See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/232057697

Detection of Fusobacterium Species in Human Feces Using Genus-Specific

PCR Primers and Denaturing Gradient Gel Electrophoresis

Article  in  Microbial Ecology in Health and Disease · July 2009

DOI: 10.1080/089106002320644294

CITATIONS READS

8 542

4 authors, including:

Jens Walter Christian Hertel

University of Alberta DIL Deutsches Institut für Lebensmitteltechnik e. V.
217 PUBLICATIONS   15,234 CITATIONS    182 PUBLICATIONS   7,428 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Microbial ecology of sourdough View project

AiF 21709 N: Inactivation of desiccated, heat-tolerant Salmonella in chocolate production View project

All content following this page was uploaded by Jens Walter on 28 May 2014.

The user has requested enhancement of the downloaded file.

 SHORT COMMUNICATION

Detection of Fusobacterium Species in Human Feces

Using Genus-SpeciŽ c PCR Primers and Denaturing
Gradient Gel Electrophoresis
Jens Walter, Dirk Margosch, Walter P. Hammes and Christian Hertel

From the Institute of Food Technology, University of Hohenheim, Stuttgart, Germany

Correspondence to: Christian Hertel, Institute of Food Technology, University of Hohenheim, Garbenstr.
28, D-70599, Stuttgart, Germany. Tel.: »49 711 459 4255; Fax: »49 711 459 4199; E-mail: hertel@uni-
hohenheim.de

Microbial Ecology in Health and Disease 2002; 14: 129 – 132

Denaturing gradient gel electrophoresis of 16S rDNA fragments generated with a genus-speciŽ c PCR system was used to detect
Fusobacterium species in human feces, with the exception of F. prausnitzii. Out of 30 fecal samples, four contained fusobacteria at
numbers close to the detection-limit of approximately 10 5 cells per g, thus questioning a substantial role for these species in the intestinal
 ora.

The distal human gastrointestinal tract is colonized by a
complex bacterial community referred to as the intestinal
micro ora (13). Species of the genus Fusobacterium are
considered to constitute a substantial part of the bacteria
colonizing this ecosystem (5, 13), and F. prausnitzii has
been identiŽ ed as a dominant organism within the human
fecal  ora (7, 11, 12, 17, 19). However, the application of
phenotypic and genotypic methods of classiŽ cation re-
vealed that F. prausnitzii can be separated from the genus
Fusobacterium (8, 16). Although reclassiŽ cation is not yet
proposed, an afŽ liation with the genus Eubacterium is
more suitable (16). Those fusobacteria within a close phy-
logenetic relationship to the genus type-species F. nuclea -
tum were not detectable in human feces by direct analysis
of 16S rDNA fragments generated by PCR with universal
primers (11, 18, 19). Nevertheless, even if present only at
minor numbers in the human gut, their occurrence is of
interest since some are known human pathogens (5, 9).
Denaturing gradient gel electrophoresis in conjunction
with speciŽ c primers proved suitable to detect members of
the intestinal micro ora even when present at low numbers
or in a non-culturable state (14). In this communication,
we describe the derivation and use of PCR primers speciŽ c
for the genus Fusobacterium and their application to detect
fusobacteria in human fecal samples by PCR-DGGE.
Regions of the 16S rDNA speciŽ c for fusobacteria were
identiŽ ed using the PROBE-DESIGN tool of the software
package ARB (6). Primers f109V and f315R (Table I) were
constructed to selectively amplify the V1 region. Primer
f678R was used in combination with the universal primer

Table I
Primers used for identiŽ cation of pure cultures and for PCR-DGGE

Primer Sequence (5Æ–3Æ) Position a Purpose Source or reference

f109V CGGGTGAGTAACGCGTAAAG 109 IdentiŽ cation This study

f315R b GCCGTGTCTCAGTCCCCT 315 IdentiŽ cation This study
HDA1 c ACTCCTACGGGAGGCAGCAGT 337 SpeciŽ c DGGE (15)
f678R CGAATTTCACCTCTACACTTGT 678 SpeciŽ c DGGE This study

a
Position according to the 16S rDNA of E. coli (3).
b
Primer was used with and without a 39 bp GC clamp (5Æ-CGC CCC CGC GGC CCG CGC CCC CCC CGC
CGC CCC CGC CCC -3Æ) added to 5Æ-end.
c
A 40 bp GC clamp (5Æ-CGC CCG GGG CGC GCC CCG GGC GGG GCG GGG GCA CGG GGG G-3Æ)
was added to 5Æ-end.

© Taylor & Francis 2002. ISSN 0891-060 X Microbial Ecology in Health and Disease
130 J. Walter et al.

Table II
Bacterial strains, media used for their cultivation, and speciŽ city of the PCR systems with primers
f109V:f315R and HDAI:f678R

b
Species Source Medium PCR product

c
f109V:f315R HDAI:f678R d

Escherichia coli DH5a LB n.d. e ¼

Bacteroides fragilis ATCC 25285 T BHI ¼ ¼
BiŽ dobacterium dentium ATCC 27678 T BHI ¼ ¼
Clostridium perfringens ATCC 13124 T BHI ¼ ¼
Eubacterium limosum DSM 20543 T BHI ¼ ¼
Fusobacterium gonidiaforman s ATCC 25563 T BHI » »
Fusobacterium necrogenes ATCC 25556 T BHI n.d. »
Fusobacterium necrophorum DSM 20698 BHI » »
Fusobacterium necrophorum ATCC 25286 T BHI » »
Fusobacterium russii ATCC 25533 T BHI » »
Fusobacterium simiae ATCC 33568 T BHI » »
Fusobacterium varium ATCC 8501 T BHI » »
Fusobacterium sp. AN 82 a BHI » »
Fusobacterium sp. AN 83 BHI » n.d.
Lactobacillus paracasei DSM 5622 T MRS ¼ ¼

a
AN, Anaerobic strain collection Hohenheim University.
b
BHI, brain heart infusion broth (Difco); LB, Lauria-Bertani broth; MRS (Difco).
c
Annealing temperature 66°C. The GC clamp at the 5Æ-end of the primer f315R reduced neither the
selectivity nor the sensitivity of the PCR system.
d
Annealing temperature 60°C.
e
n.d., Not determined.

HDAI (Table I) to selectively amplify the V3 region. The tion of bands were performed as described previously (2,
target sequences of the custom primers were compared 15) with a gradient of 25 – 35% urea and formamide in
with all sequences in the ARB database using the PROBE- DGGE gels. As shown in Fig. 1, the PCR fragments of
MATCH tool, and the suitability of the obtained PCR pure cultures showed sharp bands in DGGE gels at spe-
fragments for DGGE was deduced as described previously ciŽ c migration distances (lane 1–7).
(14). In silico primer speciŽ city analysis showed that the
primers should bind exclusively to the 16S rDNA of all
known Fusobacterium species (except F. prausnitzii ),
Clostridium rectum, and Propionigenium modestum which is
presumably not present in the human intestine. The match
with C. rectum is consistent with the phylogenetic Ž nding
that this species should be allotted the genus Fusobac -
terium (4). The speciŽ city of the PCR systems was evalu-
ated with DNA extracted from pure cultures. Bacterial
culture, DNA extraction, PCR reaction mixture and am-
pliŽ cation program (except the annealing temperature)
were performed as described previously (14). For both
primer pairs, PCR products were obtained exclusively with
fusobacteria (Table II). The sensitivity of the two PCR
systems was determined using chromosomal DNA of F. Fig. 1. DGGE analysis of PCR-ampliŽ ed 16S rDNA fragments
obtained with primer pair HDAI:f678R and DNA isolated from
varium ATCC8501 T . A minimum of 1 pg of DNA for
Fusobacterium species (Lane 1 – 7) and human feces (subjects
primer pair HDAI:f678R was necessary to obtain a faint A – D). Lane (1) F. necrogenes ATCC 25556 T ; (2) F. necrophorum
PCR product. In contrast, PCR with primers f109V:f315R ATCC 25286 T ; (3) F. gonidiaformans ATCC 25563 T ; (4) F. varium
required at least 10 ng of DNA. For identiŽ cation of ATCC 8501 T ; (5) F. russii ATCC 25533 T ; (6) F. simiae ATCC
cultures we used primers f109V:f315R, since the speciŽ city 33568 T ; (7) Fusobacterium sp. AN82. The bands (indicated by
arrows) were excised and sequenced (see Table III). The fragment
of both primers makes the PCR system more reliable.
of F. necrophorum DSM 20698 (not run in this gel) migrated the
Primers HDAI:f678R were used to detect Fusobacterium same distance as the fragment of the corresponding type strain
species in human feces. DGGE and sequence determina- (lane 2).

Table III
Species detected by PCR-DGGE with primers HDAI:f678R and by culture for subjects A–D
a
Band Species b
1 F. varium
2 F. gonidiaformans
3 F. naviforme :F. nucleatum ssp. vincentii:F. simiae
4 F. nucleatum ssp. polymorphum
5 F. nucleatum ssp. polymorphum
a
Bands from DGGE gel depicted in Fig. 1.
b
IdentiŽ ed by sequencing upon excision from the gel.
c
n.d., not determined.
We tested the primer pair HDAI:f678R with total DNA
extracted from fecal samples of three healthy subjects
(male, aged 26, 30 and 33 years). DNA was isolated as
described previously (14), but the incubation with lysis
buffer was reduced from 1 h to 10 min and mutanolysin
was omitted. A faint PCR product was obtained exclu-
sively from the fecal sample of subject C. In parallel, the
samples were homogenized, diluted as described previously
(14), and viable cell counts were determined by plating on
Fastidious Anaerobe Agar (FAA selective with neomycin
and vancomycin, (1)). This agar was designed for the
selective cultivation of Fusobacterium species from clinical
and non-clinical specimens. After 48 h, colonies became
visible on the agar plates of all three subjects, and one
representative of each colony morphology was picked and
puriŽ ed. From the 14 strains obtained, DNA was isolated
(15) and subjected to PCR with primers f109V:f315R. Two
colony types (strains AN 82 and AN 83) from subject C
gave a positive result. Additionally, the Ž rst 500 bp of the
16S rDNA gene of all isolates was ampliŽ ed, and the
resulting PCR products were puriŽ ed and sequenced. A
GenBank search using the BlastN algorithm conŽ rmed the
PCR result with primers f109V:f315R. Sequence analysis
of the complete 16S rRNA gene revealed that the se-
quences of both isolates were identical and showed similar-
ity of \ 98.5% to the species F. simiae, F. nucleatum subsp.
vincentii and F. naviforme. A band with the same migra-
tion distance and sequence was also detected by PCR-
DGGE in the fecal sample of subject C (Fig. 1, Lane 7 and
subject C, band 3). Additionally, F. nucleatum subsp.
polymorphum (band 4) was detectable by DGGE in the
feces of subject C but not by culture (Table III).
To determine the detection-limit of the primers HDAI
and f678R we spiked feces (which gave a negative PCR
result) with F. necrophorum DSM 20698 and F. varium
ATCC 8501T . For both organisms, 105 cells per g were still
detectable by PCR resulting in a faint band. This Ž nding is
in agreement with the fecal sample of subject C from
which strains AN82 and AN83 had been detected at
approximately 105 CFU:g (Table III).
Detection of fusobacteria in feces by speciŽ c PCR-DGGE 131
Similarity (%) Cell counts on FAA agar
(CFU:g)
99.4 n.d. c
100 n.d.
100:99.7:99.7 1.1½105
99.3 –
99.6 n.d.
To determine the molecular diversity of Fusobacterium
species in human feces we tested further 27 human fecal
samples with primer HDAI and f678R. PCR products
were obtained for three of the samples only. PCR-DGGE
analysis revealed different band patterns for each individ-
ual (Fig. 1). Bands 1 and 2 were identiŽ ed based on
comparison with the migration distance of the reference
strains (F. varium and F. gonidiaformans ), and all se-
quences could be allotted to the genus Fusobacterium upon
sequencing (Table III).
Our study has led to the derivation of speciŽ c PCR
primers that partially amplify the 16S rDNA of bacteria
belonging to the genus Fusobacterium, except F. praus -
nitzii. These primers have been demonstrated to be useful
to detect, at the species level, these bacteria in human
feces. Our results show that only a minority (four out of
30) of human fecal samples contained fusobacteria, in
numbers close to 105 cells per g. Given bacterial numbers
exceeding 1011 CFU:g of feces these low numbers question
a metabolically important role of fusobacteria in the gut,
for example as a meaningful producer of butyrate (10).
The use of primers HDAI and f678R promises to be a
valuable aid in advancing our knowledge of the species
composition and population shifts within fusobacteria in
other complex ecosystems without the bias of cultivation,
such as the oral cavity, dental plaque, or abscesses, where
these bacteria play a signiŽ cant role.
ACKNOWLEDGEMENTS
We thank M. Kranz for excellent technical assistance during
sequencing. The participation of the subjects in this study is
gratefully acknowledged.
REFERENCES
1. Atlas RM. In: Parks LC, ed. Microbiological Media. London,
UK: CRC Press, 1993.
2. Ben Omar N, Ampe F. Microbial community dynamics dur-
ing production of the Mexican fermented maize dough pozol.
Appl Environ Microbiol 2000; 66: 3664 – 73.
132 J. Walter et al.
3. Brosius J, Dull TJ, Sleeter DD, Noller HF. Gene organization
and primary structure of a ribosomal RNA operon from
Escherichia coli. J Molec Biol 1981; 148: 107 – 27.
4. Collins MD, Lawson PA, Willems A, Cordoba JJ, Fernandez-
Grarayzabal J, Garcia P, Cai J, Hippe J, Farrow JAE. The
phylogeny of the genus Clostridium : proposal of Ž ve new genera
and eleven new species combinations. Int J Syst Bacteriol 1994;
44: 812 – 26.
5. Hofstad, T, 1992 The genus Fusobacterium, In: Balows et al.
(ed.), The Prokaryotes Berlin, Germany: Springer, p. 4115 –
4126.
6. Ludwig, W, Strunk, O, 1997. ARB : a software environment for
sequence data. http:::www.biol.chemie.tu-muenchen.de :pub:
ARB:documentation:arb.ps.
7. Moore WE, Holdeman LV. Human fecal  ora: the normal  ora
of 20 Japanese – Hawaiians. Appl Microbiol 1974; 27: 961 – 79.
8. Moore WE, Holdeman LV, Welley RW. Genus Fusobacterium.
In: Krieg NR, Holt JG, eds. Bergey’s Manual of Systematic
Bacteriology, vol. 1. Baltimore, MD: Williams and Wilkins,
1989: 631.
9. Onderdonk AB. The intestinal micro ora and intra-abdominal
sepsis. In: Tannock GW, ed. Medical Importance of the
Normal Micro ora. London, UK: Kluwer Academic Publish-
ers, 1999.
10. Salminen S, Bouley C, Boutron-Ruault M-C, Cummings JH,
Franck A, Gibson GR, Isolauri E, Moreau M-C, Roberfroid
M, Rowland I. Functional food science and gastrointestinal
physiology and function. Br J Nutr 1998; 80: S147 – 71.
11. Suau A, Bonnet R, Sutren M, Godon J-J, Gibson GR, Collins
MD, Doré J. Direct analysis of genes encoding 16S rRNA from
complex communities reveals many novel molecular species
within the human gut. Appl Environ Microbiol 1999; 65:
4799 – 807.
View publication stats
12. Suau, A, Rochet, V, Sghir, A, Gramet, G, Brewaeys, S, Sutren,
M, Rigottier-Gois, L, Doré, J. Fusobacterium prausnitzii and
related species represent a dominant group within the human
fecal  ora. Syst Appl Microbiol 2001; 24: 139 – 145.
13. Tannock GW. Normal Micro ora. An Introduction to Mi-
crobes Inhabiting the Human Body. London, UK: Chapman
and Hall, 1995.
14. Walter J, Hertel C, Tannock GW, Lis CM, Munro K, Hammes
WP. Detection of Lactobacillus, Pediococcus, Leuconostoc, and
Weissella species in human feces by using group-speciŽ c PCR
primers and denaturing gradient gel electrophoresis. Appl
Environ Microbiol 2001; 67: 2578 – 85.
15. Walter J, Tannock GW, Tilsala-Timisjarvi A, Rodtong S,
Loach DM, Munro K, Alatossava T. Detection and identiŽ ca-
tion of gastrointestinal Lactobacillus species by using denatur-
ing gradient gel electrophoresis and species-speciŽ c PCR
primer. Appl Environ Microbiol 2000; 66: 297 – 303.
16. Wang R-F, Cao W-W, Cerniglia CE. Phylogenetic analysis of
Fusobacterium prausnitzii based upon the 16S rRNA gene
sequence and PCR conŽ rmation. Int J Syst Bacteriol 1996; 46:
341 – 3.
17. Wang R-F, Cao W-W, Cerniglia CE. PCR detection and
quantitation of predominant anaerobic bacteria in human and
animal fecal samples. Appl Environ Microbiol 1996; 62: 1242 –
7.
18. Wilson KH, Blitchington RB. Human colonic biota studied by
ribosomal DNA sequence analysis. Appl Environ Microbiol
1996; 62: 2273 – 8.
19. Zoetendal EG, Akkermans ADL, de Vos WM. Temperature
gradient gel electrophoresis analysis of 16S rRNA from human
fecal samples reveals stable and host-speciŽ c communities of
active bacteria. Appl Environ Microbiol 1998; 64: 3854 – 9.