacteria. For clinical specimens
micro-concentrator.
that could not be inspected in a timely manner
Collection of plaque samples: Plaque samples
or delivered over a long distance, anaerobic bags
were collected in different ways depending on
(commercially available) or prereductions of liq-
different clinical requirements and purposes.
uid spiral tubules stamped with liquid paraffin
Plaque indicators were used to display plaque
were used for delivery.
for some collections. Before sample collection,
subjects gargled with warm water to remove
food residue in their mouths. Then, sterile gauze
or a yarn ball was used to isolate saliva and collect 7.4.2 Dispersion and Dilution
plaque samples or decayed materials. A sterile of Samples
probe was used in the collection of plaque in the
occlusal surface fissure. Adjacent surface plaque Oral clinical infection is generally a mixed infec-
samples were collected with both a sterile probe tion of many bacteria, with mixed species and
and dental floss or with a fine wire used in ortho- varying quantities of bacteria in a concentrated
dontics. A sterile curette was used in the collec- plaque mass. Thus, an oral clinical specimen is
tion of root surface plaque samples. Plaque usually required for inoculation after
decentralized processing and dilution to achieve a train general aerobic and facultative anaerobic
single colony of pure culture. bacteria, ordinary medium containing blood agar
Sample dispersion: Generally, two methods, (BA) was used.
named spiral vortex oscillation and ultrasonic Inoculation of samples: The spread method,
dispersing, are adopted. drop method and spiral vaccination method were
Sample dilution: Oral clinical samples are adopted for oral clinical bacteriology samples,
mixed bacterial infection samples, with mixes in which makes the appropriate dilution degrees of
the number and variety of bacteria. Therefore, the specimen solution and quantitative inocula-
proper concentrations of diluent dilution are tion on the agar plate.
required before vaccination to obtain a single Incubation of samples: For a medium that has
colony after the sample dispersion process. The received clinical samples, its incubation
transporting fluid can be used as a diluent, and a conditions are determined according to the
phosphate buffer with a pH value of 7.2 is also requirements of cultivation, including atmo-
available. Tenfold dilution series are usually spheric conditions, temperature and time. Oral
used. Under an aseptic operating status, a speci- clinical specimens, such as an infected root
men liquid of 0.1 mL is added to 0.9 mL of canal, pericoronitis infection after tooth extrac-
diluent, and 0.1 mL of mixture after the diluent tion and samples under the gums of periodontitis
is thoroughly incorporated (10 1) is added to a plaque, whose main characteristics are mixed
tube containing 0.9 mL of diluent for blending. bacterial infection, are generally involved differ-
According to the above method, tenfold dilution ent atmospheric conditions with a variety of
series are achieved. Different samples have dif- microorganisms with their respective
ferent diluted concentrations, such as a saliva characteristics. An anaerobic culture containing
sample dilution degree of 10 4–10 6, a gingiva 80% N2, 10% CO2 and 10% H2 at atmospheric
groove plaque dilution of 10 1–10 2 and a conditions with a temperature of 37 C and a time
plaque collection dilution of 10 3–10 5. of 48–72 h was used to grow the bacteria. Some
bacteria in the mouth, such as Treponema, were
trained in the anaerobic environment for approxi-
mately 1 week. Common anaerobic incubation
7.4.3 Inoculation and Incubation
devices include an anaerobic glove box, anaero-
of Samples
bic incubation and anaerobic bag.
In addition, to select the appropriate medium
before inoculation, vaccination dilution degrees,
inoculation method and incubation environment 7.4.4 Smear and Stain
and times must be established according to the
specimen type, purpose and microbial species. Smear test and slide stain are basic techniques for
Selection of the medium: The basic media the identification of microbes, and they are primar-
commonly used for oral bacteria include cardio- ily used for morphological observation. A combi-
cerebral immersion (BHI) medium, pancreatic nation of smear and stain tests is widely used in
enzyme-hydrolysed soy agar (TSA) and TPY oral microbial research for differentiating spiro-
agar medium. These media can be used to culti- chete, bacteria, fungi and protozoa and to identify
vate most bacteria in oral samples. Approxi- specific cellular structures, including spores,
mately 5% of fibre blood serum (or 5% serum) capsules and flagella. Therefore, we used a direct
and chlorinated haemoglobin and vitamin K1 smear test and stained smear test under a micro-
were supplied to the culture medium for some scope for cellular morphological examination,
obligate anaerobic Gram-negative bacterium. To including Gram staining and Congo red staining.
296 X. Peng et al.
7.4.5 Growth Characteristics 7.4.7 Molecular Method

and Identification
The 16S rRNA gene was used as the standard for
Phenotypic organism identification is the most the classification and identification of microbes
basic and important part of microbiology. The because it is present in most microbes and shows
classical method for bacterial identification is to proper changes. Type strains of 16S rRNA gene
observe the phenotypic characteristics on a foun- sequences for most bacteria and archaea are avail-
dation of pure bacterial culture, including colony able in public databases (GenBank).
characteristics (size, colour, shape, etc.), cell
characteristics (size, shape, arrangement and
dying), special structure (with or without spores, 7.4.8 DNA Extraction and Sequencing
capsule and flagellum), culture characteristics
(sensitivity to oxygen, optimum growth tempera- Total DNA was extracted from collected samples
ture and pH, requirements for nutrients and from each respective host. The barcoded 16S
growth factors, etc.) and metabolites. Bergey’s rRNA amplicons [86] (V1–V3 hypervariable
Manual of Systematic Bacteriology, which is an region) of all samples were sequenced on using
authoritative reference book for bacterial isola- a Roche 454 FLX Titanium. Pyrosequencing data
tion, is the reference for the growth characteristics were analysed using scripts from MOTHUR [87],
of bacteria. Bacterial colony morphology QIIME [88] and custom R scripts. All raw
includes size, colour, shape, growth patterns and sequences were deposited at the OMBC [89].
characteristics. Haemolytic reaction is one of the
basic characteristics of bacterial identification.
Some bacteria can produce a haemolytic reaction,
7.4.9 16S rRNA Alignment
whereas some produce pigmentation; this test has
been used for differentiation; some bacteria pro-
All bacterial 16S rRNA gene sequences that we
duce gas, and some bacteria exhibit their own
believe represent oral taxa and named human oral
growth patterns, such as the migration of Proteus
species in GenBank were entered. Evolutionary
growth.
analyses were conducted by exporting aligned
sequences from our database in MEGA7
[90]. Phylogenetic trees were made using the
7.4.6 Biochemical Tests Neighbour-Joining method [52]. Bootstrapping
was performed using 1000 replicates [53].
Biochemical tests are an important microbial
identification method. Routinely, biochemical
tests include the carbohydrate fermentation test, 7.4.10 Database and Web Design
methyl red test, citric acid utilization test and
hydrogen sulphide production test. The micro- The backbone of our platform is an industrial
biochemical test reaction plate we used included standard LAMP system (Fig. 7.4). Linux
30 biochemical matrixes and relevant biochemi- (CentOS) provides maximum stability and a
cal test indicators, phosphate-buffered saline multithread computation environment as the
(PBS), a bacterial turbidity standard tube and operating system; Apache provides the most
eight identification series and was used in a important and fundamental function as the web
VITEK-2 COMPACT. service; MySQL works as the relational database,
Fig. 7.4 Description of the essential elements and main methodology used in the establishment of the OMBC. The
backbone of the database is the LAMP model
and PHP is adopted for dynamic web page ren- to the suggestions of more than 20 professionals
dering. PHP is also used to code the Common in microbiome research with more than 10 years
Gateway Interface (CGI) to the relational data- of expertise in this field. The key features of our
base. Our database can be accessed via the URL database include the following: (1) The database
http://www.sklod.org/ombc has been designed with a user-friendly interface.
Users can start using the core functions immedi-
ately without professional training. (2) The back-
7.4.11 Curation office management system provides add, delete
and modify record functions for administrators.
The project investigators Peng Xian, Zhou We plan to make the system a public platform that
Xuedong, Xu Xin, Li Yuqing, Li Yan, Li Jiyao, enables users to upload their own bacterial strain
Su Xiaoquan, Huang Shi, Xu Jian and Liao Ga information in the near future. (3) Query provides
carried out the curation of the database. These statistical functions that can efficiently analyse
investigators reviewed each item on the taxon the trends and distributions of each variable of
description page. the dataset as a whole. (4) Export and backup
functions plus a complete restoration mechanism
ensure data security and integrity.
7.4.12 Service and Function
Acknowledgments This work was supported by the
National Key R&D Program of China
The database and query and statistical functions (2017YFC0840100 and 2017YFC0840107), the Key Proj-
deployed were designed and developed according ect for Frontier Research of Science and Technology
298 X. Peng et al.
Department of Sichuan Province (2016JY0006 to X.Z.) 16. Xu X, et al. Oral cavity contains distinct niches with
and the National Natural Science Foundation of China dynamic microbial communities. Environ Microbiol.
(81670978 and 81430011 to X.Z, 81470746 and 2015;17(3):699–710.
81772275 to G.L, 81700963 to X.P). The content of 17. Alcaraz LD, et al. Identifying a healthy oral
this chapter was modified from a paper reported by microbiome through metagenomics. Clin Microbiol
our group in Int J Oral Sci (Peng X et al. 2018). The Infect. 2012;18(Suppl 4):54–7.
related contents are reused with permission. 18. Zaura E, Nicu EA, Krom BP, BJF K. Acquiring and
maintaining a normal oral microbiome: current per-
spective. Front Cell Infect Microbiol. 2014;4:85.
Conflicts of Interests The authors declare that they have
19. Koopman JE, et al. Nitrate and the origin of saliva
no conflicts of interests.
influence composition and short chain fatty acid pro-
duction of oral microcosms. Microb Ecol. 2016;72
(2):479–92.
20. Pizzo G, Guiglia R, Lo Russo L, Campisi G. Dentistry
References and internal medicine: from the focal infection theory
to the periodontal medicine concept. Eur J Intern Med.
1. Schmidt TSB, Raes J, Bork P. The human gut 2010;21(6):496–502.
microbiome: from association to modulation. Cell. 21. Jenkinson HF. Beyond the oral microbiome. Environ
2018;172(6):1198–215. Microbiol. 2011;13(12):3077–87.
2. Ferreiro A, Crook N, Gasparrini AJ, Dantas 22. Fan X, et al. Human oral microbiome and prospective
G. Multiscale evolutionary dynamics of host- risk for pancreatic cancer: a population-based nested
associated microbiomes. Cell. 2018;172(6):1216–27. case-control study. Gut. 2018;67(1):120–7.
3. Byrd AL, Belkaid Y, Segre JA. The human skin 23. Tilg H, Cani PD, Mayer EA. Gut microbiome and liver
microbiome. Nat Rev Microbiol. 2018;16(3):143–55. diseases. Gut. 2016;65(12):2035–44.
4. Kundu P, Blacher E, Elinav E, Pettersson S. Our gut 24. Jorth P, et al. Metatranscriptomics of the human oral
microbiome: the evolving inner self. Cell. 2017;171 microbiome during health and disease. MBio. 2014;5
(7):1481–93. (2):e01012–4.
5. Lloyd-Price J, et al. Strains, functions and dynamics in 25. Aagaard K, et al. The placenta harbors a unique
the expanded human microbiome project. Nature. microbiome. Sci Transl Med. 2014;6(237):237ra265.
2017;550(7674):61–6. 26. Brown JM, Hazen SL. Microbial modulation of car-
6. Turnbaugh PJ, et al. The human microbiome project. diovascular disease. Nat Rev Microbiol. 2018;16
Nature. 2007;449(7164):804–10. (3):171–81.
7. Furquim CP, et al. The salivary microbiome and Oral 27. Kholy KE, Genco RJ, Van Dyke TE. Oral infections
Cancer risk: a pilot study in Fanconi Anemia. J Dent and cardiovascular disease. Trends Endocrinol Metab.
Res. 2017;96(3):292–9. 2015;26(6):315–21.
8. Johansson I, Witkowska E, Kaveh B, Lif Holgerson P, 28. Velmurugan S, et al. Dietary nitrate improves vascular
Tanner ACR. The microbiome in populations with a function in patients with hypercholesterolemia: a
low and high prevalence of caries. J Dent Res. 2016;95 randomized, double-blind, placebo-controlled study.
(1):80–6. Am J Clin Nutr. 2016;103(1):25–38.
9. Vasconcelos RM, et al. Host-microbiome cross-talk in 29. Skarke C, et al. A pilot characterization of the human
Oral Mucositis. J Dent Res. 2016;95(7):725–33. Chronobiome. Sci Rep. 2017;7(1):17141.
10. Kalyan S, et al. Systemic immunity shapes the oral 30. Kriebel K, Hieke C, Müller-Hilke B, Nakata M,
microbiome and susceptibility to bisphosphonate- Kreikemeyer B. Oral biofilms from symbiotic to path-
associated osteonecrosis of the jaw. J Transl Med. ogenic interactions and associated disease -connection
2015;13:212. of periodontitis and rheumatic arthritis by
11. Shi B, et al. The denture-associated oral microbiome in peptidylarginine deiminase. Front Microbiol.
health and stomatitis. mSphere. 2016;1(6) 2018;9:53.
12. Baker JL, Bor B, Agnello M, Shi W, He X. Ecology of 31. Mitchell J. Streptococcus mitis: walking the line
the Oral microbiome: beyond Bacteria. Trends between commensalism and pathogenesis. Mol Oral
Microbiol. 2017;25(5):362–74. Microbiol. 2011;26(2):89–98.
13. Chen T, et al. The human oral microbiome database: a 32. Agnello M, et al. Microbiome associated with severe
web accessible resource for investigating oral microbe caries in Canadian first nations children. J Dent Res.
taxonomic and genomic information. Database 2017;96(12):1378–85.
(Oxford). 2010;2010:baq013. 33. Zhu F, Zhang H, Wu H. Glycosyltransferase-mediated
14. Dewhirst FE, et al. The human oral microbiome. J sweet modification in Oral streptococci. J Dent Res.
Bacteriol. 2010;192(19):5002–17. 2015;94(5):659–65.
15. Zaura E, Keijser BJF, Huse SM, Crielaard W. Defining 34. Rammos C, et al. Impact of dietary nitrate on
the healthy “core microbiome” of oral microbial age-related diastolic dysfunction. Eur J Heart Fail.
communities. BMC Microbiol. 2009;9:259. 2016;18(6):599–610.
35. Slocum C, Kramer C, Genco CA. Immune 51. Edlund A, et al. Metabolic fingerprints from the human
dysregulation mediated by the oral microbiome: poten- oral microbiome reveal a vast knowledge gap of
tial link to chronic inflammation and atherosclerosis. J secreted small peptidic molecules. mSystems. 2017;2
Intern Med. 2016;280(1):114–28. (4)
36. Garcia SS, et al. Targeting of Streptococcus mutans 52. Saitou N, Nei M. The neighbor-joining method: a new
biofilms by a novel small molecule prevents dental method for reconstructing phylogenetic trees. Mol
caries and preserves the oral microbiome. J Dent Res. Biol Evol. 1987;4(4):406–25.
2017;96(7):807–14. 53. Felsenstein J. Confidence limits on phylogenies: an
37. Pozhitkov AE, Beikler T, Flemmig T, Noble approach using the bootstrap. Evolution; Int J Org
PA. High-throughput methods for analysis of the Evol. 1985;39(4):783–91.
human oral microbiome. Periodontol 2000. 2011;55 54. Kimura M. A simple method for estimating evolution-
(1):70–86. ary rates of base substitutions through comparative
38. Linden GJ, Herzberg MC, Working group 4 of the studies of nucleotide sequences. J Mol Evol. 1980;16
joint EFPAAPw. Periodontitis and systemic diseases: (2):111–20.
a record of discussions of working group 4 of the joint 55. Du Q, Li M, Zhou X, Tian K. A comprehensive
EFP/AAP workshop on periodontitis and systemic profiling of supragingival bacterial composition in
diseases. J Periodontol. 2013;84(4 Suppl):S20–3. Chinese twin children and their mothers. Antonie
39. Duran-Pinedo AE, et al. Community-wide Van Leeuwenhoek. 2017;110(5):615–27.
transcriptome of the oral microbiome in subjects 56. Stahringer SS, et al. Nurture trumps nature in a longi-
with and without periodontitis. ISME J. 2014;8 tudinal survey of salivary bacterial communities in
(8):1659–72. twins from early adolescence to early adulthood.
40. Mazumdar V, Snitkin ES, Amar S, Segrè D. Metabolic Genome Res. 2012;22(11):2146–52.
network model of a human oral pathogen. J Bacteriol. 57. Ebersole JL, Holt SC, Delaney JE. Acquisition of oral
2009;191(1):74–90. microbes and associated systemic responses of new-
41. Anbalagan R, et al. Next generation sequencing of oral born nonhuman primates. Clin Vaccine Immunol.
microbiota in type 2 diabetes mellitus prior to and 2014;21(1):21–8.
after neem stick usage and correlation with serum 58. Sampaio-Maia B, Monteiro-Silva F. Acquisition and
monocyte chemoattractant-1. Diabetes Res Clin maturation of oral microbiome throughout childhood:
Pract. 2017;130:204–10. an update. Dent Res J (Isfahan). 2014;11(3):291–301.
42. Xiao E, et al. Diabetes Enhances IL-17 Expression and 59. Al-Shehri SS, et al. Deep sequencing of the 16S ribo-
Alters the Oral Microbiome to Increase Its Pathogenic- somal RNA of the neonatal oral microbiome: a com-
ity. Cell Host Microbe. 2017;22(1):120–128.e124. parison of breast-fed and formula-fed infants. Sci Rep.
43. Zheng J, et al. Diabetes activates periodontal ligament 2016;6:38309.
fibroblasts via NF-κB in vivo. J Dent Res. 2018; 60. Timby N, et al. Oral microbiota in infants fed a for-
https://doi.org/10.1177/0022034518755697. mula supplemented with bovine Milk fat globule
44. Edlund A, et al. An in vitro biofilm model system membranes - a randomized controlled trial. PLoS
maintaining a highly reproducible species and meta- One. 2017;12(1):e0169831.
bolic diversity approaching that of the human oral 61. Ling Z, et al. Analysis of oral microbiota in children
microbiome. Microbiome. 2013;1(1):25. with dental caries by PCR-DGGE and barcoded
45. Warinner C, et al. Pathogens and host immunity in the pyrosequencing. Microb Ecol. 2010;60(3):677–90.
ancient human oral cavity. Nat Genet. 2014;46 62. Xin BC, et al. Microbial diversity in the oral cavity of
(4):336–44. healthy Chinese Han children. Oral Dis. 2013;19
46. Gomez A, et al. Host Genetic Control of the Oral (4):401–5.
Microbiome in Health and Disease. Cell Host 63. Goldberg BE, et al. The Oral bacterial communities of
Microbe. 2017;22(3):269–278.e263. children with well-controlled HIV infection and with-
47. Zhang X, et al. The oral and gut microbiomes are out HIV infection. PLoS One. 2015;10(7):e0131615.
perturbed in rheumatoid arthritis and partly normalized 64. Gomez A, Nelson KE. The oral microbiome of chil-
after treatment. Nat Med. 2015;21(8):895–905. dren: development, disease, and implications beyond
48. Gao W, et al. In-depth snapshot of the equine oral health. Microb Ecol. 2017;73(2):492–503.
subgingival microbiome. Microb Pathog. 65. Smith BC, et al. Distinct ecological niche of anal, oral,
2016;94:76–89. and cervical mucosal microbiomes in adolescent
49. Uriarte SM, Edmisson JS, Jimenez-Flores E. Human women. Yale J Biol Med. 2016;89(3):277–84.
neutrophils and oral microbiota: a constant tug-of-war 66. Koopman JE, et al. The effect of fixed orthodontic
between a harmonious and a discordant coexistence. appliances and fluoride mouthwash on the oral
Immunol Rev. 2016;273(1):282–98. microbiome of adolescents – a randomized controlled
50. Lopez-Oliva I, et al. Dysbiotic subgingival microbial clinical trial. PLoS One. 2015;10(9):e0137318.
communities in periodontally healthy patients with 67. Wu J, et al. Cigarette smoking and the oral microbiome
rheumatoid arthritis. Arthritis Rheumatol. in a large study of American adults. ISME J. 2016;10
2018;70:1008. (10):2435–46.
300 X. Peng et al.
68. Zawadzki PJ, et al. Examination of oral microbiota oropharyngeal cancers. Theranostics. 2017;7
diversity in adults and older adults as an Approach to (17):4313–21.
prevent spread of risk factors for human infections. 80. Gholizadeh P, et al. Role of oral microbiome on oral
Biomed Res Int. 2017;2017:8106491. cancers, a review. Biomed Pharmacother.
69. Huang S, et al. Preliminary characterization of the oral 2016;84:552–8.
microbiota of Chinese adults with and without gingi- 81. Wang L, Ganly I. The oral microbiome and oral can-
vitis. BMC Oral Health. 2011;11:33. cer. Clin Lab Med. 2014;34(4):711–9.
70. Cockburn AF, et al. High throughput DNA sequencing 82. Noguera-Julian M, et al. Oral microbiome in
to detect differences in the subgingival plaque HIV-associated periodontitis. Medicine (Baltimore).
microbiome in elderly subjects with and without 2017;96(12):e5821.
dementia. Investig Genet. 2012;3(1):19. 83. Kistler JO, Arirachakaran P, Poovorawan Y,
71. Kurabayashi H, et al. Identification of oral bacteria by Dahlén G, Wade WG. The oral microbiome in
16S rRNA gene analysis in elderly persons requiring human immunodeficiency virus (HIV)-positive
nursing care. J Infect Chemother. 2011;17(1):40–4. individuals. J Med Microbiol. 2015;64(9):1094–101.
72. JY An et al. Rapamycin treatment attenuates 84. Long J, et al. Association of oral microbiome with
age-associated periodontitis in mice. Geroscience 2017. type 2 diabetes risk. J Periodontal Res. 2017;52
73. Griffen AL, et al. CORE: a phylogenetically-curated (3):636–43.
16S rDNA database of the CORE oral microbiome. 85. Brusca SB, Abramson SB, Scher JU. Microbiome and
PLoS One. 2011;6(4):e19051. mucosal inflammation as extra-articular triggers for
74. Yost S, Duran-Pinedo AE, Krishnan K, Frias-Lopez rheumatoid arthritis and autoimmunity. Curr Opin
J. Potassium is a key signal in host-microbiome Rheumatol. 2014;26(1):101–7.
dysbiosis in periodontitis. PLoS Pathog. 2017;13(6): 86. Huang S, et al. Predictive modeling of gingivitis sever-
e1006457. ity and susceptibility via oral microbiota. ISME
75. Feres M, Teles F, Teles R, Figueiredo LC, Faveri J. 2014;8(9):1768–80.
M. The subgingival periodontal microbiota of the 87. Schloss PD, et al. Introducing mothur: open-source,
aging mouth. Periodontol 2000. 2016;72(1):30–53. platform-independent, community-supported software
76. He Y, et al. Dysbiosis of oral buccal mucosa for describing and comparing microbial communities.
microbiota in patients with oral lichen planus. Oral Appl Environ Microbiol. 2009;75(23):7537–41.
Dis. 2017;23(5):674–82. 88. Caporaso JG, et al. QIIME allows analysis of high-
77. Wang K, et al. Preliminary analysis of salivary throughput community sequencing data. Nat Methods.
microbiome and their potential roles in oral lichen 2010;7(5):335–6.
planus. Sci Rep. 2016;6:22943. 89. Teng F, et al. Prediction of early childhood caries via
78. Moretti S, et al. Fine-tuning of Th17 cytokines in spatial-temporal variations of oral microbiota. Cell
periodontal disease by IL-10. J Dent Res. 2015;94 Host Microbe. 2015;18(3):296–306.
(9):1267–75. 90. Kumar S, Stecher G, Tamura K. MEGA7: molecular
79. Lim Y, Totsika M, Morrison M, Punyadeera C. Oral evolutionary genetics analysis version 7.0 for bigger
microbiome: a new biomarker reservoir for oral and datasets. Mol Biol Evol. 2016;33(7):1870–4.
Invasion of Oral Microbiota into the Gut
8
Bolei Li, Yang Ge, Lei Cheng, Benhua Zeng, Jinzhao Yu,
Xian Peng, Jianhua Zhao, Wenxia Li, Biao Ren, Mingyun Li,
Hong Wei, and Xuedong Zhou
Electronic Supplementary Material: The online version Abstract

of this chapter (https://doi.org/10.1007/978-981-15-7899-
1_8) contains supplementary material, which is available The oral microbiota is associated with oral
to authorized users. diseases and digestive systemic diseases. Nev-
ertheless, the causal relationship between them
B. Li · Y. Ge · J. Yu
State Key Laboratory of Oral Diseases, Sichuan has not been completely elucidated, and colo-
University, Chengdu, China nization of the gut by oral bacteria is not clear
National Clinical Research Center for Oral Diseases, due to the limitations of existing research
Sichuan Unziversity, Chengdu, China models. The aim of this study was to develop
Department of Cariology and Endodontics, West China a human oral microbiota-associated (HOMA)
Hospital of Stomatology, Sichuan University, Chengdu, mouse model and to investigate the ecological
China invasion into the gut. By transplanting human
L. Cheng · X. Zhou (*) saliva into germ-free (GF) mice, a HOMA
State Key Laboratory of Oral Diseases, National Clinical mouse model was first constructed. 16S
Research Center for Oral Diseases, West China Hospital of rRNA gene sequencing was used to reveal
the biogeography of oral bacteria along the
Department of Cariology and Endodontics, West China cephalocaudal axis of the digestive tract. In
China the HOMA mice, 84.78% of the detected
e-mail: zhouxd@scu.edu.cn genus-level taxa were specific to the donor.
B. Zeng · H. Wei (*) Principal component analysis (PCA) revealed
Department of Laboratory Animal Science, College of that the donor oral microbiota clustered with
Basic Medical Sciences, Third Military Medical those of the HOMA mice and were distinct
University, Chongqing, China from those of specific pathogen-free (SPF)
X. Peng · B. Ren · M. Li mice. In HOMA mice, OTU counts decreased
State Key Laboratory of Oral Diseases, Sichuan from the stomach and small intestine to the
distal gut. The distal gut was dominated by
National Clinical Research Center for Oral Diseases, Streptococcus, Veillonella, Haemophilus,
Sichuan Unziversity, Chengdu, China
Fusobacterium, Trichococcus, and Actinomy-
J. Zhao ces. HOMA mice and human microbiota-
Shanghai Majorbio Bio-pharm Technology Co., Ltd,
Shanghai, China associated (HMA) mice along with the GF mice
were then cohoused. Microbial communities of
W. Li
State Key Laboratory of Oral Diseases, National Clinical cohoused mice clustered together and were sig-
Research Center for Oral Diseases, West China Hospital of nificantly separated from those of HOMA mice

https://doi.org/10.1007/978-981-15-7899-1_8
302 B. Li et al.
and HMA mice. The Source Tracker analysis and common experiment animal model, differs from
network analysis revealed more significant eco- that of humans. Therefore, a HOMA mouse
logical invasion from oral bacteria in the small model, with an oral microbiota similar to the
intestines, compared to the distal gut, of cohoused human donors, must be established to reveal the
mice. In conclusion, a HOMA mouse model was cause and effect relationships between the oral
successfully established. By overcoming the microbiota and host pathologies, like the HMA
physical and microbial barrier, oral bacteria mouse model [11, 12].
colonized the gut and profiled the gut microbiota, Not only oral diseases but also oral bacteria are
especially in the small intestine. linked to various digestive systemic diseases,
including inflammatory bowel disease [13, 14],
Keywords colorectal cancer (CRC) [15], pancreatic cancer
[16, 17], liver carcinoma [18], and liver cirrhosis
Oral microbiota · Gut microbiota · Mouse
[19]. Seedorf et al. [20] demonstrated that mouth-
model · Ecological invasion
derived bacteria such as Actinobacteria, Bacilli,
Clostridia, Fusobacteria, and Epsilonproteo-
bacteria are able to overcome the host physical
barrier and persist in the germ-free distal gut.
8.1 Introduction Comparing the gut microbiome of patients
suffering from liver cirrhosis with that of healthy
Clinical trials have indicated that the oral control individuals, Qin et al. [21] found that most
microbiota is associated with dental caries and (54%) of the patient-enriched faecal microbial
periodontitis [1–4], both of which give rise to an species originated from the oral cavity,
extensive loss of natural teeth in older people and demonstrating that the oral microbiota had
are identified as public health problems world- invaded the gut of patients with liver cirrhosis.
wide [5]. Accumulating evidence has even linked These studies indicated that the oral microbiota
the human oral microbiota to oral cancer [6, 7]. In influenced host health by invading and colonizing
recent years, oral microecology dysbiosis has the gut. The colonization of oral microbiota in the
been proven to cause periodontitis [4, 8] and gut is a key point to understand pathologic colo-
regarded as an indicator to predict early childhood nization, facilitating studies of the pathogenic
caries (ECC) [9]. Thus, the oral microbiota plays mechanisms of oral bacteria in systemic digestive
a key role in the initiation of oral diseases. diseases. However, invasion by oral microbiota
An increasing number of clinical research by overcoming host physical barriers and gut
studies of the oral microbiota are being designed. microbiota barriers at various regions along the
However, the clinical investigations are usually cephalocaudal axis of the gut is not well
restricted by complex conditions, including ethi- described.
cal issues. Regardless, a prospective cohort clini- To develop the HOMA mouse model, we
cal study [9] found that shifts in the microbiota introduced the human salivary microbiota into
preceded the manifestation of clinical symptoms GF mice and created a well-defined, representa-
of ECC. Unfortunately, most of the other studies tive animal model of the human oral microbial
were cross-sectional and could barely address ecosystem. Using the HOMA mouse model, we
whether the oral microbiota was the cause or investigated the colonization of gut-selected oral
effect in the development of oral diseases. In bacteria along the longitudinal axis. Furthermore,
vitro models also have limitations due to the we studied the competition of oral microbiota
abundant uncultivated phylotypes in the mouth with the native gut microbiota in various regions
[10]. Animal models would have been considered of the gut and identified key bacteria during the
a good choice to study the oral microbiota; how- ecological invasion, by cohousing HOMA mice,
ever, the oral microbiota of mice, the most HMA mice, and GF mice (Fig. 8.1).
8 Invasion of Oral Microbiota into the Gut 303
GF Mouse HOMA Mouse
HMA Mouse Cohoused Mouse

Human Salivary
Sample Sacrifice
5 weeks
4 weeks
Human Fecal
Sample
Cohouse Cohouse
5 weeks
Fig. 8.1 Design of the human microbiota transplant and cohousing experiments
closely with the HOMA mouse but were distinct

8.2 Results
from SPF mouse microbiota, especially in PC1
(57.91%) (Fig. 8.2a). The oral microbiota of
8.2.1 The Oral Microbiota
HOMA mice differed from that of SPF mice in
of the HOMA Mouse Model
taxonomic structure. Dominant genus-level taxa
present in the donor saliva sample were signifi-
The surveys of oral samples revealed the engraft-
cantly more abundant among HOMA mice than
ment of the human oral microbiota: all bacterial
SPF mice, including Veillonella, Fusobacterium,
phyla, classes, orders, 27 of 28 bacterial families,
Streptococcus, and Haemophilus (Fig. 8.2b, c).
and 84.78% (39 of 46) of genus-level taxa were
detected among the recipient mice. All seven
genus-level taxa missed by the humanized mice
exhibited a low abundance in the donor sample 8.2.2 Biogeography of the Host
(0.21% on average). The oral microbiota of the Gut-Selected Oral Microbiota
donor was dominated by 11 genus-level taxa,
with a high relative abundance (> 1%), of The 16S rRNA gene sequencing survey revealed
which 5, Veillonella, Fusobacterium, Streptococ- that the oral bacteria colonized various segments
cus, Porphyromonas, and Haemophilus, of the gut. In the stomach, 18 genus-level taxa
maintained a high abundance (>1% on average) were detected, with a relative abundance of more
among the recipient mice. The others were than 0.1% on average, 11 of which had a relative
depleted to a low abundance among the recipient abundance exceeding 0.5% on average. In the
mice (Table S1). small intestine, the relative abundances of
To further identify the advantages of the 23 genus-level taxa exceeded 0.1% on average.
HOMA mouse model, we compared the oral Those with a relative abundance greater than
microbiota of HOMA mice with SPF mice. PCA 0.5% on average were Streptococcus, Veillonella,
revealed that the donor oral microbiota clustered Haemophilus, Enterococcus, Fusobacterium,
304 B. Li et al.
a c
●
●
●
●
●●
●
●●
PC3 12.63%
● group
0 ● ● ● Donor_O
● ●
● HOMA_O
● ● SPF_O
●
●
●
−1000
SPF_O
group
group
Donor_O
HOMA_O ●
HOMA_O
SPF_O
Donor_O
−1000 0 1000 2000 3000
b PC1 57.91%
Fig. 8.2 Advancement of the HOMA mouse model. (a) of 16S sequences. (c) The HOMA mouse-enriched taxa
PCA score plot of the oral microbiota of the human donor are indicated by a negative LDA score (red), while the taxa
(Donor_O, red), HOMA mice (HOMA_O, green), and enriched by SPF mice have a positive score (green). Taxa
SPF mice (SPF_O, blue) at the genus level. (b) Taxonomic at the genus level with different abundances between
cladogram for HOMA mouse-enriched taxa (red) and SPF groups and with an LDA score greater than 3.0 are shown
mouse-enriched taxa (green) obtained by LEfSe analysis
Acinetobacter, Enterobacteriaceae_unclassified, and Bacteroides (Fig. 8.3a, Table S2). All six
and Bacteroides. In the caecum, only six genus- main genus-level taxa in the gut were also the
level taxa were detected, with a relative abun- dominant genus-level taxa (>1%) in the mouth
dance greater than 0.1% on average, including of the HOMA mouse (Table S1). Although the
Veillonella, Streptococcus, Haemophilus, microbial communities colonizing various
Fusobacterium, Bacteroides, and Trichococcus. regions shared some main bacteria, the
Genus-level taxa with a relative abundance differences among them were clear. Principal
greater than 0.1% in the colon were the same as coordinates analysis (PCoA) showed that micro-
those in the caecum. The main genus-level taxa in bial communities present in the caecum, colon,
the whole gut were Streptococcus, Veillonella, and faeces clustered together and were distinct
Haemophilus, Fusobacterium, Trichococcus, from those in the stomach and small intestine
Fig. 8.3 Biogeography of gut-selected oral microbiota. from each segment of HOMA mouse guts based on
(a)Heatmap of specimens showing the relative abundance unweighted UniFrac metrics. (c)The Kruskal–Wallis test
of the main identified bacteria at the genus taxonomic level was used to compare the difference between each segment
in each segment of HOMA mouse guts, including the of HOMA mouse guts in the OTU count and Chao index
stomach (St), small intestine (Si), caecum (Ce), colon (*P < 0.05, **P < 0.01)
(Co), and faeces (F). (b) PCoA score plot of the microbiota
306 B. Li et al.
(Fig. 8.3b). OTU counts significantly decreased HOMA mouse (Fig. 8.4c). In the small intestine,
from the stomach and small intestine to the distal seven genus-level taxa were significantly
gut and from the caecum to faeces, as did the increased from HMA mice to cohoused mice,
Chao index (Fig. 8.3c). Distal gut communities six of which were dominant genera in the mouth
were depleted to a low diversity consortium. The of the HOMA mouse: Enterococcus, Streptococ-
relative abundances of Acinetobacter, Enterobac- cus, Empedobacter, Porphyromonas, Moraxella,
teriaceae_unclassified, Lactobacillus, and Trichococcus (Fig. 8.4d). In the distal gut,
Turicibacter, Proteobacteria_unclassified, and four genus-level taxa were significantly increased
Moraxella decreased from the stomach and from HMA mice to cohoused mice, but none was
small intestine to the distal gut and faeces. The the dominant genera in the mouth (Fig. 8.4e, f).
relative abundances of Parabacteroides, Microbial Source Tracker was used to analyse the
Lachnoclostridium, and Blautia decreased from effects of cohousing on the flow of microbes
the caecum and colon to the faeces (Fig. 8.3a). between cage mates, which allowed us to deter-
These results indicated that the oral bacteria were mine whether the assembly processes were
filtered out by the distal gut. involved in shaping the communities. The results
revealed significant ecological invasion by oral
bacteria in the small intestine (Fig. 8.4g).
8.2.3 Ecological Invasion by Oral
Microbiota in the Gut
8.2.4 Porphyromonas Competed
PCoA revealed that the microbial communities in
for Colonization with the Small
every segment could not be distinguished by the
Intestinal Microbiota
original grouping 28 days after cohousing
(Fig. 8.4a). Therefore, the gut microbiota of the
To further study the functional positions of oral
cohoused mice could be regarded as an aggregate,
bacteria in the microbial community colonizing
regardless of the original mouse group. The
the small intestine, the co-occurrence network of
microbial communities of cohoused mice were
the top 50 abundant genus-level taxa was used.
closely clustered with those of HMA mice and
Porphyromonas was found to correlate nega-
distinct from those of HOMA mice in every seg-
tively with Turicibacter (Fig. 8.5). Before inva-
ment (Fig. 8.4a), suggesting that the oral
sion by the oral microbiota, Turicibacter was the
microbiota was unable to challenge the dominant
most dominant genus in the small intestine with
position of the gut microbiota in the gut. Interest-
the highest relative abundance (40.40% on aver-
ingly, further analysis without HOMA mice
age). Following invasion by the oral microbiota,
showed that the microbial communities of
the relative abundance of Porphyromonas
cohoused mice could also be separated from
increased significantly, and the abundance of
HMA mice in every segment (Fig. 8.4b). These
Turicibacter decreased to 8.79% on average
results indicated that although the oral microbiota
(Fig. 8.4d, Fig. S1). Moreover, Porphyromonas
was almost protected by the gut microbiota bar-
was found to correlate positively with these
rier, it reshaped the native gut microbiota. To
genera dominating the mouth of the HOMA
further understand the effect of the oral
mouse, including Streptococcus, Enterococcus,
microbiota on the community composition of
Acinetobacter, Moraxella, Trichococcus,
the gut microbiota, LEfSe analysis was used. In
Fusobacterium, Flavobacterium, and Lactobacil-
the stomach, seven genus-level taxa were signifi-
lus (Fig. 8.5, Table S1). These results suggested
cantly increased from HMA mice to cohoused
that Porphyromonas, as common oral bacteria,
mice. One of the seven genus-level taxa was
played a key role in competing for colonization
Streptococcus, which was the dominant genus
with the native main genus in the small intestine.
(relative abundance >1%) in the mouth of the
a 1.0
Pcoa
HMA_St 1.0
Pcoa
HMA_Si
Pcoa Pcoa
HMA_Co
Cohoused_St Cohoused_Si Cohoused_Co
HMA_Ce
HOMA_St HOMA_Si HOMA_Co
Cohoused_Ce
HOMA_Ce 0.2
0.6
0.5
0.5
0.4
0.0
PC2 : 14.39%
PC2 : 0.96%
PC2 : 7.7%
0.0
PC2 : 1.55%
0.2
0.0
−0.2
−0.5 0.0
−0.4
−0.5
−0.2
−1.0
−0.6
−1.0 −0.4
−1 0 1 2 −1 0 1 2 −2 −1 0 1 2 3
−2 −1 0 1 2 3
b
PC1: 78.91% PC1: 71.28% PC1: 96.53%
PC1: 95.99%
Pcoa Pcoa Pcoa Pcoa

HMA_St HMA_Si HMA_Ce HMA_Co
0.8 Cohoused_St Cohoused_Si Cohoused_Ce Cohoused_Co
0.4
0.4
0.4
0.6
0.2
0.2
0.4
0.2
0.0
PC2 : 14.63%
PC2 : 24.42%
PC2 : 19.59%
PC2 : 21.25%
0.2
0.0
−0.2 0.0
0.0
−0.4
−0.2
−0.2
−0.2
−0.6
−0.4
−0.4
−0.5 0.0 0.5 1.0 −1.0 −0.5 0.0 0.5 1.0 −0.4 −0.2 0.0 0.2 0.4 0.6 0.8 −0.2 0.0 0.2 0.4 0.6
PC1: 41.59% PC1: 57.86% PC1: 41.9% PC1: 32.26%
c d
g **
**
*
**
**
Proportions of the oral sources
1.0
0.8
0.6
0.4
0.2
0.0
e
h
um
on
t in
ac
ol
ec
om
es
C
C
nt
St
lI
al
Sm
Fig. 8.4 The shift in microbial composition after cohous- mouse-enriched taxa have a negative LDA score (red).
ing. (a) PCoA score plot of the microbiota from each gut (d) The HMA mouse-enriched genus level taxa in the
segment of HOMA mice, HMA mice, and cohoused mice. small intestine are indicated by a positive LDA score
(b)PCoA score plot of the microbiota from each gut seg- (green), while the cohoused mouse-enriched taxa have a
ment from HMA mice and cohoused mice. c HMA mouse- negative LDA score (red). (e) The HMA mouse-enriched
enriched genus level taxa in the stomach are indicated by a genus level taxa in the caecum are indicated by a positive
positive LDA score (green), while the cohoused (c) LDA score (green), while the cohoused mouse-enriched
308 B. Li et al.
color phylum size abundance

Actinobacteria
20000
Bacteria_unclassified
Bacteroidetes 2000
Cyanobacteria 100
Firmicutes
Weissella
Fusobacteria
Acinetobacter
Janthinobacterium
Proteobacteria
Corynebacterium_1
Paenibacillus
Trichococcus
Sphingomonas Streptococcus
Moraxella Lactobacillus Erysipelotrichaceae_incertae_sedis
Enterococcus Flavobacterium
Fusobacterium Erysipelotrichaceae_UCG-003
Ruminococcus_2 Bifidobacterium
Staphylococcus Planomicrobium
Cyanobacteria_norank Phascolarctobacterium
Marvinbryantia
Mitochondria_norank
Intestinimonas Hungatella
Blautia
Enterobacteriaceae_unclassified
Veillonella Aquabacterium Porphyromonas Bacteroidales_S24-7_group_norank Alistipes
Butyricimonas Flavonifractor
Turicibacter
Ruminiclostridium
Bacteria_unclassified Escherichia-Shigella Bilophila
Erysipelatoclostridium Megamonas Lachnoclostridium
Ruminococcaceae_uncultured
Lachnospiraceae_uncultured
Parabacteroides
Morganella
Bacteroides
Subdoligranulum
Anaerostipes
Fig. 8.5 The co-occurrence network was generated from represents a genus-level taxon, and the size of each node
the small intestinal microbiota of the cohoused mice. Dif- is proportional to the abundance. The colour of the nodes
ferent coloured edges represent a positive (red) and a indicates their classification at the phylum level
negative (blue) correlation, respectively. Each node
HOMA mouse model can play an important role

8.3 Discussion
in translational medicine, similar to the HMA
mouse model. In the present study, 84.78%
In the past years, cumulative research data have
(39 of 46) of the genus-level taxa were from
implied a tight association between dysbiosis of
donor saliva, similar to the HMA mouse model
the oral microbiota and diseases [3, 6, 7, 16,
receiving 11 of 12 bacterial classes, and 88%
22]. However, it has been difficult to verify the
(58 of 66) of the genus-level taxa were human
contribution of the oral microbiota to diseases via
[12]. Additionally, in subsequent study, we
clinical studies due to their limitations. The lack
inoculated the contents of another two donor sali-
of understanding of the effect and pathogenic
vary glands into GF mice and obtained similar
mechanism of dysbiotic oral microbiota manifests
results [24]. Additionally, the HOMA mouse was
in a great gap between the large amount of data
a better representative for the donor than tradi-
and clinical applications [23]. Thus, for oral
tional SPF mice (Fig. 8.2a). Therefore, it is not
microbiota investigations, the establishment of a
difficult to conclude that the HOMA mouse
Fig. 8.4 (continued) taxa have a negative LDA score showed the proportions of the different sources present in
(red). (f) The HMA mouse-enriched genus level taxa in the microbiota of the cohoused mice in each gut segment.
the colon are indicated by a positive LDA score (green), The Kruskal–Wallis test was used to compare the
while the cohoused mouse-enriched taxa have a negative proportions of the oral sources present in each gut segment
LDA score (red). (g) Microbial Source Tracker analysis of the cohoused mice (*P < 0.05, **P < 0.01)
model was established successfully. Currently, foreign bacteria. However, the microbiota barrier
the HMA mouse is an ideal model to study the of the gut was not consistently indestructible,
role of the disease-associated gut microbiome especially in the small intestine, where six of
[11]. In future, we believe that the HOMA seven increasing genus-level taxa in the cohoused
mouse model could be used to investigate the mice were dominant genera in the mouth of the
effect of a dysbiotic oral microbiota on oral HOMA mouse, including Porphyromonas
diseases, such as dental caries, periodontics, and (Fig. 8.4d). As a key oral genus to overcome the
oral cancer. In addition to oral disease, the gut microbiota barrier, Porphyromonas was
HOMA mouse model will be applied to verify tightly associated with these genera that
whether the oral microbiota is associated with dominated the mouth of the HOMA mouse, but
some digestive systemic diseases. it correlated negatively with Turicibacter, the
In most previous studies, the faecal microbiota most dominant genus in the small intestine of
was collected to represent the gut microbiota; HMA mice. Prior to invasion by oral microbiota,
however, some researchers have had different the relative abundance of Turicibacter in other
opinions and have suggested to divide the diges- regions of the gut was lower than that in the
tive tract into different sections to study the gut small intestine (Fig. S1), which might explain
microbiota [25]. By collecting ileostomy samples why more oral bacteria invaded the small intes-
from humans, Zoetendal et al. [26] found that the tine instead of the other regions. The small intes-
small intestine was enriched with Streptococcus tine is responsible for the majority of substance
sp. and Escherichia coli. Interestingly, in the transformation [27] and is covered by a thinner
present analysis, invasion by oral bacteria into mucin layer than the distal gut [28]. Thus, the
the small intestine increased the relative abun- small intestinal microbiota more effectively
dance of Streptococcus and Enterobacteriaceae impacts digestive systemic health, suggesting
(Fig. 8.4d). Furthermore, in the small intestines of that ecological invasion in the small intestine by
the cohoused mice, nearly 40% of the taxa were Porphyromonas had a marked effect on digestive
from oral microbial communities, which reshaped systemic health. For example, oral administration
the community composition in the small intestine of Porphyromonas gingivalis, belonging to
of the HMA mouse (Fig. 8.4g). Thus, especially Porphyromonas, has been confirmed to induce
in the small intestine, the oral microbiota played gut microbiota dysbiosis and impair mucosal bar-
an important role in building the integrated gut rier function, leading to the dissemination of
microbiota. Enterobacteriaceae to the liver [29, 30].
In the present study, oral bacteria overcame the Another interesting phenomenon is revealed
host physical barrier and colonized the gut in by the barrier function of the gut microbiota.
HOMA mice (Fig. 8.3a, Table S2). However, in Fusobacterium overcame the physical barrier
cohoused mice, the oral bacteria showed minimal and became the dominant genus in the gut of the
colonization of the gut, especially the distal gut HOMA mouse. However, after receiving the gut
(Fig. 8.4g). This result is consistent with a previ- microbiota by cohousing, the abundance of
ous study [20], in which all the distal guts of Fusobacterium decreased dramatically, and even
HMA mice cohoused with mice with the the gut microbiota barrier was partly overcome by
microbiota from soil or zebrafish were dominated oral microbiota in the small intestine.
by caecum-derived microbiota at 7 days after Fusobacterium was still stopped by the
cohousing. These results indicated that gut microbiota barrier, but the resistance to
microbiota plays an important role as a barrier in Fusobacterium was supported by the gut
resisting the foreign bacteria from mouth. This microbiota from a healthy donor here. Those
resistance might due to greater acceptability in individuals suffering CRC fail to resist
the gut of the gut microbiota than the oral Fusobacterium [15, 31, 32]. The accumulating
microbiota and the creation of a more stable Fusobacterium nucleatum overcome the defec-
microenvironment by the gut microbiota to resist tive gut microbiota barrier from the CRC patient
310 B. Li et al.
and further promote tumour development [33– were bred in plastic gnotobiotic isolators, where
35]. In conclusion, resistance from various gut the temperature and humidity were maintained at
microbial communities is a key point to under- 20–26 C and 40–70%, respectively. They were
stand the effect of oral microbiota on gut fed a standard diet (GB-T14924.3–2001)
microbiota and digestive systemic health, and it sterilized by 60 co gamma radiation. Thirteen-
should be investigated in future studies. week-old SPF mice were also maintained in the
Overall, we first established a HOMA mouse Experimental Animal Research Center. They
model, which copied the oral microbiota of the were fed in the barrier housing facility.
human donor. Using this animal model, we found
that both physical and microbiota barriers filtrated
the oral microbiota in the digestive tract. Addi- 8.4.3 Establishment of the HOMA
tionally, the oral microbiota invaded and profiled and HMA Mouse Models
the gut microbiota, especially in the small intes-
tine. Oral Porphyromonas was the key bacterial To establish the HOMA mouse model, swabs
species competing with the small intestinal dipped in 200 μL fresh saliva from the male
microbiota. donor were used to seed oral microbiota in the
GF mice (n ¼ 13) by swabbing without anaesthe-
sia. Swabbing was performed only once. The
8.4 Materials and Methods HMA mouse model was developed as previously
described [36]. The faeces were resuspended in
8.4.1 Sample Collection from 10 mL sterile potassium phosphate buffer
Humans (0.1 mol•L1, pH 7.2). Eight GF mice were
inoculated by intragastric gavage with 1 mL
The study was authorized by the Ethical Commit- human faeces suspension each, and 2-mL aliquots
tee of Sichuan University (WCHSIRB-D-2016- were spread on the fur. HOMA mice and HMA
070). The saliva was collected using a sterilized mice were bred in separated plastic gnotobiotic
tube from an adult donor with natural dentition isolators. After 35 days, oral microbial samples
without periodontitis or active caries and without were collected from the HOMA mice with swabs.
the use of antibiotics in the previous 3 months. The oral microbial samples from SPF mice were
The donor was required not to brush teeth for 24 h collected in the same way. Faeces of HOMA mice
and abstain from food/drink intake for 2 h prior to were also collected. Six of thirteen HOMA mice
donating saliva. Faeces were collected from the and six of eight HMA mice were subsequently
same person using a sterilized sealable plastic sacrificed randomly, and the contents of the stom-
bag. A portion of the saliva and faeces was sent ach, small intestine, caecum, and colon were col-
to the lab and inoculated into GF mice within lected. All the samples were immediately stored
30 min. The rest was stored immediately at at 80 C.
80 C.
8.4.4 Cohousing Experiment

8.4.2 Animal Husbandry
Two HOMA mice and two HMA mice was trans-
The animal experimentation protocols were ferred to a new germ-free plastic isolator
approved by the Ethical Committee of Sichuan containing two GF mice (Fig. 8.1). These six
University (WCHSIRB-D-2016-118) and the mice were then distributed into two triads, each
Third Military Medical University. Six-week-old of which included a HOMA mouse, a HMA
GF male Kunming mice were maintained in the mouse, and a GF mouse housed in one cage, by
Experimental Animal Research Center at the which the animals could exchange components of
Third Military Medical University. All GF mice their microbiota. After 28 days, the cohoused
mice were sacrificed, and the contents of the metrics analysis, were determined using the rep-
stomach, small intestine, caecum, and colon resentative sequences of OTUs for each sample,
were collected. All these samples were immedi- and PCA and PCoA were conducted according to
ately stored at 80 C. the distance matrices. LEfSe analysis (linear dis-
criminant analysis [LDA] coupled to effect size
measurements) was conducted to calculate bacte-
8.4.5 16S rRNA Gene Sequencing ria with significant difference in relative abun-
dance between the groups. Using a normalized
The samples were processed by Shanghai relative abundance matrix, LEfSe showed taxa
Majorbio Bio-Pharm Technology Co., Ltd. with significantly different abundances, and
(Shanghai, China). Total DNA was extracted, LDA estimated the effect size of the feature
amplified, and sequenced according to standard [37, 40]. In this study, a P value threshold of
procedures [37, 38]. Briefly, microbial DNA was 0.05 (Wilcoxon rank-sum test) and an effect size
extracted using the E.Z.N.A.® Soil DNA Kit threshold of 3 were used for all bacteria
(Omega Bio-Tek, Norcross, GA, USA) according discussed. Microbial Source Tracker analysis
to the manufacturer’s protocol. The DNA concen- was performed using the Source Tracker package
tration was assessed using a NanoDrop (Thermo based on Bayesian inference [20, 41]. The
Scientific), and the quality was determined by co-occurrence network of the top 50 abundant
agarose gel electrophoresis. Bacterial 16S rRNA genus-level taxa was inferred based on the Spear-
gene sequences spanning the variable regions man correlation matrix with a strict p-value
V4–V5 were amplified using the primer threshold (P < 0.05) and a high correlation
515F_907R. The amplicons were then extracted value (r > 0.6) to filter strong correlations. The
from 2% agarose gels and further purified using combined result was exported to Cytoscape
the AxyPrep DNA Gel Extraction Kit (Axygen V.3.2.1 [37].
Biosciences, Union City, CA, USA) and The data were subjected to nonparametric
quantified by QuantiFluor™-ST (Promega, Kruskal–Wallis analysis. Differences were con-
USA). Purified amplicons were pooled in equi- sidered significant when P < 0.05. SPSS21.0
molar amounts and subjected to paired-end software (SPSS Inc., Chicago, IL, USA) was
sequencing (2 300) on an Illumina MiSeq used for statistical analysis.
platform.
Data Availability The raw reads were deposited
into the NCBI Sequence Read Archive (SRA)
8.4.6 Bioinformatics and Statistical database (Accession Number: SRP116564).
Analysis
Competing Financial Interests The authors
Raw fastq files were demultiplexed and quality- declare that they have no competing financial
filtered by QIIME (version 1.9.1) [39]. Opera- interests.
tional taxonomic units (OTUs) were clustered
with a 97% similarity cut-off using UPARSE Acknowledgments This study was supported by the
(version 7.1). The taxonomy of each 16S rRNA National Key Research and Development Program of
China 2016YFC1102700 (X.Z.); National Natural Science
gene sequence was analysed using the RDP Clas-
Foundation of China grant 81372889 (L.C.), 81370906
sifier (http://rdp.cme.msu.edu/) against the (W.H.), 81600858 (B.R.), and 81430011 (X.Z.); Youth
SILVA rRNA database (http://www.arb-silva.de) Grant of the Science and Technology Department of
with a confidence threshold of 70%. After the Sichuan Province, China 2017JQ0028 (L.C.); and
National Basic Research Program of China 973 Program
elimination of interference sequence, alpha diver- 2013CB532406 (W.H). The content of this chapter was
sity estimator calculations were performed using modified from a paper reported by our group in Int J
Mothur v.1.30.2. Phylogenetic beta diversity Oral Sci (Li B et al. 2019). The related contents are
measures, such as unweighted UniFrac distance reused with permission.
312 B. Li et al.
Conflict of Interests The authors declare that they have correlates with IBD status of the host. Inflamm
no conflicts of interest. Bowel Dis. 2011;17:1971–8.
14. Ismail Y, et al. Investigation of the enteric pathogenic
potential of oral Campylobacter concisus strains
Authors’ Contributions Lei Cheng, Xuedong Zhou, and
isolated from patients with inflammatory bowel dis-
Hong Wei conceived and designed the experiments; Bolei
ease. PLoS One. 2012;7:e38217.
Li, Jinzhao Yu, Benhua Zeng, Xian Peng Wenxia Li, Biao
15. Kostic AD, et al. Genomic analysis identifies associa-
Renand, and Mingyun Li performed the experiments;
tion of Fusobacterium with colorectal carcinoma.
Bolei Li, Yang Ge, and Jianhua Zhao analysed the data;
Genome Res. 2012;22:292–8.
Bolei Li and Yang Ge wrote the manuscript; and Hong
16. Farrell JJ, et al. Variations of oral microbiota are
Wei and Lei Cheng revised the manuscript.
associated with pancreatic diseases including pancre-
Supplementary information accompanies the manu-
atic cancer. Gut. 2012;61:582–8.
script at the International Journal of Oral Science website:
17. Fan X, et al. Human oral microbiome and prospective
http://www.nature.com/ijos.
risk for pancreatic cancer: a population-based nested
case-control study. Gut. 2018;67:120–7.
18. Lu H, et al. Deep sequencing reveals microbiota
dysbiosis of tongue coat in patients with liver carci-
References noma. Sci Rep. 2016;6:33142.
19. Bajaj JS, et al. Salivary microbiota reflects changes in
1. Johansson I, Witkowska E, Kaveh B, Holgerson PL, gut microbiota in cirrhosis with hepatic encephalopa-
Tanner AC. The microbiome in populations with a low thy. Hepatology. 2015;62:1260–71.
and high prevalence of caries. J Dent Res. 20. Seedorf H, et al. Bacteria from diverse habitats colo-
2016;95:80–6. nize and compete in the mouse gut. Cell.
2. Belda-Ferre P, et al. The oral metagenome in health 2014;159:253–66.
and disease. ISME J. 2012;6:46–56. 21. Qin N, et al. Alterations of the human gut microbiome
3. Li Y, et al. Phylogenetic and functional gene structure in liver cirrhosis. Nature. 2014;513:59–64.
shifts of the oral microbiomes in periodontitis patients. 22. Curtis MA, Zenobia C, Darveau RP. The relationship
ISME J. 2014;8:1879–91. of the oral microbiota to periodontal health and dis-
4. Xiao E, et al. Diabetes enhances IL-17 expression and ease. Cell Host Microbe. 2011;10:302–6.
alters the oral microbiome to increase its pathogenic- 23. Mankoff SP, Brander C, Ferrone S, Marincola
ity. Cell Host Microbe. 2017;22:120–128.e124. FM. Lost in translation: obstacles to translational med-
5. Petersen PE, Ogawa H. Prevention of dental caries icine. J Transl Med. 2004;2:14.
through the use of fluoride--the WHO approach. Com- 24. Wu H, et al. Research on oral microbiota of monozy-
munity Dent Health. 2016;33:66–8. gotic twins with discordant caries experience – in vitro
6. Schmidt BL, et al. Changes in abundance of oral and in vivo study. Sci Rep. 2018;8:7267.
microbiota associated with oral cancer. PLoS One. 25. Donaldson GP, Lee SM, Mazmanian SK. Gut bioge-
2014;9:e98741. ography of the bacterial microbiota. Nat Rev
7. Pushalkar S, et al. Comparison of oral microbiota in Microbiol. 2016;14:20–32.
tumor and non-tumor tissues of patients with oral 26. Zoetendal EG, et al. The human small intestinal
squamous cell carcinoma. BMC Microbiol. microbiota is driven by rapid uptake and conversion
2012;12:144. of simple carbohydrates. ISME J. 2012;6:1415–26.
8. Hajishengallis G, et al. Low-abundance biofilm spe- 27. Sarker SA, Ahmed T, Brussow H. Hunger and micro-
cies orchestrates inflammatory periodontal disease biology: is a low gastric acid-induced bacterial over-
through the commensal microbiota and complement. growth in the small intestine a contributor to
Cell Host Microbe. 2011;10:497–506. malnutrition in developing countries? Microb
9. Teng F, et al. Prediction of early childhood caries via Biotechnol. 2017;10:1025–30.
spatial-temporal variations of oral microbiota. Cell 28. Tropini C, Earle KA, Huang KC, Sonnenburg JL. The
Host Microbe. 2015;18:296–306. gut microbiome: connecting spatial organization to
10. Dewhirst FE, et al. The human oral microbiome. J function. Cell Host Microbe. 2017;21:433–42.
Bacteriol. 2010;192:5002–17. 29. Arimatsu K, et al. Oral pathobiont induces systemic
11. Arrieta MC, Walter J, Finlay BB. Human microbiota- inflammation and metabolic changes associated with
associated mice: a model with challenges. Cell Host alteration of gut microbiota. Sci Rep. 2014;4:4828.
Microbe. 2016;19:575–8. 30. Nakajima M, et al. Oral administration of P. gingivalis
12. Turnbaugh PJ, et al. The effect of diet on the human induces dysbiosis of gut microbiota and impaired bar-
gut microbiome: a metagenomic analysis in rier function leading to dissemination of enterobacteria
humanized gnotobiotic mice. Sci Transl Med. to the liver. PLoS One. 2015;10:e0134234.
2009;1:6–14. 31. Wang T, et al. Structural segregation of gut microbiota
13. Strauss J, et al. Invasive potential of gut mucosa- between colorectal cancer patients and healthy
derived Fusobacterium nucleatum positively volunteers. ISME J. 2012;6:320–9.
32. Chen W, Liu F, Ling Z, Tong X, Xiang C. Human associated mouse model. Curr Microbiol.
intestinal lumen and mucosa-associated microbiota in 2013;67:313–21.
patients with colorectal cancer. PLoS One. 2012;7: 37. Wang AH, et al. Human colorectal mucosal microbiota
e39743. correlates with its host niche physiology revealed by
33. Rubinstein MR, et al. Fusobacterium nucleatum endomicroscopy. Sci Rep. 2016;6:21952.
promotes colorectal carcinogenesis by modulating 38. Zhu Y, et al. Meat, dairy and plant proteins alter
E-cadherin/beta-catenin signaling via its FadA bacterial composition of rat gut bacteria. Sci Rep.
adhesin. Cell Host Microbe. 2013;14:195–206. 2015;5:15220.
34. Gur C, et al. Binding of the Fap2 protein of 39. Caporaso JG, et al. QIIME allows analysis of high-
Fusobacterium nucleatum to human inhibitory recep- throughput community sequencing data. Nat Methods.
tor TIGIT protects tumors from immune cell attack. 2010;7:335–6.
Immunity. 2015;42:344–55. 40. Ling Z, et al. Alterations in the fecal microbiota of
35. Yu T, et al. Fusobacterium nucleatum promotes patients with HIV-1 infection: an observational study
chemoresistance to colorectal cancer by modulating in a Chinese population. Sci Rep. 2016;6:30673.
autophagy. Cell. 2017;170:548–563.e516. 41. Knights D, et al. Bayesian community-wide culture-
36. Zeng B, et al. Effects of age and strain on the independent microbial source tracking. Nat Methods.
microbiota colonization in an infant human flora- 2011;8:761–3.
Mycobiome Dysbiosis in Oral Lichen
Planus 9
Yan Li, Kun Wang, Bo Zhang, Qichao Tu, Yufei Yao,
Bomiao Cui, Biao Ren, Jinzhi He, Xin Shen, Joy D. VanNostrand,
Jizhong Zhou, Wenyuan Shi, Liying Xiao, Changqing Lu,
and Xuedong Zhou
Abstract
The biodiversity of the mycobiome, an impor-

tant component of the oral microbial commu-
Electronic Supplementary Material: The online version nity, and the roles of fungal-bacterial and
of this chapter (https://doi.org/10.1007/978-981-15-7899-
1_9) contains supplementary material, which is available fungal-immune system interactions in the
to authorized users. pathogenesis of oral lichen planus (OLP)
remain largely uncharacterized. In this study,
Y. Li · K. Wang · B. Zhang · Y. Yao · B. Cui · B. Ren · we sequenced the salivary mycobiome and
J. He · X. Shen · L. Xiao
State Key Laboratory of Oral Diseases, National Clinical bacteriome (Wang et al Sci Rep 6:22943,
Research Center for Oral Diseases, West China Hospital of 2016) associated with OLP. First, we
Stomatology, Sichuan University, Chengdu, China described the dysbiosis of the microbiome in
Q. Tu OLP patients, which exhibits lower levels of
Institute of Marine Science and Technology, Shandong fungi and higher levels of bacteria. Signifi-
University, Qingdao, China cantly higher abundances of the fungi Candida
Institute for Environmental Genomics, Department of and Aspergillus in patients with reticular OLP
Microbiology and Plant Biology, University of Oklahoma, and of Alternaria and Sclerotiniaceae_uni-
Norman, OK, USA
dentified in patients with erosive OLP were
J. D. VanNostrand · J. Zhou observed compared to the healthy controls.
Institute for Environmental Genomics, Department of
Microbiology and Plant Biology, University of Oklahoma, Aspergillus was identified as an “OLP-
Norman, OK, USA associated” fungus because of its detection at
W. Shi a higher frequency than in the healthy controls.
The Forsyth Institute, Cambridge, MA, USA Second, the co-occurrence patterns of the sali-
C. Lu vary mycobiome-bacteriome demonstrated
Department of Anatomy, West China School of Basic negative associations between specific fungal
Medical and Forensic Medicine, Sichuan University, and bacterial taxa identified in the healthy
Chengdu, China controls, which diminished in the reticular
X. Zhou (*) OLP group and even became positive in the
State Key Laboratory of Oral Diseases, National Clinical erosive OLP group. Moreover, the oral
Stomatology, Sichuan University, Chengdu, China cavities of OLP patients were colonized by
dysbiotic oral flora with lower ecological net-
Hospital of Stomatology, Sichuan University, Chengdu, work complexity and decreased fungal
China Firmicutes and increased fungal Bacteroidetes

https://doi.org/10.1007/978-981-15-7899-1_9
316 Y. Li et al.
sub-networks. Third, several keystone fungal was characterized by greater variety and
genera (Bovista, Erysiphe, Psathyrella, etc.) less bacterial specificity, comprising only
demonstrated significant correlations with Porphyromonas and Solobacterium [1], which
clinical scores and IL-17 levels. Thus, we exhibited significantly higher abundances com-
established that fungal dysbiosis is associated pared with the healthy controls. Additionally, a
with the aggravation of OLP. Fungal dysbiosis decrease in Streptococcus and an increase in
could alter the salivary bacteriome or may gingivitis/periodontitis-associated bacteria
reflect a direct effect of host immunity, which were observed in OLP lesions in another study
participates in OLP pathogenesis. [5]. These findings implicated a link between oral
bacterial dysbiosis and OLP. It is noteworthy that
Keywords the oral cavity is colonized by both bacteria and
fungi, the latter of which have been known to
Oral lichen planus · Network assay ·
have a role in OLP for a long time. Among oral
Mycobiome · Bacteriome · Host immunity
fungi, Candida species have been reported to be
associated with OLP and are detected in 37–50%
of OLP patients [6]. Candida albicans is the most
predominant OLP-associated Candida species
9.1 Introduction and is involved in the malignant transformation
of OLP [7]. The carriage rate for Candida
Oral lichen planus (OLP) is a chronic oral muco- albicans in patients with erosive OLP is much
sal disease that occurs in approximately 0.5% to higher than that observed in patients with
2% of the general adult population [2], with an non-erosive OLP or in healthy controls [8]. Addi-
even higher prevalence among women. In clinical tionally, non-Candida albicans species have been
settings, OLP is classified into three subtypes specifically isolated from OLP patients,
(reticular, atrophic, and ulcerative) and affects indicating a possible association between these
the buccal mucosa in the vast majority of cases. yeasts and OLP [9]. However, previous studies
The gingiva, tongue, and lips may also be have primarily focused on fungal epidemiology,
affected. The reticular form is typically asymp- such as the carriage rate for Candida species in
tomatic and is the most common type, OLP patients, with few studies analyzing the bio-
characterized by the presence of Wickham striae. diversity and composition of the entire fungal
However, the atrophic and erosive types may community living in symbiosis with bacteria in
cause different degrees of discomfort and sore- the oral ecosystem. The advent of the use of next-
ness, demonstrating high risks for malignant generation sequencing technology to evaluate
transformation at rates of 1–2% (range of microbial diversity has broadened our view of
0–12.5%) [3, 4]. the importance of fungi. The salivary
The precise etiology of OLP is uncertain, mycobiome, which primarily refers to the fungal
which is a major obstacle in the development of microbiota, is an important component of the
new therapeutics. Various factors have been con- oral microbiome. Ghannoum et al. [10] and
sidered to be potential causes of OLP, such as Dupuy et al. [11] evaluated the complexity of
infection, immunity, genetic factors, stress, and the core oral mycobiomes of healthy individuals.
trauma [2]. However, the precise roles of these However, these findings did not significantly con-
factors have been debated. Over the last decade, tribute to a wider understanding of the disease
microbial infection has received increasing atten- state. Moreover, the interaction between the
tion in the context of OLP pathogenesis. Previ- mycobiome and the resident bacterial
ously, we evaluated differences in the salivary microbiome may be crucial for the progression
microbial communities between OLP patients of diseases such as inflammatory bowel disease,
and healthy individuals. We observed that the cystic fibrosis, and oral diseases [12–
bacterial community in saliva from OLP patients 14]. Interactions between fungi and commensal
9 Mycobiome Dysbiosis in Oral Lichen Planus 317
bacteria involve physical binding, signaling mol- numerical inferiority, the oral mycobiome may be
ecule communication, and metabolic exchange in a driving force for bacteriome shifts though the
oral niches [14]. Although microbial infection has modulation of mucosal immunity, which directly
been proposed to be a causative, associated or or indirectly affects OLP pathogenicity.
possibly worsening factor in OLP, little is
known regarding the oral fungal-bacterial rela-
tionship in OLP progression.
9.2 Results
In addition, OLP is considered a T-cell-
mediated inflammatory disease because the
9.2.1 Participant Demographics
infiltrating lymphocytes are primarily T cells.
and Sequence Data
Recently, the Th17 subset of CD4+ T-helper
cells was shown to play a crucial role in promot-
The subjects enrolled in this study included
ing immune inflammatory reactions in the
18 healthy subjects (age 39.72 11.02 years),
defense against infection by extracellular
17 reticular OLP patients (age
microorganisms and in autoimmune disease.
43.58 9.97 years), and 18 erosive OLP patients
Moreover, numerous Th17 cells have been
(age 46.72 9.80 years). There were no signifi-
identified in OLP lesions [15], and interleukin
cant differences in the age and gender
(IL)-17 and IL-23, cytokines secreted by Th17
distributions among the groups (P ¼ 0.127 and
cells, are important components involved in the
P ¼ 0.815, respectively). The severity of OLP
defense against pathogenic microorganisms
was scored using a semiquantitative scoring sys-
[16]. For example, salivary IL-17 and IL-23 are
tem based on the site, area, and clinical presence
significantly correlated with specific bacterial
of lesions [23].
genera in OLP, such as Porphyromonas,
Using an Illumina MiSeq sequencing plat-
indicating their potential roles in the pathogenic
form, 1 580 028 raw paired-end reads of ITS
mechanism of OLP [4]. Accumulating evidence
region amplicons were obtained. After merging
has also implicated IL-17 and IL-23 in immunity
the forward and reverse reads and performing
to fungal pathogens, with the IL-23/IL-17 axis
quality trimming, 712 295 merged sequences
being essential in the defense against
with an average length of 324 bp were obtained
Pneumocystis carinii. Conversely, this axis
for all 53 samples. These sequences (335 185 for
amplifies the inflammatory pathology in mouse
the healthy control samples, 197 963 for the retic-
models of Candida or Aspergillus infection [17].
ular OLP samples, and 179 147 for the erosive
Similar to the gut microbiome [12, 18, 19],
OLP samples) were then clustered into 4 564
inter-kingdom interactions between bacteria and
OTUs after quality trimming, dereplication, clus-
fungi may be substantial in the oral cavity.
tering, and chimera removal using the UPARSE
Because the host immune system is a major stress
pipeline, with an OTU identity cutoff of 97%. Of
that modulates microbial composition [14, 20–
the 4 564 identified OTUs, 1 990 were singletons.
22], perturbations in salivary IL-17 and IL-23
The taxonomic assignments made using the RDP
levels, as well as the altered oral bacteriome
classifier showed that 4563 OTUs were fungi,
observed in our previous study, suggest a disequi-
with only one OTU with 2 sequences identified
librium within the oral mycobiomes of OLP
as protozoan but with 20% confidence. Among
patients. To test this hypothesis, we evaluated
the fungal ITS OTUs, 1 588 belonged
the salivary fungal abundance, frequency, and
to Ascomycota, 20 to Chytridiomycota, 976 to
diversity in OLP and explored the complex and
Basidiomycota, 52 to Zygomycota, and 15 to
dynamic ecological relationships between the
Glomeromycota. The remaining OTUs were
fungal mycobiome, oral bacteria, and host immu-
either assigned to unidentified fungi (124 OTUs)
nity. Our results indicated that fungal community
or known fungal phyla with <50% confidence
composition and diversity are dramatically
(1789 OTUs).
altered among OLP patients. Thus, despite their
318 Y. Li et al.
9.2.2 Lower Saliva Biodiversity Fig. 9.1a, b). Rarefaction analyses indicated that
of the Mycobiome and Higher fungal species richness and alpha diversity among
Biodiversity of the Bacteriome the three groups gradually decreased as the dis-
in OLP ease was aggravated (Fig. 9.1c, d), which was in
contrast to the tendency of the bacteriome
We estimated the community diversity for all of (Table S1) [1].
the samples to compare their complexity among The phylogenetic structure was further
reticular OLP, erosive OLP, and healthy analyzed. Although unweighted principal coordi-
individuals. Significantly lower richness and nate analysis showed no obvious separation
alpha diversity were observed for the fungal among the mycobiomes of the healthy subjects,
communities in the erosive OLP group compared reticular OLP, and erosive OLP (Fig. S1), dissim-
with the healthy subjects (P < 0.05, Fig. 9.1a, b). ilarity tests, including MRPP, adonis, and
The same trend was also observed between the ANOSIM, did reveal significant differences
reticular OLP and healthy control samples, but no between the healthy control group and the two
significant difference was detected (P > 0.05, OLP groups (P < 0.05, Table 9.1). However, no
Fig. 9.1 Diversity analysis of the salivary fungal diversity measures (P < 0.05). (a) Chao1 richness. (b)
communities in the healthy subject (H), reticular OLP Shannon index. (c) Rarefaction curves of Chao1 richness
(R), and erosive OLP (E) groups. The fungal community obtained by combining samples in the same group. (d)
of erosive OLP displayed significantly lower richness and Rarefaction curves of Shannon index obtained by combin-
α-diversity compared to the healthy controls for various ing samples in the same group
Table 9.1 Comparison of the overall fungal community structure using three nonparametric statistical methods
MRPP Adonis ANOSIM
δ P F P R P
H vs R 0.777 0.001 0.083 0.002 0.144 0.005
H vs E 0.807 0.002 0.079 0.002 0.171 0.001
R vs E 0.725 0.254 0.038 0.16 0.02 0.162
H healthy control, R reticular OLP, E erosive OLP
dramatic differences were detected in reticular significantly higher levels of Alternaria and
OLP when it was compared with erosive OLP Sclerotiniaceae_unidentified were observed in
(P > 0.05, Table 9.1). the erosive OLP group compared with the reticu-
lar OLP group.
The most frequently detected fungi
9.2.3 Taxonomic Differences Among (constituting the “core” mycobiome) at the
Healthy Individuals and OLP genus level with an average relative abundance
Patients above 0.1% are shown in Fig. 9.3. Among them,
Candida and Ascomycota_unidentified_1_1 were
The fungal community composition was analyzed the two genera with the highest detectable
at different taxonomic levels. At the phylum frequencies (96%) in all three groups. In addition,
level, significantly different patterns were the frequencies of Phoma, Trichosporon, Penicil-
observed for the top two prevalent phyla: lium, Aspergillus, Fungi_unidentified_1_1, and
Ascomycota (59.03% in healthy individuals, Coniochaeta were above 50% in all of the
69.58% in reticular OLP, and 68.22% in erosive samples. No “OLP-specific” taxa (present in
OLP) and Basidiomycota (15.62%, 13.46%, and either the healthy or OLP groups) were detected.
7.33%, respectively, Fig. 9.2a). Phylum However, we identified Aspergillus as an “OLP-
Ascomycota showed higher abundance in the associated” fungus, as it was present at a higher
reticular and erosive OLP groups, whereas the frequency in the OLP group than in healthy
abundance of Basidiomycota was lower in the controls.
OLP groups compared with the healthy controls. To further investigate the key oral fungal
At the family level, there were 11 fungal families microbiota associated with OLP, we evaluated the
for which no significant difference was observed genera and OTUs with frequencies of at least 50%
between the OLP patients and healthy individuals and relative abundances of 0.5%. Aspergillus
(Fig. 9.2b). was only present in the reticular OLP group,
At the genus level, a total of 280 genera were while Phoma was detected in both the healthy
detected. Among them, 126 genera were only subject and reticular OLP groups (Fig. S2a).
present in one individual. The abundances of Although Candida and Ascomycota_uni-
several genera were significantly different dentified_1_1 were detected in all three groups,
among the groups (Fig. 9.2c). The relative Candida was more abundant in the reticular OLP
abundances of Candida and Aspergillus were group, and the abundance of Ascomycota_uni-
significantly increased in the reticular OLP dentified_1_1 was significantly increased in the
group compared with those observed in the healthy subjects (Fig. 9.2c). Additionally, in
healthy subjects. In contrast, Ascomycota_uni- terms of OTU levels, we observed that
dentified_1_1 and Trichosporon were strikingly OTU_4429 (Candida) and OTU_21 (Phoma)
more abundant in the healthy subjects than were only present in the two OLP groups and
in those with erosive OLP. Furthermore, were absent in the healthy control group (Fig. S2b).
320 Y. Li et al.
Fig. 9.2 Relative abundances of fungal phyla, families, (E) groups. (a) Phylum level. (b) Family level. (c) Com-
and predominant genera (P > 0.1%) among the healthy parison of the top 20 abundant genera. (a) H vs R; (b) H vs
subject (H), reticular OLP (R), and erosive OLP E; (c) R vs E. Superscript letters indicate P < 0.05
Fig. 9.3 Frequency of fungal genera with average relative abundance above 0.1% among the healthy subject (H),
reticular OLP (R), and erosive OLP (E) groups. A total of 16 genera were included in this analysis
9.2.4 Inversion of Myco-Bacteriome identified in the reticular OLP group

Co-occurrence Patterns from (Abiotrophia, Actinobacillus, Aggregatibacter,
Antagonization Dialister, SR1 genera incertae sedis, and
to Co-prosperity Treponema), and 6 were observed in erosive
the OLP group (Bacteroides, Brachymonas,
Given the observation that bacterial-fungal Capnocytophaga, Cellulosimicrobium,
interactions are actively present throughout Planobacterium, and Veillonella) (Table S2).
the human body and that certain fungal taxa
are distinctly distributed, we hypothesized that
bacteriome-mycobiome co-occurrence and 9.2.5 Distinct Network Topology
co-exclusion networks differed between the Between OLP and Healthy
OLP patients and healthy controls. The Individuals
bacterial-fungal network was constructed by
only including the genera detected in no fewer We also constructed co-occurrence ecological
than eight subjects. In total, 12 fungal and 29 bac- networks at the OTU level by incorporating both
terial genera were included, as shown in Fig. 9.4. fungal and bacterial OTUs to predict their ecolog-
Several interesting findings were obtained from ical relationships involved in OLP (Fig. S3).
the network. First, among the healthy individuals, Strikingly, the co-occurrence or mutual exclusion
most of the myco-bacteriome co-occurrence patterns of the three groups were significantly
interactions were negative, whereas positive different. Decreased network complexity
co-occurrence relationships were observed in the was observed from the healthy to the erosive
erosive OLP group. However, in the reticular OLP stages. In total, 1 175 associations and
OLP group, half of the correlations disappeared 336 nodes were observed in the healthy control
because some of the enrolled fungi were not group network, 1241 associations and 366 nodes
detected in this group. Second, as the predomi- were observed in the reticular OLP network, and
nant fungal genus, Candida exhibited 12 signifi- 1 175 associations and 383 nodes were observed
cant inversions (negative to positive) with in the erosive OLP network. The constructed
bacterial genera, of which 6 genera were healthy control group network showed an average
322 Y. Li et al.
Fig. 9.4 Co-occurrence relationships between abundant genera belonging to Ascomycota are marked in blue, while
fungal and bacterial genera across samples. Co-occurrence Basidiomycota genera are marked in gray. Rectangle
and co-exclusion relationships of genera present in at least frames are used to highlight the negative myco-bacteriome
eight subjects were explored by Pearson correlation coef- co-occurrence interactions in the healthy control group,
ficient analysis. The bacterial genera are shown on the left, which changed to positive in the erosive OLP group
and the fungal genera are positioned at the top. Fungal
connectivity of 6.994, an average geodesic dis- was further confirmed via sub-networks
tance of 5.509, a modularity of 0.76, and a cen- constructed by extracting the first bacterial
tralization of connectivity value of 0.069, while neighbors of the fungal nodes with the highest
the networks of reticular and erosive OLP had connectivity (Fig. 9.6). Several interesting
average connectivities of 6.781 and 6.136, aver- findings were observed. The number of signifi-
age geodesic distances of 6.05 and 7.22, cant correlations involving members of the phy-
modularities of 0.768 and 0.777, and centraliza- lum Firmicutes (black nodes, the majority
tion of connectivity values of 0.061 and 0.05, belonging to Streptococcus) clearly decreased in
respectively (Fig. 9.5, Table S3). This finding the erosive OLP network compared with the
Fig. 9.5 Fungal-bacterial co-occurrence network analysis co-occurrence patterns, including the total number of
of the healthy subject (H), reticular OLP (R), and erosive nodes (a), total number of links (b), average connectivity
OLP (E) groups. Various network indices were used to (c), average geodesic distance (d), modularity (e), and
describe the properties of the fungal-bacterial centralization of connectivity (f)
healthy control network. In contrast, the involve- 9.2.6 Fungal Disturbance Promotes
ment of OTUs from the phylum Bacteroidetes OLP Exacerbation
(rose red nodes, primarily Prevotella,
Porphyromonas, and Capnocytophaga) in the We also examined the relationship between fun-
co-occurrence network increased significantly in gal genera and clinical parameters based on
the erosive OLP network. For fungal genera Pearson correlation coefficient values. The sali-
belonging to the phylum Ascomycota, such as vary concentrations of IL-17 and IL-23 were
Candida, far fewer co-occurrence events were measured using an enzyme-linked immunosor-
observed in the reticular OLP network than in bent assay (ELISA) [1]. In total, 29 fungal genera
the erosive OLP network. were observed to have significant correlations
324 Y. Li et al.
Fig. 9.6 Sub-network analysis of fungal-bacterial of the bacterial OTUs connected with the fungal OTUs.
relationships in the healthy subject (H), reticular OLP The nodes in the inner circle are fungal OTUs, and nodes
(R), and erosive OLP (E) groups. Sub-networks for in the outer circle are bacterial OTUs
the H, R, and E groups were constructed by extracting all
Fig. 9.7 Relationship between the relative abundances of and IL-17 and IL-23 levels. Pearson correlation coefficient
fungal genera and clinical parameters. Three clinical was performed. * indicates P < 0.05
parameters were analyzed, including the clinical score
with clinical parameters, including clinical scores several fungal genera, such as Dothiorella,
and salivary levels of IL-17 and IL-23, and were Sympoventuria, and Mycosphaerella, showed
therefore identified as keystone fungi in saliva significant positive correlations with salivary
(Fig. 9.7). Several interesting correlations were levels of IL-17. However, Sordariaceae unidenti-
observed. First, there were significant positive fied, Helotiales unidentified 1, and Pestalotiopsis
correlation patterns between clinical scores and were negatively correlated with IL-17. Notably,
the fungal genera Erysiphe and Bovista, whereas no significant correlation was observed between
Sordariomycetes unidentified 1 was negatively salivary levels of IL-23 and fungal genera.
correlated with clinical scores. Second, regarding Finally, among the fungal genera associated
the correlation with immunologic factors with clinical data, significant correlations with
involved in the inflammatory response in OLP, more than one parameter were determined for
genera such as Bovista, which positively diversity, identifying 6 phyla, 11 families, and
correlated with clinical scores and salivary levels 280 genera of fungi. In particular, we evaluated
of IL-17 simultaneously. the patterns of fungal genera associated with
OLP, demonstrating an increase in opportunis-
tic/pathogenic fungi and a decrease in symbiotic
9.3 Discussion fungi. The relative abundance of Candida was
higher in the reticular and erosive OLP groups
Although numerous studies have emphasized (49.6% and 41.3%, respectively) than in the
the possible role of bacterial or viral infection in healthy subject group (27.1%), although a signif-
OLP [1, 4], the fungal component of the oral icant difference was only observed between the
microbiome has not been thoroughly reticular OLP and healthy control groups. This
investigated. In the present study, we showed result was in complete accordance with previous
for the first time the structural characteristics of findings [29]. We propose the following possible
the core mycobiome in salivary samples from causes of this increase in Candida abundance.
reticular and erosive OLP patients, which First, the susceptibility of OLP patients to Can-
demonstrated lower biodiversity and an increased dida may be increased compared with healthy
abundances and frequencies of the genera Can- controls. Second, Candida hyphae may prefer
dida and Aspergillus. the nonlesional reticular mucosa to erosive
The oral fungal community was less enriched mucosa. Third, the types of pathogenic Candida
in OLP patients compared with that observed in in the saliva of OLP patients may be different
the healthy control group. Interestingly, the oppo- from those in healthy individuals, a hypothesis
site pattern was observed for the bacteriome, that is supported by our analyses at the OTU
which demonstrated significantly increased diver- level. OTU_3662 (Candida) dominated in the
sity in the OLP group compared to the healthy saliva of the healthy control group, while the
control group. The fungi-to-bacteria diversity core species in the reticular and erosive OLP
ratio decreased sharply in the OLP group com- groups was OTU_4429 (Candida). Hoarau et al.
pared to the healthy control group. OLP is quite [18] showed that C. tropicalis rather than
different from most other mucocutaneous C. albicans is the pathogen responsible for
diseases, such as atopic dermatitis, psoriasis, Crohn’s disease. Aspergillus, another opportunis-
Crohn’s disease, and ulcerative colitis, which are tic fungal pathogen involved in endodontic infec-
associated with decreased diversity of the tion, cystic fibrosis [30, 31], and
bacteriome [1, 24–26] and an increased diversity immunocompromised patients, may cause a spec-
of the mycobiome [19]. This inverted trum of respiratory disease, wound infections, and
mycobiome-to-bacteriome trend was similar to biofilm formation on medical devices. We also
the results obtained by Hoarau in the gastrointes- observed a significantly higher abundance and
tinal tract [18]. The results of a previous study frequency of Aspergillus in OLP patients than in
showed that the Candida load negatively the healthy control group. In cases of oral lesions
correlates with salivary bacterial diversity associated with dimorphic fungi (Candida), fila-
[27]. In addition, a study by Peleg study showed mentous fungi (Aspergillus spp.) have been
that anaerobic bacteria otherwise inhibit fungi reported to be present, but these instances typi-
[28]. Specific alterations in fungal diversity in cally involve severe immunosuppression and
parallel with variations in bacterial diversity disseminated infection to extraoral sites [32]. Tak-
implicate an oral microecological imbalance ing these findings into consideration, it is possible
in OLP. that alterations in the fungal population are driven
Previous studies [10, 11] have reported that by an expansion of Candida and Aspergillus in
more than 100 fungal species are members of the oral mycobiota of OLP individuals. Similar
the oral flora. The results of our study further results have revealed a higher susceptibility to
demonstrated the existence of oral mycobiota Candida and Aspergillus infection in the absence
326 Y. Li et al.
of Toll IL1R8 (TIR8), a negative regulator of patients by exploring the differences in microbial
Th17 responses [33]. The overgrowth of native co-occurrence and co-exclusion patterns between
Candida and Aspergillus species may be posi- healthy and OLP individuals. The most dominant
tively correlated with OLP severity, suggesting a fungal genus, Candida, was of particular interest.
disease link. Moreover, a fungal genus associated Candida was negatively correlated with 18 out of
with invasive diseases, Alternaria, was observed 29 bacterial genera in healthy individuals. In con-
to have a richer abundance in individuals with trast, Candida was positively correlated with
erosive OLP rather than reticular OLP, indicating eight bacterial genera in reticular OLP and eight
its potential pathogenicity with the development bacterial genera in erosive OLP. Some of them
of OLP. Howard et al. [34] showed that asthma (Treponema, Aggregatibacter, Dialister, SR1,
severity is associated with the presence of Bacteroides, Capnocytophaga, and Veillonella)
Alternaria species in the lung that may have are strict anaerobic periodontopathogenic genera.
originally been derived from the mouth. Signifi- How such strict anaerobes survive in an aerobic
cant differences in the abundance of niche such as the oral cavity may be explained by
Sclerotiniaceae, which has also been detected in the relationship between Candida and the high
Crohn’s disease [35], were observed between the level of O2 consumption that is typical of yeasts,
erosive OLP group compared to reticular OLP which creates an anaerobic microniche to permit
and healthy control groups, possibly because it the growth and biofilm formation of these strict
is a family of necrotrophic fungi. The results of anaerobic bacteria under aerobic conditions
the studies referenced above indicate that the oral [36]. Furthermore, lactic acid is the most pre-
mycobiome is involved in specific oral diseases ferred source of carbon for fungi under the hyp-
as well as in respiratory and digestive diseases. oxic conditions created by C. albicans. Excluding
Sixteen genera were present with frequencies metabolic interactions, Candida species also
greater than 20% in each group and were demonstrate positive physical interactions with
designated the “core” mycobiome, which bacteria. For example, co-aggregation promotes
exhibited substantial overlap with the core oral the growth of fungal cells in the biofilm core with
mycobiota described in two previous studies. bacteria around their periphery. Additionally, the
Specifically, our results are in good agreement Treponema flagellum forms a “bridge” between
with those of Ghannoum et al. [10] and fungi and bacteria. With respect to chemical
Dupuy et al. [11] with respect to the identifica- interactions, fungal ethanol secretion can enhance
tion of Candida, Alternaria, Aspergillus, the growth and virulence of Acinetobacter
Cladosporium/Davidella, Saccharomyces, baumannii. In contrast, bacteria may develop
Phoma, and Malassezia. However, nine oral antibacterial tolerance by living under the protec-
cavity-associated genera were uniquely identified tive fungal matrix umbrella [37]. Through the
in our study, including Ascomycota_uni- rapid consumption of molecular oxygen, the
dentified_1_1, Trichosporon, Fungi_uni- rapid increase in the local pH, the provision of a
dentified_1_1, and Podospora, among others. physical scaffold for the adhesion of oral bacteria,
Candida species were the most prevalent in both and the production of chemical factors that mod-
healthy and diseased oral cavities, demonstrating ulate oral bacteria, shifts in fungal communities
a 96% carriage rate in the samples assayed in our may be a driving force for those that occur in
study, higher than that observed in other studies bacterial communities. Mycobacterium infections
(60–80%) [1, 10] and much higher than the cul- have been shown to be associated with aspergil-
ture rate of 17.7% [32]. losis [38]. The abundance of Candida tropicalis
In addition to analyzing disease-associated has been observed to be positively correlated
fungi, we further confirmed significant shifts in with the presence of Serratia marcescens and
the salivary fungal-bacterial interactions in OLP E. coli [18]. Although fungi only constitute
approximately 0.1% of the total microbial load in OLP. The opposite scenario has been observed
the oral cavity [21], at least 10% of the biovolume with respect to obesity, inflammatory bowel
compensates for the presence of these microbes. diseases, and autism spectrum disorders, with
An ecological network is a representation of increased Firmicutes and decreased Bacteroidetes
various biological relationships connected by observed. The phylum Firmicutes is enriched for
pairwise links within an ecosystem [39]. By genes encoding nutrient transporters, while the
analyzing and then visualizing the spatial phylum Bacteroidetes enriched for genes linked
Pearson’s correlations between fungi and bacteria to carbohydrate metabolism [42]. However, our
detected from saliva samples, an imbalanced results are in agreement with those of other stud-
microbial network was observed in patients with ies. Sam et al. [19] observed an association
OLP. First, OLP patients, particularly those with between Candida and Bacteroides. Members of
erosive OLP, showed simpler co-occurrence the genus Bacteroides are more abundant in
patterns between the mycobiome and bacteriome, individuals who consume a high protein diet,
as evidenced by lower connectivity and while the abundance of Candida is strongly
higher modularity, suggesting that the fungal associated with the recent consumption of
and bacterial nodes in the OLP networks carbohydrates. Thus, an increased connection
were more sparsely connected. In addition, in between Bacteroides and fungi might contribute
the sub-networks, the correlation between to OLP severity.
Bacteroidetes and fungal species was increased, Emerging evidence suggests that the entire
but the correlation between Firmicutes and fungal community of microbial residents influences the
species was decreased in OLP, consistent with balance of immune responses and microbial com-
previous observations, such as the rapid con- munity dysbiosis may lead to deficient education
sumption of molecular oxygen and the rapid of the host immune system followed by immune-
increase in local pH. On one hand, most mediated diseases [40]. Furthermore, the expres-
Bacteroidetes (including Prevotella and sion of pro-inflammatory cytokines (e.g., IL-17
Porphyromonas) are strictly anaerobic bacteria, and IL-23) may be upregulated by the presence
which may be favored by fungi at the expense of pathogens and the immunomodulatory
of oxygen. Furthermore, Bacteroides excel at components of biofilms (e.g., fungal glucans and
dominating the microbiota due to their ability to bacterial lipopolysaccharides), resulting in tissue
modulate surface polysaccharides in an effort to damage and lesions [18, 22, 32]. In particular,
evade the host immune system [40]. On the other IL-17, an inflammation-associated cytokine
hand, the consumption of lactic acid by fungi that reflects the immune dysregulation status,
causes the environment to become less acidic, has emerged as a central player in the
which may influence the growth of most immunopathogenesis of OLP [15, 16, 43] Previ-
Firmicutes members (such as Lactobacillus or ously, we analyzed a potential association
Streptococci). Moreover, Lactobacillus between the oral microbiome and IL-17 and
sp. stimulate the mammalian host to induce anti- IL-23 levels in the saliva of OLP patients [1]. In
fungal immunity in the mucosal membrane this study, we further screened oral fungal genera
[21]. Additionally, as the most prevalent genus that are potentially associated with disease sever-
of the phylum Firmicutes, the abundance and ity and immune dysfunction of OLP. In total,
networks of Streptococci were decreased in OLP 23 fungal genera were analyzed, none of which
patients, as was reported in our previous study [1] were significantly associated with IL-23. A sig-
and in a separate study [41]. The alteration of nificant positive correlation was observed
such correlations indicates that active roles for between IL-17 and IL-18 fungal genera, includ-
the phyla Firmicutes and Bacteroidetes may be ing Dothiorella, Sympoventuria, Mycosphaerella,
important for the severity and exacerbation of and Psathyrella. In a previous study, the
328 Y. Li et al.
abundance of Psathyrella was significantly 9.4 Materials and Methods

associated with Crohn’s disease, supporting the
results of a previous study showing that IL-17 9.4.1 Subject Recruitment
was essential for host defense against fungal and Sample Collection
infection [44]. Notably, the genera Bovista and
Erysiphe showed significantly positive Subjects with reticular OLP (n ¼ 17) and erosive
correlations with clinical scores, suggesting their OLP (n ¼ 18), who were diagnosed according to
involvement in the aggravation of OLP. Thus, the clinical classification and definition of the
they were defined as keystone fungal genera World Health Organization, together with
[37] that can modulate the host and the ecology 18 sex- and age-matched healthy controls were
in a manner that far outweighs their numerical recruited from the West China Hospital of
representation in the community. Our results Stomatology, Sichuan University. Demographic
were consistent with those of a study by Wheeler information was obtained, and an oral examina-
et al. [45], who inoculated typically rare fungi tion was performed. A semiquantitative scoring
(A. amstelodami, E. nigrum, and W. sebi) in system [23] consistent with the site, area, and
mice and observed exaggerated immune presence of OLP lesions was used to assess the
responses, suggesting that these keystone fungi clinical scores and severity of OLP. All subjects
play important roles in immune homeostasis. included in this study had not received treatment
Despite a scarcity of data, the antifungal treatment for OLP for at least 2 months and were asked to
of OLP patients has been shown to improve the avoid drinking or eating for 2 h before oral sam-
clinical symptoms of OLP [46]. Another study pling. Those with other oral (e.g., periodontitis or
also described the involvement of fungi in the dental caries) or systemic diseases were excluded.
aggravation of inflammatory responses and the To reflect the structural changes of the entire
severity of gastrointestinal diseases [12]. Based microbiome in the oral cavity and adopt a painless
on the correlation between the myco-bacteriome approach, approximately 5 ml of spontaneous
and clinical parameters observed in this study and whole unstimulated saliva (WUS) was collected
in a previous investigation [43], we suggest that in a sterile DNA-free conical tube from each
the mycobiome may interact with commensal subject between 8:00 and 11:00 AM following
bacteria to augment the mucosal inflammatory standard techniques as described previously
response. In contrast, cytokines IL-17 had been [1]. All samples were carried to the laboratory
shown to influence fungal composition and are on ice within 2 h and stored at 80 C before
important for protecting against infections caused further processing. The methods were performed
by fungi (Candida albicans, Aspergillus in accordance with approved guidelines.
fumigatus, and Pneumocystis carinii) on mucosal
surfaces [6, 15] through the release of
pro-inflammatory cytokines, chemokines, and
antimicrobial peptides. A functional deficiency
9.4.2 Cytokine Assay
in the Th17 cell subset is associated with a
IL-17 and IL-23 levels in the saliva were
dysbiotic state characterized by Candida over-
measured by ELISA as described previously [43].
growth [14]. Furthermore, signaling through the
IL-17 receptor is crucial for protecting against
candidiasis [47]. The results of these studies
demonstrated that IL-17 can play a central role 9.4.3 DNA Extraction
on influencing the composition of core fungi,
such as Candida and Aspergillus. Thus, it was Genomic DNA was extracted from individual
supposed that keystone fungi can boost the host saliva samples using a Qiagen QIAamp® DNA
immunity (e.g., IL-17) and shape the core fungi Mini Kit (Qiagen, Valencia, CA, USA) according
composition through IL-17. to the manufacturer’s instructions as previously
described [48]. Briefly, after thawing on ice, using the primers F515 (5’-
aliquots were pelleted at 5000 g for 10 min -GTGCCAGCMGCCGCGG-30 ) and R806 (3’-
and resuspended in 600 μL sorbitol buffer -TAATCTWTGGGVHCATCAG-50 ) at the
(1 molL1 sorbitol, 100 mmolL1 EDTA, and Institute for Environmental Genomics, University
14 mmolL1 ß-mercaptoethanol). After of Oklahoma (Norman, OK, USA). The
incubating with 200 U lyticase at 30 C for amplicons obtained from all of the samples were
30 min for cell lysis, protein digestion was then sequenced on an Illumina MiSeq platform.
achieved by adding Proteinase K and incubating
the samples at 56 C for 1.5 h. The DNA was
bound to a spin column filter, washed with 9.4.5 Data Preprocessing, OTU
96–100% ethanol and then was washed with the Clustering, and Taxonomic
two buffers supplied by the kit. The bound DNA Classification
was eluted from the spin column filter with
200 μL of the supplied elution buffer. DNA qual- Data preprocessing and OTU clustering were
ity was assessed by measuring the absorbance performed as described previously [51]. Only
ratios using a Nano Drop-1000 Spectrophotome- the reads with perfectly matched barcodes were
ter (NanoDrop Technologies Inc., Wilmington, extracted and used for further data analysis. Qual-
DE, USA). DNA samples with ratios of 1.8–2.0 ity trimming of raw reads was carried out using
(for A260/280 nm) and >1.8 (for A260/230 nm) the program Btrim [52] with an average quality
were likely to be free from contamination and score cutoff of 30 and window size of 3. The
were used for downstream experiments. Finally, paired-end reads were then joined using the pro-
the total DNA concentration was measured using gram pear [53] with the default parameters. Fur-
a PicoGreen kit (Invitrogen, Carlsbad, CA, USA), ther quality trimming and OTU clustering were
and the extracts were frozen at 20 C for further carried out using the UPARSE pipeline. The
analysis. joined reads were subjected to further quality
control with a maximum expected error threshold
of 0.5 and a length cutoff of 200. Qualifying reads
9.4.4 Illumina Sequencing were then dereplicated, sorted by size, and clus-
tered into OTUs with 97% sequence identity. The
The ITS2 region was amplified from the OTU sequences were checked against the UNITE
fungal DNA using the primers gITS7F database, and potential chimeric sequences were
(GTGARTCATCGARTCTTTG) and ITS4R removed. Finally, the qualifying reads were
(TCCTCCGCTTATTGATATGC), the product mapped to representative OTU sequences to cal-
of which is expected to be 309 bp (not including culate the relative abundance of each OTU. Tax-
the primers) [49]. A two-step phasing amplicon onomic assignment for representative OTUs was
sequencing approach (PAS) was performed to carried out using the Ribosomal Database Project
avoid the amplification biases introduced by (RDP) classifier [54] trained by the UNITE data-
long barcoded PCR primers [49, 50]. Sample base. A confidence cutoff of 50% was used for
libraries for sequencing were prepared according taxonomic information assignments, and a ran-
to the 500-cycle v2 MiSeq Reagent Cartridge dom subsampling of 2 227 reads per sample was
Preparation Guide (Illumina, San Diego, CA, performed for further statistical analysis.
USA) as described previously [49]. Sequencing
was performed for 251, 12, and 251 cycles for the
forward, index, and reverse reads, respectively, at 9.4.6 Statistical Analysis
the Institute for Environmental Genomics, Uni-
versity of Oklahoma (Norman, OK, USA). The The preprocessed data were further analyzed
barcoded 16S rRNA amplicon sequencing was using the following statistical methods. First, we
performed using an Illumina MiSeq platform used three different nonparametric multivariate
330 Y. Li et al.
analysis methods, including adonis (permuta- 9.5 Data Availability

tional multivariate analysis of variance using dis-
tance matrices), ANOSIM (analysis of All the ITS2 and 16S rRNA sequences were
similarities), and multi-response permutation pro- deposited at NCBI under accession number
cedure (MRPP) [1], as well as principle coordi- SRP067603.
nate analysis (PCoA) to measure and visualize the
overall differences in the fungal community struc-
ture between healthy and OLP individuals. Sec-
9.6 Ethics Statement
ond, the fungal community diversity was assessed
based on the Chao1 richness and Shannon diver-
Written informed consent was obtained from all
sity indices. Rarefaction analyses were performed
of the participants in this study. All procedures
using the program Mothur [55] by pooling
were approved (WCHSIRB-ST-2015-070) by the
samples within the same group. Student’s t-test
local ethics committee of the West China Hospital
was used to evaluate significant differences
of Stomatology, Sichuan University.
between healthy and OLP individuals, such as
diversity indices and relative abundances of
Acknowledgments This study was supported by the
OTUs and taxonomic groups. Third, the Pearson National Key Research and Development Program of
correlation coefficient was used to construct China (2016YFC1102700), the National Natural Science
bacterial-fungal co-occurrence patterns from the Foundation of China (Grant Nos. 81771085, 81430011,
16S rRNA gene and ITS amplicon data, which 81600858, and 81600874), and the Key Projects of
Sichuan Provincial Health and Family Planning Commis-
were also used for analyses of the association sion (Grant No.16ZD021). The funders had no role in the
between fungi and clinical parameters. Bacterial study design, data collection and analysis, decision to
and fungal OTUs present in more than 8 samples publish, or preparation of the manuscript. The content of
were extracted and used for correlation this chapter was modified from a paper reported by our
group in Int J Oral Sci (Li Y et al. 2019). The related
calculations by clustering and visualizing using contents are reused with permission.
the MeV package [56]. For better visualization,
co-occurrence patterns with a Pearson correlation Conflicts of Interest All of the authors declare no
coefficient 0.6 and P-value 0.05 were conflicts of interest.
extracted and plotted. Finally, OTU-level micro-
bial co-occurrence networks were constructed Author Contributions Conception and design of the
and analyzed. The random matrix theory-based experiments: Y.L., L. X., and X.Z.. Conducted the
approach in the MENA pipeline [57] was used to experiments: Y.L., B. Z., C.L., K.W., X. S., and
J.V.N. Data processing and analysis: Q.T., Y.L., K.W.,
construct the microbial co-occurrence networks. B.R., and J. H. Volunteer recruitment and sample collec-
A Pearson correlation coefficient cutoff of 0.76 tion: X. S., B. Z. B. C., and L. X. Manuscript writing: Y.L.,
was determined by the random matrix theory K.W. B. Z., and C.L. Revision of the manuscript: Q.T., L.
approach by observing the transition point of the X., J.V.N., J.Z., W. S., and X.Z.
nearest neighbor spacing distribution of
eigenvalues from Gaussian to Poisson
distributions, representing two universal extreme References
distributions. In such networks, OTUs were
represented by network nodes, while correlations 1. Wang K, et al. Preliminary analysis of salivary
microbiome and their potential roles in oral lichen
were transformed into the links between them.
planus. Sci Rep. 2016;6:22943.
Sub-networks representing fungal-bacterial 2. Baek K, Choi Y. The microbiology of oral lichen
co-occurrence networks were subsequently planus: is microbial infection the cause of oral lichen
constructed by extracting the first neighbors of planus? Mol Oral Microbiol. 2018;33:22–8.
3. Aghbari SMH, et al. Malignant transformation of oral
the fungal OTUs. The co-occurrence networks
lichen planus and oral lichenoid lesions: a meta-
were then visualized using Cytoscape 3.2.1. analysis of 20095 patient data. Oral Oncol.
2017;68:92–102.
4. Gupta S, Jawanda MK. Oral Lichen planus: an update innate and adaptive immunity in health and disease.
on etiology, pathogenesis, clinical presentation, diag- Eur J Immunol. 2014;44:3166–81.
nosis and management. Indian J Dermatol. 21. Bozena DK, Iwona D, Ilona K. The mycobiome – a
2015;60:222–9. friendly cross-talk between fungal colonizers and their
5. Choi YS, et al. The presence of bacteria within tissue host. Ann Parasitol. 2016;62:175–84.
provides insights into the pathogenesis of oral lichen 22. Underhill DM, Iliev ID. The mycobiota: interactions
planus. Sci Rep. 2016;6:29186. between commensal fungi and the host immune sys-
6. Bombeccari GP, Gianni AB, Spadari F. Oral Candida tem. Nat Rev Immunol. 2014;14:405–16.
colonization and oral lichen planus. Oral Dis. 23. Piboonniyom SO, Treister N, Pitiphat W, Woo
2017;23:1009–10. SB. Scoring system for monitoring oral lichenoid
7. Gainza-Cirauqui ML, et al. Production of carcinogenic lesions: a preliminary study. Oral Surg Oral Med
acetaldehyde by Candida albicans from patients with Oral Pathol Oral Radiol Endod. 2005;99:696–703.
potentially malignant oral mucosal disorders. J Oral 24. Alekseyenko AV, et al. Community differentiation of
Pathol Med. 2013;42:243–9. the cutaneous microbiota in psoriasis. Microbiome.
8. Zeng X, et al. Carriage rate and virulence attributes of 2013;1:31.
oral Candida albicans isolates from patients with oral 25. Lynde CW, et al. The skin microbiome in atopic der-
lichen planus: a study in an ethnic Chinese cohort. matitis and its relationship to emollients. J Cutan Med
Mycoses. 2009;52:161–5. Surg. 2016;20:21–8.
9. Masaki M, Sato T, Sugawara Y, Sasano T, Takahashi 26. Pascal V, et al. A microbial signature for Crohn’s
N. Detection and identification of non-Candida disease. Gut. 2017;66:813–22.
albicans species in human oral lichen planus. 27. Kraneveld EA, et al. The relation between oral Can-
Microbiol Immunol. 2011;55:66–70. dida load and bacterial microbiome profiles in Dutch
10. Ghannoum MA, et al. Characterization of the oral older adults. PLoS One. 2012;7:e42770.
fungal microbiome (mycobiome) in healthy 28. Peleg AY, Hogan DA, Mylonakis E. Medically impor-
individuals. PLoS Pathog. 2010;6:e1000713. tant bacterial-fungal interactions. Nat Rev Microbiol.
11. Dupuy AK, et al. Redefining the human oral 2010;8:340–9.
mycobiome with improved practices in amplicon- 29. Bokor-Bratic M, Cankovic M, Dragnic
based taxonomy: discovery of Malassezia as a promi- N. Unstimulated whole salivary flow rate and
nent commensal. PLoS One. 2014;9:e90899. anxiolytics intake are independently associated with
12. Mukherjee PK, et al. Mycobiota in gastrointestinal oral Candida infection in patients with oral lichen
diseases. Nat Rev Gastroenterol Hepatol. planus. Eur J Oral Sci. 2013;121:427–33.
2015;12:77–87. 30. Gomes CC, et al. Aspergillus in endodontic infection
13. Harrison MJ, et al. Fungal microbiota in the adult near the maxillary sinus. Braz J Otorhinolaryngol.
cystic fibrosis (CF) airway: characterization by 2015;81:527–32.
second-generation sequencing and correlation with 31. Burgel PR, Paugam A, Hubert D, Martin
standard culture-based methods and clinical pheno- C. Aspergillus fumigatus in the cystic fibrosis lung:
type. Ir J Med Sci. 2012;181:S369–437. pros and cons of azole therapy. Infect Drug Resist.
14. Xu H, Dongari-Bagtzoglou A. Shaping the oral 2016;9:229–38.
mycobiota: interactions of opportunistic fungi with 32. Diaz PI, Hong BY, Dupuy AK, Strausbaugh
oral bacteria and the host. Curr Opin Microbiol. LD. Mining the oral mycobiome: methods,
2015;26:65–70. components, and meaning. Virulence. 2017;8:313–23.
15. Wang H, et al. Role of distinct CD4(+) T helper subset 33. Mehdipour M, et al. Prevalence of Candida species in
in pathogenesis of oral lichen planus. J Oral Pathol erosive oral lichen planus. J Dent Res Dent Clin Dent
Med. 2016;45:385–93. Prospects. 2010;4:14–6.
16. Chen J, et al. Immunoexpression of interleukin-22 and 34. Artico G, et al. Prevalence of Candida spp.,
interleukin-23 in oral and cutaneous lichen planus xerostomia, and hyposalivation in oral lichen
lesions: a preliminary study. Mediat Inflamm. planus--a controlled study. Oral Dis. 2014;20:e36–41.
2013;2013:801974. 35. Findley K, et al. Topographic diversity of fungal and
17. Zelante T, et al. IL-23 and the Th17 pathway promote bacterial communities in human skin. Nature.
inflammation and impair antifungal immune resis- 2013;498:367–70.
tance. Eur J Immunol. 2007;37:2695–706. 36. Fox EP, et al. Anaerobic bacteria grow within Candida
18. Hoarau G, et al. Bacteriome and mycobiome albicans biofilms and induce biofilm formation in sus-
interactions underscore microbial dysbiosis in familial pension cultures. Curr Biol. 2014;24:2411–6.
Crohn's disease. MBio. 2016;7:e01250-16. 37. Janus MM, Willems HM, Krom BP. Candida albicans
19. Sam QH, Chang MW, Chai LY. The fungal in multispecies oral communities; a keystone commen-
mycobiome and its interaction with gut bacteria in sal? Adv Exp Med Biol. 2016;931:13–20.
the host. Int J Mol Sci. 2017;18:E330. 38. Amiri MRJ, et al. Invasive forms of Candida and
20. Rizzetto L, De Filippo C, Cavalieri D. Richness and Aspergillus in sputum samples of pulmonary tubercu-
diversity of mammalian fungal communities shape losis patients attending the tuberculosis reference
332 Y. Li et al.
laboratory in Ghaemshahr, Northern Iran: an analysis 48. Vesty A, Biswas K, Taylor MW, Gear K, Douglas
of samples collected during the past 10years. Int J RG. Evaluating the impact of DNA extraction method
Mycobacteriol. 2016;5(Suppl 1):S179–80. on the representation of human oral bacterial and fun-
39. Fath BD, Scharler UM, Ulanowicz RE, Hannon gal communities. PLoS One. 2017;12:e0169877.
B. Ecological network analysis: network construction. 49. Zhou J, et al. Temperature mediates continental-scale
Ecol Model. 2007;208:49–55. diversity of microbes in forest soils. Nat Commun.
40. Petersen C, Round JL. Defining dysbiosis and its 2016;7:12083.
influence on host immunity and disease. Cell 50. Wu L, et al. Phasing amplicon sequencing on Illumina
Microbiol. 2014;16:1024–33. Miseq for robust environmental microbial community
41. He Y, et al. Dysbiosis of oral buccal mucosa analysis. BMC Microbiol. 2015;15:125.
microbiota in patients with oral lichen planus. Oral 51. Liu KL, Porras-Alfaro A, Kuske CR, Eichorst SA, Xie
Dis. 2017;23:674–82. G. Accurate, rapid taxonomic classification of fungal
42. Koliada A, et al. Association between body mass index large-subunit rRNA genes. Appl Environ Microbiol.
and firmicutes/bacteroidetes ratio in an adult Ukrainian 2012;78:1523–33.
population. BMC Microbiol. 2017;17:120. 52. Kong Y. Btrim: a fast, lightweight adapter and quality
43. Wang K, et al. Analysis of oral microbial community trimming program for next-generation sequencing
and Th17-associated cytokines in saliva of patients technologies. Genomics. 2011;98:152–3.
with oral lichen planus. Microbiol Immunol. 53. Zhang J, Kobert K, Flouri T, Stamatakis A. PEAR: a
2015;59:105–13. fast and accurate Illumina paired-end reAd mergeR.
44. Gladiator A, Wangler N, Trautwein-Weidner K, Bioinformatics. 2014;30:614–20.
LeibundGut-Landmann S. Cutting edge: IL-17-secret- 54. Wang Q, Garrity GM, Tiedje JM, Cole JR. Naive
ing innate lymphoid cells are essential for host defense Bayesian classifier for rapid assignment of rRNA
against fungal infection. J Immunol. 2013;190:521–5. sequences into the new bacterial taxonomy. Appl
45. Wheeler ML, et al. Immunological consequences of Environ Microbiol. 2007;73:5261–7.
intestinal fungal dysbiosis. Cell Host Microbe. 55. Schloss PD, et al. Introducing mothur: open-source,
2016;19:865–73. platform-independent, community-supported software
46. Silverman S Jr, Gorsky M, Lozada-Nur F, Giannotti for describing and comparing microbial communities.
K. A prospective study of findings and management in Appl Environ Microbiol. 2009;75:7537–41.
214 patients with oral lichen planus. Oral Surg Oral 56. Mar JC, Matigian NA, Quackenbush J, Wells
Med Oral Pathol. 1991;72:665–70. CA. Attract: a method for identifying core pathways
47. Conti HR, et al. IL-17 receptor signaling in oral epi- that define cellular phenotypes. PLoS One. 2011;6:
thelial cells is critical for protection against oropharyn- e25445.
geal candidiasis. Cell Host Microbe. 2016;20:606–17. 57. Deng Y, et al. Molecular ecological network analyses.
BMC Bioinformatics. 2012;13:113.
Intestinal Microbiota and Osteoporosis
10
Xin Xu, Xiaoyue Jia, Longyi Mo, Chengcheng Liu, Liwei Zheng,
Quan Yuan, and Xuedong Zhou
X. Xu · X. Jia
Abstract
Department of Operative Dentistry and Endodontics, West
China Hospital of Stomatology, Sichuan University, Postmenopausal osteoporosis (PMO) is a prev-
Chengdu, China
alent metabolic bone disease characterized by
State Key Laboratory of Oral Diseases, West China bone loss and structural destruction, which
China increases the risk of fracture in postmeno-
pausal women. Owing to the high morbidity
L. Mo
State Key Laboratory of Oral Diseases, West China and serious complications of PMO, many
Hospital of Stomatology, Sichuan University, Chengdu, efforts have been devoted to its prophylaxis
China and treatment. The intestinal microbiota is the
C. Liu complex community of microorganisms
Department of Periodontics, West China Hospital of colonizing the gastrointestinal tract.
Stomatology, Sichuan University, Chengdu, China Probiotics, which are dietary or medical
State Key Laboratory of Oral Diseases, West China supplements consisting of beneficial intestinal
Hospital of Stomatology, Sichuan University, Chengdu, bacteria, work in concert with endogenous
China
intestinal microorganisms to maintain host
L. Zheng health. Recent studies have revealed that
Department of Pediatric Dentistry, West China Hospital of
Stomatology, Sichuan University, Chengdu, China bone loss in PMO is closely related to host
immunity, which is influenced by the intestinal
State Key Laboratory of Oral Diseases, West China
Hospital of Stomatology, Sichuan University, Chengdu, microbiota. The curative effects of probiotics
China on metabolic bone diseases have also been
Q. Yuan demonstrated. The effects of the intestinal
Department of Dental Implantology, West China Hospital microbiota on bone metabolism suggest a
of Stomatology, Sichuan University, Chengdu, China promising target for PMO management. This
State Key Laboratory of Oral Diseases, West China review seeks to summarize the critical effects
Hospital of Stomatology, Sichuan University, Chengdu, of the intestinal microbiota and probiotics on
China PMO, with a focus on the molecular
X. Zhou (*) mechanisms underlying the pathogenic rela-
State Key Laboratory of Oral Diseases, National Clinical tionship between bacteria and host, and to
Stomatology, Sichuan University, Chengdu, China define the possible treatment options.
China

https://doi.org/10.1007/978-981-15-7899-1_10
334 X. Xu et al.
Keywords increase bone mineral density, with a decreased

risk of fractures in the vertebra, hip, or long bones
Postmenopausal osteoporosis · Intestinal [1, 10]. All of these pharmacological agents can
microbiota · Probiotics · Estrogen deficiency · reduce bone resorption by inhibiting osteoclasts,
Ovariectomy except teriparatide, which acts as an anabolic
agent by activating or increasing osteoblast activ-
ity and prompting bone formation [1, 11]. Recent
10.1 Introduction studies have demonstrated a close relationship
between the intestinal microbiota and bone
Postmenopausal osteoporosis (PMO) is an estro- metabolism [12–15], providing evidence that the
gen deficiency-induced metabolic bone disorder intestinal microbiome may serve as a potential
characterized by reduced bone strength, which therapeutic target for the treatment of PMO.
increases the risk of fracture in postmenopausal
women [1]. The onset of PMO is occult, without
any obvious symptoms until a fracture occurs. 10.1.1 The Intestinal Microbiota
The most prevalent complication is a fragility and Its Regulators
fracture, which often occurs in the hip, femur, or
spine under nontraumatic or mildly traumatic The intestinal microbiota is the collection of
conditions, resulting in pain, malformation, dys- microorganisms that colonize the gastrointestinal
function, and even death. Studies showed that the tract, which consists of approximately 10 trillion
mortality rate associated with a hip fracture was bacteria [16]. Obligate anaerobes such as
17% in the first year [2] and approximately Bacteroidetes and Firmicutes are the predominant
12–20% within the two following years residents of the healthy gastrointestinal tract,
[3]. PMO is also a potential risk factor for oral outnumbering aerobes and facultative anaerobes
bone loss and aggressive periodontitis in post- [16, 17]. Based on their roles in maintaining
menopausal females. PMO animal models human health, intestinal microorganisms can be
showed an equivalent bone loss in alveolar bone categorized into beneficial, harmful, and neutral
and femurs [4]. Compared with healthy postmen- bacteria. Both host and environmental factors can
opausal women, patients afflicted with PMO also shape intestinal microbial composition and struc-
exhibited an inclination to more bone loss and ture (Fig. 10.1). Animal experiments [18–21] and
lower bone mineral density (BMD) in the jaw, twin studies [22, 23] revealed that host genetic
especially in postmenopausal females with background had a significant impact on the abun-
preexisting periodontitis who suffered from dance of the intestinal microbiota and the predis-
accelerated alveolar bone loss under routine treat- position to the colonization of pathogens (e.g.,
ment [5–7]. In addition to bone loss and Escherichia coli). Though still disputed, gender
microstructural deterioration, PMO affects the may be another host factor affecting intestinal
osseous formation processes. Delayed osseous microbiome species diversity [24, 25]. Environ-
maturation and reduced bone regeneration during mental factors, including diet, lifestyle, hygiene,
bone healing in ovariectomized (OVX) rats were antibiotic treatment, and probiotics, also contrib-
reported. [8, 9] The high morbidity and serious ute to the alteration of the intestinal microbiota
complications of PMO have attracted major composition [26–31]. Notably, the effects of diet
research efforts on its prophylaxis and treatment and antibiotics on the intestinal microbiota also
for decades. Current medications for the treat- depend on the host genetic background [32, 33].
ment of PMO include bisphosphonates, raloxi- Probiotics are defined as dietary or medical
fene, teriparatide and calcitonin, denosumab, supplements consisting of live bacteria that can
estrogen, menopausal hormone therapy, etc. benefit the host if provided in adequate quantities
These medications can prevent bone loss and [34–36]. Currently, approximately 20 types of
10 Intestinal Microbiota and Osteoporosis 335
Fig. 10.1 Regulators of the gut microbiota and factors, the gut microbiota regulates bone metabolism
mechanisms by which the gut microbiota regulates bone through various pathways, including the immune system,
metabolism. Shaped by both host and environmental endocrine system, and influences on calcium balance
beneficial bacteria are used in probiotic microbiome and butyrate concentrations

supplements. They are generally classified into [41]. RCTs in elder adults showed that the
five categories, including lactobacilli, age-associated intestinal microbiota imbalance
bifidobacteria, streptococci, yeast, and others was restored by probiotic-based functional foods,
[37]. Lactobacilli and bifidobacteria are the most with increased resident probiotic-related bacteria
commonly used probiotics. Probiotics can selec- and decreased emergence of opportunistic
tively ferment prebiotics, which contain soluble pathogens [44, 45]. Animal experimentation also
dietary fibers such as oligosaccharides and inulin, showed that probiotic administration improved
facilitating the production of beneficial products the intestinal microbiota composition in
conducive to the growth of certain probiotics such hyperlipidemic rats by recovering the abundance
as bifidobacteria [34, 38, 39]. However, it is still of Bacteroidetes and Verrucomicrobia and reduc-
disputed whether probiotics can alter the gut ing Firmicutes [46]. However, another RCT in
microbiota composition. Randomized controlled healthy adults demonstrated that Lactobacillus
trials (RCTs) in healthy adults indicated that pro- rhamnosus GG (LGG) supplement induced no
biotic intervention or probiotics-fermented alteration in gut microbiota composition or diver-
products resulted in changes in intestinal sity stability, except for a transient increased fecal
microbiota composition or diversity [40– excretion of probiotic-associated bacteria during
43]. Although probiotics promoted the significant the intervention [47]. Additionally, one RCT in
increase of certain bacteria, Bacteroides was the healthy subjects and patients with irritable bowel
dominant genus under probiotics administration, syndrome (IBS) showed parallel, transient, and
while other bacteria such as Clostridiales were distinct increases in probiotics but limited changes
inhibited. [40, 41] In addition, the effect of in other specific bacteria in fecal samples of both
probiotics on Clostridiales genera may be healthy and IBS-afflicted subjects with
associated with the initial status of the intestinal Bifidobacterium infantis intervention [48].
336 X. Xu et al.
10.1.2 The Intestinal Microbiota assessed by the Modified Mankin Score in rats
Regulates Bone Metabolism [50]. Gut microbiota modified by diet regulated
the production of IL-1β (Interleukin-1beta) and
10.1.2.1 Involvement of the Intestinal prevented the spontaneous development of osteo-
Microbiota in Bone Metabolism myelitis in Pstpip2cmo mice predisposed to
The dynamic homeostasis of the gut microbiome autoinflammatory osteomyelitis [52, 53].
is critical to health. Accumulating evidence has
demonstrated that the gut microbiota is associated
10.1.2.2 Mechanisms by Which the Gut
with physiological bone metabolism and a range
Microbiota Regulates Bone
of inflammatory or metabolic bone diseases [12–
Metabolism
15, 49, 50]. In animal experimentation, germ-free
Gut microbiota can regulate bone metabolism, but
mice showed higher trabecular volume bone min-
the exact mechanisms are still unclear. Multiple
eral density (vBMD) and improved histomor-
approaches through which gut microbiota may
phologic indices in trabecula compared with
regulate bone metabolism have been proposed,
conventionally raised (CONV-R) mice [12]. How-
including actions on the immune system, endo-
ever, both trabecular BMD and cortical cross-
crine system, and calcium absorption (Fig. 10.1).
sectional area decreased when germ-free mice
were recolonized by the gut microbiota, a. The gut microbiota regulates bone metabolism
indicating that the gut microbiota is a major regu- through the immune system.
lator of bone mass [12]. Microbial recolonization
Recent studies have revealed a close interrela-
in germ-free mice induced an incipient acute
tionship between the immune system and bone
decrease in bone mass but predominantly led to
metabolism, leading to the development of
bone formation with a longer duration, leading to
“osteoimmunology,” which highlights the role
a new equilibrium in bone mass [14]. Further-
of immune-related factors in modulating bone
more, germ-free mice colonized with immature
remodeling [54, 55]. In immune-mediated bone
gut microbiota from donors of different ages or
metabolism, the RANKL (Receptor activator NF
nutritional statuses showed varied femoral
kappa B ligand)-RANK-OPG axis and
phenotypes, suggesting that the impact of the
immunoreceptor tyrosine-based activation motif
gut microbiota on bone morphologic properties
(ITAM) pathway play key roles in physiological
is age/nutrition dependent [13]. Compromised
bone turnover and bone diseases
bone biomechanical properties in mice were also
[54, 56]. Recently, it has been widely recognized
induced by an altered gut microbiota resulting
that the gut microbiota can interact with the host
from immunodeficiency or long-term antibiotic
immune system and further influence host health
intervention during growth [15]. Additionally,
[57–59]. One study showed that altered immune
through post-weaning exposure to low-dose pen-
status in germ-free mice (e.g., decreased
icillin (LDP) or by introducing LDP to their
pro-inflammatory cytokines, fewer CD4+ T
mother in pregnancy, adult offspring with a
cells, and reduced osteoclast/precursor cells in
perturbed gut microbiota showed altered bone
bone marrow) may account for the higher bone
mineral content (BMC) and BMD [51]. In addi-
mass than in CONV-R mice [12]. Intestinal seg-
tion to physiological condition, inflammatory or
mented filamentous bacteria in mice were shown
metabolic bone diseases, such as metabolic oste-
to promote the production of IL-17 and IFN-γ
oarthritis, osteoporosis, and autoinflammatory
(interferon-gamma), both of which played critical
osteomyelitis, are also associated with gut micro-
roles in the formation of osteoclasts and
bial alteration [49, 50, 52, 53]. The abundance of
osteoblasts [60–62]. These studies suggest that
gut bacteria Lactobacillus spp. and Methanobre-
the gut microbiota regulates bone metabolism by
vibacter spp. was shown to have a significant
altering host immune status.
relationship with the prediction of osteoarthritis
b. The gut microbiota regulates bone metabolism activity by the human colon microbiota [82]. A
through the endocrine system. recent study showed that the gut microbiota,
especially spore-forming bacteria, can enhance
In addition to the immune system, hormones
the biosynthesis of serotonin by colonic
are regarded as another important regulator of
enterochromaffin cells [83]. Despite the lack of
bone metabolism. As an autocrine or paracrine
direct evidence, it has been suggested that gut
growth factor, insulin-like growth factor-1
microbiota-bone communication likely depends
(IGF-1) can promote the differentiation and
on the endocrine system or hormone-like
growth of bone cells, including osteoblasts,
substances.
osteoclasts, and chondrocytes, and enhance nor-
mal interactions among them [63–65]. Moreover, c. The gut microbiota regulates bone metabolism
the IGF-1 signaling pathway is involved in the by influencing calcium absorption.
regulation of bone metabolism via both growth
Gut microbiota can affect the absorption of
hormone and parathormone [64]. Intermittent
skeletal development-related nutrients such as
administration of parathormone promoted bone
calcium and vitamin D. Calcium, the dominant
formation by increasing local IGF-1 production
mineral component in bone, is essential for bone
and activating the IGF-1 signaling pathway in
health. Calcium absorption can be facilitated by
bone [64]. Growth hormone can directly or
vitamin D. Either dietary calcium deprivation or
IGF-1-dependently target the growth plate to pro-
vitamin D deficiency may induce osteoporosis
mote cartilage formation and longitudinal bone
[84]. Sufficient calcium consumption can be a
growth [66, 67]. Moreover, gonadal steroids,
prophylactic measure against osteoporosis and
including estrogen and androgen, play key roles
relevant fracture [85]. A clinical study in adoles-
in the regulation of bone mass and turnover in
cent girls showed decreased bone resorption in
bone metabolism [68–70]. Furthermore, serum
the presence of high calcium consumption
neurotransmitter 5-hydroxytryptamine, namely,
(47.4 mmol/day compared to the recommended
circulating serotonin with a hormone-like effect,
22.5 mmol/day) [86]. Some studies showed that
can stimulate or inhibit bone formation, and dual-
calcium metabolism differences among ethnic
directional effects may be gender/age dependent
groups—in terms of dietary calcium intake,
[71–74]. The gut microbiota, which is currently
renal calcium excretion, and relevant regulatory
considered a novel “endocrine organ” of the
hormone or factor—were associated with bone
human body, can engage in an interplay with the
parameters related to osteoporosis/fracture risk
endocrine system (e.g., hypothalamic-pituitary-
[87]. In animal models, a low-calcium diet alone
adrenal axis) and secrete hormones or hormone-
can lead to bone resorption, high bone turnover,
like products to regulate host hormone levels,
and impaired bone trabecular microarchitecture in
further influencing host health status [75, 76]. In
multiple bones, including the hard palate, mandi-
animal experimentation, gut microbial coloniza-
ble, vertebrae, femur, and proximal tibia [88–91].
tion in germ-free mice significantly increased the
Calcium is absorbed by the active transcellular
serum IGF-1 level, resulting in bone growth and
pathway (ion pumps) or passive paracellular dif-
normalized bone mass [14]. Isoflavones, the
fusion (ion channels), depending on the level of
compounds classified as phytoestrogens and
1,25-(OH)2D (1,25-dihydroxy vitamin D)
structurally similar to endogenous estrogen,
[92]. The proteins involved in the transcellular
were converted into more estrogenic metabolite
pathway consist of transient receptor potential
equol by specific gut microorganisms such as
vanilloid type 6 (TRPV6/CaT1/ECaC2), which
rod-shaped and gram-positive anaerobic bacteria
absorbs calcium from the gut lumen into cells;
in approximately 30–50% of humans [77–
calbindin-D9k, which is responsible for intracel-
81]. Polycyclic aromatic hydrocarbons—
lular calcium transportation; and plasma mem-
contaminants widely present in nature—can be
brane calcium-ATPase 1b (PMCA1b), which
bio-transformed into products with estrogenic
excretes calcium outside cells into the blood
338 X. Xu et al.
[93]. Passive paracellular calcium diffusion serum 1,25-(OH)2D level, and it was related to
occurs as calcium (Ca2+) flux across the intestinal the transcription factors vitamin D receptor
epithelium and is based on tight junction (VDR) and cdx-2 [107–109]. The SCFA butyrate
(TJ) proteins between intestinal epithelial cells resulting from the prebiotic diet can upregulate
[94]. Normal calcium intake rates in adults are VDR, activate the cdx-2 promoter, and facilitate
approximately 30–35% [95, 96]; these levels can cdx-2 mRNA expression [110]. Although direct
be increased by probiotics, prebiotics, and evidence for the SCFA-related effect on intestinal
synbiotics consisting of probiotics and their paracellular calcium absorption is still absent, a
favorable prebiotics [97]. Specific probiotic bac- ruminant model in which more than 50% of cal-
teria, such as Lactobacillus salivarius rather than cium absorption pre-intestinally occurs in the
Bifidobacterium infantis, stimulated calcium rumen manifested a dose-dependent promotion
uptake by enterocytes in a Caco-2 cell culture by SCFA on the ruminal calcium ion flux rate
model. [98] Oligosaccharides (NDO), the dietary from mucosa to serum in the paracellular pathway
prebiotics containing fructooligosaccharides [111, 112]. As stated above, both probiotics and
(FOS) and inulin, significantly facilitated intesti- prebiotics can influence intestinal epithelial per-
nal calcium absorption and increased skeletal cal- meability by regulating TJ protein expression and
cium content in growing and adult rats [99– distribution, which possibly underlies the mecha-
102]. Prebiotic inulin produced an enhancement nism of prebiotic effects on paracellular calcium
in calcium absorption compared to other transport. In addition to direct action on the cellu-
oligosaccharides [99, 100], while the combina- lar structure involved in the calcium absorption
tion of both may act synergistically process, prebiotics can also alter the intestinal
[101, 102]. Additionally, a study in healthy ado- microenvironment, thereby indirectly modulating
lescent girls demonstrated that daily administra- bone metabolism. SCFA generated from
tion of GOS can increase calcium absorption prebiotics could lower the intestinal lumen pH
[103]. Another clinical study reported the and consequently inhibit the formation of calcium
improvement of calcium absorption in young complexes, such as calcium phosphates, leading
healthy women with long-term treatment with to increased calcium absorption [113].
lactosucrose [104].
As the fermentation substrates of gut
microbiota, prebiotics affect bone metabolism 10.1.3 Relationship Between
by producing a variety of beneficial metabolites, the Intestinal Microbiota
such as short-chain fatty acids (SCFA). The and PMO
potential mechanism by which SCFA regulate
bone metabolism involves direct effects on 10.1.3.1 PMO Animal Models
proteins associated with calcium absorption. Current data on the relationship between intesti-
Experiments both in vitro and in vivo using ani- nal microbiota and PMO are primarily obtained
mal models showed that an SCFA supplement from animal models. The most commonly used
could increase the transcriptional levels of PMO animal models are rodents submitted to
TRPV6 and calbindin-D9k rather than PMCA1b either surgery or medication. Ovariectomy is the
in cultured Caco-2 human colonic epithelium most frequently used surgery to generate PMO
and rat colorectal mucosa [105, 106]. The rodent models. Bilateral ovariectomy is used to
TRPV6 gene was shown to contain a segment successfully set up morbid states of PMO in the
characterized by a positive response to SCFA proximal tibia, distal femur, and lumbar vertebra
[105]. In addition, the response of calbindin- according to the guidelines for the preclinical and
D9k to SCFA varied with time and SCFA dose clinical evaluation of PMO medication issued by
[106]. The upregulation of calbindin-D9k by pre- the US Food and Drug Administration (FDA)
biotic diet specifically occurred in the colorectal [114]. Gonadotropin-releasing hormone (GnRH)
segment regardless of dietary calcium uptake and agonists are frequently used to induce PMO in
rodents. The long-term or high-dose administra- microbiota, whereas trabecular thickness (Tb.
tion of GnRH agonists to rats typically housed Th) is not [49].
under germ-free conditions [49] inhibits the Bone resorption in PMO has also been shown
secretion of endogenous GnRH, gonadotrophin, to be closely related to genetic background
and estrogen [115, 116]. GnRH agonist-induced (Fig. 10.2). Previous studies have shown that
bone loss is reversible. Kurabayashi T et al. found estrogen deficiency-induced bone loss varies
that Sprague-Dawley (SD) rats submitted to remarkably among different mouse strains
long-term GnRH agonist treatment exhibited [124, 126, 127]. Genetic regulation can act on
decreased bone mass, bone density, and bone PMO bone loss through multiple mechanisms.
turnover that could be partially recovered after Genetic background determines basal bone mass
treatment interruption [115]. Estrogen deficiency [1, 122] and the specific distribution of intestinal
induced by either ovariectomy or GnRH agonist antigen-presenting cells (APCs) with different
in murine models evidently increases bone turn- functions [129]. Intestinal APCs, especially den-
over and bone loss and reduces bone mineral dritic cells (DCs), present pathogenic antigens
density and bone volume in lumbar vertebrae from the gut microbiota and activate CD4+ T
and long bones, thus recapitulating conditions in cells to produce pro-inflammatory cytokines
patients with PMO [114, 115, 117]. such as tumor necrosis factor-α (TNF-α), which
Animal age can affect the final experimental stimulates osteoclastogenesis and induces bone
results, as preadolescent mice undergo rapid bone loss [130, 131]. In addition, host genetic back-
growth and high bone turnover due to the pres- ground can shape the intestinal microbiota
ence of growth hormones [118]. In addition, mice [20, 22, 23, 33, 132, 133], which can influence
are likely to undergo irreversible aging symptoms the development and activity of host immune
[119] and potentially develop senile osteoporosis systems [59, 134] and thus may indirectly regu-
as early as 5–6 months old. Therefore, 8–20- late bone loss in PMO.
week-old rats or mice are usually used to establish
PMO animal models [49, 115, 118, 120–128]. 10.1.3.3 Probiotics Prevent Bone Loss
in PMO Murine Models
10.1.3.2 PMO Development Depends Bone loss in PMO murine models can be
on the Intestinal Microbiota prevented by probiotics. Several studies have
and Host Genetic Background shown that bone resorption of femur and vertebra
The intestinal microbiota is indispensable to in OVX mice could be completely inhibited by
PMO development. Compared to conventionally the administration of probiotics such as Lactoba-
raised (Con-R) mice, germ-free (GF) mice cillus reuteri, LGG, and the commercial mixture
showed no significant alteration in either VSL#3 [49, 118]. In addition, probiotics such as
pro-inflammatory cytokines in bone marrow or Bifidobacterium longum, Lactobacillus
femoral trabecular parameters after PMO paracasei, and a mixture of Lactobacillus
model establishment by the administration of paracasei and Lactobacillus plantarum alleviated
GnRH agonists [49]. However, similar to Con-R femoral bone loss and increased bone mineral
mice, GF mice colonized with a normal gut density in OVX rats or mice [120, 121]. Further-
microbiota exhibited increased pro-inflammatory more, soy skim milk fermented by Lactobacillus
cytokines and impaired bone properties due to paracasei subsp. paracasei NTU 101 (NTU
estrogen deficiency [49]. Accordingly, intestinal 101F) and Lactobacillus plantarum NTU 102
microorganisms are involved in estrogen (NTU 102F) mitigated bone loss and improved
deficiency-associated trabecular bone resorption. the trabecular microarchitecture in OVX
These microorganisms may be correlated with mice [125].
certain trabecular bone parameters. In particular, The effects of probiotics on bone tissues
trabecular number (Tb.N) and trabecular spacing depend on the systemic conditions of the host.
(Tb.Sp) are influenced by the intestinal McCabe LR et al. [123] showed that L. reuteri
340 X. Xu et al.
Fig. 10.2 Genetic

background acts on PMO
bone loss. Genetic
regulation affects bone loss
in PMO by shaping the gut
microbiota and determining
basal bone mass as well as
the distribution of APCs
increased trabecular bone parameters of the femur intestinal epithelial barrier, and the host immune
and vertebra in healthy male mice (but not intact system maintain homeostasis, inhibiting the num-
female mice), suggesting that estrogen level ber of intestinal pathogens and maintaining mus-
might affect the sensitivity of bone formation to culoskeletal balance. If homeostasis is disturbed,
L. reuteri in mice. L. reuteri may affect bone intestinal pathogens intrude into the host through
metabolism by activating the estrogen signaling the epithelial barrier and provoke an immune
pathway in male mice, whereas healthy adult response, ultimately promoting osteoclastic bone
female mice are impervious to L. reuteri due to resorption and continual bone loss in PMO.
sufficient estrogen. Notably, probiotics enhanced Accordingly, probiotics ameliorate bone resorp-
the trabecular bone parameters in intact female tion and destruction by suppressing immune
mice under inflammatory conditions after surgery responses and restoring equilibrium between the
[49, 135]. These results indicate that inflamma- intestinal microbiota and the host.
tory pathways may be potential targets of
probiotics to normalize bone homeostasis.
10.1.4.1 Intestinal Microbial Diversity
in PMO Is Regulated by Estrogen
and Probiotics
10.1.4 Host and Microbiota A healthy state and sufficient estrogen levels
Interactions maintain intestinal microbial diversity
in the Pathogenesis (Fig. 10.3a). Under these conditions, beneficial
and Treatment of PMO bacteria are predominant and stunt the growth of
pathogenic species, preserving the stability of the
Immune responses mediated by antigens from the intestinal microbiota composition. In postmeno-
intestinal microbiota play a central role in the pausal women, the absence of estrogen alters
pathogenesis of PMO. Under healthy conditions, intestinal microbial composition and structure,
interplays between the intestinal microbiota, the leading to decreased microbial diversity
Fig. 10.3 Intestinal microbial diversity in PMO is reduces gut microbial diversity and beneficial bacteria,
regulated by estrogen and probiotics. Healthy status can while increased pathogens induce inflammation (b).
maintain gut microbial diversity and beneficial bacteria, Probiotics can prevent pathogens and increase gut micro-
which can activate Tregs to sustain immune homeostasis bial diversity by producing extracellular substances (c)
that is resistant to pathogens (a). Estrogen deficiency
(Fig. 10.3b). Clinical surveys of males and When used to treat PMO, probiotics improve
postmenopausal females have shown significant intestinal microbial constitution and restore
correlations between biodiversity (or Clostridium biodiversity. Probiotics halt pathogen growth
abundance) in feces and urinary levels of estrogen and increase intestinal microbial diversity
(or estrogen metabolites) [136, 137]. Estrogen by synthesizing extracellular compounds
deficiency destroys intestinal microbial diversity, (Fig. 10.3c). A study by Preidis GA et al. [141]
which is reflected as a reduction in Firmicutes showed that L. reuteri increased microbial diver-
populations, including Clostridium species sity and homogeneity in the feces of mice by
[136–138]. Firmicutes bacteria, especially Clos- producing reuterin. Reuterin, an antibiotic com-
tridium species, possess immune-regulatory pound, promotes oxidative stress in cells by
effects that boost the formation of regulatory T inducing the modification of thiols on proteins
cells (Tregs) and enhance their function, sustain- or small molecules, which in turn suppress the
ing immune homeostasis [139, 140]. Hence, growth of pathogens such as Bacteroides while
estrogen deficiency undermines intestinal micro- increasing the presence of Clostridium species
bial diversity and reduces the abundance of intes- [118, 142]. Additionally, the Lactococcus lactis
tinal bacteria that are conducive to immune strain G50 prevented H2S-producing bacteria
homeostasis, consequently facilitating pathogen from growing, while strain H61 had an inhibitory
reproduction and initiating an immune response. effect on Staphylococcus in a mouse model of
342 X. Xu et al.
senile osteoporosis [119, 143]. However, it has epithelial barrier, leading to the production of
not yet been demonstrated whether L. lactis has pro-inflammatory cytokines such as tumor necro-
an equivalent role in PMO. sis factor-α (TNF-α) and interferon-γ (IFN-γ).
TNF-α and IFN-γ downregulate the TJ proteins
10.1.4.2 Intestinal Epithelial Barrier occludin and zo-1 via Raf-MEK1/2-ERK1/2 or
Function in PMO Is Regulated by MLKs-MKK3/6-p38 in the MAPK pathway and
Estrogen and Probiotics further compromise the intestinal epithelial bar-
The intestinal epithelium is the first barrier to rier [157]. In addition, the pro-inflammatory fac-
physically resist intestinal pathogens. This barrier tor interleukin-17 (IL-17) can increase claudin-1
not only absorbs water and nutrients but also protein expression and reinforce the intestinal
limits the penetration of intestinal antigens. The epithelial barrier through Ras-Raf-MEK1/2-
ability of the barrier to function properly depends ERK1/2 in the MAPK pathway [158]. However,
on transcellular and paracellular pathways. The the positive action of IL-17 fails to completely
fundamental paracellular pathway structure is the compensate for the adverse effect of TNF-α and
tight junction (TJ), the integrity, and selective IFN-γ because TNF-α and IFN-γ may be central
permeability of which are of vital importance to players in the immune responses elicited by intes-
intestinal epithelial barrier function. TJs are pro- tinal bacteria. Hence, estrogen deficiency
tein complexes consisting of claudin, occludin, increases intestinal epithelial permeability
and zo proteins, which together allow selective (Fig. 10.4b), facilitating the intrusion of intestinal
passage of ions and small molecules [144– pathogens and provoking immune reactions and
150]. TJ permeability can be represented by ultimately resulting in increased osteoclastic bone
transepithelial electrical resistance (TER); higher resorption and continual bone loss in PMO.
TER usually indicates lower permeability When used to treat PMO, probiotics fortify the
[151, 152]. Both physiological and pathological intestinal epithelial barrier to protect the host
stimuli can affect the production and distribution against intestinal pathogen invasion (Fig. 10.4c).
of TJ proteins, thereby modulating intestinal epi- Probiotics regulate the production and distribu-
thelial permeability. TJ proteins are mainly tion of TJ proteins and reduce intestinal epithelial
regulated by phosphorylation through protein permeability by inducing changes in TJ-related
kinase A (PKA), protein kinase C (PKC), protein gene expression. In vitro experiments have con-
kinase G (PKG), serine/threonine (Ser/Thr) firmed that L. plantarum can promote the produc-
kinases, Rho, mitogen-activated protein kinase tion and rearrangement of claudin-1, occludin,
(MAPK), phosphatidylinositol-3-kinase/Akt and zo-1 proteins in the Caco-2 human colon
(PI3K/Akt), and myosin light chain kinase adenocarcinoma cell line in a dose-dependent
(MLCK) [144, 150]. manner [159, 160]. Bifidobacteria infantis was
Sufficient levels of estrogen activate the found to increase zo-1 and occludin protein
GTP-binding protein Ras and a series of kinases expression by inhibiting pro-inflammatory
present in cytoplasm (Raf, MEK1/2 and ERK1/2) cytokines or through the secretion of polypeptide
through estrogen receptors on the intestinal epi- bioactive factors to augment Erk levels while
thelium; they also maintain relatively high levels decreasing p38 levels [161]. The probiotic mix-
of occludin protein expression (Fig. 10.4a) ture VSL#3 also promoted the expression and
[144, 153–155]. As a result of this paracellular redistribution of occludin, zo-1, and claudin-1
pathway, the intestinal epithelial barrier exhibits proteins in a mouse model of acute colitis
increased TER and can prevent pathogen inva- [162]. The potential mechanism for the probiotic
sion. Estrogen deficiency weakens the effect of regulation of TJ proteins probably involves
the aforementioned estrogen-associated pathway, SCFAs as fermentation products, especially buty-
leading to increased intestinal epithelial perme- rate, which could stimulate the reorganization of
ability [156]. Antigens from intestinal pathogens TJ proteins and promote TJ assembly by
initiate inflammatory cascades across the upregulating AMP-activated protein kinase
Fig. 10.4 Intestinal epithelial barrier function in PMO is through both the Raf-MEK1/2-ERK1/2 and MLKs-
regulated by estrogen and probiotics. Sufficient estrogen MKK3/6-p38 pathways and compromise the gut epithelial
can prompt the expression of TJ proteins through the barrier (b). The positive action of IL-17 on TJ proteins
Raf-MEK1/2-ERK1/2 pathway to enhance the gut epithe- (thin green arrows in b) fails to completely compensate for
lial barrier (a), while this active effect on TJ is weakened the adverse effect of TNF-α and IFN-γ. Probiotics can
by estrogen deficiency (b). Under estrogen deficiency, enhance the gut epithelial barrier by regulating the produc-
pathogen-induced pro-inflammatory cytokines such as tion and distribution of TJ proteins and affecting the
TNF-α and IFN-γ reduce the production of TJ proteins growth and movement of intestinal epithelial cells (c)
(AMPK) activity in the Caco-2 cell model, intestinal epithelial proliferation [165, 166].
resulting in increased TER and an enhanced intes- Probiotics also offer resistance against the toxic
tinal epithelial barrier [163]. In addition, effects produced by intestinal pathogens on the
probiotics affected the growth and movement of intestinal epithelium. Bifidobacteria reduce the
intestinal epithelial cells by altering gene expres- production of autophagy-related proteins and fur-
sion related to protein synthesis, metabolism, cell ther prevent intestinal epithelial autophagy trig-
adhesion, and apoptosis [162, 164]. L. reuteri gered by endotoxins from gram-negative
substantially promoted intestinal epithelial cell bacteria [167].
migration and proliferation and increased intesti-
nal crypt depth, ultimately improving the absorp- 10.1.4.3 Host Immune Responses in PMO
tive function of the intestinal epithelial barrier Are Regulated by Estrogen
[141]. Both LGG and L. plantarum can stimulate and the Intestinal Microbiota
the intestinal epithelium to produce physiological The immune system is the final barrier to intesti-
levels of reactive oxygen species (ROS), which nal pathogen invasion and is also a critical target
act as a second messenger to activate the for PMO treatment. APCs in the intestinal lamina
Erk/MAPK pathway and consequently lead to propria can be divided into dendritic cells (DCs)
344 X. Xu et al.
and macrophages [129]. Although all enhanced production of IFN-γ in turn improves
macrophages and DCs can induce Foxp3+ Treg the antigen-presenting ability of bone marrow
cell differentiation, macrophages with a higher T macrophages (BMM) by upregulating MHC II
cell/APC ratio are more efficient than DCs molecules [183–187]. In addition, estrogen defi-
[129]. By contrast, DCs only partially induce ciency upregulates co-stimulator CD80 to acti-
Th17 cell differentiation [129]. Treg cells are a vate bone marrow DCs [184]. Increased antigen
subset of immunocytes with inhibitory effects on presentation motivates CD4+ cells, including
the differentiation and function of Th1, Th2, and IL-17-producing Th17 cells, to mediate osteoclast
Th17 cells [130]. In addition, Treg cells can formation and bone resorption [130, 188]. In
inhibit osteoclast formation by cell-to-cell contact addition to antigen-dependent activation,
via the cytotoxic T lymphocyte antigen (CTLA-4) increased levels of IFN-γ and IL-7, in combina-
or by secreting anti-inflammatory cytokines such tion with low levels of TGF-β, indirectly activate
as IL-4, IL-10, and transforming growth factor-β T cells in bone marrow [130, 188, 189]. Activated
(TGF-β) [168–171]. Th17 cells, a subgroup of T T cells generate a considerable quantity of
cells, stimulate osteoclast formation and bone TNF-α, which acts as a key pathogenic factor in
resorption by producing high levels of IL-17, PMO development [131, 190–193]. TNF-α
RANKL, and TNF-α [172]. stimulates the production of RANKL and macro-
Both adequate estrogen levels and intestinal phage colony stimulatory factor (M-CSF); it also
microbial diversity are needed to maintain suppresses the production of osteoprotegerin
immune homeostasis (Fig. 10.5a). Clostridium (OPG) by inducing the expression of CD40L
improves the aggregation, quantity, and function and the bone mass regulatory factor DLK1/FA-1
of Treg cells to create an environment abundant in [130, 194, 195]. In addition, TNF-α acts either
TGF-β, which consequently prevents osteoclas- directly on osteoclast precursors to promote their
togenesis [139]. Estrogen protects bone by maturation [196] or indirectly on TNF-α receptor
downregulating immune responses and p55 to augment M-CSF- and RANKL-induced
modulating osteoblast/osteoclast equilibrium osteoclastogenesis [131]. Furthermore, estrogen
[173]. Estrogen not only activates the deficiency increases levels of Act1 adaptor pro-
apoptosis-promoting Fas/FasL pathway through tein on the surfaces of osteoblasts and subse-
direct interaction with osteoclasts [174–177] but quently activates the IL-17 signal pathway to
also indirectly increases TGF-β production by promote bone resorption [197, 198]. These
Treg cells and decreases the production of findings provide evidence that CD4+T cells
TNF-a and RANKL by Th17 cells, ultimately (including Th17 cells) and the pro-inflammatory
promoting osteoclast apoptosis [131, 168, 169, cytokine TNF-α are primary factors responsible
171, 178, 179]. Furthermore, estrogen exerts for bone loss mediated by intestinal bacteria
antiapoptotic effects on osteoblasts and in PMO.
osteocytes through the ERK pathway [177, 180]. When used for PMO treatment, probiotics
Estrogen deficiency and reduced intestinal also suppress bone resorption by regulating
biodiversity have negative effects on bone immune responses to intestinal microorganisms.
(Fig. 10.5b). Pathogenic antigens cross the intes- Probiotics secrete small molecules to regulate the
tinal epithelium and trigger inflammatory host immune response (Fig. 10.5c). Probiotics
immune responses that are mainly mediated by also produce SCFAs by utilizing prebiotics
T cells. Estrogen deficiency boosts the antigen [30, 34, 199, 200]. SCFA receptors contain
presentation of DCs and macrophages through GPR41 and GPR43, the latter of which is mainly
multiple pathways. Upon estrogen depletion, found in immunocytes such as neutrophils and
ROS excessively accumulate in bone marrow monocytes [201]. SCFAs, especially butyric
cells [181, 182]. ROS enhance the antigen- acid, interact with GPR43 to reduce levels of
presenting function of DCs, which further monocyte chemotactic protein-1 (MCP-1) and
activates CD4+T cells to produce IFN-γ. The LPS-induced cytokines such as TNF-α and
10
Intestinal Microbiota and Osteoporosis
Fig. 10.5 Host immune responses in PMO are regulated by estrogen and intestinal deficiency reduces osteoblast formation; the invasion of pathogens activates CD4+T
microbiota. Both beneficial gut bacteria and sufficient estrogen activate Tregs, which cells including TH17, which mainly produce TNF-α to promote osteoclastogenesis,
345
produce TGF-β to prevent osteoclastogenesis and induce osteoclast apoptosis; estrogen leading to bone loss and microstructural destruction (b). Probiotics can regulate
prompts osteoblast formation to improve bone mass and structure (a). Estrogen immune responses by secreting small molecules such as SCFAs and histamine (c)
346 X. Xu et al.
IFN-γ. They also upregulate the expression of The imbalance in calcium metabolism induced
TGF-β1, IL-4, and IL-10, ultimately activating by estrogen deficiency was also redressed by the
Treg cells [120, 201–205]. In addition, L. reuteri application of probiotics and prebiotics for the
transforms dietary L-histidine to histamine, which treatment of PMO [97]. Probiotic supplements
inhibits the MEK1/2-ERK1/2 pathway via H2 completely inhibited the increase in FECa due to
receptors and further inhibits TNF-α production estrogen deficiency in OVX rats [120]. Oligosac-
by monocytes [206]. Lactobacillus also impedes charides (NDO), dietary prebiotics such as
DC activation during inflammation and promotes fructooligosaccharides (FOS), galactooligosac-
Treg differentiation by inducing the expression of charides (GOS), and inulin, can significantly pro-
molecular ligands with inhibitory effects on per- mote intestinal calcium absorption and skeletal
tinent DNA motifs [207]. calcium retention in OVX rats, resulting in
suppressed bone loss [217, 218].
10.1.4.4 The Intestinal Microbiota
10.1.4.5 The Gut Microbiota Produces
and Estrogen Orchestrate
Estrogen-Like Metabolites
Calcium Absorption
with Regulatory Effects on Bone
As described above, both calcium content and
Metabolism
estrogen level are critical to bone metabolism. In
Estrogen plays a major role in promoting osteo-
postmenopausal-osteoporotic rats, combined
genesis. The role of estrogen is not limited to the
deficiencies of dietary calcium and estrogen had
direct suppression of osteoclast activity and
a more adverse effect on bone mass and micro-
lifespan, facilitation of osteoblast lifespan and
structure than either single deficiency, with more
differentiation, or reduction of mature osteoblasts
bone loss and more severely impaired bone
apoptosis to promote osteogenesis. It also inhibits
properties [88, 90, 208]. Additionally, calcium
the formation of both osteoblasts and osteoclasts
balance can be regulated by estrogen. Under nor-
from bone marrow precursors to prevent bone
mal conditions, estrogen treatment can increase
remodeling and regulate bone turnover
intestinal calcium absorption in rats
[69, 70]. In the absence of estrogen due to ovari-
[209]. Accumulating evidence suggests that
ectomy or post-menopause, estrogen-deficient
estrogen deficiency could induce impaired cal-
women exhibit accelerated bone loss and
cium absorption, which was improved by estro-
increased bone turnover as well as impaired
gen supplementation [210–212]. The potential
bone microarchitectural and mechanical
mechanisms of estrogen-associated regulation on
properties [49, 177, 219]. Hormone replacement
calcium absorption are still disputed. Estrogen
therapy (HRT), including supplementation with
may indirectly promote vitamin D receptor
estrogen and progesterone, has been applied to
(VDR) protein expression and enhance intestinal
postmenopausal women suffering from PMO and
mucosal responsiveness to 1,25-(OH)2D,
achieved favorable effects [220]. Instead of estro-
resulting in increased intestinal calcium absorp-
gen supplementation, the gut microbiota may act
tion [213, 214]. However, estrogen deficiency-
as another “endocrine organ” and potentiate novel
related calcium malabsorption may not depend
access to replenish estrogen by utilizing exoge-
on the serum 1,25-(OH)2D pathway. Estrogen
nous nutrients and producing more estrogenic
reversed the reduced calcium absorption by
substances.
directly interacting with estrogen receptor alpha
Phytoestrogens, which are predominantly
(ER-α) on the intestine, upregulating the calcium
present in natural foods such as soy, are exoge-
transport protein 1 (CaT 1) of the calcium influx
nous nutrients with structures and bioactivity sim-
channel without significantly altering serum 1,25-
ilar to human intrinsic estrogens. Various
(OH)2D level. [212, 215, 216] In addition, estro-
metabolites produced from phytoestrogens by
gen deficiency increased the urinary fractional
the gut microbiota, including equol, urolithins,
excretion of calcium (FECa) in OVX rats [120].
and enterolignans, are characterized by higher
bioavailability and respectively more estrogenic, for fecal samples in postmenopausal women with
antiestrogenic, and antioxidant bioactivities than dietary isoflavone uptake indicated obviously
their precursors in phytoestrogens, such as higher proportions of Eubacterium and
isoflavones, ellagitannins, and lignans Bifidobacterium in equol-producing subjects
[221]. Daidzein, the principle isoflavone in soy, than in equol non-producers [238]. Other studies
has two metabolic patterns including equol and identified other bacteria that significantly
O-desmethylangolensin (O-DMA) production increased in fecal samples of equol producers,
[222]. Equol shows much more estrogenic bioac- including Collinsella, Asaccharobacter, Dorea,
tivity or effects than O-DMA for bone metabo- and Finegoldia [234, 239]. In terms of function,
lism in PMO [223]. Equol, which is mostly sulfate-reducing bacteria were suggested to be
present as a glucuronide conjugate and binds to involved in equol production [235]. In addition
the estrogen receptor (ER), can suppress bone to specific gut bacteria, equol-producing capac-
resorption, promote bone formation, and improve ity may inversely correlate with O-DMA
bone biomechanical and microstructural production [235]. In addition, daidzein bioavail-
properties in subjects with PMO but has no ability and the equol/O-DMA production ratio
impacts on bone in healthy early postmenopausal could be elevated by the combined administra-
women [224–229]. The potential mechanism that tion of isoflavones and prebiotic oligosac-
involves equol may prevent osteoclast formation, charides or probiotic bacteria such as
stimulate the proliferation and differentiation of Lactobacillus casei [240–242]. However,
osteoblasts, and increase osteocalcin level by ER another study showed that the combination of
[223, 230]. Additionally, equol can inhibit the soy isoflavones and fructo-oligosaccharides had
expression of relevant inflammatory cytokines in no synergistic effects on bone mineral density or
bone marrow in a dose-dependent fashion due to bone mineral content but effectively improved
estrogen deficiency or LPS from intestinal bone microstructural properties, including
pathogens [231–233]. Although produced by gut trabecular number, thickness, and separation
microbiota, equol may modify gut microbiota [243]. Overall, the beneficial effects of phytoes-
diversity and composition in turn [231]. Isofla- trogen supplementation on PMO mainly depend
vone metabolism can promote the growth of on individual metabolisms involving both the
Clostridium clusters XIVa and IV and suppress appropriate gut microbiome and dietary
the genera Bacteroides and Parabacteroides composition [244].
[234]. Nevertheless, equol production from die-
tary phytoestrogens has significant interpersonal
variations, predominantly depending on gut 10.1.5 Conclusion
microbial composition and potential correlations
among the three groups of phytoestrogen metab- Bone resorption in PMO is the consequence of
olism as well as dietary components [77, 221, interactions among the estrogen level, the intesti-
235, 236]. At present, the key equol-producing nal microbiota, and the host immune system.
gut bacteria have not yet been identified. Most When estrogen levels are deficient, bacteria and
studies target potential equol-producing bacteria intestinal antigens cross the compromised intesti-
by cultivation or sequence analysis of fecal nal epithelium barrier and initiate the immune
samples. Two strains of Eubacterium sp. were responses associated with bone loss in PMO.
isolated and considered the most likely equol- Probiotics prevent bone resorption by restoring
producing bacteria from pig feces [237]. Another intestinal microbial diversity, enhancing the intes-
intestinal bacteria, Slackia TM-30, a rod-shaped tinal epithelial barrier, and normalizing aberrant
and gram-positive anaerobe isolated from healthy host immune responses, as well as facilitating
human feces, also proved to be highly related to intestinal calcium absorption and the potential
equol production [78]. The sequence information production of estrogen-like metabolites, as
348 X. Xu et al.
Table 10.1 Current probiotics with beneficial effects on estrogen deficiency-induced bone loss
Probiotics Research models Outcomes References
Lactobacillus spp.
L. rhamnosus C57Bl/6 OVX mice Attenuates intestinal and BM inflammation [49]
GG and completely inhibits bone loss
C57Bl/6 OVX mice Reduces TJ destruction and gut epithelial [49]
permeability
C57Bl/6 OVX mice Affects enterocyte proliferation and migration [165]
L. reuteri Balb/c OVX mice and healthy C57Bl/ Suppresses inflammation and bone loss in [118, 123,
6 male mice or intact female mice with OVX mice and increases bone parameters in 135, 206]
inflammation healthy male mice
Outbred CD1 neonatal mice Increases enterocyte migration, proliferation, [141]
and crypt height
Outbred CD1 neonatal mice or Balb/c Increases intestinal microbial diversity and [118, 141,
OVX mice evenness and inhibits growth of pathogens 142]
L. paracasei C57Bl/6 OVX mice Decreases inflammatory cytokines and bone [120]
loss
L. plantarum Murine and drosophila intestine or Induces enterocyte proliferation and [164, 166]
Caco-2 cell monolayers modulates cellular processes, e.g.,
metabolism, adhesion and apoptosis
Caco-2 cell monolayers Promotes production and rearrangement of TJ [159, 160]
proteins and enhances TJ integrity
Lactococcus SAMP6 mice Inhibits H2S-producing bacteria and [119, 143]
lactis Staphylococcus
Bifidobacterium spp.
B. longum OVX SD rat Reduces bone loss and enhances bone mineral [121]
density
B. infantis IL-10-deficient mice Induces rearrangement of TJ proteins and [161]
normalizes gut permeability
Mixture
L. paracasei C57Bl/6 OVX mice Decreases inflammatory cytokines and bone [120]
and loss
L. plantarum
VSL#3a C57Bl/6 OVX mice Attenuates intestinal and BM inflammation [49]
and completely inhibits bone loss
C57Bl/6 OVX mice or BALB/c mice Promotes expression and redistribution of TJ [49, 162]
in acute colitis model proteins and reduces intestinal epithelial
permeability
a
The mixture VSL#3 contains Bifidobacterium breve, Bifidobacterium longum, Bifidobacterium infantis, Lactobacillus
acidophilus, Lactobacillus plantarum, Lactobacillus paracasei, Lactobacillus bulgaricus, and Streptococcus
thermophiles
summarized in Table 10.1. Hence, the intestinal probiotics application in humans have been
microbiota serves as a key factor in the pathogen- demonstrated by clinical studies in specific
esis of PMO and will also serve as a new target in groups, such as in healthy infants [245], preterm
the treatment of PMO. infants, children with intractable diarrhea [246],
The application of probiotics may be a and children and adolescents undergoing HCT
promising adjuvant to current therapies. How- [247]. However, in patients with predicted severe
ever, current studies on probiotics for PMO treat- acute pancreatitis, significant increases in bowel
ment are limited to animal studies. The translation ischemia and mortality were related to probiotic
from animal studies to clinical application faces prophylaxis, as reported in the study by Besselink
many challenges, such as effective dosage and et al. [248] Hence, more studies are needed to
safety in humans. The safety and feasibility of validate the safety of probiotics and confirm the
optimal dosage and the proper time and method defects in the ovariectomized rat. Osteoporos Int.
of delivery for probiotics in the context of PMO 2014;25:1535–45.
10. Black DM, Rosen CJ. Clinical practice. Postmeno-
treatment. pausal osteoporosis. N Engl J Med.
2016;374:254–62.
Acknowledgments We thank Dr. Geelsu Hwang from 11. Deal C. Potential new drug targets for osteoporosis.
the University of Pennsylvania School of Dental Medicine Nat Clin Pract Rheumatol. 2009;5:20–7.
for critical advice on the manuscript. This work was 12. Sjogren K, Engdahl C, Henning P, et al. The gut
supported by the National Natural Science Foundation of microbiota regulates bone mass in mice. J Bone
China (grant numbers 81430011, 81470711, and Miner Res. 2012;27:1357–67.
81670978) and the Brilliant Young Investigator Award, 13. Blanton LV, Charbonneau MR, Salih T, et al. Gut
Sichuan University (grant number 2015SCU04A16). The bacteria that prevent growth impairments transmitted
content of this chapter was modified from a paper by microbiota from malnourished children. Science.
reported by our group in Bone Research (Xu X et al. 2016;351
2018). The related contents are reused with permission. 14. Yan J, Herzog JW, Tsang K, et al. Gut microbiota
induce IGF-1 and promote bone formation and
growth. Proc Natl Acad Sci USA. 2016;113:E7554–
Disclosures The authors declare no conflicts of interest. e7563.
15. Guss JD, Horsfield MW, Fontenele FF, et al.
Alterations to the gut microbiome impair bone
strength and tissue material properties. J Bone
References Miner Res. 2017;32:1343–53.
16. Qin J, Li R, Raes J, et al. A human gut microbial gene
1. Watts NB, Bilezikian JP, Camacho PM, et al. Ameri- catalogue established by metagenomic sequencing.
can Association of Clinical Endocrinologists medical Nature. 2010;464:59–65.
guidelines for clinical practice for the diagnosis and 17. Tojo R, Suarez A, Clemente MG, et al. Intestinal
treatment of postmenopausal osteoporosis. Endocr microbiota in health and disease: role of
Pract. 2010;16(Suppl 3):1–37. bifidobacteria in gut homeostasis. World J
2. Forsen L, Sogaard AJ, Meyer HE, Edna T, Kopjar Gastroenterol. 2014;20:15163–76.
B. Survival after hip fracture: short- and long-term 18. Org E, Parks BW, Joo JW, et al. Genetic and envi-
excess mortality according to age and gender. ronmental control of host–gut microbiota
Osteoporos Int. 1999;10:73–8. interactions. Genome Res. 2015;25:1558–69.
3. Orwig DL, Chan J, Magaziner J. Hip fracture and its 19. Kovacs A, Ben-Jacob N, Tayem H, Halperin E, Iraqi
consequences: differences between men and women. FA, Gophna U. Genotype is a stronger determinant
Orthop Clin North Am. 2006;37:611–22. than sex of the mouse gut microbiota. Microb Ecol.
4. Macari S, Duffles LF, Queiroz-Junior CM, et al. 2011;61:423–8.
Oestrogen regulates bone resorption and cytokine 20. Benson AK, Kelly SA, Legge R, et al. Individuality
production in the maxillae of female mice. Arch in gut microbiota composition is a complex polygenic
Oral Biol. 2015;60:333–41. trait shaped by multiple environmental and host
5. Esfahanian V, Shamami MS, Shamami genetic factors. Proc Natl Acad Sci U S
MS. Relationship between osteoporosis and peri- A. 2010;107:18933–8.
odontal disease: review of the literature. J Dent 21. Esworthy RS, Smith DD, Chu FF. A strong impact of
(Tehran). 2012;9:256–64. genetic background on gut microflora in mice. Int J
6. LaMonte MJ, Hovey KM, Genco RJ, Millen AE, Inflam. 2010;2010:986046.
Trevisan M, Wactawski-Wende J. Five-year changes 22. Goodrich JK, Waters JL, Poole AC, et al. Human
in periodontal disease measures among postmeno- genetics shape the gut microbiome. Cell.
pausal females: the Buffalo OsteoPerio study. J 2014;159:789–99.
Periodontol. 2013;84:572–84. 23. Turnbaugh PJ, Hamady M, Yatsunenko T, et al. A
7. Passos JS, Vianna MI, Gomes-Filho IS, et al. Osteo- core gut microbiome in obese and lean twins. Nature.
porosis/osteopenia as an independent factor 2009;457:480–4.
associated with periodontitis in postmenopausal 24. Zhao L, Wang G, Siegel P, et al. Quantitative genetic
women: a case-control study. Osteoporos Int. background of the host influences gut microbiomes in
2013;24:1275–83. chickens. Sci Rep. 2013;3:1163.
8. Calciolari E, Mardas N, Dereka X, Anagnostopoulos 25. Dabrowska K, Witkiewicz W. Correlations of Host
AK, Tsangaris GT, Donos N. The effect of experi- Genetics and Gut Microbiome Composition. Front
mental osteoporosis on bone regeneration: part 2, pro- Microbiol. 2016;7:1357.
teomics results. Clin Oral Implants Res. 2016; 26. Kashtanova DA, Popenko AS, Tkacheva ON, Tyakht
9. Durao SF, Gomes PS, Colaco BJ, et al. The AB, Alexeev DG, Boytsov SA. Association between
biomaterial-mediated healing of critical size bone
350 X. Xu et al.
the gut microbiota and diet: Fetal life, early child- 43. Unno T, Choi JH, Hur HG, et al. Changes in human
hood, and further life. Nutrition. 2016;32:620–7. gut microbiota influenced by probiotic fermented
27. Schmidt B, Mulder IE, Musk CC, et al. Establishment milk ingestion. J Dairy Sci. 2015;98:3568–76.
of normal gut microbiota is compromised under 44. Rampelli S, Candela M, Severgnini M, et al. A
excessive hygiene conditions. PLoS One. 2011;6: probiotics-containing biscuit modulates the intestinal
e28284. microbiota in the elderly. J Nutr Health Aging.
28. Panda S, El khader I, Casellas F, et al. Short-term 2013;17:166–72.
effect of antibiotics on human gut microbiota. PLoS 45. Ahmed M, Prasad J, Gill H, Stevenson L, Gopal
One. 2014;9:e95476. P. Impact of consumption of different levels of
29. Cho I, Yamanishi S, Cox L, et al. Antibiotics in early Bifidobacterium lactis HN019 on the intestinal
life alter the murine colonic microbiome and adipos- microflora of elderly human subjects. J Nutr Health
ity. Nature. 2012;488:621–6. Aging. 2007;11:26–31.
30. Gibson GR, Roberfroid MB. Dietary modulation of 46. Chen D, Yang Z, Chen X, et al. The effect of Lacto-
the human colonic microbiota: introducing the con- bacillus rhamnosus hsryfm 1301 on the intestinal
cept of prebiotics. J Nutr. 1995;125:1401–12. microbiota of a hyperlipidemic rat model. BMC
31. Shin JH, Sim M, Lee JY, Shin DM. Lifestyle and Complement Altern Med. 2014;14:386.
geographic insights into the distinct gut microbiota in 47. Lahti L, Salonen A, Kekkonen RA, et al.
elderly women from two different geographic Associations between the human intestinal
locations. J Physiol Anthropol. 2016;35:31. microbiota, Lactobacillus rhamnosus GG and serum
32. Fujisaka S, Ussar S, Clish C, et al. Antibiotic effects lipids indicated by integrated analysis of high-
on gut microbiota and metabolism are host depen- throughput profiling data. Peer J. 2013;1:e32.
dent. J Clin Invest. 2016;126:4430–43. 48. Charbonneau D, Gibb RD, Quigley EM. Fecal excre-
33. Leamy LJ, Kelly SA, Nietfeldt J, et al. Host genetics tion of Bifidobacterium infantis 35624 and changes
and diet, but not immunoglobulin A expression, con- in fecal microbiota after eight weeks of oral supple-
verge to shape compositional features of the gut mentation with encapsulated probiotic. Gut
microbiome in an advanced intercross population of Microbes. 2013;4:201–11.
mice. Genome Biol. 2014;15:552. 49. Li JY, Chassaing B, Tyagi AM, et al. Sex steroid
34. Sekhon BS, Jairath S. Prebiotics, probiotics and deficiency-associated bone loss is microbiota depen-
synbiotics: an overview. J Pharm Educ Res. dent and prevented by probiotics. J Clin Invest.
2010;1:13–36. 2016;126:2049–63.
35. Roberfroid MB. Prebiotics and probiotics: are they 50. Collins KH, Paul HA, Reimer RA, Seerattan RA,
functional foods? Am J Clin Nutr. 2000;71:1682S– Hart DA, Herzog W. Relationship between inflam-
7S. mation, the gut microbiota, and metabolic osteoar-
36. Salminen S, Bouley C, Boutron-Ruault MC, et al. thritis development: studies in a rat model.
Functional food science and gastrointestinal physiol- Osteoarthritis Cartilage. 2015;23:1989–98.
ogy and function. Br J Nutr. 1998;80(Suppl 1): 51. Cox LM, Yamanishi S, Sohn J, et al. Altering the
S147–71. intestinal microbiota during a critical developmental
37. Gupta V, Garg R. Probiotics. Indian J Med window has lasting metabolic consequences. Cell.
Microbiol. 2009;27:202–9. 2014;158:705–21.
38. Roberfroid MB. Prebiotics and synbiotics: concepts 52. Phillips FC, Gurung P, Kanneganti TD. Microbiota
and nutritional properties. Br J Nutr. 1998;80: and caspase-1/caspase-8 regulate IL-1beta-mediated
S197–202. bone disease. Gut Microbes. 2016;7:334–41.
39. Roberfroid M, Gibson GR, Hoyles L, et al. Prebiotic 53. Lukens JR, Gurung P, Vogel P, et al. Dietary modu-
effects: metabolic and health benefits. Br J Nutr. lation of the microbiome affects autoinflammatory
2010;104(Suppl 2):S1–63. disease. Nature. 2014;516:246–9.
40. Plaza-Diaz J, Fernandez-Caballero JA, Chueca N, 54. Crotti TN, Dharmapatni AA, Alias E, Haynes
et al. Pyrosequencing analysis reveals changes in DR. Osteoimmunology: major and costimulatory
intestinal microbiota of healthy adults who received pathway expression associated with chronic inflam-
a daily dose of immunomodulatory probiotic strains. matory induced bone loss. J Immunol Res.
Nutrients. 2015;7:3999–4015. 2015;2015:281–7.
41. Ferrario C, Taverniti V, Milani C, et al. Modulation 55. Zupan J, Jeras M, Marc J. Osteoimmunology and the
of fecal Clostridiales bacteria and butyrate by probi- influence of pro-inflammatory cytokines on
otic intervention with Lactobacillus paracasei DG osteoclasts. Biochem Med (Zagreb). 2013;23:43–63.
varies among healthy adults. J Nutr. 56. Kim N, Takami M, Rho J, Josien R, Choi Y. A novel
2014;144:1787–96. member of the leukocyte receptor complex regulates
42. Zhang J, Wang L, Guo Z, et al. 454 pyrosequencing osteoclast differentiation. J Exp Med.
reveals changes in the faecal microbiota of adults 2002;195:201–9.
consuming Lactobacillus casei Zhang. FEMS
Microbiol Ecol. 2014;88:612–22.
57. Geuking MB, Koller Y, Rupp S, McCoy KD. The 74. Battaglino R, Fu J, Spate U, et al. Serotonin regulates
interplay between the gut microbiota and the immune osteoclast differentiation through its transporter. J
system. Gut Microbes. 2014;5:411–8. Bone Miner Res. 2004;19:1420–31.
58. Peterson CT, Sharma V, Elmen L, Peterson 75. Neuman H, Debelius JW, Knight R, Koren
SN. Immune homeostasis, dysbiosis and therapeutic O. Microbial endocrinology: the interplay between
modulation of the gut microbiota. Clin Exp Immunol. the microbiota and the endocrine system. FEMS
2015;179:363–77. Microbiol Rev. 2015;39:509–21.
59. Palm NW, de Zoete MR, Flavell RA. Immune- 76. Sudo N. Microbiome, HPA axis and production of
microbiota interactions in health and disease. Clin endocrine hormones in the gut. Adv Exp Med Biol.
Immunol. 2015;159:122–7. 2014;817:177–94.
60. Ivanov II, Atarashi K, Manel N, et al. Induction of 77. Landete JM, Arques J, Medina M, Gaya P, de Las
intestinal Th17 cells by segmented filamentous bac- RB, Munoz R. Bioactivation of phytoestrogens:
teria. Cell. 2009;139:485–98. intestinal bacteria and health. Crit Rev Food Sci
61. Adamopoulos IE, Chao CC, Geissler R, et al. Nutr. 2016;56:1826–43.
Interleukin-17A upregulates receptor activator of 78. Tamura M, Hori S, Nakagawa H, Yamauchi S,
NF-kappaB on osteoclast precursors. Arthritis Res Sugahara T. Effects of an equol-producing bacterium
Ther. 2010;12:R29. isolated from human faeces on isoflavone and lignan
62. Duque G, Huang DC, Dion N, et al. Interferon- metabolism in mice. J Sci Food Agric.
gamma plays a role in bone formation in vivo and 2016;96:3126–32.
rescues osteoporosis in ovariectomized mice. J Bone 79. Bowey E, Adlercreutz H, Rowland I. Metabolism of
Miner Res. 2011;26:1472–83. isoflavones and lignans by the gut microflora: a study
63. Wang Y, Nishida S, Elalieh HZ, Long RK, Halloran in germ-free and human flora associated rats. Food
BP, Bikle DD. Role of IGF-I signaling in regulating Chem Toxicol. 2003;41:631–6.
osteoclastogenesis. J Bone Miner Res. 80. Cassidy A, Brown JE, Hawdon A, et al. Factors
2006;21:1350–8. affecting the bioavailability of soy isoflavones in
64. Wang Y, Bikle DD, Chang W. Autocrine and para- humans after ingestion of physiologically relevant
crine actions of IGF-I signaling in skeletal develop- levels from different soy foods. J Nutr.
ment. Bone Res. 2013;1:249–59. 2006;136:45–51.
65. Wang Y, Nishida S, Sakata T, et al. Insulin-like 81. Song KB, Atkinson C, Frankenfeld CL, et al. Preva-
growth factor-I is essential for embryonic bone devel- lence of daidzein-metabolizing phenotypes differs
opment. Endocrinology. 2006;147:4753–61. between Caucasian and Korean American women
66. Wu S, Yang W, De Luca F. Insulin-like growth and girls. J Nutr. 2006;136:1347–51.
factor-independent effects of growth hormone on 82. Van de Wiele T, Vanhaecke L, Boeckaert C, et al.
growth plate chondrogenesis and longitudinal bone Human colon microbiota transform polycyclic aro-
growth. Endocrinology. 2015;156:2541–51. matic hydrocarbons to estrogenic metabolites. Envi-
67. Giustina A, Mazziotti G, Canalis E. Growth hor- ron Health Perspect. 2005;113:6–10.
mone, insulin-like growth factors, and the skeleton. 83. Yano JM, Yu K, Donaldson GP, et al. Indigenous
Endocr Rev. 2008;29:535–59. bacteria from the gut microbiota regulate host seroto-
68. Leder B. Gonadal steroids and bone metabolism in nin biosynthesis. Cell. 2015;161:264–76.
men. Curr Opin Endocrinol Diabetes Obes. 84. Morris HA, O’Loughlin PD, Anderson
2007;14:241–6. PH. Experimental evidence for the effects of calcium
69. Imai Y, Youn MY, Kondoh S, et al. Estrogens main- and vitamin D on bone: a review. Nutrients.
tain bone mass by regulating expression of genes 2010;2:1026–35.
controlling function and life span in mature 85. Zhu K, Prince RL. Calcium and bone. Clin Biochem.
osteoclasts. Ann NY Acad Sci. 2009;1173(Suppl 1): 2012;45:936–42.
E31–9. 86. Wastney ME, Martin BR, Peacock M, et al. Changes
70. Syed F, Khosla S. Mechanisms of sex steroid effects in calcium kinetics in adolescent girls induced by
on bone. Biochem Biophys Res Commun. high calcium intake. J Clin Endocrinol Metab.
2005;328:688–96. 2000;85:4470–5.
71. Bliziotes M. Update in serotonin and bone. J Clin 87. Redmond J, Jarjou LM, Zhou B, Prentice A,
Endocrinol Metab. 2010;95:4124–32. Schoenmakers I. Ethnic differences in calcium, phos-
72. Wang Q, Chen D, Nicholson P, et al. The phate and bone metabolism. Proc Nutr Soc.
associations of serum serotonin with bone traits are 2014;73:340–51.
age- and gender-specific. PLoS One. 2014;9: 88. Hodgkinson A, Aaron JE, Horsman A, McLachlan
e109028. MS, Nrodin BE. Effect of oophorectomy and calcium
73. Gustafsson BI, Thommesen L, Stunes AK, et al. deprivation on bone mass in the rat. Clin Sci Mol
Serotonin and fluoxetine modulate bone cell function Med. 1978;54:439–46.
in vitro. J Cell Biochem. 2006;98:139–51. 89. Hara T, Sato T, Oka M, Mori S, Shirai H. Effects of
ovariectomy and/or dietary calcium deficiency on
352 X. Xu et al.
bone dynamics in the rat hard palate, mandible and 104. Teramoto F, Rokutan K, Sugano Y, et al. Long-term
proximal tibia. Arch Oral Biol. 2001;46:443–51. administration of 4G-beta-D-galactosylsucrose
90. Shen V, Birchman R, Xu R, Lindsay R, Dempster (lactosucrose) enhances intestinal calcium absorption
DW. Short-term changes in histomorphometric and in young women: a randomized, placebo-controlled
biochemical turnover markers and bone mineral den- 96-wk study. J Nutr Sci Vitaminol (Tokyo).
sity in estrogen-and/or dietary calcium-deficient rats. 2006;52:337–46.
Bone. 1995;16:149–56. 105. Fukushima A, Aizaki Y, Sakuma K. Short-chain fatty
91. Goto S, Fujita Y, Hotta M, Sugiyama A, Maki acids induce intestinal transient receptor potential
K. Influence of differences in the hardness and cal- vanilloid type 6 expression in rats and Caco-2 cells.
cium content of diets on the growth of craniofacial J Nutr. 2009;139:20–5.
bone in rats. Angle Orthod. 2015;85:969–79. 106. Fukushima A, Aizaki Y, Sakuma K. Short-chain fatty
92. Fleet JC, Schoch RD. Molecular mechanisms for acids increase the level of calbindin-D9k messenger
regulation of intestinal calcium absorption by vitamin RNA in Caco-2 cells. J Nutr Sci Vitaminol (Tokyo).
D and other factors. Crit Rev Clin Lab Sci. 2012;58:287–91.
2010;47:181–95. 107. Fukushima A, Ohta A, Sakai K, Sakuma
93. Hoenderop JG, Nilius B, Bindels RJ. Calcium K. Expression of calbindin-D9k, VDR and Cdx-2
absorption across epithelia. Physiol Rev. messenger RNA in the process by which fructooligo-
2005;85:373–422. saccharides increase calcium absorption in rats. J
94. Alexander RT, Rievaj J, Dimke H. Paracellular cal- Nutr Sci Vitaminol (Tokyo). 2005;51:426–32.
cium transport across renal and intestinal epithelia. 108. Ohta A, Motohashi Y, Ohtsuki M, Hirayama M,
Biochem Cell Biol. 2014;92:467–80. Adachi T, Sakuma K. Dietary fructooligosaccharides
95. Kuwabara A, Tanaka K. The role of gastro-intestinal change the concentration of calbindin-D9k differ-
tract in the calcium absorption. Clin Calcium. ently in the mucosa of the small and large intestine
2015;25:1607–12. of rats. J Nutr. 1998;128:934–9.
96. Sheikh MS, Schiller LR, Fordtran JS. In vivo intesti- 109. Takasaki M, Inaba H, Ohta A, et al. Dietary short-
nal absorption of calcium in humans. Miner Electro- chain fructooligosaccharides increase calbindin-D9k
lyte Metab. 1990;16:130–46. levels only in the large intestine in rats independent of
97. Scholz-Ahrens KE, Ade P, Marten B, et al. dietary calcium deficiency or serum 1,25 dihydroxy
Prebiotics, probiotics, and synbiotics affect mineral vitamin D levels. Int J Vitam Nutr Res.
absorption, bone mineral content, and bone structure. 2000;70:206–13.
J Nutr. 2007;137:838s–46s. 110. Domon-Dell C, Wang Q, Kim S, Kedinger M, Evers
98. Gilman J, Cashman KD. The effect of probiotic bac- BM, Freund JN. Stimulation of the intestinal Cdx2
teria on transepithelial calcium transport and calcium homeobox gene by butyrate in colon cancer cells.
uptake in human intestinal-like Caco-2 cells. Curr Gut. 2002;50:525–9.
Issues Intest Microbiol. 2006;7:1–5. 111. Leonhard-Marek S, Becker G, Breves G, Schroder
99. Kruger MC, Brown KE, Collett G, Layton L, B. Chloride, gluconate, sulfate, and short-chain fatty
Schollum LM. The effect of fructooligosaccharides acids affect calcium flux rates across the sheep
with various degrees of polymerization on calcium forestomach epithelium. J Dairy Sci.
bioavailability in the growing rat. Exp Biol Med 2007;90:1516–26.
(Maywood). 2003;228:683–8. 112. Uppal SK, Wolf K, Martens H. The effect of short
100. Nzeusseu A, Dienst D, Haufroid V, Depresseux G, chain fatty acids on calcium flux rates across isolated
Devogelaer JP, Manicourt DH. Inulin and fructo- rumen epithelium of hay-fed and concentrate-fed
oligosaccharides differ in their ability to enhance the sheep. J Anim Physiol Anim Nutr (Berl).
density of cancellous and cortical bone in the axial 2003;87:12–20.
and peripheral skeleton of growing rats. Bone. 113. Weaver CM. Diet, gut microbiome, and bone health.
2006;38:394–9. Curr Osteoporos Rep. 2015;13:125–30.
101. Coudray C, Tressol JC, Gueux E, Rayssiguier 114. Thompson DD, Simmons HA, Pirie CM, Ke
Y. Effects of inulin-type fructans of different chain HZ. FDA Guidelines and animal models for osteopo-
length and type of branching on intestinal absorption rosis. Bone. 1995;17:125s–33s.
and balance of calcium and magnesium in rats. Eur J 115. Kurabayashi T, Fujimaki T, Yasuda M,
Nutr. 2003;42:91–8. Yamamoto Y, Tanaka K. Time-course of vertebral
102. Demigne C, Jacobs H, Moundras C, et al. Compari- and femoral bone loss in rats administered
son of native or reformulated chicory fructans, or gonadotrophin-releasing hormone agonist. J
non-purified chicory, on rat cecal fermentation and Endocrinol. 1993;138:115–25.
mineral metabolism. Eur J Nutr. 2008;47:366–74. 116. Wang Y, Yano T, Kikuchi A, et al. Comparison of
103. Whisner CM, Martin BR, Schoterman MH, et al. the effects of add-back therapy with various natural
Galacto-oligosaccharides increase calcium absorp- oestrogens on bone metabolism in rats administered a
tion and gut bifidobacteria in young girls: a double- long-acting gonadotrophin-releasing hormone ago-
blind cross-over trial. Br J Nutr. 2013;110:1292–303. nist. J Endocrinol. 2000;165:467–73.
117. Boyd SK, Davison P, Muller R, Gasser 130. Pacifici R. Role of T cells in ovariectomy induced
JA. Monitoring individual morphological changes bone loss--revisited. J Bone Miner Res.
over time in ovariectomized rats by in vivo micro- 2012;27:231–9.
computed tomography. Bone. 2006;39:854–62. 131. Cenci S, Weitzmann MN, Roggia C, et al. Estrogen
118. Britton RA, Irwin R, Quach D, et al. Probiotic deficiency induces bone loss by enhancing T-cell
L. reuteri treatment prevents bone loss in a meno- production of TNF-alpha. J Clin Invest.
pausal ovariectomized mouse model. J Cell Physiol. 2000;106:1229–37.
2014;229:1822–30. 132. Alaish SM, Smith AD, Timmons J, et al. Gut
119. Kimoto-Nira H, Mizumachi K, Okamoto T, Sasaki K, microbiota, tight junction protein expression, intesti-
Kurisaki J-I. Influence of long-term consumption of a nal resistance, bacterial translocation and mortality
Lactococcus lactis strain on the intestinal immunity following cholestasis depend on the genetic back-
and intestinal flora of the senescence-accelerated ground of the host. Gut Microbes. 2013;4:292–305.
mouse. Br J Nutr. 2009;102:181–5. 133. Davenport ER, Cusanovich DA, Michelini K,
120. Ohlsson C, Engdahl C, Fåk F, et al. Probiotics protect Barreiro LB, Ober C, Gilad Y. Genome-wide associ-
mice from ovariectomy-induced cortical bone loss. ation studies of the human gut microbiota. PLoS One.
PLoS ONE. 2014;9:1–8. 2015;10:e0140301.
121. Parvaneh K, Ebrahimi M, Sabran MR, et al. 134. Wu HJ, Wu E. The role of gut microbiota in immune
Probiotics (Bifidobacterium longum) increase bone homeostasis and autoimmunity. Gut Microbes.
mass density and upregulate sparc and Bmp-2 genes 2012;3:4–14.
in rats with bone loss resulting from ovariectomy. 135. Collins FL, Irwin R, Bierhalter H, et al. Lactobacillus
Biomed Res Int. 2015;2015:897639. reuteri 6475 increases bone density in intact females
122. Klinck J, Boyd SK. The magnitude and rate of bone only under an inflammatory setting. PLoS ONE.
loss in ovariectomized mice differs among inbred 2016;11:1–17.
strains as determined by longitudinal in vivo micro- 136. Fuhrman BJ, Feigelson HS, Flores R, et al.
computed tomography. Calcif Tissue Int. Associations of the fecal microbiome with urinary
2008;83:70–9. estrogens and estrogen metabolites in postmeno-
123. McCabe LR, Irwin R, Schaefer L, Britton pausal women. J Clin Endocrinol Metab.
RA. Probiotic use decreases intestinal inflammation 2014;99:4632–40.
and increases bone density in healthy male but not 137. Flores R, Shi J, Fuhrman B, et al. Fecal microbial
female mice. J Cell Physiol. 2013;228:1793–8. determinants of fecal and systemic estrogens and
124. Bouxsein ML, Myers KS, Shultz KL, Donahue LR, estrogen metabolites: a cross-sectional study. J Transl
Rosen CJ, Beamer WG. Ovariectomy-induced bone Med. 2012;10:253.
loss varies among inbred strains of mice. J Bone 138. Breban M. Gut microbiota and inflammatory joint
Miner Res. 2005;20:1085–92. diseases. Joint Bone Spine. 2016;83:645–9.
125. Chiang S-S, Pan T-M. Antiosteoporotic effects of 139. Atarashi K, Tanoue T, Shima T, et al. Induction of
lactobacillus-fermented soy skim milk on bone min- colonic regulatory T cells by indigenous Clostridium
eral density and the microstructure of femoral bone in species. Science. 2011;331:337–41.
ovariectomized mice. J Agric Food Chem. 140. Nagano Y, Itoh K, Honda K. The induction of Treg
2011;59:7734–42. cells by gut-indigenous Clostridium. Curr Opin
126. Li CY, Schaffler MB, Wolde-Semait HT, Hernandez Immunol. 2012;24:392–7.
CJ, Jepsen KJ. Genetic background influences corti- 141. Preidis GA, Saulnier DM, Blutt SE, et al. Probiotics
cal bone response to ovariectomy. J Bone Miner Res. stimulate enterocyte migration and microbial diver-
2005;20:2150–8. sity in the neonatal mouse intestine. FASEB
127. Iwaniec UT, Yuan D, Power RA, Wronski TJ. Strain- J. 2012;26:1960–9.
dependent variations in the response of cancellous 142. Schaefer L, Auchtung TA, Hermans KE,
bone to ovariectomy in mice. J Bone Miner Res. Whitehead D, Borhan B, Britton RA. The antimicro-
2006;21:1068–74. bial compound reuterin (3-hydroxypropionaldehyde)
128. Legette LL, Lee W-H, Martin BR, et al. Genistein, a induces oxidative stress via interaction with thiol
phytoestrogen, improves total cholesterol, and Syn- groups. Microbiology. 2010;156:1589–99.
ergy, a prebiotic, improves calcium utilization, but 143. Kimoto-Nira H, Suzuki C, Kobayashi M, Sasaki K,
there were no synergistic effects. Menopause. Kurisaki J-I, Mizumachi K. Anti-ageing effect of a
2011;18:923–31. lactococcal strain: analysis using senescence-
129. Denning TL, Norris BA, Medina-Contreras O, et al. accelerated mice. Br J Nutr. 2007;98:1178–86.
Functional specializations of intestinal dendritic cell 144. Gonzalez-Mariscal L, Tapia R, Chamorro
and macrophage subsets that control Th17 and regu- D. Crosstalk of tight junction components with sig-
latory T cell responses are dependent on the T cell/ naling pathways. Biochim Biophys Acta.
APC ratio, source of mouse strain, and regional local- 1778;2008:729–56.
ization. J Immunol. 2011;187:733–47. 145. Muto S, Furuse M, Kusano E. Claudins and renal salt
transport. Clin Exp Nephrol. 2012;16:61–7.
354 X. Xu et al.
146. Muto S, Hata M, Taniguchi J, et al. Claudin-2-defi- response to immune mediators. Gastroenterology.
cient mice are defective in the leaky and cation- 2000;118:1001–11.
selective paracellular permeability properties of 159. Anderson RC, Cookson AL, McNabb WC, et al.
renal proximal tubules. Proc Natl Acad Sci U S Lactobacillus plantarum MB452 enhances the func-
A. 2010;107:8011–6. tion of the intestinal barrier by increasing the expres-
147. Yu AS, Enck AH, Lencer WI, Schneeberger sion levels of genes involved in tight junction
EE. Claudin-8 expression in Madin-Darby canine formation. BMC Microbiol. 2010;10:316.
kidney cells augments the paracellular barrier to cat- 160. Qin H, Zhang Z, Hang X, Jiang Y. L. plantarum
ion permeation. J Biol Chem. 2003;278:17350–9. prevents enteroinvasive Escherichia coli-induced
148. Angelow S, Kim KJ, Yu AS. Claudin-8 modulates tight junction proteins changes in intestinal epithelial
paracellular permeability to acidic and basic ions in cells. BMC Microbiol. 2009;9:63.
MDCK II cells. J Physiol. 2006;571:15–26. 161. Ewaschuk JB, Diaz H, Meddings L, et al. Secreted
149. Balda MS, Whitney JA, Flores C, Gonzalez S, bioactive factors from Bifidobacterium infantis
Cereijido M, Matter K. Functional dissociation of enhance epithelial cell barrier function. Am J Physiol
paracellular permeability and transepithelial electrical Gastrointest Liver Physiol. 2008;295:G1025–34.
resistance and disruption of the apical-basolateral 162. Mennigen R, Nolte K, Rijcken E, et al. Probiotic
intramembrane diffusion barrier by expression of a mixture VSL#3 protects the epithelial barrier by
mutant tight junction membrane protein. J Cell Biol. maintaining tight junction protein expression and
1996;134:1031–49. preventing apoptosis in a murine model of colitis.
150. Ulluwishewa D, Anderson RC, McNabb WC, Am J Physiol Gastrointest Liver Physiol. 2009;296:
Moughan PJ, Wells JM, Roy NC. Regulation of G1140–9.
tight junction permeability by intestinal bacteria and 163. Peng L, Li ZR, Green RS, Holzman IR, Lin
dietary components. J Nutr. 2011;141:769–76. J. Butyrate enhances the intestinal barrier by
151. van der Helm MW, Odijk M, Frimat JP, et al. Direct facilitating tight junction assembly via activation of
quantification of transendothelial electrical resistance AMP-activated protein kinase in Caco-2 cell
in organs-on-chips. Biosens Bioelectron. monolayers. J Nutr. 2009;139:1619–25.
2016;85:924–9. 164. Panigrahi P, Braileanu GT, Chen H, Stine
152. Srinivasan B, Kolli AR, Esch MB, Abaci HE, Shuler OC. Probiotic bacteria change Escherichia coli-
ML, Hickman JJ. TEER measurement techniques for induced gene expression in cultured colonocytes:
in vitro barrier model systems. J Lab Autom. Implications in intestinal pathophysiology. World J
2015;20:107–26. Gastroenterol. 2007;13:6370–8.
153. Sumanasekera WK, Zhao L, Ivanova M, et al. Effect 165. Ardita CS, Mercante JW, Kwon YM, et al. Epithelial
of estradiol and dihydrotestosterone on hypergravity- adhesion mediated by pilin SpaC is required for Lac-
induced MAPK signaling and occludin expression in tobacillus rhamnosus GG-induced cellular responses.
human umbilical vein endothelial cells. Cell Tissue Appl Environ Microbiol. 2014;80:5068–77.
Res. 2006;324:243–53. 166. Jones RM, Luo L, Ardita CS, et al. Symbiotic
154. Sumanasekera WK, Sumanasekera GU, Mattingly lactobacilli stimulate gut epithelial proliferation via
KA, Dougherty SM, Keynton RS, Klinge Nox-mediated generation of reactive oxygen species.
CM. Estradiol and dihydrotestosterone regulate endo- EMBO J. 2013;32:3017–28.
thelial cell barrier function after hypergravity- 167. Han C, Ding Z, Shi H, Qian W, Hou X, Lin R. The
induced alterations in MAPK activity. Am J Physiol Role of Probiotics in Lipopolysaccharide-Induced
Cell Physiol. 2007;293:C566–73. Autophagy in Intestinal Epithelial Cells. Cell Physiol
155. Ye L, Martin TA, Parr C, Harrison GM, Mansel RE, Biochem. 2016;38:2464–78.
Jiang WG. Biphasic effects of 17-beta-estradiol on 168. Kim YG, Lee CK, Nah SS, Mun SH, Yoo B, Moon
expression of occludin and transendothelial resis- HB. Human CD4+CD25+ regulatory T cells inhibit
tance and paracellular permeability in human vascu- the differentiation of osteoclasts from peripheral
lar endothelial cells. J Cell Physiol. 2003;196:362–9. blood mononuclear cells. Biochem Biophys Res
156. Hass MA, Nichol P, Lee L, Levin RM. Estrogen Commun. 2007;357:1046–52.
modulates permeability and prostaglandin levels in 169. Zaiss MM, Axmann R, Zwerina J, et al. Treg cells
the rabbit urinary bladder. Prostaglandins Leukot suppress osteoclast formation: a new link between the
Essent Fatty Acids. 2009;80:125–9. immune system and bone. Arthritis Rheum.
157. Patrick DM, Leone AK, Shellenberger JJ, Dudowicz 2007;56:4104–12.
KA, King JM. Proinflammatory cytokines tumor 170. Yuan FL, Li X, Lu WG, et al. Regulatory T cells as a
necrosis factor-alpha and interferon-gamma modulate potent target for controlling bone loss. Biochem
epithelial barrier function in Madin-Darby canine Biophys Res Commun. 2010;402:173–6.
kidney cells through mitogen activated protein kinase 171. Luo CY, Wang L, Sun C, Li DJ. Estrogen enhances
signaling. BMC Physiol. 2006;6:2. the functions of CD4(+)CD25(+)Foxp3(+) regulatory
158. Kinugasa T, Sakaguchi T, Gu X, Reinecker T cells that suppress osteoclast differentiation and
HC. Claudins regulate the intestinal barrier in
bone resorption in vitro. Cell Mol Immunol. 187. Gao Y, Grassi F, Ryan MR, et al. IFN-gamma
2011;8:50–8. stimulates osteoclast formation and bone loss
172. Sato K, Suematsu A, Okamoto K, et al. Th17 in vivo via antigen-driven T cell activation. J Clin
functions as an osteoclastogenic helper T cell subset Invest. 2007;117:122–32.
that links T cell activation and bone destruction. J 188. Ryan MR, Shepherd R, Leavey JK, et al. An IL-7-
Exp Med. 2006;203:2673–82. dependent rebound in thymic T cell output
173. Carlsten H. Immune responses and bone loss: the contributes to the bone loss induced by estrogen
estrogen connection. Immunological Reviews. deficiency. Proc Natl Acad Sci U S
2005;208:194–206. A. 2005;102:16735–40.
174. Nakamura T, Imai Y, Matsumoto T, et al. Estrogen 189. Yang NN, Venugopalan M, Hardikar S, Glasebrook
prevents bone loss via estrogen receptor alpha and A. Identification of an estrogen response element
induction of Fas ligand in osteoclasts. Cell. activated by metabolites of 17beta-estradiol and ral-
2007;130:811–23. oxifene. Science. 1996;273:1222–5.
175. Krum SA, Miranda-Carboni GA, Hauschka PV, et al. 190. Adeel S, Singh K, Vydareny KH, et al. Bone loss in
Estrogen protects bone by inducing Fas ligand in surgically ovariectomized premenopausal women is
osteoblasts to regulate osteoclast survival. EMBO associated with T lymphocyte activation and thymic
J. 2008;27:535–45. hypertrophy. J Investig Med. 2013;61:1178–83.
176. Martin-Millan M, Almeida M, Ambrogini E, et al. 191. Ammann P, Rizzoli R, Bonjour JP, et al. Transgenic
The estrogen receptor-alpha in osteoclasts mediates mice expressing soluble tumor necrosis factor-
the protective effects of estrogens on cancellous but receptor are protected against bone loss caused by
not cortical bone. Mol Endocrinol. 2010;24:323–34. estrogen deficiency. J Clin Invest.
177. Manolagas SC, Kousteni S, Jilka RL. Sex steroids 1997;99:1699–703.
and bone. Recent Prog Horm Res. 2002;57:385–409. 192. Charatcharoenwitthaya N, Khosla S, Atkinson EJ,
178. Hughes DE, Dai A, Tiffee JC, Li HH, Mundy GR, McCready LK, Riggs BL. Effect of blockade of
Boyce BF. Estrogen promotes apoptosis of murine TNF-alpha and interleukin-1 action on bone resorp-
osteoclasts mediated by TGF-beta. Nat Med. tion in early postmenopausal women. J Bone Miner
1996;2:1132–6. Res. 2007;22:724–9.
179. Lelu K, Laffont S, Delpy L, et al. Estrogen receptor 193. D’Amelio P, Grimaldi A, Di Bella S, et al. Estrogen
alpha signaling in T lymphocytes is required for deficiency increases osteoclastogenesis up-regulating
estradiol-mediated inhibition of Th1 and Th17 cell T cells activity: a key mechanism in osteoporosis.
differentiation and protection against experimental Bone. 2008;43:92–100.
autoimmune encephalomyelitis. J Immunol. 194. Sherman ML, Weber BL, Datta R, Kufe
2011;187:2386–93. DW. Transcriptional and posttranscriptional regula-
180. Chen JR, Plotkin LI, Aguirre JI, et al. Transient tion of macrophage-specific colony stimulating factor
versus sustained phosphorylation and nuclear accu- gene expression by tumor necrosis factor. Involve-
mulation of ERKs underlie anti-versus pro-apoptotic ment of arachidonic acid metabolites. J Clin Invest.
effects of estrogens. J Biol Chem. 2005;280:4632–8. 1990;85:442–7.
181. Wood ZA, Poole LB, Karplus PA. Peroxiredoxin 195. Hofbauer LC, Lacey DL, Dunstan CR, Spelsberg TC,
evolution and the regulation of hydrogen peroxide Riggs BL, Khosla S. Interleukin-1beta and tumor
signaling. Science. 2003;300:650–3. necrosis factor-alpha, but not interleukin-6, stimulate
182. Ozaki M, Suzuki S, Irani K. Redox factor-1/APE osteoprotegerin ligand gene expression in human
suppresses oxidative stress by inhibiting the rac1 osteoblastic cells. Bone. 1999;25:255–9.
GTPase. FASEB J. 2002;16:889–90. 196. Lam J, Takeshita S, Barker JE, Kanagawa O, Ross
183. Kantengwa S, Jornot L, Devenoges C, Nicod FP, Teitelbaum SL. TNF-alpha induces osteoclas-
LP. Superoxide anions induce the maturation of togenesis by direct stimulation of macrophages
human dendritic cells. Am J Respir Crit Care Med. exposed to permissive levels of RANK ligand. J
2003;167:431–7. Clin Invest. 2000;106:1481–8.
184. Grassi F, Tell G, Robbie-Ryan M, et al. Oxidative 197. Molnar I, Bohaty I, Somogyine-Vari E. IL-17A-
stress causes bone loss in estrogen-deficient mice mediated sRANK ligand elevation involved in post-
through enhanced bone marrow dendritic cell activa- menopausal osteoporosis. Osteoporos Int.
tion. Proc Natl Acad Sci U S A. 2007;104:15087–92. 2014;25:783–6.
185. Lean JM, Davies JT, Fuller K, et al. A crucial role for 198. Molnar I, Bohaty I, Somogyine-Vari E. High preva-
thiol antioxidants in estrogen-deficiency bone loss. J lence of increased interleukin-17A serum levels in
Clin Invest. 2003;112:915–23. postmenopausal estrogen deficiency. Menopause.
186. Cenci S, Toraldo G, Weitzmann MN, et al. Estrogen 2014;21:749–52.
deficiency induces bone loss by increasing T cell 199. Roberfroid MB, Delzenne NM. Dietary fructans.
proliferation and lifespan through IFN-gamma- Annu Rev Nutr. 1998;18:117–43.
induced class II transactivator. Proc Natl Acad Sci
U S A. 2003;100:10405–10.
356 X. Xu et al.
200. Roberfroid MB, Van Loo JA, Gibson GR. The 215. Ten Bolscher M, Netelenbos JC, Barto R, Van
bifidogenic nature of chicory inulin and its hydrolysis Buuren LM, Van der vijgh WJ. Estrogen regulation
products. J Nutr. 1998;128:11–9. of intestinal calcium absorption in the intact and
201. Cox MA, Jackson J, Stanton M, et al. Short-chain ovariectomized adult rat. J Bone Miner Res.
fatty acids act as antiinflammatory mediators by 1999;14:1197–202.
regulating prostaglandin E(2) and cytokines. World 216. Van Cromphaut SJ, Rummens K, Stockmans I, et al.
J Gastroenterol. 2009;15:5549–57. Intestinal calcium transporter genes are upregulated
202. Asarat M, Apostolopoulos V, Vasiljevic T, Donkor by estrogens and the reproductive cycle through vita-
O. Short-chain fatty acids produced by synbiotic min D receptor-independent mechanisms. J Bone
mixtures in skim milk differentially regulate prolifer- Miner Res. 2003;18:1725–36.
ation and cytokine production in peripheral blood 217. Chonan O, Matsumoto K, Watanuki M. Effect of
mononuclear cells. Int J Food Sci Nutr. galactooligosaccharides on calcium absorption and
2015;66:755–65. preventing bone loss in ovariectomized rats. Biosci
203. Asarat M, Apostolopoulos V, Vasiljevic T, Donkor Biotechnol Biochem. 1995;59:236–9.
O. Short-chain fatty acids regulate cytokines and 218. Zafar TA, Weaver CM, Zhao Y, Martin BR, Wastney
Th17/Treg cells in human peripheral blood mononu- ME. Nondigestible oligosaccharides increase calcium
clear cells in vitro. Immunol Invest. 2016;45:205–22. absorption and suppress bone resorption in ovariec-
204. Kwon HK, Lee CG, So JS, et al. Generation of tomized rats. J Nutr. 2004;134:399–402.
regulatory dendritic cells and CD4+Foxp3+ T cells 219. Brennan O, Kuliwaba JS, Lee TC, et al. Temporal
by probiotics administration suppresses immune changes in bone composition, architecture, and
disorders. Proc Natl Acad Sci U S strength following estrogen deficiency in osteoporo-
A. 2010;107:2159–64. sis. Calcif Tissue Int. 2012;91:440–9.
205. Lavasani S, Dzhambazov B, Nouri M, et al. A novel 220. Gambacciani M, Levancini M. Management of post-
probiotic mixture exerts a therapeutic effect on exper- menopausal osteoporosis and the prevention of
imental autoimmune encephalomyelitis mediated by fractures. Panminerva Med. 2014;56:115–31.
IL-10 producing regulatory T cells. PLoS One. 221. Gaya P, Medina M, Sanchez-Jimenez A, Landete
2010;5:e9009. JM. Phytoestrogen metabolism by adult human gut
206. Thomas CM, Hong T, van Pijkeren JP, et al. Hista- microbiota. Molecules. 2016;21
mine derived from probiotic Lactobacillus reuteri 222. Uehara M. Isoflavone metabolism and bone-sparing
suppresses TNF via modulation of PKA and ERK effects of daidzein-metabolites. J Clin Biochem Nutr.
signaling. PLoS One. 2012;7:e31951. 2013;52:193–201.
207. Bouladoux N, Hall JA, Grainger JR, et al. Regulatory 223. Ohtomo T, Uehara M, Penalvo JL, et al. Comparative
role of suppressive motifs from commensal DNA. activities of daidzein metabolites, equol and
Mucosal Immunol. 2012;5:623–34. O-desmethylangolensin, on bone mineral density
208. Agata U, Park JH, Hattori S, et al. The effect of and lipid metabolism in ovariectomized mice and in
different amounts of calcium intake on bone metabo- osteoclast cell cultures. Eur J Nutr. 2008;47:273–9.
lism and arterial calcification in ovariectomized rats. J 224. Ishimi Y. Dietary equol and bone metabolism in
Nutr Sci Vitaminol (Tokyo). 2013;59:29–36. postmenopausal Japanese women and osteoporotic
209. Arjmandi BH, Hollis BW, Kalu DN. In vivo effect of mice. J Nutr. 2010;140:1373s–6s.
17 beta-estradiol on intestinal calcium absorption in 225. Tezval M, Sehmisch S, Seidlova-Wuttke D, et al.
rats. Bone Miner. 1994;26:181–9. Changes in the histomorphometric and biomechani-
210. Gallagher JC, Riggs BL, DeLuca HF. Effect of estro- cal properties of the proximal femur of ovariecto-
gen on calcium absorption and serum vitamin D mized rat after treatment with the phytoestrogens
metabolites in postmenopausal osteoporosis. J Clin genistein and equol. Planta Med. 2010;76:235–40.
Endocrinol Metab. 1980;51:1359–64. 226. Legette LL, Prasain J, King J, Arabshahi A, Barnes S,
211. Kalu DN, Chen C. Ovariectomized murine model of Weaver CM. Pharmacokinetics of equol, a soy isofla-
postmenopausal calcium malabsorption. J Bone vone metabolite, changes with the form of equol
Miner Res. 1999;14:593–601. (dietary versus intestinal production) in ovariecto-
212. O’Loughlin PD, Morris HA. Oestrogen deficiency mized rats. J Agric Food Chem. 2014;62:1294–300.
impairs intestinal calcium absorption in the rat. J 227. Tousen Y, Ezaki J, Fujii Y, Ueno T, Nishimuta M,
Physiol. 1998;511(Pt 1):313–22. Ishimi Y. Natural S-equol decreases bone resorption
213. Schwartz B, Smirnoff P, Shany S, Liel Y. Estrogen in postmenopausal, non-equol-producing Japanese
controls expression and bioresponse of 1,25- women: a pilot randomized, placebo-controlled trial.
dihydroxyvitamin D receptors in the rat colon. Mol Menopause. 2011;18:563–74.
Cell Biochem. 2000;203:87–93. 228. Brink E, Coxam V, Robins S, Wahala K, Cassidy A,
214. Liel Y, Shany S, Smirnoff P, Schwartz B. Estrogen Branca F. Long-term consumption of isoflavone-
increases 1,25-dihydroxyvitamin D receptors expres- enriched foods does not affect bone mineral density,
sion and bioresponse in the rat duodenal mucosa. bone metabolism, or hormonal status in early post-
Endocrinology. 1999;140:280–5. menopausal women: a randomized, double-blind,
placebo controlled study. Am J Clin Nutr. 239. Decroos K, Vanhemmens S, Cattoir S, Boon N,
2008;87:761–70. Verstraete W. Isolation and characterisation of an
229. Fujioka M, Uehara M, Wu J, et al. Equol, a metabo- equol-producing mixed microbial culture from a
lite of daidzein, inhibits bone loss in ovariectomized human faecal sample and its activity under gastroin-
mice. J Nutr. 2004;134:2623–7. testinal conditions. Arch Microbiol. 2005;183:45–55.
230. Wang J, Xu J, Wang B, Shu FR, Chen K, Mi 240. Fujii S, Takahashi N, Inoue H, et al. A combination
MT. Equol promotes rat osteoblast proliferation and of soy isoflavones and cello-oligosaccharides
differentiation through activating estrogen receptor. changes equol/O-desmethylangolensin production
Genet Mol Res. 2014;13:5055–63. ratio and attenuates bone fragility in ovariectomized
231. Tousen Y, Matsumoto Y, Matsumoto C, et al. The mice. Biosci Biotechnol Biochem. 2016;80:1632–5.
combined effects of soya isoflavones and resistant 241. Ohta A, Uehara M, Sakai K, et al. A combination of
starch on equol production and trabecular bone loss dietary fructooligosaccharides and isoflavone
in ovariectomised mice. Br J Nutr. 2016;116:247–57. conjugates increases femoral bone mineral density
232. Nishide Y, Tadaishi M, Kobori M, et al. Possible role and equol production in ovariectomized mice. J
of S-equol on bone loss via amelioration of inflam- Nutr. 2002;132:2048–54.
matory indices in ovariectomized mice. J Clin 242. Mathey J, Mardon J, Fokialakis N, et al. Modulation
Biochem Nutr. 2013;53:41–8. of soy isoflavones bioavailability and subsequent
233. Kang JS, Yoon YD, Han MH, et al. Estrogen effects on bone health in ovariectomized rats: the
receptor-independent inhibition of tumor necrosis case for equol. Osteoporos Int. 2007;18:671–9.
factor-alpha gene expression by phytoestrogen 243. Devareddy L, Khalil DA, Korlagunta K,
equol is mediated by blocking nuclear factor-kappaB Hooshmand S, Bellmer DD, Arjmandi BH. The
activation in mouse macrophages. Biochem effects of fructo-oligosaccharides in combination
Pharmacol. 2005;71:136–43. with soy protein on bone in osteopenic ovariecto-
234. Guadamuro L, Dohrmann AB, Tebbe CC, Mayo B, mized rats. Menopause. 2006;13:692–9.
Delgado S. Bacterial communities and metabolic 244. Wu J, Oka J, Ezaki J, et al. Possible role of equol
activity of faecal cultures from equol producer and status in the effects of isoflavone on bone and fat
non-producer menopausal women under treatment mass in postmenopausal Japanese women: a double-
with soy isoflavones. BMC Microbiol. 2017;17:93. blind, randomized, controlled trial. Menopause.
235. Possemiers S, Bolca S, Eeckhaut E, Depypere H, 2007;14:866–74.
Verstraete W. Metabolism of isoflavones, lignans 245. Hoy-Schulz YE, Jannat K, Roberts T, et al. Safety
and prenylflavonoids by intestinal bacteria: producer and acceptability of Lactobacillus reuteri DSM 17938
phenotyping and relation with intestinal community. and Bifidobacterium longum subspecies infantis
FEMS Microbiol Ecol. 2007;61:372–83. 35624 in Bangladeshi infants: a phase I randomized
236. Bolca S, Wyns C, Possemiers S, et al. Cosupple- clinical trial. BMC Complement Altern Med.
mentation of isoflavones, prenylflavonoids, and 2016;16:44.
lignans alters human exposure to phytoestrogen- 246. Kitajima H, Hirano S. Safety of Bifidobacterium
derived 17beta-estradiol equivalents. J Nutr. breve (BBG-01) in preterm infants. Pediatr Int.
2009;139:2293–300. 2016;59:328–33.
237. Yu ZT, Yao W, Zhu WY. Isolation and identification 247. Ladas EJ, Bhatia M, Chen L, et al. The safety and
of equol-producing bacterial strains from cultures of feasibility of probiotics in children and adolescents
pig faeces. FEMS Microbiol Lett. 2008;282:73–80. undergoing hematopoietic cell transplantation. Bone
238. Nakatsu CH, Armstrong A, Clavijo AP, Martin BR, Marrow Transplant. 2016;51:262–6.
Barnes S, Weaver CM. Fecal bacterial community 248. Besselink MG, van Santvoort HC, Buskens E, et al.
changes associated with isoflavone metabolites in Probiotic prophylaxis in predicted severe acute pan-
postmenopausal women after soy bar consumption. creatitis: a randomised, double-blind, placebo-con-
PLoS One. 2014;9:e108924. trolled trial. Lancet. 2008;371:651–9.
Index
A Dilution, 38–40, 68, 294, 295

Acellular microorganisms, 1, 3 DNA, 3, 10, 13, 16–19, 21, 22, 65, 73, 74, 76, 79, 82, 85,
Actinomyces, 28, 54, 74, 81 87, 90, 97–99, 107, 108, 112, 139, 146, 149, 154,
Adhesion, 12, 71–73, 171, 178, 207, 288, 326, 343 159, 161, 168, 193, 205, 240, 256, 260, 296, 311,
Aggregatibacter, 186, 227, 321, 326 328
Aspergillus, 282, 317, 319, 325, 326, 328
E
B Eikenella, 29, 168
Bacilli, 4, 15, 16, 36, 40, 81, 82, 88, 93, 97, 107, 146, 153, Elizabethkingia, 263
154, 156, 167, 182, 291, 302 Enterococcus, 146, 306
Bacterial capsule stain, 28–32 Escherichia, 4, 8, 11, 17, 20, 23, 224, 266, 309, 334
Bacteriophages, 4, 6, 18 Eubacterium, 146, 149, 347
Bacteroides, 154, 156, 159, 160, 168, 190, 201, 304, 321, Eukaryote, 1
326, 327, 335, 341, 347
Bifidobacterium, 88 F
Binary fission, 15, 16 Flagellar stain, 32–33
Biofilm, 64, 67, 71–72, 76, 136, 186, 235, 288, 325–327 Flagellum, 6, 11, 12, 25, 32, 37, 256, 267, 296, 326
Fluctuation test, 19, 20
C Fungal Structures Stain, 32–35
Campylobacter, 12, 32, 50, 177, 266 Fusobacterium, 54, 164, 172, 303, 306, 309
Candida, 33–35, 56, 63, 238, 243, 272, 276, 278, 280,
316, 319, 323, 325–328 G
Capnocytophaga, 55, 62, 159, 161, 165, 321, 326 Giemsa stain, 33, 37, 207, 236
Capsule, 6, 10, 22, 25, 28, 31, 32, 37, 98, 188, 217, 220, Gram-negative, 6, 7, 9, 12, 21, 27, 29, 39, 40, 50, 51, 72,
227, 228, 230, 263, 283, 295 83, 108, 110, 134, 138, 139, 153–155, 217,
Cell membrane, 3, 6, 7, 9, 11, 236, 238 224–236, 256, 267, 295, 343
Cell wall, 6–7, 9–11, 13, 16, 26, 82, 100, 111, 120, 175, Gram-positive, 6, 8, 12, 13, 16, 17, 21, 27, 28, 50, 51, 72,
202, 207, 211, 235, 238, 256 81, 138, 141, 146, 173, 211–225, 230, 238, 253,
Chromosome, 2, 12, 18, 19, 21, 276 337, 347
Chryseobacterium, 257 Gram stain, 6, 9, 25–27, 32, 33, 43, 72, 83, 86, 88, 91, 94,
Cocci, 4, 15, 50, 51, 111, 112, 115, 126, 128, 139, 146, 96, 99, 105, 109, 112, 114, 117, 121, 129, 134,
153, 182, 212, 230, 253 141, 149, 151, 154, 157, 163, 166, 172, 176, 181,
Collection, 37–39, 68, 294, 295, 310, 328, 334 184, 187, 190, 193, 198, 214, 220, 226, 228, 231,
Colony forming units, 41, 68–70 233, 236, 240, 254, 256, 263, 268, 270, 272
Confocal laser scanning microscopy (CLSM), 57, 64, 66, Growth curves, 15, 66–68
72, 291
Conjugation, 10, 19–23 H
Corynebacterium, 108, 110, 153, 256 Haemophilus, 19, 171, 186, 227, 303
Cytoplasm, 2, 6, 7, 9, 32, 238, 342 Helicobacter, 176, 177
Heredity, 10, 13, 15, 17
D
Decline phase, 15, 66 I
Dental plaque, 38, 54, 64, 71, 82, 99, 101, 112, 119, 140, Identification, 25, 26, 32, 37–47, 78, 185, 220, 276, 280,
153, 172, 186, 217, 227 292, 295, 296

https://doi.org/10.1007/978-981-15-7899-1
360 Index
Incubation, 20, 37–47, 68, 71, 82, 108, 124, 192, 199, 211, R
238, 276, 295 Replica plating, 19, 21
Inoculation, 67, 68, 153, 294, 295 RNA, 3, 9, 13, 17, 65
Intestinal microbiota, 306, 308, 309, 333–349 Rothia, 61
Isolation, 37–47, 119, 235, 253, 256, 257
S
K Saccharomyces, 236–249, 326
Klebsiella, 263 Sanger sequencing, 73, 77–79
Scanning electron microscopy (SEM), 2, 17, 47, 60–63,
L 65, 72, 75, 115, 118, 122, 125, 129, 134, 139, 141,
Lactobacillus, 61, 98, 306, 327, 335, 336, 338, 339, 146, 147, 150, 152, 155, 157, 159, 162, 164, 166,
346–348 169, 173, 177, 182, 184, 187, 191, 194, 196, 198,
Lag phase, 15, 66 200, 203, 206, 207, 209, 212, 217, 219, 221, 223,
Leptotrichia, 134, 140 226, 228, 231, 233, 238, 239, 254, 257, 259, 261,
Leuconostoc, 253 264, 268, 270, 273, 275, 277, 279, 282, 284
Lichen planus, 293, 316–330 Spirochete, 4, 18, 25, 31, 36, 39, 72, 205, 209, 295
Logarithmic phase, 15, 66 Spores, 4–6, 13, 14, 25, 27–28, 30, 32, 82, 83, 92, 98, 106,
107, 128, 136, 146, 154, 155, 158, 159, 167, 168,
M 170, 172, 188, 201, 205, 206, 227, 228, 231, 238,
Moraxella, 230, 306 247, 263, 267, 282, 285, 295, 296
Mycobiome, 293, 316–330 Staining bacterial spores stain, 27–30
Mycoplasma, 3, 18, 26, 29, 33, 72, 235–237 Staphylococcus, 4, 7, 21, 38, 45, 111, 341
Stationary phase, 15, 66
N Stenotrophomonas, 256
Negative Congo red stain, 33–37 Stereomicroscopy, 47–57
Neisseria, 230 Streptococcus, 6, 17, 19, 21, 22, 29, 50, 51, 56, 59, 67, 76,
Next-generation sequencing (NGS), 74, 316 112, 146, 214–225, 288, 291, 303, 306, 309, 316,
Nuclear material, 6, 10 322, 348
Subgingival, 37, 38, 41, 58, 70, 88, 111, 146
O Supragingival, 81–142, 186
Oral microbiome, 72–79, 288, 289, 294, 316, 325, Suspension, 32, 38–39, 71, 310
327
Osteoporosis, 334–347 T
Transduction, 10, 19, 21, 23
P Transformation, 19, 309, 316
Peptidoglycan, 6, 7, 26, 111, 120, 202, 207 Transmission electron microscopy (TEM), 53–65, 290, 291
Peptostreptococcus, 149 Transportation, 37–38, 68, 337
Pilus, 6, 12, 21 Treponema, 42, 205, 208, 295, 321
Porphyromonas, 29, 39, 46, 51, 62, 154, 201, 205, 289,
303, 306, 309, 310, 317, 323, 327 V
Prevotella, 39, 55, 154, 190, 327 Variations, 13, 15, 16, 19, 73, 282, 325, 347
Prokaryote, 1, 15 Veillonella, 139, 272, 303, 321
Propionibacterium, 153 Vibrio, 4, 12
Protozoan Smears, 37 Virus, 3, 4, 13, 18, 72, 240–250

Oral Microbiology Book

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Oral Microbiology Book

Uploaded by

Copyright:

Available Formats

Xuedong

ISBN 978-981-15-7898-4 ISBN 978-981-15-7899-1 (eBook)

Jointly published with Zhejiang University Press

# Zhejiang University Press 2020

The human body is home to a diverse range of microorganisms, including a

Chengdu, Sichuan, China Xuedong Zhou

1 Basic Biology of Oral Microbes . . . . . . . . . . . . . . . . . . . . . . . 1

10 Intestinal Microbiota and Osteoporosis . . . . . . . . . . . . . . . . . 333

Xian Peng State Key Laboratory of Oral Diseases, National Clinical

Lei Cheng State Key Laboratory of Oral Diseases, National Clinical

Qiang Guo State Key Laboratory of Oral Diseases, National Clinical

Yuqing Li State Key Laboratory of Oral Diseases, National Clinical

Jian Xu Single-Cell Center, CAS Key Laboratory of Biofuels and Shandong

Jizhong Zhou Institute for Environmental Genomics, Department of

Abstract morphology, microbial cell structure, micro-

# Zhejiang University Press 2020 1

Fig. 1.1 Eukaryotic

Fig. 1.2 Prokaryotic

Fig. 1.3 Prokaryotic

Fig. 1.4 Acellular

Fig. 1.5 Microbial size

1.2.1 Microbial Size structure of microbes, as it provides us with a

Fig. 1.6 Basic shape of

Fig. 1.7 Fungal spores

Fig. 1.8 Fungal hyphae

rabies virus), brick-shaped (e.g., poxvirus), 1.3.1.1 Cell Wall

Fig. 1.10 Schematic representation of bacterial cell structure

Fig. 1.11 Schematic

Streptococcus, protein A of Staphylococcus physical, chemical, or biological factors. When

Fig. 1.12 Schematic

Fig. 1.15 Capsule of

independently of chromosomal DNA and trans- 1.3.2 Special Bacterial Structures

Fig. 1.17 Examples of

Fig. 1.18 Periplasmic

Fig. 1.19 Schematic

Fig. 1.20 Spore stain of

Fig. 1.21 Size,

collected information, it is possible to generate a

1. Lag phase: During this process, the bacteria

Fig. 1.23 Binary ﬁssion in

information can be stored and transformed into a

Variation refers to the differences between off-

Fig. 1.25 Division of

Fig. 1.26 The growth

Fig. 1.27 The processes of

Fig. 1.28 DNA mutation

sequence. These changes are stable and heritable.

1.5.5 Gene Transfer

Gene transfer is a process by which exogenous

Fig. 1.30 Lysogenic and

Fig. 1.36 Generalized

Fig. 1.37 Restricted mode

6. Morse ML, Lederberg EM, Lederberg J. Transduction

Abstract stain techniques, isolation, incubation and

# Zhejiang University Press 2020 25

Fig. 2.1 Procedure of smear test

2.1.1 Kopeloff’s Modification of Gram relatively fewer lipids. Thus, Gram-positive

Add 5–10 g basic fuchsin to 100 ml 95% 2.1.1.4 Reporting Results

1. Add crystal violet Liquid A onto the ﬁxed

Fig. 2.3 Gram-positive

Fig. 2.4 Gram-positive

Fig. 2.5 Gram-negative

Fig. 2.6 Gram-negative

Fig. 2.7 Bacillus subtilis