Received Date : 29-Aug-2018

Revised Date : 14-Jan-2019

Accepted Date : 03-Apr-2019
Accepted Article
Age-induced oxidative stress impairs adipogenesis and thermogenesis in brown fat

Xianwei Cui1,#, Wen Xiao1,2,#, Lianghui You1, Fan Zhang1,3, Xinguo Cao1, Jie Feng1, Dan Shen1, Yun

Li1, Yan Wang1, Chenbo Ji1,*, Xirong Guo1,*

1
Nanjing Maternal and Child Health Medical Institute, Nanjing Maternity and Child Health Care

Hospital, Women's Hospital of Nanjing Medical University, Nanjing, Jiangsu 210004, China.
2
JiangSu Second Normal University, Nanjing, Jiangsu 210013, China.
3
Department of Neonatal Screening, Nantong Maternal and Child Health Hospital, Nantong, Jiangsu

226018, China.

#
Co-first author.

Running title: Oxidative stress contributes to BAT dysfunction

Article type : Original Article

*
To whom correspondence should be addressed: Nanjing Maternity and Child Health Care

Hospital, Women's Hospital of Nanjing Medical University, Nanjing, Jiangsu 210004, China. Phone:

86-25-52226162, Fax: 86-25-52226162. E-mail: xrguo@njmu.edu.cn (Xirong Guo); E-mail:

chenboji@njmu.edu.cn (Chenbo Ji).

This article has been accepted for publication and undergone full peer review but has not
been through the copyediting, typesetting, pagination and proofreading process, which may
lead to differences between this version and the Version of Record. Please cite this article as
doi: 10.1111/febs.14838
This article is protected by copyright. All rights reserved.
 Keywords: aging; ROS; brown fat·dysfunction;·H2O2;·antioxidant
Accepted Article
Abbreviations: White adipose tissue, WAT; Brown adipose tissue, BAT; Uncoupling protein 1, Ucp1;

Reactive oxygen species, ROS; Hydrogen peroxide, H2O2; Stromal vascular fractions cells, SVFs;

Vitamin E, VE; Tandem fluorescent-tagged microtubule-associated light chain 3, mRFP-GFP-LC3;

Chloroquine, CQ; Superoxide dismutase, SOD; Malondialdehyde, MDA; Peptidylprolyl isomerase A,

PPIA; Proliferator-activated receptor gama, PPARγ; CCAAT/enhancer binding protein beta, C/EBPβ;

Sequestosome1/SQSTM1, p62; Peroxisome proliferator activated receptor alpha, Pparα; Peroxisome

proliferator-activated receptor gamma coactivator 1-alpha, Pgc1α; Cytochrome c, Cyt C;

Mitochondrial DNA, mtDNA; Cell death-inducing DFFA-like effector alpha, Cideα; Fatty acid

binding protein 4, Fabp4; Superoxide anions, O2-.

Abstract

It is well-established that the mass and function of human brown adipose tissue (BAT) declines with

age. A key factor involved in age-related impairment of BAT is oxidative stress; however, there is a

paucity of studies to date that have explored this relationship. Here, we characterized the age-related

molecular and functional alterations in BAT in vivo in mice of different ages, and treated human

brown adipocytes with H2O2 to dissect the direct effect of oxidative stress in vitro. We further

explored the structural and functional changes of BAT in an oxidative-stress-induced mouse model of

aging. We found that the progressive deterioration of BAT was linked to oxidative stress, and

observed that the adipogenesis and thermogenic program were significantly impaired upon H 2O2

treatment in vitro. Moreover, antioxidant supplementation (e.g. vitamin E) attenuated oxidative stress

and rescued BAT activity decline, suggesting that age-related injury in BAT function can be partly

This article is protected by copyright. All rights reserved.

 alleviated by antioxidant treatment. Finally, we found that oxidative-stress-induced BAT dysfunction

is linked to the enhancement of autophagy. These results point to oxidative stress as being an
Accepted Article
important factor in age-dependent functional impairment of BAT.

Introduction

Brown adipose tissue (BAT) is essential to the process of thermoregulation in mammals. In contrast to

white adipose tissue (WAT), which functions largely as a lipid storage depot, BAT is characterized by

the presence of multiple, small lipid droplets and a higher number of mitochondria [1-3]. BAT is

abundant in newborns, wherein it is especially important for maintaining body heat in colder

environments [4]. The high expression levels and inducibility of uncoupling protein 1 (UCP1) enables

BAT to efficiently dissipate energy stored as triglycerides in the form of heat [1, 5]. Although it is

well-known that both the activity and mass of BAT gradually decreases with age [6], the

age-dependent decline of BAT has not been well-studied. The discovery of active BAT deposits in

human adults [7, 8] led researchers to postulate that BAT may be a promising therapeutic target in the

treatment of obesity [9, 10]. Contemporary studies have demonstrated that the mass of BAT is

inversely correlated with body mass index [7], and approximately 50 g of BAT contributes to 3–5% of

the basal metabolic rate in humans [2]. Transplantation of BAT could significantly reduce total body

fat and improve metabolic homeostasis both in diet-induced and leptin-deficient obese mice [11],

offering further proof for the therapeutic potential of BAT in the treatment of obesity.

Recent studies have identified several major factors that contribute to the aging-related impairment of

BAT: (i) defects at the stem and/or progenitor cell level, (ii) mitochondrial dysfunction, (iii) impaired

ability to sense sympathetic tone, and (iv) endocrine changes that involve hormones and inflammatory

This article is protected by copyright. All rights reserved.

 cytokines [12, 13]. In general, mitochondrial dysfunction is associated with a decrease in fuel

oxidation and an increase in the production of reactive oxygen species (ROS) [14, 15]. This
Accepted Article
accumulation of ROS leads to cellular oxidative stress, resulting in direct or indirect macromolecular

damage to proteins, nucleic acids, and lipids that further exacerbates mitochondrial dysfunction [16].

Thus, ROS accumulation is one viable theory to explain the age-related gradual decline of BAT in

humans. However, the potential role of ROS-induced oxidative stress in BAT during aging remains

unclear. We aimed to study the age-dependent decrease in the activity and mass of BAT through

analyzing the effects of oxidative stress on the adipogenic and thermogenic capabilities of this tissue.

In this study, we investigated the molecular and functional alterations that occur in the BAT of mice

at different ages and found that the progressive deterioration of BAT was linked to oxidative stress.

We also found that oxidative stress impaired both adipogenesis and thermogenesis in BAT in vitro

and in vivo. We demonstrated that antioxidant treatment rescued the oxidative stress phenotype and

alleviated its induced BAT activity deterioration. Finally, we found that autophagy was linked to the

H2O2-induced impairment of BAT functions.These data indicated that the age-related dysfunction of

BAT may be attributed to ROS accumulation and subsequent oxidative stress.

Results

Brown fat dysfunction is accompanied by oxidative stress with aging

Mice of at 6 weeks, 6 months, and 20 months of age were used to explore the link between BAT

dysfunction and oxidative stress during aging. Thermogenic genes, as well as mitochondrial DNA

(mtDNA) markers, were measured by real-time PCR (RT-PCR). A significant decrease in Ucp1,

This article is protected by copyright. All rights reserved.

 peroxisome proliferator activated receptor alpha (Pparα), peroxisome proliferator-activated receptor

gamma coactivator 1-alpha (Pgc1α), and cytochrome c (Cyt C) expression levels was observed with
Accepted Article
increasing age (Fig. 1A). Additionally, immunohistochemical analysis revealed a substantial decrease

in UCP1 staining (Fig. 1B), suggesting that there is gradual decline in the thermogenic capability of

BAT with aging. As shown in Fig. 1C, the mtDNA content was also reduced with aging. Notably, the

production of malondialdehyde (MDA), a marker of oxidative stress, was significantly increased in

BAT in aging mice (Fig. 1D). Antioxidant enzymes such as superoxide dismutase (SOD) play a key

role in diminishing oxidative stress. Given that oxidative stress was increased with age, we

hypothesized that SOD activity would be decreased in these cells. A comparison between mice of

different ages revealed a significant decrease in SOD activity in BAT of aging mice (Fig. 1E),

suggesting that the level of intracellular ROS increases with age. Together, these data indicate that the

decline in BAT function is associated with the oxidative stress that occurs during the aging process,

suggesting that oxidative stress is linked to the age-related dysfunction of BAT.

H2O2-induced oxidative stress impairs adipogenesis and thermogenesis of preadipocytes from

fetal BAT

H2O2 is a major chemical messenger, and when present in high enough concentrations, it can induce

oxidative stress in cells. To further explore the effect of oxidative stress on BAT function, stromal

vascular fractions cells (SVFs) isolated from fetal BAT were treated with either 0, or 0.05, 0.1 mM

H2O2 during adipose differentiation, and these concentrations had no significant effects on cell

viability (Fig. 2A). There was a significant increase in ROS content in brown adipocytes after H2O2

stimulation (Fig. 2B). Oil Red O staining indicated that chronic oxidative stress resulted in a

This article is protected by copyright. All rights reserved.

 significant reduction in the size of the lipid droplets present in the cells (Fig. 2C), although we did not

observe a visible reduction in lipid droplet in cells following 0.05 mM H2O2 exposure. Similarly,
Accepted Article
triacylglycerol content gradually decreased with increasing concentrations of H2O2 (Fig. 2D). As

shown in Fig. 2E, chronic oxidative stressinhibited the expression of peroxisome

proliferator-activated receptor gama (Pparγ), CAAT/enhancer binding protein beta (C/ebpβ), cell

death-inducing DFFA-like effector alpha (Cideα), and fatty acid binding protein 4 (Fabp4) in

differentiated brown adipocytes. Consistent with the RT-PCR data, the protein levels of both PPARγ

and C/EBPβ were down-regulated (Fig. 2F). Collectively, these data indicate that chronic oxidative

stress impairs adipogenesis of human brown preadipocytes.

We further investigated the impact of chronic oxidative stress on the thermogenic program in SVFs

isolated from fetal BAT. RT-PCR analyses indicated that chronic oxidative stress reduced the

expression levels of thermogenic genes, such as Ucp1, Pparα, Pgc1α, and Cyt C, in a dose-dependent

manner (Fig. 3A). Consistent with these results, the protein level of UCP1 was also gradually

decreased with the accumulation of H2O2 (Fig. 3B). We next used transmission electron microscopy to

determine the effects of oxidative stress on the morphology and number of mitochondria in brown

adipocytes. The number and size of mitochondria were declined in the cell groups treated with either

0.1 or 0.25 mM H2O2 (Fig. 3C). Consistent with the observed morphologic changes, mtDNA copy

numbers were also markedly reduced in brown adipocytes post H2O2 treatment (Fig. 3D). Taken

together, our findings strongly suggest that chronic oxidative stress impairs brown adipocyte

thermogenesis, and the impact of H2O2 on the brown thermogenic program may be dependent on the

inhibiting effect of H2O2 on adipocyte differentiation.

This article is protected by copyright. All rights reserved.

 Effect of H2O2-induced oxidative stress on mature human brown adipocytes

The impairment of thermogenesis in brown adipocytes upon H2O2 treatment may be caused indirectly
Accepted Article
as an effect of poor cell differentiation or directly by the disruption of the BAT thermogenic program.

To determine the cause, we analyzed the effects of H2O2 on mature brown adipocytes. No significant

changes in the cell morphology, lipid accumulation and levels of adipogenic markers were observed

after 12 h of H2O2 stimulation (Fig. 4A-C). However, the mRNA expression level of Ucp-1 was

significantly decreased post 0.1 mM H2O2 treatment in mature human brown adipocytes (Fig. 4D).

Additionally, transmission electron microscopy revealed that both the number and the size of the

mitochondria were decreased in the mature brown adipocytes after 0.1 mM H2O2 treatment (Fig. 4E).

Similarly, these cells exhibited a decline in the mtDNA content (Fig. 4F). These data suggest that

H2O2 treatment does not affect the lipid content in these cells, but rather directly impairs the

thermogenic program in mature brown adipocytes.

Vitamin E supplementation alleviates the oxidative stress-induced brown adipocytes

dysfunction in vitro

Vitamin E (VE) is well-known for its antioxidant properties [17]. We hypothesized that treatment

with VE could lower the amount oxidative stress, therefore enhancing adipogenesis and restoring

mitochondrial function in vitro. To determine whether VE could prevent the oxidative stress-induced

dysfunction of human brown adipocytes, SVFs were incubated with 30 μM VE prior to treatment with

0.1 mM H2O2. Although we observed no significant changes in adipogenesis and thermogenesis of

cells treated with VE along, the brown adipocyte dysfunction induced by H2O2 treatment indeed can

be alleviated by supplementation with VE. Oil Red O staining revealed that lipid accumulation in the

This article is protected by copyright. All rights reserved.

 differentiated adipocytes was significantly increased in the VE-treated group compared with the group

exposed to H2O2 alone (Fig. 5A). Similarly, an elevation in triacylglycerol content was observed in the
Accepted Article
VE-treated group (Fig. 5B). Consistent with enhanced adipogenic differentiation, VE supplementation

showed significant protective effects on both mitochondrial morphology and mtDNA content (Fig. 5C

and D). Furthermore, VE significantly inhibited the H2O2-induced down-regulation of key genes

implicated in adipogenesis and thermogenesis (Fig. 5E). Collectively, these results indicate that the

H2O2 treatment inducedbrown adipocyte dysfunction can be alleviated by supplementation with VE.

VE supplementation reduces oxidative stress and improves BAT function in mouse aging model

D-galactose is a reducing sugar that is converted into aldose, H2O2, and superoxide anions (O2-) [18].

The release of ROS from D-galactose metabolism results in oxidative stress, and as such, is a useful

tool in modeling the normal aging process in mice. Therefore, we assessed the effects

D-galactose-induced aging on the levels of oxidative stress and function of BAT, as well as

determined whether VE supplementation could rescue the BAT impairment. MDA levels in the serum

and BAT of the D-galactose- group were significantly higher than those of the control group, and VE

supplementation recovered these levels (Fig. 6A and B). Conversely, the decrease in SOD activity was

attenuated by VE treatment in both serum and BAT (Fig. 6C and D).

To determine how oxidative stress correlates to BAT dysfunction in the D-galactose-induced aging

mouse model, we measured the changes in mtDNA copy numbers and expression of brown fat

markers in these mice. As shown in Fig. 6E, mtDNA copy numbers decreased significantly in the

D-galactose model mice, and this effect was reversed in mice treated with VE. At the molecular level,

This article is protected by copyright. All rights reserved.

 VE supplementation relieved D-galactose induced suppression of adipogenic and thermogenic genes

(Fig. 6F). Finally, immunohistochemical analysis revealed that VE supplementation to the D-galactose
Accepted Article
model mice restored UCP1 expression (Fig. 6G). Taken together, these data suggest that oxidative

stress contributes to brown fat dysfunction in the mouse aging model, and administration of VE can

rescue its impairment.

Autophagy is involved in H2O2-induced oxidative stress

Previous studies suggest that autophagy could ameliorate oxidative stress through the nonselective

removal of damaged proteins and organelles [19]. To determine whether autophagy is involved in

H2O2-induced oxidative stress in human brown adipocytes, we examined the expression of autophagy

markers through western immunoblotting. A marked increase in the conjugated form of

microtubule-associated light chain 3 (LC3), LC3-II, was observed in cells treated with 0.1 mM H2O2

concurrently with a decrease in the protein accumulation of sequestosome1/SQSTM1 (the homolog of

p62) (Fig. 7A), suggesting an enhancement in autophagic flux. We then used the tandem

fluorescent-tagged LC3 (mRFP-GFP-LC3) to monitor the synthesis of both autophagosomes and

autolysosomes. As shown in Figure 7B, there was an increase in the number of autophagosomes

(yellow puncta) and autolysosomes (red puncta) in cells treated with of H2O2, especially the

red-fluorescent puncta. These results suggest that H2O2-induced oxidative stress could induce

autophagy in human brown adipocytes. However, these puncta significantly decreased in the presence

of chloroquine (CQ) (Fig. 7B), a well-known inhibitor of autophagasome-lyosome fusion. In addition,

the mRFP-EGFP-LC3 plasmid-transfected primary preadipocytes that exposed to CQ along led to the

This article is protected by copyright. All rights reserved.

 production of both red and green fluorescence producing a yellow overlay (Fig. 7B), indicating the

inhibition of autophagosome-lysosome fusion.

Accepted Article
We then sought to explore the function of H2O2-induced autophagy in brown adipocyte differentiation

and thermogenesis through studies with a pharmacological intervention. Treatment of brown

adipocytes with CQ during adipogenic differentiation and post-H2O2 stimulation resulted in

morphologic changes to lipid accumulation, which is consistent with the reduced triglyceride content

previously observed (Fig. 7C and D). As shown in Fig. 7E, the copy number of mtDNA was also

restored in the presence of CQ. Consistent with the attenuation of adipogenic differentiation and

thermogenesis, the expression levels of adipogenic and thermogenic genes were significantly

increased in the presence of CQ (Fig. 7F). Taken together, these data suggest that autophagy may

contribute to the H2O2-induced dysfunction of brown fat.

Discussion

Global prevalence of obesity has dramatically increased over the past several decades and has become

a widespread public health problem [20]. An imbalance between calorie intake and consumption is the

primary etiology of obesity. BAT, the major organ involved in non-shivering thermogenesis, is

thought to contribute to systemic metabolism, due to its high energy expenditure [2]. Several studies

have indicated that BAT is critical for metabolic control and weight regulation in adults [11]. Obesity

is frequently accompanied by an increase in BAT inflammation and oxidative damage [21]. While

aging is associated with a reduction in BAT mass and/or its metabolic activity, it may be the loss of

the energy-expending capacity of BAT that contributes to metabolic disorders with advancing age

This article is protected by copyright. All rights reserved.

 [22]. Surprisingly, only a handful of studies have attempted to shed light onto the involvement of

BAT dysfunction with age-related metabolic diseases [6, 15]. A better understanding of age-related
Accepted Article
BAT decline may reveal feasible therapeutic strategies for metabolic disorders.

Aging results in the gradual decline in physiological function. Moreover, aging is closely associated

with chronic diseases, including obesity and diabetes. It is plausible that there may be considerable

overlap between age-related pathways and metabolic signaling [23]. Oxidative stress is caused by an

imbalance between the production of ROS and the ability to scavenge ROS by endogenous

antioxidants, and it is responsible for the tissue and cellular damage observed during aging. [16].

Oxidative stress results in the direct or indirect macromolecular damage and is implicated in a variety

of diseases, such as obesity and diabetes. There is a large body of research suggesting that there is a

causal relationship between oxidative stress and BAT dysfunction. For example, Lopez-Torres et. al.

have reported a significant increase in the antioxidant enzymes in the BAT of 3- to 9-month-old rats

[15]. However, direct evidence of oxidative stress impairing brown adipocyte function has not been

reported. Here, we investigated the relationship between oxidative stress and the progressive decline

in BAT function that occurs with increased age in mice. Moreover, we examined the oxidative

stress-induced functional and molecular alterations in BAT both in vivo and in vitro and explored a

probable mechanism by which this occurs.

BAT is characterized by a large number of mitochondria, as well as the ability to dissipate energy as

heat, i.e., thermogenesis. The progressive decline of mitochondrial function is a common phenomenon

that is correlated with increasing age [12]. Mitochondrial dysfunction could lead to a reduction in the

This article is protected by copyright. All rights reserved.

 fuel oxidation and increased levels of ROS, resulting in the accumulation of oxidative stress with

aging [24]. ROS accumulation may inhibit the BAT thermogenic program, and this may be one of the
Accepted Article
mechanisms by which aging and metabolic pathologies interfere with BAT function. Consistent with

these theories, our findings showed that the expression level of thermogenic genes was decreased with

advancing age, while the oxidative stress level was significantly increased. These results indicate that

the structural and molecular alterations in BAT are associated with the oxidative stress that develops

with aging.

Using a H2O2-induced oxidative stress model [25], we explored the functional adipogenic and

thermogenic abnormalities of brown adipocytes in response to oxidative stress in vitro. We observed

that the accumulation of lipids, mitochondrial number and size, and expression levels of

corresponding genes were significantly diminished post-H2O2 treatment in a dose-dependent manner.

The impact of H2O2 on the BAT thermogenic program may be dependent on the inhibitory effect of

H2O2 on adipocyte differentiation. We further investigated the structural and functional changes in

BAT in vivo using an oxidative stress-induced aging mouse model. It is generally accepted that the

supplementation of antioxidants may protect cells from oxidative stress-induced injury [26, 27]. VE is

a potent, lipid-soluble antioxidant that can protect against oxidative stress. Previous research has

demonstrated that VE supplementation was able to decrease inflammation and oxidative stress, as

well as improve the metabolic phenotype in obesity [17]. In this study, we revealed that VE

supplementation attenuated the sharp decline of BAT activity induced by oxidative stress. These data

together suggest that oxidative stress contributes to the aging-associated BAT dysfunction at both the

cellular and molecular levels.

This article is protected by copyright. All rights reserved.

 Autophagy is a nonselective pathway by which cytosolic organelles and proteins are degraded by the

lysosome. More recent studies have investigated the importance of autophagy in the regulation of
Accepted Article
adipogenesis, in addition to its fundamental role in regulating nutrient supply and cell death [19].

Depletion of critical autophagy genes such as autophagy-related 7 (Atg7) resulted in inhibition of

3T3-L1 preadipocyte differentiation in vitro and a marked decrease in WAT mass in vivo [28].

Notably, an induction of BAT-like adipocyte development in WAT was observed in Atg7 knockout

mice [28]. Pharmacological inhibition of autophagy by systemic administration of CQ reduces the

severity of high-fat diet-induced obesity and its metabolic consequences in mice [29]. Moreover, cold

induced-autophagy in proopiomelanocortin neurons activates lipophagy in BAT in mice [30]. All of

these data indicate that autophagy is implicated in the pathogenesis of obesity through the regulation

of adipogenic differentiation. Additionally, there is a growing consensus that ROS generated in

oxidative stress acts as an early inducer of autophagy [31, 32]. H2O2 is proposed to initiate autophagy

directly via the regulation of AMP-activated protein kinase (AMPK). In light of these findings, we

speculated that the oxidative stress-induced functional decline of BAT with aging may be linked to

autophagy in a cell-autonomous manner.

We have shown that autophagy is activated in human brown adipocytes treated with H2O2. As

expected, we observed an attenuation of the H2O2-induced functional decline in BAT post-CQ

administration.In contrast, previous studies have reported that thermogenic activation mediated by

noradrenaline or cAMP results in the striking suppression of autophagic activity in BAT [30, 33].

Specifically, beige adipocyte maintenance is tightly coupled to mitochondrial clearance, and the

process of autophagy is crucial for mitochondrial clearance during the beige-to-white adipocyte

This article is protected by copyright. All rights reserved.

 transition [34]. These results indicated that there may be a close relationship between autophagy and

BAT energy metabolism.

Accepted Article
In summary, we examined the molecular alterations and histological features in BAT in mice of

different ages, as well as determined the impact of H2O2 on adipogenesis and thermogenesis in human

brown adipocytes. The age-related deterioration in BAT function can be reversed to a substantial

degree by VE supplementation. Mechanistically, the H2O2-induced decline in BAT function may be

due to the increase in autophagic activity. Thus, our findings will provide a better understanding of

BAT dysfunction and can be used to develop treatment strategies to prevent aging-related obesity and

other metabolic abnormalities. Further experiments will be necessary to determine the direct target by

which oxidative stress leads to BAT dysfunction with aging.

Materials and Methods

Primary brown adipocyte cultures and differentiation

SVFs containing human primary preadipocytes were isolated from fetal interscapular BAT necropsies

as our previous research described [35, 36]. Samples were minced and digested in a solution

consisting of 1% collagenase II (Sigma-Aldrich,St. Louis, MO, USA), 1% BSA and 1% PBS by

gentle shaking for 1 h at 37 oC. After digestion, the suspension was filtered through cell strainer and

then centrifuged 15 minutes at 500 × g. SVFs were maintained in DMEM/F12 medium (Thermo

Fisher Scientific, Waltham, MA, USA) containing 10% fetal bovine serum and human recombinant

basic fibroblast growth factor (20 ng/ml). When adipocytes reached confluence, differentiation was

induced by DMEM/F12 medium containing 0.5 mM 3-isobutyl-1-methylxanthine (Sigma-Aldrich),

This article is protected by copyright. All rights reserved.

 1.0 mM dexamethasone (Sigma-Aldrich), 1.0 mM rosiglitazone (Sigma-Aldrich) and 1.0 nM

triiodothyronine (Sigma-Aldrich). After 3 days induction, cells were switched to maintenance medium
Accepted Article
containing DMEM/F12, 5.0 μg/ml insulin and 1.0 nM triiodothyronine until fully differentiated. To

examine the effects of H2O2 (Sigma-Aldrich), the experimental groups were exposed to 0, 0.05 and

0.1 mM H2O2 during the whole process of differentiation until cells were harvested. To rescue cells

from the H2O2 induced oxidative stress, SVFs were pre-treated with 30 μM VE (T3634,

Sigma-Aldrich) dissolved in ethanol for 24 h before inducing differentiation. Differentiated

adipocytes were treated with various concentrations of H2O2 for 12 h to see the effect of H2O2 on

mature brown adipocytes. Lentivirus expressing mRFP-GFP-LC3 was purchased from Hanbio. Co.

LTD (Shanghai, China), and infection was conducted before inducing differentiation. To regulate

autophagy induced by 0.1 mM H2O2, CQ (40 μM) was added in maintenance medium and incubated

for 4 days. Cells were harvested and confocal images were obtained after treatment.

Cell viability

The cell viability was evaluated by using Cell Counting Kit-8 (CCK-8, Dojindo Laboratories,

Kumamoto, Japan). In brief, SVFs isolated from fetal BAT were seeded in the 96-well plates at the

density of 2 × 103 per well. H2O2 was introduced to cells with different test concentrations (0 mM,

0.05 mM and 0.1 mM) in culture medium. After treatment for 0-72 h, CCK-8 solution was added to

each well and incubated for an additional 3 h at 37 oC. The absorbance at 450 nm was determined

using fluorescence multimode plate reader (Synergy 4, BioTek instruments, Inc., USA).

This article is protected by copyright. All rights reserved.

 Content of reactive oxygen species

The content of ROS was tested by ROS Detection Kit (KeyGEN BioTECH, Nanjing, China). The
Accepted Article
probe DCFH-DA was directly located into adherent cells and observed by a fluorescence microscope

(Imager. A2; Zeiss, Oberkochen, Germany). The ROS could emit green fluorescence at 488 nm.

Oil red O staining and triglyceride content

Cells were washed with PBS and fixed in 3.7% formaldehyde for 20 min. Oil Red O (0.3% in

isopropanol) was diluted with double distilled water (2:3) , filtrated by a 0.22 µm strainer and

incubated for 30 min at 37 oC. Then cells were washed twice with water and photographed by light

microscopy. Triglyceride content was measured using a triglyceride assay kit (Applygen

Technologies Inc, Beijing, China) at 550 nm. Briefly, cells were washed with PBS and lysed with

lysis buffer for 30 min at room temperature and then incubated at 70 oC for 10 min. After incubation,

the suspension was added in the working solution according to the manufacturer’s instructions and

normalized to protein content.

Mitochondrial DNA contents

Total DNA were isolated from BAT or SVFs using a QIAamp DNA Mini Kit (QIAGEN, Germany).

Mitochondrial DNA contents were measured using RT-PCR analysis of total DNA as previous

described, and 18S rRNA was selected as the internal control [37]. Primers for mitochondrial DNA

markers quantification were listed in Table 1.

This article is protected by copyright. All rights reserved.

 Animal studies

Male C57BL/6J mice were purchased from Model Animal Research Center of Nanjing University and
Accepted Article
housed in a light/dark 12 h:12 h cycle with unrestricted access to standard food and water. Mice at age

of 6-week old were randomly divided into 3 groups: (1) Normal control group, (2) D-galactose model

group, (3) D-galactose + VE group, consists 6 animals in each. In the D-galactose model group, mice

were injected subcutaneously with D-galactose (100 mg/kg) daily for six weeks to induce subacute

aging model [38]. These injected with equivalent normal saline subcutaneously were served as control.

In the D-galactose + VE group, since 8 days of D-galactose injection, VE (100 mg/kg/day) was

injected intraperitoneally for next 35 days. While, all the normal control group, mice were treated

with the same volume saline. Mice were weighted and sacrificed at the end of treatment, and

interscapular BAT and blood samples were immediately collected for experiments. All animal

procedures were conducted in conformity with the Guide for the Care and Use of Laboratory Animals

published by the U.S. National Institutes of Health (NIH Publication number 85–23, revised 1996)

and the approved regulations set by the Nanjing Medical University Committee on Care and Use of

Animals (permit number IACUC-1601186).

Detection of oxidative stress-associated biological indicators

Oxidative stress was measured by determining SOD activity and the level of MDA. Serum was

prepared from the blood by centrifugation at 1000 × g at 4 oC for 10 min. BAT (100 mg) was

homogenized in ice-cold PBS, and then the homogenate was centrifuged at 12000 × g at 4 oC for 5

min, and supernatant was collected for further assay. The commercially available MDA assay kit

(BioVision) was used to detect the MDA level according to the manufacturer’s instructions. SOD

This article is protected by copyright. All rights reserved.

 activity was measured using a SOD assay kit (BioVision, USA) according to the manufacture’s

instruction.
Accepted Article
Histology and immunohistochemistry analysis

BAT samples were fixed with 4% paraformaldehyde, embedded in paraffin, and then cut into 5-mm

thick sections. Then sections were mounted on glass slides and stained with hematoxylin & eosin

(H&E). For immunohistochemistry, slides were incubated with primary antibodies against UCP1

(1:500; Abcam, ab10983, Cambridge, United Kingdom). Immunostaining was performed using

horseradish peroxidase tagged secondary antibody complex in combination with the

Diaminobenzidine Detection Kit (EliVision, Incheon, Korea). Subsequently, hematoxylin was used

for counterstaining. Slides had the primary antibody replaced by the 1% bovine serum albumin served

as negative control. All pictures were captured by using a fluorescence microscope (Zeiss, Imager. A2,

Oberkochen, Germany).

Gene expression

Total RNA from tissue or cells were extracted using TRIzol reagent (Thermo Fisher Scientific, USA).

Purity and concentration of total RNA were quantified using the BioDrop Duo. 500 ng total RNA

were reverse transcribed using PrimeScriptTM RT Master Mix (Takara, Japan) and diluted to a final

volume of 50 μl. RT-PCR was performed by the ViiA 7 Real-Time PCR system (Thermo Fisher

Scientific, USA) using the SYBR Green method. The reactions were performed as follows: initial

denaturing step at 95 oC for 10 min and 40 cycles of 95 oC for 15 sec, 56 oC for 30 sec and 72 oC for 1

min. Relative mRNA expression was normalized to PPIA (Peptidylprolyl isomerase A) and quantified

on the cycle threshold (Ct) values. The primer sequences for the genes were presented in Table 1.

This article is protected by copyright. All rights reserved.

 Western blotting

Differentiated brown adipocytes were harvested in RIPA buffer (Beyotime, China) containing a
Accepted Article
Protease Inhibitor Cocktail (Roche, Germany) and quantified by BCA Protein Assay Kit (Thermo

Fisher Scientific, Rockford, USA). 30 ng of protein were subjected to 10% SDS-PAGE gel and then

transferred onto a PVDF membrane. Membranes were blocked in 5% milk in Tris-buffered saline with

0.2% Tween 20 and incubated overnight with primary antibodies. Proteins were visualized using the

FluorChem M system (Proteinsimple, USA). The antibody against PPARγ (2435), C/EBPβ (3087S),

p62 (5114) and LC3-I/II (4108) were purchased from Cell Signaling Technology. UCP1 (Ab10983)

and GAPDH (Ab10983) were obtained from Abcam.

Transmission electron microscope

To assess the effects of oxidative stress on mitochondria number and morphology in brown adipocytes,

we used the transmission electron microscopy to observe these changes. Firstly, differentiated cells

were fixed with 2.5% glutaraldehyde made up with 0.1 mol/L sodium cacodylate buffer overnight at 4

o
C, post-fixed with osmium tetroxide (20 g/L) and dehydrated through an alcohol series (30%, 50%,

80%, 90%, and 100%) for 2 h. Thereafter, the cells were embedded in the Spurr's resin (Agar

Scientific, Essex, UK) and then sectioned. Sections were picked up on Formvar and carbon-coated

copper grids, contrasted with 3% uranyl acetate and lead citrate for 6 min. The sections were observed

in an EM-100S transmission electron microscope (JEOL, Tokyo, Japan), and images were acquired

digitally.

This article is protected by copyright. All rights reserved.

 Statistical analysis

Results were presented as mean ± SD of three independent experiments. Significant differences

Accepted Article
between groups (*P<0.05, **
P<0.01) were analyzed by Student’s t-test or one-way ANOVA when

appropriate.

Acknowledgements

This work was funded by a grant from the National Natural Science Foundation of China (Grant No.

81770837, 81770866, 81700744, 81670773, 81600687, 81471086 and 81800689), Jiangsu Provincial

Medical Innovation Team (CXTDA2017001), Jiangsu Provincial Medical Youth Talent (Grant No.

QNRC2016109 and QNRC2016108), Jiangsu Provincial Key Research and Development Program

(Grant No. BE2016619, BE2018616 and BE2018614), the Six Talent Peaks Project in Jiangsu

Province (YY-081 and YY-084), Nanjing Technological Development Program (Grant No.

201715054, 201803013 and 201803012), 333 High Level Talents Training Project of Jiangsu

Province and Nanjing Medical Science and Technique Development Foundation (Grant No.

YKK17180).

Author Contributions

C.B.J. and X.W.C. designed the study and wrote the manuscript. Y.L., W.X., F.Z., X.G.C., J.F., D.S.

and Y.W. performed the experiments and analyzed the data. L.H.Y., X.R.G., X.W.C. and C.B.J.

provided the funding and approved the final version of the manuscript.

Conflicts of interest

The authors declare no conflict of interest.

This article is protected by copyright. All rights reserved.

 References:
1. Symonds, M. E., Pope, M. & Budge, H. (2015) The Ontogeny of Brown Adipose Tissue, Annual
review of nutrition. 35, 295-320.
Accepted Article
2. Poekes, L., Lanthier, N. & Leclercq, I. A. (2015) Brown adipose tissue: a potential target in the
fight against obesity and the metabolic syndrome, Clinical science. 129, 933-49.
3. Poher, A. L., Altirriba, J., Veyrat-Durebex, C. & Rohner-Jeanrenaud, F. (2015) Brown adipose
tissue activity as a target for the treatment of obesity/insulin resistance, Frontiers in physiology. 6, 4.
4. Rogers, N. H. (2015) Brown adipose tissue during puberty and with aging, Annals of medicine. 47,
142-9.
5. Zingaretti, M. C., Crosta, F., Vitali, A., Guerrieri, M., Frontini, A., Cannon, B., Nedergaard, J. &
Cinti, S. (2009) The presence of UCP1 demonstrates that metabolically active adipose tissue in the
neck of adult humans truly represents brown adipose tissue, FASEB journal : official publication of
the Federation of American Societies for Experimental Biology. 23, 3113-20.
6. Schosserer, M., Grillari, J., Wolfrum, C. & Scheideler, M. (2018) Age-Induced Changes in White,
Brite, and Brown Adipose Depots: A Mini-Review, Gerontology. 64, 229-236.
7. Virtanen, K. A., Lidell, M. E., Orava, J., Heglind, M., Westergren, R., Niemi, T., Taittonen, M.,
Laine, J., Savisto, N. J., Enerback, S. & Nuutila, P. (2009) Functional brown adipose tissue in healthy
adults, The New England journal of medicine. 360, 1518-25.
8. Cypess, A. M., Lehman, S., Williams, G., Tal, I., Rodman, D., Goldfine, A. B., Kuo, F. C., Palmer,
E. L., Tseng, Y. H., Doria, A., Kolodny, G. M. & Kahn, C. R. (2009) Identification and importance of
brown adipose tissue in adult humans, The New England journal of medicine. 360, 1509-17.
9. Saito, M., Okamatsu-Ogura, Y., Matsushita, M., Watanabe, K., Yoneshiro, T., Nio-Kobayashi, J.,
Iwanaga, T., Miyagawa, M., Kameya, T., Nakada, K., Kawai, Y. & Tsujisaki, M. (2009) High
incidence of metabolically active brown adipose tissue in healthy adult humans: effects of cold
exposure and adiposity, Diabetes. 58, 1526-31.
10. van Marken Lichtenbelt, W. D., Vanhommerig, J. W., Smulders, N. M., Drossaerts, J. M.,
Kemerink, G. J., Bouvy, N. D., Schrauwen, P. & Teule, G. J. (2009) Cold-activated brown adipose
tissue in healthy men, The New England journal of medicine. 360, 1500-8.
11. Stanford, K. I., Middelbeek, R. J., Townsend, K. L., An, D., Nygaard, E. B., Hitchcox, K. M.,
Markan, K. R., Nakano, K., Hirshman, M. F., Tseng, Y. H. & Goodyear, L. J. (2013) Brown adipose
tissue regulates glucose homeostasis and insulin sensitivity, The Journal of clinical investigation. 123,
215-23.
12. Graja, A. & Schulz, T. J. (2015) Mechanisms of aging-related impairment of brown adipocyte
development and function, Gerontology. 61, 211-7.
13. Stout, M. B., Justice, J. N., Nicklas, B. J. & Kirkland, J. L. (2017) Physiological Aging: Links
Among Adipose Tissue Dysfunction, Diabetes, and Frailty, Physiology. 32, 9-19.
14. Murphy, M. P., Holmgren, A., Larsson, N. G., Halliwell, B., Chang, C. J., Kalyanaraman, B.,
Rhee, S. G., Thornalley, P. J., Partridge, L., Gems, D., Nystrom, T., Belousov, V., Schumacker, P. T. &
Winterbourn, C. C. (2011) Unraveling the biological roles of reactive oxygen species, Cell
metabolism. 13, 361-366.
15. Lopez-Torres, M., Perez-Campo, R. & Barja de Quiroga, G. (1991) Aging in brown fat:
antioxidant defenses and oxidative stress, Mechanisms of ageing and development. 59, 129-37.
16. Shadel, G. S. & Horvath, T. L. (2015) Mitochondrial ROS signaling in organismal homeostasis,
Cell. 163, 560-9.

This article is protected by copyright. All rights reserved.

 17. Alcala, M., Sanchez-Vera, I., Sevillano, J., Herrero, L., Serra, D., Ramos, M. P. & Viana, M.
(2015) Vitamin E reduces adipose tissue fibrosis, inflammation, and oxidative stress and improves
metabolic profile in obesity, Obesity. 23, 1598-606.
Accepted Article
18. Li, J., Cai, D., Yao, X., Zhang, Y., Chen, L., Jing, P., Wang, L. & Wang, Y. (2016) Protective
Effect of Ginsenoside Rg1 on Hematopoietic Stem/Progenitor Cells through Attenuating Oxidative
Stress and the Wnt/beta-Catenin Signaling Pathway in a Mouse Model of d-Galactose-induced Aging,
International journal of molecular sciences. 17.
19. Zhang, Y., Zeng, X. & Jin, S. (2012) Autophagy in adipose tissue biology, Pharmacological
research. 66, 505-12.
20. Collaboration, N. C. D. R. F. (2017) Worldwide trends in body-mass index, underweight,
overweight, and obesity from 1975 to 2016: a pooled analysis of 2416 population-based measurement
studies in 128.9 million children, adolescents, and adults, Lancet. 390, 2627-2642.
21. Alcala, M., Calderon-Dominguez, M., Bustos, E., Ramos, P., Casals, N., Serra, D., Viana, M. &
Herrero, L. (2017) Increased inflammation, oxidative stress and mitochondrial respiration in brown
adipose tissue from obese mice, Scientific reports. 7, 16082.
22. Sellayah, D. & Sikder, D. (2014) Orexin restores aging-related brown adipose tissue dysfunction
in male mice, Endocrinology. 155, 485-501.
23. Fusco, D., Colloca, G., Lo Monaco, M. R. & Cesari, M. (2007) Effects of antioxidant
supplementation on the aging process, Clinical interventions in aging. 2, 377-87.
24. Ray, P. D., Huang, B. W. & Tsuji, Y. (2012) Reactive oxygen species (ROS) homeostasis and
redox regulation in cellular signaling, Cellular signalling. 24, 981-90.
25. Zhou, Y. F., Guo, B., Ye, M. J., Liao, R. F. & Li, S. L. (2016) Protective Effect of Rutin Against
H2O2-Induced Oxidative Stress and Apoptosis in Human Lens Epithelial Cells, Current eye research.
41, 933-42.
26. Liu, A., Ma, Y. & Zhu, Z. (2009) Protective effect of selenoarginine against oxidative stress in
D-galactose-induced aging mice, Bioscience, biotechnology, and biochemistry. 73, 1461-4.
27. Ahangarpour, A., Oroojan, A. A. & Heidari, H. (2014) Effects of exendin-4 on male
reproductive parameters of d-galactose induced aging mouse model, The world journal of men's
health. 32, 176-83.
28. Singh, R., Xiang, Y., Wang, Y., Baikati, K., Cuervo, A. M., Luu, Y. K., Tang, Y., Pessin, J. E.,
Schwartz, G. J. & Czaja, M. J. (2009) Autophagy regulates adipose mass and differentiation in mice,
The Journal of clinical investigation. 119, 3329-39.
29. Zhang, C., He, Y., Okutsu, M., Ong, L. C., Jin, Y., Zheng, L., Chow, P., Yu, S., Zhang, M. & Yan,
Z. (2013) Autophagy is involved in adipogenic differentiation by repressesing proteasome-dependent
PPARgamma2 degradation, American journal of physiology Endocrinology and metabolism. 305,
E530-9.
30. Martinez-Lopez, N., Garcia-Macia, M., Sahu, S., Athonvarangkul, D., Liebling, E., Merlo, P.,
Cecconi, F., Schwartz, G. J. & Singh, R. (2016) Autophagy in the CNS and Periphery Coordinate
Lipophagy and Lipolysis in the Brown Adipose Tissue and Liver, Cell metabolism. 23, 113-27.
31. Filomeni, G., De Zio, D. & Cecconi, F. (2015) Oxidative stress and autophagy: the clash
between damage and metabolic needs, Cell death and differentiation. 22, 377-88.
32. Van Erp, A. C., Hoeksma, D., Rebolledo, R. A., Ottens, P. J., Jochmans, I., Monbaliu, D.,
Pirenne, J., Leuvenink, H. G. D. & Decuypere, J. P. (2017) The Crosstalk between ROS and
Autophagy in the Field of Transplantation Medicine, Oxidative medicine and cellular longevity. 2017,

This article is protected by copyright. All rights reserved.

 7120962.
33. Cairó, M., Villarroya, J., Cereijo, R., Campderrós, L., Giralt, M. & Villarroya, F. (2016)
Thermogenic activation represses autophagy in brown adipose tissue, International Journal of Obesity.
Accepted Article
40, 1591-1599.
34. Altshuler-Keylin, S., Shinoda, K., Hasegawa, Y., Ikeda, K., Hong, H., Kang, Q., Yang, Y., Perera,
Rushika M., Debnath, J. & Kajimura, S. (2016) Beige Adipocyte Maintenance Is Regulated by
Autophagy-Induced Mitochondrial Clearance, Cell metabolism. 24, 402-419.
35. Wang, X., You, L., Cui, X., Li, Y., Wang, X., Xu, P., Zhu, L., Wen, J., Pang, L., Guo, X. & Ji, C.
(2018) Evaluation and optimization of differentiation conditions for human primary brown adipocytes,
Scientific reports. 8, 5304.
36. Cui, X., You, L., Li, Y., Zhu, L., Zhang, F., Xie, K., Cao, Y., Ji, C. & Guo, X. (2016) A
transcribed ultraconserved noncoding RNA, uc.417, serves as a negative regulator of brown adipose
tissue thermogenesis, FASEB journal : official publication of the Federation of American Societies for
Experimental Biology. 30, 4301-4312.
37. Xu, F., Zheng, X., Lin, B., Liang, H., Cai, M., Cao, H., Ye, J. & Weng, J. (2016) Diet-induced
obesity and insulin resistance are associated with brown fat degeneration in SIRT1-deficient mice,
Obesity. 24, 634-42.
38. Prakash, A. & Kumar, A. (2013) Pioglitazone alleviates the mitochondrial apoptotic pathway
and mito-oxidative damage in the d-galactose-induced mouse model, Clinical and experimental
pharmacology & physiology. 40, 644-51.

This article is protected by copyright. All rights reserved.

 Table 1. Primer sequences used in this study.
Accepted Article
Primer Sequence Application
F: GCTGTGCAGGAGATCACAGA
Pparγ RT-PCR
R: GGGCTCCATAAAGTCACCAA
F: GACAAGCACAGCGACGAGTA
C/ebpβ RT-PCR
R: AGCTGCTCCACCTTCTTCTG
F: GATGCCCTCGTCATCGCTAC
Cidea RT-PCR
R: GCGTGTTGTCTCCCAAGGTC
F: GGCCAGGAATTTGACGAAGT
Fabp4 RT-PCR
R: ATCCCACAGAATGTTGTAGAGT
F: CTGGAATAGCGGCGTGCTT
Ucp1 RT-PCR
R: AATAACACTGGACGTCGGGC
F: CCCTGCCATTGTTAAGACC
Pparα RT-PCR
R: TCCAAAACGAATCGCGTTGT
F: CTGTGTCACCACCCAAATCCTTAT
Pgc1a RT-PCR
R: TGTGTCGAGAAAAGGACCTTGA
F: GGTGATGTTGAGAAAGGCAAG
Cyt C RT-PCR
R: GTTCTTATTGGCGGCTGTGT
F: TTCATCTGCACTGCCAAGAC
PPIA RT-PCR
R: TCGAGTTGTCCACAGTCAGC
F: TAAACACCCCTCCCCACA
Cyt b mtDNA copy
R: TGTCCTCCGATTCAGGTTAGA
F: CCCTAAAACCCGCCACATCT
ND1 mtDNA copy
R: GAGCGATGGTGAGAGCTAAGGT
F: TAGAGGGACAAGTGGCGTTC
18S rRNA mtDNA copy
R: CGCTGAGCCAGTCAGTGT

This article is protected by copyright. All rights reserved.

Accepted Article

Fig. 1. Brown fat dysfunction is accompanied by oxidative stress with aging

6-week, 6-month, and 20-month-old male C57BL/6J mice were selected for the present study (n=6

per group). The interscapular BAT was carefully dissected to avoid WAT contamination in each

tissue preparation. (A) Changes in the expression levels of thermogenic genes with increased age. (B)

Representative images from UCP1 immunohistochemical staining. (C) Quantification of mtDNA

content in BAT. Cyt b, Cytochrome b; ND1, NADH dehydrogenase subunit 1. Alterations of MDA

content (D) and SOD activity (E) in BAT in mice. MDA, malondialdehyde; SOD, superoxide

**
dismutase. Data were presented as mean ± SD from three independent experiments. P<0.01,

one-way ANOVA analysis.

This article is protected by copyright. All rights reserved.

Accepted Article

Fig. 2. H2O2-induced oxidative stress impairs adipogenesis of preadipocytes from fetal BAT

Three independent brown adipocyte primary cultures were isolated from fetal interscapular BAT to do

one batch of experiments. Cells were treated with indicated different concentrations of H2O2 at the

day 0 of differentiation. (A) Cell viability was determined using a Cell Counting Kit-8. (B) Detection

This article is protected by copyright. All rights reserved.

 of ROS by fluorescence microscope. Magnification：200×. (C) Representative Oil-red-O staining of

differentiated brown adipocytes. Magnification：100×. (D) Triglyceride levels of differentiated brown

Accepted Article
adipocytes. RT-PCR (E) and Western blot analysis (F) of the expression levels of adipogenic markers.

Data were presented as mean ± SD from three independent experiments. *P<0.05 and **P<0.01 versus

0 mM H2O2, unpaired t-tests.

This article is protected by copyright. All rights reserved.

Accepted Article

Fig. 3. H2O2-induced oxidative stress impairs thermogenesis of preadipocytes from fetal BAT

Three independent brown adipocyte primary cultures were isolated from fetal interscapular BAT to do

one batch of experiments. Cells were treated with indicated different concentrations of H2O2 at the

day 0 of differentiation.(A) Relative mRNA expression levels of thermogenic markers in

differentiated brown adipocytes. (B) Western blot analysis of UCP1 protein levels in differentiated

brown adipocytes. (C) Representative images from transmission electron microscopy of differentiated

brown adipocytes. Scale bar, 0.5 µm. (D) Quantification of mtDNA content in differentiated brown

adipocytes. Data were presented as mean ± SD from three independent experiments. *P<0.05 and

**
P<0.01 versus 0 mM H2O2, unpaired t-tests.

This article is protected by copyright. All rights reserved.

Accepted Article

Fig. 4. Effect of H2O2-induced oxidative stress on mature human brown adipocytes

Three independent brown adipocyte primary cultures were isolated from fetal interscapular BAT to do

one batch of experiments. Cells were grown to confluence and then initiated differentiation.

Differentiated adipocytes were treated with indicated different concentrations of H2O2 for 12 h. (A)

This article is protected by copyright. All rights reserved.

 Representative Oil-red-O staining of mature brown adipocytes. Magnification：200×. (B) Triglyceride

levels of mature brown adipocytes. Quantification of the mRNA expression levels of adipogenic
Accepted Article
markers (C) and Ucp1 (D) in mature brown adipocytes. (E) Representative images from transmission

electron microscopy of mature brown adipocytes. Scale bar, 0.5 µm. (F) Quantification of mtDNA

content in mature brown adipocytes. Data were presented as mean ± SD from three independent

experiments. *P<0.05 versus 0 mM H2O2, unpaired t-tests.

This article is protected by copyright. All rights reserved.

Accepted Article

Fig. 5. Vitamin E supplementation alleviates the oxidative stress-induced brown adipocytes

dysfunction in vitro

Three independent brown adipocyte primary cultures were isolated from fetal interscapular BAT to do

one batch of experiments. Cells were incubated with VE prior to the treatment of H2O2. (A)

Representative Oil-red-O staining of differentiated brown adipocytes. Magnification：200×. (B)

Triglyceride levels of differentiated brown adipocytes. (C) Representative images from transmission

electron microscopy of differentiated brown adipocytes. Scale bar, 0.5 µm. (D) Quantification of

mtDNA content in differentiated brown adipocytes. (E) Relative mRNA expression levels of

This article is protected by copyright. All rights reserved.

 adipogenic and thermogenic markers in differentiated brown adipocytes. VE, vitamin E. Data were

presented as mean ± SD from three independent experiments. *P<0.05 and **P<0.01 versus control,
Accepted Article
#
P<0.05 vs. 0.1 mM H2O2, unpaired t-tests.

This article is protected by copyright. All rights reserved.

Accepted Article

Fig. 6. Vitamin E supplementation reduces oxidative stress and improves BAT function in mouse

aging model

6-week-old mice were injected subcutaneously with D-galactose daily to induce subacute aging model

(n=6 per group). VE was injected intraperitoneally for 35 days following 8 days of D-galactose

injection. Forty-2 days later, animal experiments were performed. (A and B) Alterations of MDA

content in the serum and BAT from aging mice models. (C and D) Alterations of SOD activities in the

serum and BAT from aging mice models. (E) Quantification of mtDNA content in BAT. (F) Relative

mRNA expression levels of adipogenic and thermogenic markers in aging mice models. (G)

This article is protected by copyright. All rights reserved.

 Representative images from UCP1 immunohistochemical staining in BAT from aging mice models.

Data were presented as mean ± SD from three independent experiments. *P<0.05 and **P<0.01 versus
Accepted Article
control, #P<0.05 versus D-galactose group, unpaired t-tests.

This article is protected by copyright. All rights reserved.

Accepted Article

Fig. 7. Autophagy is involved in H2O2-induced oxidative stress

(A) Western blot analysis of LC3 and p62 protein levels in differentiated brown adipocytes treated

with 0.1 mM H2O2. (B) Localization of autophagosomes and autolysosomes were using mRFP-GFP

tandem fluorescent-tagged LC3. Primary preadipocytes isolated from fetal interscapular BAT were

transfected with mRFP-GFP-LC3 lentivirus and treated with 0.1 mM H2O2. The autophagy inhibitor

chloroquine (CQ) was added after switching to maintenance medium and confocal images were

This article is protected by copyright. All rights reserved.

 obtained after treatment. Magnification: 1000×. For C-F panels, primary preadipocytes were

incubated with 0.1 mM H2O2, followed by culturing in maintenance medium containing 40 µM CQ.
Accepted Article
(C) Representative Oil-red-O staining of differentiated brown adipocytes. (D) Triglyceride levels of

differentiated brown adipocytes. (E) Quantification of mtDNA content in differentiated brown

adipocytes. (F) Relative mRNA expression levels of adipogenic and thermogenic markers. Data were

presented as mean ± SD from three independent experiments. *P<0.05 and **P<0.01 versus control,

#
P<0.05 versus D-galactose group, unpaired t-tests.

This article is protected by copyright. All rights reserved.