Cancer Letters 469 (2020) 456–467

Contents lists available at ScienceDirect

Cancer Letters
journal homepage: www.elsevier.com/locate/canlet

Original Articles

Clostridium butyricum, a butyrate-producing probiotic, inhibits intestinal T

tumor development through modulating Wnt signaling and gut microbiota
Danfeng Chena,1, Duochen Jina,1, Shumin Huanga,1, Jingyi Wua, Mengque Xua,b, Tianyu Liua,
Wenxiao Donga, Xiang Liua, Sinan Wanga, Weilong Zhonga, Yi Liuc,d, Ruihuan Jiangd,
Meiyu Piaoa, Bangmao Wanga,∗∗, Hailong Caoa,d,∗
a
Department of Gastroenterology and Hepatology, General Hospital, Tianjin Medical University, Tianjin Institute of Digestive Disease, PR China
b
Department of Gastroenterology, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou, PR China
c
Department of Gastroenterology and Hepatology, Tianjin Third Central Hospital, Tianjin, PR China
d
Department of Gastroenterology and Hepatology, Hotan District People's Hospital, Xinjiang Uygur Autonomous Region, Xinjiang, PR China

A R T I C LE I N FO A B S T R A C T

Keywords: Gut microbiota dysbiosis is closely involved in intestinal carcinogenesis. A marked reduction in butyrate-pro-
Clostridium butyricum ducing bacteria has been observed in patients with colorectal cancer (CRC); nevertheless, the potential benefit of
Gut microbiota butyrate-producing bacteria against intestinal tumor development has not been fully investigated. We found that
Short-chain fatty acids Clostridium butyricum (C. butyricum, one of the commonly used butyrate-producing bacteria in clinical settings)
Wnt signaling pathway
significantly inhibited high-fat diet (HFD)-induced intestinal tumor development in Apcmin/+ mice. Moreover,
Apcmin/+ mouse
intestinal tumor cells treated with C. butyricum exhibited decreased proliferation and increased apoptosis.
Additionally, C. butyricum suppressed the Wnt/β-catenin signaling pathway and modulated the gut microbiota
composition, as demonstrated by decreases in some pathogenic bacteria and bile acid (BA)-biotransforming
bacteria and increases in some beneficial bacteria, including short-chain fatty acid (SCFA)-producing bacteria.
Accordingly, C. butyricum decreased the fecal secondary BA contents, increased the cecal SCFA quantities, and
activated G-protein coupled receptors (GPRs), such as GPR43 and GPR109A. The anti-proliferative effect of C.
butyricum was blunted by GPR43 gene silencing using small interfering RNA (siRNA). The analysis of clinical
specimens revealed that the expression of GPR43 and GPR109A gradually decreased from human normal colonic
tissue to adenoma to carcinoma. Together, our results show that C. butyricum can inhibit intestinal tumor de-
velopment by modulating Wnt signaling and gut microbiota and thus suggest the potential efficacy of butyrate-
producing bacteria against CRC.

1. Introduction
Colorectal cancer (CRC) is considered one of the most serious public
health problems and is the third most commonly diagnosed cancer in
both males and females [1]. In addition to genetic factors, various en-
vironmental and lifestyle factors have been implicated in the develop-
ment of CRC [2]. A high-fat diet (HFD) has been recognized as a major
environmental risk factor for CRC, and the associated mechanisms in-
clude disturbance of the bile acid (BA) metabolism, induction of chronic
low-grade inflammation, and disruption of the gut microbiota [3–5]. In
contrast, dietary fiber has been negatively correlated with the risk of
CRC [6].
Numerous studies have revealed that gut microbiota dysbiosis is
related to CRC [7–9]. Compared with healthy individuals, patients with
CRC often suffer from a reduction in butyrate-producing bacteria
[10–14], which suggests that butyrate-producing bacteria might po-
tentially exhibit anti-tumor properties in CRC. Short-chain fatty acids
(SCFAs), primarily acetate, propionate, and butyrate, are the major
products of the colonic microbial fermentation of undigested dietary
fiber [15,16]. Butyrate has potential anti-inflammatory and anti-

∗
Corresponding author. Department of Gastroenterology and Hepatology, General Hospital, Tianjin Medical University, Tianjin Institute of Digestive Disease,
Anshan Road No.154, Heping District, Tianjin, 300052, PR China. Tel.: +86 022 60362608.
∗∗
Corresponding author. Department of Gastroenterology and Hepatology, General Hospital, Tianjin Medical University, Tianjin Institute of Digestive Disease,
Anshan Road No.154, Heping District, Tianjin, 300052, PR China. Tel.: +86 022 60362608.
E-mail addresses: tjmughgi@hotmail.com (B. Wang), caohailong@tmu.edu.cn (H. Cao).
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.canlet.2019.11.019
Received 23 July 2019; Received in revised form 10 November 2019; Accepted 11 November 2019
0304-3835/ © 2019 Elsevier B.V. All rights reserved.
D. Chen, et al. Cancer Letters 469 (2020) 456–467

Abbreviations GC gas chromatography

GPRs G-protein coupled receptors
ANOSIM analysis of similarities HFD high-fat diet
AOM azoxymethane IBD inflammatory bowel disease
APC adenomatous polyposis coli LCA lithocholic acid
ATCC American Type Culture Collection LEfSe linear discriminant analysis effect size
BA bile acid MEM Minimum Essential Medium
BD basal diet OTUs operational taxonomic units
CA cholic acid PBS phosphate-buffered saline
CB C. butyricum, Clostridium butyricum PCoA principal coordinate analysis
CCK-8 Cell Counting Kit-8 SCFA short-chain fatty acid
CDCA chenodeoxycholic acid siRNA small interfering RNA
CRC colorectal cancer SPF specific pathogen-free
DCA deoxycholic acid TdT terminal deoxynucleotidyl transferase
DMH 1,2-dimethylhydrazine dihydrochloride TLR4 Toll-like receptor 4
FBS et al. bovine serum TNBS 2,4,6-trinitrobenzene sulfonic acid
F/B Firmicutes/Bacteroidetes TUNEL TdT-mediated dUTP nick end-labeling

carcinogenic properties [17]. However, the oral administration of bu-
tyrate is challenging due to its rancid smell and unpleasant taste [18],
and a butyrate enema promotes colonic hypersensitivity [19]. Another
class of microbial metabolites, BAs, promotes CRC [20,21]. Primary
BAs, such as cholic acid (CA) and chenodeoxycholic acid (CDCA), are
synthesized from cholesterol in hepatocytes and then biotransformed
by bacteria of the genus Clostridium into secondary BAs, such as
deoxycholic acid (DCA) and lithocholic acid (LCA), respectively
[22,23].
The characteristics and mechanism of action of Clostridium butyr-
icum (C. butyricum), which are one of the most studied butyrate-pro-
ducing bacteria, have been reported since 1880 [24]. Moreover, C.
butyricum has been clinically used for the treatment of several gastro-
intestinal diseases, such as antimicrobial-associated diarrhea and in-
flammatory bowel disease (IBD), without serious side effects in Asia
(particularly in Japan and China) [25–28]. A study conducted by Wang
et al. revealed the stronger anti-inflammatory activities of combination
of Lactobacillus acidophilus CGMCC 7282 with C. butyricum CGMCC
7281 than either strain alone in both 2,4,6-trinitrobenzene sulfonic acid
(TNBS)-induced acute colitis in Sprague-Dawley rats and oxazolone-
induced chronic colitis in BALB/c mice [29]. C. butyricum has been
implicated in exacerbating cerebral ischemia/reperfusion injury [30]
and improving depression [31]. Moreover, its antitumor properties
have also been observed in 1,2-dimethylhydrazine dihydrochloride
(DMH)-induced CRC and azoxymethane (AOM)+TNBS-induced colitis-
associated cancer models [32,33]. Nevertheless, to our knowledge, the
effect of C. butyricum on intestinal tumor development in a genetically
modified mouse model remains to be assessed, and its efficacy in reg-
ulating the gut microbiota has not been examined. More than 95% of
CRC develops from adenomas over a number of years, and this pro-
gression is known as the adenoma-adenocarcinoma sequence. A muta-
tion in the adenomatous polyposis coli (Apc) gene, which is a negative
regulator of Wnt/β-catenin signaling, is often an early event in the
adenoma-adenocarcinoma sequence [34]. The Apcmin/+ mouse model
carrying a mutation of the Apc gene can develop multiple intestinal
adenomas and is therefore of particular advantage in intestinal tumor
studies [35,36], and several studies have revealed that HFD-treated
Apcmin/+ mice develop more intestinal tumors [37,38]; therefore, the
HFD-treated Apcmin/+ mouse model was selected for our study.
We addressed the efficacy and associated mechanisms of C. butyr-
icum on intestinal tumor development both in vitro and in vivo. Our
results show that C. butyricum suppresses intestinal tumor development,
partly by modulating Wnt/β-catenin signaling and gut microbiota, and
these effects are accompanied by the repression of cell proliferation, the
stimulation of apoptosis, a decrease in the fecal secondary BA contents,
increased SCFA production, and the activation of G-protein coupled
receptors (GPRs), such as GPR43 and GPR109A. Collectively, these
findings reveal that C. butyricum might exhibit potential efficacy against
CRC.
2. Materials and methods
2.1. Bacterial preparation
C. butyricum (ATCC 19398) was supplied by the China General
Microbiological Culture Collection Center and incubated in brain heart
infusion medium under anaerobic conditions for 24 h at 37 °C until the
logarithmic phase of growth with a bacterial density of 0.5 at A600. The
bacteria were harvested by centrifugation (3000 g × 5 min) and re-
suspended in sterile phosphate-buffered saline (PBS) to a final experi-
mental concentration of 2 × 109 CFU/0.2 mL, which was selected
based on previous research and a preliminary experiment [39]. The
supernatant was collected, filtered through 0.22-μm pore-size filters
and then diluted with complete culture medium.
2.2. Cell culture and treatment
Human CRC cell lines (HCT116, Caco-2, and HCT8) were purchased
from the American Type Culture Collection (ATCC, Manassas, VA,
USA). HCT116 cells were cultured in Dulbecco's Modified Eagle
Medium containing 10% fetal bovine serum (FBS) [40,41]; Caco-2 cells
were cultured in Minimum Essential Medium (MEM) with 20% FBS and
1.0% nonessential amino acids [42]; and HCT8 cells were cultured in
Roswell Park Memorial Institute 1640 medium with 10% FBS [43]. All
the cells were incubated in a humidified atmosphere with 5% CO2 at
37 °C.
The cell viability was determined using Cell Counting Kit-8 (CCK-8,
Beyotime, China). HCT116 and Caco-2 cells were plated in 96-well
plates (4 × 103 cells/well [44]) and then treated with C. butyricum
supernatant or sodium butyrate at different concentrations for various
times. After the treatments, 10 μL of CCK-8 assay solution was added to
each well, and the cells were further incubated for 1 h at 37 °C. The
absorbance of each well was then measured at 450 nm.
2.3. Animal experiments
Female four-week-old Apcmin/+ mice purchased from the Animal
Model Institute of Nanjing University were maintained in specific pa-
thogen-free (SPF) facilities. All the mice (n = 30) were acclimatized for
7 days and then administered an antibiotic cocktail containing 500 mg
of ampicillin, 250 mg of vancomycin, 500 mg of neomycin and 250 mg
of metronidazole (Sigma-Aldrich, St. Louis, MO, USA) for 3 days to

457
D. Chen, et al.
deplete the indigenous microbiota and thus allow C. butyricum coloni-
zation. The experimental design is shown in Fig. 1A. The mice were
randomly divided into three groups: HFD-CB group, HFD-PBS group,
and BD-PBS group. The CB group was gavaged with C. butyricum at a
dosage of 2 × 109 CFU/0.2 mL 3 times a week for 12 weeks, whereas
the PBS groups were orally administered 0.2 mL of sterile PBS 3 times a
week for 12 weeks. In addition, the HFD groups were fed an HFD (60%
fat, 20% protein, and 20% carbohydrates), whereas the basal diet (BD)
group was fed a BD (16% fat, 20% protein, and 64% carbohydrates).
The rodents were monitored daily for any signs of illness and weighed
weekly. The rodents were fasted for 12 h and euthanized by CO2 in-
halation, and the cecal contents were harvested for SCFA analysis. Our
study was approved by the Institutional Animal Care and Use Com-
mittee at Tianjin Medical University, Tianjin, P. R. China.
2.4. Measurement of intestinal tumors and tissue collection
The intestinal tissues were collected as previously described
[38,45]. The small intestine was divided into three equal portions
(proximal, middle and distal sections). The intestinal tumors were
classified as small (< 1 mm), middle (1–2 mm), or large (> 2 mm).
Intestinal Swiss rolls were fixed in 10% buffered formalin, and the
458
Cancer Letters 469 (2020) 456–467
adenomas of intestinal tissues were stored at −80 °C.
2.5. Histological and immunohistochemical analyses
Formalin-fixed intestinal tissues were embedded in paraffin as
previously described [3,46]. The degree of tumor dysplasia was as-
sessed based on previous research [21]. For immunohistochemistry, the
tissue slides were incubated with the following primary antibodies: Ki-
67 (ab16667, Abcam, Cambridge, MA, USA), β-catenin (ab32572,
Abcam, Cambridge, MA, USA), cyclin D1 (ab134175, Abcam, Cam-
bridge, MA, USA), GPR43 (ab118449, Abcam, Cambridge, MA, USA),
and GPR109A (ab198693, Abcam, Cambridge, MA, USA). The sections
were then washed, incubated with horseradish peroxidase-labeled
secondary antibodies and counterstained with hematoxylin. Ki-67 and
cyclin D1 are expressed in the nucleus, inactivated β-catenin is located
in the cytomembrane, and ectopic β-catenin is located in the cytoplasm
and nucleus. GPR43 and GPR109A are expressed on the surface of in-
testinal epithelial cells. Five random fields from a single section were
viewed to calculate the numbers of positive cells, and the data were
quantified based on the average percentages of positive cells.
Fig. 1. Clostridium butyricum inhibited HFD-in-
duced intestinal tumor development in Apcmin/+
mice. (A) Experimental flow chart. (B) Total
number of intestinal tumors in mice after the dif-
ferent treatments. One-way ANOVA. (C) Number of
colonic tumors in Apcmin/+ mice. One-way ANOVA.
(D) CB decreased the intestinal tumor burden. One-
way ANOVA. (E) Numbers of intestinal tumors of
different sizes in the three groups. Two-way
ANOVA. (F–I) Representative and histological ap-
pearance of colonic tumors in the mice after the
different treatments. BD, basal diet. HFD, high-fat
diet. CB, Clostridium butyricum. Scale bars, 50 μm
*P < 0.05, **P < 0.01, ***P < 0.001. n = 10 for
each group.
D. Chen, et al. Cancer Letters 469 (2020) 456–467

2.6. TUNEL assay 2.12. Gene silencing of GPR43 using siRNA

Terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick
end-labeling (TUNEL) was used for the detection of apoptosis in in-
testinal tumors [47]. Five areas in each section were selected randomly
to calculate the percentages of apoptotic cells.
2.7. Realtime-polymerase chain reaction
Total RNA was isolated using the RNeasy mini kit (TIANGEN,
Carlsbad, CA, USA) and reverse-transcribed using the TIANScript RT Kit
(TIANGEN, Inc. Beijing, China). The oligonucleotide primer sequences
for the target genes are shown in Table 1. The relative mRNA expres-
sion was calculated using the 2-ΔΔCT method.
To knock down GPR43 expression, the cells were transiently
transfected with small interfering RNA that targets GPR43 (GPR43
siRNA; sense strand, 5′-GGCCUGGGUUAUGUCCUUUTT-3′, antisense
strand, 5′-AAAGGACAUAACCCAGGCCTT-3′; GenePharma, Shanghai,
China) and negative control siRNA (nontargeting siRNA; sense strand,
5′-UUCUCCGAACGUGUCACGUTT-3′, antisense strand, 5′-ACGUGACA
CGUUCGGAGAATT-3′) as described previously [51]. CRC cells in 6-
well plates were transfected with 2 μg of GPR43 siRNA or control siRNA
using Lipofectamine 2000 (Invitrogen) in Opti-MEM according to the
manufacturer's instructions. After 6 h, the cells were refreshed with
complete medium for 24 h and then stimulated with C. butyricum su-
pernatant or sodium butyrate.

2.8. Western blot analysis

2.13. Collection of colonic specimens
Total proteins were extracted using RIPA buffer containing protease
Human colonic biopsies were obtained via colonoscopy at the
inhibitors (Solarbio, Beijing, China). The nuclear proteins were ex-
Digestive Endoscopy Center of Tianjin Medical University General
tracted for β-catenin analysis using the Nuclear Extraction Kit
Hospital, Tianjin, China. We analyzed 30 colonic biopsy samples, in-
(Beyotime, Shanghai, China). The membranes were incubated with
cluding normal tissue, adenoma tissues, and carcinoma tissues (10 pa-
appropriate primary antibodies against β-catenin (1:5000), cyclin D1
tients in each group). All the subjects were unrelated individuals of both
(1:10000), and c-Myc (ab32072, Abcam, Cambridge, MA, USA; 1:1000)
sexes aged 50–75 years and had consistent dietary habits. The exclusion
and then with appropriate secondary antibodies. β-actin (1:5000) and
criteria were as follows: i) prior surgery, chemotherapy, or radio-
histone 2A (1:5000) were selected as internal controls for total and
therapy; ii) diagnosis of IBD; and iii) presence of other malignant tu-
nuclear proteins, respectively. The proteins were quantified by densi-
mors. The participants were diagnosed by colonoscopy and patholo-
tometry using ImageJ software.
gical examination of colonic biopsies. Normal colonic tissues were
randomly obtained from a cluster of age- and sex-matched individuals
2.9. Illumina sequencing analysis
during health examinations involving colonoscopy of normal colonic
mucosa. The expression of GPR43 and GPR109A was examined by
16S rRNA gene sequencing was performed by the Realbio Genomics
immunohistochemical staining. Written informed consent was obtained
Institute (Shanghai, China). Total genomic DNA from frozen stool
from all the individuals, and the study was approved by the Ethics
samples was isolated using the QIAamp DNA Stool Mini Kit (Omega
Committee of General Hospital, Tianjin Medical University, China.
Bio-Tek, Norcross, GA, USA), and the V3–V4 hypervariable region of
the 16S rRNA genes was then amplified. The PCR products were col-
lected and sequenced using the Illumina HiSeq platform (Illumina, San
2.14. Statistical analysis
Diego, CA, USA). The high-quality reads were clustered into operational
taxonomic units (OTUs) based on sequences with ≥97% similarity and
The statistical analyses were performed using GraphPad Prism
then analyzed using the QIIME platform.
version 7.00. The measurement data are presented as the
means ± SDs. The data were statistically analyzed by one-way or two-
2.10. Fecal bile acid analysis way ANOVA. A P-value less than 0.05 was considered significant.

The main BA profiles in feces were determined by liquid chroma-

tography-mass spectrometry as previously described [48]. CA
(Aladdin), LCA (Aladdin), DCA (Sigma), and CDCA (Aladdin) were
added to the fecal samples as reference standards, and an external
Table 1
standard method was performed. Briefly, the fecal BAs were thoroughly
Primer sequences used for Realtime-PCR.
ground, suspended in chromatographic ethanol, and ultrasonically
processed at 30 °C for 60 min. All fecal samples were centrifuged at Primers Sequence
10,000 g and 4 °C for 10 min. The supernatant was concentrated to
hGPR41 Forward 5′- TGCGGTCAATGGGATCTG -3′
dryness under nitrogen, redissolved with chromatographic methanol, Reverse 5′- CAAGCACAGAGACGTAAGAGG -3′
and then filtered with a 0.22-μm pore-size filter. The BA concentration hGPR43 Forward 5′- TGTATGGAGTGATTGCAGCTC -3′
was quantified using a liquid chromatograph (Agilent 1260) combined Reverse 5′- TGGTTATCGGTGAAGTTCTCG -3′
with a 6120B mass spectrometer. hGPR109A Forward 5′- CACTCTCAGCTTCACCTACATG -3′
Reverse 5′- CTCACCTGTCATCTTCCTCTG -3′
hP21WAF1 Forward 5′- TGTCCGTCAGAACCCATGC -3′
2.11. Cecal short-chain fatty acid quantification Reverse 5′- AAAGTCGAAGTTCCATCGCTC -3′
hGAPDH Forward 5′- ACATCGCTCAGACACCATG -3′
Reverse 5′- TGTAGTTGAGGTCAATGAAGGG -3′
The SCFA concentrations were determined by gas chromatography
mGPR41 Forward 5′- GTGTAGTCTGTTGGTTCCTGG -3′
(GC) as previously described [49,50]. Briefly, the cecal contents were Reverse 5′- TGTAGGTTGCATTTCCCCAG -3′
diluted, acidified, and extracted ultrasonically on ice for 10 min. The mGPR43 Forward 5′- AGGTTTGCTACTGATCCGC -3′
samples were then centrifuged at 12,000 g and 4 °C for 15 min. After the Reverse 5′- GTACCCCTTCTGCTTGACTTC -3′
supernatant was mixed with ethyl acetate (1:1), the extract was filtered mGPR109A Forward 5′- TTTCTCCAGCCCATCTTTCC -3′
Reverse 5′- ATACTTCTGGTTGTGCTGGG -3′
through a 0.22-μm pore-size filter and poured into an Agilent 7890A
mGAPDH Forward 5′- GGAGAAACCTGCCAAGTATG -3′
Series GC. The SCFA standards were purchased from Sigma-Aldrich (St. Reverse 5′- TGGGAGTTGCTGTTGAAGTC -3′
Louis, MO, USA).

459
D. Chen, et al. Cancer Letters 469 (2020) 456–467

3. Results
3.1. Clostridium butyricum inhibited HFD-induced intestinal tumor
development in Apcmin/+ mice
At the end of the experiment, the body weight of the HFD-PBS group
was increased compared with that of the BD-PBS group (P < 0.001;
Supplementary Fig. S1); however, no significant change in body weight
was observed between the HFD-CB and HFD-PBS groups. As shown in
Fig. 1B, an HFD led to a significant increase in the total number of
intestinal tumors (20.9 ± 3.78 vs 11.6 ± 2.2, P < 0.01), whereas C.
butyricum prevented the formation of intestinal tumors (15 ± 2.10,
P < 0.01). The number of colonic tumors in the HFD-CB group was
lower than that in the HFD-PBS group (1.2 ± 0.87 vs 2.8 ± 1.33,
P < 0.01; Fig. 1C). The intestinal tumor burden in the group fed the
HFD alone was higher than that in the control group (28.9 ± 3.45 vs
15.3 ± 2.69, P < 0.001; Fig. 1D); however, C. butyricum significantly
decreased the intestinal tumor burden compared with that found in the
HFD group (21.7 ± 4.27 vs 28.9 ± 3.45, P < 0.01). Moreover, the
number of intestinal tumors of different sizes in the HFD-PBS group was
also increased compared with that in the BD-PBS group; however, C.
butyricum significantly decreased the number of tumors sized > 1 mm
(Fig. 1E). High-grade dysplasia in the colon, including intramucosal
carcinoma, was observed in 70% of mice fed the HFD, whereas Apcmin/
+
mice treated with C. butyricum developed adenoma with or without
low-grade dysplasia (Fig. 1F–I). In the animal experiments, we used PBS
as a control instead of heat-killed C. butyricum, which was a weakness of
our study. Isono A et al. reported that C. butyricum TO-A downregulated
the mRNA level of Toll-like receptor 4 (TLR4) in human colonic epi-
thelial cells compared with untreated controls, but the mRNA level of
TLR4 was not significantly altered by heat-killed C. butyricum TO-A
[52]. Concordantly, we found that heat-killed C. butyricum supernatant
exerted no inhibitory effect on colon cancer cells, which suggests that
heat-killed C. butyricum has no anti-CRC actions (Supplementary Fig.
S2). Collectively, these results demonstrate that C. butyricum prevents
HFD-induced intestinal tumor development.
3.2. Clostridium butyricum suppressed intestinal tumor cell proliferation
and stimulated their apoptosis
We subsequently evaluated whether C. butyricum supernatant could
inhibit the proliferation of CRC cells using the CCK-8 assay. At a con-
centration of 20%, C. butyricum supernatant significantly decreased the
viability of HCT116 cells in a time-dependent manner compared with
that of the controls (P < 0.001; Fig. 2A); however, at a relatively low
concentration, that is, 10%, C. butyricum supernatant exerted almost no
effects on cell viability. The experiment with Caco-2 cells revealed that
C. butyricum supernatant at a concentration of 20% decreased the cell

Fig. 2. Clostridium butyricum suppressed the proliferation and promoted the apoptosis of intestinal tumor cells. (A) HCT116 and Caco-2 cells were treated
with different concentrations of CB supernatant or sodium butyrate for different times, and their viability was analyzed using the CCK-8 assay. Two-way ANOVA. (B)
The intestinal sections were processed for Ki-67 immunohistochemistry. One-way ANOVA. (C) The TUNEL assay was used for the assessment of apoptosis in intestinal
tumors. One-way ANOVA. NC, normal control. CB, Clostridium butyricum. NaBu, sodium butyrate. BD, basal diet. HFD, high-fat diet. Scale bars, 50 μm *P < 0.05,
**P < 0.01, ***P < 0.001. n = 10 for each group.

460
D. Chen, et al. Cancer Letters 469 (2020) 456–467

viability for 48 and 72 h (P < 0.001; Fig. 2A). Sodium butyrate, which
was used as a positive control, concentration-dependently (0, 0.1, 1,
and 10 mmol/L) decreased the viability of CRC cells with an unclear
dependence on time. Because sodium butyrate at a concentration of
1 mmol/L was enough to exert obvious inhibitory effects on the pro-
liferation of HCT116 cells, and according to our GC data
(Supplementary Fig. S3), C. butyricum supernatant at a concentration of
20% contained approximately 0.5 mmol/L butyrate, which was on the
same order of magnitude as 1 mmol/L sodium butyrate. Thus, C. bu-
tyricum supernatant at a concentration of 20% and 1 mmol/L sodium
butyrate were selected for cell stimulation in the subsequent experi-
ments. The proliferation and apoptosis of intestinal tumor cells in mice
were quantified by Ki-67 immunohistochemistry and the TUNEL assay,
respectively. Compared with the HFD-PBS group, the C. butyricum-
treated group exhibited a significant decreased Ki-67-positive rate
(20.84 ± 3.50 vs 38.38 ± 4.25, P < 0.01; Fig. 2B) and an increased
percentage of apoptotic cells (7.99 ± 0.24 vs 1.81 ± 0.12,
P < 0.001; Fig. 2C) within the colon tumors. These results show that C.
butyricum significantly suppresses the proliferation of intestinal tumor
cells and stimulates their apoptosis.
3.3. Clostridium butyricum modulated the Wnt/β-catenin signaling pathway
An aberrant Wnt/β-catenin signaling pathway is positively relevant
to intestinal carcinogenesis, and this pathway has been considered a
potential therapeutic target [53]. Compared with the HFD-PBS mice,
the HFD-CB mice showed lower ectopic expression of β-catenin in the
nucleus (28.98 ± 1.55 vs 63.12 ± 6.04, P < 0.05) and a decreased
proportion of cyclin D1-positive cells (27.73 ± 1.79 vs 42.80 ± 5.58,
P < 0.05; Fig. 3A and B). Furthermore, a Western blot analysis re-
vealed decreased expression of β-catenin, cyclin D1, and c-Myc in C.
butyricum-treated HCT116 cells compared with the controls
(P < 0.001; Fig. 3C and D). Thus, the downregulation of Wnt signaling
might be a critical mechanism involved in its anticarcinogenic effects.
3.4. Clostridium butyricum altered the HFD-induced gut microbiota
dysbiosis in Apcmin/+ mice
The comparison of the OTUs among the three groups revealed 294
OTUs in the HFD-CB group, 332 OTUs in the HFD-PBS group, and 380
OTUs in the BD-PBS group, and a total of 222 OTUs were shared by the
different samples (Fig. 4A). The gut microbiota of all the samples was
dominated by four major phyla: Bacteroidetes, Firmicutes, Proteobacteria,
and Verrucomicrobia. Notably, compared with the control, a lower
abundance of Bacteroidetes and a higher abundance of Firmicutes were
observed in mice fed an HFD (Fig. 4B), which resulted in an increased
Firmicutes/Bacteroidetes (F/B) ratio in the HFD feeding alone group
(1.2) compared with that in the control group (0.4). However, C. bu-
tyricum did not statistically affect the F/B ratio. The genus-level analysis
revealed that HFD increased the relative abundance of pathogenic
bacteria, such as Desulfovibrio, Odoribacter, and Helicobacter, whereas C.
butyricum weakened this increase (Fig. 4C and Supplementary Figs.
S4A–S4C). Interestingly, the relative abundance of BA-biotransforming
bacteria in mice fed the HFD alone was higher than that in mice fed a
control diet, such as Clostridium XlVb and Clostridium XI, whereas C.
butyricum decreased the abundance of these bacteria, but this decrease
was not statistically significant (Fig. 4C and Supplementary Figs. S4D
and S4E). Additionally, a relatively lower abundance of Lactobacillus

Fig. 3. Clostridium butyricum suppressed the Wnt/β-catenin signaling pathway. (A–B) An immunohistochemistry analysis of intestinal tumors revealed that the
Wnt/β-catenin pathway was inhibited in Apcmin/+ mice that received CB. The β-catenin-positive cells in A indicate nuclear staining indicative of Wnt activation. One-
way ANOVA. (C–D) The protein levels of total and nuclear β-catenin, cyclin D1, and c-Myc in HCT116 cells were analyzed by western blotting using anti-β-actin and
anti-histone 2A antibodies as internal controls for total and nuclear protein, respectively. The proteins were quantified densitometrically using ImageJ software. Two-
way ANOVA. BD, basal diet. HFD, high-fat diet. CB, Clostridium butyricum. NaBu, sodium butyrate. Scale bars, 50 μm *P < 0.05, ***P < 0.001. n = 10 for each
group.

461
D. Chen, et al. Cancer Letters 469 (2020) 456–467

Fig. 4. Clostridium butyricum modulated the composition of the gut microbiota in Apcmin/+ mice. (A) Venn diagrams of bacterial OTUs. (B) Bar charts of the gut
microbiota composition at the phylum level in the three groups. (C) Bar charts of the gut microbiota composition at the genus level in each mouse. (D–E) Shannon
and Simpson diversity indexes of the gut microbiota. Kruskal-Wallis test. BD, basal diet. HFD, high-fat diet. CB, Clostridium butyricum. NS, not significant. *P < 0.05.
n = 8–10. The analyses were performed at the end of the experiment.

was observed in mice fed an HFD compared with that of the control,
whereas the abundance of Lactobacillus was restored by C. butyricum,
but this effect was not statistically significant (Fig. 4C and
Supplementary Fig. S4F).
HFD led to a significant decrease in the Shannon and Simpson in-
dices with respect to the control values (Shannon: 5.05 ± 0.22 vs
5.52 ± 0.34, P < 0.05; Simpson: 0.94 ± 0.01 vs 0.95 ± 0.01,
P < 0.05; Fig. 4D–E); however, the effect of C. butyricum on those two
indexes was not statistically significant, which suggested that HFD ex-
erted stronger negative effects on the α diversity of the gut microbiota.
An analysis of similarities (ANOSIM) based on weighted UniFrac dis-
tances indicated the existence of quite different gut microbiota struc-
tures in the three groups (R = 0.63, P = 0.001; Fig. 5A). A principal
coordinate analysis (PCoA) based on weighted UniFrac distances re-
vealed a more similar structure between HFD-CB and HFD-PBS mice
(Fig. 5B). We compared the gut microbiota among the three groups
through linear discriminant analysis effect size (LEfSe) to identify the
specific microbiota linked to C. butyricum treatment. Ruminococcaceae
and Eubacterium, whose members are generally associated with buty-
rate production, were more abundant in the HFD-CB group (Fig. 5C).
Taken together, the results indicate that HFD induces a major alteration
in the gut microbiota composition, whereas C. butyricum at least partly
alters the gut microbiota dysbiosis caused by HFD.
3.5. Clostridium butyricum altered the levels of microbial-derived
metabolites
Numerous studies have revealed the relationships between micro-
bial-derived metabolites (BAs and SCFAs) and CRC [54–56]. The HFD
induced a subtle increase in the concentration of CA compared with the
BD, but no difference in the level of CDCA was found between these
groups (Fig. 6A). In addition, primary BAs were not affected by C. bu-
tyricum treatment (Fig. 6A). The levels of the fecal secondary BAs DCA
and LCA were markedly increased in the HFD-treated mice compared
with the control (DCA: 0.63 ± 0.16 vs 0.17 ± 0.03 mg/g, P < 0.001;
LCA: 0.14 ± 0.02 vs 0.10 ± 0.02 mg/g, P < 0.01; Fig. 6A). Sur-
prisingly, the DCA and LCA levels in the C. butyricum group were de-
creased significantly (DCA: 0.46 ± 0.04 vs 0.63 ± 0.16 mg/g,
P < 0.05; LCA: 0.10 ± 0.01 vs 0.14 ± 0.02 mg/g, P < 0.01;
Fig. 6A). The concentrations of cecal SCFAs in the HFD-fed group were

462
D. Chen, et al. Cancer Letters 469 (2020) 456–467

Fig. 5. Clostridium butyricum altered specific bacterial taxa. (A) ANOSIM based on weighted UniFrac distances. (B) A PCoA based on weighted UniFrac distances
indicated a clear difference in the gut microbiota structure between the HFD-treated and non-HFD-treated groups. (C) Cladogram generated from the LEfSe. BD, basal
diet. HFD, high-fat diet. CB, Clostridium butyricum. n = 8–10. The analyses were performed at the end of the experiment.

increased compared with those in the control group. Notably, the levels
of acetic acid (1671.6 ± 3199.5 vs 238.9 ± 72.3 μmol/g,
P < 0.001), propionic acid (447.9 ± 112.5 vs 34.9 ± 8.8 μmol/g,
P < 0.001), and butyric acid (373.7 ± 96.2 vs 27.7 ± 6.8 μmol/g,
P < 0.001) in the C. butyricum-treated mice were significantly higher
than those in the HFD-fed mice (Fig. 6B). These results suggest that the
anticarcinogenic effect of C. butyricum might be partly due to altera-
tions in microbial-derived metabolites.
3.6. Clostridium butyricum activated G-protein coupled receptors
SCFAs induce multiple signaling pathways partly through their
binding to GPRs such as GPR41, GPR43, and GPR109A with varying
affinities [57]. GPR43 and GPR109A recognize SCFAs and have been
implicated in the suppression of intestinal inflammation and CRC [58].
Compared with the control, the stimulation of HCT116 cells with C.
butyricum supernatant and sodium butyrate induced 4.5-fold and 4.2-
fold upregulation of the GPR43 mRNA levels, 2.6-fold and 7.0-fold in-
creases in the GPR109A mRNA levels, and no significant change in
GPR41 mRNA expression, respectively (Fig. 7A). The GPR109A mRNA
level was downregulated 2.7-fold in the C. butyricum supernatant-
treated HCT116 cells compared with the group treated with 1 mmol/L
sodium butyrate (P < 0.01; Fig. 7A), but no difference in the mRNA
levels of GPR43 and GPR41 was found between these groups. Similar
results were found in Caco-2 and HCT8 cells (Supplementary Fig. S5).
Furthermore, we investigated whether the anticarcinogenic effect of C.
butyricum was dependent on GPR43 through siRNA-mediated silencing
of the gene encoding the GPR43 receptor and found that the gene si-
lencing of GPR43 blunted the anti-proliferative effect of C. butyricum
(Fig. 7B). In addition, marked decreases in the mRNA levels of GPR43
were found in HCT116 cells treated with GPR43 siRNA (Fig. 7C). The
cyclin-dependent kinase inhibitor P21WAF1 acts as an important in-
hibitor of cell cycle progression [59]. The mRNA level of P21WAF1 was
increased in HCT116 cells treated with C. butyricum, and the silencing
of GPR43 blocked the C. butyricum-mediated induction of P21WAF1 ex-
pression (Fig. 7C). The mRNA levels of GPRs in the HFD-PBS group
exhibited no significant change compared with those in the BD-PBS
group (Fig. 7D). However, the mRNA levels of GPR43 and GPR109A in
the HFD-CB group were upregulated by 3.89-fold and 3.8-fold, re-
spectively, compared with those in the HFD-PBS group (P < 0.05), but
no change in the GPR41 mRNA level was found between these groups
(Fig. 7D). We then examined the expression of GPR43 and GPR109A in

463
D. Chen, et al.
Fig. 6. Clostridium butyricum altered the levels of microbial-derived metabolites. (A) Effect of CB on primary BAs and secondary BAs in the fecal contents. One-
way ANOVA. (B) Alterations in the SCFA levels in the cecal contents of mice after the different treatments. One-way ANOVA. BD, basal diet. HFD, high-fat diet. CB,
Clostridium butyricum. BAs, bile acids. CA, cholic acid. CDCA, chenodeoxycholic acid. DCA, deoxycholic acid. LCA, lithocholic acid. SCFAs, short-chain fatty acids.
*P < 0.05, **P < 0.01, ***P < 0.001. n = 8–10. The analyses were performed at the end of the experiment.
human colonic tissues and found that the expression of GPR43 and
GPR109A showed a gradual decrease from human normal colonic tissue
to adenoma to carcinoma (Fig. 7E). The percentages of GPR43-and
GPR109A-positive cells in carcinoma tissues were decreased compared
with those in adenoma tissues (GPR43: 13.84 ± 2.86% vs
27.50 ± 3.75%, P < 0.05; GPR109A: 19.46 ± 3.22% vs
30.70 ± 3.74%, P < 0.05; Fig. 7E). These results indicate that the
activation of GPR43 and GPR109A plays a critical role in the antic-
arcinogenic effects of C. butyricum.
4. Discussion
Currently, the restoration of an altered gut microbiota using pro-
biotics is considered a potential strategy for the prevention and treat-
ment of CRC [60,61]. Butyrate-producing bacteria exhibit therapeutic
potential for CRC because these bacteria are diminished in the fecal
microbiota of patients with CRC [62,63]. However, whether C. butyr-
icum can inhibit intestinal tumor development in genetically modified
models and its efficacy on the gut microbiota remain uncertain. As
demonstrated in our study, C. butyricum inhibits intestinal tumor de-
velopment in Apcmin/+ mice induced by HFD. Moreover, the mechan-
isms involved in the protective effects of C. butyricum are related to
suppressing the proliferation and promoting the apoptosis of tumor
cells, modulating the gut microbiota, and inhibiting Wnt/β-catenin
signaling. Importantly, C. butyricum treatment alters microbial-derived
metabolites such as secondary BAs and SCFAs and activates the G-
protein coupled receptors GPR43 and GPR109A. Therefore, C. butyr-
icum might exert protective effects against CRC.
The antitumor activity of C. butyricum in CRC cell lines and a che-
mically induced CRC mouse model was recently reported [32,64]. C.
butyricum increases P21WAF1 expression in C57BL/6 mice in-
traperitoneally injected with DMH, which suggests that it exerts an
antiproliferative effect [32]. The efficacy of C. butyricum for the treat-
ment of colitis-associated cancer induced by AOM/TNBS was also ob-
served in a previous study [33]. HFD has been recognized as a major
environmental risk factor for CRC [65]. Concordantly, our study reveals
that C. butyricum ameliorates the development of intestinal tumors and
improves the morphological abnormalities in HFD-fed Apcmin/+ mice,
464
Cancer Letters 469 (2020) 456–467
which is different from the results obtained by Chen et al. using C57BL/
6 mice treated with DMH [32]. C. butyricum represses the proliferation
and enhances the apoptosis of intestinal tumor cells both in vitro and in
vivo. Moreover, to our knowledge, our study is the first to focus on the
efficacy of C. butyricum in regulating the gut microbiota in a CRC mouse
model. The novel finding of our study is that C. butyricum can meta-
bolize fat to produce SCFAs, which have been implicated in inhibiting
CRC [66], and thus significantly alleviate the tumor burden caused by
HFD.
The dysregulation of Wnt signaling is considered a crucial event in
CRC progression [67–69]. A mutation in the Apc gene leads to increased
cytoplasmic accumulation and nuclear translocation of β-catenin [70].
β-catenin interacts with the T cell factor/lymphoid enhancer factor and
thereby increases the expression of its target genes, such as cyclin D1
and c-Myc, which have been further linked to aberrant cell proliferation
and apoptosis [71]. This study shows that Apcmin/+ mice fed an HFD
exhibit increased ectopic accumulation of β-catenin and upregulated
expression of cyclin D1 and that these effects are significantly decreased
by C. butyricum. Recent studies demonstrated that some harmful bac-
teria can activate Wnt/β-catenin through bacterial effectors and toxins,
such as Helicobacter pylori, Salmonella enterica, Fusobacterium nucleatum,
and Bacteroides fragilis [72,73]. In our study, HFD increases the relative
abundance of Helicobacter, and C. butyricum weakens this increase, but
further studies are needed to investigate whether C. butyricum sup-
presses Wnt signaling directly or through other mediators.
Numerous studies have described gut dysbiosis in CRC. Hence, we
analyzed the microbial diversity of fecal samples from the different
treatment groups and found that C. butyricum partly alters the gut mi-
crobiota dysbiosis caused by HFD. In agreement with previous reports
[74,75], the present study shows that HFD feeding results in an in-
creased F/B ratio. C. butyricum not only inhibits the increase in pa-
thogenic bacteria but also enhances the growth of probiotic bacteria.
Previous studies have revealed that members of Clostridium biotrans-
form primary BAs into secondary BAs via 7α-dehydroxylation [76–78],
and intestinal Bacteroidetes are negatively correlated with secondary
BAs [79]. Consistent with these findings, we found a decreased abun-
dance of Clostridium and an increased abundance of Bacteroidetes in the
mice administered C. butyricum. Interestingly, we also observed
D. Chen, et al. Cancer Letters 469 (2020) 456–467

Fig. 7. Clostridium butyricum activated G-protein coupled receptors and increased P21WAF1 expression. (A) Relative expression of GPR41, GPR43, and
GPR109A in HCT116 cells. One-way ANOVA. (B) The anti-proliferative activity of C. butyricum was inhibited by siRNA-mediated GPR43 silencing. One-way ANOVA.
(C) Expression of GPR43 and P21WAF1 in GPR43-knockdown HCT116 cells relative to the negative control. One-way ANOVA. (D) Relative expression of GPR41,
GPR43, and GPR109A in colonic tumor tissues. One-way ANOVA. (E) Immunohistochemical detection of GPR43 and GPR109A in human colonic tissues. One-way
ANOVA. n = 10 for each group. CB, Clostridium butyricum. NaBu, sodium butyrate. BD, basal diet. HFD, high-fat diet. ns, not significant. Scale bars, 50 μm
*P < 0.05, **P < 0.01, ***P < 0.001. The analyses were performed at the end of the experiment.

decreased levels of secondary BAs in C. butyricum-treated mice. Taken
together, the results indicate that the positive effect exerted by C. bu-
tyricum on the gut microbiota might contribute to its inhibitory impact
on CRC.
An accumulating body of evidence demonstrates that a high dietary
fiber intake is related to a lower risk of colorectal carcinogenesis [80].
This protective effect of dietary fiber might be attributable to the an-
ticarcinogenic properties of beneficial microbial metabolic products,
such as SCFAs [81]. Notably, Ruminococcaceae and Eubacterium, which
are well known to produce SCFAs, are increased after C. butyricum
treatment. In addition, C. butyricum obviously increases the con-
centration of each acid, as expected. Butyrate can influence multiple
intracellular signaling pathways in the intestine partly through binding
to specific butyrate receptors, namely, GPR41, GPR43, and GPR109A
[82–84]. GPR41, GPR43, and GPR109A can be activated by butyrate,
although with varying affinities. The activation of GPR43 and GPR109A
inhibits cell proliferation and induces apoptosis following butyrate
treatment [85,86]. GPR109A suppresses NF-κB activation, down-
regulates cyclin D1, and upregulates the death receptor pathway [85].
Interestingly, we also found that C. butyricum increases the expression
of GPR43 and GPR109A in colonic tissue. The siRNA-mediated gene
silencing of GPR43 blunts the anti-proliferative effect of C. butyricum
and blocks the C. butyricum-mediated induction of P21WAF1 expression
in CRC cells, and this finding indicates that the protective role of C.
butyricum might be related to the activation of GPR43. Moreover, the
results from the immunohistochemical analysis of human colonic tis-
sues also suggest that GPRs play a role in inhibiting carcinoma pro-
gression. Further studies are needed to investigate whether C. butyricum
exerts anti-tumor effects in GPR43/109A-knockout Apcmin/+ mice.
Taken together, our results suggest that C. butyricum suppresses
intestinal tumor development at least partly by modulating Wnt/β-ca-
tenin signaling and the gut microbiota. Thus, C. butyricum might be

465
D. Chen, et al.
considered a promising option in the treatment of CRC.
Author contributions
Chen DF, Jin DC, Wang BM, and Cao HL designed the research
study; Chen DF, Jin DC, Huang SM, Wu JY, Xu MQ, Liu TY, Dong WX,
Liu X, Wang SN, Zhong WL, Liu Y, Jiang RH, and Piao MY performed
the experiments; Chen DF, Jin DC, Huang SM, and Cao HL wrote the
paper; and all the authors approved the final draft of the manuscript.
Funding sources
This study was supported by grants (81570478, 81741075, and
81700456) from the National Natural Science Foundation of China, a
grant (17JCYBJC24900) from the Natural Science Foundation of
Tianjin, a grant (2019M651049) from the Postdoctoral Science
Foundation of China, and a grant (2018242755) from the Medical and
Health Science and Technology Project of Zhejiang.
Declaration of competing interest
The authors declare no conflicts of interest.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.canlet.2019.11.019.
References
[1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, CA A Cancer J. Clin. 2018 (68)
(2018) 7–30.
[2] D. Wang, R. Zhao, Y.Y. Qu, et al., Colonic lysine homocysteinylation induced by
high-fat diet suppresses DNA damage repair, Cell Rep. 25 (2018) 398–412 e6.
[3] H. Cao, M. Xu, W. Dong, et al., Secondary bile acid-induced dysbiosis promotes
intestinal carcinogenesis, Int. J. Cancer 140 (2017) 2545–2556.
[4] D. Dermadi, S. Valo, S. Ollila, et al., Western diet deregulates bile acid homeostasis,
cell proliferation, and tumorigenesis in colon, Cancer Res. 77 (2017) 3352–3363.
[5] Yilmaz ÖH, Dietary regulation of the origins of cancer, Sci. Transl. Med. (2018) 10.
[6] K. Makki, E.C. Deehan, J. Walter, et al., The impact of dietary fiber on gut micro-
biota in host health and disease, Cell Host Microbe 23 (2018) 705–715.
[7] S.V. Lynch, O. Pedersen, The human intestinal microbiome in health and disease, N.
Engl. J. Med. 375 (2016) 2369–2379.
[8] D. Chen, J. Wu, D. Jin, et al., Fecal microbiota transplantation in cancer manage-
ment: current status and perspectives, Int. J. Cancer (2018).
[9] A.M. Thomas, P. Manghi, F. Asnicar, et al., Metagenomic analysis of colorectal
cancer datasets identifies cross-cohort microbial diagnostic signatures and a link
with choline degradation, Nat. Med. 25 (2019) 667–678.
[10] H.M. Chen, Y.N. Yu, J.L. Wang, et al., Decreased dietary fiber intake and structural
alteration of gut microbiota in patients with advanced colorectal adenoma, Am. J.
Clin. Nutr. 97 (2013) 1044–1052.
[11] S.J. Bultman, Emerging roles of the microbiome in cancer, Carcinogenesis 35
(2014) 249–255.
[12] M.B. Burns, J. Lynch, T.K. Starr, et al., Virulence genes are a signature of the mi-
crobiome in the colorectal tumor microenvironment, Genome Med. 7 (2015) 55.
[13] S. Hu, L. Liu, E.B. Chang, et al., Butyrate inhibits pro-proliferative miR-92a by di-
minishing c-Myc-induced miR-17-92a cluster transcription in human colon cancer
cells, Mol. Cancer 14 (2015) 180.
[14] S. Bullman, C.S. Pedamallu, E. Sicinska, et al., Analysis of Fusobacterium persis-
tence and antibiotic response in colorectal cancer, Science 358 (2017) 1443–1448.
[15] Y. Furusawa, Y. Obata, S. Fukuda, et al., Commensal microbe-derived butyrate
induces the differentiation of colonic regulatory T cells, Nature 504 (2013)
446–450.
[16] E.E. Canfora, M. RCR, K. Venema, et al., Gut microbial metabolites in obesity,
NAFLD and T2DM, Nat. Rev. Endocrinol. 15 (2019) 261–273.
[17] J. Yang, J. Yu, The association of diet, gut microbiota and colorectal cancer: what
we eat may imply what we get, Protein Cell 9 (2018) 474–487.
[18] R. Simeoli, R.G. Mattace, C. Pirozzi, et al., An orally administered butyrate-re-
leasing derivative reduces neutrophil recruitment and inflammation in dextran
sulphate sodium-induced murine colitis, Br. J. Pharmacol. 174 (2017) 1484–1496.
[19] X. Long, M. Li, L.X. Li, et al., Butyrate promotes visceral hypersensitivity in an IBS-
like model via enteric glial cell-derived nerve growth factor, Neuro Gastroenterol.
Motil. 30 (2018) e13227.
[20] W. Wang, J. Wang, J. Li, et al., Cholecystectomy damages aging-associated in-
testinal microbiota construction, Front. Microbiol. 9 (2018) 1402.
[21] S. Wang, W. Dong, L. Liu, et al., Interplay between bile acids and the gut microbiota
466
Cancer Letters 469 (2020) 456–467
promotes intestinal carcinogenesis, Mol. Carcinog. 58 (2019) 1155–1167.
[22] S.L. Long, G. CGM, S.A. Joyce, Interactions between gut bacteria and bile in health
and disease, Mol. Asp. Med. 56 (2017) 54–65.
[23] T. Fu, S. Coulter, E. Yoshihara, et al., FXR regulates intestinal cancer stem cell
proliferation, Cell 176 (2019) 1098–1112 e18.
[24] N. Cassir, S. Benamar, B. La Scola, Clostridium butyricum: from beneficial to a new
emerging pathogen, Clin. Microbiol. Infect. 22 (2016) 37–45.
[25] H. Seki, M. Shiohara, T. Matsumura, et al., Prevention of antibiotic-associated
diarrhea in children by Clostridium butyricum MIYAIRI, Pediatr. Int. 45 (2003)
86–90.
[26] A. Hayashi, T. Sato, N. Kamada, et al., A single strain of Clostridium butyricum
induces intestinal IL-10-producing macrophages to suppress acute experimental
colitis in mice, Cell Host Microbe 13 (2013) 711–722.
[27] S. Mo, B.S. Kim, S.J. Yun, et al., Genome sequencing of Clostridium butyricum DKU-
01, isolated from infant feces, Gut Pathog. 7 (2015) 8.
[28] A. Yasueda, T. Mizushima, R. Nezu, et al., The effect of Clostridium butyricum
MIYAIRI on the prevention of pouchitis and alteration of the microbiota profile in
patients with ulcerative colitis, Surg. Today 46 (2016) 939–949.
[29] Y. Wang, Y. Gu, K. Fang, et al., Lactobacillus acidophilus and Clostridium butyricum
ameliorate colitis in murine by strengthening the gut barrier function and de-
creasing inflammatory factors, Benef. Microbes 9 (2018) 775–787.
[30] J. Sun, F. Wang, Z. Ling, et al., Clostridium butyricum attenuates cerebral ischemia/
reperfusion injury in diabetic mice via modulation of gut microbiota, Brain Res.
1642 (2016) 180–188.
[31] T. Miyaoka, M. Kanayama, R. Wake, et al., Clostridium butyricum MIYAIRI 588 as
adjunctive therapy for treatment-resistant major depressive disorder: a prospective
open-label trial, Clin. Neuropharmacol. 41 (2018) 151–155.
[32] Z.F. Chen, L.Y. Ai, J.L. Wang, et al., Probiotics Clostridium butyricum and Bacillus
subtilis ameliorate intestinal tumorigenesis, Future Microbiol. 10 (2015)
1433–1445.
[33] Y. Xiao, X. Dai, K. Li, et al., Clostridium butyricum partially regulates the devel-
opment of colitis-associated cancer through miR-200c, Cell. Mol. Biol. (Noisy-Le-
Grand) 63 (2017) 59–66.
[34] A. Klaus, W. Birchmeier, Wnt signalling and its impact on development and cancer,
Nat. Rev. Cancer 8 (2008) 387–398.
[35] Y. Yamada, H. Mori, Multistep carcinogenesis of the colon in Apc(Min/+) mouse,
Cancer Sci. 98 (2007) 6–10.
[36] R. Jackstadt, O.J. Sansom, Mouse models of intestinal cancer, J. Pathol. 238 (2016)
141–151.
[37] K.A. Baltgalvis, F.G. Berger, M.M. Peña, et al., The interaction of a high-fat diet and
regular moderate intensity exercise on intestinal polyp development in Apc Min/+
mice, Cancer Prev. Res. 2 (2009) 641–649.
[38] A. Saxena, R. Tammali, K.V. Ramana, et al., Aldose reductase inhibitor, fidarestat
prevents high-fat diet-induced intestinal polyps in ApcMin/+ mice, Curr. Cancer
Drug Targets 18 (2018) 905–911.
[39] Y. Shi, L.Z. Xu, K. Peng, et al., Specific immunotherapy in combination with
Clostridium butyricum inhibits allergic inflammation in the mouse intestine, Sci.
Rep. 5 (2015) 17651.
[40] J. Liu, C. Mu, W. Yue, et al., A diterpenoid derivate compound targets selenocys-
teine of thioredoxin reductases and induces Bax/Bak-independent apoptosis, Free
Radic. Biol. Med. 63 (2013) 485–494.
[41] T. Lu, Z. Zhu, J. Wu, et al., DRAM1 regulates autophagy and cell proliferation via
inhibition of the phosphoinositide 3-kinase-Akt-mTOR-ribosomal protein S6
pathway, Cell Commun. Signal. 17 (2019) 28.
[42] T. Satoh, S. Sugiura, K. Shin, et al., A multi-throughput multi-organ-on-a-chip
system on a plate formatted pneumatic pressure-driven medium circulation plat-
form, Lab Chip 18 (2017) 115–125.
[43] C. Yan, L. Luo, C.Y. Guo, et al., Doxorubicin-induced mitophagy contributes to drug
resistance in cancer stem cells from HCT8 human colorectal cancer cells, Cancer
Lett. 388 (2017) 34–42.
[44] Y. Peng, L. Qiu, D. Xu, et al., M4IDP, a zoledronic acid derivative, induces G1 arrest,
apoptosis and autophagy in HCT116 colon carcinoma cells via blocking PI3K/Akt/
mTOR pathway, Life Sci. 185 (2017) 63–72.
[45] H. Cao, S. Luo, M. Xu, et al., The secondary bile acid, deoxycholate accelerates
intestinal adenoma-adenocarcinoma sequence in Apc (min/+) mice through en-
hancing Wnt signaling, Fam. Cancer 13 (2014) 563–571.
[46] R. Xie, Y. Sun, J. Wu, et al., Maternal high fat diet alters gut microbiota of offspring
and exacerbates DSS-induced colitis in adulthood, Front. Immunol. 9 (2018) 2608.
[47] H. Esen, F. Erdi, B. Kaya, et al., Tissue thioredoxin reductase-1 expression in as-
trocytomas of different grades, J. Neuro Oncol. 121 (2015) 451–458.
[48] M. Hagio, M. Matsumoto, M. Fukushima, et al., Improved analysis of bile acids in
tissues and intestinal contents of rats using LC/ESI-MS, J. Lipid Res. 50 (2009)
173–180.
[49] C. Zhang, J.M. Monk, J.T. Lu, et al., Cooked navy and black bean diets improve
biomarkers of colon health and reduce inflammation during colitis, Br. J. Nutr. 111
(2014) 1549–1563.
[50] J. Yang, C. Ding, X. Dai, et al., Soluble dietary fiber ameliorates radiation-induced
intestinal epithelial-to-mesenchymal transition and fibrosis, JPEN - J. Parenter.
Enter. Nutr. 41 (2017) 1399–1410.
[51] Z. Xu, Y. Zhang, J. Jiang, et al., Epidermal growth factor induces HCCR expression
via PI3K/Akt/mTOR signaling in PANC-1 pancreatic cancer cells, BMC Canc. 10
(2010) 161.
[52] A. Isono, T. Katsuno, T. Sato, et al., Clostridium butyricum TO-A culture super-
natant downregulates TLR4 in human colonic epithelial cells, Dig. Dis. Sci. 52
(2007) 2963–2971.
[53] R. Nusse, H. Clevers, Wnt/β-Catenin signaling, disease, and emerging therapeutic
D. Chen, et al.
modalities, Cell 169 (2017) 985–999.
[54] P. Louis, G.L. Hold, H.J. Flint, The gut microbiota, bacterial metabolites and col-
orectal cancer, Nat. Rev. Microbiol. 12 (2014) 661–672.
[55] A.N. Thorburn, L. Macia, C.R. Mackay, Diet, metabolites, and "western-lifestyle"
inflammatory diseases, Immunity 40 (2014) 833–842.
[56] J. Suez, E. Elinav, The path towards microbiome-based metabolite treatment, Nat
Microbiol 2 (2017) 17075.
[57] A. Koh, F. De Vadder, P. Kovatcheva-Datchary, et al., From dietary fiber to host
physiology: short-chain fatty acids as key bacterial metabolites, Cell 165 (2016)
1332–1345.
[58] Y. Tian, Q. Xu, L. Sun, et al., Short-chain fatty acids administration is protective in
colitis-associated colorectal cancer development, J. Nutr. Biochem. 57 (2018)
103–109.
[59] A.L. Gartel, S.K. Radhakrishnan, Lost in transcription: p21 repression, mechanisms,
and consequences, Cancer Res. 65 (2005) 3980–3985.
[60] P. Ambalam, M. Raman, R.K. Purama, et al., Probiotics, prebiotics and colorectal
cancer prevention, Best Pract. Res. Clin. Gastroenterol. 30 (2016) 119–131.
[61] E. Jacouton, F. Chain, H. Sokol, et al., Probiotic strain Lactobacillus casei BL23
prevents colitis-associated colorectal cancer, Front. Immunol. 8 (2017) 1553.
[62] T. Wang, G. Cai, Y. Qiu, et al., Structural segregation of gut microbiota between
colorectal cancer patients and healthy volunteers, ISME J. 6 (2012) 320–329.
[63] P.D. Cani, Gut cell metabolism shapes the microbiome, Science 357 (2017)
548–549.
[64] H. Arimochi, K. Morita, S. Nakanishi, et al., Production of apoptosis-inducing
substances from soybean protein by Clostridium butyricum: characterization of
their toxic effects on human colon carcinoma cells, Cancer Lett. 277 (2009)
190–198.
[65] M.D. Schulz, C. Atay, J. Heringer, et al., High-fat-diet-mediated dysbiosis promotes
intestinal carcinogenesis independently of obesity, Nature 514 (2014) 508–512.
[66] A. Górska, D. Przystupski, M.J. Niemczura, et al., Probiotic bacteria: a promising
tool in cancer prevention and therapy, Curr. Microbiol. 76 (2019) 939–949.
[67] L. Ai, Y. Ren, Y. Li, et al., Synbindin deficiency inhibits colon carcinogenesis by
attenuating Wnt cascade and balancing gut microbiome, Int. J. Cancer 145 (2019)
206–220.
[68] P. Antas, L. Novellasdemunt, A. Kucharska, et al., SH3BP4 regulates intestinal stem
cells and tumorigenesis by modulating β-catenin nuclear localization, Cell Rep. 26
(2019) 2266–2273 e4.
[69] D.M. Gay, R.A. Ridgway, M. Müller, et al., Loss of BCL9/9l suppresses Wnt driven
tumourigenesis in models that recapitulate human cancer, Nat. Commun. 10 (2019)
723.
[70] H. Clevers, Wnt/beta-catenin signaling in development and disease, Cell 127 (2006)
467
Cancer Letters 469 (2020) 456–467
469–480.
[71] E. Ashihara, T. Takada, T. Maekawa, Targeting the canonical Wnt/β-catenin
pathway in hematological malignancies, Cancer Sci. 106 (2015) 665–671.
[72] A. Gagnaire, B. Nadel, D. Raoult, et al., Collateral damage: insights into bacterial
mechanisms that predispose host cells to cancer, Nat. Rev. Microbiol. 15 (2017)
109–128.
[73] M.R. Rubinstein, J.E. Baik, S.M. Lagana, et al., Fusobacterium nucleatum promotes
colorectal cancer by inducing Wnt/β-catenin modulator Annexin A1, EMBO Rep.
(2019) 20.
[74] A. Cotillard, S.P. Kennedy, L.C. Kong, et al., Dietary intervention impact on gut
microbial gene richness, Nature 500 (2013) 585–588.
[75] Z. Gao, B. Guo, R. Gao, et al., Microbiota disbiosis is associated with colorectal
cancer, Front. Microbiol. 6 (2015) 20.
[76] J.M. Ridlon, D.J. Kang, P.B. Hylemon, et al., Bile acids and the gut microbiome,
Curr. Opin. Gastroenterol. 30 (2014) 332–338.
[77] N. Hartmann, M. Kronenberg, Cancer immunity thwarted by the microbiome,
Science 360 (2018) 858–859.
[78] Y. Xiao, K. Zhou, Y. Lu, et al., Administration of antibiotics contributes to choles-
tasis in pediatric patients with intestinal failure via the alteration of FXR signaling,
Exp. Mol. Med. 50 (2018) 155.
[79] N. Keren, F.M. Konikoff, Y. Paitan, et al., Interactions between the intestinal mi-
crobiota and bile acids in gallstones patients, Environ Microbiol Rep 7 (2015)
874–880.
[80] M. Song, K. Wu, J.A. Meyerhardt, et al., Fiber intake and survival after colorectal
cancer diagnosis, JAMA Oncol 4 (2018) 71–79.
[81] S.J. O'Keefe, Diet, microorganisms and their metabolites, and colon cancer, Nat.
Rev. Gastroenterol. Hepatol. 13 (2016) 691–706.
[82] N. Singh, A. Gurav, S. Sivaprakasam, et al., Activation of Gpr109a, receptor for
niacin and the commensal metabolite butyrate, suppresses colonic inflammation
and carcinogenesis, Immunity 40 (2014) 128–139.
[83] D. Bolognini, A.B. Tobin, G. Milligan, et al., The pharmacology and function of
receptors for short-chain fatty acids, Mol. Pharmacol. 89 (2016) 388–398.
[84] S. Sivaprakasam, P.D. Prasad, N. Singh, Benefits of short-chain fatty acids and their
receptors in inflammation and carcinogenesis, Pharmacol. Ther. 164 (2016)
144–151.
[85] M. Thangaraju, G.A. Cresci, K. Liu, et al., GPR109A is a G-protein-coupled receptor
for the bacterial fermentation product butyrate and functions as a tumor suppressor
in colon, Cancer Res. 69 (2009) 2826–2832.
[86] Y. Tang, Y. Chen, H. Jiang, et al., G-protein-coupled receptor for short-chain fatty
acids suppresses colon cancer, Int. J. Cancer 128 (2011) 847–856.