Journal of Neuroscience Research 89:418–428 (2011)

Lungfish Aestivating Activities Are Locked

in Distinct Encephalic c-Aminobutyric
Acid Type A Receptor a Subunits
Giuseppina Giusi,1 Michele Crudo,1 Anna Di Vito,1 Rosa Maria Facciolo,1
Filippo Garofalo,2 Shit Fun Chew,3 Yuen Kwong Ip,4 and Marcello Canonaco1*
1
Comparative Neuroanatomy Laboratory, University of Calabria, Arcavacata di Rende (CS), Italy
2
Department of Cell Biology, University of Calabria, Arcavacata di Rende (CS), Italy
3
Natural Sciences, National Institute of Education, Nanyang Technological University, Singapore,
Republic of Singapore
4
Department of Biological Sciences, National University of Singapore, Singapore, Republic of Singapore

Ammonia in dipnoans plays a crucial role on neuronal
homeostasis, especially for those brain areas that
maintain torpor and awakening states in equilibrium. In
the present study, specific a subunits of the major neu-
roreceptor inhibitory complex (GABAAR), which predo-
minated during some phases of aestivation of the lung-
fish Protopterus annectens, turned out to be key adapt-
ive factors of this species. From the isolation, for the
first time, of the encoding sequence for GABAAR a1,
a4, and a5 subunits in Protopterus annectens, qPCR
and in situ hybridization levels of a4 transcript in tha-
lamic (P < 0.001) and mesencephalic (P < 0.01) areas
proved to be significantly higher during long aestivating
maintenance states. Very evident a5 mRNA levels were
detected in diencephalon during short inductive aesti-
vating states, whereas an a4/a1 turnover characterized
the arousal state. Contextually, the recovery of physio-
logical activities appeared to be tightly related to an
evident up-regulation of a1 transcripts in telencephalic
and cerebellar sites. Surprisingly, TUNEL and amino cu-
pric silver methods corroborated apoptotic and neuro-
degenerative cellular events, respectively, above all in
telencephalon and cerebellum of lungfish exposed to
long maintenance aestivating conditions. Overall, these
results tend to underlie a novel GABAergic-related ON/
OFF molecular switch operating during aestivation of
the lungfish, which might have a bearing on sleeping
disorders. VC 2011 Wiley-Liss, Inc.
Key words: apoptosis; inhibitory neuroreceptor; torpor;
arousal; in situ hybridization
The African lungfish represents an important ex-
perimental model because of its adaptability to extreme
environmental conditions, such as lack of food and/or
drought, by entering into a torpor state recognized as
aestivation (Glass, 2008). This state, in contrast to hiber-
nation, may exhibit a reduction of metabolism in the ab-
sence of decreased body temperature accompanied by
down-regulation of gas exchange, heart rate, and cardiac
work. By surviving in cocoons for long periods, the
lungfish is also protected against ammonia toxicity,
which is characterized by the reduction of O2 uptake (Ip
et al., 2004; Glass, 2008) during drought periods. At
present, data regarding neuronal processes involved with
the induction and maintenance of this physiological state
are lacking, aside from recent evidence of oxidative
modifications occurring during aestivation in a manner
comparable to that in Alzheimer’s disease (Perry et al.,
2002). In this context, the same protective reprogram-
ming of neuronal factors featured during hibernation
(Henry et al., 2007) might very well be elicited against
metabolic challenges of aestivating conditions via modifi-
cation of some major neuroreceptor systems such as the
inhibitory g-aminobutyric acid (GABA)/excitatory glu-
tamate homeostatic neurosignaling events (Drew et al.,
2007). Indeed, the recovery of cerebral glutamine syn-
thesis and/or GABA metabolism of the lungfish, recog-
nized as a protective measure against ammonia toxicity,
further corroborate the importance of these neurorecep-
tor systems in aestivating dipnoans (Loong et al., 2008).
It is widely known that the GABA type A receptor
(GABAAR) complex is involved in many behavioral and
neuroendocrine activities of vertebrates ranging from
mammals (Olsen and Sieghart, 2009) to fish such as tele-
osts (Doldán et al., 1999). This neuroreceptor belongs to
an evolutionary superfamily of ligand-gated ion protein
Contract grant sponsor: MIUR (Italian University Research Ministry);
Contract grant sponsor: Singapore Ministry of Education; Contract grant
number: R-154-000-429-112 (to Y.K.I.).
*Correspondence to: Marcello Canonaco, Comparative Neuroanatomy
Laboratory, University of Calabria, 87030 Rende (CS), Italy. E-mail:
canonaco@unical.it
Received 9 July 2010; Revised 6 September 2010; Accepted 20 October
2010
Published online 6 January 2011 in Wiley Online Library
(wileyonlinelibrary.com). DOI: 10.1002/jnr.22553

' 2011 Wiley-Liss, Inc.


complex in which a1,4,5 subunits are largely responsible
for inhibitory interneuronal activities through the vary-
ing sensitivity degrees of principal agonists, i.e., benzo-
diazepines (Olsen and Sieghart, 2009). Moreover, the
prevalence of a subunits represents a major facet of exci-
tatory/inhibitory synaptic plasticity not only in episodic
ischemic bouts and epilepsy (Fritschy, 2008) but also in
neuroendocrine-related energy balance of hypothalamic
sites recognized for their control of particular physiologi-
cal events such as hibernation (Henry et al., 2007). Brain
neuronal metabolic pathways of GABAAR production
and degradation are well characterized in mammals, but
in lungfish few studies have dealt with structural and
functional properties of the GABAergic receptor system,
aside from differential expression of glutamic acid decar-
boxylase 65 (GAD65) and 67 (GAD67) mRNAs in
physiologically distinct brain regions such as olfactory
and visual centers (Trabucchi et al., 2008). However, no
data have been reported on GABA release, transport
alterations, or molecular and pharmacological properties
of GABAergic receptors in lungfish brain during either
normal or aestivating conditions. From a functional
point of view, elevated contents of GABA in the brain
of fish and amphibians have been correlated with anoxic
states, and this appears to be responsible for an increased
cellular storage of glycogen as well as for a severe reduc-
tion of ATP turnover (Lutz and Nilsson, 2004). Further-
more, some authors have shown that an increase of
GABAergic transmission during torpor state in mamma-
lian hibernators may protect the brain against excitotoxic
damage by decreasing the energy consumption associated
with synaptic neurotransmission processes (Henry et al.,
2007). On the basis of these considerations, it was our
intention to determine the turnover of GABAAR a1,4,5
subunit mRNAs expression during the different aestivat-
ing states of the lungfish, Protopterus annectens, together
with the evaluation of eventual brain morphological
alterations. The selection of a subunits was supported by
their key role as phylogenic tonic/phasic modulatory
elements of sleeping states in some hibernating mamma-
lian brain regions (Giusi et al., 2009), as in the case of
a4 and a5 GABAergic extrasynaptic subunits (Winsky-
Sommerer, 2009). On the other hand, the choice of a1
was based on its major role being evoked during the
correct arrangement and pharmacological properties of
GABAAR complex (Olsen and Sieghart, 2009). The
identification of a specific GABAAR-dependent molecu-
lar mechanism controlling metabolic suppression and
ammonia defense processes in aestivating lungfish may
bring us closer to the understanding of neuronal evolu-
tionary traits that characterize sophisticated adaptive
physiological states such as hibernation and aestivation.
Moreover, the analysis of metabolic depression occurring
during torpor phenomena of the lungfish, which exhibits
a nonrapid-eye-movement (NREM) sleep-like state in a
manner similar to hibernating conditions (Heller and
Ruby, 2004), may prove to be clinically useful, espe-
cially for investigation, diagnosis, and management of
sleeping disorders.
Journal of Neuroscience Research
GABAAR and Aestivation 419
MATERIALS AND METHODS
Maintenance of Specimens
The study was performed on a total of 62 specimens of
the African lungfish Protopterus annectens (body weight of 140–
190 g). These specimens were collected from Central Africa
and imported through a local fish farm in Singapore (Qian
Hu Fish Farm Trading Co., Singapore). In this work, animal
sex was not taken into consideration, because its identification
is not possible due to the lack of distinct external features. All
lungfish were acclimatized to our laboratory conditions for at
least 1 month in order to eliminate any nonspecific effects
deriving from stressful ambient states before the beginning of
the experimental trials. They were maintained in plastic aqua-
ria filled with dechlorinated tap water (pH 7.1–7.2) containing
0.71 mM Na1, 0.32 mM K1, 0.72 mM Ca21, 0.06 mM
Mg21, 2.2 mM Cl2, and 0.2 mM HCO

3 at 25 8C under 12-
hr light 12-hr dark photoperiod until use; water was changed
daily. During the adaptation period, the animals were fed fro-
zen bloodworms up to a period of 96 hr before experimental
observation, when food was withdrawn. Experimental proto-
cols of this study were approved by the National University
of Singapore Institutional Animal Care and Use Committee
(IACUC Permits 813/05, S06/06 A, and 035/09).
Aestivation
All fish belonging to the different experimental groups
were induced to aestivate at 25–308C individually in plastic
tanks (29 cm 3 19 cm 3 17.5 cm, length 3 width 3 height)
containing a small volume (15 ml) of dechlorinated tap water,
as previously described (Chew et al., 2004). Water dried up in
approximately 6 days and, during this time, animals formed a
mucus cocoon that enveloped the entire body. Subsequently,
animals (n 5 14 for each condition) were sacrificed during
the different aestivating states: at the induction phase after 6
days of aerial aestivation (6dAE) that may be considered an
entering state into aestivation (Loong et al., 2008); after 6
months of aerial aestivation (6mAE), defined as the long
maintenance phase of such a state; at 1 day of arousal after 6
months of aestivation (6mAE1d), which corresponds to a re-
covery period from this state. Other fish (n 5 20), maintained
under freshwater (FW) conditions, were identified as controls
and placed in dechlorinated tap water for the same duration
that was used for all aestivating lungfish. Afterward, all animals
were sacrificed and their dorsal skull was opened in order to
extract their brain, which was stored at –808C for future anal-
yses.
Morphological Analysis and Neuron Quantification
For cytoarchitectonic analysis, serial transverse sections
(16 lm) of FW Protopterus annectens brain (n 5 3) were cut at
–208C using a Microm-HM505E Zeiss cryostat (Zeiss, Wall-
ford, Germany) and mounted onto subbed slides. The sections
were stained with the Nissl method and analyzed with a Leitz
optic microscope (Dialux 20EB; Leica, Italy; 316 magnifica-
tion; 258C) and captured via Leica imaging software to iden-
tify different neuronal cell groups according to previous work
(Vallarino et al., 1997). The quantification of neurons with
respect to glial cells in FW Protopterus annectens brain (n 5 3)
420 Giusi et al.
was performed by staining them with the transcription factor
NeuN, considered a main structural marker of neuronal integ-
rity, in neuronal cell nucleus and soma as previously described
(Ünal-Çevik et al., 2004), with some modifications for this
fish species. Subsequently, fixed 30 lm-thick sections were
incubated with mouse monoclonal anti-NeuN antibody
(Chemicon, Temecula, CA), diluted 1:500 in blocking solu-
tion 2% overnight at 48C. The sections were incubated with
goat anti-mouse secondary antibody FITC conjugated (Invi-
trogen, Carlsbad, CA) diluted 1:200 in blocking solution 2%
with or without anti-NeuN antibody for 60 min in a dark
room at 258C. Sections were counterstained with 100 ng/ml
DAPI (Sigma Italy) to visualize nuclei and coverslipped with
fluorescence mounting medium for microscopic observation
(Leitz fluorescent microscope; Leica Italy; 320 magnification;
258C plus Leica imaging software for image acquisition).
The counting of telencephalic, hypothalamic, tectal and
cerebellar cells was performed on five sections/area by using
the following formula: Ns 5 [S(N/Vsection)/n] 3 Vref as
previously reported for quantification of damaged neurons
during toxic conditions (Giusi et al., 2008), where Ns 5
stained neurons per area, N 5 stained neuron/single section,
Vsection 5 section volume, n 5 sections per area, and Vref
5 volume of brain area. Labeling index for NeuN-positive
cells was calculated by dividing NeuN-positive neurons by
DAPI-positive total cells/area and expressed as percentage of
total cells.
qPCR of GABAAR a Subunits
For this study, we directed our attention to only some
of the major GABAAR a (a1,4,5) subunits, which, aside from
their organizational and neuromodulatory roles, are also
strongly involved with motor and anesthetic effects (Bonin
and Orser, 2008; Zarnowska et al., 2009). Brains of Protopterus
annectens belonging to 6dAE (n 5 4), 6mAE (n 5 4),
6mAE1d (n 5 4), and FW (n 5 4) groups were quickly
removed from the skull and stored at –808C. Total RNA was
extracted for every experimental groups using TRI reagent
(Sigma Italy), the quality of RNA samples was ensured by
measuring an optical density (OD; 260/280) absorption ratio
of 1.7 (range 1.62–2.1), and their integrity was verified by the
detection of 18S and 28S bands after agarose gel electrophore-
sis. Total RNA (2 lg) of each sample was used to synthesize
cDNA according to indications of the High-Capacity cDNA
Reverse Transcription Kit (Applied Biosystems Italy).
Quantitative real-time PCR (qPCR) was performed on
a Bio-Rad Miniopticon (Bio-Rad Italy) single-color thermo-
cycler, and experimental procedures were established on the
basis of previous reported guidelines (Bustin et al., 2009). The
primer set used for qPCR analysis was designed using Primer
Premier 3.0, and optimal primers were identified on the basis
of the following parameters: 1) robustness, consisting of a suc-
cessful amplification over a range of annealing temperatures;
2) specificity, because these primers were able to generate a
single significant peak in the melting curve; and 3) consis-
tency, which represents a high reproducibility of quantifica-
tion cycle (Cq) values within the reactions of a triplicate. For
the quantitative expression analysis of GABAAR a1,4,5 subu-
nits, primers were a1 (forward: 50 AAAGTGCGACCATAGA
ACCGAAAG; reverse: 50 GCGGAAAGGCTATTCTGACA
TC); a4 (forward: 50 AGCAGCAAGAGGTCTTTCGTC; re-
verse: 50 AGAAGGTGGTGGA GCAGAGG); a5 (forward:
50 CCATCCTCCAAACATCCCAAAG; reverse: 50 CGATC
TTGCTGATGCTGTTGTAGG). The length of all PCR
products ranged from 150 to 200 bp, and the average amplifi-
cation efficiency of each primer pair was optimized ranging
between 0.95 and 1.00. After checking independent trials of
several reference genes, the elongation factor 1a (EF1a)
reported the most reproducible results across the various
cDNAs and so was used as normalization gene by using the
following primer pair: forward: 50 CTGGTGGTGTTGGTGA
GTTC; reverse: 50 GTAGCCGATTTTCTTGATGTAGG.
Amplification reactions were prepared in a final volume of 25
ll by adding 12.5 ll SYBR-Green Supermix, 0.3 lM primers
for target genes (GABAAR a1,4,5 subunits), and 0.1 lM pri-
mers for EF1a plus 2 ll (10 ng) of each cDNA. All reactions
were run in triplicate according to the following cycling pa-
rameters: one cycle at 948C for 3 min, 40 cycles of denatura-
tion at 948C for 10 sec, and annealing-extension at 578C for
30 sec. After the reaction, the existence of a unique PCR
product was confirmed via melting curve analysis (Lekanne
Deprez et al., 2002), obtained by an increase of 0.58C every
10 sec from 578C to 958C. The presence of a single PCR
product was further verified by 1.5% agarose gel electrophore-
sis. The results of qPCR were analyzed by using the Opticon
Monitor qPCR detection system (Bio-Rad), with a program
that permits the analysis of the reaction kinetics. Cq values
were obtained with Genex software (Bio-Rad) and data were
analyzed according to the method of 22DDCt (Livak and
Schmittgen, 2001) on the basis of gene expression levels cal-
culated from three biological repeats. Data obtained from all
experimental groups were reported as a proportion of the
highest value after normalization, and the statistical differences
were estimated by one-way ANOVA followed by a post hoc
Student’s t-test when there was a P value <0.05.
In Situ Hybridization Analysis
To perform in situ hybridization, antisense and sense
probes were designed on the basis of the GABAAR a1,4,5 par-
tial sequences obtained in Protopterus annectens and were la-
beled by 30 -tailing using digoxigenin-11-dUTP (DIG; Roche,
Milan, Italy) as previously reported (Canonaco et al., 2005).
Briefly, 100 ng of antisense probe was added to brain sections
(14 lm; n 5 4) of each group (6dAE, 6mAE, 6mAE1d, and
FW) and left overnight at 508C in a humidified chamber.
Nonspecific hybridization was handled on slides incubated
with sense probe. For immunological detection, anti-DIG
alkaline phosphatase antibody (1:100; Roche) was added for 2
hr at room temperature, preceded by 45 min on Blocking
Reagent (1%; Roche).
Neuronal hybridization signals were observed with a
brightfield Dialux EB 20 microscope (Leitz, Stuttgart, Ger-
many; 316 magnification; 258C plus Leica imaging software
for image acquisition). Transcription differences of GABAAR
a1,4,5 for anterior, intermediate, and posterior brain areas were
evaluated by using a Macintosh computer-assisted image ana-
Journal of Neuroscience Research

lyzer system running MIH Image software from the National
Institutes of Health (Scion Image 2.0) and an internal standard
for OD calibration. Before proceeding with the calibration of
mean OD value for all sections, an estimation of the back-
ground level, which was processed automatically in Scion
Image, was elaborated and included for all final calculations.
Apoptosis and Neurodegeneration
The determination of apoptosis in 6dAE (n 5 3),
6mAE (n 5 3), and 6mAE1d (n 5 3) with respect to FW (n
5 3) Protopterus annectens was handled by using a kit for im-
munohistochemical detection and quantification of apoptosis
based on TUNEL technology (In Situ Cell Death Detection
Kit POD; Roche Italy). Briefly, fixed brain sections (16 lm)
were incubated in TUNEL reaction mix (label with or with-
out terminal transferase solution) for 60 min at 378C. Then, a
solution of sheep antifluorescein antibody conjugated with
horseradish peroxidase (POD) was added to brain sections for
45 min at 378C, and the colorimetric reaction was obtained
by adding diaminobenzadine (DAB) substrate (20 min at
258C). Hematoxylin-counterstained slides were coverslipped
with Di-N-butyl-phthalate in xylene (DPX) mounting me-
dium for light microscopic observation. Brown-stained
TUNEL-positive apoptotic cells were quantified on five dif-
ferent measurements/area using the above Ns calculation. To
establish whether advanced neurodegenerative events charac-
terized the different aestivating stages, the same brain areas of
other lungfishes (n 5 3 for each condition), maintained as
described above, were processed by using amino cupric silver
staining (ACS) methods previously applied for teleost fish
(Giusi et al., 2005). TUNEL and argyrophilic reactions of all
experimental groups were observed at a brightfield Dialux EB
20 microscope (Leitz, Stuttgart, Germany; 316–40 magnifica-
tion; 258C plus Leica imaging software for image acquisition).
Because of the same negative results, only two representative
controls are shown for both methods and compared with the
different brain areas of all groups.
Statistical Analysis
The quantification of apoptotic cells (TUNEL) of
6dAE, 6mAE, and 6mAE1d Protopterus annectens brain with
respect to FW animals was done using a one-way ANOVA
followed by a post hoc Bonferroni’s test when there was a P
value <0.05. Data deriving from qPCR analysis were eval-
uated by using a one-way ANOVA followed by Student’s t-
test. For in situ hybridization analysis, mRNA levels (OD 6
s.e.m.) of each GABAAR subunit were expressed as percent-
age of total GABAAR a1,4,5 subunits for the different brain
regions among all aestivating conditions and evaluated by
using a one-way ANOVA followed by a post hoc multiple
Newman-Keul’s test.
RESULTS
Morphological Features and Neuronal Content of
Lungfish Brain
The staining of the various lungfish brain areas
(Fig. 1A–C) with Nissl substance showed that they fea-
ture the typical laminar organization in which the major-
Journal of Neuroscience Research
GABAAR and Aestivation 421
ity of neuronal cell bodies are localized along periven-
tricular regions (Fig 1a–c). Immunofluorescent staining
of somatic and nuclear areas with anti-NeuN allowed us
to establish the relative amount of neurons with respect
to DAPI-labeled total cells (Fig. 1ai–cii) at the different
brain levels. The telencephalon (TEL) of the lungfish is
divided into pallium and subpallium regions, according
to the nomenclature suggested by Reiner and Northcutt
(1992). In this case, the somatic and nuclear compart-
ments of dorsal pallium (Dp) neurons (characterized by
rounded cells arranged in laminar configuration) plus
dorsal (Pd), intermedia (Pi) and ventral (Pv) portions of
the medial pallium showed an intense anti-NeuN immu-
noreactivity (Fig. 1aii). As a consequence, a moderately
consistent quantity of neuronal cells with respect to non-
neuronal cells (approximately 35%) was typical of the
dorsal TEL plus the rostral, lateral (Sl), and medial sub-
pallium (Sm) located within the ventral (approximately
28%) portion (Fig. 1D). Even the two periventricular
nuclei of the hypothalamus (Hyp), i.e., dorsal (Hyd) and
ventral (Hyv) Hyp, exhibited a moderate quantity of
neuronal cells (approximately 40%; Fig. 1D) densely
packed along the periventricular zone (Fig. 1bii). On the
other hand, neuronal cell bodies confined mostly to the
periventricular gray zone of the mesencephalic optic tec-
tum (Te) plus small piriform neurons with radially ori-
ented dendrites and larger multipolar cells, which charac-
terized the midbrain, displayed a great amount (45%) of
NeuN-expressing neurons (Fig. 1D), above all at the nu-
clear level. Interestingly, in the posterior rhombence-
phalic region, it was the single, large folium (corpus cer-
ebelli, Cc) and some accessory structures such as the
auricula plus crista cerebellaris (Crc) of cerebellum (Cb;
Fig. 1cii) that displayed a very great amount (72%) of
NeuN-positive neurons (Fig. 1D).
GABAAR a Subunits Display a Different
Expression During Aestivation
Application of specific primers designed on rat het-
erolog sequences permitted us to identify, for the first
time, a partial coding sequence of putative GABAAR a1
(GU117704), GABAAR a4 (GU066784), and GABAAR
a5 (GU066785) along with EF1a (GU066783) in Proto-
pterus annectens. The sequences showed a high nucleoti-
dic identity (>85%) to GABAAR a1 (NM_183326.2),
a4 (NM_080587.3), and a5 (NM_017295.1) of Rattus
norvegicus and other vertebrates such as GABAAR a1
(NM_001077326.1) of Danio rerio. From qPCR evalua-
tions, a1 was threefold more abundant (P < 0.01) in
6mAE and 6mAE1d groups with respect to both FW
and 6dAE lungfishes (Fig. 2A), whereas a4 showed a
tenfold up-regulation (P < 0.001) during the long aesti-
vating maintenance state compared with all the other ex-
perimental groups (Fig. 2B). A moderate (P < 0.05) up-
regulation of this subunit was also reported for FW and
6dAE animals with respect to 6mAE1d. Conversely, this
effect was substituted by a5 during the short inductive
aestivating state as displayed by a tenfold more abundant
422 Giusi et al.

Fig. 1. Morphological analyses of anterior (A), intermediate (B), and posterior (C) brain areas of
the FW lungfish Protopterus annectens. Cytological differences of the following representative neuro-
nal fields in Dp (a; 80 lm), Hyd (b; 80 lm), and Crc (c; 80 lm) were determined by Nissl
method. The quantification of neuronal content with respect to total cells (D) of the same repre-
sentative areas reported for Nissl method was handled on DAPI (ai–ci)- and anti-NeuN (aii–cii)-
stained sections and reported as percentage of total cell 6 s.e.m. Scale bars 5 40 lm.

mRNA expression (P < 0.001) compared with FW,
6mAE, and 6mAE1d conditions (Fig. 2C).
GABAAR a4,5 mRNA Expression During the
Torpor State of Aestivation
GABAAR a1,4,5 subunits exhibited a heterogeneous
brain region-specific mRNA expression pattern in both
6dAE and 6mAE with respect not only to FW but
above all to 6mAE1d. In particular, the extrasynaptic
subunit (a4) displayed a consistent up-regulatory trend in
the dorsal thamalus (Thd, P < 0.001) and Te (P < 0.01)
during the 6mAE state plus a moderate (P < 0.05)
increase in Dp (145%), Sl (142%) and in the preopticus
periventricular nucleus (NPP; 138%) compared with
both 6dAE and FW animals (Fig. 3A,C). In the case of
a1 transcripts, a moderate up-regulation was reported in
Dp (140%), Crc (139%), and Hyv (142%) of 6mAE
animals with respect to FW and 6dAE groups (Fig.
3B,D). With regard to the other extrasynaptic subunit

Journal of Neuroscience Research

 GABAAR and Aestivation 423

Fig. 2. GABAAR a1,4,5 mRNA expression during aestivation. The mRNA levels of a1 (A), a4
(B), and a5 (C) were evaluated in FW (white), 6dAE (striped), 6mAE (black), and 6mAE1d (gray)
animals by qPCR. The results are expressed as a proportion of the highest value after normaliza-
tion with respect to EF1a expression levels and represent the means 6 s.e.m. of three independent
biological replicates. Data were evaluated by a one-way ANOVA followed by Student’s t-test; *P
< 0.05, **P < 0.01, *** P < 0.001.

Fig. 3. GABAAR a1,4 in situ hybridization profile during aestivation. The expression pattern of
GABAAR a4 (A,C) and a1 (B,D) was carried out for extradiencephalic (A,B) and diencephalic
(C,D) brain areas of FW (white), 6dAE (striped), 6mAE (black), and 6mAE1d (gray) groups by
applying in situ hybridization techniques. mRNA levels of each GABAAR subunit were defined as
percentage of total GABAAR a1,4,5 subunits 6 s.e.m. Variations among all aestivating states were
established by one-way ANOVA followed by a post hoc multiple Newman-Keul’s test; *P <
0.05, **P < 0.01, ***P < 0.001.

Journal of Neuroscience Research

424 Giusi et al.
Fig. 4. GABAAR a5 in situ hybridization profile during aestivation.
The in situ hybridization expression pattern of GABAAR a5 was car-
ried out for extradiencephalic (A) and diencephalic (B) brain areas of
FW (white), 6dAE (striped), 6mAE (black), and 6mAE1d (gray)
groups. mRNA levels of this GABAAR subunit were defined as per-
centage of total GABAAR a1,4,5 subunits 6 s.e.m. Variations among
all aestivating states were established by one-way ANOVA followed
by a post hoc multiple Newman-Keul’s test; *P < 0.05, **P < 0.01,
***P < 0.001.
(a5), it displayed a very evident (P < 0.001) up-regula-
tion of mRNA levels in Hyd (198–104%) and Hyv
(196–110%) plus evident and moderate levels in Dp
(173–78%; P < 0.01) and Sl (142–47%; P < 0.05),
respectively, of 6dAE animals compared with FW and
6mAE groups (Fig. 4A,B).
GABAAR a1 mRNA Levels Are Up-Regulated
During the Recovery State of Aestivation
It is notable that the gene expression pattern of
these GABAAR a subunits showed an inverted profile
during the recovery state, which coincides with the
arousal from the aestivation phase. In particular, a4 dis-
played a relevant down-regulating effect in Thd (–110%;
P < 0.001) and Te (–83%; P < 0.01), along with the
moderate (P < 0.05) down-regulation being typical of
NPP (–40%), Dp (–38%), and Sl (–43%) of 6mAE1d
animals with respect to 6mAE (Fig. 3A,C). Conversely,
a1 mRNA levels appeared evidently to increase (P <
0.01) in not only Dp (177%) and Crc (184%) of
6mAE1d with respect to FW and 6dAE conditions but
also in a moderate manner in Hyv (145–52%; P <
0.05) of the same arousal state conditions (Fig. 3B,D).
Even in this case, a5 did not vary during the arousal
state with respect to either 6mAE or FW animals; rather,
differences were noted in comparison with 6dAE lung-
fish. Such a difference was mostly typical of some dien-
cephalic areas as shown by very evident decreases of a5
mRNA expression levels in Hyd (–112%; P < 0.001)
and Hyv (–122%; P < 0.001) plus an evident reduction
(–82%; P < 0.01) in Dp during arousal states with
respect to only 6dAE animals (Fig. 4A,B).
Apoptosis and Neurodegeneration During
Aestivation
The determination of both apoptotic and neurode-
generative events via TUNEL and ACS methods in the
same brain regions (Fig. 5A) of GABAAR a subunits
expression pattern revealed a remarkabe number of
TUNEL-labeled neuronal fields (185%; P < 0.01) above
all in TEL (Fig. 5a) at 6dAE with respect to the represen-
tative FW control (Fig. 5ai). Interestingly, moderate apo-
ptotic signals (154%; P < 0.05) were detected in Cb dur-
ing this short inductive aestivating state. As far as the long
aestivating maintenance state, a consistent amount of neu-
ronal fields in TEL (175%) and Te (148%; Fig. 5b) was
observed (P < 0.01 and P < 0.05, respectively), aside
from a high level of neurodegenerative reaction (Fig. 5bi)
in the mesencephalic area with respect to its control (Fig.
5bii). In the case of the posterior areas such as Cb, both
an evident (P < 0.01) TUNEL reaction (176%; Fig. 5c)
and a moderate degree of neurodegeneration (Fig. 5ci)
were specific for the 6mAE state. Moreover, during the
arousal state (Fig. 5A), only moderate (P < 0.05) increases
of apoptotic processes were detected for TEL (148%)
and Cb (149%).
DISCUSSION
Morphological Features of Lungfish Brain Are
Conserved
The results of this study represent the first evidence
of GABAAR a subunit transcriptional variations consti-
tuting major neurosignaling factors for the induction and
maintenance of aestivating states against metabolic
depression events, which turn out to be adaptive cues
for the survival of lungfish. Such a goal was achieved on
the one hand through the detection of apoptotic and ne-
crotic cells during aestivation and on the other hand by
the molecular identification of specific a1,4,5 subunit
genes operating during the induction of torpor-arousal
state in a similar manner to that of hibernating rodents
(Naum et al., 2001; Canonaco et al., 2005). These mor-
phofunctional evaluations were made possible on the ba-
sis of brain neuronal content in Protopterus annectens (via
anti-NeuN analysis) comparable to that of other dipno-
ans such as Protopterus dolloi (Northcutt, 2009) as well as
mammals (Herculano-Houzel and Lent, 2005). Interest-
ingly, such similarities tend not only to underlie the lack
Journal of Neuroscience Research

Fig. 5. Apoptotic and neurodegenerative events during 6dAE
(striped), 6mAE (black), and 6mAE1d (gray) states. At 6dAE state, an
evident amount of neuronal fields containing apoptotic cells (TUNEL
method, black arrow) was detected in TEL (a) with respect to the rep-
resentative TUNEL control (ai). In the case of 6mAE condition, Te
supplied a moderate (P < 0.05) apoptotic activity (b) plus a consis-
tently high level of degeneration (ACS, white arrow, bi) with respect
of brain morphological variations among them but also
suggest conservative adaptive mechanisms. As a conse-
quence, brain structural features of Protopterus annectens
can be excluded as key factors responsible for extreme
neuronal sensory-motor features; rather, distinct molecu-
lar properties together with nitrogen metabolism altera-
tions seem to constitute crucial elements of aestivating
events (Chew et al., 2004).
GABAAR a Subunit mRNA Expression Is Involved
With the Different Aestivating States
The partial encoding sequence for a1, a4, and a5
subunits, obtained for the first time in Protopterus annect-
ens, made it possible to demonstrate the transcriptional
variations of these specific subunits during the different
aestivating conditions. This derives mainly from preva-
lently elevated expression pattern of the extrasynaptic
subunit (a5) in Hyd and TEL of 6dAE conditions,
whereas the other extrasynaptic subunit (a4) was
expressed predominantly in motor- and visual-control-
ling sites such as Te and Thd of maintenance conditions.
The involvement of a GABAAR subunits in neurophys-
iological events of fish should not be so surprising, inso-
far as GABAergic actions have been reported to control
Journal of Neuroscience Research
GABAAR and Aestivation 425
to its control (bii). At the posterior level, an evident TUNEL reaction
was observed in Cb (c) during long aestivating maintenance state to-
gether with notable neurodegenerative reaction (ci). Variations in apo-
ptotic cell content were reported as percentage of apoptotic cells 6
s.e.m. with respect to FW and analyzed by ANOVA followed by
Bonferroni’s post hoc comparison test; *P < 0.05, **P < 0.01,
***P < 0.001. Scale bars 5 40 lm in a,ai,b,c; 80 lm in bi,bii,ci.
their reproductive, motor (Fraser et al., 2002), feeding
(Martyniuk et al., 2005), and visual (Mora-Ferrer and
Neumeyer, 2009) activities. Moreover, anoxia induces
increased GABAergic activities in brains of vertebrates
that tolerate prolonged periods of oxygen depletion,
such as fish of the genus Carassius and freshwater turtles
of the genera Chrysemys and Trachemys, which are able
to adapt to extreme environmental conditions by aesti-
vating in a similar manner to that of the lungfish, genera
Protopterus (Walsh et al., 2007). As a consequence, in this
resistant and well-adapted species, an increase of
GABAergic activity may be a conservative process re-
sponsible for the depression of neuronal activity, thereby
reducing ATP consumption during periods of oxygen
deprivation and metabolic suppression (Ellefsen et al.,
2009). Moreover, the rising levels of GABAAR a4 subu-
nit mRNA expression during 6mAE period appear to
strengthen the participation of this specific GABAAR
subunit during the adaptation to long maintenance aesti-
vation, probably via the activation of the same neuronal
pathway that the a4 agonist gaboxadol exploits to induce
NREM sleep (Ebert et al., 2006). In this context, the
emerging evidence of aestivating and hibernating torpor
states being considered an evolutionary extension of
426 Giusi et al.
sleep (Heller and Ruby, 2004) tends to underscore ho-
mologous energy-conserving processes operating during
the maintenance state of aestivation to ensure the same
physiological end point, i.e., a ‘‘sleeping state.’’
Regarding the gene expression pattern of a5, its
dense mRNA levels in some brain regions of 6dAE ani-
mals suggest that it may very well operate during the
induction phase of aestivation, in which initial inhibitory
GABAergic actions may be eliciting a phasic type of
transmission in strategically positioned extrasynaptic neu-
ronal clefts, as in mammals (Winsky-Sommerer, 2009).
The functional importance of a5-dependent signals is
supported by their consistent distribution in not only
homeostatic- and neuroendocrine-regulating brain sta-
tions such as Hyp (Verkuyl et al., 2004) but also in
major motor-controlling areas of the dorsal TEL and Te
(Caraiscos et al., 2004). This relationship is in good
agreement, on the one hand, with a preferentially early
developmental role of a5 gene expression on the forma-
tion of dendritic processes and the activation of TEL
silent neurons in a hibernating mammalian species, i.e.,
the golden hamster (Giusi et al., 2009). On the other
hand, the high sensitivity to GABA content and slow
desensitization properties of this subunit tend to consti-
tute a key element for the detection of tonic extracellu-
lar GABA concentration changes within TEL and Hyp
areas exposed to stressful conditions (Caraiscos et al.,
2004). As a consequence of this detecting property of
a5, compensatory functional pathways (Verkuyl et al.,
2004) might very well be promoted via the facilitation
of stronger sedative responses (Takahashi et al., 2009).
During the recovery state, elevated mRNA expres-
sion levels of a1 subunit were instead detected in TEL and
various Cb neuronal fields, areas commonly associated
with GABAergic-dependent plasticity and motor proper-
ties in rodents (Fritschy and Panzanelli, 2006; Li et al.,
2009). Thus, it is tempting to suggest that a1 in our lung-
fish model, as in mammals (Olsen and Sieghart, 2009),
might exert a major role on the correct arrangement of the
other GABAergic subunits, above all for the recovery of all
physiological functions at arousal. Because it is known
that, during arousal, ischemic events are a risk, as already
shown by the notable neuronal damage of some brain
regions during such a hibernating state in rodents (Drew
et al., 2007), the rising gene expression of a1 might also
represent an early activation of protective pathways against
ischemic-like stress episodes in Protopterus annectens
brain areas, as in mammals (Zepeda et al., 2004). Conse-
quently, the potentiation of a1-expressing neurons in
motor-controlling centers seems to strengthen the hyper-
locomotor events induced in a manner similar to that
resulting from hyperammonia-dependent high extracellu-
lar GABAAR activities in rodents (Cauli et al., 2009).
Apoptotic Events Characterize the Switching On/
Off of Lungfish Aestivation
The results of TUNEL analysis tend to suggest that
a specific homeostatic neuronal program involving
neurogenesis and apoptotic events seems to characterize
the different aestivating conditions of Protopterus annect-
ens. In particular, motor-regulating neuronal fields of
TEL, Te, and Cb during the 6mAE state exhibited
dense apoptotic reactions similar to those obtained for
other vertebrates such as amphibians (Cerri et al., 2009)
and mammals (von der Ohe et al., 2007). In line with
such conditions, only a moderate number of apoptotic
neurons occurred during 6mAE1d states in Cb. Hence,
it is tempting to propose that the aestivating lungfish
brain strikes a precise balance between cell death and
neurogenesis, especially in TEL and Cb, areas that are
required to maintain in equilibrium an accurate number
of cells in a regenerative state (Zupanc, 2008). This con-
dition reported for other species, such as frogs, appears
to fit well with the apoptotic events occurring in 6mAE
lungfishes and thereby suggests highly conserved time-
dependent strategies to face cell death and the onset of
neurological damages in well-adapted species. Indeed,
with the harsh environmental conditions, which are
responsible for triggering the lungfish into enter into
a hypometabolic state, the activation of protective
factors appears to play a critical role in the arrest of
growth/developmental plus apoptotic neuronal processes
during this physiological state (Cerri et al., 2009), by
regulating endogenous fuels and thereby ensuring the
success of aestivation (Henry et al., 2007).
CONCLUSIONS
Overall, these results corroborate for the first time
the important role of GABAAR a subunit transcriptional
variations in distinct brain regions that are also character-
ized by apoptotic events in the brain of the aestivating
lungfish. Recently, work is beginning to point to
GABAergic neurons as major constituents of apoptotic
activities (Diwakarla et al., 2009), especially in motor-
controlling areas, which are required for the mainte-
nance of an accurate number of cells in a regenerative
state (Zupanc, 2008), although further studies are
required to demonstrate the exact relationship between
GABAAR-dependent neurosignalling properties and cell
death. The reduction and/or activation of specific a
subunits genes may represent a first step toward pro-
grammed neuronal turnover activities as supported by a4
accounting for a prolonged quiescent state. On the other
hand, the promotion of neurogenic programs in motor-
controlling areas appear to be tightly related to an
increase of a1 gene expression. This subunit has already
been recognized as a highly specific factor involved with
the promotion of new synaptic plasticity states in ische-
mic brain areas (Zepeda et al., 2004), which is also the
condition detected during the arousal phase of hiberna-
tion (Drew et al., 2007). We are still at the beginning,
but the unraveling of distinct GABAAR a subunit-
encoding genes may represent a first step toward
defining the role of inhibitory signals alone or via the
interaction of excitatory glutamatergic mechanisms
(work in progress) during aestivation. At same time, the
Journal of Neuroscience Research

application of specific pharmacological and molecular
approaches directed to the characterization of distinct a-
containing GABAARs membrane domains may bring us
closer to the understanding of adaptive neuronal mecha-
nisms operating during aestivation, and this could have
valuable therapeutic bearings on sleeping disorders such
as insomnia (Vecsey et al., 2009).
REFERENCES
Bonin RP, Orser BA. 2008. GABAA receptor subtypes underlying gen-
eral anesthesia. Pharmacol Biochem Behav 90:105–112.
Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M,
Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J,
Wittwer CT. 2009. The MIQE guidelines: minimum information for
publication of quantitative real-time PCR experiments. Clin Chem
55:611–622.
Canonaco M, Madeo M, Alò R, Giusi G, Granata T, Carelli A, Canon-
aco A, Facciolo RM. 2005. The histaminergic signaling system exerts a
neuroprotective role against neurodegenerative-induced processes in the
hamster. J Pharmacol Exp Ther 315:188–195.
Caraiscos VB, Elliott EM, You-Ten KE, Cheng VY, Belelli D, Newell
JG, Jackson MF, Lambert JJ, Rosahl TW, Wafford KA, MacDonald JF,
Orser BA. 2004. Tonic inhibition in mouse hippocampal CA1 pyrami-
dal neurons is mediated by alpha5 subunit-containing gamma-aminobu-
tyric acid type A receptors. Proc Natl Acad Sci U S A 101:3662–3667.
Cauli O, Mansouri MT, Agusti A, Felipo V. 2009. Hyperammonemia
increases GABAergic tone in the cerebellum but decreases it in the rat
cortex. Gastroenterology 136:1359–1367.
Cerri S, Bottiroli G, Bottone MG, Barni S, Bernocchi G. 2009. Cell
proliferation and death in the brain of active and hibernating frogs.
J Anat 215:124–131.
Chew SF, Chan NK, Loong AM, Hiong KC, Tam WL, Ip YK. 2004.
Nitrogen metabolism in the African lungfish, Protopterus dolloi, aestivat-
ing in a mucus cocoon on land. J Exp Biol 207:777–786.
Diwakarla S, Mercer LD, Kardashsyan L, Chu PW, Shin YS, Lau CL,
Hughes ML, Nagley P, Beart PM. 2009. GABAergic striatal neurons
exhibit caspase-independent, mitochondrially mediated programmed
cell death. J Neurochem 109:198–206.
Doldán MJ, Prego B, Holmqvist BI, de Miguel E. 1999. Distribution of
GABA-immunolabeling in the early zebrafish (Danio rerio) brain. Eur
J Morphol 37:126–129.
Drew KL, Buck CL, Barnes BM, Christian SL, Rasley BT, Harris MB.
2007. Central nervous system regulation of mammalian hibernation:
implications for metabolic suppression and ischemia tolerance. J Neuro-
chem 102:1713–1726.
Ebert B, Wafford KA, Deacon S. 2006. Treating insomnia: current and
investigational pharmacological approaches. Pharmacol Ther 112:612–
629.
Ellefsen S, Stensløkken KO, Fagernesm CE, Kristensen TA, Nilsson GE.
2009. Expression of genes involved in GABAergic neurotransmission in
anoxic crucian carp brain (Carassius carassius). Physiol Genomics 36:61–
68.
Fraser EJ, Bosma PT, Trudeau VL, Docherty K. 2002. The effect of
water temperature on the GABAergic and reproductive systems in
female and male goldfish (Carassius auratus). Gen Comp Endocrinol
125:163–175.
Fritschy JM. 2008. Epilepsy, E/I balance and GABAA receptor plasticity.
Front Mol Neurosci 1:1–5.
Fritschy JM, Panzanelli P. 2006. Molecular and synaptic organization of
GABAA receptors in the cerebellum: effects of targeted subunit gene
deletions. Cerebellum 5:275–285.
Giusi G, Facciolo RM, Alò R, Carelli A, Madeo M, Brandmayr P, Can-
onaco M. 2005. Some environmental contaminants influence motor
Journal of Neuroscience Research
GABAAR and Aestivation 427
and feeding behaviors in the ornate wrasse (Thalassoma pavo) via distinct
cerebral histamine receptor subtypes. Environ Health Perspect
113:1522–1529.
Giusi G, Alò R, Crudo M, Facciolo RM, Canonaco M. 2008. Specific
cerebral heat shock proteins and histamine receptor cross-talking mech-
anisms promote distinct lead-dependent neurotoxic responses in teleosts.
Toxicol Appl Pharmacol 227:248–256.
Giusi G, Facciolo RM, Rende M, Alò R, Di Vito A, Salerno S, Morelli
S, De Bartolo L, Drioli E, Canonaco M. 2009. Distinct a subunits of
the GABAA receptor are responsible for early hippocampal silent neu-
ron-related activities. Hippocampus 19:1103–1114.
Glass ML. 2008. The enigma of aestivation in the African lungfish Proto-
pterus dolloi. Commentary on the paper by Perry et al. Respir Physiol
Neurobiol 160:18–20.
Heller HC, Ruby NF. 2004. Sleep and circadian rhythms in mammalian
torpor. Annu Rev Physiol 66:275–289.
Henry PG, Russeth KP, Tkac I, Drewes LR, Andrews MT, Gruetter R.
2007. Brain energy metabolism and neurotransmission at near-freezing
temperatures: in vivo 1H MRS study of a hibernating mammal. J Neu-
rochem 101:1505–1515.
Herculano-Houzel S, Lent R. 2005. Isotropic fractionator: a simple, rapid
method for the quantification of total cell and neuron numbers in the
brain. J Neurosci 25:2518–2521.
Ip YK, Chew SF, Randall DJ. 2004. Five tropical air-breathing fishes, six
different strategies to defend against ammonia toxicity on land. Physiol
Biochem Zool 77:768–782.
Lekanne Deprez RH, Fijnvandraat AC, Ruijter JM, Moorman AF. 2002.
Sensitivity and accuracy of quantitative real-time polymerase chain reac-
tion using SYBR green I depends on cDNA synthesis conditions. Anal
Biochem 307:63–69.
Li P, Rudolph U, Huntsman MM. 2009. Long-term sensory deprivation
selectively rearranges functional inhibitory circuits in mouse barrel cor-
tex. Proc Natl Acad Sci U S A 106:12156–12161.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data
using real-time quantitative PCR and the 22DDCt method. Methods
25:402–408.
Loong AM, Ang SF, Wong WP, Pörtner HO, Bock C, Wittig R,
Bridges CR, Chew SF, Ip YK. 2008. Effects of hypoxia on the energy
status and nitrogen metabolism of African lungfish during aestivation in
a mucus cocoon. J Comp Physiol B178:853–865.
Lutz PL, Nilsson GE. 2004. Vertebrate brains at the pilot light. Respir
Physiol Neurobiol 141:285–296.
Martyniuk CJ, Crawford AB, Hogan NS, Trudeau VL. 2005. GABAer-
gic modulation of the expression of genes involved in GABA synaptic
transmission and stress in the hypothalamus and telencephalon of the
female goldfish (Carassius auratus). J Neuroendocrinol 17:269–275.
Mora-Ferrer C, Neumeyer C. 2009. Neuropharmacology of vision in
goldfish: a review. Vis Res 49:960–969.
Naum OG, Fernanda Rubio M, Golombek DA. 2001. Rhythmic varia-
tion in gamma-aminobutyric acid(A)-receptor subunit composition in
the circadian system and median eminence of Syrian hamsters. Neurosci
Letts 310:178–182.
Northcutt RG. 2009. Telencephalic organization in the spotted African
lungfish, Protopterus dolloi: a new cytological model. Brain Behav Evol
73:59–80.
Olsen RW, Sieghart W. 2009. GABAA receptors: subtypes provide di-
versity of function and pharmacology. Neuropharmacology 56:141–
148.
Perry G, Taddeo MA, Nunomura A, Zhu X, Zenteno-Savin T, Drew
KL, Shimohama S, Avila J, Castellani RJ, Smith MA. 2002. Compara-
tive biology and pathology of oxidative stress in Alzheimer and other
neurodegenerative diseases: beyond damage and response. Comp Bio-
chem Physiol C Toxicol Pharmacol 133:507–513.
428 Giusi et al.
Reiner A, Northcutt RG. 1992. An immunohistochemical study of the
telencephalon of the Senegal bichir (Polypterus senegalus). J Comp Neu-
rol 319:359–386.
Takahashi A, Yap JJ, Bohager DZ, Faccidomo S, Clayton T, Cook JM,
Miczek KA. 2009. Glutamatergic and GABAergic modulations of ultra-
sonic vocalizations during maternal separation distress in mouse pups.
Psychopharmacology 204:61–71.
Trabucchi M, Trudeau VL, Drouin G, Tostivint H, Ihrmann I, Vallarino
M, Vaudry H. 2008. Molecular characterization and comparative local-
ization of the mRNAs encoding two glutamic acid decarboxylases
(GAD65 and GAD67) in the brain of the African lungfish, Protopterus
annectens. J Comp Neurol 506:979–988.
Ünal-Çevik I, Kilinç M, Gürzoy-Özdemir Y, Gurer G, Dalkara T. 2004.
Loss of NeuN immunoreactivity after cerebral ischemia does not indi-
cate neuronal cell loss: a cautionary note. Brain Res 1015:169–174.
Vallarino M, Trabucchi M, Masini MA, Chartrel N, Vaudry H. 1997.
Immunocytochemical localization of somatostatin and autoradiographic
distribution of somatostatin binding sites in the brain of the African
lungfish, Protopterus annectens. J Comp Neurol 388:337–353.
Vecsey CG, Baillie GS, Jaganath D, Havekes R, Daniels A, Wimmer M,
Huang T, Brown KM, Li XY, Descalzi G, Kim SS, Chen T, Shang YZ,
Zhuo M, Houslay MD, Abel T. 2009. Sleep deprivation impairs cAMP
signalling in the hippocampus. Nature 461:1122–1125.
Verkuyl JM, Hemby SE, Joëls M. 2004. Chronic stress attenuates
GABAergic inhibition and alters gene expression of parvocellular neu-
rons in rat hypothalamus. Eur J Neurosci 20:1665–1673.
von der Ohe CG, Garner CC, Darian-Smith C, Heller HC. 2007. Syn-
aptic protein dynamics in hibernation. J Neurosci 27:84–92.
Walsh PJ, Veauvy CM, McDonald MD, .Pamenter ME, Buck LT,
Wilkie MP. 2007. Piscine insight into comparisons of anoxia tolerance,
ammonia toxicity, stroke and hepatic encephalopathy. Comp Biochem
Physiol A147:332–343.
Winsky-Sommerer R. 2009. Role of GABAA receptors in the physiology
and pharmacology of sleep. Eur J Neurosci 29:1779–1794.
Zarnowska ED, Keist R, Rudolph U, Pearce RA. 2009. GABAA recep-
tor alpha5 subunits contribute to GABAA, slow synaptic inhibition in
mouse hippocampus. J Neurophysiol 101:1179–1191.
Zepeda A, Sengpiel F, Guagnelli MA, Vaca L, Arias C. 2004. Functional
reorganization of visual cortex maps after ischemic lesions is accompa-
nied by changes in expression of cytoskeletal proteins and NMDA and
GABAA receptor subunits. J Neurosci 24:1812–1821.
Zupanc GK. 2008. Adult neurogenesis and neuronal regeneration in the
brain of teleost fish. J Physiol Paris 102:357–373.
Journal of Neuroscience Research