Deciphering The Diversity and History of New Worldnightjars (Aves Caprimulgidae) Usingmolecular Phylogenetics

bs_bs_banner
Zoological Journal of the Linnean Society, 2014, 170, 506–545. With 8 figures
Deciphering the diversity and history of New World

nightjars (Aves: Caprimulgidae) using
molecular phylogenetics
SNORRI SIGURÐSSON1,2* and JOEL CRACRAFT1
1
Department of Ornithology, American Museum of Natural History, Central Park West at 79th
Street, New York, NY 10024, USA
2
The Graduate Center, City University of New York, 365 Fifth Avenue, New York, NY 10016, USA
Received 24 April 2013; revised 8 August 2013; accepted for publication 23 October 2013
We present a new molecular phylogeny of the three main radiations of nightjars (Caprimulgidae), restricted to
the New World. Both mitochondrial and nuclear markers were sampled, and ancient DNA from museum skin
specimens was an important source of sequence data for many taxa. Intraspecific diversity is high in the nightjars,
with many traditionally defined species further divided into subspecies. By dense sampling at the species and
subspecies level, we were able to investigate the molecular diversity among the majority of recognized subspecies.
This resulted in the identification of new phylogenetic species in addition to finding molecular support for recent
taxonomic modifications such as the division of the Whip-poor-will (Antrostomus vociferus Wilson, 1812) into two
species. Other species that we suggest should be split into two or more phylogenetic species include Caprimulgus
longirostris Bonaparte, 1825, Chordeiles acutipennis (Hermann, 1783), Nyctidromus albicollis (Gmelin, 1789), and
Nyctiprogne leucopyga (Spix, 1825). We also propose substantial modifications to the generic structure within the
family, with some genera being enlarged (including Hydropsalis, Nyctidromus, and Nyctiprogne), whereas others
are discontinued (including Eleothreptus and Uropsalis). All New World species of Caprimulgus are moved into
other genera. The resulting phylogeny provides the most up-to-date and complete taxonomic review for the New
World diversity of the family.
© 2014 The Linnean Society of London, Zoological Journal of the Linnean Society, 2014, 170, 506–545.
doi: 10.1111/zoj.12109
ADDITIONAL KEYWORDS: avian phylogenetics – Caprimulgiformes – Caprimulgus – Hydropsalis – new

species – nighthawk – Nyctidromus – Nyctiprogne – poorwill – taxonomy.
INTRODUCTION there has been great progress in the field, some

important clades have undeniably received less focus
Avian systematics has undergone a revolution in the
than others, and among those are the nightjars
last couple of decades with the greatly increased use
(Caprimulgidae). Nightjars are biologically important
of genetic data for phylogenetics. The taxonomy of
for several reasons. They are a cosmopolitan group
most avian taxa, from species to higher groups, has
found on all continents, except Antarctica, and have a
been in a process of re-evaluation, with the result that
relatively high species diversity for a non-passerine
major changes have been made to traditional classi-
family, with 89 or 90 biological species recognized
fications. Classical ideas about relationships among
(Cleere & Nurney, 1998; Cleere, 1999; Holyoak, 2001;
many higher taxa, as well as about their true species
Dickinson et al., 2003). The highest species diversity
diversity, have been drastically challenged. Although
is in South America and Africa, but radiations extend
into North America, South and Southeast Asia, and
*Corresponding author. E-mail: snorri.sigurdsson@ Australia, with two species breeding in Europe and
reykjavik.is two species on Madagascar (Cleere & Nurney, 1998).
506 © 2014 The Linnean Society of London, Zoological Journal of the Linnean Society, 2014, 170, 506–545
PHYLOGENY OF NEW WORLD NIGHTJARS 507
Systematic analyses are greatly needed for the support for a monophyletic Caprimulgidae and for
Caprimulgidae, inasmuch as an accurate understand- five major lineages within the family. Eurostopodus
ing of their current diversity is lacking. Intraspecific was found to be sister to all remaining capri-
diversity is high within the family, with 47 species mulgids. Three New World clades were resolved
being divided into two or more subspecies, and with as paraphyletic, with the nighthawks (Chordeiles
some species divided into as many as ten subspecies Swainson, 1832 and Podager Wagler, 1832) being
(Holyoak, 2001; Dickinson et al., 2003; Cleere, 1999; the sister group to an Old World radiation. They
Cleere, 2010). Recently, suggestions have been made suggested that their results indicate a Neotropi-
to elevate some subspecies to full species status on cal origin for the family, excluding Eurostopodus.
morphological and behavioural differences (Cleere, The only genus with multiple species sampled was
2010; Chesser et al., 2012), but genetic data are also Caprimulgus Linnaeus, 1758, which was clearly not
needed to evaluate the taxonomic status of nearly all monophyletic and was divided into three unrelated
named taxa. groups. Another important result was that the tradi-
Phylogenetic studies of the caprimulgids have tional division of the family into the Chordeilinae and
mostly focused on their relationship with the other the Caprimulginae, which were previously erected on
caprimulgiform families (Aegothelidae, Apodiidae, morphological data (mainly skull characters), was not
Hemiprocnididae, Trochilidae, Nyctibiidae, Podargi- recovered by the RAG-1 data (Barrowclough et al.,
dae, and Steatornithidae). The systematics of the 2006).
caprimulgiform families have long been in flux, with Larsen et al. (2007) analysed partial sequences of
the three families previously placed in the order CYTB from 21 caprimulgid species in eight genera,
Apodiformes, now being placed within Caprimulgi- including three subspecies of Caprimulgus europaeus
formes based on the results of both morphological Linnaeus, 1758. Their small data set did not support
(Mayr, 2002, 2010) and molecular phylogenetic studies a monophyletic Caprimulgidae when Eurostopodus
(Cracraft et al., 2004; Ericson et al., 2006; Hackett was included, but there was also no strong support
et al., 2008; Braun & Huddleston, 2009). Some authors for Eurostopodus being more closely related to other
prefer retaining the order Apodiformes and elevating caprimulgiforms. Corroborating the results of
all other caprimulgiform families to the ordinal level Barrowclough et al. (2006), Larsen et al. (2007) found
(Yuri et al., 2013). evidence for geographically structured clades, includ-
Morphological evidence strongly suggests that the ing an Old World clade and three or four New World
potoos (Nyctibiidae) are the sister group to nightjars clades, but relationships among them were not
(Mayr, 2002, 2010; Livezey & Zusi, 2006, 2007), resolved. Their results also failed to support the split
but results from molecular data are inconsistent, into the two subfamilies (Larsen et al., 2007). The
and usually lack strong resolution (Cracraft et al., small character sampling raises questions about the
2004; Ericson et al., 2006; Hackett et al., 2008; validity of their results.
Braun & Huddleston, 2009). The monophyly of the By far the most extensive analysis of the capri-
Caprimulgidae has not been questioned, with one mulgids in terms of taxon sampling is that of Han,
notable exception as described below (Mariaux & Robbins & Braun (2010). A total of 66 specimens
Braun, 1996). of 55 species were sampled from 14 of the 16 recog-
There are few generic-level phylogenetic studies nized genera. Both mitochondrial (CYTB) and nuclear
within caprimulgids and analyses of species or sub- markers (C-MYC and GH) were amplified and
species are practically non-existent. Previously pub- sequenced, with the final alignment of all genes
lished studies vary greatly in their taxon sampling. being 4226 bp. Both the nuclear markers and
Mariaux & Braun (1996) included five caprimulgid the concatenated data set supported a monophyletic
species in their phylogeny of the order based on Caprimulgidae. The most basal lineages consisted of
656 bp of cytochrome b (CYTB) sequence data. Their the four species of Eurostopodus and the Malagasy
results were rather unusual, with the Aegothelidae Caprimulgus enarratus G.R. Gray, 1871, and the
embedded within the Caprimulgidae, splitting the authors placed the latter in a new genus Gactornis
genus Eurostopodus Gould, 1838, from the remaining Han, Robbins & Braun, 2010. The remaining
caprimulgids. This phylogenetic pattern was not well caprimulgids formed a well-supported core clade that
supported, has not been corroborated by other analy- was further divided into four major groups with clear
ses, and is likely to be an artifact of poor character geographic patterns. There was an Old World clade
and taxon sampling (Mariaux & Braun, 1996). containing species of Caprimulgus (including the
Barrowclough, Groth & Mertz (2006) included 21 type species C. europaeus) as well as Macrodipteryx
species (14 genera) of caprimulgids in a nuclear exon Swainson, 1837. The three New World lineages com-
recombination activating gene 1 (RAG-1) phylogeny prised a clade of seven genera of primarily South
of the Caprimulgiformes. Their results exhibited good American species (including species of ‘Caprimulgus’),
© 2014 The Linnean Society of London, Zoological Journal of the Linnean Society, 2014, 170, 506–545
508 S. SIGURÐSSON AND J. CRACRAFT
a nighthawk clade (Chordeiles with the monotypic MATERIAL AND METHODS

Podager embedded inside it), and a mostly North and TAXON SAMPLING
Central American clade of four genera (again with
species of ‘Caprimulgus’). The relationships among Dickinson et al. (2003) recognized 89 species of capri-
these four core clades differed across individual mulgids in the Howard & Moore checklist, of which
gene trees and concatenated trees. As with previous 44 are from the New World. Twenty-five of those
studies, the monophyly of neither the Caprimulginae New World species contain two or more subspecies,
nor the Chordeilinae was supported (Han et al., giving a total of 101 subspecies. Adding the 19
2010). monotypic species yields 120 named taxa in the New
These previous studies provide a good frame- World (Dickinson et al., 2003). Of the 44 traditionally
work for further analyses of relationships within the defined species, 41 were sampled in this study. Of the
family. Despite a significant increase in taxon sam- 101 subspecies, 78 were sampled in this study. Three
pling in the study of Han et al. (2010), compared with species were not sampled because of a lack of speci-
previous work, it was far from complete at the species men availability: ‘Caprimulgus’ maculosus (Todd,
level. A total of 34 recognized species were not 1920) (the cayenne nightjar), known only from the
sampled in that study: 24 from the Old World and ten unique holotype from French Guiana; Antrostomus
from the New World (based on the species tally noctitherus (Wetmore, 1919) (the Puerto Rican night-
in Holyoak, 2001). Two subspecies of Antrostomus jar), a very rare and endangered species found in
(= ‘Caprimulgus’) vociferus (Wilson, 1812) and two south-western Puerto Rico; and Siphonorhis ameri-
subspecies of Lurocalis semitorquatus (Gmelin, 1789) cana (Linnaeus, 1758) (the Jamaican poorwill), an
were included in the study of Han et al. (2010), and extremely rare species from Jamaica, last collected in
three subspecies of Caprimulgus europaeus were 1859, that is presumed to be near extinction if not
included in Larsen et al.’s (2007) study, but there extinct.
was no further sampling of subspecies or any dense The samples included fresh tissue from museum
intraspecific sampling (such as from multiple local- collections as well as toe-pads from museum skins
ities in species with large ranges). Moreover, usually when fresh tissues were not available. The taxonomic
only one individual of each species was used for the coverage at the subspecies level is therefore about
phylogenetic analyses. 77%, which is the densest sampling of New World
This study presents a molecular phylogeny of the nightjars in any phylogenetic study of the group.
nightjars, with an emphasis on the New World taxa. A number of Old World nightjars were also sam-
The Old World taxa are principally members of a pled. Nightjars of the genus Eurostopodus (eared
single radiation, with the exception of the most basal nightjars) are considered to be basal within capri-
lineages of the family (Eurostopodus, Lyncornis, and mulgids; however, previous research suggests that
Gactornis). The focus of this article is therefore on the genus is paraphyletic with respect to the remain-
the members of the three well-defined New World ing nightjar taxa (Han et al., 2010). Of the seven
clades found in the studies of Barrowclough et al. traditionally recognized species of Eurostopodus,
(2006) and Han et al. (2010). The major goals of the five were sampled in this study, with Eurostopodus
current study are to: (1) re-examine relationships at diabolicus Stresemann, 1931 (Heinrich’s nightjar)
the genus/species level within the four core clades of and Eurostopodus papuensis (Schlegel, 1866) (the
the family, concentrating particularly on relationships Papuan nightjar) not included. Cleere (2010) recog-
among the species within the three New World clades; nized nine species of eared nightjars. He placed two
(2) employ genetic evidence to re-evaluate the species of them, Eurostopodus macrotis (Vigors, 1831) and
status of some of the New World taxa, in particular Eurostopodus temminckii (Gould, 1838), in a separate
investigate the status of subspecies that have been genus, Lyncornis, and this placement is used in this
suspected to be true species (such as ‘Caprimulgus’ study. A thorough study of the eared nightjars incor-
parvulus heterurus and ‘Caprimulgus’ longirostris porating molecular data is needed. The basal collared
decussatus (Cleere, 2010); and (3) use these results to nightjar (Gactornis enarratus G.R. Gray, 1871) from
address the current taxonomy and nomenclature of Madagascar was sampled in this study, as were ten
both genera and species within the New World night- Old World species that belong to the strictly Old
jars, and propose modifications where necessary. World monophyletic clade (Barrowclough et al., 2006;
Many New World species have been placed in the Han et al., 2010). As the goal of this study was to
genus Caprimulgus, but as noted above, previous specifically investigate the relationships among the
studies have demonstrated its non-monophyly. There- New World taxa, no more Old World taxa were
fore, for clarity, we identify New World species in sampled. Finally, to root the whole nightjar tree,
which the taxonomic status has not been officially a number of species from closely related families
changed as ‘Caprimulgus’. were included: the swift Apus affinis Gray, 1830; the
tree-swift Hemiprocne mystacea Lesson, 1827; the in length. The single codon deletion at positions 1135–
hummingbirds Colibri coruscans (Gould, 1846) and 1137 seen in Nyctidromus albicollis (J.F. Gmelin,
Phaethornis griseogularis Gould, 1851; and finally the 1789) and Gactornis enarratus in the study of Han
frogmouth Podargus strigoides (Latham, 1801). et al. (2010) was not encountered in the sequences
Of the 96 species/subspecies sampled in this study, produced in our study. Additionally, 27 sequences
57 were available as fresh tissue specimens (as well produced by the studies of Han et al. (2010) and
as all three out-group taxa), whereas 39 were only Larsen et al. (2007) were downloaded from GenBank.
available as museum skins, some as old as from the Among those were two taxa, Eleothreptus candicans
late 1800s. Two monotypic species were added by and Antrostomus salvini, not sequenced in this study.
using CYTB sequences downloaded from GenBank, Thus, CYTB is the only marker sampled for these two
including Eleothreptus candicans (Pelzeln, 1867) and taxa. A total of 85 CYTB sequences, including out-
Antrostomus salvini Hartert, 1892. When available, groups, were analysed in this study.
more than one specimen was sampled for a given Intron 9 of ACO1 was sequenced for 109 individuals
taxon, especially if the taxon had a wide distribution. from fresh tissue, plus a partial sequence was suc-
In those cases, specimens from different parts of their cessfully obtained from a museum skin specimen
range were chosen if possible. Along with the 16 Old of Antrostomus ridgwayi Nelson, 1897, using the
World taxa and non-caprimulgid out-group taxa, the same protocol as for the fresh tissue specimens during
total number of individuals sampled was 210. amplification and sequencing. The final complete
sequence was 871 bp in length, but insertion/deletion
events of 1–6 bp are quite common.
CHARACTER SAMPLING RAG-1 was sequenced for 78 individuals, all from
A DNA sequence data set was produced by amplifying fresh tissue. The final complete sequence was 2873 bp
and sequencing four genetic markers: the two in length. Eight of the sequences are incomplete. There
mitochondrial loci NADH dehydrogenase subunit 2 is a single insertion/deletion event in the RAG-1 data
(ND2) and CYTB, RAG-1, and the nuclear intron matrix: a 6-bp deletion from base 1037 to base 1042 in
9 from the aconitase gene (ACO1 I9). The two all ten taxa sampled from the Old World clade.
mitochondrial markers and the nuclear intron were
chosen to target genetic signals at the species level,
whereas RAG-1 was chosen to resolve relatively LABORATORY METHODS
deeper nodes within the family, specifically among the Genomic DNA was extracted from frozen tissue
four main radiations. DNA was amplified from fresh samples using the standard procedure implemented
tissue specimens where possible, but for 79 specimens in the DNeasy Tissue Kit (Qiagen, Valencia, Califor-
DNA was extracted from toe pads of museum skins. nia). For the museum skin specimens, small pieces
ND2 was the only marker amplified and sequenced (approximately 1–2 mm in diameter) of toe-pad skin
from these skin extractions, hence was the only was cut off, rinsed in sterilized water, and extracted
marker sampled for all species (except for the two via the same process as the tissue samples, with the
GenBank sequences, in which only CYTB was exception that 30 μL of diluted dithiothreitol (DTT)
sampled). The other three markers were sampled was added into the sample at the beginning of the
from the fresh tissue specimens (summarized in extraction process, along with a tissue lysis buffer
Table 1). (ATL) and proteinase K to aid with the tissue diges-
Sequences of ND2 were obtained for 163 individ- tion process. To increase the final DNA concentration
uals, with the final complete sequence being 1041 bp in the toe-pad extractions, samples were eluted in
in length. Additionally, five out-group sequences 100 μL of an elution buffer (AE), whereas samples
were downloaded from GenBank. For some of the from fresh tissue specimens were eluded in 200 μL of
older museum skin specimens, complete sequences AE buffer.
were not obtained because of degradation of the DNA DNA was amplified via polymerase chain reaction
and severe difficulties in amplification. The shortest (PCR). General external and internal primers were
sequence was less than 300 bp in length, and a used for all four genetic markers (Table 2). Multiple
number of genes have large gaps in the middle of internal ND2 primers had to be designed for the
the sequence, in some cases up to 400 bp in length. toe-pad samples (Table 3). Amplification of fresh
Twenty-eight individuals have incomplete sequences, tissue specimens for ND2, RAG-1, and ACO1 I9 fol-
but only five of those have less than 500 bp of avail- lowed the same step-down PCR procedures. Amplifi-
able sequence. The total number of individuals in the cation of fresh tissue specimens for CYTB followed a
ND2 matrix is thus 199, including the out-group taxa. different procedure (listed in Table 4). Amplification of
CYTB was sequenced for 58 specimens, all from toe-pad samples from museum specimens required
fresh tissue. The final complete sequence was 1143 bp extensive optimization procedures, with independent
Table 1. Specimen list
Taxon name Source Specimen number Specimen type
Antrostomus badius*,† AMNH #824782 Skin

Antrostomus carolinensis† AMNH DOT 13818 Fresh tissue
Antrostomus carolinensis† USNM B16652 Fresh tissue
Antrostomus carolinensis† LSUMZ B-3403 Fresh tissue
Antrostomus carolinensis† AMNH #814800 Skin
Antrostomus cubanensis ekmani† AMNH #477312 Skin
Antrostomus ridgwayi† AMNH #817016 Skin
Antrostomus ridgwayi†,‡ AMNH #326088 Skin
Antrostomus rufus minimus† AMNH #389422 Skin
Antrostomus rufus otiosus† AMNH #477310 Skin
Antrostomus rufus rufus† USNM B04420 Fresh tissue
Antrostomus rufus rufus† LSUMZ B-44579 Fresh tissue
Antrostomus rufus rufus† AMNH #288295 Skin
Antrostomus rufus rutilus† AMNH #798850 Skin
Antrostomus salvini† Sequence from GenBank
(Han et al., 2010)
Antrostomus saturatus† LSUMZ B-16198 Fresh tissue
Antrostomus saturatus† AMNH #811270 Skin
Antrostomus seriocaudatus mengeli† LSUMZ B-28908 Fresh tissue
Antrostomus seriocaudatus seriocaudatus† AMNH #169760 Skin
Antrostomus vociferus spp.† FM 394005 Fresh tissue
Antrostomus vociferus spp.† FM 433988 Fresh tissue
Antrostomus vociferus arizonae† FM 343200 Fresh tissue
Antrostomus vociferus arizonae† AMNH #477247 Skin
Antrostomus vociferus oaxaceae† AMNH #815275 Skin
Antrostomus vociferus oaxaceae AMNH #815279 Skin
Antrostomus vociferus oaxaceae† AMNH #815280 Ski
Antrostomus vociferus vociferus† AMNH DOT 7377 Fresh tissue
Antrostomus vociferus vociferus†,§ ANSP 24536 Fresh tissue
Antrostomus vociferus vociferos† AMNH DOT 9310 Fresh tissue
Antrostomus vociferus vociferos† FM 444791 Fresh tissue
Caprimulgus anthonyi AMNH DOT 16843 Fresh tissue
Caprimulgus batesi USNM B09936 Fresh tissue
Caprimulgus cayennensis albicauda AMNH #294678 Skin
Caprimulgus cayennensis apertus ANSP 19607 Fresh tissue
Caprimulgus cayennensis cayennensis ANSP 21440 Fresh tissue
Caprimulgus cayennensis cayennensis USNM B04364 Fresh tissue
Caprimulgus cayennensis insularis AMNH #133075 Skin
Caprimulgus cayennensis leopetes AMNH #477206 Skin
Caprimulgus climacurus AMNH DOT 11123 Fresh tissue
Caprimulgus europaeus AMNH DOT 10905 Fresh tissue
Caprimulgus fossii AMNH DOT 2165 Fresh tissue
Caprimulgus hirundinaceus cearae AMNH #241596 Skin
Caprimulgus hirundinaceus vielliardi AMNH #477244 Skin
Caprimulgus longirostris atripunctatus AMNH DOT 2733 Fresh tissue
Caprimulgus longirostris atripunctatus FM 429897 Fresh tissue
Caprimulgus longirostris atripunctatus LSUMZ B-3571 Fresh tissue
Caprimulgus longirostris atripunctatus AMNH #820494 Skin
Caprimulgus longirostris atripunctatus AMNH #823745 Skin
Caprimulgus longirostris bifasciatus AMNH DOT 13553 Fresh tissue
* Labelled as Caprimulgus salvini badius.
† All Antrostomus specimens were labelled Caprimulgus.
‡ Mislabelled as Caprimulgus vociferus.
§ Mislabelled as Phalaenoptilus nuttallii.
Table 1. Continued
Caprimulgus longirostris bifasciatus AMNH #748519 Skin

Caprimulgus longirostris decussatus LSUMZ B-5262 Fresh tissue
Caprimulgus longirostris decussatus AMNH #151324 Skin
Caprimulgus longirostris decussatus AMNH #329090 Skin
Caprimulgus longirostris longirostris AMNH #779169 Skin
Caprimulgus longirostris patagonicus USNM B14783 Fresh tissue
Caprimulgus longirostris roraimae AMNH DOT 4729 Fresh tissue
Caprimulgus longirostris roraimae LSUMZ B-4783 Fresh tissue
Caprimulgus longirostris roraimae AMNH #323499 Skin
Caprimulgus longirostris ruficervix ANSP 27189 Fresh tissue
Caprimulgus longirostris ruficervix AMNH #143565 Skin
Caprimulgus longirostris ruficervix AMNH #824761 Skin
Caprimulgus macrurus AMNH DOT 9565 Fresh tissue
Caprimulgus macrurus USNM B04000 Fresh tissue
Caprimulgus maculicaudus USNM B14678 Fresh tissue
Caprimulgus maculicaudus LSUMZ B-13935 Fresh tissue
Caprimulgus maculicaudus AMNH #768804 Skin
Caprimulgus madagascariensis FM 356643 Fresh tissue
Caprimulgus nigrescens AMNH DOT 12694 Fresh tissue
Caprimulgus nigrescens FM 389183 Fresh tissue
Caprimulgus nigrescens USNM B04272 Fresh tissue
Caprimulgus nigrescens LSUMZ B-65861 Fresh tissue
Caprimulgus parvulus heterurus AMNH #824104 Skin
Caprimulgus parvulus parvulus AMNH DOT 2207 Fresh tissue
Caprimulgus parvulus parvulus USNM B20984 Fresh tissue
Caprimulgus parvulus parvulus LSUMZ B-25754 Fresh tissue
Caprimulgus pectoralis FM 444036 Fresh tissue
Caprimulgus poliocephalus FM 357948 Fresh tissue
Caprimulgus whitelyi AMNH DOT 11875 Fresh tissue
Caprimulgus whitelyi USNM B19022 Fresh tissue
Caprimulgus whitelyi LSUMZ B-48367 Fresh tissue
Chordeiles acutipennis acutipennis AMNH DOT 14304 Fresh tissue
Chordeiles acutipennis acutipennis ANSP 21428 Fresh tissue
Chordeiles acutipennis acutipennis FM 392639 Fresh tissue
Chordeiles acutipennis acutipennis USNM B04145 Fresh tissue
Chordeiles acutipennis acutipennis LSUMZ B-25493 Fresh tissue
Chordeiles acutipennis acutipennis AMNH #816611 Skin
Chordeiles acutipennis aequatorialis ANSP 18986 Fresh tissue
Chordeiles acutipennis exilis AMNH #824127 Skin
Chordeiles acutipennis littoralis KU 9367 Fresh tissue
Chordeiles acutipennis littoralis AMNH #813311 Skin
Chordeiles acutipennis micromeris AMNH #789456 Skin
Chordeiles acutipennis texensis AMNH DOT 4164 Fresh tissue
Chordeiles acutipennis texensis LSUMZ B-18025 Fresh tissue
Chordeiles acutipennis texensis AMNH #476941 Skin
Chordeiles gundlachii vicinus FM 387662 Fresh tissue
Chordeiles gundlachii vicinus LSUMZ B-48963 Fresh tissue
Chordeiles minor asseriensis AMNH #361249 Skin
Chordeiles minor chapmani FM 443599 Fresh tissue
Chordeiles minor chapmani FM 432665 Fresh tissue
Chordeiles minor hesperis AMNH DOT 7786 Fresh tissue
Chordeiles minor hesperis ANSP 22294 Fresh tissue
Chordeiles minor howellii/sennetti AMNH #815662 Skin
Chordeiles minor howellii AMNH #827821 Skin
Chordeiles minor minor AMNH DOT 10080 Fresh tissue
Chordeiles minor minor FM 395875 Fresh tissue
Table 1. Continued

Chordeiles minor panamensis AMNH #766711 Skin
Chordeiles minor sennetti AMNH #815659 Skin
Chordeiles pusillus esmeraldae FM 392642 Fresh tissue
Chordeiles pusillus novaesi AMNH #241901 Skin
Chordeiles pusillus septentrionalis ANSP 21634 Fresh tissue
Chordeiles pusillus septentrionalis USNM B12308 Fresh tissue
Chordeiles rupestris ANSP 17721 Fresh tissue
Chordeiles rupestris LSUMZ B-43037 Fresh tissue
Eleothreptus anomalus KU 3275 Fresh tissue
Eleothreptus anomalus AMNH #477064 Skin
Eleothreptus candicans Sequence from Genbank (Larsen et al., 2007)
Eurostopodus archboldi AMNH #816464 Skin
Eurostopodus argus AMNH #803858 Skin
Eurostopodus mystacalis AMNH DOT 2401 Fresh tissue
Gactornis enarratus* FM 352811 Fresh tissue
Gactornis enarratus* FM 431158 Fresh tissue
Hydropsalis torquata furcifer† ANSP 22420 Fresh tissue
Hydropsalis torquata furcifer† USNM B06315 Fresh tissue
Hydropsalis torquata torquata AMNH #449183 Skin
Hydropsalis climacocerca canescens AMNH #281556 Skin
Hydropsalis climacocerca climacocerca ANSP 19378 Fresh tissue
Hydropsalis climacocerca climacocerca USNM B06949 Fresh tissue
Hydropsalis climacocerca climacocerca AMNH #791814 Skin
Hydropsalis climacocerca climacocerca AMNH #816610 Skin
Hydropsalis climacocerca schomburgki ANSP 21533 Fresh tissue
Hydropsalis climacocerca ssp. AMNH #430379 Skin
Lurocalis rufiventris ANSP 19588 Fresh tissue
Lurocalis rufiventris LSUMZ B-32761 Fresh tissue
Lurocalis semitorquatus nattereri KU 277 Fresh tissue
Lurocalis semitorquatus nattereri AMNH #272590 Skin
Lurocalis semitorquatus semitorquatus AMNH DOT 14155 Fresh tissue
Lurocalis semitorquatus semitorquatus ANSP 20825 Fresh tissue
Lurocalis semitorquatus semitorquatus USNM B11905 Fresh tissue
Lurocalis semitorquatus stonei ANSP 18451 Fresh tissue
Lyncornis macrotis‡ USNM B03732 Fresh tissue
Lyncornis macrotis‡ Sequence from Genbank (Brown et al.,
2008 as Eurostopodus macrotis)
Lyncornis temmincki‡ AMNH #648315 Skin
Macrodipteryx vexillarius AMNH DOT 10638 Fresh tissue
Macropsalis forcipata AMNH #317317 Skin
Macropsalis forcipata AMNH #314025 Skin
Nyctidromus albicollis albicollis AMNH DOT 8787 Fresh tissue
Nyctidromus albicollis albicollis ANSP 16491 Fresh tissue
Nyctidromus albicollis albicollis FM 399123 Fresh tissue
Nyctidromus albicollis albicollis FM 433071 Fresh tissue
Nyctidromus albicollis albicollis USNM B00440 Fresh tissue
Nyctidromus albicollis albicollis USNM B11635 Fresh tissue
Nyctidromus albicollis albicollis LSUMZ B-12198 Fresh tissue
Nyctidromus albicollis derbyanus AMNH #393364 Skin
* Labelled as Caprimulgus enarratus.
† Labelled as Hydropsalis brasiliana.
‡ Labelled as Eurostopodus.
Table 1. Continued
Nyctidromus albicollis insularis AMNH #477162 Skin

Nyctidromus albicollis intercedens LSUMZ B-27017 Fresh tissue
Nyctidromus albicollis merrilli LSUMZ B-37032 Fresh tissue
Nyctidromus albicollis merrilli AMNH #361109 Skin
Nyctidromus albicollis yucatanensis ANSP 27121 Fresh tissue
Nyctidromus albicollis yucatanensis LSUMZ B-19253 Fresh tissue
Nyctiphrynus mcleodii* FM 343199 Fresh tissue
Nyctiphrynus mcleodii* AMNH #702848 Skin
Nyctiphrynus ocellatus ocellatus ANSP 19987 Fresh tissue
Nyctiphrynus ocellatus ocellatus USNM B07024 Fresh tissue
Nyctiphrynus rosenbergi AMNH #117635 Skin
Nyctiphrynus yucatanicus KU 2110 Fresh tissue
Nyctiprogne leucopyga latifascia AMNH #431874 Skin
Nyctiprogne leucopyga latifascia AMNH #245957 Skin
Nyctiprogne leucopyga latifascia AMNH DOT 14305 Fresh tissue
Nyctiprogne leucopyga leucopyga USNM B19380 Fresh tissue
Nyctiprogne leucopyga majuscula KU 3144 Fresh tissue
Nyctiprogne leucopyga majuscula AMNH #791797 Skin
Nyctiprogne vielliardi AMNH #291910 Skin
Phalaenoptilus nuttallii californicus AMNH DOT 9848 Fresh tissue
Phalaenoptilus nuttallii californicus AMNH #754341 Skin
Phalaenoptilus nuttallii centralis AMNH #783838 Skin
Phalaenoptilus nuttallii dickeyi AMNH #131568 Skin
Phalaenoptilus nuttallii hueyi LSUMZ B-40919 Fresh tissue
Phalaenoptilus nuttallii hueyi AMNH #754348 Skin
Phalaenoptilus nuttallii nuttallii LSUMZ B-21804 Fresh tissue
Podager nacunda minor ANSP 21646 Fresh tissue
Podager nacunda minor USNM B12379 Fresh tissue
Podager nacunda nacunda USNM B20909 Fresh tissue
Podager nacunda nacunda USNM B02768 Fresh tissue
Siphonorhis brewsteri KU 8149 Fresh tissue
Uropsalis lyra lyra ANSP 19587 Fresh tissue
Uropsalis lyra lyra AMNH #460138 Skin
Uropsalis lyra peruana AMNH #820936 Skin
Uropsalis segmentata kalinowskii AMNH DOT 2877 Fresh tissue
Uropsalis segmentata segmentata ANSP 15766 Fresh tissue
*Labelled as Otophanes mcleodii.
Table 1. Continued
Taxon name Geographic location Sequences in data matrix
Antrostomus badius*,† Quintana Roo, Mexico ND2

Antrostomus carolinensis† North Carolina, USA ND2, ACO1 I9, RAG-1
Antrostomus carolinensis† Florida, USA ND2, ACO1 I9, RAG-1
Antrostomus carolinensis† Louisiana, USA ND2, ACO1 I9
Antrostomus carolinensis† Panama (on wintering grounds) ND2
Antrostomus cubanensis ekmani† San Domingo, Dominican Republic ND2 (partial)
Antrostomus ridgwayi† Sonora, Mexico ND2, CYTB, ACO1 I9 (partial)
Antrostomus ridgwayi†,‡ La Flor, Honduras ND2
Antrostomus rufus minimus† Costa Rica ND2
Antrostomus rufus otiosus† St. Lucia ND2
Antrostomus rufus rufus† Berbice, Guyana ND2, CYTB, ACO1 I9, RAG-1
Antrostomus rufus rufus† Tarapoto, Peru ND2, CYTB, ACO1 I9, RAG-1
Antrostomus rufus rufus† Rio Tapajoz, Brazil ND2
Antrostomus rufus rutilus† Corrientes, Argentina ND2
Antrostomus salvini† Mexico CYTB
Antrostomus saturatus† San Jose, Costa Rica ND2, CYTB, ACO1 I9, RAG-1
Antrostomus saturatus† Talamanca Cordillera, Costa Rica ND2
Antrostomus seriocaudatus mengeli† Contamana, Peru ND2, CYTB, ACO1 I9, RAG-1
Antrostomus seriocaudatus seriocaudatus† Misiones, Argentina ND2
Antrostomus vociferus spp.† Michoacán, Mexico ND2, ACO1 I9, RAG-1
Antrostomus vociferus spp.† El Salvador ND2, ACO1 I9
Antrostomus vociferus arizonae† Jalisco, Mexico ND2, CYTB, ACO1 I9 (partial)
Antrostomus vociferus arizonae† Huachuca Mts, Arizona, USA ND2
Antrostomus vociferus oaxaceae† Oaxaca, Mexico ND2
Antrostomus vociferus vociferus† Florida, USA ND2, CYTB, ACO1 I9, RAG-1
Antrostomus vociferus vociferus†,§ New Jersey, USA ND2, ACO1 I9
Antrostomus vociferus vociferus† New Jersey, USA ND2, ACO1 I9, RAG-1 (partial)
Antrostomus vociferus vociferus† Illinois, USA ND2, CYTB, ACO1 I9
Caprimulgus anthonyi El Oro Province, Ecuador ND2, CYTB, ACO1 I9
Caprimulgus batesi Gabon ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus cayennensis albicauda Panama ND2
Caprimulgus cayennensis apertus Imbatura Province, Ecuador ND2, CYTB
Caprimulgus cayennensis cayennensis Guyana ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus cayennensis cayennensis Berbice, Guyana ND2, ACO1 I9, RAG-1
Caprimulgus cayennensis insularis Norte De Santander, Colombia ND2
Caprimulgus cayennensis leopetes Tobago, Trinidad and Tobago ND2
Caprimulgus climacurus Central African Republic ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus europaeus North Sea ND2, CYTB, RAG-1
Caprimulgus fossii Central African Republic ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus hirundinaceus cearae Ceara, Brazil ND2
Caprimulgus hirundinaceus vielliardi Bahia, Brazil ND2
Caprimulgus longirostris atripunctatus Bolivia ND2, ACO1 I9, RAG-1
Caprimulgus longirostris atripunctatus Cuzco, Peru ND2, ACO1 I9, RAG-1
Caprimulgus longirostris atripunctatus Acomayo, Peru ND2, CYTB
Caprimulgus longirostris atripunctatus Cordillera de Vilcabamba, Peru ND2
Caprimulgus longirostris atripunctatus Cochabamba, Bolivia ND2
Caprimulgus longirostris bifasciatus Argentina ND2, CYTB, ACO1 I9, RAG-1
* Labelled as Caprimulgus salvini badius.
† All Antrostomus specimens were labelled Caprimulgus.
‡ Mislabelled as Caprimulgus vociferus.
§ Mislabelled as Phalaenoptilus nuttallii.
Table 1. Continued
Caprimulgus longirostris decussatus Ica, Peru ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus longirostris decussatus Trujillo, Peru ND2
Caprimulgus longirostris decussatus Arequipa, Peru ND2
Caprimulgus longirostris longirostris Entre Rios, Argentina ND2
Caprimulgus longirostris patagonicus Tacuarembo, Uruguay ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus longirostris roraimae Bolivar, Venezuela ND2, CYTB (partial), ACO1 I9
Caprimulgus longirostris roraimae Amazonas, Venezuela ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus longirostris roraimae Mt Huyantepui, Venezuela ND2
Caprimulgus longirostris ruficervix Napo, Ecuador ND2, ACO1 I9
Caprimulgus longirostris ruficervix Colima, Colombia ND2
Caprimulgus longirostris ruficervix Merida, Venezuela ND2
Caprimulgus macrurus Singapore ND2, ACO1 I9, RAG-1
Caprimulgus macrurus New Ireland, Papua New Guinea ND2, CYTB
Caprimulgus maculicaudus Guyana ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus maculicaudus Florida, Bolivia ND2, ACO1 I9
Caprimulgus maculicaudus Oaxaca, Mexico ND2
Caprimulgus madagascariensis Antananarivo, Madagascar ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus nigrescens Amazonas, Venezuela ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus nigrescens Roraima, Brazil ND2, ACO1 I9
Caprimulgus nigrescens Berbice, Guyana ND2, ACO1 I9
Caprimulgus nigrescens Suriname ND2, CYTB
Caprimulgus parvulus heterurus Colon, Venezuela ND2 (partial)
Caprimulgus parvulus parvulus Bolivia ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus parvulus parvulus Artigas, Uruguay ND2, ACO1 I9
Caprimulgus parvulus parvulus Paraguay ND2, ACO1 I9
Caprimulgus pectoralis Malawi ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus poliocephalus Burundi ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus whitelyi Bolivar, Venezuela ND2, CYTB, ACO1 I9, RAG-1
Caprimulgus whitelyi Guyana ND2, ACO1 I9
Caprimulgus whitelyi Kopinang, Guyana ND2, CYTB, RAG-1
Chordeiles acutipennis acutipennis Amazonas, Brazil ND2, ACO1 I9, RAG-1
Chordeiles acutipennis acutipennis Upper Takutu, Guyana ND2, CYTB, ACO1 I9
Chordeiles acutipennis acutipennis Para, Brazil ND2, CYTB, ACO1 I9, RAG-1
Chordeiles acutipennis acutipennis Berbice, Guyana ND2, RAG-1
Chordeiles acutipennis acutipennis Para, Brazil ND2, ACO1 I9
Chordeiles acutipennis acutipennis Amazonas, Venezuela ND2
Chordeiles acutipennis aequatorialis Loja, Ecuador ND2
Chordeiles acutipennis exilis Chiclayo, Peru ND2
Chordeiles acutipennis littoralis El Salvador ND2, CYTB, ACO1 I9, RAG-1
Chordeiles acutipennis littoralis Guatemala ND2
Chordeiles acutipennis micromeris Costa Rica ND2, ACO1 I9
Chordeiles acutipennis texensis Arizona, USA ND2, ACO1 I9, RAG-1
Chordeiles acutipennis texensis Chocolate Mts, California, USA ND2, CYTB, ACO1 I9, RAG-1
Chordeiles acutipennis texensis Costa Rica ND2
Chordeiles gundlachii vicinus Florida, USA ND2, ACO1 I9, RAG-1 (partial)
Chordeiles gundlachii vicinus Bahamas ND2, CYTB, ACO1 I9, RAG-1
Chordeiles minor asseriensis Tivoli, Texas, USA ND2
Chordeiles minor chapmani Florida, USA ND2, CYTB, ACO1 I9, RAG-1
Chordeiles minor chapmani Florida, USA ND2
Chordeiles minor hesperis California, USA ND2, CYTB, ACO1 I9, RAG-1
Chordeiles minor hesperis Montana, USA ND2, CYTB, ACO1 I9
Chordeiles minor howellii / sennetti Nebraska, USA ND2, ACO1 I9
Chordeiles minor howellii New Mexico, USA ND2, ACO1 I9
Chordeiles minor minor New York, USA ND2, CYTB
Chordeiles minor minor New Jersey, USA ND2
Chordeiles minor minor New York, USA ND2
Chordeiles minor minor Wisconsin, USA ND2, ACO1 I9, RAG-1
Table 1. Continued
Chordeiles minor minor Wisconsin, USA ND2, ACO1 I9, RAG-1

Chordeiles minor minor Wisconsin, USA ND2, ACO1 I9
Chordeiles minor minor Wisconsin, USA ND2, ACO1 I9
Chordeiles minor minor Illinois, USA ND2, ACO1 I9, RAG-1
Chordeiles minor minor Illinois, USA ND2, ACO1 I9
Chordeiles minor panamensis Panama ND2
Chordeiles minor sennetti Nebraska, USA ND2, ACO1 I9
Chordeiles pusillus esmeraldae Para, Brazil ND2, CYTB, ACO1 I9, RAG-1
Chordeiles pusillus novaesi Flores, Brazil ND2 (partial)
Chordeiles pusillus septentrionalis Guyana ND2, CYTB, ACO1 I9, RAG-1
Chordeiles pusillus septentrionalis Guyana ND2, ACO1 I9, RAG-1
Chordeiles rupestris Napo, Ecuador ND2, ACO1 I9, RAG-1
Chordeiles rupestris Rio Maranon, Peru ND2, CYTB, ACO1 I9
Eleothreptus anomalus Paraguay ND2, CYTB, ACO1 I9, RAG-1
Eleothreptus anomalus Brazil ND2
Eleothreptus candicans Paraguay CYTB
Eurostopodus archboldi Mt Albert Edward, New Guinea ND2 (partial)
Eurostopodus argus Northern Territory, Australia ND2 (partial)
Eurostopodus mystacalis New South Wales, Australia ND2, CYTB, ACO1 I9, RAG-1
Gactornis enarratus* Toliara, Madagascar ND2, CYTB, ACO1 I9, RAG-1
Gactornis enarratus* Antsiranana, Madagascar ND2, CYTB, ACO1 I9
Hydropsalis torquata furcifer† Uruguay ND2, CYTB, ACO1 I9, RAG-1
Hydropsalis torquata furcifer† Tacuarembo, Uruguay ND2, ACO1 I9, RAG-1
Hydropsalis torquata torquata Entre Rios, Argentina ND2
Hydropsalis climacocerca canescens Rio Madeira, Brazil ND2
Hydropsalis climacocerca climacocerca Napo, Ecuador ND2
Hydropsalis climacocerca climacocerca Para, Brazil ND2, CYTB, ACO1 I9, RAG-1
Hydropsalis climacocerca climacocerca Beni, Bolivia ND2
Hydropsalis climacocerca climacocerca Amazonas, Venezuela ND2
Hydropsalis climacocerca schomburgki Guyana ND2, CYTB, ACO1 I9, RAG-1
Hydropsalis climacocerca ssp. Rio Tocantins, Brazil ND2
Lurocalis rufiventris Zamora Chinchipe, Ecuador ND2, CYTB, ACO1 I9
Lurocalis rufiventris Chontali, Peru ND2, ACO1 I9, RAG-1
Lurocalis semitorquatus nattereri Paraguay ND2, CYTB, ACO1 I9, RAG-1
Lurocalis semitorquatus nattereri Rio Negro, Brazil ND2 (partial)
Lurocalis semitorquatus semitorquatus Amazonas, Brazil ND2, ACO1 I9
Lurocalis semitorquatus semitorquatus Potaro-Siparuni, Guyana ND2, ACO1 I9
Lurocalis semitorquatus semitorquatus Guyana ND2, CYTB, ACO1 I9, RAG-1
Lurocalis semitorquatus stonei Manabi, Ecuador ND2, CYTB, ACO1 I9
Lyncornis macrotis‡ Luzon, Philippines ND2, CYTB, RAG-1
Lyncornis macrotis‡ Unknown ND2
Lyncornis temmincki‡ Sarawak ND2 (partial)
Macrodipteryx vexillarius Central African Republic ND2, CYTB, ACO1 I9, RAG-1
Macropsalis forcipata Espirito Santo, Brazil ND2
Macropsalis forcipata Grande do Sul, Brazil ND2
Nyctidromus albicollis albicollis Venezuela ND2, CYTB, ACO1 I9
Nyctidromus albicollis albicollis Morona-Santiago, Ecuador ND2
Nyctidromus albicollis albicollis Alagoas, Brazil ND2, CYTB, ACO1 I9, RAG-1
Nyctidromus albicollis albicollis Madre de Dios, Peru ND2, ACO1 I9, RAG-1
Nyctidromus albicollis albicollis Bocas del Toro, Panama ND2, ACO1 I9, RAG-1
Nyctidromus albicollis albicollis Guyana ND2
Nyctidromus albicollis albicollis Velasco, Bolivia ND2, CYTB, ACO1 I9
Nyctidromus albicollis derbyanus Sao Jeronimo, Brazil ND2
* Labelled as Caprimulgus enarratus.
† Labelled as Hydropsalis brasiliana.
‡ Labelled as Eurostopodus.
Table 1. Continued
Nyctidromus albicollis insularis Maria Madre Island, Mexico ND2

Nyctidromus albicollis intercedens Panama ND2, CYTB, ACO1 I9
Nyctidromus albicollis merrilli Webb County, Texas, USA ND2, CYTB, ACO1 I9
Nyctidromus albicollis merrilli Cameron County, Texas, USA ND2
Nyctidromus albicollis yucatanensis Panama ND2, CYTB
Nyctidromus albicollis yucatanensis Mexico CYTB, ACO1 I9
Nyctiphrynus mcleodii* Jalisco, Mexico ND2, CYTB, RAG-1
Nyctiphrynus mcleodii* Jalisco, Mexico ND2
Nyctiphrynus ocellatus ocellatus Sucumbios, Ecuador ND2, RAG-1 (partial)
Nyctiphrynus ocellatus ocellatus Para, Brazil ND2, CYTB, RAG-1
Nyctiphrynus rosenbergi Narino, Colombia ND2 (partial), CYTB
Nyctiphrynus yucatanicus Mexico ND2, CYTB, ACO1 I9, RAG-1
Nyctiprogne leucopyga latifascia Rio Cassiquaire, Venezuela ND2 (partial)
Nyctiprogne leucopyga latifascia Rio Cassiquaire, Venezuela ND2 (partial)
Nyctiprogne leucopyga latifascia Amazonas, Brazil ND2, CYTB (partial), ACO1 I9
Nyctiprogne leucopyga leucopyga Upper Takutu, Guyana ND2, CYTB, ACO1 I9, RAG-1
Nyctiprogne leucopyga majuscula Paraguay ND2, CYTB, ACO1 I9, RAG-1
Nyctiprogne leucopyga majuscula Beni, Bolivia ND2 (partial)
Nyctiprogne vielliardi Barra, Brazil ND2
Phalaenoptilus nuttallii californicus Shasta, California, USA ND2, CYTB, ACO1 I9
Phalaenoptilus nuttallii californicus San Diego, California, USA ND2
Phalaenoptilus nuttallii centralis Zacatecas, Mexico ND2
Phalaenoptilus nuttallii dickeyi Miraflores, Mexico ND2
Phalaenoptilus nuttallii hueyi Clark County, Nevada, USA ND2, ACO1 I9, RAG-1
Phalaenoptilus nuttallii hueyi Arizona, USA ND2
Phalaenoptilus nuttallii nuttallii Jeff Davis County, Texas, USA ND2, CYTB, ACO1 I9, RAG-1
Podager nacunda minor Upper Takutu, Guyana ND2, ACO1 I9
Podager nacunda minor Guyana ND2, CYTB, ACO1 I9, RAG-1
Podager nacunda nacunda Artigas, Uruguay ND2, CYTB, ACO1 I9
Podager nacunda nacunda Entre Rios, Argentina CYTB, ACO1 I9, RAG-1
Siphonorhis brewsteri Dominican Republic ND2, CYTB, ACO1 I9, RAG-1
Uropsalis lyra lyra Zamora Chinchipe, Ecuador ND2, CYTB
Uropsalis lyra lyra Mt Macarena, Colombia ND2 (partial)
Uropsalis lyra peruana Cerros del Sira, Peru ND2 (partial)
Uropsalis segmentata kalinowskii Bolivia ND2, CYTB, ACO1 I9, RAG-1
Uropsalis segmentata segmentata Carchi, Ecuador ND2, ACO1 I9
*Labelled as Otophanes mcleodii.
Table lists specimens using taxonomy as presented in Dickinson et al. (2003). Abbreviations for sources: AMNH, American
Museum of Natural History, New York; ANSP, the Academy of Natural Sciences of Drexel University, Philadelphia; FM, the Field
Museum, Chicago; KU, Kansas University; LSUMZ, the Louisiana State University Museum of Zoology, Baton Rouge; and
USNM, the Smithsonian Institution National Museum of Natural History, Washington D.C.
primer pairs treated differently, especially with sequencing plate and the sequences were run on a
regards to annealing temperatures (see Table 4). 3730 Automated DNA Sequencer (Perkin-Elmer, ABI).
All PCR products were cleaned using single-
step enzymatic clean-up (EXOSAP), which removes
unwanted deoxyribonucleotide triphosphates (dNTPs) DATA ANALYSIS
and primers from PCR products, and were cycle Sequences were assembled, edited, and aligned
sequenced with the same primers as used in each in GENEIOUS 4.6.5 (Drummond et al., 2010). The
amplification process using the BigDye Terminator sequence matrix for each of the four loci was aligned
Cycle Sequencing Kit (Applied Biosystems, Foster separately using the Muscle Alignment Feature
City, California). (Edgar, 2004), as implemented in GENEIOUS 4.6.5,
The cycle-sequencing reaction is described in with default parameters, and later the four matrices
Table 4. The cycle sequencing product was cleaned by were concatenated. The concatenated data set was
70% alcohol precipitation and spun in a centrifuge partitioned by locus. Additionally the ND2, CYTB, and
until the alcohol was removed. A 35-μl volume of RAG-1 data sets were partitioned by codon position. All
deionized water was added to each well on the data sets were also analyzed in a non-partitioned state.
Table 2. General all-purpose primers used for amplification and sequencing
Gene Primer name Sequence 5′ → 3′ Reference
ND2 L5204 TAACTAAGCTATCGGGCCCAT Modified from Sorenson et al. (1999)

H6312 CTTATTTAAGGCTTTGAAGGCC Cicero, Johnson (2001)
H5766 GGAYGARAAGGCTAGGACTTTTCG Sorenson et al. (1999)
L5602 GRTTCCCAGAAGTYCTYCAAGG Ribas et al. (2005)
CYTB L14851 CCTACCTAGGATCATTCGCCCT Groth (1998)
H16057 TCAGTCTTTGGYTTACAAGACC Modified from Groth (1998)
L15410 TGAGGAGGATTCTCAGTAGACAA Modified from Groth (1998)
H15532 AATGGGATTTTGTCGCAGTCTG Modified from Groth (1998)
RAG-1
R13 (forward) TCTGAATGGAAATTCAAGCTGTT Groth, J. G., Barrowclough, G. F. (1999)
R16 (reverse) GTTTGGGGAGTGGGGTTGCCA Groth, J. G., Barrowclough, G. F. (1999)
R15 (forward) TCGCTAAGGTTTTCAAGATTGA Groth, J. G., Barrowclough, G. F. (1999)
R18 (reverse) GATGCTGCCTCGGTCGGCCACCTTT Groth, J. G., Barrowclough, G. F. (1999)
R17 (forward) TCGCTAAGGTTTTCAAGATTGA Groth, J. G., Barrowclough, G. F. (1999)
R20 (reverse) CCATCTATAATTCCCACTTCTGT Groth, J. G., Barrowclough, G. F. (1999)
R19 (forward) GTCACTGGGAGGCAGATCTTCCA Groth, J. G., Barrowclough, G. F. (1999)
R22 (reverse) GAATGTTCTCAGGATGCCTCCCAT Groth, J. G., Barrowclough, G. F. (1999)
R21 (forward) GGATCTTTGAGGAAGTAAAGCCCAA Groth, J. G., Barrowclough, G. F. (1999)
R24 (reverse) GCCTCTACTGTCTCTTTGGACAT Groth, J. G., Barrowclough, G. F. (1999)
R23 (forward) TACAAGAATCCTGATGTGTCTAA Groth, J. G., Barrowclough, G. F. (1999)
R2 (reverse) TTCCACTGAATCATTGCTTTCCA Groth, J. G., Barrowclough, G. F. (1999)
ACO1 Intron 9
ACO1-I9F CTGTGGGAATGCTGAGAGATTT Barker et al. (2008)
ACO1-I9R CTGCAGCAAGGCACAACAGT Barker et al. (2008)
Phylogenetic analyses were performed on all data sets: Bayesian analyses were performed in BEAST 1.6.2
separate and concatenated. (Drummond & Rambaut, 2007) on the entire data set
Maximum-likelihood analyses were performed on as well as the individual partitions. Base substitution
the whole data set (210 individuals) as well as the models were chosen for individual loci and the con-
individual partitions in RAxML (Stamatakis, 2006; catenated data set based on the results from the
Stamatakis et al., 2008) on the open RAxML jModelTest analysis. For the coding ND2, CYTB, and
BlackBox cluster server (http://embnet.vital-it.ch/ RAG-1 matrices, the data were partitioned into codon
raxml-bb/). RAxML incorporates bootstrap analyses positions. The analysis was run for 15 million genera-
for support in tree-search analyses using rapid boot- tions, with tree samples taken every 1000 genera-
strap (RBS) heuristics. Bootstrap inferences are con- tions. Stationarity was evaluated in TRACER 1.3
ducted under the GTR + CAT model of rate (Rambaut & Drummond, 2007), with the first 20% of
heterogeneity; however, the final trees are scored trees discarded as burn-in.
under GTR + Γ, the standard RAxML model to Maximum-parsimony analyses were performed in
account for site heterogeneity. To ensure these default TNT (Goloboff, Farris & Nixon, 2008) on the non-
settings suited the data, PHYML as implemented in partitioned concatenated data set only, representing
jModelTest (Posada, 2008) was used on all individual all sampled taxa. The parsimony analysis was per-
locus data sets to calculate the appropriate model of formed to verify general topological patterns, and was
substitution for each data set under Aikake’s infor- not performed on the individual gene partitions. Tra-
mation criterion. The best-fitting model for three of ditional heuristic tree searching methods were imple-
the four individual loci data sets (for CYTB it was the mented with tree bisection and reconnection (TBR)
second best behind TIM3 + I) as well as the concat- branch swapping, as well as sectorial searching,
enated data set is GTR + Γ, a widely used model in ratcheting, and tree fusing. Trees were retrieved by a
RAxML (Stamatakis, 2006; Stamatakis et al., 2008). driven search using 100 initial addition sequences
We note, however, that GTR + G + I has been shown and requiring that the minimum length tree be found
to be mathematically inappropriate (Yang, 2006), and a total of ten times. All characters were equally
thus did not use it. weighted and non-additive, and gaps were treated
Table 3. Specifically designed primers for amplification of degraded DNA from toe-pad extractionsND2
Primer name Sequence 5′ → 3′ Primer name Sequence 5′ → 3′
CM FW (Externa primer) GCTATCGGGCCCATACCCCGAA MA 5 TCAACAATAATAACCTCATG

CM REV (External primer) CAGGTTAATATCTTGCGGGTCT MA 7 TCAACAATCACCCTTTCAC
CM 1 CACTGGGCAATAGCTTGAACC MA A TACATCCAACTCACTCAACC
CM 2 ATCAAATACTTCCTAGTGCAGGCA MA C ATAACCGCTACCATCTTC
CM 3 TGGCTCCTACTGACAACAGCAATTG MA E ACCTTCGTCTTGCGTACCA
CM 4 ACCGGCCTCCTTCTATCGACA MY 2 GAAGTACTCCAAGGCTCA
CM5 ATCATGGCCATTATCTCAGCAG MY 4 ATCATCCTATACAGCCCAA
CM 6 ACTAACCCTCATAACATTCTACC MY A ATTCCCTCCAATTACTATTC
CM 7 ACCTCATGAACAAAGGTCCCAACAC MY C ATAACCTCCTCTATCTTC
CM 8 CAATGGCACATCTACAGCTCAACA L2 ACATCCTCCCTTCTGCTAACA
CM 9 CAATGGCACATCTACAGCTCAACA L3 ATCACCATTCTCTTCCTAAC
CM A ATACTTCCTAGTACAGGCAGCA L5 CCATCTTTCTTACCCTCAACA
CM B GAGACATCACCCAGCTAACACA L6 TGGCTGCTGGGGTTATTTCT
CM C AACTTGGACTAGTACCATTCC LB AGCCCTAGGAGGCTGAAT
CM D ATCACTATCCTCCTTCTCACATCC LC CTAAGCTTACCCTCATAAC
CM E CTAGCTTTCTCATCCCTCGCACACT LE AGAAATAACCCCAGCAGCCA
CM F ACCGCCACCATCTTCCTCACTCTA LF TGCCATTCTCACCTCAATAT
CM G GCTTCCTGCCAAAATGACTTATAC NA 1 CACTGAGCAACAGCCTGAACC
CM H CGTCTCGCATACTATTCAACA NA 2 ACTTTCTAGTACAAGCAAC
CM I CATAATCCTAACAACCATCTAGA NA 3 ATTCCCCGAAGTCCTCCAAG
CL 1 ACAATCTCAAGCAACCATTGA NA 4 ACTATAGCCATCGCCTCAGCAG
CL 2 TTCCTAGTACAAGCAACTGC NA 5 ACTCACCCTAATAACATTCTACC
CL 3 ATAAACGCATGATTCACCGGA NA 6 ACCTCGTGAACAAAAATCCCGA
CL 4 CAGAAGTACTTCAGGGCACCTC NA 7 ATAACCACAGCAGCCACAATT
CL 5 GCTTCAGCAGCCCTAGGGGG NA 8 ACCCTCAAATTGCCATTTTCAC
CL 6 ATCATAACAGCCACCGTAT NA A TACTTTCTAGTACAAGCAACT
CL 7 TAGCTGGACTTCCCCCA NA B TGCCTCCTACTAACAACAGC
CL 8 TCGCATACTACTCAACAATTAC NA C ATCACCATTCTCCTTCTCACATCA
CL A GAGCAGTAGAAGCCGCAATC NA D GCCTTCTCGTCCATCTCTCA
CL B ATAAAACTAGGCCTAGTCCCATT NA E ATCTTCTTTACCCTCAACAC
CL C CTCCTACTATCAACAATAAT NA F CCAAAATGACTCATCATCCA
CL D CAAATCCGAAAAATCCTAGC NA G CGCCTCGCATACTACTCAACA
CL E CCTAAATGCAACACTCAT NPHR 4 CACTAATAACCACTATAGCC
CL F ACAAGAAATAACCACAGCAGC NPHR 5 AGCCTTTTCATCCATCTCCCAC
CL G TCCTCAATATCGGCCTTACT NPHR 6 TCCTCACCCTAAACACAACCA
RUF 1 GACTAGAAATTAACACTCTA NPHR 7 CCCAACACTCAATGCAAC
RUF 2 TCTGATTCCCAGAAGTCCTTCA NPHR A ACCCAACACTAATAACCACTAT
RUF 3 ACTAATAACCACTATAGCTA NPHR B AACTCACCCTCATAACATTC
RUF 4 CATAACTACTACCATCTTC NPHR C ACACTCAATGCAACCCTCAT
RUF 5 CATATTATCACTACTTGGACTA NPHR D CAGCAGCCACCATCATCGC
RUF A ATTGCCTCAGCCGCCCTAGGA NP 1 TGAGCAACAGCCTGAGCTGGGCT
RUF B TACTACCATCTTCCTTA NP 2 TAACTCACCCAACATCCTGC
RUF C ACTGCAACAGCCACAATCAT NP 3 CAACCACCATCCTCTTCCTTA
AV 1 GCCTCCTCCTAGGAACAACCATTA NP 4 TCCTAGCCTTCTCATCCAT
AV 2 GCCATTCTCCTATTCTCCAGC NP 5 CACTATCTTCTTCACTCT
AV 3 ACCATTCCACTTCTGATTCCCA NP 6 CACTAACAGGCTTCCTGCCAA
AV 4 TCACTCAACCCAACACTAAT NP 7 TCGCATACTACTCAACAATC
AV 5 AGCCTTCTCATCCATCTCCCAC NP A TCTGATTCCCAGAAGTACTTCAA
AV 6 ACTCTCAACCATAATAAC NP B TAATAACCACCATAGCCCT
AV 7 ACAAGAAATAACCACAGCAGC NP C TCACCCTCATAACATTCTAC
AV 8 ACACAAAACAATGGCATA NP D ACGCAACCCTCATACTAAC
AV A CCTCATCTCAAAATCCCAC NP E CATATTATCACTACTAGGA
AV B CTCCAGCACAATAAACGCATGA NP F TCGCCATCCTCACCTCAAT
AV C TGATTCCCAGAAGTCCTTCAAG PN 1 TAGAAATCAACACCCTAGCCA
AV D AACCAAACACAAATCCGA PN 2 TAGGCCTCAACCAAACACA
AV E AAACTCACCCTCATAACATTC PN 3 TCATACTAACCTTACTATC
AV F AATGCAACCCTCATACTAA PN A CAGCATAATAAACGCATGATT
AV G TTACCTCCGTCTCGCATA PN B ATGCAGCCCTCATACTAAC
AV H ATCTCCCCTATAATCCTTACC SIPH 8 CACAACAGCCACAATCATCG
MA 3 TGATTACCATGGCCATTGCAT
Eleven sets of primers were designed using reference sequences from the following taxa: AV, Antrostomus vociferus and close relatives; CL,
Caprimulgus longirostris and close relatives; CM, Chordeiles minor and its congeners; L, the genus Lurocalis; MA, Eurostopodus macrotis; MY,
Eurostopodus mystacalis; NA, Nyctidromus albicollis and close relatives; NP, the genus Nyctiprogne; NPHR, the genus Nyctiphrynus; PN,
Phalaenoptilus nuttallii; RUF, Antrostomus rufus and close relatives; SIPH, the genus Siphonorhis. Each primer set includes taxon-specific primers
ranging from a single primer aimed to amplify a particular gene region to nine or ten primer pairs that together capture the whole gene. On
occasions primers from different primer sets were paired up to amplify problematic regions. The length of fragments amplified and sequenced using
various primer pairs ranged from around 80 up to 200 bp. Primers in which names include numbers (1–9) are always leading primers, whereas
primers in which names are followed by a letter (A–I) are reverse primers. The external primers designed using Chordeiles minor reference
sequences were also successfully used for most other taxa.
Table 4. Polymerase chain reaction (PCR) settings
1. Step-down PCR for amplification of ND2, RAG-1 and ACO1 I9 from fresh tissue
Initialization at 94 °C for 2 min, followed by one cycle of 94 °C for 15 s (denaturation), 58 °C for 15 s (annealing), and
70 °C for 1 min (extension), then one cycle of 94 °C for 15 s, 56 °C for 15 s, and 70 °C for 1 min, one cycle of 94 °C
for 15 s, 54 °C for 15 s, and 70 °C for 1 min, and finally 29 cycles of 94 °C for 15 s, 52 °C for 15 s, and 70 °C for
1 min, with a final extension of 70 °C for 5 min.
2. Step-down PCR for amplification of CYTB from fresh tissue
Initialization at 94 °C for 5 min, followed by ten cycles of 94 °C for 15 s, 54 °C for 15 s, and 72 °C for 1 min, then ten
cycles of 94 °C for 15 s, 52 °C for 15 s, and 72 °C for 1 min, then 20 cycles of 94 °C for 15 s, 50 °C for 15 s, and
72 °C for 1 min, with a final extension of 72 °C for 5 min.
3. General set-up for amplification of short ND2 fragments from toe-pad specimens
The general set-up for PCR amplification of short ND2 fragments was a three- or four-stage step-down, with various
sets of annealing temperatures (ranging from 60 °C as the highest temperature in a given step-down reaction to
46 °C as the lowest temperature in a given reaction). In a four-stage step-down procedure, there would generally be
ten cycles of 94 °C for 15 s, with the highest annealing temperature for 10 s, and a 72 °C extension for 30 s,
followed by ten cycles of 94 °C for 15 s, the second-highest temperature for 10 s, and a 72 °C extension for 30 s,
then ten cycles of 94 °C for 15 s, the second-lowest temperature for 10 s, and a 72 °C extension for 30 s, and finally
20 cycles of 94 °C for 15 s, the lowest temperature for 10 s, and a 72 °C extension for 30 s. In a three-stage
step-down procedure there are 30 cycles of the lowest annealing temperature reactions instead of 20.
4. Cycle-sequencing reaction set-up
Fifteen cycles of 96 °C for 1 min, 50 °C for 5 s, and 60 °C for 1 min 15 s, followed by five cycles of 96 °C for 10 s,
50 °C for 5 s, and 60 °C for 1 min 30 s, and finally five cycles of 96 °C for 10 s, 50 °C for 5 min, and 60 °C for 2 min.
as missing data. The results of these searches were The poorwill clade: Antrostomus Bonaparte, 1838
subsequently resubmitted to TNT for TBR branch (previously Caprimulgus), Nyctiphrynus Bonaparte,
swapping. Support values for nodes were also calcu- 1857, Phalaenoptilus Ridgway, 1880, and Siphonorhis
lated in TNT through standard bootstrap resampling, Sclater, 1861. Predominantly North and Central
employing 100 iterations, each subjected to five itera- America and the Caribbean, with a few South Ameri-
tions of ratcheting and three rounds of tree fusing can taxa.
after an initial five rounds of Wagner tree building.
The South American clade (SA clade): Eleothreptus
Gray, 1840, Hydropsalis Wagler, 1832, Lurocalis
RESULTS
Cassin, 1851, Macropsalis Sclater, 1866, Nyctidromus
Overall there was a high level of congruence among Gould, 1838, Nyctiprogne Bonaparte, 1857, and
the results from the various phylogenetic analyses, Uropsalis de W. Miller, 1915, as well as species in the
but minor differences were present. As a result of genus Caprimulgus.
variation in taxon sampling across gene trees, not all
topological relationships can be compared directly.
The Old World clade: Caprimulgus and Macro-
Figure 1 summarizes the results from the individual
dipteryx. Africa, Europe, Middle East, and South and
analyses of the four loci, with an emphasis on the
Southeast Asia.
relationships among the basal genera and the major
There is disagreement among the four gene trees
subgroups within the family.
regarding the relationships of the three basal genera
with one another, and with the core nightjar radiation
BASAL RELATIONSHIPS (Fig. 1). Of the four gene trees, the RAG-1 tree is
The basal lineages within the family include the the only one that resolves all the basal relationships
genera Eurostopodus and Lyncornis (previously with strong support (bootstrap values > 90). Eurosto-
Eurostopodus), as well as Gactornis enarratus (Fig. 1). podus is the sister group to all other nightjars, with
The remainder of nightjar diversity forms a well- Lyncornis and Gactornis also placed outside the core
supported core radiation that can be further split into nightjar radiation. RAG-1 also resolves with strong
four major clades. support the relationships among the four clades
within the core radiation. The South American clade
The nighthawk clade: Chordeiles and Podager. North, is the sister to a clade containing the other three.
Central, and South America. Among the three remaining clades, the poorwill clade
Gactornis enarratus
Gactornis enarratus
S-American clade
S-American clade
Nighthawk clade
Nighthawk clade
Old World clade
Old World clade

Outgroup taxa
Outgroup taxa
Poorwill clade
Poorwill clade
Eurostopodus
Eurostopodus
Lyncornis
Lyncornis
88 87 80
81 63
98
ND2 phylogeny CYTB phylogeny

Gactornis enarratus
Gactornis enarratus
S-American clade
S-American clade
Nighthawk clade
Nighthawk clade
Old World clade
Old World clade

Outgroup taxa
Poorwill clade
Poorwill clade
Eurostopodus
Lyncornis
94 68
74
100 100
100
91
100
RAG-1 phylogeny ACO1 Intron-9 phylogeny

Figure 1. A summary figure, showing the individual gene trees of the four markers: ND2 (1041 bp); CYTB (1143 bp);
RAG-1 (2873 bp); and ACO1 I9 (871 bp). The trees show the relationships among the three basal nightjar genera and the
four core radiations. Bootstrap values from maximum-likelihood (ML) analyses are displayed on the nodes (only values
> 60 are displayed).
is the sister group to the nighthawk clade plus the among the four core clades are not resolved. The
Old World clade (Fig. 1). CYTB tree is similarly poorly resolved at these basal
The ND2 tree does not resolve whether Lyncornis or nodes, although unlike the ND2 tree the placement
Eurostopodus is the sister group to the remaining of Gactornis is not well resolved, and it is placed as
nightjars (Fig. 1), but the position of Gactornis as the the sister to Eurostopodus with very low bootstrap
sister taxon to the core radiation is relatively well support. This is incongruent with both the RAG-1 and
supported (bootstrap value > 80). The relationships ND2 trees. Another incongruent pattern on the CYTB
tree is that the Old World clade is the sister group to outgroups
the other three clades within the core nightjar radia-
tion, with rather good support (bootstrap values > 85),
suggesting that the New World diversity of nightjars
is a monophyletic assemblage. Neither Eurostopodus 89
Eurostopodus (~4 species)
1
nor Lyncornis is sampled in the ACO1 I9 tree, but
Gactornis is the sister to the remaining diversity with
strong support (Fig. 1).
The relationships among the four core groups are 100 Gactornis (1 species)
1
not well resolved but there is low bootstrap support
(68%) for the sister relationship of the nighthawk
clade and the Old World clade. This is congruent with
the RAG-1 results. Additionally, there is a single 99 87 100 South American Clade
deletion event in the ACO1 I9 data set that is unique 0.85 1 (~28 species)
to these two clades.
The maximum-likelihood phylogeny from the ana-
lysis of all four markers concatenated together is 100
Nighthawk Clade (~7 species)
100 1
depicted in Figures 2–7. Figure 2 depicts relationships 1
among the major groups, whereas Figures 3–7 show 95
_
the relationships among species within those groups 1
(Old World taxa, nighthawks, poorwills, and South 100

1
Old World Clade (>36 species)
American radiation). This concatenated phylogeny has
larger taxon sampling than any of the individual gene
trees, and is overall the best-resolved tree. As seen in
Figure 2, the topological relationships among the three 99
Poorwill Clade (~18 species)
basal genera, as well as among the four clades within 1
the core radiation, are identical to the patterns on the

RAG-1 tree. This is unsurprising. as RAG-1 was the
only individual locus that successfully resolved these
99 Lyncornis (~3 species)
relationships (Fig. 1). 1
At lower taxonomic levels the data set formed

from the total evidence provides a robust phylogeny
for the three major radiations of New World nightjars, Figure 2. Phylogenetic overview of relationships among
and is by far the most taxonomically complete the main clades of the Caprimulgidae based on a
phylogenetic tree available for this group. Thus, this maximum-likelihood (ML) analysis of a concatenated
phylogeny (Figs 3–7) will be used to evaluate and 5298-bp molecular data set. ML bootstrap values higher
discuss the phylogenetic relationships and the status than 60 and Bayesian posterior probability values higher
of all taxa. The placement of individual taxa within than 0.85 are displayed on the nodes.
the four core radiations is mostly congruent among
the four gene trees, and exceptions are in most cases
resolved in the analysis of the concatenated data. All data (see supporting information), which is unsur-
individual gene trees can be found in the supporting prising as their allopatric ranges are roughly split by
information. the Amazon River; however, the branches leading
to these two subclades are extremely short (Fig. 4).
Morphological differences between the two are
THE NIGHTHAWK CLADE present, with males of the nominate form Podager
nacunda nacunda Viellot, 1817 having a darker
Relationships of taxa within the nighthawk clade are crown and breast with black feathers more prominent
relatively well resolved. The genus Chordeiles is not than Podager nacunda minor Cory, 1915. A more
monophyletic, as Podager nacunda (Vieillot, 1817) detailed investigation of the genetic structure and
(the Nacunda nighthawk) and Chordeiles pusillus morphological variation in this species is needed.
Gould, 1861 (the least nighthawk) are sister taxa Only three of the six recognized subspecies
with very strong support, and form the sister group to (Dickinson et al., 2003) of Chordeiles pusillus were
the remaining members of Chordeiles (Fig. 4). sampled in this study. The overall range of C. pusillus
The two subspecies of Podager nacunda show some in South America is not well defined and is frag-
genetic separation (particularly in the mitochondrial mented, and mostly consists of relatively small areas
Colibri
100
1
Phaethornis
100
0.94
Apus
100
1 Hemiprocne
Eurostopodus archboldi Archbold’s Nightjar

89
1 Eurostopodus argus Spotted Nightjar
100
1
Eurostopodus mystacalis White-throated Nightjar
Gactornis enarratus
100 Collared Nightjar
1 Gactornis enarratus
100
1
SOUTH AMERICAN CLADE
87 100
1 NIGHTHAWK CLADE
99
0.85 Caprimulgus madagascariensis Madagascan Nightjar
95
_
1
Caprimulgus poliocephalus Abyssinian Nightjar
100 100
1 100 1 Caprimulgus pectoralis Fiery-necked Nightjar
1
Caprimulgus macrurus bimaculatus
100
1 Large-tailed Nightjar
100 Caprimulgus macrurus schlegelli
1
Caprimulgus europaeus European Nightjar
99 Caprimulgus fossii Mozambique Nightjar
1 100
1
_
78 Caprimulgus climacurus Long-tailed Nightjar
0.97
Macrodipteryx vexillarius Pennant-winged Nightjar
Caprimulgus batesi
99
1 POORWILL CLADE
100
Lyncornis macrotis
1 Great-eared Nightjar
99 Lyncornis macrotis
1
Lyncornis temmincki Malaysian Eared Nightjar
Figure 3. A phylogeny from a maximum-likelihood (ML) analysis of a concatenated 5298-bp molecular data set. The
figure shows the Old World taxa in the basal genera Eurostopodus, Gactornis, and Lyncornis, as well as the members of
the Old World crown clade. ML bootstrap values higher than 60 and Bayesian posterior probability values higher than
0.95 are displayed on the nodes. Names on the tree represent current taxonomy; names on the right represent those
resulting from this revision (see text).
each inhabited by a single subspecies. There is some seven subspecies distributed throughout a large
evidence indicating that C. p. novaesi is taxonomi- range extending from south-eastern USA and north-
cally distinct from the other two subspecies (Fig. 4), ern Mexico, south to coastal Peru, as well as Brazil
as it is genetically separated on the tree (Fig. 4), but south of the Amazon basin (Holyoak, 2001; Dickinson
more sampling is needed to fully investigate et al., 2003). Both ND2 and ACO1 I9 sequences indi-
intraspecific diversity within this species. cate that Chordeiles acutipennis should be split into
The remaining nighthawk species all belong to the two phylospecies. There is a particularly high degree
genus Chordeiles, and they form a monophyletic clade of divergence in the ND2 sequences, with 14 homolo-
(Fig. 4). There are two well-supported species groups. gous substitution events present in the sequences
One of these species groups contains the monoty- of the three individuals of the northernmost taxon
pic Chordeiles rupestris (Spix, 1825) (sand-coloured Chordeiles acutipennis texensis Lawrence, 1856.
nighthawk) and Chordeiles acutipennis (Hermann, These character changes separate them from the indi-
1783) (the lesser nighthawk), which is polytypic with viduals of the other subspecies of C. acutipennis,
Eurostopodus
Gactornis
SOUTH AMERICAN CLADE Antillean Nighthawk
Chordeiles gundlachii
(Chordeiles gundlachii)
Chordeiles minor hesperis
Chordeiles minor hesperis
Chordeiles minor sennetti
Chordeiles minor minor
Chordeiles minor howellii
100
1 Chordeiles minor minor
Chordeiles minor minor Common Nighthawk
Chordeiles minor panamensis (Chordeiles minor)
73/1 Chordeiles minor minor
90 Chordeiles minor chapmani
-
1 Chordeiles minor chapmani
100 Chordeiles minor asseriensis
1
Chordeiles acutipennis texensis
100 Chordeiles acutipennis texensis Texan Nighthawk
-
1 (Chordeiles texensis)
Chordeiles acutipennis texensis
Chordeiles acutipennis aequatorialis
100 Chordeiles acutipennis acutipennis
1 Chordeiles acutipennis acutipennis
Chordeiles acutipennis acutipennis
Chordeiles acutipennis acutipennis Lesser Nighthawk
Chordeiles acutipennis acutipennis
(Chordeiles acutipennis)
100 97/1 71 Chordeiles acutipennis acutipennis
1 100 -
1 1 Chordeiles acutipennis exilis
Chordeiles acutipennis littoralis
84 Chordeiles acutipennis littoralis
-
1 Chordeiles acutipennis micromeris
100 Chordeiles rupestris Sand-coloured Nighthawk

1 Chordeiles rupestris (Chordeiles rupestris)
95
Chordeiles pusillus novaesi
- 100
1 1 Chordeiles pusillus septentrionalis Least Nighthawk
99
-
1 Chordeiles pusillus septentrionalis (Podager pusillus)
100 Chordeiles pusillus esmeraldae
-
1
96 Podager nacunda minor
-
100 1
Podager nacunda minor Nacunda Nighthawk
1
87 Podager nacunda nacunda
- (Podager nacunda)
1 Podager nacunda nacunda
OLD WORLD CLADE
POORWILL CLADE
Lyncornis
Figure 4. A phylogeny of the nighthawk clade based on a maximum-likelihood (ML) analysis of a concatenated 5298-bp
molecular data set. ML bootstrap values higher than 60 and Bayesian posterior probability values higher than 0.95 are
displayed on the nodes. Names on the tree represent current taxonomy; names on the right represent those resulting from
this revision (see text).
Eurostopodus
Gactornis
SOUTH AMERICAN CLADE
NIGHTHAWK CLADE
OLD WORLD CLADE
Nyctiphrynus rosenbergi Choco Poorwill (Nyctiphrynus rosenbergi)
97 100 Nyctiphrynus mcleodii
1 1 Nyctiphrynus mcleodii Eared Poorwill (Nyctiphrynus mcleodii)
100
1 Nyctiphrynus yucatanicus Yucatán Poorwill (Nyctiphrynus yucatanicus)
100 / 1 100 Nyctiphrynus ocellatus ocellatus Ocellated Poorwill (Nyctiphrynus ocellatus)
1 Nyctiphrynus ocellatus ocellatus
Phalaenoptilus nuttallii dickeyi
Phalaenoptilus nuttallii huyei
100 Phalaenoptilus nuttallii californicus
1
Phalaenoptilus nuttallii nuttallii
Common Poorwill
99
1 83
_ Phalaenoptilus nuttallii californicus
(Phalaenoptilus nuttallii)
0.99
Phalaenoptilus nuttallii huyei
Phalaenoptilus nuttallii centralis
Antrostomus salvini Tawny-collared Nightjar (Antrostomus salvini)
Antrostomus cubanensis ekmani Greater Antillean Nightjar (Antrostomus cubanensis)
Antrostomus carolinensis
99
Antrostomus carolinensis Chuck-will’s Widow
100 _
75
0.99 Antrostomus carolinensis (Antrostomus carolinensis)
1 1 Antrostomus carolinensis
_
82
0.91 Antrostomus rufus rufus
84
_
Antrostomus rufus rufus
0.83
96
_
1
Antrostomus rufus rufus Rufous Nightjar
86
_
100 Antrostomus rufus rutilus
0.86 (Antrostomus rufus)
1
_
100
Antrostomus rufus minimus
1 Antrostomus rufus otiosus
Antrostomus badius Yucatán Nightjar (Antrostomus badius)

99
99
_ 1 Antrostomus seriocaudatus mengeli
1 _
96
_
95
1 Antrostomus seriocaudatus seriocaudatus
Silky-tailed Nightjar (Antrostomus seriocaudatus)
1
100 Antrostomus saturatus
Dusky Nightjar (Antrostomus saturatus)
95 Antrostomus vociferus
_
_77
100 0.99
Antrostomus vociferus Whip-poor-will
1 100
1 Antrostomus vociferus (Antrostomus vociferus)
89
_
_
94 Antrostomus arizonae spp
1 Antrostomus arizonae arizonae
Antrostomus arizonae oaxaceae
Mexican Whip-poor-will
100 Antrostomus arizonae oaxaceae
Antrostomus arizonae
1 Antrostomus arizonae oaxaceae
Antrostomus arizonae arizonae
100 Antrostomus ridgwayi
1 Antrostomus ridgwayi Buff-collared Nightjar (Antrostomus ridgwayi)
Siphonorhis brewsteri Least Poorwill (Siphonorhis brewsteri)
Lyncornis
Figure 5. A phylogeny of the poorwill clade based on a maximum-likelihood (ML) analysis of a concatenated 5298-bp
molecular data set. ML bootstrap values higher than 60 and Bayesian posterior probability values higher than 0.95 are
displayed on the nodes. Names on the tree represent current taxonomy; names on the right represent those resulting from
this revision (see text).
resulting in a strongly supported clade on the concat- genetic structure within the species, and what there
enated tree (Fig. 4). Individuals of C. a. texensis are is does not follow subspecies lines or any geographic
noticeably larger in size and have a lighter plumage patterns. In the two markers that were best sampled
than most other subspecies of C. acutipennis. Thus, for C. minor, ND2 and ACO1 I9, there are 12 poly-
we suggest that C. a. texensis be elevated to full morphic sites: ten in ND2 and two in ACO1 I9. The
species status as Chordeiles texensis. way in which these polymorphisms are distributed
The second species group contains Chordeiles minor among the sampled individuals does not follow any
(J.R. Forster, 1771) (the common nighthawk) and congruent pattern, however, and analysis results in a
Chordeiles gundlachii Lawrence, 1856 (the Antillean basal polytomy in the concatenated tree (Fig. 4). This
nighthawk). There are nine subspecies of C. minor, lack of structured genetic diversity suggests either a
eight of which were sampled. There is little to no recent expansion of its range or that gene flow is high
Eurostopodus
Gactornis
Nyctiprogne leucopyga latifascia - VENEZUELA

100
1 Nyctiprogne leucopyga latifascia - VENEZUELA Nyctiprogne latifascia
81
_
0.99
Nyctiprogne leucopyga latifascia - Amazonas, BRAZIL
100
1 Nyctiprogne leucopyga majuscula - PARAGUAY
83
1 Nyctiprogne leucopyga leucopyga - GUYANA Nyctiprogne leucopyga
100
1 Nyctiprogne leucopyga majuscula - BOLIVIA
Nyctiprogne vielliardi - Barra, BRAZIL Nyctiprogne vielliardi

Lurocalis semitorquatus nattereri - PARAGUAY
Lurocalis semitorquatus nattereri - Rio Negro, BRAZIL

100
Lurocalis semitorquatus semitorquatus - GUYANA
1 Lurocalis semitorquatus
Lurocalis semitorquatus semitorquatus - Amazonas, BRAZIL
100 Lurocalis semitorquatus semitorquatus - GUYANA

100 1
1 Lurocalis semitorquatus stonei - ECUADOR
Lurocalis rufiventris - ECUADOR

100
Lurocalis rufiventris
1 Lurocalis rufiventris - PERU
“Caprimulgus” hirundinaceus vielliardi - Bahia, BRAZIL

100 Nyctidromus hirundinaceus
1 “Caprimulgus” hirundinaceus cearae - Ceara, BRAZIL
98 “Caprimulgus” nigrescens - SURINAME

1
“Caprimulgus” nigrescens - GUYANA
100
Nyctidromus nigrescens
1
“Caprimulgus” nigrescens - Roraima, BRAZIL
“Caprimulgus” nigrescens - VENEZUELA
Nyctidromus albicollis yucatanensis - PANAMA

Nyctidromus albicollis yucatanensis- MEXICO
Nyctidromus albicollis intercedens - PANAMA
Nyctidromus merrilli
100 Nyctidromus albicollis merrilli - Texas, USA
1
100 Nyctidromus albicollis insularis - Maria Madre Island, MEXICO
1
Nyctidromus albicollis merrilli - Texas, USA
100 Nyctidromus albicollis albicollis - Alagoas, BRAZIL

_
100
1
95
1 Nyctidromus albicollis derbyanus - Sao Jeronimo, BRAZIL Nyctidromus derbyanus
1
Nyctidromus albicollis albicollis - BOLIVIA
87
_
1 Nyctidromus albicollis albicollis - GUYANA
_93 _
95
Nyctidromus albicollis albicollis - PERU
0.96 97
_
1 1 Nyctidromus albicollis albicollis - PANAMA Nyctidromus albicollis
_
95
1 Nyctidromus albicollis albicollis - ECUADOR
Nyctidromus albicollis albicollis - VENEZUELA

“Caprimulgus” anthonyi - ECUADOR Nyctidromus anthonyi
Hydropsalis
NIGHTHAWK CLADE
OLD WORLD CLADE
POORWILL CLADE
Lyncornis
Figure 6. A phylogeny of the genera Lurocalis, Nyctidromus, and Nyctiprogne within the South American clade, based
on a maximum-likelihood (ML) analysis of a concatenated 5298-bp molecular data set. ML bootstrap values higher than
60 and Bayesian posterior probability values higher than 0.95 are displayed on the nodes. Names on the tree represent
current taxonomy; names on the right represent those resulting from this revision (see text).
Eurostopodus
Gactornis
Nyctiprogne
Lurocalis
Nyctidromus
“Caprimulgus” whitelyi - VENEZUELA
100
1 _ 82
“Caprimulgus” whitelyi - GUYANA Hydropsalis whitelyi
0.99 “Caprimulgus” whitelyi - GUYANA
Uropsalis segmentata segmentata - ECUADOR Hydropsalis segmentata
100 Uropsalis lyra lyra - ECUADOR
100
100
1
96
1 95
_ Uropsalis lyra peruana - PERU Hydropsalis lyra
1 1 Uropsalis lyra lyra - COLOMBIA
0.99
Uropsalis segmentata kalinowskii - BOLIVIA Hydropsalis segmentata*
“Caprimulgus” longirostris decussatus - Trujillo, PERU
100
1 “Caprimulgus” longirostris decussatus - Arequipa, PERU Hydropsalis decussatus
95 “Caprimulgus” longirostris decussatus - Ica, PERU
1
“Caprimulgus” parvulus heterurus - VENEZUELA Hydropsalis heterurus
100
1 “Caprimulgus” parvulus parvulus - PARAGUAY
100
1 _ 85 “Caprimulgus” parvulus parvulus - URUGUAY Hydropsalis parvulus
0.86 “Caprimulgus” parvulus parvulus - BOLIVIA
“Caprimulgus” maculicaudus - MEXICO

100
1 _97 “Caprimulgus” maculicaudus - BOLIVIA Hydropsalis maculicaudus
1 “Caprimulgus” maculicaudus - GUYANA
100 Macropsalis forcipata - Grande do Sul, BRAZIL
100 1 Macropsalis forcipata - Espirito Santo, BRAZIL
Hydropsalis forcipata
1
“Caprimulgus” cayennensis cayennensis - GUYANA
_
100
1 “Caprimulgus” cayennensis leopetes - Tobago Hydropsalis cayennensis
“Caprimulgus” cayennensis cayennensis - GUYANA
97 100
1 1 _
98 “Caprimulgus” cayennensis apertus - ECUADOR
_
100 1 “Caprimulgus” cayennensis insularis - COLOMBIA Hydropsalis albicauda
0.98
“Caprimulgus” cayennensis albicauda - PANAMA
Hydropsalis climacocerca climacocerca - Parra, BRAZIL
88
_
1 Hydropsalis climacocerca schomburgki - GUYANA
Hydropsalis climacocerca climacocerca - ECUADOR
100
Hydropsalis climacocerca climacocerca - BOLIVIA
1 Hydropsalis climacocerca
Hydropsalis climacocerca climacocerca - VENEZUELA
_86 Hydropsalis climacocerca canescens - Rio Madeira, BRAZIL
0.99
Hydropsalis climacocerca spp. - Rio Tocantins, BRAZIL
96
_
Hydropsalis torquata furcifer - URUGUAY
100
1 1 Hydropsalis torquata furcifer - URUGUAY Hydropsalis torquata
Hydropsalis torquata torquata - Entre Rios, ARGENTINA
“Caprimulgus” longirostris bifasciatus - ARGENTINA
_67 “Caprimulgus” longirostris bifasciatus - Yumbel, CHILE
0.97
“Caprimulgus” longirostris patagonicus - URUGUAY
“Caprimulgus” longirostris longirostris - Entre Rios, ARGENTINA
100
“Caprimulgus” longirostris atripunctatus - BOLIVIA Hydropsalis longirostris
1 “Caprimulgus” longirostris atripunctatus - BOLIVIA
“Caprimulgus” longirostris atripunctatus - Acomayo, PERU
_70 “Caprimulgus” longirostris atripunctatus - PERU
0.99
100 “Caprimulgus” longirostris atripunctatus - Cuzco, PERU
1
100 “Caprimulgus” longirostris roraimae - Bolivar, VENEZUELA
70 1
1
“Caprimulgus” longirostris roraimae - Amazonas, VENEZUELA Hydropsalis roraimae
“Caprimulgus” longirostris roraimae - Pantepui, VENEZUELA
87 “Caprimulgus” longirostris ruficervix - ECUADOR
1 100
1 “Caprimulgus” longirostris ruficervix - Merida, VENEZUELA Hydropsalis ruficervix
“Caprimulgus” longirostris ruficervix - Colima, COLOMBIA
100
Eleothreptus candicans - PARAGUAY Hydropsalis candicans
1 100 Eleothreptus anomalus - PARAGUAY
1 Eleothreptus anomalus - BRAZIL
Hydropsalis anomalus
NIGHTHAWK CLADE
OLD WORLD CLADE
POORWILL CLADE
Lyncornis
Figure 7. A phylogeny of the Hydropsalis group of the South American clade based on a maximum-likelihood (ML)
analysis of a concatenated 5298-bp molecular data set. ML bootstrap values higher than 60 and Bayesian posterior
probability values higher than 0.95 are displayed on the nodes. Names on the tree represent current taxonomy; names
on the right represent those resulting from this revision (see text).
between populations. In this study, sampling was too (Fig. 5): Antrostomus carolinensis (Gmelin, 1789)
sparse to test for the presence and directionality of (the chuck-will’s-widow) and its allies, on the one hand,
gene flow in the species. and Antrostomus vociferus Bonaparte, 1838 (the
Two individuals of C. gundlachii were sampled, one whip-poor-will) and its allies, on the other. The former
from Florida and the other from the Bahamas, but species group includes six traditionally recognized
the results from the two individuals are strikingly species: Antrostomus badius Bangs & Peck, 1908,
different. The nuclear data do not demonstrate that Antrostomus carolinensis, Antrostomus cubanensis
C. gundlachii is a distinct species, as it falls within Lawrence, 1860, Antrostomus rufus (Boddaert, 1783),
C. minor. The ND2 data tell the same story about A. salvini and Antrostomus seriocaudatus Cassin,
the Florida individual, thus suggesting it may be a 1849. Antrostomus carolinensis forms a reasonably
wrongly identified Chordeiles minor chapmani Coues, well-supported clade with the rufous nightjar (A.
1888 (see supporting information, Fig. S1). But, the rufus) and the greater Antillean nightjar (A.
ND2 sequence of the individual from the Bahamas is cubanensis). These three species form a larger clade
different from the Florida individual (3.5% divergent) with A. badius, A. salvini, and A. seriocaudatus. The
as well as all the other C. minor individuals, such relationships within this larger clade are not com-
that it is placed as their sister taxon. This is also the pletely resolved, but there is strong support for
result on the concatenated tree (Fig. 4). the sister relationships of A. badius and A. seriocau-
duatus, whereas the position of A. salvini within this
six-species clade is not resolved (Fig. 5).
THE POORWILL CLADE The vociferus species group contains three species
Within the poorwill clade relationships are relatively for which the phylogenetic relationships are well
well resolved on the phylogenetic tree using the con- resolved in this study (Fig. 5). Antrostomus vociferus
catenated data set (Fig. 5). The genus Siphonorhis is and Antrostomus arizonae Brewster, 1881, which
sister to the other poorwill genera with strong were previously one species (A. vociferus) are distinct
support. The genus Nyctiphrynus consists of four tra- species (with over 5% divergence in the ND2 data).
ditionally described species [Nyctiphrynus mcleodii Strong genetic structure among the subspecies within
(Brewster, 1888), Nyctiphrynus ocellatus (Tschudi, A. arizonae was not present; however, only five of the
1844), Nyctiphrynus rosenbergi (Hartert, 1895), and seven subspecies were sampled in this study (see
Nyctiphrynus yucatanicus (E. Hartert, 1892)], and is Table 1). Their sister species is the morphologically
the strongly supported sister group of the clade similar Antrostomus saturatus Salvin, 1870. The last
containing Antrostomus and Phalaenoptilus (Fig. 5). species in the poorwill clade is A. ridgwayi, which is
Nyctiphrynus rosenbergi (Hartert, 1895) (the Chocó positioned as the sister species to the A. arizonae/
poorwill) is the sister species of the remaining A. vociferus/A. saturatus clade, but with no support.
Nyctiphrynus species, with N. mcleodii being the
sister of N. ocellatus and N. yucatanicus.
Phalaenoptilus nuttallii (Audubon, 1844) (the THE SOUTH AMERICAN CLADE
common poorwill) is the only member of its genus, The largest of the three New World core clades has its
and is placed as the sister taxon to a large clade diversity almost entirely limited to South America,
containing the genus Antrostomus (Fig. 5). Genetic hence it is termed here the SA clade (Figs 6, 7). A
diversity among the five subspecies of P. nuttallii total of 21 biological species belong to this clade in
is very low (less than six polymorphic sites in the eight genera (Holyoak, 2001; Dickinson et al., 2003).
ND2 sequence), although Phalaenoptilus nuttallii Intraspecific diversity is high within many of the
dickeyi Grinnell, 1928 is distinct from the remaining species, particularly those with large ranges. In this
individuals sampled (0.7% divergence in ND2). This study, 29 phylogenetic species are identified within
subspecies is found on the southern half of the Baja this clade, and numerous species are moved into
Peninsula, south of the well-known biogeographic different genera.
boundary at 30°N (Lindell, Ngo & Murphy, 2006). There are four strongly supported lineages at the
Only one individual of P. n. dickeyi was sampled, so base of the SA clade. Three represent single genera:
more sampling is required to investigate its status. Lurocalis, a modified Nyctiprogne, and a modified
The remaining diversity of the poorwills is contained Nyctidromus (Fig. 6). A fourth clade, the Hydropsalis
in a strongly monophyletic clade that includes ten clade, includes the remaining five genera (Eleothre-
traditionally defined species (of which nine are ptus, Hydropsalis, Macropsalis, Uropsalis, and taxa
sampled in this study). All were previously assigned to in ‘Caprimulgus’; Fig. 7). Relationships among these
Caprimulgus, but have recently been moved into the four clades are not resolved on the concatenated tree
genus Antrostomus (Han et al., 2010; Chesser et al., (Fig. 6) because of conflict among genes. RAG-1 data
2012). Antrostomus can be split into two species groups place Lurocalis as the sister group to the other three,
but in the ND2 and ACO1 I9 trees, Nyctiprogne is 1923) and Nyctidromus nigrescens (Cabanis, 1849) are
sister to the others. Moreover, Nyctidromus is the both monotypic, but three subspecies are recognized of
sister group to the Hydropsalis clade on the ND2 tree, Nyctidromus hirundinaceus. Only two of those were
with low support, whereas RAG-1 and ACO1 I9 fail to sampled in the study, just one specimen of each, and
resolve this relationship (see supporting information only ND2 was sampled. Thus we could not address
Figs S1, S3 & S4). Relationships within these four possible genetic structure within the species, but
clades, on the other hand, are generally much better disjunct distributions of the three subspecies in the
resolved. Caatinga scrubland in eastern Brazil suggests the
Within Lurocalis there are two species, L. semitor- possibility that structure could be found.
quatus and Lurocalis rufiventris Taczanowski, 1884. Genetic diversity among the subspecies of Nycti-
Among the five subspecies sampled within L. dromus albicollis was investigated in this study, and
semitorquatus there is some slight genetic structure the results show that genetic structure is present.
using the mitochondrial markers, but there is no This is seen in all four markers, but is better sup-
support for this on the concatenated tree (Fig. 6). ported by the mitochondrial markers (see supporting
Nyctiprogne vielliardi (Lencioni-Neto, 1994), a species information, Figs S1 & S2). As can be seen in the tree
previously placed in Chordeiles, is included for resulting from the analysis of the concatenated data
the first time in a molecular phylogeny, and it is set (Fig. 6), there are at least three groups within
clearly within Nyctiprogne (Fig. 6). The other member N. albicollis that are separated geographically. One
of the genus is Nyctiprogne leucopyga (Spix, 1825), includes individuals from the southernmost part of
and we find strong support for dividing it into the species range, an individual of the subspecies
two phylogenetic species, as it is paraphyletic Nyctidromus albicollis derbyanus Gould, 1838,
with N. vielliardi (Fig. 6). One of the subspecies from southern Brazil, as well as two individuals
of N. leucopyga, Nyctiprogne leucopyga latifascia assigned to N. albicollis from Bolivia and eastern
Friedmann, 1945, is the sister taxon to a clade Brazil. The second group contains the remaining indi-
containing N. vielliardi and the two other sampled viduals of the nominate form from Guyana, Ven-
subspecies of N. leucopyga (N. l. leucopyga and ezuela, Ecuador, Peru, and Panama. The third group
Nyctiprogne leucopyga majuscula Pinto & Camargi, contains individuals from the northern parts of the
1952). There is over 8% divergence in the ND2 range of the species: the three Mexican subspecies
sequences between the two N. leucopyga groups, (Nyctidromus albicollis merrilli Sennett, 1888;
whereas the divergence between N. vielliardi and the Nyctidromus albicollis insularis Nelson, 1898; and
leucopyga/majuscula clade is 2.6%. There is also 7% Nyctidromus albicollis yucatanensis Nelson, 1901),
divergence between the two groups in the CYTB as well as two individuals from Panama that
sequence, whereas there is only 0.7% divergence in are assigned to Nyctidromus albicollis intercedens
the ACO1 I9 sequence. Only ND2 is available for Griscom, 1929. The subspecies Nyctidromus albicollis
N. vielliardi. gilvus Bangs, 1902, is the only subspecies not
Traditionally, Nyctidromus albicollis is the only sampled in this study.
species in its genus. Three species in the genus The remainder of the SA clade consists of 12 pre-
‘Caprimulgus’ – ‘Caprimulgus’ anthonyi (Chapman, viously described species (Dickinson et al., 2003) in
1923) (the scrub nightjar), ‘Caprimulgus’ hirun- five genera: Eleothreptus, Hydropsalis, Macropsalis,
dinaceus Spix, 1825 (the pygmy nightjar ), and Uropsalis, and ‘Caprimulgus’ that we place in
‘Caprimulgus’ nigrescens Cabanis, 1848 (the blackish Hydropsalis. Relationships within the Hydropsalis
nightjar) – form a clade with N. albicollis (Fig. 6) that clade are somewhat incongruent and unresolved
is the sister group to a larger clade containing the among the individual gene trees, in particular the
remaining ‘Caprimulgus’ species in the SA clade, as more basal nodes. The concatenated tree (Fig. 7)
well as four other genera (Eleothreptus, Hydropsalis, is the best resolved, with only two of the basal
Macropsalis, and Uropsalis). We assign all these to nodes receiving low bootstrap support. Hydropsalis
Hydropsalis (Fig. 7). This study is the first on nightjar (‘Caprimulgus’) whitelyi (Salvin, 1885) is resolved as
relationships to include ‘Caprimulgus’ hirundinaceus, the sister species to the remaining taxa (Fig. 7).
which is placed as the sister species to ‘Caprimulgus’ Despite its position receiving high bootstrap support
nigrescens, and these in turn are sister to a clade on the best scoring maximum-likelihood tree there
containing N. albicollis and ‘Caprimulgus’ anthonyi is considerable incongruence among the individual
(Fig. 6). We suggest that all of these species should be gene trees about its relationships, especially between
placed in Nyctidromus. The placement of Nyctidromus the mitochondrial data and RAG-1 (see supporting
hirundinaceus Spix, 1825 is only provided by ND2, as information Figs S1–S3).
it is the only marker sampled for the species, but the The next node upstream in the Hydropsalis clade
support is robust. Nyctidromus anthonyi (Chapman, on the concatenated tree (Fig. 7) separates the two
‘Uropsalis’ species from the remainder of the clade. Hydropsalis longirostris longirostris Bonaparte, 1825,
Interestingly, Hydropsalis (Uropsalis) segmentata and Hydropsalis longirostris patagonicus (Olrog,
is not monophyletic with Hydropsalis (Uropsalis) 1962)], but when mitochondrial data are included
lyra embedded within it. These taxa represent a rela- H. l. atripunctatus is marginally distinct from its
tively old lineage of Andean nightjars, and require a sister taxon H. l. bifasciatus (Fig. 7).
more thorough investigation of their species limits. The widespread Hydropsalis (‘Caprimulgus’)
The position of Hydropsalis (‘Caprimulgus’) parvulus maculicaudus (Lawrence, 1862) (the spot-tailed
(Gould, 1837) within the Hydropsalis clade is not nightjar) is the sister species to a clade containing
completely resolved, as there is incongruence among Hydropsalis cayennensis (Gmelin, 1789), Hydropsalis
the different gene trees (see supporting information climacocerca (Tschudi, 1844), Hydropsalis torquata
Figs S1–S4). In the concatenated tree it is the sister (Gmelin, 1789), and Hydropsalis forcipata Nitzsch,
species to a well-supported clade of 12 species, but 1840 (Fig. 7). Hydropsalis (Macropsalis) forcipata
because of a lack of support it effectively forms a (Bonaparte, 1850) is the sister species to a small clade
polytomy that includes the lyra/segmentata clade and containing the original members of the genus
Hydropsalis decussatus (Tschudi, 1844) (Fig. 7). The Hydropsalis, H. climacocerca and H. torquata, as well
results indicate that H. parvulus represents two as Hydropsalis (‘Caprimulgus’) cayennensis and its
phylogenetic species, as the four individuals of the close relative, the new species Hydropsalis albicauda
nominate subspecies form a distinct clade from sp. nov. (Fig. 7). The different gene trees are incon-
Hydropsalis parvulus heterurus. Unfortunately, only gruent regarding the relationships among these
a single skin specimen of H. p. heterurus was sampled species. The ND2 data (supporting information
in the study; however, a nearly complete ND2 Fig. S1) suggest that H. torquata and H. cayennensis
sequence was produced for this individual, and it are sister taxa, but the CYTB and ACO1 I9 trees
considerably differs (5%) from the three individuals of (see supporting information Figs S2 & S4) show
H. parvulus (Fig. 7). H. climacocerca and H. torquata forming a monophy-
The bulk of the diversity within the Hydropsalis letic clade, and this is the pattern seen on the con-
clade (nine nightjar species) forms a well-supported catenated tree with good support (Fig. 7).
subclade (Fig. 7). Half of that clade contains two Three of the five subspecies of H. climacocerca
species traditionally placed in Eleothreptus [Hydro- were investigated for potential intraspecific diversity,
psalis anomalus Gould, 1838 and Hydropsalis but there was no genetic structure. Within H.
candicans (Pelzeln, 1867)] and the polytypic cayennensis, however, the results from the ND2 data
Hydropsalis (‘Caprimulgus’) longirostris; however, suggest that there are two distinct clades, split
Hydropsalis longirostris is paraphyletic, as one of its roughly along a west–east axis with the subspecies
seven subspecies, Hydropsalis longirostris decussatus Hydropsalis cayennensis albicauda (Lawrence, 1875),
(Tschudi, 1844), is resolved more basally in the Hydropsalis cayennensis apertus (Peters, 1940),
Hydropsalis phylogeny than the other six subspecies, and Hydropsalis cayennensis insularis (Richmond,
which form a monophyletic clade. In fact, 1902) forming a strongly monophyletic clade, and
H. l. decussatus is outside the nine species that form then with Hydropsalis cayennensis cayennensis and
the core Hydropsalis clade (Fig. 7), and is clearly a Hydropsalis cayennensis leopetes (Jardine & Selby,
separate species. The ND2, CYTB, RAG-1, and the 1830) comprising a second clade (with 1.3% diver-
concatenated data sets are congruent in this place- gence in the ND2 sequences), a pattern that is also
ment of H. l. decussatus. There is considerable genetic retained in the concatenated tree (Fig. 7).
structure among the remaining subspecies of
H. longirostris, which mostly falls along subspecies
lines. The two northern subspecies, Hydropsalis
longirostris ruficervix (Sclater, 1866) and Hydropsalis THE OLD WORLD CLADE
longirostris roraimae Chapman, 1929, form separate The relationships among the ten species that repre-
clades that are distinct from one another (3.7% ND2 sent the Old World clade can be seen in the phylogeny
divergence), and from the remaining subspecies of Figure 3. This is only a small portion of the species
(5% ND2 divergence). This finding is supported in diversity within this clade, so little can be stated
particular by the ND2 data, but also by the ACO1 I9 about the results. The majority of the nodes are
data, and thus is present on the concatenated tree well supported on the tree based on the concatenated
(Fig. 7). The ACO1 data (see supporting information data, including the placement of Caprimulgus
Fig. S4) also suggest that Hydropsalis longirostris madagascariensis Sganzin, 1840 as the sister species
atripunctatus (Chapman, 1923) is separated from the to all the other taxa. Macrodipteryx vexillarius
remaining three subspecies of H. longirostris (Gould, 1838), the only member of its genus sampled
[Hydropsalis longirostris bifasciatus (Gould, 1837), in the study is placed well within Caprimulgus,
making Caprimulgus non-monophyletic within the data from different studies have not always been
Old World clade. congruent with one another. The most robust result
has been the sister-group relationship between the
nighthawk clade and the Old World clade, which is
DISCUSSION
supported by the RAG-1 data of Barrowclough
MAJOR NIGHTJAR LINEAGES et al. (2006), the combined three-marker data set of
The results presented in this study are largely Han et al. (2010), as well as by this study, in which
congruent with the findings of previous studies this relationship receives high bootstrap support
(Barrowclough et al., 2006; Larsen et al., 2007; Han (Fig. 2).
et al., 2010). The division of the family into the sub- The placement of the SA clade as the poorly sup-
families Chordeilinae and Caprimulginae is not supported sister group to the other three (Fig. 2) is the
ported, and the basal lineages within the family are same topology seen in the tree of Barrowclough et al.
members of the genera Eurostopodus and Lyncornis (2006), which is unsurprising as their tree is based on
(previously Eurostopodus), as well as a single species RAG-1. The concatenated maximum-likelihood tree in
from Madagascar, Gactornis enarratus (Figs 2, 3). the study of Han et al. (2010) places the poorwill clade
The recognition of Lyncornis as a separate genus as the most basal of the four, but without bootstrap
is corroborated, as the ‘old’ Eurostopodus is not support. Additional sampling of nuclear markers will
monophyletic. Lyncornis contains the Southeast Asian be needed to resolve these relationships. Regardless
Lyncornis macrotis (Vigors, 1831) and its relative of which clade is the sister to the remainder, the
Lyncornis temminckii (Gould, 1838). Lyncornis poorwill clade or the SA clade, it is evident that there
macrotis is polytypic, with five subspecies distributed are three independent radiation events in the New
from India, Myanmar, Thailand, Cambodia, and World, and that the Old World seems to have been
Vietnam to the Philippines and Sulawesi (Holyoak, re-colonized from the New World.
2001; Dickinson et al., 2003). It is highly likely that
some of these subspecies represent valid species, but
this remains unstudied. Lyncornis temmincki is
allopatric to L. macrotis, and is found on Sumatra RELATIONSHIPS WITHIN THE NIGHTHAWK CLADE
and Borneo and the southernmost part of the Malay The six traditionally defined species of the highly
Peninsula. Eurostopodus includes species that supported nighthawk clade have been placed in two
breed in Australia and Papua New Guinea: Eurosto- genera: Chordeiles and Podager (Fig. 4). The relation-
podus archboldi (Mayr & Rand, 1935), Eurostopodus ships among the species presented here are consistent
argus Hartert, 1892, and Eurostopodus mystacalis with previous studies (Barrowclough et al., 2006; Han
(Temminck, 1826) are the three species sampled in et al., 2010), but this analysis revealed evidence that
this study, but Cleere (2010) recognizes four more supports the split of at least one species into two or
species that breed in Papua New Guinea, the more phylogenetic species.
Solomon Islands, and in New Caledonia. They are The genus Chordeiles is paraphyletic, with C. pusil-
likely to belong to this clade as well. Eurostopodus is lus being more closely related to Podager nacunda
recovered as the sister to the remaining nightjars than to the other members of Chordeiles. This is
(Fig. 3), which was also seen in the study of Han congruent with previous studies. Han et al. (2010)
et al. (2010), but in both studies the support for this recommended placing P. nacunda in Chordeiles. We
topology is low. Improved character and taxon sam- suggest instead that Chordeiles pusillus be incorpo-
pling is required to clarify the exact placement rated into Podager. The two species have a distinct
of Eurostopodus and Lyncornis. The position of evolutionary history, as evidenced by their genetic
Gactornis enarratus as a single-species lineage sister distance to the other nighthawk taxa, distances that
to the core nightjar clade, first seen in Han et al. are comparable with those between distinct genera
(2010), is supported in this study with strong support elsewhere in the New World nightjar phylogeny. They
(Fig. 3). also share ecological and biogeographical similarities,
The remainder and bulk of nightjar diversity is despite noticeable size differences.
split into four major radiations that seemingly This is the first phylogenetic study that investi-
diversified over a narrow window of time. These four gates intraspecific genetic diversity in the polytypic
radiations have been consistently seen in all molecu- Chordeiles acutipennis and Chordeiles minor. The
lar phylogenetic studies of nightjars (Barrowclough results are strikingly different in these widespread
et al., 2006; Larsen et al., 2007; Han et al., 2010), and taxa. There is strong genetic structure within
the results of this study are no different. C. acutipennis, and we suggest elevating the subspe-
The topological relationships among these four core cies C. a. texensis to full species status. There is
clades, however, have proven difficult to resolve, and also some genetic evidence to suggest that the two
Central American subspecies Chordeiles acutipen- phologically to S. brewsteri, and thus is likely to be its
nis micromeris Oberholser, 1914 and Chordeiles sister species (Holyoak, 2001).
acutipennis littoralis Brodkorb, 1940 are separated The phylogenetic placement of Nyctiphrynus as
from the South American subspecies (Fig. 4), and that well as the relationships among the four species in
they are morphologically different from the nominate the genus is in agreement with the results of Han
form Chordeiles acutipennis acutipennis Hermann, et al. (2010). They found an indel in their nuclear
1783, Chordeiles acutipennis aequatorialis Chapman, data that supported the topology within the genus
1923, and Chordeiles acutipennis exilis (Lesson, (Han et al., 2010). The topological relationships
1839), being larger in size and with lighter coloured seen within Nyctiphrynus are surprising findings,
plumage. In fact, their morphology is more similar to as N. yucatanicus and N. mcleodii are both found in
C. texensis. Better sampling of individuals (including Mexico, whereas N. ocellatus is found isolated in
the missing subspecies Chordeiles acutipennis south-east Brazil, Bolivia, and Peru (although a little-
crissalis A.H. Miller, 1959) and increased sequence known subspecies Nyctiphrynus ocellatus lautus
data should clarify whether any more subspecies of C. Miller & Griscom, 1925, has been found in Nicaragua;
acutipennis represent distinct taxa, as was the case Holyoak, 2001; Dickinson et al., 2003).
with C. texensis. The sister relationship of Antrostomus and
On the other hand, there is no tangible genetic Phalaenoptilus is congruent with the results of Han
diversity among the nine subspecies of Chordeiles et al. (2010) and Barrowclough et al. (2006). Our
minor, perhaps as a result of the homogeneous range results support the monophyly of the reinstated genus
of the species. In particular, the seven subspecies Antrostomus (Han et al., 2010; Chesser et al., 2012),
breeding in North America lack clear range limits, with three additional species sampled that were not
and numerous hybrid zones have been suggested present in the study of Han et al. (2010): A. badius,
based on observations of morphology (Selander, 1954; A. cubanensis, and A. seriocaudatus. Topological rela-
Holyoak, 2001). Chordeiles minor is also a long- tionships within the genus are mostly congruent
distance migrant that winters in South America. between our study and theirs, with a few exceptions.
Information about wintering localities and breeding- A. carolinensis and A. rufus are sister species in their
site fidelity are scarce. results. In our study, A. cubanensis (missing from the
study of Han et al.) is present in a clade with the
other two species, but the relationships of the three
RELATIONSHIPS WITHIN THE POORWILL CLADE species are not well resolved. A paucity of data for
A. cubanensis is a likely explanation for the lack of
The second of the three major nightjar radiations in
support. There is also some evidence for intraspecific
the New World contains a collection of mostly North
genetic diversity within A. rufus that has not been
and Central American species, of which many are
demonstrated before.
known as poorwills. Based on traditional taxonomy,
Phylogenetic analysis indicates that A. rufus
there are 17 species in four genera: Siphonorhis,
is split into at least two independent lineages
Nyctiphrynus, Phalaenoptilus, and Antrostomus.
(Fig. 5). One includes individuals of the subspecies
There are only four species that breed on the South
Antrostomus rufus minimus (Griscom & Greenway,
American continent, a surprisingly low number. On
1937) and Antrostomus rufus otiosus (Bangs, 1911),
the other hand, of the three nightjar radiations, the
and the other individuals of Antrostomus rufus
poorwills are by far the most successful group to
rufus Boddaert, 1873, Antrostomus rufus rutilus
colonize the islands of the Caribbean, with species
(Burmeister, 1856), and Antrostomus rufus noctivi-
found on all of the Greater Antilles (Cuba, Hispaniola,
gulus (Wetmore & Phelps, 1953). These genetic results
Puerto Rico, and Jamaica; Holyoak, 2001; Dickinson
are only based on the ND2 sequences, as the majority
et al., 2003).
of the specimens sampled were museum skins. There is
about 2% divergence between these two lineages in the
ND2 sequence. This result is consistent with the
BASAL POORWILL GENERA observations of Wetmore & Phelps (1953), who recog-
The placement of Siphonorhis as the sister to the nized A. r. otiosus as a separate species; however,
other poorwill genera is congruent with the results of Robbins & Parker (1997) suggested that plumage and
Han et al. (2010). In both studies, only Siphonorhis vocal differences are not sufficiently distinct to justify
brewsteri (Chapman, 1917) (the least poorwill) was the elevation of A. r. otiosus to full species status.
sampled. Siphonorhis americana (the Jamaican Although a taxonomic change is not suggested for
poorwill), which by all accounts is extinct (it hasn’t A. rufus based on the limited results in this study,
been collected since 1859, and sighting reports since the genetic evidence clearly identifies two separate
then are few and unconfirmed), is very similar mor- lineages. A more rigorous examination of species limits
will require additional sampling of individuals [includ- Both mitochondrial and nuclear markers in our
ing missing subspecies Antrostomus rufus saltarius study support this, a result fully congruent with the
(Olrog, 1979)] and molecular markers, as well as a results of Han et al. (2010), and supports observations
closer look at their morphology. on the vocal differences between the two geographi-
According to Holyoak (2001) and Dickinson et al. cally disjunct species (Davis, 1972). Antrostomus
(2003) there are three subspecies of A. cubanensis: saturatus (the dusky nightjar) in Costa Rica is
Antrostomus cubanensis cubanensis Lawrence, 1860, described as being very similar morphologically to
which breeds on Cuba; Antrostomus cubanensis A. arizonae and A. vociferus (Cleere, 2010), so it is not
ekmani (Lönnberg, 1929), which breeds on His- surprising that it is their closest relative. The disjunct
paniola, and Antrostomus cubanensis insulaepinorum distributions of the three taxa in areas separated
(Garrido, 1983), which breeds on Isla de la Juventud, by well-known biogeographic barriers, along with
south of Cuba. Cleere (2010) elevated two of these their relationships (Fig. 5), suggest a vicariance event
subspecies to full species status, naming them the between North and Middle America.
Cuban nightjar (A. cubanensis) and the Hispaniolan Finally, the phylogenetic position of A. ridgwayi
nightjar (A. ekmani), respectively. All three are (the buff-collared nightjar) is not fully resolved. Its
similar in their morphology, with slight differences in placement within Antrostomus is well supported
plumage patterns. Song differences have been noted (Fig. 5), but its relationships to the two species groups
and because of their separated ranges on large (carolinensis group and vociferus group) are unclear.
islands it is possible that they are genetically distinct The results of Han et al. (2010) strongly place it as
and might be separate phylospecies (Garrido & the sister species to the carolinensis group, but here
Reynard, 1998). Unfortunately, these species are it is placed as the sister species to the vociferus group
poorly sampled in this study, with only old museum without support (Fig. 5).
skins being available. Because of the highly degraded One species that was not sampled in this study
state of the DNA extracted from toe pads of these (because of the paucity of available specimens),
skins, only a fraction of ND2 was sequenced, and from but which is likely to be placed in the vicinity
just one of the two subspecies (A. c. ekmani). of A. vociferus and the other whip-poor-wills, is
The phylogenetic relationships of A. badius (the A. noctitherus (the Puerto Rican nightjar, also known
Yucatan nightjar), A. salvini (the tawny-collared as the Puerto Rican whip-poor-will; Cleere, 2010). It
nightjar), and A. seriocaudatus (the silky-tailed night- is a critically endangered species with a very small
jar) are not fully resolved in this study, which is the range in south-eastern Puerto Rico. It has previously
first to include all three species. They are clearly been considered a subspecies of A. vociferus (Peters,
affiliated with the clade containing A. carolinensis, 1940), although its vocalizations are considerably dif-
A. cubanensis, and A. rufus, which is congruent with ferent (Reynard, 1962). It is very similar in morphol-
the results of Han et al. (2010). In their study, ogy to A. vociferus and A. arizonae.
A. salvini was sampled, whereas A. badius was not,
and they found A. salvini to be the sister species to
A. seriocaudatus, whereas in this study A. badius and RELATIONSHIPS WITHIN THE SOUTH
A. seriocaudatus are sister species with A. salvini in AMERICAN CLADE
an unresolved position within the clade of six species. The SA clade is the largest of the three core New
No skin or tissue specimen of A. salvini was sampled World clades, and it also has the least resolved phy-
here, but the CYTB sequence produced by Han et al. logeny and the most complex taxonomic problems
(2010) was used in our data set. Meanwhile, only ND2 (Figs 6, 7). As discussed earlier, the relationships at
was available for A. badius, so there was no overlap- the base of the SA clade are poorly resolved. Despite
ping data with A. salvini. It was therefore impossible our more complete taxon sampling, there is little
to comprehensively test the relationships of these improvement on the results of Han et al. (2010),
species, and more data are needed. which also had poor resolution. Conflict in the topo-
There is strong genetic evidence for dividing the logical signal of the different loci seems to be the
whip-poor-will into two distinct species, as published cause of this. The RAG-1 tree is the best resolved
in a recent supplement to the American Ornitholo- (see supporting information Fig. S3), just as the
gists’ Union Check-list of North American Birds, same nodes on the much smaller phylogeny of
where the nominate form was recognized as a sepa- Barrowclough et al. (2006) were fully resolved.
rate species, A. vociferus, keeping the common name The genera Lurocalis and Nyctiprogne were both pre-
whip-poor-will, whereas the remaining five sub- viously placed in the Chordeilinae, along with the
species were pooled into a single species the Mexican nighthawks Chordeiles and Podager, as well as the
whip-poor-will (Antrostomus arizonae; Chesser et al., basal nightjars Eurostopodus and Lyncornis, mostly
2012). based on the lack of rectal bristles and the same
number of secondaries (13, but Nyctiprogne may only in which both ‘C’. nigrescens and ‘C’. anthonyi were
have 12 secondaries; see Ridgway, 1914). Molecular placed in a clade with N. albicollis. Our results provide
results from a number of phylogenetic studies clearly the first molecular evidence for the placement of
refute this classification (Barrowclough et al., 2006); ‘C’. hirundinaceus in this clade. Han et al. (2010)
Han et al., 2010; this study). Moreover, the placement suggested that these species (including N. albicollis)
of Lurocalis and Nyctiprogne within the SA clade is should be placed in the genus Hydropsalis like all
seen in the study of Barrowclough et al. (2006) as well the other taxa in the SA clade; however, we suggest
as in our RAG-1 data. retaining Nyctidromus, and moving the three species
This study presents strong evidence that Luroca- anthonyi, hirundinaceus, and nigrescens into that
lis semitorquatus (the short-tailed nighthawk) and genus from ‘Caprimulgus’.
Lurocalis rufiventris (the rufous nighthawk) in the This study provides the first insight into the
SA clade (Fig. 6) are two separate species, contra pre- intraspecific genetic diversity of the Pauraque
vious studies (Peters, 1940; Sibley & Monroe, 1990). (N. albicollis; Fig. 6). Our results for both nuclear and
As species of Lurocalis are not closely related to the mitochondrial markers show three distinct geographi-
nighthawks in Chordeiles and Podager, we suggest a cally separated subclades within this biospecies. We
change in their vernacular names is warranted. therefore propose that N. albicollis be split into three
The molecular phylogeny produced in this study phylogenetic species, with members of the nominate
provides a drastically altered picture of the genus subspecies albicollis north of the Amazon retaining
Nyctiprogne. Not only does it provide the first genetic the name N. albicollis (the type is from Guyana;
evidence for moving the species Chordeiles vielliardi Holyoak, 2001), and with individuals from the south-
into the genus, as previously suggested on the ernmost part of the range, including Brazil south of
basis of morphology (Whitney et al., 2003; Cleere, the Amazon, as well as individuals of derbyanus,
2010), but it also suggests that the paraphyletic placed in the reinstated species N. derbyanus. The
species Nyctiprogne leucopyga be split into two unre- four Central American and Mexican subspecies form
lated phylospecies, with N. leucopyga as sister to the third phylospecies, N. merrilli.
N. vielliardi (Fig. 6). The subspecies latifascia is The external morphology of the Pauraque has been
elevated to full species status, as Nyctiprogne studied extensively (Hartert, 1892; Griscom, 1929;
latifascia Friedmann, 1945. It has been suspected that Grant, 1965). Hartert (1892) suggested that there is
the biospecies N. leucopyga may not be a single clinal variation in plumage morphology, with individ-
species, and in particular that Nyctiprogne latifascia uals in the wet tropics being darker and smaller in
latifascia may be a separate species (Friedmann, size than individuals in more arid regions. The mor-
1945). Morphological diversity within Nyctiprogne is phological variability also falls along subspecies lines,
very limited, with subtle plumage differences among however, and observations on the external plumage
the recognized subspecies, but N. l. latifascia is dis- morphology of the three phylospecies proposed in this
tinct from the others, being overall darker in colour study show that they clearly differ from one another.
and less vermiculated (Friedmann, 1945). Differences Nyctidromus albicollis is the smallest of the three.
in vocalizations have also been observed (Naka, 2012). Overall it is the darkest, with a soot-grey head, but
The status of the two subspecies of N. leucopyga that also has distinct brown markings on its back and
are not sampled in this study, Nyctiprogne leucopyga coverts. Nyctidromus derbyanus is the largest of the
exigua Friedmann, 1945 and Nyctiprogne leucopyga three phylospecies and the most conspicuously
pallida Phelps & Phelps Jr, 1952, remains uncer- reddish brown in colour, with the crown, back, and
tain. Based on their distribution in Venezuela, it is coverts rustic–brown. Nyctidromus merrilli is inter-
possible that they are closely related to N. latifascia, mediate in size and the plumage is both lighter and
in particular N. l. exigua, the range of which is greyer than in the other two phylospecies, with a
parapatric with N. latifascia in southern Venezuela. slate-grey coloration on the crown and back being
However, the morphology of both N. l. exigua and particularly noticeable. There are also conspicuous
N. l. pallida is more similar to N. leucopyga than to black patterns on the coverts of N. merrilli, which in
N. latifascia. both N. albicollis and N. derbyanus tend to be
We present a highly modified Nyctidromus in this browner. Some individuals in arid areas of Mexico are
study. Three species traditionally placed in ‘Capri- slightly more reddish in colour, but overall the three
mulgus’ – ‘Caprimulgus’ anthonyi (the scrub nightjar), named forms within N. merrilli (N. m. insularis,
‘Caprimulgus’ hirundinaceus (the pygmy nightjar), N. m. merrilli, and N. m. yucatanensis) are similar to
and ‘Caprimulgus’ nigrescens (the blackish nightjar) – one another. These morphological differences are con-
are more closely related to the Pauraque (N. albicollis) gruent with our genetic results, thus reinforcing the
than they are to any other ‘Caprimulgus’ species. This taxonomic modifications suggested above. Neverthe-
is congruent with the results of Han et al. (2010), less, more extensive morphological work is needed on
these taxa using specimens across the entire geo- 2000; Cadena, Klicka & Ricklefs, 2007; Weir, 2009;
graphic range. Also, one additional subspecies of Sedano & Burns, 2010). They are further divided into
Nyctidromus ‘albicollis’ was not sampled in the subspecies, and thus it is likely that these two species
molecular phylogeny. Nyctidromus albicollis gilvus might represent more than two phylogenetic species.
Bangs, 1902 is similar in size to the nominate form, Unfortunately, the intraspecific sampling for these
but is considerably lighter in colour. Genetic data are species is very poor in this study, so we could not
needed to address its taxonomic status. investigate this thorougly. Our results, however, indi-
The remaining nightjar taxa in the SA clade form a cate that H. segmentata is paraphyletic with respect
well-defined clade. They represent five genera includ- to H. lyra. Clearly, this species complex requires
ing a paraphyletic collection of ‘Caprimulgus’ species, further study to unravel its complex taxonomy. The
and thus provide a complicated taxonomic problem biogeographic patterns of these species even suggest
(see Fig. 7). We propose that all of the species in this that this might be a case of leapfrog speciation, a
clade be placed in Hydropsalis, including species cur- phenomenon that is well known in other Andean bird
rently placed in Eleothreptus, Macropsalis, and groups (Maijer & Fjeldså, 1997; Johnson, 2002;
Uropsalis. This is very similar to the recommendation Cadena, Cheviron & Funk, 2011).
made by Han et al. (2010). They suggested, however, It has been suggested that H. parvulus is in fact
that all the species in the SA clade should be placed two separate species. Traditionally, there are two
in Hydropsalis, including species in Lurocalis, subspecies recognized that have allopatric ranges:
Nyctidromus, and Nyctiprogne. We do not think Hydropsalis parvulus heterurus Todd, 1915, found in
it is necessary to enlarge Hydropsalis to that northern Colombia and Venezuela, and the nominate
degree, given the taxonomic modifications described Hydropsalis parvulus parvulus Gould, 1837, with a
above. Lurocalis, Nyctidromus, and Nyctiprogne form large range south of the Amazon from eastern Peru
well-supported monophyletic entities. Retaining throughout Bolivia, Paraguay, and most of Brazil, as
Eleothreptus, Macropsalis, and Uropsalis is more well as northern Argentina and Uruguay (Holyoak,
complicated, as this would require placing some 2001; Dickinson et al., 2003). The two subspecies are
species currently in ‘Caprimulgus’ [e.g. ‘C.’ whitelyi, very similar morphologically, but H. p. heterurus has
the Roraiman nightjar; ‘C.’ parvulus, the little more extensive white areas near the tips of the
nightjar; and ‘C.’ maculicaudus, the spot-tailed night- restrices (Holyoak, 2001). Their territorial calls are
jar] in new genera, some of which would be also considerably different (Davis, 1979; Cleere,
monotypic. To avoid this, slightly modifying the taxo- 2010). Cleere (2010) elevated the two subspecies to
nomic suggestions of Han et al. (2010) is a more species status and named them Antrostomus parvulus
pragmatic solution. and Antrostomus heterurus, with the latter receiving
The two genera Uropsalis and Macropsalis have the common name Todd’s nightjar. Despite limited
been thought to be closely related, and were even sampling of individuals and genetic data, the
merged in Macropsalis by Holyoak (2001) and sequence evidence lends support to elevating
Cleere (2010). The three species in these two genera H. p. heterurus to species status, and thus we agree
[Hydropsalis (Uropsalis) lyra (Bonaparte, 1859) with Cleere (2010), except we do not place the species
(the lyre-tailed nightjar); Hydropsalis (Uropsa- in Antrostomus, and instead place it in Hydropsalis.
lis) segmentata (Cassin, 1849) (the swallow-tailed Hydropsalis longirostris (the band-winged nightjar)
nightjar); and Hydropsalis (Macropsalis) forcipata is the most taxonomically diverse nightjar species
(Nitzsch, 1840) (the long-trained nightjar)] all have in the New World, with seven recognized subspecies
long tail feathers, in which the outermost retrices are (Holyoak, 2001; Dickinson et al., 2003) that are
greatly elongated, a secondary sexual trait only seen spread over a large distributional range in various
in males, as members of all three species are polyga- habitats, as well as being morphologically diverse.
mous and have lek breeding systems (Holyoak, 2001). No phylogenetic study has previously evaluated the
In this study, Macropsalis forcipata is included in status of these subspecies. Cleere (2010) elevates
a phylogeny for the first name, and contrary to the two of the subspecies to full species status,
proposals of Holyoak (2001) and Cleere (2010), it H. l. decussatus and H. l. roraimae (Chapman, 1929),
should not be affiliated with the two ‘Uropsalis’ based on observations on their morphology. He called
species, as they are in separate lineages (Fig. 7). them the Tschudi’s nightjar and Tepui nightjar,
The two ‘Uropsalis’ species, Hydropsalis lyra and respectively, and placed them in Antrostomus, as he
Hydropsalis segmentata provide a taxonomic chal- did all other New World nightjars in ‘Caprimulgus’.
lenge. The two species have very fragmented ranges This study provides genetic evidence that supports
throughout the high montane forests of the North and the full species status of these taxa, as well as
Central Andes, areas known to promote high specia- H. ruficervix (P.L. Sclater, 1866), with all three
tion rates in birds (e.g. Garcia-Moreno & Fjeldså, species being placed in Hydropsalis.
The morphology of both H. roraimae and H. ruficer- uals assigned to H. c. albicauda, H. c. apertus, and
vix is distinctively different from the other subspecies H. c. insularis can be included in new species
also considered part of H. longirostris. There are some Hydropsalis albicauda, and the subspecies H. c.
obvious similarities, such as the slender body shape, cayennensis and H. c. tobagensis form the modified
long beak, and plumage patterns, including a white Hydropsalis cayennensis. The molecular data support
throat patch, a brownish collar on the hind neck, a this taxonomic modification, although the morphology
white band on the four outermost primaries, and of the two is nearly identical. One trait that may
broad white tips and bands across the inner margin distinguish between them is that males of apertus
of their tail feathers. However, H. ruficervix and and insularis (less so albicauda) have darker, more
H. roraimae have a much darker plumage, with the auburn-coloured patterns on the crown, whereas
white markings being less conspicuous. cayennensis and tobagensis have noticeably more
Although H. decussatus is much more similar white pattern on the crown. Better sampling of indi-
to ‘H. longirostris’ than either H. roraimae or viduals and additional genetic markers is recom-
H. ruficervix, it is not closely related as previously mended to test the limits of these taxa.
thought. It is considerably smaller and paler, with Finally, there is one nightjar species from South
sandy–light brown being the most prominent America that was not sampled in this study, and it is
colour in its plumage, rather than grey or dark not clear where it might fall in the phylogeny. This
brown; however, it does look very similar to H. l. is ‘Caprimulgus’ maculosus (the cayenne nightjar). It
atripunctatus, in particular, which is also small in size is known from only a single museum specimen col-
and has pale plumage, although H. l. atripunctatus lected in 1917 in French Guiana. It is supposedly
has a larger white throat patch and more prominent similar to the sympatric Nyctidromus nigrescens
reddish brown and orange patterns in its plumage. (blackish nightjar) (Griscom & Greenway, 1937). No
Thus, it is surpising that H. decussatus is not a close other information is available about this species, but
relative of H. longirostris, perhaps the most unexpec- it is likely that it is related to N. nigrescens and thus
ted result in this study. It is possible that atripunctatus could be included in the genus Nyctidromus.
is a separate species in itself which might be
expected as it is morphologically distinct from
other subspecies of H. longirostris (H. l. bifasciatus,
H. l. longirostris, and H. l. patagonicus), but the THE OLD WORLD CLADE
molecular support for this is inconsistent in our data The last of the four large caprimulgid radiations
set, so we recommend further genetic sampling to is a highly diverse clade exclusive to the Old World,
investigate that. with the majority of the diversity in Africa and South
We recommend placing the two ‘Eleothreptus’ East Asia, with a few species breeding in Europe,
species, H. anomalus (the sickle-winged nightjar) and the Middle East, and India. As this study focused
H. candicans (white-winged nightjar), in Hydropsalis. on the diversity in the New World, this group was
The affinities of these two species were suspected heavily under-sampled. Only nine species of the 36
based on observations of morphology and vocaliza- species belonging to the genera Caprimulgus and
tions by Cleere (2002), and they were supported by Macrodipteryx (Dickinson et al., 2003) were sampled
the CYTB data of Larsen et al. (2007), as is confirmed (Fig. 3), all of which are monophyletic. These ten
in this study. species are: Caprimulgus batesi Sharpe, 1906 (Bate’s
As discussed above, H. forcipata (the long-trained nightjar); Caprimulgus climacurus Viellot, 1825 (the
nightjar) is not related to the species traditionally long-tailed nightjar); Caprimulgus europaeus (the
placed in Uropsalis. It is instead closely related to European nightjar); Caprimulgus fossii Hartlaub,
H. cayennensis and H. albicauda (the white-tailed 1857 (the square-tailed nightjar); Caprimulgus
nightjars), H. climacocerca (the ladder-tailed night- macrurus Horsfield, 1821 (the large-tailed nightjar);
jar), and H. torquata (the scissor-tailed nightjar), Caprimulgus madagascariensis Sganzin, 1840 (the
which like H. forcipata are known for polygyny and Madagascar nightjar); Caprimulgus pectoralis Cuvier,
the presence of long tail feathers in males, a second- 1816 (the fiery-necked nightjar); Caprimulgus polio-
ary sexual character. This leads to the inference that cephalus Rüppell, 1840 (the Abyssinian nightjar); and
these traits were lost in the white-tailed nightjar Macrodipteryx vexillarius (Gould, 1838) (the pennant-
complex (Hydropsalis cayennensis), which is sister to winged nightjar).
H. climacocerca, as well as in H. albicauda, which is A number of other taxa have been placed in this
sister to H. cayennensis (Fig. 7). Old World clade in previous studies. Larsen et al.
We propose here that H. cayennensis should be con- (2007) included Caprimulgus inornatus, Caprimul-
sidered as two phylospecies, as the genetic split gus fraenatus, and Macrodipteryx longipennis in
between them has a clear geographic signal. Individ- this clade, whereas Han et al. (2010) included
Caprimulgus affinis, Caprimulgus aegyptius, Capri- review of these revised genera is needed to identify
mulgus indicus, Caprimulgus manillensis, Capri- diagnostic morphological traits.
mulgus nigriscapularis, and Caprimulgus rufigena.
Thus, when merging the results from all available
studies, 18 species of Old World nightjars fall within PODAGER WAGLER, 1832
the Old World clade. This leaves another 18 species
that will need to be sampled to fully understand their Type species
relationships within this clade. These 18 species are Podager nacunda (Viellot, 1817).
all members of the genus Caprimulgus, except for the
two species in Macrodipteryx that are also embedded
Definition
within this clade. Hence, the name Macrodipteryx
The clade containing P. nacunda and all species
must be synonymized with Caprimulgus. It is pos-
that share a more recent common ancestor with
sible that some Old World Caprimulgus species that
P. nacunda than with Chordeiles acutipennis, Chor-
have not been included in any phylogenetic study
deiles gundlachii, Chordeiles minor, Chordeiles
will fall outside the Old World clade, as was the case
rupestris, Chordeiles texensis, or any species in the
with Gactornis enarratus. For example, there is the
genera Antrostomus, Caprimulgus, Eurostopodus,
unusual African species Veles binotatus Bonaparte,
Gactornis, Hydropsalis, Lyncornis, Macrodipteryx,
1850, the placement of which in the caprimulgid
Nyctidromus, Nyctiphrynus, Nyctiprogne, Phalae-
phylogeny is unknown, and unfortunately was not
noptilus, Siphonorhis, or Veles.
sampled in this study.
Consequently, there is considerable intraspecific
diversity within a number of Old World nightjar
Included species
species that needs to be investigated. Based on what
Podager nacunda (Viellot, 1817) and Podager pusillus
this study has demonstrated about New World diver-
(Gould, 1861).
sity, it is likely that Old World species with numerous
recognized subspecies may be split into two or more
phylospecies. This is especially likely in species
Comments
with large breeding ranges in tropical areas such
Genetic evidence strongly demonstrates that Chor-
as Caprimulgus aegyptius, C. affinis, C. climacurus,
deiles pusillus (Gould, 1861) is the sister taxon to
C. fossii, C. macrurus, C. natalensis, C. nubicus,
Podager nacunda (Viellot, 1817), and should not
C. pectoralis, and C. tristigma (Dickinson et al., 2003).
remain in Chordeiles (Fig. 4). Sequence divergence
A study similar in scope to this one should be per-
between P. nacunda and P. pusillus is quite high in
formed, focusing on the Old World nightjars.
the mitochondrial markers (12.0–13.5%). In the two
nuclear markers, the sequence divergence is lower
TAXONOMIC MODIFICATIONS between P. pusillus and P. nacunda (1.1% in RAG-1
and 3.7% in ACO1 I9) than between P. pusillus and
Based on the results of this study and comparisons C. acutipennis (1.6% in RAG-1 and 4.8% in ACO1 I9),
with previous work, a number of taxonomic modifica- as well as P. pusillus and C. minor (2.4% in RAG-1
tions are recommended here. It should also be noted and 4.7% in ACO1 I9). Han et al. (2010) moved
that there are a number of species requiring more P. nacunda into Chordeiles, but on our evidence we
detailed taxonomic analysis, and thus this list is suggest the opposite modification, to place Chordeiles
expected to be modified in the future. A phylogeny pusillus within Podager.
presenting all the New World species using the pro-
posed modified taxonomy is depicted in Figure 8.
CHORDEILES SWAINSON, 1832

GENERIC REVISIONS
Type species
Six nightjar genera are revised in this study. The Chordeiles minor (J.R. Forster, 1771).
modifications range from a simple move of a single
species from one genus to another (Podager), to more
complex recommendations in which multiple species Definition
in five different genera are moved into a single genus The clade containing C. minor and all species that
(Hydropsalis). These revisions and phylogenetic defi- share a more recent common ancestor with C. minor
nitions of groups are based on the molecular phylog- than with Podager nacunda, Podager pusillus, or any
eny produced in this study (Fig. 8) and the diagnostic species in the genera Antrostomus, Caprimulgus,
characters in the sequence data. A morphological Eurostopodus, Gactornis, Hydropsalis, Lyncornis,
Eurostopodus archboldi
96
77 100
Eurostopodus argus
97 Eurostopodus mystacalis
100
100
Gactornis enarratus
100
100
Nyctiprogne latifascia
100
100 100 Nyctiprogne vielliardi
100 87 Nyctiprogne leucopyga
83
100 Lurocalis rufiventris
100 100
100 100 Lurocalis semitorquatus
100
100 Hydropsalis whitelyi
100 100
95 100 Hydropsalis decussatus
100
100 Hydropsalis heterurus
100 99 Hydropsalis parvulus
100
100 Hydropsalis forcipata
100 100
100 100
100
Hydropsalis albicauda
99 / 86
75 100 100 Hydropsalis cayennensis

95
94 100
57 99 100 Hydropsalis torquata
94 100
73 68 100
100
Hydropsalis climacocerca
100 Hydropsalis maculicaudus
South American Clade
97
95
74 81
100
100
Hydropsalis candicans
(29 species)
100 100 Hydropsalis anomalus
100 98
100 Hydropsalis ruficervix
62 99 100
100 Hydropsalis longirostris
98 100
100
Hydropsalis roraimae
100
Hydropsalis segmentata segmentata
100
100 95 Hydropsalis segmentata kalinowskii
93 100
98
Hydropsalis lyra
100 Nyctidromus hirundinaceus
100 98 100
82 100 Nyctidromus nigrescens
97
99 100
60 Nyctidromus anthonyii
100 Nyctidromus merrilli
89 100 96
98
98
100 83 93 Nyctidromus derbyanus
92 87 Nyctidromus albicollis
96
Siphonorhis brewsteri
100 Phalaenoptilus nuttallii
93
Antrostomus salvini
99 Antrostomus carolinensis
100 85 83 100
98 100 Antrostomus rufus
95 62 97
76
Antrostomus cubanensis
65
99
Antrostomus badius
92
60 81 94
98
Antrostomus seriocaudatus Poorwill Clade
96
100 100
100 Antrostomus arizonae
(16 species)
100 99 100
87 100 Antrostomus vociferus
65 100
100 Antrostomus ridgwayi
60
Nyctiphrynus rosenbergi
91 100 Nyctiphrynus mcleodii
60
100 100
100 Nyctiphrynus yucatanicus
100 100 Nyctiphrynus ocellatus
100
100 Podager pusillus
100 100
100 100 Podager nacunda
100
100
100
100
100
100 78
97
Chordeiles minor Nighthawk Clade
100 Chordeiles rupestris
100
100 100
100
(7 species)
100 100 100 Chordeiles texensis
93 100 96
89
Chordeiles acutipennis
Caprimulgus madagascariensis
100 Caprimulgus poliocephalus
100
100 100 Caprimulgus pectoralis
100
100 Caprimulgus batesi
Maximum Likelihood 100
100
Caprimulgus macrurus Old World Clade
Bootstrap Support 71
Caprimulgus europaeus
Maximum Parsimony 98
61 78
Macrodipteryx vexillarius
Bootstrap Support
100
Caprimulgus climacurus
100 Caprimulgus fossii
97
Lyncornis temminckii
86 100
Lyncornis macrotis
100
Figure 8. A summary tree showing 52 New World nightjar species using the taxonomy recommended in this study. Also
shown are 15 Old World species. Maximum-likelihood (ML) and maximum-parsimony (MP) bootstrap scores are displayed
above and below the nodes.
Macrodipteryx, Nyctidromus, Nyctiphrynus, Nycti- already been supported by morphological and vocali-
progne, Phalaenoptilus, Siphonorhis, or Veles. zation data (Chesser et al., 2012).
Included species NYCTIPROGNE BONAPARTE, 1857

Chordeiles acutipennis (Hermann, 1783), Chordeiles
Type species
gundlachii (Lawrence, 1856), Chordeiles minor
Nyctiprogne leucopyga (Spix, 1825).
(J.R. Forster, 1771), Chordeiles rupestris (Spix, 1825),
and Chordeiles texensis (Lawrence, 1856).
Definition
The clade containing N. leucopyga and all species
Comments
Genetic and morphological evidence supports the
N. leucopyga than with Hydropsalis albicauda, H.
elevation of C. a. texensis to full phylogenetic species
anomalus, H. candicans, H. cayennensis, H. climaco-
status (see below). Chordeiles pusillus is moved to
cerca, H. decussatus, H. forcipata, H. heterurus,
Podager and C. vielliardi is moved to Nyctiprogne.
H. longirostris, H. lyra, H. maculicaudus, H. parvu-
lus, H. roraimae, H. ruficervix, H. segmentata,
ANTROSTOMUS BONAPARTE, 1838 H. torquata, H. whitelyi, Lurocalis rufiventris, L.
semitorquatus, Nyctidromus albicollis, N. anthonyi,
Type species
N. derbyanus, N. hirundinaceus, N. merrilli, and
Antrostomus carolinensis (previously Caprimulgus
N. nigrescens, or with species in other nightjar genera
carolinensis J.F. Gmelin, 1789).
such as Antrostomus, Caprimulgus, Chordeiles,
Eurostopodus, Gactornis, Lyncornis, Macrodipteryx,
Definition Nyctiphrynus, Phalaenoptilus, Podager, Siphonorhis,
The clade containing A. carolinensis and all species or Veles.
A. carolinensis than with Phalaenoptilus nuttallii,
Included species
or any species in the genera Nyctiphrynus and
Nyctiprogne latifascia (Friedmann, 1945), Nycti-
Siphonorhis, or with species in other nightjar genera
progne leucopyga (Spix, 1825), and Nyctiprogne
such as Caprimulgus, Chordeiles, Eurostopodus,
vielliardi (Lencioni-Neto, 1994).
Gactornis, Hydropsalis, Lyncornis, Macrodipteryx,
Nyctidromus, Nyctiprogne, Podager, and Veles.
Comments
Genetic evidence supports the placement of
Included species Chordeiles vielliardi in Nyctiprogne, as suggested by
Antrostomus arizonae (Brewster, 1881), Antrostomus Whitney et al. (2003). This study also provides evi-
badius (Bangs & Peck, 1908), Antrostomus carolinen- dence for the elevation of N. leucopyga latifascia
sis (Gmelin, 1789), Antrostomus cubanensis (Law- to full phylogenetic species status as N. latifascia
rence, 1860), Antrostomus noctitherus (Wetmore, (Fig. 6), which is in agreement with Friedmann
1919), Antrostomus ridgwayi (Nelson, 1897), Antro- (1945), based on his observations of its morphology
stomus rufus (Boddaert, 1783), Antrostomus salvini and vocalizations.
(Hartert, 1892), Antrostomus saturatus (Salvin,
1870), Antrostomus seriocaudatus (Cassin, 1849), and
Antrostomus vociferus (Wilson, 1812). The inclusion of NYCTIDROMUS GOULD, 1838
A. ekmani, as suggested by Cleere (2010), is possible, Type species
but this study does not have data to support its split Nyctidromus albicollis Gmelin, 1789.
from A. cubanensis.
Definition
Comments The clade containing N. albicollis and all species
Genetic evidence in this study supports the move of that share a more recent common ancestor with
these 11 species from Caprimulgus into Antrostomus N. albicollis than with Hydropsalis albicauda, H.
(Han et al., 2010; Chesser et al., 2012), and demon- anomalus, H. candicans, H. cayennensis, H. climaco-
strates the monophyly of the genus (Fig. 5). This was cerca, H. decussatus, H. forcipata, H. heterurus,
proposed by Han et al. (2010), but this study also H. longirostris, H. lyra, H. maculicaudus, H. parvu-
provides the first molecular evidence for the place- lus, H. roraimae, H. ruficervix, H. segmentata, H.
ment of A. cubanensis and A. seriocaudatus in the torquata, H. whitelyi, Lurocalis rufiventris, L. semi-
genus, as well as the elevation of A. v. arizonae to full torquatus, Nyctiprogne latifascia, N. leucopyga, and
phylogenetic species status as A. arizonae, which has N. vielliardi, or with species in other nightjar genera
such as Antrostomus, Caprimulgus, Chordeiles, parvulus (Gould, 1837), Hydropsalis roraimae

Eurostopodus, Gactornis, Lyncornis, Macrodipteryx, (Chapman, 1929), Hydropsalis ruficervix (P.L. Sclater,
Nyctiphrynus, Phalaenoptilus, Podager, Siphonorhis, 1866), Hydropsalis segmentata (Cassin, 1849),
or Veles. Hydropsalis torquata (J. F. Gmelin, 1789), and
Hydropsalis whitelyi (Salvin, 1885).
Included species
Nyctidromus albicollis (Gmelin, 1789), Nyctidromus Comments
anthonyi (Chapman, 1923), Nyctidromus derbyanus Genetic evidence in this study supports a large clade
(Gould, 1838), Nyctidromus hirundinaceus (Spix, that contains members of five genera: Caprimul-
1825), Nyctidromus merrilli (Sennett, 1888), and gus, Eleothreptus, Hydropsalis, Macropsalis, and
Nyctidromus nigrescens (Cabanis, 1848). Uropsalis (Fig. 7). The name Caprimulgus cannot be
used for any New World taxa, as the type species is
Comments Caprimulgus europaeus (Linnaeus, 1758), a member
Genetic evidence supports the hypothesis that Capri- of the crown Old World radiation. The species in
mulgus anthonyi, C. hirundinaceus, and C. nigrescens this clade, traditionally placed in Caprimulgus, do
are all more closely related to Nyctidromus albicollis not form a monophyletic assemblage, and cannot
than to other New World species previously placed in be placed in a single genus unless membership is
the genus Caprimulgus (Fig. 6). These results for extended to the other four New World genera. There-
C. anthonyi and C. nigrescens are congruent with fore, in order to avoid creating additional new genera
those of Han et al. (2010), but this is the first to maintain the monophyly of Hydropsalis itself, we
genetic evidence to support this placement of conclude that the simplest and preferable solution is
C. hirundinaceus. Thus, it is suggested that all three to move the species of Eleothreptus, Hydropsalis,
species be moved into Nyctidromus. Genetic evi- Macropsalis, and Uropsalis into a single genus,
dence also supports dividing the polytypic species along with the previous members of Caprimulgus.
N. albicollis into three distinct phylogenetic species: Hydropsalis is the oldest available name. Unlike Han
N. albicollis, N. derbyanus, and N. merrilli (see et al. (2010), we do not propose to move members
species descriptions below). of Lurocalis, Nyctidromus, and Nyctiprogne into
Hydropsalis.
HYDROPSALIS WAGLER, 1832
Type species CHANGES IN SPECIES LIMITS
Hydropsalis torquata J.F. Gmelin, 1789. In this study, both mitochondrial and nuclear data
were used to inform decisions and changes in taxo-
Definition nomic status. Thus, under a phylogenetic species
The clade containing H. torquata and all species concept (Nelson & Platnick, 1981; Cracraft, 1983,
that share a more recent common ancestor with 1997), basal diagnosable evolutionary units are con-
H. torquata than with Nyctidromus albicollis, sidered to be species, and in this article species status
N. anthonyi, N. derbyanus, N. hirundinaceus, N. mer- is applied when there is phenotypic or genotypic evi-
rilli, N. nigrescens, Lurocalis rufiventris, L. semitor- dence for distinctness of isolated populations (see also
quatus, Nyctiprogne latifascia, N. leucopyga, and Goldstein & DeSalle, 2000). In many instances this
N. vielliardi, or with species in other nightjar genera included morphological, behavioural, genetic charac-
such as Antrostomus, Caprimulgus, Chordeiles, ter data, and measures of evolutionary divergence.
Eurostopodus, Gactornis, Lyncornis, Macrodipteryx, All changes made in the article involve taxa that
Nyctiphrynus, Phalaenoptilus, Podager, Siphonorhis, had already been formally recognized taxonomically,
or Veles. either as species or as subspecies.
Included species
Hydropsalis albicauda (Lawrence, 1875), Hydropsalis
CHORDEILES TEXENSIS (LAWRENCE, 1856)
anomalus (Gould, 1837), Hydropsalis candicans Definition
(Pelzeln, 1867), Hydropsalis cayennensis (J.F. Gmelin, Previously Chordeiles acutipennis texensis. It is
1789), Hydropsalis climacocerca (Tschudi, 1844), elevated to full species status and is the sister species
Hydropsalis decussatus (Tschudi, 1844), Hydropsalis of Chordeiles acutipennis Hermann, 1783.
forcipata (Nitzsch, 1840), Hydropsalis heterurus
(Todd, 1915), Hydropsalis longirostris (Bonaparte, Diagnosis
1825), Hydropsalis lyra (Bonaparte, 1850), Hydropsa- Chordeiles texensis is similar morphologically to
lis maculicaudus (Lawrence, 1862), Hydropsalis C. acutipennis, but is noticeably larger in size and
paler in plumage, although C. a. littoralis and C. a. leucopyga latifascia (Fig. 6). This, along with morpho-
micromeris are somewhat intermediate in size logical characters and observations on the vocaliza-
between C. texensis and the remaining subspecies of tions, supports recognizing two phylogenetic species:
C. acutipennis. Both ND2 and ACO1 I9 show genetic N. latifascia and N. leucopyga (Fig 8).
divergence between C. texensis and C. acutipennis,
with over 2% divergence in ND2 sequences and 14
NYCTIDROMUS DERBYANUS GOULD, 1838
homologous substitution events.
Definition
Comments Previously Nyctidromus albicollis derbyanus. It is
Genetic evidence in this study supports the elevation elevated to full species status and is the sister species
of C. a. texensis to full species status (Fig. 4). The of N. albicollis.
other six subspecies of C. acutipennis remain as
members of that species. Further study of the system Diagnosis
is recommended, in particular regarding the status of Noticeably larger than both N. albicollis and N.
C. a. littoralis and C. a. micromeris. merrilli. Back, crown, outer primaries and second-
aries are distinctly reddish in colour. Not as dark in
colour as N. albicollis.
NYCTIPROGNE VIELLIARDI (LENCIONI-NETO, 1994)
Definition Comments
Previously Chordeiles vielliardi. It is moved from Genetic evidence in this study is consistent with
Chordeiles into Nyctiprogne. It is the sister species of N. albicollis being split into three phylogenetic
N. leucopyga Spix, 1825. species (Fig. 6). Members of the nominate subspecies
remain as N. albicollis, whereas N. a. derbyanus
Diagnosis is elevated to full phylospecies status under the
Similar to N. leucopyga, but lacks white tail mark- name N. derbyanus. Some individuals identified as
ings. Very few specimens are known, hence the infor- N. a. albicollis may also belong to this phylospecies,
mation on morphology is scarce. particularly south of the Amazon River (see details
in Discussion). The remaining four subspecies,
Comments N. a. insularis, N. a. intercedens, N. a. merrilli, and
Genetic evidence in this study shows that C. vielliardi N. a. yucatanensis, can be united as a phylogenetic
is not related to other species in Chordeiles, but species: N. merrilli (see below).
belongs in Nyctiprogne (Fig. 6), as suggested by
Cleere & Nurney (1998).
NYCTIDROMUS MERRILLI SENNETT, 1888
Definition
NYCTIPROGNE LATIFASCIA FRIEDMANN, 1945 Previously N. a. merrilli, and includes individuals
Definition assigned to N. a. insularis, N. a. intercedens, and
Previously Nyctiprogne leucopyga latifascia. It is N. a. yucatanensis. It is elevated to full species status
elevated to full species status and is the sister and is the sister species of a clade containing
species of a clade that contains N. leucopyga and N. albicollis and N. derbyanus.
N. vielliardi.
Diagnosis
Diagnosis Nyctidromus merrilli is intermediate in size, and the
Similar to N. leucopyga and N. vielliardi, but notice- plumage is both lighter and greyer than N. albicollis
ably larger and with much darker, more blackish and N. derbyanus, with a slate-grey coloration on
plumage. There is evidence for distinct vocalizations the crown and back being particularly noticeable.
(Friedmann, 1945; Naka, 2012). There are also conspicuous black patterns on the
There is over 8% divergence in ND2 sequences coverts of N. merrilli, which in both N. albicollis and
and 7% divergence in CYTB between N. latifascia N. derbyanus tend to be browner. Some individuals
and N. leucopyga, as well as 0.7% divergence in the in arid areas of Mexico are slightly more reddish in
ACO1 I9 sequences. colour, but overall the three named forms within
N. merrilli (insularis, merrilli, and yucatanensis) are
Comments similar to one another.
Genetic evidence in this study shows that N. leuc-
opyga is non-monophyletic because some subspecies Comments
are more closely related to N. vielliardi than to N. See comments in previous section on N. derbyanus.
HYDROPSALIS HETERURUS (TODD, 1915) of H. ruficervix. Together the two species form a clade
Definition that is sister to H. longirostris.
Previously Caprimulgus parvulus heterurus. It is
elevated to full species status and is the sister species Diagnosis
of Hydropsalis parvulus (formerly C. p. parvulus). Large, very dark, long-billed nightjar with few mark-
ings in plumage. It is most similar to H. ruficervix,
Diagnosis but is both larger and darker.
Small, brownish-grey, with broad buff neck collar and There is genetic divergence in both ND2 and
a white throat patch. White tips on outermost prima- ACO1 I9, with 3.7% divergence in ND2 between
ries and tail feathers. Very similar to H. parvulus, but H. roraimae and H. ruficervix and 5% divergence
more extensive white markings near the tips of the between the two and H. longirostris.
feathers. There is 5% divergence in ND2 sequences
between H. heterurus and H. parvulus.
Comments
Comments Genetic evidence in this study supports elevating the
Genetic evidence in this study supports splitting two closely related subspecies of H. longirostris,
H. parvulus into two phylogenetic species along H. l. roraimae and H. l. ruficervix, to phylogenetic
subspecies lines (Fig. 7). This is congruent with the species status, as they are genetically divergent
taxonomic modifications of Cleere (2010), based on from the remaining taxa assigned to H. longirostris
observations on the morphology and vocalizations of (H. l. atripunctatus, H. l. bifasciatus, H. l. longiros-
the two taxa. Both species are placed in the genus tris, and H. l. patagonicus), as well as from one
Hydropsalis, as discussed earlier. another (Fig. 7). This is in agreement with the
suggestions of Cleere (2010), at least regarding
HYDROPSALIS DECUSSATUS (TSCHUDI, 1844) H. l. roraimae.
Definition
Previously Caprimulgus longirostris decussatus. It HYDROPSALIS RUFICERVIX (P.L. SCLATER, 1866)
is elevated to full species status. Its phylogenetic
position within Hydropsalis is not completely resolved Definition
in this study. It is part of a four-way polytomy that Previously Caprimulgus longirostris ruficervix. It is
includes the following clades: (1) H. decussatus; elevated to full species status. It is the sister species
(2) H. lyra and H. segmentata; (3) H. parvulus and of H. roraimae. Together the two species form a clade
H. heterurus; and (4) H. longirostris, H. roraimae, that is sister to H. longirostris.
H. ruficervix, H. anomalus, H. candicans, H. maculi-
caudus, H. forcipata, H. albicauda, H. cayennensis, Diagnosis
H. climacocerca, and H. torquata. Intermediate in size and body shape to H. longirostris
and H. roraimae. Its plumage is most similar to
Diagnosis H. roraimae, but is slightly lighter and is more dis-
Small, cryptically coloured nightjar with a slender tinctly cinnamon coloured, with white spots.
long bill. It is morphologically similar to H. l.
atripunctatus in plumage and body shape, but much
smaller in size. Territorial calls are also different Comments
(Cleere, 2010). See previous section on H. roraimae.
Comments
Genetic evidence strongly supports H. decussatus HYDROPSALIS ALBICAUDA (J.F. GMELIN, 1789)
being an independent diagnosable species (Fig. 7). Definition
Although formerly a subspecies of H. (Caprimulgus) Previously Caprimulgus cayennensis albicauda. It is
longirostris, the phylogenetic results show that it is elevated to full species status. It is the sister species
distant from H. longirostris, despite some morphologi- of H. cayennensis.
cal similarities.
Diagnosis
HYDROPSALIS RORAIMAE (CHAPMAN, 1929) Very similar to H. cayennensis, a small, grey-brown
Definition nightjar with a broad tawny collar, a white throat
Previously Caprimulgus longirostris roraimae. It is patch, and conspicuous white colouring on wing and
elevated to full species status. It is the sister species tail feathers, noticeably more than in H. cayennensis.
There is over 1.3% divergence in ND2 sequences heterozygosity, and base composition. Molecular Phylogene-
between H. albicauda and H. cayennensis. tics and Evolution 41: 238–248.
Braun MJ, Huddleston CJ. 2009. A molecular phylogenetic
Comments survey of caprimulgiform nightbirds illustrates the utility of
Genetic evidence in this study supports splitting non-coding sequences. Molecular Phylogenetics and Evolu-
H. cayennensis into two separate phylogenetic species tion 53: 948–960.
Brown, JW, Rest JS, García-Moreno J, Sorenson MD,
(Fig. 7). The subspecies H. a. albicauda, H. a. apertus,
Mindell DP. 2008. Strong mitochondrial DNA support for a
and H. a. insularis together form the phylospecies
Cretaceous origin of modern avian lineages. BMC Biology 6:
H. albicauda, whereas individuals belonging to the
6.
subspecies H. c. cayennensis and H. c. leopetes re-
Cadena CD, Cheviron ZA, Funk WC. 2011. Testing the
main as the original nominate species Hydropsalis
molecular and evolutionary causes of a ‘leapfrog’ pattern of
cayennensis. The status of the subspecies manati is geographical variation in coloration. Journal of Evolution-
unresolved. ary Biology 24: 402–414.
Cadena CD, Klicka J, Ricklefs RE. 2007. Evolutionary
differentiation in the Neotropical montane region: molecular
ACKNOWLEDGEMENTS phylogenetics and phylogeography of Buarremon brush-
Fresh tissue specimens were provided by ornithology finches (Aves, Emberizidae). Molecular Phylogenetics and
collections from the following institutions: American Evolution 44: 993–1016.
Museum of Natural History, New York; The Academy Chesser RT, Banks RC, Barker FK, Cicero C, Dunn JL,
of Natural Sciences, Drexel University, Philadelphia; Kratter AW, Lovette IJ, Rasmussen PC, Remsen JV,
Rising JD, Stotz DF, Winker K. 2012. Fifty-third sup-
The Field Museum, Chicago; Museum of Natural
plement to the American Ornithologists’ Union Check-List of
History, Lousiana State University, Baton Rouge;
North American Birds. The Auk 129: 573–588.
and the National Museum of Natural History,
Cicero C, Johnson NK. 2001. Higher-level phylogeny of
Smithsonian Institution, Washington DC. We want to
New World vireos (Aves: Vireonidae) based on sequences of
thank these collections and the curators responsible
multiple mitochondrial DNA genes. Molecular Phylogenetics
for providing the loans. All skin specimens were from and Evolution 20: 27–40.
the collection of the American Museum of Natural Cleere N. 1999. Family Caprimulgidae (Nightjars). In: Del
History. Hoyo J, Elliott A, Sargaral J, eds. Handbook of the birds of
Laboratory work was performed at the Cullman the world. Vol. 5. Barn-owls to hummingbirds. Barcelona:
Molecular Laboratory in the American Museum of Lynx Edicions, 302–386.
Natural History. We are grateful to lab manager Cleere N. 2002. A review of the taxonomy and systematics
Jeff Groth for his assistance and helpful advice, of the Sickle-winged and White-winged Nightjars
particularly regarding primer design. We also (Caprimulgidae). The Bulletin of the British Ornithology
acknowledge William M. Mauck III, Jonas Lai, Paula Club 122: 168–179.
Veverica, Jessica Shearer, Esther Quintero, Santiago Cleere N. 2010. Nightjars, potoos, frogmouths, oilbirds and
Claramunt, Utku Pertkas, George Barrowclough, Paul owlet-nightjars of the world. Old Basing, UK: WILDGuides
Sweet, Thomas J. Trombone, and Peter Capainolo for Ltd., Parr House.
their help. Cleere N, Nurney D. 1998. Nightjars: a guide to
This work was part of the doctoral research of nightjars and related nightbirds. East Sussex, UK: Pica
Snorri Sigurðsson, and was partially funded by a Press.
PhD Fellowship from The Graduate Center, CUNY. Cracraft J. 1983. Cladistic analysis and vicariance biogeog-
Further research support was provided by the Frank raphy. American Scientist 71: 273–281.
M. Chapman Fund and the L.C. and L.J. Sanford Cracraft J. 1997. Species concepts in systematics and con-
servation biology – an ornithological viewpoint. In: Claridge
funds of the Department of Ornithology, as well as the
MF, Dawah HA, Wilson MR, eds. Species the units of bio-
Sackler Institute for Comparative Genomics, Ameri-
diversity. London: Chapman and Hall, 325–339.
can Museum of Natural History.
Cracraft J, Barker FK, Braun M, Harshman J, Dyke GJ,
Feinstein J, Stanley S, Cibois A, Schikler P, Beresford
P, García-Moreno J, Sorenson MD, Yuri T, Mindell
REFERENCES
DP. 2004. Phylogenetic relationships among modern birds
Barker FL, Vandergon AJ, Lanyon SM. 2008. Assessment (Neornithes). Towards an avian tree of life. In: Cracraft J,
of species limits among yellow-breasted meadowlarks Donoghue MJ, eds. Assembling the tree of life. New York:
(Sturnella spp.) using mitochondrial and sex-linked Oxford Univ. Press, 468–489.
markers. The Auk 125: 869–879. Davis LI. 1972. A field guide to the birds of Mexico and
Barrowclough GF, Groth JG, Mertz LA. 2006. The RAG-1 Central America. Austin, TX and London: University of
exon in the avian order Caprimulgiformes: phylogeny, Texas Press.
Davis LI. 1979. Acoustic evidence of relationships in (Caprimulgidae). Molecular Phylogenetics and Evolution 55:
Caprimulginae. Pan American Studies 1: 22–57. 443–453.
Dickinson EC, Bahr N, Dowsett R, Pearson D, Remsen Hartert E. 1892. Catalogue of the Picariae in the collection of
V, Roselaar CS, Schodde D, eds. 2003. The Howard and the British Museum. Catalogue of the birds in the British
Moore complete checklist of birds of the world, 3rd edn. Museum, volume 16. London: British Museum.
London: Christopher Holm. Holyoak DT. 2001. Nightjars and their allies. Oxford, UK:
Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper Oxford University Press.
A, Duran C, Field M, Heled J, Kearse M, Markowitz S, Johnson NK. 2002. Leapfrogging revisited in Andean birds:
Moir R, Stones-Havas S, Sturrock S, Thierer T, Wilson geographical variation in the Tody-Tyrant superspecies
A. 2010. Geneious v5.5. Poecilotriccus ruficeps and P. luluae. Ibis 144: 69–84.
Drummond AJ, Rambaut A. 2007. BEAST: Bayesian evo- Larsen C, Speed M, Harvey N, Noyes HA. 2007. A molecu-
lutionary analysis by sampling trees. BMC Evolutionary lar phylogeny of the nightjars (Aves: Caprimulgidae) sug-
Biology 7: 214. gests extensive conservation of primitive morphological
Edgar RC. 2004. MUSCLE: multiple sequence alignment traits across multiple lineages. Molecular Phylogenetics and
with high accuracy and high throughput. Nucleic Acids Evolution 42: 789–796.
Research 32: 1792–1797. Lindell J, Ngo A, Murphy RW. 2006. Deep genealogies and
Ericson PGP, Anderson CL, Britton T, Elzanowski A, the mid-peninsular seaway of Baja California. Journal of
Johansson US, Källersjö M, Ohlson JI, Parsons TJ, Biogeography 33: 1327–1331.
Zuccoon D, Mayr G. 2006. Diversification of Neoaves: Livezey BC, Zusi RL. 2006. Higher-order phylogeny
integration of molecular sequence data and fossils. Biologi- of modern birds (Theropoda, Aves: Neornithes) based on
cal Letters 2: 543–547. comparative anatomy. I. Methods and characters. Bulletin of
Friedmann H. 1945. The genus Nyctiprocne. Proceedings of the Carnegie Museum of Natural History 37: 1–556.
the Biological Society of Washington 58: 117–120. Livezey BC, Zusi RL. 2007. Higher-order phylogeny of
Garcia-Moreno J, Fjeldså J. 2000. Chronology and mode of modern birds (Theropoda, Aves: Neornithes) based on com-
speciation in the Andean avifauna. Bonn Zoological Mono- parative anatomy. II. Analysis and discussion. Zoological
graph 46: 25–46. Journal of the Linnean Society 149: 1–95.
Garrido, OH, Reynard GB. 1998. Is the Greater Antillean Maijer S, Fjeldså J. 1997. Description of a new Cranioleuca
Nightjar, Caprimulgus cubanensis (Aves: Caprimulgidae), a spinetail from Bolivia and a ‘leapfrog pattern’ of geographic
composite species? Ornithologia Neotropical 9: 1–12. variation in the genus. Ibis 139: 606–616.
Goldstein PZ, DeSalle R. 2000. Phylogenetic species, Mariaux J, Braun MJ. 1996. A molecular phylogenetic
nested hierarchies, and character fixation. Cladistics 16: survey of the nightjars and allies (Caprimulgiformes) with
364–384. special emphasis on the potoos (Nyctibiidae). Molecular
Goloboff PA, Farris JS, Nixon KC. 2008. TNT, a free Phylogenetics and Evolution 6: 228–244.
program for phylogenetic analysis. Cladistics 24: 774– Mayr G. 2002. Osteological evidence for paraphyly of
786. the avian order Caprimulgiformes (nightjars and allies).
Grant PR. 1965. A systematic study of the terrestrial birds of Journal of Ornithology 143: 82–97.
the Tres Marias Islands, Mexico. Postilla 90: 1–106. Mayr G. 2010. Phylogenetic relationships of the paraphyletic
Griscom L. 1929. Studies from the Dwight Collection of ‘caprimulgiform’ birds (nightjars and allies). Journal of Zoo-
Guatemala Birds. I. American Museum Novitates 379: 1–13. logical Systematics and Evolutionary Research 48: 126–137.
Griscom L, Greenway JC. 1937. Critical notes on new Naka L. 2012. Personal communication.
neotropical birds. Bulletin of the Museum of Comparative Nelson G, Platnick NI. 1981. Systematics and biogeography:
Zoology, Harvard 81: 417–437. cladistics and vicariance. New York: Columbia University
Groth JG. 1998. Molecular phylogenetics of finches and Press.
sparrows: consequences of character state removal in Oberholser HC. 1914. A monograph of the genus Chordeiles
Cytochrome b sequences. Molecular Phylogenetics and Evo- Swainson, type of a new family of goatsuckers. Bulletin 86.
lution 10: 377–390. Washington: Smithsonian Institution, USNM.
Groth JG, Barrowclough GF. 1999. Basal divergences Peters JL. 1940. Check-list of birds of the world. Vol. IV.
in birds and the phylogenetic utility of the nuclear RAG-1 Cambridge, MA: Harvard University Press.
gene. Molecular Phylogenetics and Evolution 12: 115– Posada D. 2008. jModelTest: phylogenetic model averaging.
123. Molecular Biology and Evolution 25: 1253–1256.
Hackett SJ, Kimball RT, Reddy S, Bowie RCK, Braun Rambaut A, Drummond AJ. 2007. Tracer v1.4. Available at:
EL, Braun MJ, Chojnowski JL, Cox WA, Han K, http://beast.bio.ed.ac.uk/Tracer
Harshman J, Huddleston CJ, Marks BD, Miglia KJ, Reynard GB. 1962. The rediscovery of the Puerto Rican
Moore WS, Sheldon FH, Steadman DW, Witt CC, Yuri Whip-poor-will. Living Bird 1: 51–60.
T. 2008. A phylogenetic study of birds reveals their evolu- Ribas CC, Gaban-Lima R, Miyaki CY, Cracraft J. 2005.
tionary history. Science 320: 1763–1768. Historical biogeography and diversification within the
Han K, Robbins MB, Braun MJ. 2010. A multi-gene Neotropical parrot genus Pionopsitta (Aves: Psittacidae).
estimate of phylogeny in the nightjars and nighthawks Journal of Biogeography 32: 1409–1427.
Ridgway R. 1914. The birds of North and Middle America. bootstrap algorithm for the RAxML web servers. Systematic
Part VI. Bulletin of the United States National Museum 50, Biology 57: 758–771.
882. Weir JT. 2009. Implications of genetic differentiation in
Robbins MB, Parker III, TA. 1997. Voice and taxonomy Neotropical montane forest birds. Annals of The Missouri
of Caprimulgus (rufus) otiosus (Caprimulgidae), with a Botanical Garden 96: 410–433.
reevaluation of Caprimulgus rufus subspecies. Ornithologi- Wetmore A, Phelps WH. 1953. Notes on the Rufous
cal Monographs 48: 601–607. Goatsuckers of Venezuela. Proceedings of the Biological
Sedano RE, Burns KJ. 2010. Are the Northern Andes Society of Washington 66: 15–19.
a species pump for Neotropical birds? Phylogenetics and Whitney BM, Pacheco JF, Moreira da Fonseca PS,
biogeography of a clade of Neotropical tanagers (Aves: Webster RE, Kirwan GM, Mazar Barnett J. 2003.
Thraupini). Journal of Biogeography 37: 325–343. Reassignment of Chordeiles vielliardi Lencioni-Neto, 1994
Selander RK. 1954. A systematic review of the booming to Nyctiprogne Bonaparte, 1857, with comments on the
nighthawks of western North America. Condor 56: 57–82. latter genus and some presumably related chordeilines
Sibley CG, Monroe BL. 1990. Distribution and taxonomy of (Caprimulgidae). The Bulletin of the British Ornithology
birds of the world. New Haven and London: Yale University Club 123: 103–112.
Press. Yang Z. 2006. Computational molecular evolution (Oxford
Sorenson MD, Ast JC, Dimcheff DE, Yuri T, Mindell DP. series in ecology and evolution). New York: Oxford Univer-
1999. Primers for a PCR-based approach to mitochondrial sity Press, 113–114.
genome sequencing in birds and other vertebrates. Molecu- Yuri T, Kimball RT, Harshman J, Bowie RCK, Braun
lar Phylogenetics and Evolution 12: 105–114. MJ, Chojnowski JL, Han K, Hackett SJ, Huddleston
Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood- CJ, Moore WS, Reddy S, Sheldon FH, Steadman DW,
based phylogenetic analyses with thousands of taxa and Witt CC, Braun EL. 2013. Parsimony and model-based
mixed models. Bioinformatics 22: 2688–2006. analyses of indels in avian nuclear genes reveal congruent
Stamatakis A, Hoover P, Rougemont J. 2008. A rapid and incongruent phylogenetic signals. Biology 2: 419–444.
SUPPORTING INFORMATION
Additional supporting information may be found in the online version of this article at the publisher’s web-site:
Figure S1. A phylogeny from a maximum-likelihood analysis of an 1041 bp ND2 data set for 168 individuals
representing 107 taxa.
Figure S2. A phylogeny from a maximum-likelihood analysis of an 1143 bp CYTB data set for 84 individuals
Figure S3. A phylogeny from a maximum-likelihood analysis of an 2873 bp RAG-1 data set for 79 individuals
Figure S4. A phylogeny from a maximum-likelihood analysis of an 871 bp ACO1 I9 data set for 110 individuals

Deciphering The Diversity and History of New Worldnightjars (Aves Caprimulgidae) Usingmolecular Phylogenetics

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Deciphering The Diversity and History of New Worldnightjars (Aves Caprimulgidae) Usingmolecular Phylogenetics

Uploaded by

Copyright:

Available Formats

bs_bs_banner

Deciphering the diversity and history of New World

ADDITIONAL KEYWORDS: avian phylogenetics – Caprimulgiformes – Caprimulgus – Hydropsalis – new

INTRODUCTION there has been great progress in the field, some

a nighthawk clade (Chordeiles with the monotypic MATERIAL AND METHODS

Table 1. Specimen list

Taxon name Source Specimen number Specimen type

Antrostomus badius*,† AMNH #824782 Skin

Taxon name Source Specimen number Specimen type

Caprimulgus longirostris bifasciatus AMNH #748519 Skin

Taxon name Source Specimen number Specimen type

Chordeiles minor minor FM 428842 Fresh tissue

Taxon name Source Specimen number Specimen type

Nyctidromus albicollis insularis AMNH #477162 Skin

Taxon name Geographic location Sequences in data matrix

Antrostomus badius*,† Quintana Roo, Mexico ND2

Taxon name Geographic location Sequences in data matrix

Taxon name Geographic location Sequences in data matrix

Chordeiles minor minor Wisconsin, USA ND2, ACO1 I9, RAG-1

Taxon name Geographic location Sequences in data matrix

Nyctidromus albicollis insularis Maria Madre Island, Mexico ND2

Table 2. General all-purpose primers used for amplification and sequencing

Gene Primer name Sequence 5′ → 3′ Reference

ND2 L5204 TAACTAAGCTATCGGGCCCAT Modified from Sorenson et al. (1999)

Primer name Sequence 5′ → 3′ Primer name Sequence 5′ → 3′

CM FW (Externa primer) GCTATCGGGCCCATACCCCGAA MA 5 TCAACAATAATAACCTCATG

Table 4. Polymerase chain reaction (PCR) settings

Old World clade

ND2 phylogeny CYTB phylogeny

Old World clade

RAG-1 phylogeny ACO1 Intron-9 phylogeny

(Old World taxa, nighthawks, poorwills, and South 100

the core radiation, are identical to the patterns on the

At lower taxonomic levels the data set formed

Eurostopodus archboldi Archbold’s Nightjar

100 Chordeiles rupestris Sand-coloured Nighthawk

Antrostomus badius Yucatán Nightjar (Antrostomus badius)

Nyctiprogne leucopyga latifascia - VENEZUELA

Nyctiprogne vielliardi - Barra, BRAZIL Nyctiprogne vielliardi

Lurocalis semitorquatus nattereri - Rio Negro, BRAZIL

100 Lurocalis semitorquatus semitorquatus - GUYANA

Lurocalis rufiventris - ECUADOR

“Caprimulgus” hirundinaceus vielliardi - Bahia, BRAZIL

98 “Caprimulgus” nigrescens - SURINAME

Nyctidromus albicollis yucatanensis - PANAMA

100 Nyctidromus albicollis albicollis - Alagoas, BRAZIL

Nyctidromus albicollis albicollis - VENEZUELA

OLD WORLD CLADE

“Caprimulgus” maculicaudus - MEXICO

CHORDEILES SWAINSON, 1832

75 100 100 Hydropsalis cayennensis

Included species NYCTIPROGNE BONAPARTE, 1857

such as Antrostomus, Caprimulgus, Chordeiles, parvulus (Gould, 1837), Hydropsalis roraimae

You might also like