Yeast

Yeast 2004; 21: 163–171.

Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/yea.1074
Yeast Functional Analysis Report

DsdA (D-serine deaminase): a new

heterologous MX cassette for gene disruption
and selection in Saccharomyces cerevisiae
Mara K. Vorachek-Warren and John H. McCusker*
Department of Molecular Genetics and Microbiology, 3020 Duke University Medical Center, Durham, NC 27710, USA

*Correspondence to: Abstract

John H. McCusker, Department
of Molecular Genetics and
Microbiology, 3020 Duke
University Medical Center,
Durham, NC 27710, USA.
E-mail: mccus001@mc.duke.edu,
http://www.duke.edu/web/
microlabs/mccusker/
Received: 4 August 2003
Accepted: 10 November 2003
Dominant drug resistance markers offer experimental flexibility in the study of
Saccharomyces cerevisiae by eliminating the dependence on auxotrophic mutations
and, because they are phenotypically neutral, avoid the deleterious effects of
auxotrophic mutations. We have developed a new dominant resistance marker,
dsdAMX4, for use in the genetic manipulation of S. cerevisiae. The dsdA gene, which
is derived from Escherichia coli and encodes a D-serine deaminase, confers to S.
cerevisiae resistance to D-serine and the ability to use D-serine as a nitrogen source.
Here we describe the construction of a dsdAMX4 cassette, capable of expression in
S. cerevisiae, and the characterization of this new marker for use in chromosomal
gene disruption. The unique selection properties of the dsdAMX4 cassette make it an
important addition to the existing array of S. cerevisiae genetic tools. Copyright 
2004 John Wiley & Sons, Ltd.
Keywords: MX cassette; D-serine; DsdA; D-serine deaminase; dominant drug resis-
tance marker; heterologous drug resistance marker

Introduction Wieczorke et al., 1999) or multiple signalling path-

The development of heterologous MX cassettes,
expressing several different dominant drug resis-
tance markers, for selectable gene disruption (Wach
et al., 1994; Goldstein and McCusker, 1999) have
facilitated the genetic manipulation of Saccha-
romyces cerevisiae by virtually eliminating the
problems with mistargeting (Wach et al., 1994).
Dominant drug resistance markers confer exper-
imental flexibility by abolishing dependence on
auxotrophic mutations. In addition, the delete-
rious effects of auxotrophic markers (Atkinson
et al., 1980; Baganz et al., 1997; Goldstein and
McCusker, 1999, 2001; Schroeder and Breitenbach,
1981; Smith, et al., 1995, 1996) can be avoided by
using phenotypically neutral dominant drug resis-
tance markers. The development of new, dominant
drug resistance markers for homologous gene dis-
ruption is important for three reasons. First, due to
gene duplication events (e.g. hexose transporters;
ways (e.g. pseudohyphal formation; Pan et al.,
2000; Rupp et al., 1999), many pathways and sys-
tems are difficult to dissect with single gene disrup-
tions. Second, when looking for synthetic pheno-
types in double mutants, dominant drug resistance
markers provide a simple way to ‘mark’ muta-
tions in crosses. Third, when looking for subtle
phenotypic defects, dominant drug resistance mark-
ers provide a simple way to distinguish strains
in small-scale competition experiments (Goldstein
and McCusker, 2001; Steinmetz et al., 2002).
We have developed a new dominant resistance
marker, dsdAMX4, for use in the genetic manip-
ulation of S. cerevisiae. The dsdA gene, which
is derived from Escherichia coli and encodes a
D-serine deaminase (McFall, 1987), confers to S.
cerevisiae resistance to D-serine and the ability to
use D-serine as a nitrogen source. Here we describe
the construction of a dsdAMX4 cassette, capable of
expression in S. cerevisiae, and the characterization

Copyright  2004 John Wiley & Sons, Ltd.

164 M. K. Vorachek-Warren and J. H. McCusker

of this new marker for use in chromosomal gene
disruption. The phenotypes of the dsdAMX4 cas-
sette make it a unique and important addition to
the catalogue of S. cerevisiae genetic tools.
Methods
Strains and media
Genomic Escherichia coli DNA was isolated from
wild type K12 strain W3110. Host E. coli strain
XL1blue was used to amplify plasmids. Sac-
charomyces cerevisiae strains and plasmids are
listed in Table 1. Yeast extract peptone dex-
trose (YPD), YPGalactose and synthetic dextrose
(SD) media were prepared as previously described
(Rose et al., 1989). Selection for the kanMX4 and
natMX4 markers was performed on YPD contain-
ing 200 µg/ml G418 (YPD + G418; obtained from
Life Technologies) or 100 µg/ml nourseothricin
(Werner BioAgents), respectively. Two different
D-serine selection media were used. Yeast trans-
formants harbouring the dsdA gene in a CEN
plasmid backbone were selected on SDSer (syn-
thetic dextrose D-serine) medium containing 2%
w/v dextrose, 0.17% Difco yeast nitrogen base
without ammonium sulphate or amino acids, and
500 µg/ml D-serine (Sigma-Aldrich). For selection
of yeast transformants with successful directed
chromosome integration of the dsdAMX4 cas-
sette, the SDPSer (synthetic dextrose proline D-
serine) medium contained 2% w/v dextrose, 0.17%
yeast nitrogen base without ammonium sulphate or
amino acids, 5 mg/ml L-proline, and 2 mg/ml D-
serine. Solid media contained 2% w/v agar.
Construction of plasmids containing D-serine
resistance cassette
The dsdA gene (GenBank Accession No. AE000-
324 U00096) was amplified from E. coli strain
W3110 genomic DNA using primers MV007 and
MV008 (Table 2), which contain sequences homol-
ogous to the 3
region of the promoter and 5
region
of the terminator, respectively, of the TEF gene
from the filamentous fungus Ashbya gossypii con-
tained in the MX4 cassette (Wach et al., 1994).
Each 100 µl reaction contained 20 mM Tris–HCl
(pH 8.4), 50 mM KCl, 2.5 mM MgCl2 , 0.2 mM
dNTPs, 1.0 µM each primer, 10–20 ng genomic
DNA, and 10 units Taq DNA polymerase (Invitro-
gen). The temperature profile for the reaction began
with a 3 min incubation at 94 ◦ C followed by five
low-stringency cycles (94 ◦ C for 45 s, 45 ◦ C for
45 s, and 72 ◦ C for 2 m) and 25 higher-stringency
cycles (the annealing temperature was shifted to
55 ◦ C) and terminated with a 10 min extension at
72 ◦ C. Plasmid pAG26, which was derived from the
CEN6-containing plasmid pRS316 (Sikorski and
Hieter, 1989; Goldstein and McCusker, 1999), was

Table 1. Saccharomyces cerevisiae strains and plasmids used in this study

Name Genotype Reference

Strains
YJM237 MATa//MATα ho/ho LYS2/lys2-101 LYS5/lys5-101 gal2/gal2 (McCusker et al., 1994)
YMV101 Derived from YJM237, ho/ho::dsdAMX4 This study
YMV102 Derived from YJM237, ho/ho::dsdAMX4 This study
YMV103 Derived from YJM237, ho/ho::kanMX4 This study
YMV104 Derived from YJM237, ho/ho::kanMX4 This study
S019 MATαura3-1 (Goldstein and McCusker, 1999)
YMV109 Derived from S019, ho::loxP-dsdAMX4-loxP This study
YMV110 Derived from S019, ho::loxP-dsdAMX4-loxP This study
YMV111 Derived from S019, ho::loxP-dsdAMX4-loxP This study
Plasmids
pAG26 hphMX4 CEN URA3 (Goldstein and McCusker, 1999)
pMKV001 Derived from pAG26, dsdAMX4 CEN URA3 This study
pFA6 kanMX4 (Wach et al., 1994)
pUG6 loxP-kanMX4-loxP (Güldener et al., 1996)
pNATCre natMX4 Cre (Steensma and Ter Linde, 2001)
pMKV005 Derived from pAG26, loxP-kanMX4-loxP CEN URA3 This study
pMKV006 Derived from pMKV005, loxP-dsdAMX4-loxP CEN URA3 This study

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 163–171.
D-serine deaminase MX cassettes 165

dsdAMX4 cassette construction into pAG26 restriction-digested within the hygromycin resis-
dsdAMX4 cassette construction into pAG26

Verify homologous integration at lys5 locus

Verify excision at loxP sites within ho locus
Verify excision at loxP sites within ho locus
loxP-kanMX4-loxP integration into pAG26
loxP-kanMX4-loxP integration into pAG26
Verify homologous integration at ho locus
Verify homologous integration at ho locus
tance gene (hph) using RsrII. Yeast strain S019
was made competent by lithium acetate treatment
and approximately 20 ng PCR product and 5 ng
digested plasmid were introduced by heat shock at
42 ◦ C (Geitz, et al., 1995). Cells were incubated
at 30 ◦ C for 3 h to allow expression of the dsdA
his3 targeting primer
his3 targeting primer
lys5 targeting primer
lys5 targeting primer
ho targeting primer
ho targeting primer

gene, pelleted by centrifugation, and washed with

sterile water to decrease available nutrients. Yeast
Comments

harbouring plasmids successfully replacing the hph

open reading frame (ORF) with the dsdA ORF,
as illustrated in Figure 1A, were selected by plat-
ing on SDSer medium. Plasmid pMKV001 was
isolated from the yeast (Hoffman and Winston,
1987) and introduced into CaCl2 -competent E. coli
XL1blue for amplification.
GATACAGTTCTCACATCACATCCGAACATAAACAACCATGGAAAACGCTAAAATGAACTCGa

TTACTTTTATTACATACAACTTTTTAAACTAATATACACATTTTAGCATAGGCCACTAGTGGATCTG

To construct a CEN plasmid containing the

CATATCCTCATAAGCAGCAATCAATTCTATCTATACTTTAAAATGCAGCTGAAGCTTCGTACGC

loxP–dsdAMX4–loxP gene cassette, the loxP–

GTTCTTGAAAACAAGAATCTTTTTATTGTCAGTACTGATTAACGGCCTTTTGCCAGATA

GAATGAGGAGAAAGAGAATCACTCAGCAAAAAAACCGTGGCAGCTGAAGCTTCGTACGC
AATAAGAGTCTATCGATTACATAAATGTGAGCAAGCGAACATAGGCCACTAGTGGATCTG
AAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAGCTGAAGCTTCGTACGC

kanMX4–loxP gene cassette was amplified as

GTATATATATCGTATGCTGCAGCTTTAAATAATCGGTGCATAGGCCACTAGTGGATCTG

described above from 10 ng of pUG6 (Güldener

et al., 1996), using primers MV021 and MV022
(Table 2), which contain sequences homologous to
CAAAAGCTGGGTACTAGAGCGGGCGGCCGCATAGGCCACTAGTGGATCTG
CGAATTGGAGCTCCACCGCGGTGGCGGCCGCCAGCTGAAGCTTCGTACGC

the polylinker region 5
and 3
of the MX4 cassette

in pAG26, respectively, as shown in Figure 1B.
Approximately 20 ng PCR product and 5 ng 5000
bp product of pAG26 digested with XmaI and
ClaI were introduced into competent S019 and
selection was performed on YPD + G418. Plas-
mid pMKV005 was isolated from G418-resistant
colonies and introduced into XL1blue for ampli-
fication. The purified plasmid was restriction-
digested by NruI, which cuts within the kan gene.
Approximately 5 ng digested plasmid and 15 ng
the same dsdA PCR product used to construct plas-
mid pMKV001 was introduced, as before, into
competent S019 yeast cells. Selection for plas-
GTTCGCTGATACGTGTTACG
CAAGGCCATGTCTTCTCGTT
CGCAAGTCCTGTTTCTATGC

mids containing the dsdA gene within the MX cas-

CCTCGACATCATCTGCCC

CTACGTTGCCTCCATCG

sette was performed on SDSer medium. Plasmid

pMKV006 was isolated from yeast and introduced
into XL1blue for amplification.
Sequence 5
to 3

Bold type denotes dsdA sequence.

Table 2. Oligonucleotides

Plasmid requests

The plasmids pMKV001 (dsdAMX4, Accession

No. P30203) and pMKV006 (loxP–dsdAMX4–
loxP, Accession No. P30204) can be obtained indi-
vidually or as a package from Euroscarf (Frankfurt,
Primer

MV007
MV008

MV021
MV022
PH005
PH006

PH007
PH008
HS249
HS250

HS166
SA125
SA126

SA135

Germany; http://www.uni-frankfurt.de/fb15/
JM37

mikro/euroscarf/index.html).
a

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 163–171.
166 M. K. Vorachek-Warren and J. H. McCusker

A Primers

Av HI
Bs III

Bg I

II
Sa I

sH
iW

Pa I
1: MV007

tE

I
d

I
eI
aI

cI

lII
I

lI
ot

ot
in

Xm

la

iI
Ba

Sp
Bs

Bs

Sf
N
H

N
2: MV008
3: MV021
4: MV022

Plasmids:

II
I
lu
rI

sr
M
Bt

R
P-TEF hph T-TEF pAG26

aI
m
/X
I
I

Pm EI
sH
xA

eI

aI

I
sc
p

Av

1
Bs
Se

Bs

M
dsdA pMKV001
( 1329 bp)
2

B
Bs III
Sa I
iW

aI

I
d

I
eI
aI
I

lI
ot

ot
in

Xm

la

iI
Sp
Av

Sf
N
H

N
II
Bt II

dI
tE

I
Bg I
Bs I

I
I

oI
I
a
lI

la
ru

3
in

a
lu
rI
Xb

Xh
Av
C

H
M

loxP P-TEF KAN T-TEF loxP pMKV005

(810 bp) 4
II
Bs I

Pm EI
sH

aI
xA

eI

I
sc
p

Xm

1
Se

Bs

dsdA pMKV006
(1329 bp) 2

Figure 1. Construction of the new dsdAMX4 cassettes. (A) The dsdA ORF was amplified from E. coli genomic DNA using
primers MV007 and MV008, containing regions of homology to the 3
end of the TEF promoter and the 5
end of the
TEF terminator, respectively. Plasmid pAG26 (Goldstein and McCusker, 1999) was digested within the hph ORF using
restriction endonuclease RsrII. The amplified fragment and digested plasmid were introduced into yeast strain S019 and
plasmid pMKV001 was created by the exchange of the hph ORF for dsdA through gap repair, selecting for the resistance
to D-serine. (B) Plasmid pAG26 was digested with XmaI and ClaI, which remove the entire hphMX4 cassette, including the
TEF promoter and terminator, from the plasmid backbone. The loxP–kanMX4–loxP cassette was amplified from plasmid
pUG6 (Güldener et al., 1996), using primers MV021 and MV022 containing sequence homology to the region 5
and 3

of the XmaI and ClaI sites of the digested pAG26 plasmid. The PCR product and digested plasmid were introduced into
S019 and the successful homologous integration of the loxP–kanMX4–loxP cassette was selected on YPD + G418 media,
creating plasmid pMKV005. The dsdA gene was again amplified from E. coli strain W3110 using primers MV007 and MV008
and plasmid pMKV005 was restriction-digested within the kanMX4 cassette with NruI. Plasmid pMKV006 was created by
gap repair in yeast strain S019 by simultaneous introduction of the dsdA PCR product and digested pMKV005 plasmid,
selecting for resistance to D-serine

Targeted disruption of chromosomal genes template (either pFA6, pMKV001 or pMKV006)

using 1.0 µM each primer. PCR products were gel-
Targeted gene disruption constructs were ampli- purified to eliminate template plasmid using the
fied by PCR under the reaction conditions and Qiagen Qiaquick Gel Extraction kit. Approximately
temperature profile described above from 10 ng 500 ng PCR products were introduced into lithium

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 163–171.
D-serine deaminase MX cassettes
acetate competent S. cerevisiae. After a 3 h incu-
bation at 30 ◦ C in YPD, successful transformants
were selected by growth on SDPSer medium, sup-
plemented as needed, or YPD + G418.
Targeting efficiency of the dsdA D-serine
resistance cassette
The his3 and lys5 loci were targeted for disruption
in S019 by either the dsdAMX4 or kanMX4 cas-
sette, amplified as described above from pMKV001
or pFA6, respectively. Primers used were PH005
and PH006 for the his3 deletion and SA125
and SA126 for the lys5 deletion. Transformants
were selected on SDPSer, supplemented with
either 50 µg/ml L-histidine or 100 µg/ml L-lysine,
or YPD + G418. Resistant colonies were replica-
plated onto SD medium containing 10 µg/ml uracil
to confirm the auxotrophy. Successful integration at
the lys5 locus was confirmed by PCR using primers
SA135 and JM37.
Neutrality of the dsdA gene cassette
One copy of the ho locus was disrupted in YJM237
by either the dsdAMX4 or kanMX4 cassette, ampli-
fied as described above from pMKV001 or pFA6,
respectively, with primers HS249 and HS250. Suc-
cessful integration into the ho locus was confirmed
by PCR using primers JM37 and HS166. Reac-
tions contained 20 mM Tris–HCl (pH 8.4), 50 mM
KCl, 2.5 mM MgCl2 , 200 µM dNTPS, 0.6 µM each
primer, 2 units Taq DNA polymerase, and cells
from a single resistant colony as template. The tem-
perature profile of the reaction began with a 2 min
hot start at 94 ◦ C, followed by 30 cycles of 94 ◦ C
for 30 s, 50 ◦ C for 30 s, and 72 ◦ C for 1.5 min, and
finished with a 10-min extension at 72 ◦ C.
A single colony from each confirmed isolate was
inoculated into 2 ml YPD and grown overnight
at 30 ◦ C on a rotating drum. Cells were counted
by haemocytometer and an equal number of cells
from each resistant strain were mixed. Cell mix-
tures were diluted in sterile water to 2 × 103
cells/ml and approximately 200 cells were inoc-
ulated into 100 ml YPD. Cultures were grown to
saturation (∼2 × 108 cell/ml), cells were counted,
and approximately 200 cells were used to inoculate
another 100 ml YPD. This process was repeated
once more. At 0, 24, 48 and 72 population dou-
blings, approximately 200 cells were plated onto
Copyright  2004 John Wiley & Sons, Ltd.
167
YPD and subsequently replica-plated from the
YPD onto SDPSer plates and onto YPD + G418
plates to compare the relative growth of the two
differently marked strains.
Excision of the loxP–dsdAMX4–loxP cassette
using the Cre recombinase
The ho locus was targeted for disruption in S019
by the loxP–dsdAMX4–loxP cassette, amplified
as described above from pMKV006 using primers
HS249 and HS250. Transformants were selected
on SDPSer and successful integration was con-
firmed using primers JM37 and HS166. Three S019
ho::loxP–dsdAMX4–loxP isolates were selected
and pNATCre, a CEN plasmid carrying the gene
for the Cre recombinase expressed from the yeast
GAL1 promoter and marked with nat1, confer-
ring resistance to nourseothricin (Steensma and Ter
Linde, 2001), was introduced. Selection for the
Cre-containing plasmid was performed on YPD
containing 100 µg/ml nourseothricin and approx-
imately 100 resistant colonies were swabbed from
the plates and inoculated into 5 ml YPGalactose,
and incubated in a rotating drum at 30 ◦ C for 3 h.
Cultures were diluted 10−4 and 100 µl was plated
onto YPD. For each of the three sets of isolates,
40 colonies were streaked onto YPD and replica
plated to SDPSer. Isolates that were sensitive to
SDPSer were confirmed as ho::loxP by colony
PCR, using primers PH007 and PH008 under the
standard amplification conditions described above.
Results and Discussion
Media conditions for selection of
dsdA-mediated resistance to D-serine
S. cerevisiae strain S019 was tested for growth
on SD + uracil plates containing several different
concentrations of D-serine. Varying amounts of L-
proline were added both as a nitrogen source [sub-
stituting for 5 mg/ml (NH4 )2 SO4 ] and to induce
expression/activity of Gap1p, the general amino
acid transporter capable of D-amino acid uptake
(Chen and Kaiser, 2002; Rytka, 1975). It was
determined that yeast is sensitive to D-serine at
concentrations as low as 100 µg/ml in medium
supplemented with 100 µg/ml L-proline, with com-
plete growth inhibition at 1 mg/ml D-serine supple-
mented with 100 µg/ml L-proline (data not shown).
Yeast 2004; 21: 163–171.
168
However, consistent with work by others (Rytka,
1975), S. cerevisiae gap1 mutants are resistant to
very high concentrations (2 mg/ml) of D-serine,
confirming that efficient Gap1p-mediated transport
of D-serine into the cell is necessary for selection
(data not shown).
When the gene encoding D-serine deaminase is
expressed from an MX4 cassette on a CEN plas-
mid, selection can be performed on SD medium
containing 500 µg/ml D-serine (SDSer) and no
additional nitrogen source. However, selection for
transformants expressing dsdA from the MX4 cas-
sette integrated into the genome, as is the case
with the insertional deletion of chromosomal genes,
requires L-proline as a nitrogen source and D-
serine at a four-fold higher concentration, 2 mg/ml
(SDPSer), possibly indicating that the dsdA gene
is not well transcribed from the TEF promoter
when integrated into the genome. Spontaneous
gap1 mutations (at a frequency of approximately
10−6 ) may produce a low background during selec-
tion for D-serine resistance on media containing any
additional nitrogen source. However, these gap1
mutants can be detected easily by: (a) confirmation
PCR of the target locus; (b) their cross-resistance
to D-histidine (Rytka, 1975); and/or (c) their inabil-
ity to grow on medium containing L-citrulline as
the sole nitrogen source (Grenson et al., 1970) and
should not interfere with the success of the trans-
formation.
Interestingly, the requirement for L-proline as a
nitrogen source applies only during the initial, post-
transformation selection as dsdAMX4-containing
integrative transformants will grow on SDSer when
streaked for single colonies. Therefore, counter-
selection against spontaneous gap1 mutants can
also be performed by requiring the utilization of
D-serine as the sole nitrogen source.
Targeting efficiency of dsdAMX4
To compare the consistency of homologous inte-
gration for the dsdAMX4 cassette at a single chro-
mosomal locus with that of the kanMX4 cassette,
the two cassettes were targeted for either the his3
or the lys5 locus. Both cassettes were amplified
using primers PH005 and PH006 for targeting
his3, or SA125 and SA126 for targeting lys5, and
introduced into S019. Selection was performed on
either YPD + G418 plates or on SDPSer plates
Copyright  2004 John Wiley & Sons, Ltd.
M. K. Vorachek-Warren and J. H. McCusker
supplemented with 10 µg/ml uracil and 50 µg/ml L-
histidine or 100 µg/ml L-lysine, as required. G418-
resistant or D-serine resistant colonies were rese-
lected on YPD + G418 plates or on SDSer plates
supplemented with 10 µg/ml uracil and subse-
quently replica-plated to YPD and synthetic dex-
trose (SD) containing 10 µg/ml uracil. When tar-
geted to the his3 locus, 17 of 20 (85%) G418-
resistant isolates tested did not grow on medium
lacking histidine compared to 14 of 20 (70%) of D-
serine-resistant isolates. Targeting of the cassettes
to the lys5 locus yielded similar results, with 18 of
20 G418-resistant and 17 of 20 D-serine-resistant
isolates confirmed as lys5 mutants by lysine aux-
otrophy and PCR.
Caution should be used when applying D-serine
selection to auxotrophic strains that require supple-
mentation of the media. The addition of too much
of an alternative nitrogen source, as would be the
case in rich media or media supplemented with a
concentration of metabolically usable amino acids
or ammonium sulphate greater than 10 mg/ml,
abolishes not only the selection for D-serine utiliza-
tion, but sensitivity as well (data not shown). Pre-
sumably, this is caused by competition for uptake
and/or by the lack of general amino acid permease
activity (Rytka, 1975). Furthermore, higher concen-
trations of L-histidine and L-lysine than normally
provided were necessary in order to obtain the his3
and lys5 D-serine resistant transformants. This may
reflect a careful balance in amino acid uptake sys-
tems used to transport both D-serine and amino
acids required by auxotrophs into the cell (Rytka,
1975).
Neutrality of the dsdAMX4 gene cassette
In S. cerevisiae genetic studies, phenotypically
neutral markers are particularly useful. It has
been demonstrated previously that the kanMX4,
hphMX4, natMX4 and patMX4 cassettes inte-
grated at the ho locus of a diploid S288c labo-
ratory strain are phenotypically neutral under lab-
oratory conditions (Baganz et al., 1997; Goldstein
and McCusker, 1999). The kanMX4 and dsdAMX4
cassettes were integrated into one copy of the ho
locus of a prototrophic diploid, S288c background
strain, YJM237. Two isolates from each resis-
tance marker transformation were used in growth
competition experiments to compare the neutral-
ity of the gene cassettes. YMV101 and YMV102
Yeast 2004; 21: 163–171.
D-serine deaminase MX cassettes 169

(ho/ho::dsdAMX4) and YMV103 and YMV104 A 80 YMV101 ho/ho::dsdAMX4

(ho/ho::kanMX4) were grown to saturation in YMV103 ho/ho::kanMX4
YPD liquid medium. Equal amounts of cells from 60
YMV101 and YMV103 were mixed, and likewise

YMV102 and YMV104. The mixed cultures were
diluted with sterile water and roughly 200 cells
were inoculated into 100 ml YPD. Every 24 popu-
lation doublings, the stationary phase cultures were
diluted and re-inoculated into 100 ml fresh liquid
YPD media, allowing the cultures to grow under
non-selective conditions for a total of 72 dou-
blings. Samples were removed in duplicate from
each mixed culture at 0, 24, 48 and 72 doublings
and plated first to YPD and then replica-plated to
YPD + G418 and SDSer plates to determine the
fraction of cells resistant to either drug. As shown
in Figure 2A, B, the percentage of each strain con-
taining either marker cassette remained stable dur-
ing the entire outgrowth, staying within 5% of the
initial inoculation ratio. This confirms that, similar
to the kanMX4 cassette, the dsdAMX cassette has
no deleterious effect on growth rate under the con-
ditions tested. Therefore, like other dominant drug
resistance marker cassettes, the dsdAMX4 cassette
can be used effectively to mark strains in compe-
tition experiments (Baganz et al., 1997; Goldstein
and McCusker, 1999, 2001).
A loxP–dsdAMX4–loxP cassette for repeated
use in S. cerevisiae
The loxP –kanMX4–loxP cassette, which can be
used to repeatedly delete genes on the yeast
genome, is extremely useful (Güldener et al.,
2002). To determine whether the dsdAMX4 cassette
can be excised effectively from the yeast genome, a
loxP–dsdAMX4–loxP cassette-bearing CEN plas-
mid, pMKV006, was constructed using gap repair
(Ma et al., 1987). This new cassette was amplified
from the plasmid using primers HS249 and HS250
for homologous integration into the ho locus. Fol-
lowing introduction of the PCR product into S019,
transformants were selected on SDPSer medium
containing 10 µg/ml uracil. After PCR confirma-
tion of a correct integration event with primers
HS166 and JM37, the Cre recombinase encod-
ing plasmid, pNATCre was introduced into three
separate ho::loxP-dsdAMX4-loxP isolates. From
each of the three ho::loxP-dsdAMX4-loxP iso-
lates into which pNATCre was introduced, approx-
imately 100 nourseothricin-resistant colonies were
% of Culture
40
20
0
0 24 48 72
Generations
B 80
YMV102 ho/ho::dsdAMX4
YMV104 ho/ho::kanMX4
60
% of Culture
40
20
0
0 24 48 72
Generations
Figure 2. Neutrality and stability of the dsdAMX4 cassette
in S. cerevisiae. Resistance cassettes kanMX4 and dsdAMX4
were integrated into a single ho locus of YJM237 by
homologous recombination. In two separate experiments a
single ho/ho::dsdAMX4 isolate, either YMV101 or YMV102,
was mixed in equal proportions with either YMV103
or YMV104, ho/ho::kanMX4 isolates, and grown for 72
population doublings under non-selective conditions. At
0, 24, 48 and 72 doublings, samples were removed in
duplicate and approximately 200 cells were plated onto
YPD without selection. Colonies were replica-plated onto
either SDSer or YPD containing 200 µg/ml G418 to
calculate the percentage of either resistance phenotype
in the culture. Each data point is the average of the
two sample measurements. (A) The comparison between
isolates YMV101 and YMV103 over 72 generations. (B) The
results of the competition between isolates YMV102 and
YMV104 performed in the same manner
collected and inoculated into YP + 2% w/v galac-
tose to induce expression of the Cre recombinase
from the GAL1 promoter. From each of the three
galactose-grown cultures, roughly 200 cells were
plated onto YPD and 40 of the resulting colonies
were tested for D-serine sensitivity on SDPSer
plates containing 10 µg/ml uracil; 80% of the iso-
lates were D-serine sensitive.

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 163–171.
170
To determine whether the dsdAMX4 cassette had
been correctly excised, genomic DNA from 24 D-
serine-sensitive colonies (eight from each of the
three galactose-grown cultures) was PCR-amplified
using primers PH007 and PH008, which flank the
ho gene. Consistent with these D-serine sensitive
isolates having excised dsdAMX4 and leaving one
loxP site (ho::loxP ), 23/24 D-serine sensitive
isolates yielded a PCR product of approximately
1200 base pairs, the expected size of the fragment
after proper excision (data not shown). Therefore,
by using the loxP–dsdAMX4–loxP cassette, one
is able to repeatedly disrupt different genes on
the chromosome without limiting the number of
available markers for further experiments. In this
way, strain construction can be simplified and
expedited for studies requiring the disruption of
several genes in a regulatory pathway or that
encode proteins of overlapping function.
Conclusion
With the sequencing of the S. cerevisiae genome,
the functional characterization of thousands of
known and unknown gene products, many with
subtle contributions to phenotype, has over-
whelmed the field of yeast genetics. This ongoing
study has rendered the use and development of
heterologous markers imperative, therefore making
the dsdAMX4 cassette, with its unique selection
properties, a much-needed addition to the library
of tools available.
Acknowledgements
This work was supported by the National Institutes of
Health, USA (Grants RO1 GM-58129, RO1 GM-58476).
References
Atkinson KD, Jensen B, Kolat AI, et al. 1980. Yeast mutants
auxotrophic for choline or ethanolamine. J Bact 141: 558–564.
Baganz F, Hayes A, Marren D, Gardner DC, Oliver SG. 1997.
Suitability of replacement markers for functional analysis studies
in Saccharomyces cerevisiae. Yeast 13: 1563–1573.
Chen EJ, Kaiser CA. 2002. Amino acids regulate the intracellular
trafficking of the general amino acid permease of Saccharomyces
cerevisiae. Proc Natl Acad Sci USA 99: 14 837–14 842.
Geitz RD, Scheistl RH, Wellems AR, Woods RA. 1995. Stud-
ies on the transformation of intact yeast cells by the
LiAc/SS–DNA/PEG procedure. Yeast 11: 355–360.
Copyright  2004 John Wiley & Sons, Ltd.
M. K. Vorachek-Warren and J. H. McCusker
Goldstein AL, McCusker JH. 1999. Three new dominant drug
resistance cassettes for gene disruption in Saccharomyces
cerevisiae. Yeast 15: 1541–1553.
Goldstein AL, McCusker JH. 2001. Development of Saccha-
romyces cerevisiae as a model pathogen. A system for
the genetic identification of gene products required for sur-
vival in the mammalian host environment. Genetics 159:
499–513.
Grenson M, Hou C, Crabeel M. 1970. Multiplicity of the amino
acid permeases in Saccharomyces cerevisiae. IV. Evidence
for a general amino acid permease. J Bacteriol 103:
770–777.
Güldener U, Heinisch J, Koehler GJ, Voss D, Hegemann JH.
2002. A second set of loxP marker cassettes for Cre-mediated
multiple gene knockouts in budding yeast. Nucleic Acids Res
30: e23.
Güldener U, Heck S, Fielder T, Beinhauer J, Hegemann JH. 1996.
A new efficient gene disruption cassette for repeated use in
budding yeast. Nucleic Acids Res 24: 2519–2524.
Hoffman CS, Winston F. 1987. A ten-minute DNA preparation
from yeast efficiently releases autonomous plasmids for
transformation of Escherichia coli . Gene 57: 267–272.
Ma H, Kunes S, Schatz PJ, Botstein D. 1987. Plasmid con-
struction by homologous recombination in yeast. Gene 58:
201–216.
McCusker JH, Clemons KV, Stevens DA, Davis RW. 1994.
Genetic characterization of pathogenic Saccharomyces cere-
visiae isolates. Genetics 136: 1261–1269.
McFall E. 1987. The D-serine deaminase operon. In Escherichia
coli and Salmonella typhimurium: Cellular and Molecular
Biology Volume 2, Neidhardt FC, Ingraham JL, Low KB, et al.
(eds). American Society for Microbiology: Washington DC;
1520–1526.
Pan X, Harashima T, Heitman J. 2000. Signal transduction cas-
cades regulating pseudohyphal differentiation of Saccharomyces
cerevisiae. Curr Opin Microbiol 3: 567–572.
Rose MD, Winston F, Hieter P. 1989. Methods in Yeast Genetics.
Cold Spring Harbour Laboratory Press: New York.
Rupp S, Summers E, Lo HJ, Madhani H, Fink G. 1999. MAP
kinase and cAMP filamentation signalling pathways converge on
the unusually large promoter of the yeast FLO11 gene. EMBO
J 18: 1257–1269.
Rytka J. 1975. Positive selection of general amino acid permease
mutants in Saccharomyces cerevisiae. J Bacteriol 121: 562–570.
Schroeder R, Breitenbach M. 1981. Metabolism of myo-inositol
during sporulation of myo-inositol-requiring Saccharomyces
cerevisiae. J Bacteriol 146: 775–783.
Sikorski RS, Hieter P. 1989. A system of shuttle vectors and
yeast host strains designed for efficient manipulation of DNA in
Saccharomyces cerevisiae. Genetics 122: 19–27.
Smith V, Botstein D, Brown PO. 1995. Genetic footprinting: a
genomic strategy for determining a gene’s function given its
sequence. Proc Natl Acad Sci USA 92: 6479–6483.
Smith V, Chou KN, Lashkari D, Botstein D, Brown PO. 1996.
Functional analysis of the genes of yeast chromosome V by
genetic footprinting. Science 274: 2069–2074.
Steensma HY, Ter Linde JJ. 2001. Plasmids with the Cre-
recombinase and the dominant nat marker, suitable for
use in prototrophic strains of Saccharomyces cerevisiae and
Kluyveromyces lactis. Yeast 18: 469–472.
Yeast 2004; 21: 163–171.
D-serine deaminase MX cassettes
Steinmetz LM, Sinha H, Richards DR, et al. 2002. Dissecting the
architecture of a quantitative trait locus in yeast. Nature 416:
326–330.
Wach A, Brachat A, Pohlmann R, Philippsen P. 1994. New
heterologous modules for classical or PCR-based gene
disruptions in Saccharomyces cerevisiae. Yeast 10: 1793–1808.
Copyright  2004 John Wiley & Sons, Ltd.
171
Wieczorke R, Krampe S, Weierstall T, et al. 1999. Concurrent
knock-out of at least 20 transporter genes is required to block
uptake of hexoses in Saccharomyces cerevisiae. FEBS Lett 464:
123–128.
Yeast 2004; 21: 163–171.