Ó 2020 Published by Elsevier Inc. on behalf of Poultry Science Association Inc.

This is an open access article under the CC BY-NC-ND license

(http://creativecommons.org/licenses/by-nc-nd/4.0/).

Effects of nanoencapsulated cumin essential oil as an

alternative to the antibiotic growth promoter in
broiler diets
N. Amiri,* M. Afsharmanesh,*,1 M. Salarmoini,* A. Meimandipour,† S. A. Hosseini,‡
and H. Ebrahimnejad§
*
Department of Animal Sciences, Faculty of Agriculture, Shahid Bahonar University of
Kerman, Kerman, Iran; †Department of Animal Biotechnology, National Institute of Genetic
Engineering and Biotechnology (NIGEB), Tehran, Iran; ‡Department of Animal and
Poultry Nutrition, Animal Science Research Institute, Karaj, Iran; and §Department of Food
Hygiene and Public Health, Faculty of Veterinary Medicine, Shahid Bahonar University of
Kerman, Kerman, Iran

Primary Audience: Broiler Researchers, Nutritionists, Veterinarians, Plant Managers

SUMMARY
The effects of nanoencapsulated cumin essential oil (EO) feeding broilers on growth per-
formance, mucin 2 gene expression, blood parameters, and immune responses to phytohe-
magglutinin (PHA) and 2, 4-dinitrochlorobenzene (DNCB) were evaluated. In a completely
randomized design, 1050 male day-old Ross 308 broilers were distributed into 7 dietary
treatments with 5 replicates of 30 birds per replication. Dietary treatments included 1) control
basal (no additives), 2) control antibiotic growth promoter (flavophospholipol at 650 mg/kg),
control basal plus a solution of 3) 150 mg/kg of chitosan nanoparticles, free-form cumin EO at
4) 100 or 5) 200 mg/kg, and nanoencapsulated cumin EO at 6) 100 and 7) 200 mg/kg. The use
of 200 mg/kg nanoencapsulated cumin EO significantly (P , 0.01) increased body weight gain
and mucin 2 gene expression and improved feed conversion ratio compared with other treat-
ment. The highest feed intake was significantly (P , 0.01) in the control treatment during day
15 to 18 and day 29 to 42. In birds fed with nanoencapsulated cumin EO, serum total tri-
glyceride and low-density lipoprotein cholesterol levels were also significantly lower than birds
in the control group. Sheep red blood cell antibody titer (35 and 42 d), immunoglobulin G
(42 d), heterophilus (H), lymphocyte (L), and H/L ratio, PHA, and DNCB (42 d) were affected
by the nanoencapsulation process of cumin EO (P , 0.01). Finally, cumin EO in nano-
encapsulation significantly improved growth performance, mucin 2 gene expression and sus-
tained broiler immune responses and therefore could be used as substitute for antibiotics.

Key words: broiler, cumin essential oil, immune responses, mucin 2 gene expression,
nanoencapsulation
2020 J. Appl. Poult. Res. 29:875–885
https://doi.org/10.1016/j.japr.2020.08.004

1
Corresponding author: mafshar@uk.ac.ir
876 JAPR: Research Report

DESCRIPTION OF PROBLEM biodegradable, biocompatible, nontoxic, and

inexpensive. Hence, chitosan has great potential
The use of antibiotics as a growth factor is to be used as an effective EO carrier for the
restricted in many parts of the world. There are controlled release (Natrajan et al., 2015). As a
concerns over the possibility of creating a result, nanoencapsulation could improve growth
resistance to pathogenic bacteria as well as their efficiency through effective delivery of the EO
retention in animal products. Under such con- and chitosan’s antimicrobial properties
ditions, the poultry industry has access to (Meimandipour et al., 2017). It was emphasized
alternative feed supplements including antioxi- that the selection of appropriate dietary doses is
dants, probiotic, prebiotic, organic acids, as well important in influencing poultry performance
as various phytogenics (Phillips et al., 2004; for the effectiveness of these substances (Hafeez
Nosrati et al., 2017). The use of specific dietary et al., 2016). The goal of this study is therefore
herbs, in particular essential oil (EO), was to investigate the effects of various types of
studied for their growth promoting and antimi- cumin EO (free vs nanoencapsulation) on
crobial abilities (Patel, 2015). In addition, it was growth performance, mucin 2 gene expression,
hypothesized that phytogenic compounds may blood hematology, antibody response, and im-
specifically enhance activities of digestive en- mune responses to phytohemagglutinin (PHA)
zymes and promote intestinal mucus production and 2, 4-dinitrochlorobenzene (DNCB)
(Moghaddam et al., 2011). Cuminum cyminum compared with antibiotics.
is one of the main antimicrobial, anticholesterol,
and antioxidant medicinal herbs (Aami Azghadi
et al., 2010). Cumin is used as a digestive MATERIALS AND METHODS
stimulant by increasing bile acid production and
excretion content and by enhancing digestive Materials
enzymes (amylase, trypsin, chymotrypsin, and
Cumin EO was distilled from the ground
lipase) in the pancreas (Sowbhagya, 2013).
plant material using Clevenger distillation
Cumin EO has bioactive components such as
apparatus (Barij Essence Co., Kashan, Iran).
cuminaldehyde, terpinenes, polyphenols, and
Ethanol and acetic acid were provided by Merck
flavoids (Bettaieb et al., 2010). Direct incorpo-
(NYSE: MRK). Nanoencapsulation was made
ration of EO into animal diets has shown limi-
with chitosan, derived from crab shell and so-
tations related to the bioactive component’s
dium triphosphate pentabasic (TPP), supplied
reactive, hydrophobic, and volatile nature
by Sigma Chemical Company (St. Louis, MO).
(Hosseini and Meimandipour, 2018). The effi-
cacy of EO has been shown to increase when
used in a safe form such as encapsulation.
Nevertheless, the efficacy of EO has been
Table 1. Standardized digestible amino acid
shown to increase when used in a safe form content of soybean meal and corn obtained by
such as encapsulation. Encapsulation consists of NIRS.
a process in which the small particles are sur- Content (% as is)
rounded by a capsule coating (Wen et al., 2016). Parameter Soybean meal Corn
Nanoencapsulation is a new technology in the
Crude protein (% as is) 42.25 7.08
poultry industry that protects EO against an Methionine 0.548 0.119
adverse environment such as high temperature, Methionine 1 cystine 1.04 0.278
high humidity, and drying. In addition, nano- Lysine 2.45 0.201
encapsulation which releases its contents at Threonine 1.40 0.228
controlled levels under specific conditions Tryptophan 0.501 0.045
Arginine 2.92 0.304
(Yang et al., 2012; Hosseini and Meimandipour, Isoleucine 1.69 0.238
2018). Chitosan (prepared by shells of crusta- Leucine 2.87 0.756
ceans, insects, many fungi, algae, and yeasts) Histidine 1.06 0.229
has been extensively studied as a nano- Phenylalanine 1.88 0.320
particulate polymer carrier because it is Abbreviation: NIRS, near-infrared reflectance spectroscopy.
AMIRI ET AL: NANOENCAPSULATED ESSENTIAL OIL 877

Table 2. Ingredients and chemical composition of basal diets2 in different periods.

Ingredients (% diet) Starter (day 1–14) Grower (day 15–28) Finisher (day 29–42)
Corn 52.37 55.60 60.80
Soybean meal 39.00 38.30 33.60
Corn Gluten 2.50 0.00 0.00
Soybean oil 1.65 2.10 1.90
Limestone 1.25 1.20 1.10
Dicalcium phosphate 1.60 1.30 1.10
Salt 0.255 0.255 0.255
Sodium carbonate 0.200 0.200 0.200
DL-methionine 0.320 0.300 0.300
Lysine-HCl 0.250 0.140 0.140
L-threonine 0.100 0.100 0.100
Vitamin and mineral premix1 0.500 0.500 0.500
Phytase 10000 (Hostazym P) 0.005 0.005 0.005

Calculated chemical composition (%)

Metabolizable energy (MJ/kg) 12.20 12.34 12.57
Crude protein (%) 22.09 20.33 18.72
Methionine (%) 0.628 0.575 0.555
Methionine 1 cysteine (%) 0.925 0.849 0.815
Lysine (%) 1.26 1.14 1.04
Threonine (%) 0.838 0.788 0.734
Tryptophan (%) 0.228 0.218 0.197
Arginine (%) 1.36 1.30 1.18
Calcium (%) 1.01 0.928 0.835
Available phosphorous (%) 0.503 0.449 0.406
Sodium (%) 0.170 0.170 0.170
Linoleic acid (%) 1.94 1.93 1.78
1
Provided per kg of diet: A (transretinyl acetate): 3 mg, D3 (cholecalciferol): 0.112 mg, E (dL-alpha-tocopheryl acetate):
43.55 mg, K (menadione): 3 mg, thiamin: 2.5 mg, riboflavin: 5.2 mg, niacin: 35 mg, pantothenic acid: 18 mg, pyridoxine:
3.2 mg, biotin: 0.18 mg, folic acid: 1.6 mg, cyanocobalamin: 0.017 mg, choline choloride: 800 mg and antioxidant:
2.5 mg. Provided per kg of diet: copper: 16 mg, iodine: 1.25 mg, iron: 20 mg, manganese: 120 mg, selenium: 0.3 mg and
zinc: 110 mg.
2
T1: Basal diet (no additives), T2: basal diet 1 antibiotic (flavophospholipol 650 mg/kg), T3: basal diet 1 chitosan
nanoparticles (150 mg/kg), T4 and T5: basal diet 1 free EO of cumin (100 and 200 mg/kg), T6 and T7: basal
diet 1 nanoencapsulated cumin EO (100 and 200 mg/kg).

Nanoencapsulation of EO 25 mL chitosan solution (pH = 5), under con-

stant stirring at room temperature. Before add-
Cumin EO nanoencapsulation was conducted ing the TPP solution, 20% (w = v) EO was
with ionic gelation in accordance with the applied to the chitosan solution for the prepa-
Hosseini and Meimandipour (2018) procedure. ration of chitosan-TPP nanoparticles loaded
Chitosan was dissolved at a concentration of with the herbal EO.
1 mg/mL in 1% (w = v) acetic acid and soni-
cated before the solution became transparent. GC/MS Analyses of Cumin EO
Chitosan-TPP nanoparticles were formed by
ionic gelation by adding 10 mL tripolyphos- Gas chromatography/mass spectrometry
phate (TPP) solution (1 mg/mL) dropwise to a (GC/MS) analysis was performed by using gas
Table 3. Primers used for RT-PCR analysis of chicken mRNAs.
Target Primer Sequence (50 30 ) Tm C Length (bp) GenBank accession number
GAPDH Forward TCTCTGGCAAAGTCCAAGTG 57.74 145 NM_204305.1
Reverse TGCCCATTGATCACAAGTTT 55.81
Mucin 2 Forward CAGCGTTAACACAGGGCTTA 58.20 94 XM_421035.2
Reverse GCAGCAGACGTTGATCTCAT 58.35
878
chromatograph (Agilent 7890B) connected with
a mass detector (Model 5977A, Agilent tech-
nologies). The following states were used:
capillary column: HP-5MS (phenyl methyl
siloxane, 30 m 3 0.25 mm ID 0.25 mm);
injector temperature: 270 C; oven temperature:
60 C (0 min) to 200 C at the rate of 5 C/min;
carrier gas: helium; flow rate: 1 mL/min; in-
jection volume: 1mL; electron impact: 70 eV;
interface temperature: 280 C; mass range: 35 to
500 m/z. The identification of ingredients was
performed by comparison of their mass spectra
with the database of the GC/MS system and
Kovats retention index (Adams and Sparkman,
2007).
Management of Experimental Birds
A total of 1,050 (with an average body
weight 44 6 2 g) day-old male broiler chicks
(Ross 308) were purchased from a commercial
hatchery and transferred to the Animal Science
Research Institute, Tehran, Iran. Then, the
chicks were weighed and randomly assigned to
35 pens (300 3 100 3 300 cm). During the
whole feeding period, all birds were kept in
these floor pens with fresh wood shavings and
were allowed ad libitum access to feed and
water. The temperature was maintained at 33 C
at the start of trial and was reduced gradually to
25 C on day 21 and was then kept constant.
Lighting was provided 23 h light and 1 h
darkness during the experiment. The experiment
was conducted in accordance with the animal
welfare guidelines at the Animal Science
Research Institute, Tehran, Iran.
Diets and Treatments
The trial was conducted based on a
completely randomized design with 7 dietary
treatments of 5 replications (30 birds in each
pen). Experimental treatments (diets) were 1)
control basal (no additives), 2) control antibiotic
growth promoter (flavophospholipol at 650 mg/
kg), control basal plus a solution of 3) 150 mg/
kg of chitosan nanoparticles, free-form cumin
EO at 4) 100 or 5) 200 mg/kg, and nano-
encapsulated cumin EO at 6) 100 and 7)
200 mg/kg. The near-infrared reflectance spec-
troscopy (NIRS), a long established method for
crude nutrient analysis has been extended to
JAPR: Research Report
total acid amine (AA) content (Sedghi et al.,
2014). We used amino NIRS to predict AA
content of soybean and corn samples (Table 1).
The trial diets were given from 1 to 14, 15 to 28,
and 29 to 42 d, based on corn and soybean meal
(Table 2). Diets have been formulated in
accordance with the standards prescribed in
Ross 308 Broiler Nutrition Specification
(Aviagen, 2014).
Performance Parameters
At weekly intervals, body weight and feed
intake (FI) were collected per pen, and mortality
was reported as occurred. Individual body
weight gain and FI together with feed conver-
sion ratio (FCR) per pen were calculated and
daily mortality was reported.
Mucin2 mRNA Gene Expression
On day 42, total mRNA was extracted from
chick jejunum tissue (2 birds per replicate) us-
ing GeneJet RNA Purification Kit procedure
(Thermo Scientific #K0731) in accordance with
the manufacturer’s protocol (Manal, 2016). The
concentration of extracted RNA was measured
using ND-1000 spectrophotometer (Thermo
Fisher Scientific). RNA was reverse transcribed
to cDNA using RevertAid First Strand cDNA
Synthesis Kit (Thermo Scientific #K1621) on
the basis of manufacturer instructions. The
cDNA was stored until analysis (280 C). Real-
time PCR was according to Kamali Sangani
et al. (2014). Briefly, 6.25 ng cDNA was
adjusted in 25 mL of the PCR reaction at a final
concentration of 0.25 ng/mL in SYBR Green.
GAPDH were considered as endogenous con-
trol. PCR was designed for 40 cycles and was as
follows: denaturation (at 95 C for 30 s),
annealing (at 63 C for 30 s) and elongation (at
72 C for 30 s). Melting curves analyses were
performed by slowly heating the PCR mixtures
from 55 C to 95 C (0.2 C per second) with
simultaneous measurements of the SYBR Green
signal intensities. Fluorescence results were
evaluated and collected at the final stage by
combined SYBR Green with expanding DNA.
Primers were designed based on published
sequences in broiler using the GenBank data-
base of National Center for Biotechnology In-
formation (http://www. ncbi.nlm.nih.gov). The
AMIRI ET AL: NANOENCAPSULATED ESSENTIAL OIL
difference between the CT amount of mucin 2
gene and cycle threshold was considered as
DCT. The highest value of DCT represents the
lowest expression. The specific primers for in-
testinal mucin 2 gene are shown in Table 3.
Relative expression of mucin 2 mRNA was
determined using the method 22DDCT (Livak
and Schmittgen, 2001) and then analyses were
conducted using GLM of SAS (SAS Institute,
2011).
Serum Biochemical Parameters
Ten chicks from each treatment (2 per
replicate) were randomly selected, and 2 mL of
blood was collected at the end of experimental
period (42 d) from the wing vein for determi-
nation of the blood parameters. Then, plasma
was isolated by centrifugation for 15 min at
3,000 3 g and stored at 220 C. The serum
concentrations of glucose, triglyceride (TG),
total cholesterol (CHOL), high-density lipo-
protein cholesterol (HDL-C), and low-density
lipoprotein cholesterol (LDL-C) in serum
samples were analyzed by an automatic
biochemical analyzer (Mohammadi and Ansari-
Pirsaraei, 2014).
Immunological Tests
At 28 and 35 d of age, 1 mL 7% suspension
of sheep red blood cell (SRBC) was injected
into the wing vein of 2 chicks per cage. The
same birds were vaccinated with SRBC at both
time points. Blood samples were collected at 35
and 42 d after injection. Serum was obtained by
centrifuging at 1,500 3 g for 15 min at 25 C,
and stored at 230 C until assayed.
Table 4. Phytochemical components of Cuminum cyminum essential oil.
Number Retention time
1 10.08
2 13.14
3 15.56
4 16.68
5 18.71
6 23.89
7 25.98
8 27.78
9 12.80
10 28.51
11 29.45
879
Hemagglutination titer was expressed as the
log2 of the reciprocal of the highest dilution
showing 100 percent agglutination (Habibian
et al., 2014). In addition, immunoglobulin G
(IgG) and immunoglobulin M (IgM) were
measured in accordance with the method pro-
posed by Cheema et al. (2003).
Heterophile (H) and lymphocyte (L) count
were determined by the stained-slide method
based on the procedure of Gross and Siegel
(1983) at day 42.
At 31 and 42 d of age, 100 mg of PHA
(suspended in a 0.1 mL of sterile saline) was
injected into the toe web of the right foot of 2
chicks per cage (Corrier and DeLoach, 1990).
The effect of treatments with PHA injection on
the cutaneous basophile hypersensitivity
response was assessed in both of chicks by
determining the thickness of the toe web of the
right foot before injection and at 12 and 24 h
after injection.
At 31 and 42 d of age, 0.25 mL of DNCB
(10 mg/mL) solution in a vehicle consisting of
an acetone and olive oil (4:1) mixture was
spread and maintained over a 10 cm area of
featherless skin on the right side of the 2 birds
per pen. The skin swelling was calculated by
measuring skin thickness before the challenge
and at 24 and 48 h after the challenge using a
digital caliper (Verma et al., 2004).
Statistical Analysis
The data were analyzed by ANOVA using
the general linear model procedure of SAS
software (SAS Institute, 2011) as randomized
complete design and differences in treatment
Compounds % Total
a-pinene 0.41
b-pinene 9.10
B phellandrene 1.01
Benzene 1 methyl 1.26
g-Terpinene 12.48
Isopropylbicyclo 1.44
Benzaldehyde 28.01
Isopropylidene 3.67
Cymene 4.24
Phenylpropanol 17.74
Benzenemethanol 11.22
880 JAPR: Research Report

means were evaluated by Tukey’s multiple
range tests. All statements of significance were
based on P , 0.05.
RESULTS AND DISCUSSION
The chemical composition of cumin EO was
evaluated by GC/MS instrument as shown in
Table 4. Benzaldehyde (28.01), phenylpropanol
(17.74), gamma terpinene (12.48), and benze-
nemethanol (11.22) were the main constituents
of the product. Most of these components have
already been reported as the principal volatile
components of cumin EO (Habibi et al., 2016).
As shown in Table 5, the inclusion of
200 mg/kg of nanoencapsulated cumin EO
(15–28, 29–42, and 1–42) in a diet compared
with the antibiotic group (P , 0.01) increased
the body weight gain. In addition, the body
weights in nanoencapsulated cumin EO using
the higher level (200 mg/kg) significantly
increased at 28 (P = 0.029) and 42 (P = 0.015)
day (Supplementary Table 1).
During the periods 15 to 28 and 29 to 42 d
(P , 0.01), the FI of birds within the control
group increased significantly. The FCR was
decreased (P , 0.01) by feeding diets supple-
mented with nanoencapsulated cumin EO
throughout all periods. The beneficial effects of
free form of cumin EO supplementation in
broiler diets have been previously recorded
(Alimohamadi et al., 2014). They showed that
the use of black seed (8 g/kg), cumin seed (8 g/
kg), and probiotic (1 g/kg) in broiler diets
significantly improved growth performance.
Berrama et al. (2017) found that 0.2% of added
cumin powder to the diet improved FCR in
broiler. The bioactive substances of cumin
maybe supporting digestive enzyme production
by improving excretion content of bile acids and
the activity pancreas enzymes (Platel and
Srinivasan, 2000; Torki et al., 2015). The
study showed that effective delivery of cumin
EO via nanoencapsulation and antimicrobial
properties of chitosan nanoparticles used to
make capsules improved the growth perfor-
mance of broiler chickens compared with anti-
biotic treatment. Chitosan and TPP mixtures can
stabilize, secure, or control the release of core
material as a carrier for plant EO. As a result,
nanoencapsulation could develop growth per-
formance through effective delivery of the EO
and chitosan’s antimicrobial properties
(Meimandipour et al., 2017).
Mucin 2 mRNA expression in the broiler
chicken jejunum was detected (Figure 1).

Table 5. Effect of dietary treatments on body weight gain, feed intake, and feed conversion ratio in broiler
chickens.
Body weight gain (g/b/day) Feed intake (g/b/day) Feed conversion ratio (g/g)
15–28 1–14 15–28 29–42
Treatment 1–14 d d 29–42 d 1–42 d 1–14 d 15–28 d 29–42 d 1–42 d d d d 1–42 d
Control (no additive) 22.41 53.18a,b 73.52a,b,c 48.12b 28.05 109.42a 155.61a 91.00 1.25 2.05a 2.11a,b 1.89a
Antibiotic 23.49 50.60b 70.39b,c 48.10b 28.33 91.25b 152.71a 87.91 1.20 1.80b 2.18a,b 1.83a,b
150 mg/kg chitosan 23.52 55.68a 71.12a,b,c 49.31a,b 28.57 91.55b 153.17a 90.42 1.21 1.64c 2.15a,b 1.83a,b
100 mg/kg free cumin 23.90 55.53a 67.91c 48.88a,b 28.28 88.37b,c 150.25a,b 87.75 1.22 1.59c 2.21a 1.79a,b,c
EO
200 mg/kg free cumin 23.51 54.89a 71.28a,b,c 47.82b 27.09 89.52b,c 149.52a,b 87.19 1.15 1.63c 2.09a,b 1.82a,b
EO
100 mg/kg 23.43 53.80a,b 75.71a,b 50.14a,b 28.20 83.84c 150.53a,b 86.41 1.20 1.56c 1.99b,c 1.72b,c,d
nanoencapsulated
cumin EO
200 mg/kg 24.07 55.90a 77.97a 51.51a 27.66 87.88b,c 144.37b 84.31 1.15 1.57c 1.85c 1.63d
nanoencapsulated
cumin EO
SEM 0.523 0.873 1.83 0.575 0.567 1.54 1.67 1.57 0.028 0.029 0.046 0.032
P value 0.431 0.002 0.001 0.001 0.222 0.001 0.003 0.082 0.134 0.001 0.001 0.001
The means in each column with different subscripts are significantly different (P , 0.05).
a-d

Abbreviation: EO, essential oil.

AMIRI ET AL: NANOENCAPSULATED ESSENTIAL OIL 881

Figure 1. Effects of feeding a free and nanoencapsulated form of cumin EO in the broiler chicken jejunum at 42 d of
age. T1, control (no additive); T2, antibiotic; T3, chitosan (150 mg/kg); T4, free EO of cumin (100 mg/kg); T5, free EO
of cumin (200 mg/kg); T6, nanoencaps, EO of cumin (100 mg/kg); T7, nanoencaps, EO of cumin (200 mg/kg).
Values without a common letter are significantly different (P , 0.05).

Expression of mucin 2 gene was increased
(P , 0.05) by feeding nanoencapsulated form of
cumin EO (200 mg/kg). Kamali Sangani et al.
(2014) reported that expression of mucin 2
mRNA in jejunum significantly increased in
birds fed turmeric, thyme, and cinnamon to both
basal diets. Zeinali et al. (2017) indicated that
birds fed dietary EO (clove, Coriondrumsativum
L, Artemisia sieberi, and Myrtus Communis)
increased the mucin 2 gene expression in the
jejunum compared with the control treatment.
The bioactive substances may alter the activity of
transcription factors such as GATA4 and Fox1
that regulates mucin 2 gene expression in broiler
chickens (Kong et al., 2010). The antimicrobial
properties of cumin EO and chitosan could help
stimulate the growth of small-intestinal mucosal
absorptive cells. It also decreases host competi-
tion for nutrients available, promotes the growth
of small intestinal mucosal absorptive cells, and
triggers the secretion of innate digestive en-
zymes. It is possible that bioactive substances of
cumin EO may affect the HapA concentration
(extracellular proteinase) and increases secretion
and accumulation of mucin 2 gene in the gastro-
intestinal tract. In addition, mucin is the major
constituent of the mucus layer and serves a crucial
role in protecting the gut from acidic chyme,
digestive enzymes, and pathogens. In addition to
its protective functions, mucin is involved in
filtering nutrients in the gastrointestinal tract and
can influence nutrient digestion and absorption
(Montagne et al., 2004).
Table 6 shows the effects of various types of
cumin EO supplementation on glucose, TG,
CHOL, HDL-C, and LDL-C levels at day 42.
Birds fed diets supplemented with 200 mg/kg of
nanoencapsulated cumin EO significantly
decreased serum TG and LDL-C concentrations
compared with the control diet. This could
attribute to the positive effects of the type of
nanoencapsulation on lipid metabolism. Yalçın
et al. (2012) reported that adding spice to the
diet decreased levels of TG, CHOL, and LDL-C
and increased levels of HDL-C. The decrease in
blood lipid levels is expected to be due to the
active compound found in cumin that acts as in-
hibitors of the cholesterol-synthesizing active
enzyme hepatic 3-hydroxyl-3 methyglutaryl co-
enzyme A. Reduction in blood cholesterol could
in some cases contribute to reduction of certain
hormones secreted by adrenal glands. Reduction
in hormones leads to reduction in the amount of
fatty acids like cholesterol (Ganong, 1995).
The effects of experimental groups on total
anti SRBC, IgG, and IgM titers are shown in
Table 7. At 7 d after the first and second SRBC
injection, the anti-SRBC titers increased
significantly compared with the other groups by
adding 200 mg/kg of nanoencapsulated cumin
EO (P , 0.01). After second immunization, IgG
responses were significantly higher (P , 0.01)
with diets supplemented with nano-
encapsulation cumin EO (200 mg/kg). Habibi
et al. (2016) stated that, after 7 d of injection,
the inclusion of wormwood EO (200 mg/kg)
882 JAPR: Research Report

Table 6. Effect of dietary treatments on serum biochemical parameters in broilers chicks at 42 d of age.
Treatment Glucose (mg/dL) TG (mg/dL) CHOL (mg/dL) HDL-C (mg/dL) LDL-C (mg/dL)
Control (no additive) 192.25 123.53a 157.20 51.88 160.66a
Antibiotic 186.06 114.80a,b 147.80 51.01 159.06a,b,c
150 mg/kg chitosan 185.53 105.80a,b 132.60 50.90 159.29a,b,c
100 mg/kg free cumin EO 180.33 93.86b,c 140.60 51.12 156.42c,d
200 mg/kg free cumin EO 186.06 95.06b,c 138.86 50.40 159.95a,b
100 mg/kg nanoencapsulated cumin EO 182.06 103.40a,b 133.93 51.12 157.38b,c,d
200 mg/kg nanoencapsulated cumin EO 177.80 79.80c 129.60 50.82 155.41d
SEM 8.73 4.94 6.53 0.362 0.679
P value 0.940 0.001 0.076 0.210 0.001
a-d
The means in each column with different subscripts are significantly different (P , 0.05).
Abbreviations: CHOL, total cholesterol; EO, essential oil; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density
lipoprotein cholesterol; TG, triglyceride.

and cumin EO (200 and 300 mg/kg) increased
the SRBC significantly. Jones Jr and Luchsinger
(1979) further suggested that cumin use might
increase immunity and antioxidant capacity,
possibly due to the presence of cuminaldehyde.
Increasing response in nanoencapsulated cumin
EO group to SRBC and IgG was expected, as
this herb increased nonspecific immune system
stimulation. Herbs rich in flavonoids such as
cumin increase vitamin C content serve as an-
tioxidants and can therefore enhance immune
function (Manach et al., 1996). These may
enhance macrophage, NK cell, and lymphocyte
function, increase phagocytosis, or stimulate
interferon synthesis. In addition, this improve-
ment could also be due to the effect of chitosan-
nanoencapsulation on the retention and protec-
tion of active compounds and their increased
absorption in the gut (Nouri, 2019).
As shown in Table 8, the H, L counts, and H/
L ratio were significantly impacted by dietary
treatments at day 42 of the growing period.
There were significant increases in H counts and
control bird H/L ratios and an increase in L
counts in birds fed 200 mg/kg of nano-
encapsulated EO cumin compared with the
control group (P , 0.01).
Lymphocytes play a role in the defense
against viruses and when viral infections occur,
their number increases. Lymphocytes (espe-
cially T4 lymphocytes) affect B-cell differenti-
ation into plasma cells by producing cytokines
such as IL-2 and IL-4 that play a role in the
antibody production. B-lymphocytes cannot
produce antibodies as in cytokines (IL-2 and
IL-4) are not received. Therefore, given the in-
crease in these cytokines by the nature of cumin,
the increase in lymphocytes may be attributed to

Table 7. Effect of dietary treatments on antibody response against SRBC of broilers at 35 and 42 d of age.
7 d after 1st SRBC injection 7 d after 2nd SRBC injection
Treatment SRBC IgG IgM SRBC IgG IgM
b b,c b
Control (no additive) 2.60 2.40 0.20 4.40 3.20 1.20
Antibiotic 4.20a 2.40 1.80 4.80b,c 3.80b 1.00
150 mg/kg chitosan 4.40a 3.00 1.40 5.80a,b 3.80b 2.00
100 mg/kg free cumin EO 4.40a 3.20 1.20 5.80a,b 3.80b 2.00
200 mg/kg free cumin EO 4.00a,b 3.00 1.00 5.20a,b,c 4.20a,b 1.00
100 mg/kg nanoencapsulated cumin EO 4.40a 3.20 1.20 5.80a,b 4.20a,b 1.60
200 mg/kg nanoencapsulated cumin EO 5.00a 3.20 1.80 6.00a 5.00a 1.00
SEM 0.287 0.277 0.424 0.370 0.250 0.378
P value 0.001 0.157 0.168 0.033 0.002 0.217
The means in each column with different subscripts are significantly different (P , 0.05).
a-c

Abbreviations: EO, essential oil; SRBC, sheep red blood cell; IgG, immunoglobulin G; IgM, immunoglobulin M.
AMIRI ET AL: NANOENCAPSULATED ESSENTIAL OIL 883

Table 8. Effect of dietary treatments on hematological parameters in broilers at 42 d of age.

Treatment H, % L, % H:L
a b
Control (no additive) 15.20 85.00 0.178a
Antibiotic 15.20a 84.40b 0.180a
150 mg/kg chitosan 15.20a 84.40b 0.179a
100 mg/kg free cumin EO 15.00a 86.20b 0.174a
200 mg/kg free cumin EO 14.20a 84.40b 0.168a
100 mg/kg nanoencapsulated cumin EO 10.40b 89.20a 0.116b
200 mg/kg nanoencapsulated cumin EO 10.00b 90.00a 0.111b
SEM 0.450 0.472 0.005
P value 0.001 0.001 0.001
The means in each column with different subscripts are significantly different (P , 0.05).
a-b

Abbreviations: EO, essential oil; H, heterophilus; L, lymphocyte.

their type T, as they make up 80 to 90 percent of
the peripheral blood lymphocytes (Ivanovska
et al., 1995).
Tables 9 and 10 demonstrate skin reaction to
DNCB and toe web swelling by PHA of various
forms of cumin EO supplementation in broilers
aged 31 and 42 d. There was a significant dif-
ference for PHA in birds fed 200 mg/kg of
nanoencapsulated cumin EO (P , 0.01) at day
31 of age (24 h after challenge). As shown in
Table 10, the skin thickness of birds treated with
nanoencapsulated cumin EO (200 mg/kg) at
24 h after the challenge (day 42) with PHA and
DNCB was significantly higher than that of
birds in other groups (P , 0.01).
The increased cutaneous basophile hypersen-
sitivity response can indicate the possible effect of
nanoencapsulation form to facilitate the under-
standing of the antigen by lymphocytes and to
provide a stronger response by these cells as well
as basophils (Erf, 2004). On the other hand, some
researchers have proposed that skin swelling at
the PHA injection site may be linked to humeral
immune response in the form of the macrophage
flow and heterophilic cells to the antigen site
(Ahmad and Beg, 2001; Koutsos et al., 2007).
Further research is needed to investigate these
cumin type encapsulation properties.
CONCLUSIONS AND APPLICATIONS
1. Nanoencapsulation of essential oil with chi-
tosan could be used as a suitable alternative
product to antibiotic growth promoters in
poultry production.
2. Nanoencapsulated cumin EO supplementa-
tion has increased the growth performance

Table 9. Effect of dietary treatments on cell-mediated immunity by response of skin to DNCB and toe web
swelling by PHA in broilers at 31 d of age.
24 h after challenge 48 h after challenge
Treatment PHA DNCB PHA DNCB
c
Control (no additive) 1.50 1.38 0.740 0.667
Antibiotic 1.47c 1.47 0.801 0.681
150 mg/kg chitosan 1.55b,c 1.46 0.878 0.778
100 mg/kg free cumin EO 1.67a,b,c 1.47 0.638 0.779
200 mg/kg free cumin EO 1.83a,b 1.41 0.791 0.763
100 mg/kg nanoencapsulated cumin EO 1.83a,b 1.54 0.785 0.795
200 mg/kg nanoencapsulated cumin EO 1.93a 1.63 0.940 0.876
SEM 0.072 0.080 0.060 0.064
P value 0.001 0.244 0.135 0.336
The means in each column with different subscripts are significantly different (P , 0.05).
a-c

Abbreviations: EO, essential oil; PHA, phytohemagglutinin; DNCB, 2, 4-dinitrochlorobenzene.

884 JAPR: Research Report

Table 10. Effect of dietary treatments on cell-mediated immunity by response of skin to DNCB and toe web
swelling by PHA in broilers at 42 d of age.
24 h after challenge 48 h after challenge
Treatment PHA DNCB PHA DNCB
b,c b
Control (no additive) 1.53 1.56 0.906 0.650
Antibiotic 1.35c 1.47b 0.858 0.647
150 mg/kg chitosan 1.57b,c 1.49b 1.04 0.789
100 mg/kg free cumin EO 1.66b 1.66a,b 1.07 0.763
200 mg/kg free cumin EO 1.58b,c 1.55b 1.05 0.777
100 mg/kg nanoencapsulated cumin EO 1.53b,c 1.43b 1.01 0.762
200 mg/kg nanoencapsulated cumin EO 2.09a 1.95a 1.20 0.895
SEM 0.054 0.074 0.074 0.062
P value 0.001 0.001 0.056 0.115
The means in each column with different subscripts are significantly different (P , 0.05).
a-c

Abbreviations: EO, essential oil; PHA, phytohemagglutinin; DNCB, 2, 4-dinitrochlorobenzene.

and mucin 2 gene expression of broiler
chickens.
3. Using 200 mg/kg of nanoencapsulated cumin
EO has shown a decrease in triglyceride and
LDL-C levels in broiler blood.
4. The nanoencapsulation form of cumin EO
has improved the immune response
compared with the other treatment.
5. As in-feed growth promoters in poultry
production, nanoencapsulated cumin EO at a
level of 200 mg/kg as opposed to free form
and antibiotic group.
DISCLOSURES
The authors wish to confirm that there are no
known conflicts of interest associated with this
publication and there has been no significant
financial support for this work that could have
influenced its outcome.
SUPPLEMENTARY DATA
Supplementary data associated with this
article can be found in the online version at
https://doi.org/10.1016/j.japr.2020.08.004.
REFERENCES
Aami Azghadi, M., A. Golian, H. Kermanshahi, and M.
Sedghi. 2010. Comparison of dietary supplementation with
cumin essential oil and prebiotic fermacto on humoral im-
mune response, blood metabolites and performance of
broiler chickens. Glob. Vet. 4:380–387.
Adams, R. P., and O. D. Sparkman. 2007. Review of
identification of essential oil components by gas chroma-
tography/mass spectrometry. J. Am. Soc. Mass. Spectrom.
18:803–806.
Ahmad, I., and A. Z. Beg. 2001. Antimicrobial and
phytochemical studies on 45 Indian medicinal plants against
multi-drug resistant human pathogens. J. Ethno-
pharmacology. 74:113–123.
Alimohamadi, K., K. Taherpour, H. Ghasemi, and F.
Fatahnia. 2014. Comparative effects of using black seed (N
igella sativa), cumin seed (C uminum cyminum), probiotic
or prebiotic on growth performance, blood haematology and
serum biochemistry of broiler chicks. J. Anim. Physiol.
Anim. Nutr. 98:538–546.
Aviagen. Ross 308 broiler: nutrition specifications,
2014. Accessed Oct. 2020. http://tmea.staging.aviagen.com/
assets/Tech_Center/Ross_Broiler/Ross-308-Broiler-Nutrition-
Specs-2014r17-EN.pdf.
Berrama, Z., S. Temim, S. Souames, and H. Ainbaziz.
2017. Growth performance, carcass and viscera yields,
blood constituents and thyroid hormone concentrations of c
hronic heat stressed broilers fed diets supplemented with
cumin seeds (Cuminum cyminum L.). Kafkas Univ Vet Fak
Derg. 23:735–742.
Bettaieb, I., S. Bourgou, W. A. Wannes, I. Hamrouni, F.
Limam, and B. Marzouk. 2010. Essential oils, phenolics, and
antioxidant activities of different parts of cumin (Cuminum
cyminum L.). J. Agric. Food Chem. 58:10410–10418.
Cheema, M., M. Qureshi, and G. Havenstein. 2003.
A comparison of the immune response of a 2001 commercial
broiler with a 1957 randombred broiler strain when fed repre-
sentative 1957 and 2001 broiler diets. Poult. Sci. 82:1519–1529.
Corrier, D., and J. DeLoach. 1990. Evaluation of cell-
mediated, cutaneous basophil hypersensitivity in young
chickens by an interdigital skin test. Poult. Sci. 69:403–408.
Erf, G. 2004. Cell-mediated immunity in poultry. Poult.
Sci. 83:580–590.
Ganong, W. F. 1995. Review of Medical Physiology.
16th ed. Mcgraw-Hill, New York, NY.
Gross, W., and H. Siegel. 1983. Evaluation of the het-
erophil/lymphocyte ratio as a measure of stress in chickens.
Avian Dis. 27:972–979.
AMIRI ET AL: NANOENCAPSULATED ESSENTIAL OIL
Habibi, R., G. Jalilvand, S. Samadi, and A. Azizpour.
2016. Effect of different levels of essential oils of worm-
wood (Artemisia absinthium) and cumin (Cuminum cymi-
num) on growth performance carcass characteristics and
immune system in broiler chicks. Iran. J. Appl. Anim. Sci.
6:395–400.
Habibian, M., S. Ghazi, M. M. Moeini, and A. Abdol-
mohammadi. 2014. Effects of dietary selenium and vitamin
E on immune response and biological blood parameters of
broilers reared under thermoneutral or heat stress conditions.
Int. J. Biometeorol. 58:741–752.
Hafeez, A., K. Männer, C. Schieder, and J. Zentek.
2016. Effect of supplementation of phytogenic feed addi-
tives (powdered vs. encapsulated) on performance and
nutrient digestibility in broiler chickens. Poult. Sci. 95:622–
629.
Hosseini, S., and A. Meimandipour. 2018. Feeding
broilers with thyme essential oil loaded in chitosan nano-
particles: an efficient strategy for successful delivery. Br.
Poult. Sci. 59:669–678.
Ivanovska, N., H. Neychev, Z. Stefanova, V. Bankova,
and S. Popov. 1995. Influence of cinnamic acid on
lymphocyte proliferation, cytokine release and Klebsiella
infection in mice. Apidologie. 26:73–81.
Jones, Jr, S.B., and A. E. Luchsinger. 1979. Plant Sys-
tematics. McGraw-Hill, New York, NY.
Kamali Sangani, A., A. A. Masoudi, and S. A. Hosseini.
2014. The effects of herbal plants on Mucin 2 gene
expression and performance in ascetic broilers. Iran. J. Vet.
Med. 8:47–52.
Kong, M., X. G. Chen, K. Xing, and H. J. Park. 2010.
Antimicrobial properties of chitosan and mode of action: a
state of the art review. Int. J. Food Microbiol. 144:51–63.
Koutsos, E. A., J. C. G. López, and K. C. Klasing. 2007.
Maternal and dietary carotenoids interactively affect cuta-
neous basophil responses in growing chickens (Gallus gallus
domesticus). Comp. Biochem. Physiol. Biochem. Mol. Biol.
147:87–92.
Livak, K. J., and T. D. Schmittgen. 2001. Analysis of
relative gene expression data using real-time quantitative
PCR and the 22 DDCT method. Methods. 25:402–408.
Manach, C., F. Regerat, O. Texier, G. Agullo, C.
Demigne, and C. Remesy. 1996. Bioavailability, metabolism
and physiological impact of 4-oxo-flavonoids. Nutr. Res.
16:517–544.
Manal, I. 2016. Detoxification and antioxidant effects of
garlic and curcumin in Oreochromis niloticus injected with
aflatoxin B 1 with reference to gene expression of gluta-
thione peroxidase (GPx) by RT-PCR. Fish. Physiol. Bio-
chem. 42:617–629.
Meimandipour, A., A. N. Emamzadeh, and A. Sol-
eimani. 2017. Effects of nanoencapsulated aloe vera, dill and
nettle root extract as feed antibiotic substitutes in broiler
chickens. Arch. Anim. Breed. 60:1.
Moghaddam, H. S., H. N. Moghaddam, H. Kerman-
shahi, A. H. Mosavi, and A. Raji. 2011. The effect of
threonine on mucin2 gene expression, intestinal histology
and performance of broiler chicken. Ital. J. Anim. Sci.
10:e14.
Mohammadi, H., and Z. Ansari-Pirsaraei. 2014. Changes
in some blood parameters and production performance of
old laying hens due to growth hormone and testosterone
injection. J. .Anim .Physiol .Anim .Nutr. 98:483–490.
885
Montagne, L., C. Piel, and J. Lalles. 2004. Effect of diet on
mucin kinetics and composition: nutrition and health implica-
tions. Nutr. Reviews. 62:105–114.
Natrajan, D., S. Srinivasan, K. Sundar, and A. Ravin-
dran. 2015. Formulation of essential oil-loaded chitosan–
alginate nanocapsules. J. Food Drug Anal. 23:560–568.
Nosrati, M., F. Javandel, L. Camacho, A. Khusro, M.
Cipriano, A. Seidavi, and A. Salem. 2017. The effects of
antibiotic, probiotic, organic acid, vitamin C, and Echinacea
purpurea extract on performance, carcass characteristics, blood
chemistry, microbiota, and immunity of broiler chickens. J.
Appl. Poult. Res. 26:295–306.
Nouri, A. 2019. Chitosan nano-encapsulation improves
the effects of mint, thyme, and cinnamon essential oils in
broiler chickens. Br. Poult. Sci. 60:530–538.
Patel, S. 2015. Plant essential oils and allied volatile
fractions as multifunctional additives in meat and fish-based
food products: a review. Food Addit. Contam. Part A.
32:1049–1064.
Phillips, I., M. Casewell, T. Cox, B. De Groot, C. Friis,
R. Jones, C. Nightingale, R. Preston, and J. Waddell. 2004.
Does the use of antibiotics in food animals pose a risk to
human health? A critical review of published data. J. Anti-
microb. Chemother. 53:28–52.
Platel, K., and K. Srinivasan. 2000. Stimulatory influ-
ence of select spices on bile secretion in rats. Nutr. Res.
20:1493–1503.
SAS Institute. 2011. The SAS System for Windows No.
Release 9.2. SAS Institute, Cary, NC.
Sedghi, M., A. Golian, F. Kolahan, A. Heravi Moussavi,
and A. Afsar. 2014. Broiler diets formulated based on
digestible amino acid values as determined by in vivo and
prediction methods. Iran. J. Appl. Anim. Sci. 4:361–366.
Sowbhagya, H. 2013. Chemistry, technology, and
nutraceutical functions of cumin (Cuminum cyminum L):
an overview. Crit. Rev. Food Sci. Nutr. 53:1–10.
Torki, M., J. Soltani, and H. Mohammadi. 2015. Effects
of adding ethanol extract of propolis and cumin essential oil
to diet on the performance, blood parameters, immune
response and carcass traits of broiler chicks. Iran. J. Appl.
Anim. Sc. 5:911–918.
Verma, J., T. Johri, B. Swain, and S. Ameena. 2004.
Effect of graded levels of aflatoxin, ochratoxin and their
combinations on the performance and immune response of
broilers. Br. Poult. Sci. 45:512–518.
Wen, P., D.-H. Zhu, H. Wu, M.-H. Zong, Y.-R. Jing,
and S.-Y. Han. 2016. Encapsulation of cinnamon essential
oil in electrospun nanofibrous film for active food pack-
aging. Food Control. 59:366–376.
Yalçın, S., K. Uzunoglu, H. Duyum, and Ö. Eltan. 2012.
Effects of dietary yeast autolysate (Saccharomyces cer-
evisiae) and black cumin seed (Nigella sativa L.) on per-
formance, egg traits, some blood characteristics and
antibody production of laying hens. Livest. Sci. 145:13–20.
Yang, C., G. Cao, P. Ferket, T. Liu, L. Zhou, L. Zhang,
Y. Xiao, and A. Chen. 2012. Effects of probiotic, Clos-
tridium butyricum, on growth performance, immune func-
tion, and cecal microflora in broiler chickens. Poult. Sci.
91:2121–2129.
Zeinali, S., S. GHazanfari, and M. A. Ebrahimi. 2017.
Mucin2 gene expression in the chicken intestinal goblet cells
are affected by dietary essential oils. Bulg. Agric. Anim. Sci.
23:134–141.