| |

Received: 15 November 2019    Revised: 24 March 2020    Accepted: 12 September 2020

DOI: 10.1111/are.14906

ORIGINAL ARTICLE

mRNA expression of growth hormone (GH) and Insulin during

the initial ontogeny of tropical gar larvae (Atractosteus tropicus)

Zuleyma Zamora-Solís1 | Luis Daniel Jiménez-Martínez1  | Carlos Alfonso Frías-

Quintana2  | Carlos Alfonso Álvarez-González3  | Dariel Tovar-Ramírez4  |
Rocío Guerrero-Zarate3

1
Laboratorio de Biología Molecular, División
Multidisciplinaria de Jalpa de Méndez, Abstract
Universidad Juárez Autónoma de Tabasco, The tropical gar (Atractosteus tropicus) is one of the most important commercial spe-
Jalpa de Méndez, Tabasco, México
2 cies in south-eastern Mexico, being studied in reproductive, physiological, nutrition
Laboratorio de Investigación en
Biotecnología Acuícola (LIBA), Tecnológico and cultivation aspects; however, the aspects related to the endocrine system are
Nacional de México Campus Boca del Río
unknown, mainly the expression of hormones during their larval development. In this
(ITBoca), Boca del Río, Veracruz, Mexico
3
Laboratorio de Acuicultura Tropical,
study, we investigated the expression of the insulin gene (INS) and growth hormone
División Académica de Ciencias Biológicas, (GH), during the embryonic period (egg), eleutheroembryon (3 DAH) up to 25 DAH
Universidad Juárez Autónoma de Tabasco,
Villahermosa, Tabasco, México
using RTq-PCR, normalized with the elongation factor gene EF1-α. The INS phylo-
4
CIBNOR, Instituto Politécnico Nacional genetic inference showed an amino acid identity of 97%, while GH 99% against the
195, La Paz, B.C.S., México sequence of Lepisosteus oculatus, indicating that these species are related and come
Correspondence from a common ancestor. The gene expression of the INS showed four peaks at 3, 7,
Carlos Alfonso Frías-Quintana, Laboratorio 11 and 19 DAH, corresponding to changes in diet (Artemia nauplii) and artificial foods.
de Investigación en Biotecnología Acuícola
(LIBA), Tecnológico Nacional de México GH expression was detected from the egg, increasing from day 15 to 25 DDE, con-
Campus Boca del Río (ITBoca). Carretera cluding that A. tropicus larvae showed early and high expressions of these hormones,
Veracruz-Córdoba Km.12, 94290. Boca del
Río, Veracruz, Mexico. indicating a direct relationship with changes in metabolism of the species, increasing
Emails: alvarez_alfonso@hotmail.com; its function according to the nutrients present in the food and the increase in growth
cafq22@hotmail.com
during the ontogeny of A. tropicus.

KEYWORDS

gene expression, growth hormone, insulin, ontogeny, tropical gar

1 |  I NTRO D U C TI O N
The tropical gar (Atractosteus tropicus) is a species that lives in
continental water bodies and with adaptability to little oxygen-
ation in its environment, a characteristic that makes this species
unique for cultivation in captivity, which is why it has been widely
studied in aspects on the biology, physiology, reproduction, nu-
trition and genetics of A. tropicus in the last 30 years, allowing
to know aspects of its cultivation (Aguilera et al., 2002; Álvarez-
González et al., 2007; Arias-Rodríguez et al., 2009; Frías-Quintana
et al., 2015, 2016; Guerrero-Zarate et al., 2013. However, the
aspects related to the expression of insulin-like hormones and
growth hormones that contribute to the knowledge of their
functioning and their importance during their larval development
are unknown.
Considering the above, scientific and technological advances
show molecular biology as an area of research that has not been
fully explored, mainly in studies for this species and have fo-
cused mainly on cyprinids and mostly on marine species such as
Lutjanus guttatus (Galaviz et al., 2011), Lates calcarifer (Srichanun
et al., 2013), Totoaba macdonaldi (Galaviz et al., 2015), Salmo salar
(Sahlmann et al., 2015), Sparus aurata (Mata-Sotres et al., 2016),
Centropomus poeyi (Asencio-Alcudia et al., 2018), and Seriola rivo-
liana (Teles et al., 2019).
In freshwater species, studies have been carried out to evaluate
the effect of diets on the expression of the gene for growth hormone

Aquaculture Research. 2020;00:1–10. wileyonlinelibrary.com/journal/are© 2020 John Wiley & Sons Ltd     1 |
 |
2       ZAMORA-SOLÍS et al.
(GH) and insulin on growth and sexual differentiation in Anguilla an-
guilla (Degani & Abraham, 1992; Degani, 2016; Degani et al., 2003),
GH secretion in Cyprinus carpio (Degani et al., 1999), GH expres-
sion and insulin-like growth factor-1 in Trichogaster trichopterus
and Acipenser gueldenstaedtii (Degani,  2014; Degani et  al.,  2017;
Goldberg et al., 2004; Yom Din et al., 2008).
For Atractosteus tropicus, dietary studies and their effect on im-
mune system genes and genes related to lipid metabolism have
been performed (Jiménez-Martínez et al., 2019; Nieves-Rodríguez
et al., 2018), which shows fluctuations in the expression of various
genes related to morphophysiological changes, in particular for en-
zymes and hormones associated with digestive physiology. Due to the
above, there are many research possibilities that have not yet been ex-
plored, mainly for knowledge of the physiology and gene expression
of species of aquaculture interest, of which there is no study focused
on insulin-like hormones and growth reported for larvae of A. tropicus.
In this way, insulin (INS) and insulin-like growth factors (IGFs) are
evolutionarily related peptides that are derived from a common an-
cestral gene (Jin Chan & Steiner, 2000). A single INS gene has been
described for almost all existing groups of vertebrates studied to
date (Irwin, 2004). However, recent studies reveal that certain spe-
cies of fish (for example, salmon, fugu and zebrafish) have multiple
copies of the INS gene, possibly as a result of an event of gene du-
plication associated with the appearance of teleosts (Conlon, 2001;
Irwin, 2004; Kavsan et al., 1993). INS has been shown to be a strong
growth-promoting agent in fish, only slightly less effective than the
action of insulin growth factor IGF-I (Planas et al., 2000).
On the other hand, growth hormone (GH) is a well-conserved
hormone and is expressed mainly in the anterior pituitary gland of
all vertebrates and is responsible for exponential growth. Although
the growth-promoting effect of GH is well documented, the growth
of fish is multifactorial and GH will be able to act at different lev-
els (Mommsen, 2001). Growth hormone (GH) is the main regulator
of somatic growth and metabolism of fish, as in other vertebrates
(Björnsson, 1997). Until recently, it was believed that GH had no role
in the growth of the embryo, but transcripts of GH have been de-
tected in rainbow trout embryos prior to organogenesis of the pitu-
itary and even in mature oocytes (Yang et al., 2019).
In tetrapod vertebrates, embryonic and foetal growth had been
considered to be independent of pituitary GH, although it is required
for post-natal growth and development. However, recent studies
suggest that extrapituitary GH play an important role in early em-
bryonic growth and differentiation (Sanders & Harvey,  2004), and
these data led to give another dimension of the action of GH in ver-
tebrates in early development. Although the expression of GH has
been described extensively in euteleosteos, until now little is known
of GH in the physiology of primitive fish (Fukamachi & Meyer, 2007).
However, little is known about the regulation of growth in tele-
osts during early development, although the implication of the endo-
crine system is obvious. The presence of GH in the embryo and the
first stages of larvae has been confirmed in fish such as Epinephelus
colloids (Li et al., 2005, 2006), Anguilla japonica (Ozaki et al., 2006)
and several species of teleost fish (Fukamachi & Meyer, 2007). Also,
the expression of GH in the early stages of development suggests
that it plays an important role in the growth and survival of larvae,
which has been proven by the stimulatory effects of growth when
using exogenous GH, and the transfer and envelope expression
of the GH gene demonstrated in teleost larvae (Wen et al., 2015).
Although GH has been detected in many groups, it may be function-
ally limited within a large number of taxa; the comparison of GH se-
quences has been informative in a variety of phylogenetic analyses.
Given the phylogenetic position of the catanes (chondrosteal) like
the long-nosed gar Lepisosteus osseus could relate the changes in
the structure of GH and the evolutionary trends in the Neopterygii
Group and among the Actinopterygii. (Rubin, Youson, Marra & Dores,
1996), should be useful for the interpretation of the evolutionary
tendencies in the structure of the GH in the Neopterygii group and
among the Actinopterígios. In this context, the objective of this re-
search is to determine the expression insulin and GH through the
larval development of the tropical gar (Atractosteus tropicus) and the
evolutionary tendencies of these genes in relation to other species.
2 | M ATE R I A L S A N D M E TH O DS
2.1 | Sample processing
For this study, a total of 2000 embryos of A. tropicus were
obtained, based on the recommendations of Frías-Quintana
et al., (2016), from an induced spawning of broodstock (1 female
3.5 kg of average weight and 3 males 1.5 kg of average weight)
using the hormone LHRHa (35 μg/kg of fish−1) which were kept
in circular tanks of 2,000 L (0.6 m high by 2 m in diameter) ob-
tained from the Laboratorio de Acuicultura Tropical in the
División Academica de Ciencias Biologicas of the Universidad
Juárez Autónoma de Tabasco (DACBIOL-UJAT). Once spawning
(16 hr post induction), the brood stocks were removed keep-
ing the eggs until hatching (day 3 post fertilization, 0 days after
hatching, DDE), at which time the eleuteroembryos were placed
in three 70-L circular plastic tanks coupled to a recirculation sys-
tem consisting of a 1,500 L reservoir that functions as a solidifier
and biological filter, as well as a ¾ HP centrifugal pump (Jacuzzi,
JWPA5D-230A, Delavan WI, USA), a silica sand filter (STA-RITE,
S166T, Delavan WI, USA) and two titanium thermostats (PSA,
R9CE371, Delavan WI, USA). The water quality of the system
was monitored daily during the 31 days of larviculture record-
ing the temperature (29°C), the dissolved oxygen (6.43  mg/L)
and the pH (6.7) by means of an oximeter (YSI 85, Ohio, USA)
and a potentiometer (HANNA HI 991001, Romania, Europe)
respectively. The organisms remained in this system until they
absorbed the yolk (2 DDE), initiating the feeding phase, which
was carried out five times a day (8:00, 11:00, 13:00, 15:00 and
18:00 hr) starting with Artemia nauplii (AN, 2–5 nauplii/ ml) from
the moment of opening of the mouth to 17 DDE, and later with
artificial feed for trout (TD, Silver Cup, 45% protein and 16% li-
pids) until 31 DDE, for which the food was broken and sifted
ZAMORA-SOLÍS et al.
TA B L E 1   Oligonucleotides used for sequencing and real-time polymerase chain reaction in Atractosteus tropicus
Primer names Forward (5´- 3´)
EF1-α GGDGACAACATGCTGGAR
CCTGCAGGACGTCTACAAGATCG
INS GGCGGTTCCAAGTTTTCTCT
TGCTCGTCTTGTCTTCTCCA
GH AGAAGACCAACAGCTGCACA
TGGAAATTGCATGGTGATGT
(250–500, 500–750 and >750μm) in relation to the size of the
mouth of the larvae. Sampling of larvae began from the egg,
eleuteroembryos (1–3 DDE), up to 4 DDE, and then, the sampling
was carried out every two days (days 7, 9, 11, 15, 19 and 25 DDE),
collecting 5 larvae per day in triplicate, up to a total of 270 larvae
that were stored in 1.5-ul Eppendorf tubes with RNAlater® solu-
tion (Ambion USA) and kept in ultra-freezing at −80°C (Thermo
Scientific, Ohio, USA) until further processing.
2.2 | RNA extraction and cDNA synthesis by RT-
PCR in larvae of A. tropicus
The total extraction of RNA was carried out using a homogenate of
larvae (0–25 days after hatching). The process was carried out with a
commercial extraction kit of RNA PurelinkTM RNA Kit (Promega WI
US), according to the supplier's specifications, based on the princi-
ple of the RNA extraction technique Otto (1998); finally, the sample
was resuspended in water free of RNAases. The concentration of
RNA extracted and purified was checked with the Nanodrop one ©
(Thermo Scientific, Ohio USA) using 1 ul per sample.
The cDNA synthesis was performed using the GoScript™
Reverse Transcription System kit (Promega, WI USA) according to
the indications established by the manufacturer, based on tech-
nique Myers and Gelfand, (1991), using 1 μg of total RNA and using
the Thermal Cycler Proflex PCR System (Thermo Scientific, Ohio
USA). Once the amplification of the obtained products was ob-
tained, they were run on a 2% agarose gel (Grey & Brendel, 1992)
to determine the presence of bands with their respective molecular
weight, using a 50 bp molecular weight marker (Invitrogen Tech-Line
NY, USA), subsequently. Once the gene was located, the products
TM
obtained from the PCR were purified with the PureLink Quick
PCR Purification Kit® kit (Life technology Germany) according to
the supplier's specifications to send them later to be sequenced.
2.3 | Oligonucleotide design
The oligonucleotide design was made based on the Hung and
Weng, (2016), technique, using the software primer 3 Plus (http://
prime​
r3plus.com/web_3.0.0/prime​
r3web_input.htm) of a specific
region of the growth hormone (GH) sequence (XM_006638287.2);
Insulin (XM_015351933) obtained from the specie Lepisosteus
|
      3
Reverse (5´- 3´) Size pb Step
TGGTTCAGGATRATVACYTG 360 RT-PCR
GACCTCAGTGGTCACGTTGGA 120 qPCR
ATATGGTGCAAGGCTTGTGG 386 RT-PCR
GCTCCACTCCGCTCATTTTA 141 qPCR
GATGACAAGTTTCGGCAGTG 708 RT-PCR
CTGCATTGGTGAAGAGGTTG 130 qPCR
oculatus and Elongation factor 1-alpha (EF1) for Atractosteus tropi-
cus (KT351350.1), whose sequence of genes were obtained from the
GenBank database. The oligonucleotides were designed with the fol-
lowing characteristics: from 20 to 22 nucleotides long, an alignment
temperature of 50 to 60°C, CG (guanine-cytosine) content of 50% and,
finally, secondary structure formation was evaluated using the Oligo
Calculator version 3.27 open-access software method Kibbe, (2007),
(http://bioto​ols.nubic.north​weste​rn.edu/Oligo​Calc.html) (Table  1).
To evaluate the oligonucleotides designed for A. tropicus, we
run in a Thermal Cycler Proflex PCR System (Thermo Scientific,
Ohio USA) using the Platinum Taq DNA Polymerase (Invitrogen,
Carlsbad, CA). Amplification was conducted under the following
conditions: 10 min at 95°C, followed by 35 cycles at 95°C for 30 s,
58°C for 30 s and 72°C for 30 s with a 5-min extension at 72°C,
according to the indications and specifications of the supplier (Pohl
& Shih, 2004). The amplification products were separated on a 2%
agarose gel stained with ethidium bromide (Grey & Brendel, 1992).
The bands observed under UV light (ENDURO © GSD Labnet
International (Nueva York, E.U.) were cut from the gel and puri-
fied using the PureLink® PCR Purification Kit (Invitrogen) according
to the indications and specifications of the supplier. The purified
bands were sent to GENEWIZ Inc. (MD, USA) for direct sequencing.
2.4 | Sequence analysis
The sequence of the genes were sent by the company by mail in
the FASTA file, which were analysed with the Chroma software
(http://www.techn​e lysi​um.com.au/) (Goodstadt & Ponting, 2001)
to evaluate the identity of each one. The nucleotide sequences
contained the amino acid sequence to be translation to the pro-
tein sequence through the ExPASy translation software (Artimo
et al., 2012) and were compared with the BLASTn and BLASTp
tools compared with DNA sequences present in the GenBank da-
tabase network service at NCBI (https://blast.ncbi.nlm.nih.gov/).
The phylogenetic tree was generated using Neighbour-Joining
(NJ) methods based on the AA sequence using MEGA X software
(Kumar et al., 2018), where the principle of the software is to align
the introduced sequence of the species and the amino acid se-
quence is aligned with other sequences of registered organisms
to build evolutionary trees of the species, as well as to estimate
genetic distances between organisms and infer in ancestral se-
quences with an ancestor in common.
 |
4       ZAMORA-SOLÍS et al.

2.5 | RT-qPCR analysis

Subsequently, the oligonucleotides for real-time qPCR were de-

signed based on these sequences obtained to evaluate the ex-
pression of the genes in the larval samples (Table 1) (Hung &
Weng, 2016). For the quantification of the expression of GH and
insulin in larvae of A. tropicus, a standard curve was constructed to
observe the dynamic range of detection of primers and verify the
efficiency of the amplification and choose a dilution to which the
samples should be quantified, taking into account that 100% of the
efficiency corresponds to a slope −3.32 (Arya et  al.,  2005). Once
the dilution was fixed, we proceeded to quantify the level of ex-
pression of the digestive enzymes throughout the ontogeny using
the SsoAdvanced ™ SYBR Green Supermix (Bio-Rad, CA USA). The
reaction mixture included 10 μl of Eva Green, 2-μl cDNA and 0.2 μM
of each primer. The thermal programme included 2 min at 95°C, fol-
lowed by 38 cycles at 95°C for 10s, 60°C for 30s and extension at
70°C for 5s, according to the supplier's specifications. All reactions
were performed in triplicate, taking as a reference the elongation F I G U R E 1   Fragments amplified using primers by RT-PCR
and visualized on 2% agarose gel with ethidium bromide using a
factor (EF1- α) of genes to normalize the Ct values obtained from the
molecular weight (MM) marker of 50 Pb (invitrogen). Samples (from
different genes analysed according to the algorithms in the Thermal
left to right): insulin (INS) 386 Pb, growth hormone (GH) 708 Pb and
Cycler Rotor Gene Q-Qiagen© (Hilden, Germany). The normaliza- elongation factor 1-α (EF1) 360 Pb (KT351350.1)
tion of cDNA EF1 was used as a constitutive gene and carried out
in parallel with all samples. Once a calibration curve was carried out
to determine the specificity of the oligos designed at different con- with ethidium bromide using a 50 Pb molecular weight (MM) marker
centrations, once it was done and determining the ideal concentra- (Invitrogen Tech-Line NY, USA) (Figure  1). These fragments were
tion, they were evaluated with the cDNA samples from the samples cut and purified to be sequenced obtaining 386 Pb (INS) partial se-
throughout ontogeny, where the CT was obtained (copy threshold) quences encoding 128 AA (Figure  2a); 708 Pb (GH) encoding 249
that indicates the molecular expression of the gene to be evaluated AA (Figure 2b), the reference gene used for this study (EF1-α) is al-
in the organism throughout the larval and juvenile development. ready registered in the Genbank database (KT351350.1) with 360 Pb
Relative gene expression of larval growth stages was calculated encoding 120 AA; used as a reference and compared with a 50 Pb
using the delta–delta method copy threshold (CT) (Pfaffl, 2001), molecular weight marker. From these sequences, the primers were
which is calculated directly by the thermal cycler programme. designed for real time (marked forward and reverse sequence in
bold) for each gene.

2.6 | Statistical analysis
The relative expression of GH, insulin and EF1- α among the differ-
ent stages days after hatching (DAH) of larvae were analysed using
the Kruskal–Wallis test. A posteriori Nemenyi tests were performed
to determine significant differences among the activities based on
age (significance value of p < .05). All statistical analyses were per-
formed using STATISTICATM v. 7.5 software (StatSoft, Tulsa, OK).
3 |  R E S U LT S
3.1 | PCR amplification and sequencing amino acid
analysis of the INS, GH and EF1 genes
Amplified fragments of the genes for insulin (INS), growth hormone
(GH) and elongation factor EF1-α (KT351350.1) were obtained,
using primers by RT-PCR which were visualized in 2% agarose gel
3.2 | Analysis of phylogenetic distance
between sequences
The phylogenetic inference of INS showed the highest percent-
age of identity (100%) against the sequence of insulin-like isoform
X3 Lepisosteus oculatus (XM_015204784.1), member of the order
Lepisosteiformes and 43% percentage of identity with insulin
Crocodylus porosus (XP 019406793.1); this being an indication of
that these species are related and come from a common ancestor,
which indicates that the amino acid sequence belongs to the hor-
mone insulin, where an alignment is shown where the zones with
greater homology or conserved between the species are shown
(Figure 3a).
The growth hormone (GH) gene showed the highest per-
centage of amino acid identity (27%) against the reported
GH sequence in Crocodylus novaeguineae (AAB34999.1) and
Oreocchromis niloticus (AAA49626.1), while with Lepisosteus
ZAMORA-SOLÍS et al. |
      5

F I G U R E 2   Partial sequences of nucleotides and amino acid (AA) AA)-encoding genes (a) INS (insulin) (b) GH (Growth Hormone), from A.
tropicus taken from GenBank for the design of specific oligonucleotides for qPCR

osseus (AAB37388.1) and Acipenser sinensis (ACC86123.1) with
11% (Figure 3b).
3.3 | The expression of insulin and GH genes
during the ontogeny in A. tropicus
Subsequently, the specificity of the oligonucleotides was confirmed
through the RT-qPCR, due to the absence of secondary structures,
the primer dimer or non-specific amplification fragments through the
analysis of fusion peaks, using the software Rotor Gene Q-Qiagen©
(Hilden, Germany). After this analysis, the relative quantification of
insulin and growth hormone (GH) was determined using EF1 as a
reference gene and the following was observed: INS expression was
low during the first days presenting a peak on day 7 DAH and sub-
sequently presented variations throughout the development of the
larva (Figure  4a). The expression of GH is detected from the first
days of culture of the larvae, presenting a peak of expression at 11
DAH, to be increased from day 15 DAH to day 25 DAH consecu-
tively (Figure 4b).
 |
6       ZAMORA-SOLÍS et al.

F I G U R E 3   Phylogenetic tree based on the protein sequences of genes (a) Insulin (INS) and (b) Growth hormone (GH) from A. tropicus
and other vertebrate species using the neighbour-joining (NJ) method. Values at branch-points represent percentage frequencies for tree
topology after 1,000 interations

4 |  D I S CU S S I O N Anguilla anguilla (Degani, 2016) expression in specific organs in

The expression of hormones represents one of the fundamental
tools for the understanding of digestive physiology, especially in
freshwater fish larvae (Rønnestad et al., 2013). In this sense, during
the development of the larvae of A. tropicus, the level of expres-
sion of digestive hormones was determined on the initial ontog-
eny, using the scheme based on live food (rotifers and Artemia).
According to our results, insulin expression (INS) is present in small
units from the development of the embryo (egg), increasing on day
3 DDE when it is in the stage of eleuteroembryon, and presents var-
iations in expression during development, increasing considerably
at 19 DDE, when it is already considered a juvenile, with the entire
digestive system fully developed, including the complete formation
of a functional pancreas (Frías-Quintana et al., 2015), where the
INS hormone remains active as it has been detected Scophthalmus
maximus (Hu et al., 2012; Wen et al., 2015), Oncorhynchus mykiss
(Mennigen et al., 2013), Platichthys stellatus (Xu et al., 2015),
Solea senegalensis, Dicentrarchus labrax, Oreochromis hornorum,
Trichogaster trichopterus, Acipenser gueldenstaedtii (Degani,  2014;
Degani et al., 2017; Funes et al., 2006; Gao et al., 2012; Patruno
et al., 2008) and in relation to other studies of insulin function and
regulation in fish (Degani et al., 1999; Irwin, 2004; Li et al., 2006;
Reindl & Sheridan, 2012) and other vertebrates in general (Jin Chan
& Steiner, 2000; Rodgers et al., 2008). However, recent studies re-
veal that certain species of fish (fugu and zebrafish) have multiple
copies of the INS gene, possibly as a result of an event of gene du-
plication associated with the appearance of teleosts (Conlon, 2001;
Irwin, 2004; Wood et al., 2005). INS has been shown to be a strong
growth-promoting agent in fish, only slightly less effective than the
action of insulin growth factor IGF-I (Reindl & Sheridan, 2012). The
increase in insulin from egg to adulthood varies according to the
species and the factors that intervene in its growth and diet, as well
as its maturity and reproductive stage where insulin and growth
hormone play an important role in reproductive stage, where it
ZAMORA-SOLÍS et al.
F I G U R E 4   Relative expression levels of INS (a) and GH (b)
compared with Ef1 during the initial ontogeny of A. tropicus
increases the expression levels of these hormones depending on
age and sex, the crucial larval stage being the presence of the insu-
lin hormone and growth hormone, since they indicate the presence
of the development and functioning of the glands that they pro-
duce them and they play an important role in the growth and regu-
lation of carbohydrates present in diets, which decrease after the
larval stage to remain constant these hormones in the adult stage.
It is well known that the growth hormone/insulin-like growth
factors (GH/IGFs) axis plays a vital role in the neuroendocrine reg-
ulation of growth (Wood et al., 2005). The GH/IGF system is com-
prised of growth hormone (GH), GH receptors, IGFs (IGF1 and IGF2),
IGF receptors (IGF1R and IGF2R) and IGF-binding proteins (IGFBPs)
(Safian et al., 2012).
Regarding the expression of GH, the results show the presence
of this hormone is detected in time in the hatching, post hatching
and larvae, once the yolk has been absorbed, increasing from day 9
DDE. However, in species such as gilthead sea bream, the expression
of GH in larvae was detected for the first time on day 3 after hatch-
ing (Funkenstein & Cohen, 1996), in Japanese sole, the percentage of
GH increased continuously from the first feeding (~9 DAH), similar to
the one obtained in this study, it seems that the highest percentage of
GH through the early stages of life of the species present would be a
|
      7
physiological approach with high growth potential in the larval period,
since that GH has growth-promoting effects in teleosts, through the
type I insulin growth factor (IGF) (Wen et al., 2015; Yang et al., 2019).
These studies suggest that the expression of GH is essential for
the growth of the larvae, and that during the initial ontogeny, this ex-
pression is very variable among fish species. For example in japonic
eel (Anguilla japonica), GH transcripts and GH protein production
were not detected in the larvae on day 3 after hatching; however,
it was detected until day 6 after hatching showing medium expres-
sion levels and were also detected at higher levels on day 10 after
hatching, to decrease in the following days, where in the adult stage
it remains (Ozaki et al., 2006), while in A tropicus a maximum peak of
expression was recorded on day 11 after hatching, decrease until it
remained constant in the adult stage.
Another recent study suggests that extrapituitary GH is ex-
pressed in early embryos in rainbow trout, as well as in other tetrapod
vertebrates, transcription of GH observed in the pinto (Epinephelus
colloids) began on day 1 after hatching, and on day 2 after hatching
in larvae (Li et al., 2005, 2006). Fish larvae grow very fast, but the
regulation of growth and nutrient requirements during the period
is little known for most of the species. The regulation of growth at
the molecular level is manifested by the expression of growth-re-
lated genes such growth hormone (GH), insulin-like growth factor-I
(IGF-I) and insulin-like growth factor-binding proteins (IGFBPs). GH
is produced by the pituitary gland, and its regulation is governed by
the hypothalamic neuropeptides (Bolander, 2004). It also regulates
nutrient metabolism along with growth, development, reproduction
and some other physiological processes (Abdolahnejad et al., 2015;
Jia et al., 2019; Mir et al., 2019; Pérez-Sanchez et al., 1991; Sakamoto
& Hirano, 1991).
In fact, in the case of the catán (Atractosteus spatula), the hatch-
ing occurs only two days after fertilization of the eggs and the larvae
grow using their yolk reserves up to 5 DDE when they begin to feed,
although the yolk reserves still they are present until 8 DEE. The devel-
opment during this first week is characterized by organogenesis and
growth at a rate of 1 mm/day. After 10 DEE, when the metamorpho-
sis has been completed, the larvae reach their highest growth rate at
5–6 mm/day. The presence of relative expression of GH and insulin
through larval stages indicates the existence of substantial expression
of this hormone in fertilized eggs, increasing expression on day 11 DAH
to decrease in following days, remaining constant in the adult stage;
this is consistent with the formation of the pituitary gland and the en-
docrine system of the species. At present, it is not possible to attribute
this incredible growth rate only to the GH-GH receptor axis, since the
thyroid hormones (T3) have also been evidenced in the early stages
with an increasing concentration until day 10 (Mendoza et al., 2002).
In the case of the catán (Atractosteus spatula), the hatching oc-
curs only two days after the fertilization of the eggs and the lar-
vae grow using their energy reserves up to 5 DDE when they start
with exogenous feeding, although the yolk reserves are still present
until 8 DEE. After 10 DEE, the metamorphosis has been completed,
and the larvae reach their highest growth rate, so the presence of
a relative expression of GH and insulin through the larval stages
 |
8       ZAMORA-SOLÍS et al.
indicates the existence of a substantial expression of this hormone
in fertilized eggs, increasing the expression on day 11 DAH to de-
crease in the following days, remaining constant in the adult stage,
this is consistent with the formation of the pituitary gland and the
endocrine system of the species. Currently, it is not possible to at-
tribute this incredible growth rate only to the axis of the GH-GH
receptor, since thyroid hormones (T3) have also been evidenced
in the early stages with an increasing concentration until day 10
(Mendoza et al., 2002).
Regulation of growth is very important to aquaculture produc-
tion and the growth hormone (GH)-IGF axis plays a major role in the
control of growth. IGFs are the primary mediators of the growth-pro-
moting effects of GH in fish and other vertebrates and have been
shown to operate in an autocrine, paracrine and endocrine manner
(Reindl & Sheridan, 2012; Wang et al., 2019; Wood et al., 2005). The
fact that GH can act as an autocrino-paracrine factor during the early
embryogenesis of A. tropicus, as well as in other fish species suggests
that this function may have appeared early during vertebrate evolu-
tion and that GH plays an important role during early embryogenesis
in the fish. In this way, the molecular expression of GH and insulin
and their role during the larval stages will undoubtedly contribute
to a better understanding of the physiology of the larvae (Aguilera
et al., 2002). The increase in insulin from egg to adulthood varies
according to the species and the factors that intervene in its growth
and diet, as well as its maturity and reproductive stage where insulin
and growth hormone play an important role in reproductive stage,
where it increases the expression levels of these hormones depend-
ing on age and sex, the crucial larval stage being the presence of
the insulin hormone and growth hormone, since they indicate the
presence of the development and functioning of the glands that they
produce them and they play an important role in the growth of the
specie and regulation of carbohydrates present in diets, since the
detection of these hormones in larval stages indicates; in addition
to the development of the endocrine system, it represents the ideal
moment in which it can be fed in this period with diets with higher
percentages of digestible carbohydrates that increase the level of
expression of these hormones, promoting increased growth and reg-
ulation in A. tropícus.
AC K N OW L E D G M E N T S
The author thanks CONACYT and the Institutional Program for
Academic Improvement of the UJAT for the scholarships granted
during the development of this thesis. As well as the Laboratory of
Excellence in Aquaculture of the Academic Division of Biological
Sciences of the Universidad Juarez Autonoma de Tabasco through
the financing project of CONACyt: CB-01-2016-282765 and the
facilities in the collection of larval samples to carry out this study
and the Applied Biotechnology Research Laboratory (LIBA) of the
Boca del Rio Technological Institute for the processing and analysis
of samples.
C O N FL I C T O F I N T E R E S T
The authors declare no conflicts of interest to be exist.
E T H I C A L S TAT E M E N T
All applicable international, national and/or institutional guidelines
for the care and use of animals were followed by the authors.
ORCID
Luis Daniel Jiménez-Martínez  https://orcid.
org/0000-0002-1869-3269
Carlos Alfonso Frías-Quintana  https://orcid.
org/0000-0002-5407-4991
Carlos Alfonso Álvarez-González  https://orcid.
org/0000-0001-9240-0041
Dariel Tovar-Ramírez  https://orcid.org/0000-0003-1204-9576
Rocío Guerrero-Zarate  https://orcid.org/0000-0002-0346-0841
REFERENCES
Abdolahnejad, Z., Pourkazemi, M., Khoshkholgh, M. R., & Yarmohammadi,
M. (2015). Expression of growth hormone gene during early devel-
opment of Siberian sturgeon (Acipenser baerii). Molecular Biology
Research Communications, 4(4), 181. https://doi.org/10.22099/​
mbrc.2019.33006.1393
Aguilera, C., Mendoza, R., Rodríguez, G., & Márquez, G. (2002).
Morphological description of alligator gar and tropical gar larvae,
with an emphasis on growth indicators. Transactions of the American
Fisheries Society, 131(5), 899–909. https://doi.org/10.1577/1548-
8659(2002)131%3C089​9:MDOAG​A%3E2.0.CO;2
Álvarez-González, C. A., Contreras, W., Castillo, K., Santana, O., &
Gallegos, R. (2007). Evaluation of commercial diets on tropical gar
Atractosteus tropicus growth. Memories of Aquaculture America, 835.
Arias-Rodríguez, L., Paramo-Delgadillo, S., Contreras-Sánchez, W. M.,
& Álvarez-González, C. A. (2009). Karyotype of the tropical gar
Atractosteus tropicus Lepisosteiformes: Lepisosteidae) and chromo-
somal variation in their larval and adults. Revista De Biología Tropical,
57, 529–539.
Artimo, P., Jonnalagedda, M., Arnold, K., Baratin, D., Csardi, G., De
Castro, E., & Grosdidier, A. (2012). ExPASy: SIB bioinformatics re-
source portal. Nucleic Acids Research, 40(W1), W597–W603. https://
doi.org/10.1093/nar/gks400
Arya, M., Shergill, I. S., Williamson, M., Gommersall, L., Arya, N., &
Patel, H. R. (2005). Basic principles of real-time quantitative PCR.
Expert Review of Molecular Diagnostics, 5(2), 209–219. https://doi.
org/10.1586/14737​159.5.2.209
Asencio-Alcudia, G. G., Tovar-Ramírez, D., Latisnere-Barragán, H.,
Martínez-García, R., Contreras-Sánchez, W. M., & Álvarez-González,
C. A. (2018). Gene expression of digestive enzymes during the ini-
tial ontogeny of Mexican snook Centropomus poeyi. Latin American
Journal of Aquatic Research, 46(5), 909–923. https://doi.org/10.3856/
vol46​-issue​5-fullt​ext-5
Björnsson, B. T. (1997). The biology of salmon growth hormone: From day-
light to dominance. Fish Physiology and Biochemistry, 17(1–6), 9–24.
Bolander, F. F. (2004). Nonclassical endocrinology. Molecular
Endocrinology (FF Bolander, Ed.), 61–100.
Conlon, J. M. (2001). Evolution of the insulin molecule: Insights into
structure-activity and phylogenetic relationships. Peptides, 22(7),
1183–1193. https://doi.org/10.1016/S0196​-9781(01)00423​-5
Degani, G. (2014). Expression of the growth hormone and insu-
lin-like growth factor 1 genes in the male and female blue gourami
(Trichogaster trichopterus) at different temperatures. Journal of Asian
Scientific Research., 4, 413–427.
Degani, G. (2016). A model of hormonal and environmental involvement
in growth and sex differentiation in European eel (Anguilla anguilla).
Advances in Biological Chemistry., 6, 141–145.
ZAMORA-SOLÍS et al.
Degani, G., & Abraham, M. (1992). Effect of insulin in the diet on the
growth of European eels (Anguilla anguilla (L.). Fish Physiology and
Biochemistry, 10, 223 227. https://doi.org/10.1007/BF000​0 4516
Degani, G., Boker, R., & Jackson, K. (1999). Secretion of growth hormone
from primary cell culture of carp (Cyprinus carpio) as affected by var-
ious gonadotropin-releasing hormones. Journal of Aquaculture in the
Tropics, 14(4), 327–337.
Degani, G., Tzhori, I., Yom-Din, G., Goldberg, D., & Jackson, K. (2003). Growth
differences and growth hormone expression in male and female European
eels (Anguilla anguilla (L.)). General and Comparative Endocrinology., 134,
88–93. https://doi.org/10.1016/S0016​-6480(03)00238​-7
Degani, G., Yom-Din, S., & Hurvitz, A. (2017). Transcription of insulin-like
growth factor receptor in ovary of Russian sturgeon (Acipenser guelden-
staedtii) during oogenesis. Universal Journal of Agricultural Research, 5(2),
119–124.
Frías-Quintana, C. A., Domínguez-Lorenzo, J., Álvarez-González, C. A.,
Tovar-Ramírez, D., & Martínez-García, R. (2016). Using cornstarch
in microparticulate diets for larvicultured tropical gar (Atractosteus
tropicus). Fish Physiology and Biochemistry, 42(2), 517–528. https://
doi.org/10.1007/s1069​5-015-0156-4
Frías-Quintana, C. A., Márquez-Couturier, G., Alvarez-González, C. A.,
Tovar-Ramírez, D., Nolasco-Soria, H., Galaviz-Espinosa, M. A., &
Gisbert, E. (2015). Development of digestive tract and enzyme activ-
ities during the early ontogeny of the tropical gar Atractosteus trop-
icus. Fish Physiology and Biochemistry, 41(5), 1075–1091. https://doi.
org/10.1007/s1069​5-015-0070-9
Fukamachi, S., & Meyer, A. (2007). Evolution of receptors for growth
hormone and somatolactin in fish and land vertebrates: Lessons from
the lungfish and sturgeon orthologues. Journal of Molecular Evolution,
65(4), 359–372. https://doi.org/10.1007/s0023​9-007-9035-7
Funes, V., Asensio, E., Ponce, M., Infante, C., Cañavate, J. P., & Manchado,
M. (2006). Insulin-like growth factors I and II in the sole Solea senegal-
ensis: cDNA cloning and quantitation of gene expression in tissues and
during larval development. General and Comparative Endocrinology,
149(2), 166–172. https://doi.org/10.1016/j.ygcen.2006.05.017
Funkenstein, B., & Cohen, I. (1996). Ontogeny of growth hormone pro-
tein and mRNA in the gilthead sea bream Sparus aurata. Growth
Regulation, 6(1), 16–21.
Galaviz, M. A., García-Gasca, A., Drawbridge, M., Álvarez-González, C. A., &
López, L. M. (2011). Ontogeny of the digestive tract and enzymatic ac-
tivity in white seabass, Atractoscion nobilis, larvae. Aquaculture, 318(1–
2), 162–168. https://doi.org/10.1016/j.aquac​ulture.2011.05.014
Galaviz, M. A., López, L. M., Gasca, A. G., González, C. A., True, C. D.,
& Gisbert, E. (2015). Digestive system development and study of
acid and alkaline protease digestive capacities using biochemical
and molecular approaches in totoaba (Totoaba macdonaldi) larvae.
Fish Physiology and Biochemistry, 41(5), 1117–1130. https://doi.
org/10.1007/s1069​5-015-0073-6
Gao, F., Lu, M., Huang, Z., Zhu, H., & Ke, X. (2012). Cloning and sequence
of two cDNAs encoding insulin-like growth factors I and II genes (IGF-I
and IGF-II) of Zanzibar tilapia (Oreochromis hornorum) and their tissue
distribution. Journal of Agricultural Biotechnology, 20(2), 171–180.
Goldberg, D., Jackson, K., Yom-Din, S., & Degani, G. (2004). Growth
hormone of Trichogaster trichopterus: cDNA cloning, sequencing and
analysis of mRNA expression during oogenesis. Journal of Aquaculture
in the Tropics., 19, 215–229.
Goodstadt, L., & Ponting, C. P. (2001). CHROMA: Consensus-based co-
louring of multiple alignments for publication. Bioinformatics, 17(9),
845–846. https://doi.org/10.1093/bioin​forma​tics/17.9.845
Grey, M., & Brendel, M. (1992). Rapid and simple isolation of DNA from
agarose gels. Current Genetics, 22(1), 83–84. https://doi.org/10.1007/
BF003​51746
Guerrero-Zarate, R., Álvarez-González, C. A., Olvera-Novoa, M. A.,
Perales-García, N., Frías-Quintana, C. A., & y Martínez-García, R.
(2013). Partial characterization of digestive proteases in tropical gar
|
      9
Atractosteus tropicus juveniles. Fish Physiology and Biochemistry, 40,
1021–1029.
Hu, J., Wen, H. S., Guan, J., Guan, S. G., He, F., Li, J. F., & Zhang, Y. Q.
(2012). Cloning of IGFBP-1,-2 and expression analysis during adult
and early developmental stages in Scophthalmus maximus. Acta
Oceanologica Sinica, 34, 139–146.
Hung, J. H., & Weng, Z. (2016). Designing polymerase chain reaction
primers using Primer3Plus. Cold Spring Harbor Protocols, 2016(9),
pdb-prot093096. https://doi.org/10.1101/pdb.prot0​93096
Irwin, D. M. (2004). A second insulin gene in fish genomes. General
and Comparative Endocrinology, 135(1), 150–158. https://doi.
org/10.1016/j.ygcen.2003.08.004
Jia, Y., Jing, Q., Gao, Y., & Huang, B. (2019). Involvement and expression of growth
hormone/insulin-like growth factor member mRNAs in the ovarian devel-
opment of turbot (Scophthalmus maximus). Fish Physiology and Biochemistry,
45(3), 955–964. https://doi.org/10.1007/s1069​5-018-0604-z
Jiménez-Martínez, L. D., Álvarez-González, C. A., De la Cruz-Hernández,
E., Tovar-Ramírez, D., Galaviz, M. A., Camarillo-Coop, S., & Peña,
E. (2019). Partial sequence characterization and ontogenetic ex-
pression of genes involved in lipid metabolism in the tropical gar
(Atractosteus tropicus). Aquaculture Research, 50(1), 162–172. https://
doi.org/10.1111/are.13879
Jin Chan, S., & Steiner, D. F. (2000). Insulin through the ages: Phylogeny
of a growth promoting and metabolic regulatory hormone. American
Zoologist, 40(2), 213–222. https://doi.org/10.1093/icb/40.2.213
Kavsan, V., Koval, A., Petrenko, O., Roberts, C. T., & LeRoith, D. (1993).
Two insulin genes are present in the salmon genome. Biochemical and
Biophysical Research Communications, 191(3), 1373–1378. https://doi.
org/10.1006/bbrc.1993.1369
Kibbe, W. A. (2007). OligoCalc: An online oligonucleotide properties cal-
culator. Nucleic Acids Research, 35(suppl_2), W43–W46. https://doi.
org/10.1093/nar/gkm234
Kumar, S., Stecher, G., Li, M., Knyaz, C., & Tamura, K. (2018). MEGA X:
Molecular evolutionary genetics analysis across computing plat-
forms. Molecular Biology and Evolution, 35(6), 1547–1549. https://doi.
org/10.1093/molbe​v/msy096
Li, M., Greenaway, J., Raine, J., Petrik, J., Hahnel, A., & Leatherland, J. (2006).
Growth hormone and insulin-like growth factor gene expression prior to
the development of the pituitary gland in rainbow trout (Oncorhynchus
mykiss) embryos reared at two temperatures. Comparative Biochemistry
and Physiology Part A: Molecular & Integrative Physiology, 143(4), 514–
522. https://doi.org/10.1016/j.cbpa.2006.01.024
Li, W. S., Chen, D., Wong, A. O., & Lin, H. R. (2005). Molecular cloning, tis-
sue distribution, and ontogeny of mRNA expression of growth hor-
mone in orange-spotted grouper (Epinephelus coioides). General and
Comparative Endocrinology, 144(1), 78–89. https://doi.org/10.1016/j.
ygcen.2005.04.018
Mata-Sotres, J. A., Martos-Sitcha, J. A., Astola, A., Yúfera, M., & Martínez-
Rodríguez, G. (2016). Cloning and molecular ontogeny of digestive
enzymes in fed and food-deprived developing gilthead seabream
(Sparus aurata) larvae. Comparative Biochemistry and Physiology
Part B: Biochemistry and Molecular Biology, 191, 53–65. https://doi.
org/10.1016/j.cbpb.2015.09.006
Mendoza, R., Aguilera, C., Montemayor, J., Revol, A., & Holt, J. (2002).
Studies on the physiology of Atractosteus spatula larval development
and its applications to early weaning onto artificial diets. Avances
en nutrición acuícola VI. Memorias Del VI Simposium Internacional De
Nutrición Acuícola, 3, 197–226.
Mennigen, J. A., Skiba-Cassy, S., & Panserat, S. (2013). Ontogenetic ex-
pression of metabolic genes and microRNAs in rainbow trout alevins
during the transition from the endogenous to the exogenous feeding
period. Journal of Experimental Biology, 216(9), 1597–1608. https://
doi.org/10.1242/jeb.082248
Mir, I. N., Bhat, I. A., Dar, S. A., Jain, K. K., Varghese, T., Kumari,
R., & Srivastava, P. P. (2019). Expression of alpha-amylase and
 |
10       ZAMORA-SOLÍS et al.
growth-related genes during early larval developmental stages of
Clarias magur. Aquaculture, 507, 69–74. https://doi.org/10.1016/j.
aquac​ulture.2019.04.014
Mommsen, T. P. (2001). Paradigms of growth in fish. Comparative
Biochemistry and Physiology Part B: Biochemistry and Molecular Biology,
129(2–3), 207–219. https://doi.org/10.1016/S1096​- 4959(01)00312​
-8
Myers, T. W., & Gelfand, D. H. (1991). Reverse transcription and DNA am-
plification by a Thermus thermophilus DNA polymerase. Biochemistry,
30, 7661–7666. https://doi.org/10.1021/bi002​45a001
Nieves-Rodríguez, K., Álvarez-González, C., Peña-Marín, E., Vega-
Villasante, F., Martínez-García, R., Camarillo-Coop, S., & Gisbert, E.
(2018). Effect of β-glucans in diets on growth, survival, digestive en-
zyme activity, and immune system and intestinal barrier gene expres-
sion for tropical gar (Atractosteus tropicus) Juveniles. Fishes, 3(3), 27.
https://doi.org/10.3390/fishe​s3030027
Otto, P. (1998). Separate isolation of genomic DNA and total RNA from
single samples using the SV Total RNA Isolation System. Promega
Notes, 69, 19–23.
Ozaki, Y., Fukada, H., Tanaka, H., Kagawa, H., Ohta, H., Adachi, S., &
Yamauchi, K. (2006). Expression of growth hormone family and
growth hormone receptor during early development in the Japanese
eel (Anguilla japonica). Comparative Biochemistry and Physiology Part
B: Biochemistry and Molecular Biology, 145(1), 27–34. https://doi.
org/10.1016/j.cbpb.2006.05.009
Patruno, M., Sivieri, S., Poltronieri, C., Sacchetto, R., Maccatrozzo, L.,
Martinello, T., & Radaelli, G. (2008). Real-time polymerase chain re-
action, in situ hybridization and immunohistochemical localization
of insulin-like growth factor-I and myostatin during development of
Dicentrarchus labrax (Pisces: Osteichthyes). Cell and Tissue Research,
331(3), 643–658. https://doi.org/10.1007/s0044​1-007-0517-0
Pérez-Sanchez, J., Smal, J., & Lebail, P. Y. (1991). Location and charac-
terization of growth hormone binding sites in the central nervous
system of a teleost fish (Oncorhynchus mykiss). Growth Regulation,
1(4), 145–152.
Pfaffl, M. W. (2001). A new mathematical model for relative quantifica-
tion in real-time RT–PCR. Nucleic Acids Research, 29(9), e45. https://
doi.org/10.1093/nar/29.9.e45
Planas, J. V., Méndez, E., Banos, N., Capilla, E., Navarro, I., & Gutiérrez,
J. (2000). Insulin and IGF-I receptors in trout adipose tissue are
physiologically regulated by circulating hormone levels. Journal of
Experimental Biology, 203(7), 1153–1159.
Pohl, G., & Shih, I. M. (2004). Principle and applications of digital PCR.
Expert Review of Molecular Diagnostics, 4(1), 41–47. https://doi.
org/10.1586/14737​159.4.1.41
Reindl, K. M., & Sheridan, M. A. (2012). Peripheral regulation of the
growth hormone-insulin-like growth factor system in fish and
other vertebrates. Comparative Biochemistry and Physiology Part A:
Molecular & Integrative Physiology, 163(3–4), 231–245. https://doi.
org/10.1016/j.cbpa.2012.08.003
Rodgers, B. D., Roalson, E. H., & Thompson, C. (2008). Phylogenetic
analysis of the insulin-like growth factor binding protein (IGFBP)
and IGFBP-related protein gene families. General and Comparative
Endocrinology, 155(1), 201–207. https://doi.org/10.1016/j.
ygcen.2007.04.013
Rønnestad, I., Yúfera, M., Ueberschär, B., Ribeiro, L., Sæle, Ø., & Boglione,
C. (2013). Feeding behaviour and digestive physiology in larval fish:
Current knowledge, and gaps and bottlenecks in research. Reviews in
Aquaculture, 5, S59–S98. https://doi.org/10.1111/raq.12010
Rubin, D. A., Youson, J. H., Marra, L. E., & Dores, R. M. (1996). Cloning
of a gar (Lepisosteus osseus) GH cDNA: Trends in actinopterygian GH
structure. Journal of Molecular Endocrinology, 16(1), 73–80. https://
doi.org/10.1677/jme.0.0160073
Safian, D., Fuentes, E. N., Valdés, J. A., & Molina, A. (2012). Dynamic tran-
scriptional regulation of autocrine/paracrine igfbp1, 2, 3, 4, 5, and 6
in the skeletal muscle of the fine flounder during different nutritional
statuses. The Journal of Endocrinology, 214(1), 95–108. https://doi.
org/10.1530/JOE-12-0057
Sahlmann, C., Gu, J., Kortner, T. M., Lein, I., Krogdahl, Å., & Bakke, A. M.
(2015). Ontogeny of the digestive system of Atlantic salmon (Salmo
salar L.) and effects of soybean meal from start-feeding. PLoS One,
10(4), e0124179.
Sakamoto, T., & Hirano, T. (1991). Growth hormone receptors in the liver
and osmoregulatory organs of rainbow trout: Characterization and
dynamics during adaptation to seawater. Journal of Endocrinology,
130(3), 425–433. https://doi.org/10.1677/joe.0.1300425
Sanders, E. J., & Harvey, S. (2004). Growth hormone as an early embry-
onic growth and differentiation factor. Anatomy and Embryology,
209(1), 1–9. https://doi.org/10.1007/s0042​9-004-0422-1
Srichanun, M., Tantikitti, C., Utarabhand, P., & Kortner, T. M. (2013). Gene
expression and activity of digestive enzymes during the larval devel-
opment of Asian seabass (Lates calcarifer). Comparative Biochemistry
and Physiology Part B: Biochemistry and Molecular Biology, 165(1), 1–9.
https://doi.org/10.1016/j.cbpb.2013.02.005
Teles, A., Salas-Leiva, J., Álvarez-González, C. A., & Tovar-Ramírez, D.
(2019). Changes in digestive enzyme activities during early ontogeny
of Seriola rivoliana. Fish Physiology and Biochemistry, 45(2), 733–742.
https://doi.org/10.1007/s1069​5-018-0598-6
Wang, B., Xu, Y., Liu, X., Liu, Q., Liu, Y., Zhang, Y., & Shi, B. (2019).
Molecular characterization and expression profiles of insulin-like
growth factors in yellowtail kingfish (Seriola lalandi) during embry-
onic development. Fish Physiology and Biochemistry, 45(1), 375–390.
https://doi.org/10.1007/s1069​5-018-0570-5
Wen, H., Qi, Q., Hu, J., Si, Y., He, F., & Li, J. (2015). Expression analysis of
the insulin-like growth factors I and II during embryonic and early lar-
val development of turbot (Scophthalmus maximus). Journal of Ocean
University of China, 14(2), 309–316. https://doi.org/10.1007/s1180​
2-015-2401-y
Wood, A. W., Duan, C., & Bern, H. A. (2005). Insulin-like growth factor
signaling in fish. International Review of Cytology, 243, 215–285.
Xu, Y., Zang, K., Liu, X., Shi, B., Li, C., & Shi, X. (2015). Insulin-like growth
factors I and II in starry flounder (Platichthys stellatus): Molecular
cloning and differential expression during embryonic develop-
ment. Fish Physiology and Biochemistry, 41(1), 139–152. https://doi.
org/10.1007/s1069​5-014-0012-y
Yang, G., Chen, B., Sun, C., Yuan, X., Zhang, Y., Qin, J., & Li, W. (2019).
Molecular identification of grouper Igfbp1 and its mRNA expres-
sion in primary hepatocytes under GH and Insulin. General and
Comparative Endocrinology, 281, 137–144. https://doi.org/10.1016/j.
ygcen.2019.06.001
Yom Din, S., Hurvitz, A., Goldberg, D., Jackson, K., Levavi-Sivan, B., &
Degani, G. (2008). Cloning of Russian sturgeon (Acipenser guelden-
staedtii) growth hormone and insulin-like growth factor 1 and their
expression in male and female fish during the first period of growth.
Journal of Endocrinological Investigation, 31, 201–210.
How to cite this article: Zamora-Solís Z, Jiménez-Martínez
LD, Frías-Quintana CA, Álvarez-González CA, Tovar-Ramírez
D, Guerrero-Zarate R. mRNA expression of growth hormone
(GH) and Insulin during the initial ontogeny of tropical gar
larvae (Atractosteus tropicus). Aquac Res. 2020;00:1–10.
https://doi.org/10.1111/are.14906