Genetic characterization of guava (Psidium

guajava L.) germplasm in the United States

using microsatellite markers

V. Sitther, D. Zhang, D. L. Harris,

A. K. Yadav, F. T. Zee, L. W. Meinhardt
& S. A. Dhekney

Genetic Resources and Crop

Evolution
An International Journal

ISSN 0925-9864

Genet Resour Crop Evol

DOI 10.1007/s10722-014-0078-5

1 23
Your article is protected by copyright and all
rights are held exclusively by Springer Science
+Business Media Dordrecht. This e-offprint
is for personal use only and shall not be self-
archived in electronic repositories. If you wish
to self-archive your article, please use the
accepted manuscript version for posting on
your own website. You may further deposit
the accepted manuscript version in any
repository, provided it is only made publicly
available 12 months after official publication
or later and provided acknowledgement is
given to the original source of publication
and a link is inserted to the published article
on Springer's website. The link must be
accompanied by the following text: "The final
publication is available at link.springer.com”.

1 23
 Author's personal copy
Genet Resour Crop Evol
DOI 10.1007/s10722-014-0078-5

RESEARCH ARTICLE

Genetic characterization of guava (Psidium guajava L.)

germplasm in the United States using microsatellite markers
V. Sitther • D. Zhang • D. L. Harris •
A. K. Yadav • F. T. Zee • L. W. Meinhardt •

S. A. Dhekney

Received: 14 August 2013 / Accepted: 7 January 2014

Ó Springer Science+Business Media Dordrecht 2014

Abstract Genetic diversity of 35 Psidium guajava
L. accessions and three related species (P. guineense
Sw., P. sartorianum (O. Berg) Nied. and P. friedrichs-
thalianum (O. Berg) Nied.) maintained at the U.S.
Department of Agriculture (USDA), National Plants
Germplasm System, Hilo, HI, was characterized using
20 simple sequence repeat (SSR) markers. Diversity
analysis detected a total of 178 alleles ranging from 4
to 16 alleles per locus. The observed mean heterozy-
gosity (0.2) and inbreeding coefficient (0.8) indicated
a high level of inbreeding among the accessions tested.
Multi-locus DNA fingerprints based on the 20 SSR
loci unambiguously differentiated all accessions and
revealed the absence of duplicated samples. Ordina-
tion and cluster analyses suggested that the genetic
relationships between majorities of the accessions
could be explained by geographic origin, mainly
including tropical America, Southeast Asia and
Hawaii. A Bayesian cluster analysis partitioned the
accessions into two groups and the partition was
largely compatible with the result of ordination
analyses. Distance-based cluster analyses further
indicated that accessions from same geographical
region or breeding programs grouped together in spite
of the inter-regional exchange of germplasm. Acces-
sions from Southeast Asia were dominantly white
fleshed, whereas accessions from tropical America
and Hawaii exhibited diverse flesh colors. The results
also indicated that accessions from the same region
were likely derived from a small number of common

V. Sitther (&) F. T. Zee

Department of Biology, Morgan State University,
1700 E. Cold Spring Lane, Baltimore, MD 21251, USA
e-mail: viji.sitther@morgan.edu
D. Zhang  L. W. Meinhardt
Sustainable Perennial Crops Laboratory, USDA-ARS,
Beltsville Agricultural Research Center, Beltsville,
MD 20705, USA
Tropical Plant Genetic Resources and Disease Research,
Hilo, HI 96720, USA
S. A. Dhekney
University of Wyoming, Sheridan Research and Extension
Center, Sheridan, WY 82801, USA

D. L. Harris
Saint Martin’s University, 5000 Abbey Way SE, Lacey,
WA 98503-7500, USA

A. K. Yadav
Agricultural Research Station, Fort Valley State
University, 1005 State University Drive, Fort Valley,
GA 31030-4313, USA

123
 Author's personal copy
ancestors or progenitors. All 20 SSRs were transfer-
able to P. guineense, P. sartorianum and P. fried-
richsthalianum, indicating a close relationship
between the cultigens and wild relatives. Application
of SSR markers in the USDA/Agricultural Research
Service germplasm collection provides new insight
into the diversity of the guava germplasm, which will
be valuable in future breeding endeavors and the
conservation of guava genetic resources.
Keywords Cultivar identification 
Fingerprinting  Genetic variation 
Homozygosity  Inbreeding  Molecular markers 
Psidium guajava  Simple sequence repeat
Introduction
Psidium guajava L. is an important fruit crop in
tropical regions of the United States, where it is
cultivated for production of fresh fruit, jam, jelly and
juice. It is an excellent source of health beneficial
compounds including high amounts of vitamins C,
dietary fiber, b-carotene, and it is known for its ability
to reduce LDL cholesterol and triglycerides (Preece
1981; Setiawan et al. 2001; Singh et al. 1992). An
increased demand for guava consumption resulted in
increased production from 1.3 million lbs (2010) to
1.9 million lbs in 2011 in the state of Hawaii alone
(http://www.nass.usda.gov/Statistics_by_State/Hawaii/
Publications/Fruits_and_Nuts/guavaFF.pdf).
The origin of guava, although uncertain, is believed
to be in Central and South America (Nakasone and
Paull 1998). The genus Psidium (2n = 22) includes
about 150 species and is widely distributed in tropical
regions of the world. While P. guajava is the most
commonly cultivated and widely studied species, other
Psidium species including P. cattleianum Sabine,
P. friedrichsthalianum (O. Berg) Nied., P. guineense
Sw., P. montanum Sw. and P. sartorianum (O. Berg)
Nied. are fairly well distributed. Adequate genetic
variation has been observed in P. guajava for the
development of commercial cultivars with economic
importance (Pathak and Ojha 1993). Selected guava
cultivars are commercially grown worldwide includ-
ing South Asia, Central and South America, subtrop-
ical regions of the continental U.S., Hawaii and
Australia. Guava is a self-pollinated crop with
35–40 % outcrossing (Nakasone and Paull 1998;
123
Genet Resour Crop Evol
Singh and Sehgal 1968). It is common to select
progeny with desirable characteristics from a seedling
population; this often results in the development of
commercial cultivars that may not be homozygous to
the parents from which they are derived.
The economic importance of guava has driven
significant efforts to accelerate the exploitation of
Psidium resources for development of new cultivars.
However, technological advances through high-input
agriculture in the last 50 years were based on perfor-
mance of a limited number of selected varieties. The
narrow genetic diversity of many commercial crops
has increased the vulnerability of agriculture to
disease, climatic and insect problems. More impor-
tantly, large- scale monoculture increases the rapid
displacement of landraces by few selected commercial
cultivars. The goal for any germplasm collection is to
capture and conserve the genetic diversity through the
preservation of the entire germplasm in a species,
which includes cultivated varieties, primitive culti-
vars, landraces and wild and weedy relatives.
Although a large number of clonally propagated
accessions are maintained in germplasm collections
worldwide, their use for crop improvement is limited
by inadequate information on genetic diversity, pop-
ulation structure and appropriate phenotypic assess-
ment. The identification, characterization and
evaluation of collections will lead to the utilization
of the germplasm for development of improved
cultivars.
In the United States, the University of Hawaii,
College of Tropical Agriculture and Human Resources
is involved in guava improvement and has signifi-
cantly impacted the development of new cultivars.
From 1948 to 1969, 21 guava cultivars from seven
countries were introduced and evaluated (Morton
1987; Nakasone and Paull 1998). ‘Beaumont’, the first
guava cultivar released to the island’s processing
industry, was selected from an open-pollinated seed-
ling population in 1954. The variety ‘Ka Hua Kula’,
selected from 1,200 open-pollinated ‘Beaumont’
seedlings and released in 1978, has fruit qualities
similar to ‘Beaumont’ but with a stronger pink color
and higher acid content. A growing interest in the
exploration of guava genetic resources and obstacles
in procuring international plant germplasm make it
paramount to characterize accessions currently avail-
able with the U.S. Department of Agriculture/Agri-
cultural Research Service (USDA/ARS), National
 Author's personal copy
Genet Resour Crop Evol
Plant Germplasm System (NPGS), which maintains an
ex situ collection in Hilo, HI. A thorough evaluation of
available germplasm can provide valuable informa-
tion to breeders for selection of parents for develop-
ment of improved cultivars.
Various DNA markers have been used to differen-
tiate guava cultivars at the molecular level (Feria-
Romero et al. 2009; Rodriguez et al. 2007). Of these,
simple sequence repeat (SSR) markers are widely
preferred as they are co-dominant, highly polymor-
phic, exhibit transferability among closely related
genera and can be scored unambiguously (Bucheli
et al. 2001; Tautz 1989). SSRs for P. guajava have
been developed using genomic libraries of the species
for the simple sequence repeats (GA)n and (GT)n
(Risterucci et al. 2005). These microsatellite loci have
proved effective for the genetic analyses of guava
accessions from various countries (Kanupriya et al.
2011; Valdés-Infante et al. 2007). The present study
aimed at dissecting the genetic structure of the largest
guava germplasm collection in the United States,
which maintains highly diverse accessions, wild
species and selections of improved cultivars. Although
the origin of the accessions is unknown, the collection
represents cultivars with diverse horticultural charac-
teristics. The objectives of the study were to charac-
terize the genetic variation among guava accessions,
determine the genetic structure of the cultivar collec-
tion and evaluate the transferability of SSR markers
developed for P. guajava to other wild species of the
genus.
Materials and methods
Plant material
Psidium accessions characterized in this study, their
source and flesh color are listed in Table 1. Leaf
samples were obtained from the USDA/ARS, Pacific
Basin Tropical Plant Germplasm Resource Center
(PBARC) in Hilo, HI. In addition to 35 P. guajava
accessions, one each of the wild species including
P. friedrichsthalianum, P. guineense, P. sartorianum
were included to test the cross-transferability of the
SSR markers. Actively growing shoot and leaf sam-
ples from all accessions and wild species were
harvested and immediately frozen to -80 °C prior to
being shipped overnight on dry ice. Immediately upon
arrival, the tender shoots were separated from stems,
ground to a fine powder in liquid nitrogen and stored at
-80 °C.
DNA isolation and quantification
Total genomic DNA was extracted from 500 mg of
leaf tissue using a Qiagen DNeasy Plant Maxi Kit
(Qiagen, Valencia, CA, USA). Prior to DNA extrac-
tion, samples were placed in a Qiagen tissue lyser
(Qiagen, Valencia, CA, USA) for 2 min at 30 Hz to
disrupt leaf material. Quality of DNA was checked on
a 1 % (w/v) agarose gel, and its concentration was
determined using a spectrophotometer (NanoDrop,
Wilmington, DE, USA). A portion of the DNA was
diluted in molecular grade water to 10 ng lL-1
concentration and stored at -20 °C.
PCR amplification and microsatellite identification
A set of forty PCR primers amplifying twenty
microsatellite loci cloned and sequenced by Risterucci
et al. (2005) were used to characterize guava acces-
sions (Table 2). These markers have been previously
demonstrated to be useful in distinguishing guava
genotypes (Kanupriya et al. 2011; Valdés-Infante et al.
2007). PCR amplifications were performed using
WellRED fluorescent dye-labeled primers (Beckman
Coulter, Inc., Fullerton, CA, USA). Reactions were
carried out in 25 lL volume containing 10 ng geno-
mic DNA, 0.4 lM dNTPs, 0.1 lM fluorescent-labeled
forward and reverse primers, 3.0 mM MgCl2, and
0.1 U of 29 Taq DNA polymerase (GoTaq DNA
Polymerase, Promega Corporation, Madison, USA)
mixed in reaction buffer (pH 8.5). DNA amplification
was performed using a Bio-Rad iCycler ver. 1.259
system (Bio-Rad, Hercules, CA, USA). Conditions for
PCR reactions were: one cycle at 94 °C for 5 min, 30
cycles at 94 °C for 45 s, 55 °C for 1 min, 72 °C for
1 min and a final cycle of 72 °C for 8 min. The
amplified loci were separated by capillary electropho-
resis with a 400 bp size standard and analyzed on a
CEQTM8000 eight-channel capillary genetic analysis
system (Beckman Coulter, Fullerton, CA, USA). SSR
fragments were generated using the CEQ 8000
Fragment Analysis software version 7.0.55 according
to manufacturers’ recommendations (Beckman Coul-
ter, Inc.) and fragment sizes were automatically
123
 Author's personal copy
Genet Resour Crop Evol

Table 1 List of the 38 guava accessions, code, source, and flesh color as recorded in the USDA/ARS, PBARC in Hilo, HI
Code Species Accession Source Flesh color

HPSI 3 Psidium guajava ‘Indonesian Seedless’ Florida White

HPSI 5 Psidium guajava ‘Hong Kong White’ Hawaii White
HPSI 6 Psidium guajava ‘Patillo’ Florida Pale pink
HPSI 7 Psidium guajava ‘Pink Acid’ Florida Pink
HPSI 8 Psidium guajava ‘Thailand Seedless’ Thailand White
HPSI 15 Psidium guajava ‘Hong Kong Pink’ Hawaii Pink
HPSI 27 Psidium guajava ‘J.B. White’ Singapore White
HPSI 34 Psidium guajava ‘Fan Retief’ South Africa Pink
HPSI 38 Psidium guajava ‘Poamoho Pink’ Hawaii Pale pink
HPSI 41 Psidium guajava ‘Thai Maroon’ Malaysia Red
HPSI 42 Psidium guajava ‘Diminuitive’ Hawaii Pale yellowish
HPSI 44 Psidium guajava ‘Bon Dov’ Israel White
HPSI 48 Psidium guajava ‘Indian Red’ Florida Pale pink
HPSI 52 Psidium guajava ‘Klom Ampom’ Thailand White
HPSI 53 Psidium guajava ‘Klom Sa Lee’ Thailand White
HPSI 54 Psidium guajava ‘Bangkok Apple’ Thailand White
HPSI 55 Psidium guajava ‘Khao Sawaive’ Thailand White
HPSI 57 Psidium guajava ‘Holmberg’ Hawaii Pink
HPSI 60 Psidium guajava ‘Klom Toonklao’ Thailand White
HPSI 67 Psidium guajava ‘Rica’ Brazil Pink
HPSI 68 Psidium guajava ‘Gema De Doro’ Brazil Yellow
HPSI 61 Psidium guajava ‘Pearl guava’ Taiwan White
HPSI 12 Psidium guajava ‘Golden’ Taiwan White
HPSI 50 Psidium guajava ‘Alahabad Safeda’ Australia Pale pink
HPSI 56 Psidium guajava ‘Red Indian’ Florida Pink
HPSI 26 Psidium guajava ‘Gushiken Sweet’ Hawaii White
HPSI 13 Psidium guajava ‘Pear’ Taiwan Pink
HPSI 14 Psidium guajava ‘Ruby 9 Supreme’ Florida White
HPSI 62 Psidium guajava ‘Less Seed’ Taiwan Pink
HPSI 49 Psidium guajava ‘Lucknow’ Australia Pale pink
HPSI 47 Psidium guajava ‘Uma’ San Diego, CA White
HPSI 16 Psidium guajava ‘Puerto Rico’ Puerto Rico Pink
HPSI 37 Psidium guajava ‘Beaumont’ Hawaii Pink
HPSI 35 Psidium guajava ‘Ka Hua Kula’ Hawaii Pink
HPSI 20 Psidium guajava ‘Waiakea’ Hawaii Dark pink
HPSI N-97-46 Psidium guineense N-97-46 Australia Pale orange
HPSI N-95-20 Psidium friedrichsthalianum ‘Costa Rican’ El Salvador White
HPSI N-97-49 Psidium sartorianum N-97-49 Australia Greenish

calculated by the CEQTM8000 Genetic Analysis Data analysis

System. Allele calling was performed using the CEQ
8000 binning wizard software (CEQTM8000 software Summary statistics for each marker locus including
version 7.0.55, Beckman Coulter, Inc.) and edited allelic richness, heterozygosity, gene diversity, number
based on the bin list using a SAS program (SAS 1999). of alleles and inbreeding coefficient were computed

123
 Author's personal copy
Genet Resour Crop Evol

Table 2 Characteristics of 20 simple sequence repeat markers (Risterucci et al. 2005) used in the analysis of genetic diversity of the
U.S. guava germplasm collection
Primer EMBL Repeat Primer sequences (50 –30 ) Allele
Accession motif size
no. Forward Reverse ranges

mPgCIR01 AJ639775 (GA)17 TAGTGCTTTGGTTGCTT GCAGGTGGATATAAGGTC 237

mPgCIR03 AJ639754 (GA)40 TTGTGGCTTGATTTCC TCGTTTAGAGGACATTTCT 158
mPgCIR04 AJ639755 (GA)25 TTCAGGGTCTATGGCTAC CAACAAGATACAGCGAACT 148
mPgCIR05 AJ639756 (GA)31 GCCTTTGAACCACATC TCAATACGAGAGGCAATA 252
mPgCIR07 AJ639757 (CA)13AA(GAA)3 ATGGAGGTAGGTTGATG CGTAGTAATCGAAGAAATG 149
mPgCIR08 AJ639758 (GA)12 ACTTTCGGTCTCAACAAG AGGCTTCCTACAAAAGTG 214
mPgCIR09 AJ639759 (GA)19 GCGTGTCGTATTGTTTC ATTTTCTTCTGCCTTGTC 173
mPgCIR10 AJ639760 (CT)12 GTTGGCTCTTATTTTGGT GCCCCATATCTAGGAAG 261
mPgCIR11 AJ639761 (CT)17 TGAAAGACAACAAACGAG TTACACCCACCTAAATAAGA 298
mPgCIR13 AJ639762 (AC)12(AT)4G(GA)2 CCTTTTTCCCGACCATTACA TCGCACTGAGATTTTGTGCT 245
mPgCIR15 AJ639764 (GA)8GG(GA)9 TCTAATCCCCTGAGTTTC CCGATCATCTCTTTCTTT 147
mPgCIR16 AJ639765 (TC)25 AATACCAGCAACACCAA CATCCGTCTCTAAACCTC 292
mPgCIR17 AJ639766 (CT)23 CCTTTCGTCATATTCACTT CATTGGATGGTTGACAT 231
mPgCIR19 AJ639768 (CT)16 AAAATCCTGAAGACGAAC TATCAGAGGCTTGCATTA 274
mPgCIR20 AJ639769 (CT)14(CA)17 TATACCACACGCTGAAAC TTCCCCATAAACATCTCT 266
mPgCIR21 AJ639770 (AG)15GG(AG)7 TGCCCTTCTAAGTATAACAG AGCTACAAACCTTCCTAAA 154
mPgCIR22 AJ639771 (GT)9(GA)14 CATAAGGACATTTGAGGAA AATAAGAAAGCGAGCAGA 235
mPgCIR23 AJ639772 (TA)4(GT)7 GTCTATACCTAATGCTCTGG CCCAGGAAAATCTATCAC 185
mPgCIR25 AJ639773 (GA)24 GACAATCCAATCTCACTTT TGTGTCAAGCATACCTTC 124
mPgCIR26 AJ639774 (GT)2(GA)17 CTACCAAGGAGATAGCAAG GAAATGGAGACTTTGGAG 185

using GenAlEx 6.5 (Peakall and Smouse 2006, 2012).
Inbreeding coefficient followed the definition of Wright
(1965). Multilocus matching was performed to identify
duplicates in the data set, and the same program was
used for genotype matching. Accessions with different
names that were completely matched at the 20 loci were
considered as duplicates. Pair-wise genetic distances as
defined by Peakall et al. (1995) were computed using the
DISTANCE procedure implemented in GenAlEx 6.5.
The same program was also used to perform a principle
coordinate analysis (PCoA).
A cluster analysis using the Neighbor Joining
method was used to further examine the genetic
relationship among accessions. Kinship coefficient
was chosen as genetic distance measurement to ensure
a direct estimate of shared ancestry among the
individual accessions (n = 38). The computation
was executed using microsatellite analyzer (Dieringer
and Schlötterer 2002) with 100 bootstrapping. A
dendrogram of the consensus tree was generated from
the resulting distance matrix using the neighbor-
joining algorithm (Saitou and Nei 1987) available in
PHYLIP (Felsenstein 1989) and visualized using the
TreeView Version 1.6.6 (Page 1996).
A model-based clustering algorithm implemented
in the STRUCTURE software program (Pritchard
et al. 2000) was applied to the SSR data in order to
verify the kinship coefficients from distance-based
cluster analyses. The model-based Bayesian algorithm
attempted to identify genetically distinct subpopula-
tions based on allele frequencies. The admixture
model was applied and the number of clusters
(K value), indicating the number of subpopulations
the program attempted to find, was set from 1 to 10,
and analyses was carried out without assuming any
prior information about the genetic groups. Ten
independent runs were assessed for each fixed number
of clusters (K), each consisting of 1 9 106 iterations
after a burn-in of 2 9 106 iterations. The DK value
was used to detect the most probable number of
clusters (Evanno et al. 2005) and the computation was
performed using the STRUCTURE HARVESTER

123
 Author's personal copy
Genet Resour Crop Evol

program (Earl and vonHoldt 2012). Of the 10 inde- Table 3 Summary statistics for 38 guava accessions assessed
pendent runs, the one with the highest Ln Pr with 20 simple sequence repeats (Risterucci et al. 2005)
(X|K) value (log probability or log likelihood) was Locus Na Ne Ho He a
IC
chosen and represented as bar plots.
mPgCIR01 6.0 3.4 0.0 0.7 1.0
Cross-species transferability mPgCIR03 4.0 1.3 0.0 0.2 1.0
mPgCIR11 11.0 6.0 0.0 0.8 1.0
All 20 loci were evaluated for amplification on three mPgCIR16 7.0 4.9 0.2 0.8 0.8
wild guava species namely P. friedrichsthalianum, mPgCIR17 11.0 5.1 0.3 0.8 0.7
P. guineense and P. sartorianum. Sample collection, mPgCIR21 11.0 4.2 0.1 0.8 0.9
DNA isolation, PCR amplification and detection of mPgCIR04 12.0 5.8 0.5 0.8 0.4
SSR profiles were performed according to the proce- mPgCIR05 8.0 3.1 0.1 0.7 0.8
dure described above for P. guajava. mPgCIR08 11.0 6.2 0.2 0.8 0.8
mPgCIR09 16.0 8.7 0.3 0.9 0.6
mPgCIR10 7.0 3.9 0.1 0.7 0.8
Results mPgCIR13 9.0 2.0 0.3 0.5 0.5
mPgCIR15 10.0 5.1 0.2 0.8 0.7
All 20 SSRs tested generated amplicons and detected mPgCIR19 8.0 2.9 0.0 0.7 1.0
polymorphisms among the guava accessions evalu- mPgCIR20 8.0 4.2 0.4 0.8 0.5
ated. The number of alleles ranged from 4 to 16 across mPgCIR22 7.0 2.6 0.1 0.6 0.8
the 20 loci, with an average of 8.9 (Table 3). The mPgCIR23 8.0 3.1 0.2 0.7 0.7
highest number of polymorphic alleles was detected at mPgCIR25 9.0 3.8 0.0 0.7 1.0
locus mPgCIR09 with a total of 16 alleles. Expected mPgCIR26 9.0 5.6 0.1 0.8 0.9
heterozygosity values (He) ranged from 0.24 to 0.9, mPgCIR07 6.0 2.6 0.1 0.6 0.8
with an average of 0.7, while observed heterozygosity Mean 8.9 4.2 0.2 0.7 0.8
(Ho) values ranged from 0.00 to 0.5 with an average of
Na = number of alleles, Ne = number of effective alleles,
0.2. The inbreeding coefficient among accessions Ho = observed heterozygosity, He = expected heterozygosity,
tested ranged from 0.4 to 1.0, with an average of 0.8. IC = inbreeding coefficient
Four of the twenty loci (mPgCIR01, mPgCIR03, a
Definition of inbreeding coefficient according to Wright
mPgCIR11 and mPgCIR25) generated complete (1965)
homozygous genotypes among the 38 accessions
tested. University of Hawaii’s guava improvement program
Individual genotype matching (pair-wise compar- and those selected by the Institute of Food and
isons) based on multi-locus SSR profiles did not detect Agricultural Sciences, University of Florida (Crane
matching pairs, demonstrating that each accession and Balerdi 2012) were included in the third group.
analyzed was a distinct genotype. Results of principle P. guineense closely clustered with the P. guajava
coordinate analysis performed to provide spatial accessions in this group.
representation of the relative genetic distances among Neighbor joining dendrogram based on kinship coef-
individuals revealed three distinct groups, with the ficient placed the 38 guava accessions into six clusters
wild species interspersed among the P. guajava (Fig. 2), which was partially supported by the results of
accessions (Fig. 1). The plane of the first three PCoA principle coordinate analysis. The first cluster comprised
axes accounted for 72.1 % of the total variation (first of almost identical accessions as those revealed in the
axis = 37.8 %, second = 19.2 % and third = 15.1 %). PCoA. This cluster comprised of eight P. guajava
Two wild species, P. friedrichsthalianum and P. sar- accessions with varied parentage and included the three
torianum along with five other P. guajava accessions wild species, P. friedrichsthalianum, P. guineense, and
clustered in the first group. The second group P. sartorianum. In this cluster, accessions ‘Beaumont’
comprised of 13 accessions, the majority of which and ‘Ka Hua Kula’ grouped closely and accurately
were clones collected from Southeast Asia. Cultivars reflected their parent–offspring relationship. Cluster II
and breeding lines that were developed at the comprised of three accessions, all of which were obtained

123
 Author's personal copy
Genet Resour Crop Evol

Fig. 1 Principle coordinate Principal Coordinates

analysis of 38 guava
accessions from USDA/
Poamoho Pink
ARS, Pacific Basin Tropical Holmberg
Plant Germplasm Resource
Indonesian Seedless
Center, Hilo, Hawaii.
Clustered groups are
represented by different Alahabad safeda
Hong Kong White
Waiakea
colors. The plane of the first Lucknow
Patillo
Hong Kong Pink N-97-46
three PCoA axes account for Rica Gushiken Sweet
Pink Acid Less Seed
a total of 72.1 % of the total Bon Dov
Ruby x Supreme
Diminuitive
variation (first Indian Red
Thai Maroon
Coord. 2
Red Indian
axis = 37.8 %, Uma
Pear
second = 19.2 % and
Beaumont
third = 15.1 %). (Color
figure online) Klom Sa Lee
Kahuakula
Klom Toonklao N-97-49
Costa Rican
Pearl guava
Khao Sawaive
J.B. White Gema De Doro

Klom Ampom
Fan Retief
Golden

Thailand Seedless
Puerto Rico

Bangkok Apple

Coord. 1
Group I Group II Group III

from Hawaii. Most accessions in cluster III were
processing type guavas with pink-fleshed acidic fruits.
The acidic processing guavas, ‘Pink acid’ and ‘Patillo’
grouped very closely in this cluster. The pink-fleshed
accessions, ‘Poamoho pink’ and ‘Holmberg’ that were
developed at the Poamoho station, University of Hawaii,
grouped closely in cluster V along with five other
accessions. ‘Pear’ that has crispy firm flesh and ‘Alahabad
Safeda’with soft flesh clustered closely with ‘Lucknow’
in this cluster. The largest number of accessions were
grouped in cluster VI comprising 12 of the 38 accessions.
This cluster included the white crispy dessert guava
‘Klom Toonklao’, ‘Klom Ampom’, ‘Thailand Seedless’
and ‘Bangkok Apple’ from Thailand; ‘Golden’ and ‘Pearl
Guava’ from Taiwan, and ‘J. B. White’ from Singapore,
which are selections developed from Thai dessert guava
germplasm. Although ‘Hong Kong White’ and ‘Hong
Kong Pink’ were collected from the University of Hawaii
germplasm site, they grouped in different clusters.
Population stratification of the accessions based on
DK value computed by STRUCTURE HARVESTER
revealed two clusters as the most probable number of K
(Evanno et al. 2005) (Figs. 3 and 4), and the partition
was partially compatible with principle coordinate
analysis (Fig. 1) as well as the dendrogram based on
kinship coefficient (Fig. 2). All accessions that grouped
together in the first cluster of PCoA and dendrogram
were included in cluster I of the structure analysis. In
addition, accessions in Group I of Bayesian clustering
included most of the accessions in clusters II, III and IV
of the kinship based dendrogram, whereas Group II of
the Bayesian cluster included most accessions in clusters
IV, V and VI. Accessions ‘Hong Kong White’, ‘Hong
Kong Pink’ ‘Costa Rica’, ‘Indian Red’, ‘Pink Acid’,
‘Ruby 9 Supreme’ and ‘Red Indian’ and ‘Patillo’ were
hybrids between the two different groups. Most of these
hybrid types fell in clusters II, III and IV in the NJ
dendrogram (Fig. 2). The Bayesian clustering assigned
cultivar groups supporting the classification based on
flesh color to a certain extent. There was a noticeable
difference in flesh color among the two groups (Fig. 3).
While most white-fleshed accessions from Thailand
clustered together in Group I (red), pink-fleshed acces-
sions were interspersed in Group II (red). Of a total of 15
white-fleshed cultivars tested in the study, only two were
assigned in Bayesian Group 1.
All SSRs markers tested were capable of amplify-
ing DNA in the different Psidium species tested. While

123
 Author's personal copy
Genet Resour Crop Evol

Fig. 2 Neighbor-joining
Accession Source Flesh Color
dendrogram depicting the
relationship among the 38 'Gema De Doro' Brazil Yellow
guava accessions from 'Costa Rican' El Salvador White
USDA/ARS, Pacific Basin N-97-46 Australia Pale Orange
Tropical Plant Germplasm N-97-49 Australia Greenish
Resource Center in Hilo, 'Ka Hua Kula' Hawaii Pink
I
Hawaii. Identification of 'Beaumont' Hawaii Pink
accessions correspond to 'Fan Retief' South Africa Pink
samples listed in Table 1 'Puerto Rico' Puerto Rico Pink
'Diminuitive' Hawaii Pale Yellowish
'Gushiken Sweet' Hawaii White II
'Waiakea' Hawaii Dark pink
'Less Seed' Taiwan Pink
'Patillo' Florida Pale Pink
'Pink Acid' Florida Pink
'Hong Kong Pink' Hawaii Pink III
‘Ruby’ x ‘Supreme’ Florida White
'Red Indian' Florida Pink
'Indian Red' Florida Pale Pink
IV
'Indonesian Seedless'Florida White
'Lucknow' Australia Pale Pink
'Pear' Taiwan Pink
'Alahabad Safeda' Australia Pale Pink
'Hong Kong White' Hawaii White V
'Rica' Brazil Pink
'Holmberg' Hawaii Pink
'Poamoho Pink' Hawaii Pale Pink
'Uma' California White
'Bon Dov' Israel White
'Thai Maroon' Malaysia Red
'Khao Sawaive' Thailand White
'Klom Sa Lee' Thailand White
'Golden' Taiwan White
'Klom Toonklao' Thailand White VI
'Pearl guava' Taiwan White
'J.B. White' Singapore White
'Klom Ampom' Thailand White
'Bangkok Apple' Thailand White
'Thailand Seedless' Thailand White

19 out of the 20 SSRs tested in the study produced
amplification profiles in the expected range allele
range, several cultivated and the wild species showed
out of range alleles at loci mPgCIR04. In general,
cross-species amplification was observed in all three
Psidium species. Of the 20 SSRs tested, three primer
pairs did not produce amplifications in the exact allele
range in P. guineense, P. sartorianum and P. fried-
richsthalianum, respectively, as described by Rister-
ucci et al. (2005).
Discussion
Assessment of genetic variability in guava is a first
step towards rational conservation and efficient use of
genetic resources for crop improvement. Accurate
identification of accessions in a germplasm collection
is an important challenge faced in crop improvement
programs. Germplasm obtained from a reliable source
such as the original breeder, an institutional collection
or those from identified sources by a knowledgeable
collector are more reliable than those obtained from
open markets. For germplasm identification, co-dom-
inant molecular markers such as microsatellites are
powerful tools as they are objective and offer repro-
ducible means of identification, independent of envi-
ronmental influences. The use of SSR markers has
provided valuable information on the genetic diversity
among guava accessions in India and Cuba (Kanupriya
et al. 2011; Valdés-Infante et al. 2007). In the
present study polymorphic SSR markers developed

123
 Author's personal copy
Genet Resour Crop Evol
Fig. 3 Inferred clusters based on Bayesian analysis among 38
guava accessions obtained from USDA/ARS, Pacific Basin
Tropical Plant Germplasm Resource Center in Hilo, HI. Each
vertical line represents an individual multilocus genotype. Each
color represents the most likely ancestry of the cluster from
which the genotype or partial genotype was derived. Delta K is
the potential number of genetic clusters that may exist in the
overall sample of individuals. Individuals with multiple colors
have admixed genotypes from multiple clusters. (Color figure
online)
by Risterucci et al. (2005) enabled identification of
cultivated and wild type accessions and establishment
of multilocus profiles of guava germplasm in the U.S.
SSRs used in the study were consistent in their
ability to amplify specific loci to discriminate alleles.
In spite of the varying heterozygosity and number of
Fig. 4 Plot of Delta K (filled circles, solid line) calculated as
the mean of the second-order rate of change in likelihood of
K divided by the standard deviation of the likelihood of K,
m(|L00 (K)|)/s [L(K)]
alleles, the combination of the 20 SSR markers used in
the present study clearly differentiated all cultivated
and wild type Psidium accessions at the USDA/ARS.
High levels of expected heterozygosity (He) were
observed among the guava accessions (0.7), while
observed heterozygosity (Ho) was much lower with an
average of 0.2. This large difference between He and
Ho indicates the tendency of high inbreeding or
‘‘founder effect’’ during domestication. The high
inbreeding coefficient (0.8) corroborates previous
observations that guava has an estimated outcrossing
rate of 35–40 % (Nakasone and Paull 1998). The
pattern of allelic diversity observed in our study was
similar to that reported by Kanupriya et al. (2011)
where 23 SSRs were used to characterize pink-fleshed,
white-fleshed, and segregating selections of open
pollinated cultivars in India. The average number of
alleles detected in the present study (8.9) was similar
to their findings where 6.4 alleles per locus were
detected.
The levels of observed heterozygosity (Ho = 0.2) in
the present study is lower than that reported by Valdés-
Infante et al. (2007) in which open pollinated
seedlings from a Cuban breeding program showed
an average observed heterozygosity of 0.38. This
suggests that cross-incompatibility may play a signif-
icant role in hindering the effectiveness of creating
true hybrids and recombining favorable alleles (from
parental clones) in the guava breeding program.
123
 Author's personal copy
Testing and identification of cross-incompatibility
groups, followed by controlled hybridization between
cross-compatible parents may be needed for the
development of improved guava cultivars. However,
since we have evaluated a small set of SSR loci, there
is possibility that the low heterozygosity and large
inbreeding coefficient was partially due to the sam-
pling bias of SSR markers. Testing of additional
guava-specific SSR markers on diverse guava germ-
plasm could verify this observation.
It was interesting to note that the processing type
pink-fleshed acidic guavas, ‘Pink acid’ and ‘Patillo’
grouped very closely in the NJ dendrogram (Fig. 2). In
addition, accessions ‘Poamoho Pink’ and ‘Holmberg’
developed at the research station in Hawaii grouped
closely (Cluster V), and most accessions that grouped
in cluster VI were selections developed from Thai
dessert guava germplasm. The clustering of these
closely-related accessions indicates the efficacy of the
SSR markers used in the study. The grouping patterns
revealed by PCoA (Fig. 1), NJ dendrogram (Fig. 2)
and Bayesian clustering analysis (Figs. 3 and 4) were
largely compatible. In general, accessions collected
from the same geographical region or breeding
program tended to group together, indicating that
despite the widespread distribution of guava in the
tropical world and more than 100 years cultivation in
the Asia and Pacific region, the exchange of germ-
plasm among regions has been limited. Additionally, it
appears that only a small number of guava germplasm
have been used in breeding programs. The pattern of
clustering could also be explained by consumer
preferences and breeding for specific traits. For
example, six out of seven accessions from Thailand
were consistently grouped in one cluster in the PCoA,
NJ tree and Bayesian clustering analyses, and all of
them were white fleshed. This apparently is due to a
regional preference of varieties with white flesh and
crunchy texture.
The 20 microsatellite markers showed transferabil-
ity among closely related genera. One or two alleles
per locus were produced in the wild guava species
(2n = 44). The interspersed distribution of wild type
guavas along with the cultivated species as observed in
the PCoA, NJ dendrogram and Bayesian clustering
analysis indicate the high levels of genetic similarity
among them. It is not surprising to notice few non-
123
Genet Resour Crop Evol
specific and out of range amplifications in the wild
species and this has been reported previously (Rister-
ucci et al. 2005). During the isolation and character-
ization of guava SSRs used in this study, non-specific
amplifications were observed in 6 of the 23 loci tested.
It was interesting to note that mPgCIR21 produced out
of range amplifications in several cultivated and wild
accessions as well. Among the wild guava accessions
tested, 19 of the 20 SSRs produced PCR products with
the exception of mPgCIR04 in P. friedrichsthalianum.
Repeated DNA extraction and amplifications did not
yield PCR products indicating the possibility of
mutation at the annealing site causing null alleles.
Cross-species transferability of the SSR markers
indicates the widespread use of this molecular tool.
Chromosomal segments conserved in several related
species enable these markers to be valuable tools in
comparative genomic studies and subsequently in
breeding programs. Such attributes are highly benefi-
cial as they minimize the efforts required for devel-
oping additional primers.
The present study provides an insight on the
molecular characterization of guava germplasm using
co-dominant markers. The information is highly
useful to curators in guiding conservation manage-
ment practices of ex situ collection for guava germ-
plasm. However, it needs to be pointed out that guava
samples tested in this study represent germplasm
available in the United States only; other wild species
and landraces remain unrepresented and genetic
relatedness has not been fully comprehended. A
broader assessment with world-wide representation
would provide a deeper insight on the distribution of
genetic relatedness in this crop.
Information generated in the present study paves
the way for selection of appropriate parents for guava
improvement. The high level of homozygosity sug-
gests an immediate need for improving genetic
diversity of available germplasm through controlled
cross-pollination. Such heterozygosity created in the
population could provide an additional source of
genetic variation for development of commercially
desirable cultivars. Additional research targeting the
use of wild species will be pursued to increase fitness
among parental accessions in the breeding program,
which will avoid the expression of deleterious reces-
sive genes caused by inbreeding.
 Author's personal copy
Genet Resour Crop Evol
Acknowledgments Financial support of the USDA-CSREES
through an award Agreement 2004-38814-15128 to The Fort
Valley State University is greatly appreciated.
References
Bucheli E, Gautschi B, Shykoff A (2001) Differences in popu-
lation structure of the anther smut fungus Microbotryum
violaceum on two closely related host species, Silene lati-
folia and S. dioica. Mol Ecol 10:285–294
Crane JH, Balerdi CF (2012) Growing guava in the Florida
landscape. University of Florida, Institute of Food and
Agricultural Sciences, Extension Bulletin # HS 4:1–8.
http://edis.ifas.ufl.edu/mg045
Dieringer D, Schlötterer C (2002) Microsatellite analyser
(MSA): a platform independent analysis tool for large
microsatellite data sets. Mol Ecol Notes 3:167–169
Earl Dent A, vonHoldt Bridgett M (2012) STRUCTURE
HARVESTER: a website and program for visualizing
STRUCTURE output and implementing the Evanno
method. Conserv Genet Resour 4(2):359–361
Evanno G, Regnaut S, Goudet J (2005) Detecting the number of
clusters of individuals using the software STRUCTURE: a
simulation study. Mol Ecol 14:2611–2620
Felsenstein J (1989) PHYLIP-Phylogeny Inference Package
(version 3.2). Cladistics 5:164–166
Feria-Romero IA, Astudillo-Dela HV, Chavez-Soto MA, Ri-
vera-Arce E, Lopez M, Serrano H, Lozoya X (2009) RAPD
markers associated with quercetin accumulation in Psidi-
um guajava. Biol Plant 53:125–128
Kanupriya C, Madhavi Latha P, Aswath C, Reddy L, Padmakar
B, Vasugi C, Dinesh MR (2011) Cultivar identification and
genetic fingerprinting of guava (Psidium guajava) using
microsatellite markers. Int J Fruit Sci 1:184–196
Morton JF (1987) Myrtaceae; Guava. In: Dowing CF Jr (ed)
Fruits of warm climates. Julia F Morton Publishers, Miami,
pp 356–363
Nakasone YH, Paull RE (1998) Tropical fruits. Crop production
science in horticulture series. CAB International, Wal-
lingford, pp 149–172
Page RDM (1996) Treeview: an application to display phylo-
genetic trees on personal computers. Cabios 12:357–358
Pathak RK, Ojha CM (1993) Genetic resources of guava.
Advances in horticulture. Malhotra Publishing House, New
Delhi, pp 143–147
Peakall R, Smouse PE (2006) GenAlex 6: genetic analysis in
Excel. Population genetic software for teaching and
research. Mol Ecol Notes 6:288–295
The author has requested enhancement of the downloaded file. All in-text references underlined in blue are linked to publications on Researc
Peakall R, Smouse PE (2012) GenAlEx 6.5: genetic analysis in
Excel. Population genetic software for teaching and
research-an update. Bioinformatics 28:2537–2539
Peakall R, Smouse PE, Huff DR (1995) Evolutionary implica-
tions of allozyme and RAPD variation in diploid popula-
tions of dioecious buffalograss Buchloe dactyloides. Mol
Ecol 4:135–147
Preece WE (ed.) (1981) Fruit nutrient composition table.
Encyclopedia Britannica 7:766
Pritchard JK, Stephens M, Donnelly P (2000) Inference of
population structure using multilocus genotype data.
Genetics 155:945–959
Risterucci AM, Duval MF, Rohde W, Billottte N (2005) Isola-
tion and characterization of microsatellite loci from Psid-
ium guajava L. Mol Ecol Notes 5:745–748
Rodriguez N, Valdes-Infante J, Becker D, Velazquez B,
Gonzalez G, Sourd D (2007) Characterization of guava
accessions by SSR markers, extension of the molecular
linkage map, and mapping of QTLs for vegetative and
reproductive characters. Acta Hortic 735:201–215
Saitou N, Nei M (1987) The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol Biol
Evol 4:406–425
SAS (1999) SAS Version 8.02: SAS/STAT Software: changes
and enhancements through Release 8.02. SAS Institute Inc,
Cary, NC
Setiawan B, Sulaeman A, Giraud DW, Driskell JA (2001)
Carotenoid content of selected Indonesian fruits. J Food
Compos Anal 14:169–176
Singh R, Sehgal OP (1968) Studies on blossom biology of
Psidium guajava L. (guava). II. Pollen studies, stigma
receptivity, pollen and fruit set. Indian J Hortic 25:52–59
Singh RB, Rostogi SS, Singh R, Gosh S, Niaz MA (1992)
Effects of guava intake on serum total and high-density
lipoprotein cholesterol levels and on systemic Blood
pressure. Am J Cardiol 70:1287–1291
Tautz D (1989) Hypervariability of simple sequences as a
general source for polymorphic DNA markers. Nucleic
Acids Res 17:6463–6471
Valdés-Infante J, Rodriguez NN, Becker D, Velazquez B, Sourd
D, Espinosa D, Rohde W (2007) Microsatellite character-
ization of guava (Psidium guajava L.) germplasm collec-
tion in Cuba. Cultiv Trop 28:61–67
Wright S (1965) The interpretation of population structure by
F-statistics with special regard to systems of mating.
Evolution 19:395–420
123