Biomedicine & Pharmacotherapy 149 (2022) 112868

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

Insulin like growth factor-1 works synergistically with dopamine to

attenuate diabetic retinopathy by downregulating vascular endothelial
growth factor
Shikha Upreti a, Seema Sen b, Tapas Chandra Nag c, Madhumita P. Ghosh a, *
a
Ocular Pharmacology and Therapeutics Lab, Centre for Medical Biotechnology, Amity Institute of Biotechnology, Amity University Uttar Pradesh, Noida 201313, India
b
Department of Ocular Pathology, Dr R.P. Centre for Ophthalmic Sciences, All India Institute of Medical Sciences, Ansari Nagar, New Delhi 110029, India
c
Department of Anatomy, All India Institute of Medical Sciences, Ansari Nagar, New Delhi 110029, India

A R T I C L E I N F O A B S T R A C T

Keywords: Aim: Levels of Insulin-like growth factor-1 (IGF-1), a proangiogenic growth factor is elevated and dopamine
Diabetic retinopathy downregulated in proliferative diabetic retinopathy (PDR). This study aims to investigate whether IGF-1 with
Dopamine dopamine can together modulate vascular endothelial growth factor (VEGF) to prevent proliferative diabetic
Insulin-like growth factor-1
retinopathy while also attenuating angiogenic effects of IGF-1.
Vascular dysfunction
Vascular endothelial growth factor
Methods: Effect of combination of levodopa L-Dopa with IGF-1 was tested on normal retinal pigment epithelium
CAM assay cells (ARPE-19) and human umbilical vein endothelial cells (HUVEC), followed by tube formation. Invivo
analysis of anti-angiogenic potential assessed by chick chorioallantoic membrane (CAM) assay. Diabetes in­
duction in wistar rats at two time points, 12 and 16 weeks, treated with L-Dopa+IGF-1 and analysed for
morphological variations, serum and tissue dopamine levels, gene expression by real-time PCR and western blot
assay.
Results: L-Dopa+IGF-1 on ARPE-19 cells caused no toxicity and worked synergistically. Reduced number of
vessels observed. Significant improvement in inner retina thickness (*p < 0.05) was observed when L-Dopa was
given alone and/or with IGF-1. Dopamine levels improved significantly in both serum and tissue (*p < 0.05).
Levels of VEGF and IGF-1 receptors reduced significantly in 12 weeks. Western studies suggest that L-Dopa+IGF-
1 modulates its effects via Akt/ERK dependent pathway.
Conclusion: First ever report on synergistic effect of L-Dopa+IGF-1 in a rat model of diabetic retinopathy. Even
though the effect of L-Dopa in combination with IGF-1 is comparable to levels of L-Dopa alone, this study
presents an interesting finding of neuroprotective function of IGF-1, which has been studied in disease models of
Parkinson’s but not diabetes.

1. Introduction
Anatomical changes in neural retina following long-term prevalence
of diabetes often lead to gradual deterioration of vision. Biosynthesis of
dopamine, a key retinal neuromodulator contributes to normal vision
through sympathetic neurotransmission via regulation of its receptors
and retinal pathways [1,2]. Chronic hyperglycemia resulting from dia­
betes alters neuronal function by reducing synthesis of dopamine in
retina and causes its frequent efflux, modifying the dopaminergic com­
munications in retina [3]. Aberrations in retinal dopamine levels in as
early as 4 weeks of diabetes results in loss of tyrosine hydroxylase
positive retinal neurons within 6 months and dysfunction of inner retina
(IR) elements [2,4–7]. Various studies have found that L-Dopa admin­
istration at early stage of diabetic retinopathy may restore dopamine
levels, thereby improving retinal function resulting from vascular de­
fects that characterize clinically recognized diabetic retinopathy [8–12].
Hence, dopamine supplementation has been found to restore retinal
function and is the most prospective regulator of diabetes induced
metergasis of retina [3].
Increased levels of IGF-1 in vitreous have been correlated with
severity of diabetic retinal neovascularization [6,13–15]. Another
crucial consequence of diabetic retinopathy is appearance of vascular

* Correspondence to: Ocular Pharmacology and Therapeutics Lab, Centre for Medical Biotechnology, Amity Institute of Biotechnology, Amity University Uttar
Pradesh, Room no. 322, J-3 block, Noida 201313, India.
E-mail addresses: shikha05upreti@gmail.com (S. Upreti), ssenop@rediffmail.com (S. Sen), tapas_nag@yahoo.com (T.C. Nag), mpghosh@amity.edu (M.P. Ghosh).

https://doi.org/10.1016/j.biopha.2022.112868
Received 5 December 2021; Received in revised form 16 March 2022; Accepted 23 March 2022
Available online 1 April 2022
0753-3322/© 2022 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
S. Upreti et al.
lesions in retina and onset of neovascularization. Although, various
studies have suggested that higher serum IGF-1 levels pose a risk to­
wards development of severe diabetic retinopathy, on the contrary,
there are other studies that show no association between serum IGF-1
levels with development or progression of diabetic retinopathy
[16–18]. Importantly, restricting IGF-1-induced signaling cascades
effectively reduces retinal VEGF levels and blood-retinal barrier (BRB)
breakdown [18]. IGF-1 controls striatal dopamine levels, local doap­
mine release in the midbrain, and dopamine neuron firing, ultimately
controlling dopamine dependent behaviors[19]. Also known to protect
and promote the survival of dopaminergic neurons invitro, chronic
administration of IGF-1 or administration of Gly-Pro-Glu, an N-terminal
peptide of IGF-1, attenuated loss of TH-immunoreactive cells in response
to 6-OHDA infusion into the dopaminergic axons within the nigrostriatal
pathway[20]. Interestingly, insulin has also been shown to affect brain
monoamine metabolism and dopamine release [21]. In a study on
dopamine beta hydroxylase knockout (Dbh-/-) mice IGF-1 receptor
phosphorylation significantly decreased as compared to their hetero­
zygote littermates [22] and combination of IGF-I and bFGF reduced the
death rate of dopaminergic neurons from programmed cell death in
another study [23]. Thus, this suggests that even if IGF-1 promotes
retinal neurogenesis, there is enough reason to believe that it can also be
neuroprotective in nature.
While current procedures such as laser surgery or anti-angiogenic
injections of VEGF antibodies are often used to arrest neo­
vascularization, we suggest a non-invasive approach that would
modulate and find a balance between neuromodulatory growth factors
and those responsible for proangiogenic activities in PDR [24]. So far,
different approaches have been used to prevent and/or delay neo­
vascularization but simultaneous regulation of dopamine and IGF-1
levels has never been thought of as a therapeutic strategy. The above
cited literature on the influence of IGF-1 on dopamine dependent
behavior of the neuronal cells in brain or in-vitro, unravels a new
approach to treat diabetic retinopathy related dopamine hypofunction
in retina. Also, since causal mechanisms intrinsic to
hyperglycemia-induced microvascular events in retina result in
increased severity of this disease, we aim to present a directed strategy
targeting neovascularization of retinal vessels and its underlying
mechanism to slow down PDR by, restoring the activity of dopaminergic
neurons through administration of L-Dopa in combination with IGF-1.
2. Methods
2.1. Cell culture
The human retinal pigment epithelium cells (ARPE-19) were a gift
from Dr Anil Tiwari, Shroff Eye Hospital, New Delhi. The cells were
grown in a medium comprised of a 1:1 ratio of Ham’s F12 medium and
Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10%
fetal bovine serum (Gibco, USA) and 1% penicillinstreptomycin com­
bination (Himedia, India) according to the supplier’s instructions.
Human umbilical vein endothelial cells (HUVEC) were a gift from Dr
Subrajit Biswas, Amity Institute of Molecular Medicine and Stem Cell
Research,Noida. The cells were cultured in MCDB 131 medium sup­
plemented with 50 μg/ml endothelial cell growth supplement, 20% fetal
bovine serum,2 mM L-glutamine, 50 μg/ml heparin and antibiotics
(10,000 U/ml Pen-strep). Cell cultures were maintained at 37⁰C in a
humidified chamber with 5% CO2 in a CO2 incubator. All experiments
using HUVECs were conducted between 2 and 5 passages. At the time of
experiments, MCDB131 medium with 2% FBS was used.
2.2. Cell Cytotoxicity and in-vitro analysis
(a) The ARPE-19 cells were seeded at a density of 10,000 cells/well
on a 96-well plate in complete media and incubated overnight at
37 ◦ C, 5% CO2. The following day, cells were pre-treated with L-
2
Biomedicine & Pharmacotherapy 149 (2022) 112868
Dopa (0–50 µM) and IGF-1 (26 nM) alone or co-treatment with
high glucose (HG) at 50 mM [25]. The dosing solutions of L-Dopa
and IGF-1 were prepared from 200 mM and 100 µg/ml stocks,
respectively in DMEM F-12 medium with low serum. After 24 h of
treatment, 3-(4, 5-dimethylthiazol-2-yl)− 2, 5-diphenyl tetrazo­
lium bromide (MTT) was added to each well, incubated for 4 h,
crystals were dissolved with dimethyl sulfoxide (DMSO) and
absorbance measured at 570 nm.
(b) The IC50 values of IGF-1 and L-Dopa was estimated on ARPE-19
cells and degree of drug interaction was assessed by combination
index.
(c) To assess the efficacy of proposed compound in reducing angio­
genesis, capillary tube formation assay was done. Briefly, 120 µl
of diluted (10 mg/ml) growth factor reduced Matrigel was tiled
on a pre-cooled 48-well plate and incubated at 37⁰C for at least 3
h for polymerization. 35,000 HUVECs/well were seeded on so­
lidified Matrigel with L-Dopa only, IGF-1 only and L-Dopa+IGF-1
in combination. Each group was taken in triplicate. After 16 h,
tube formation was observed, and images were captured.
2.3. Chick Chorioallantoic Membrane (CAM) assay
The fertilized eggs were obtained from Kegg Farms Private Limited,
Gurgaon and incubated at 37 ◦ C for eight days and divided into groups of
control (saline only), hyperglycemia (50 mM), L-Dopa alone (10 µM),
IGF-1 (100 nM) alone and L-Dopa+IGF-1 (10 µM + 100 nM) (two eggs/
group). Briefly, a small window was made in the shell on day 9 of chick
embryo development, in a laminar hood under aseptic conditions. The
window was resealed with adhesive tape after administering the drug
treatments (100 µl/egg) and eggs were returned to the incubator until
chick embryos were harvested on day 12. The experiment was repeated
twice. Imaging was done on the same day, and eggs were subsequently
discarded.
2.4. Animal maintenance
Male wistar rats weighing around 120–140 g were kept under stan­
dard conditions with food and water available ad libitum. Our protocols
were in accordance with ARVO Statement for the Use of Animals in
Ophthalmic and Vision Research and duly approved by the CPCSEA
designated Institutional Animal Ethics Committee at Amity University,
Noida, India (Approval no. CPCSEA/IAEC/AIP/017/03/27).
2.5. Dosing of animals
A total of 80 rats were used, divided into groups of 50 and 30 as two
sets, for experiments conducted at two separate time intervals and the
experiments were repeated twice. The first lot of 50 animals used for
morphological study, was equally divided into 4 groups namely control,
diabetes mellitus (DM)-treated, DM-L-Dopa-treated and DM-L-Dop­
a+IGF-1-treated, each containing 12 animals. Control group received
citrate buffer (vehicle only). Other three groups (except control)
received streptozotocin (STZ; 40 mg/kg; SRL India) made in 0.1 M cit­
rate buffer, intraperitoneally twice, in a gap of two weeks [26].
Monitoring of blood glucose (BG) levels using a glucometer (Dr
Morepen) during a fasting state, 2 days after injection was done. Animals
with BG level ≤ 250–300 mg/dL were considered diabetic and main­
tained. Weight and BG level of all rats was recorded twice weekly.
Experimental term was set at 12 and 16 weeks and animals from all 4
groups were sacrificed at termination of each time point. L-Dopa treat­
ment began two weeks after diabetes onset and lasted until 16 weeks
post hyperglycemia. Rats from L-Dopa alone and L-Dopa+IGF-1 groups
were given i.p injections of L-Dopa (10 mg/kg; Sigma-Aldrich Corp.)
prepared fresh daily, in 0.1% ascorbic acid made in saline. All injections
were given 4–8 h after light onset. Rats of DM-L-Dopa+IGF-1-treated
group received intravitreal dose of IGF-1(100μg) (2 µl/eye; Sigma-
S. Upreti et al.
Aldrich Corp.) twice each, after a gap of 7 days in the penultimate weeks
before their sacrifice. 2 animals (from n = 50) that could not survive
prolonged periods of diabetes were excluded from the study (Supple­
mentary Fig. 1).
2.6. Hematoxylin and Eosin staining
Rats were euthanized by cervical dislocation. A pair of eyeballs from
each group (both time points) were fixed in 10% formalin. After 2 h,
eyecup was formalin fixed for 4 h following a protocol with slight
modifications [27]. 5 µm thick sections were cut using a cryomicrotome
(Leica CM 1520) parallel to edge of the eyeball through optic disc taken
from four eyeballs. Sections were stained with hematoxylin and eosin
and viewed under microscope. Ten stained sections, lying in middle
when plotted from optic disc to outer periphery of retina, (from each
eyeball) were selected for image acquisition at 20X. Using image anal­
ysis software Fiji, total thickness of IR was taken as thickness of ganglion
cell layer (GCL)+thickness of inner plexiform layer (IPL). Using 2 sec­
tions per group and examining 3 sides from each section, for three
randomly selected fields of view, from each section were calibrated at
40X magnification. All observations were made by a masked
investigator.
2.7. Transmission electron microscopy
Two eyeballs each, from both time points were analyzed (without
repetition). Anterior segments were removed and fixed in pre-cooled
2.5% glutaraldehyde, followed by 1% osmium tetroxide. Samples were
dehydrated using graded ethanol and embedded (Araldite CY 212).
Ultra-thin sections (80 nm) were contrasted with uranyl acetate and lead
citrate and viewed under a Tecnai G2–20S twin transmission electron
microscope.
2.8. Sample collection and Dopamine analysis
Set of 30 animals were used for serum and tissue dopamine analysis.
Six eyes per group each were used at both time points. 6 animals (from n
= 30) that failed to become diabetic or could not survive prolonged
periods of diabetes were excluded from study.
Dopamine estimation from tissue: Retinae from six eyes (3 ani­
mals/ group) were pooled for dopamine estimation, with slight modi­
fications to existing protocol [28]. Dissected retinae were homogenized
in 500 µl of ice cold perchloric acid containing 10 mM EDTA and 10 mM
sodium metabisulfite, with 2.5 ng 3,4-dihyroxybenzylamide (DHBA) as
an internal standard and centrifuged at 14000 rpm for 15 min at 4ºC.
Supernatant was filtered using a 0.45 µm membrane (Merck Millipore)
and analyzed.
Dopamine estimation from serum: Serum dopamine level was
estimated according to established protocol with slight modifications
[29]. Dopamine signals were quantified using a detection curve estab­
lished by standards ranging from 2 to 20 ng/ml. Injection volume of 20
µl was injected into equilibrated column and modified mobile phase
consisted of 0.1 M sodium phosphate, 0.1 mM EDTA, 0.35 mM sodium
octyl sulphate and 20% acetonitrile, with flow rate set at 1 ml/min.
Tissue and serum dopamine levels were calculated by comparing peak
heights with those of standards. Dopamine content estimated was
expressed as pg/mg of wet tissue and pg/ml of serum respectively.
2.9. Quantitative RT-PCR
Two eyes/group at both time points were used for RNA extraction
using TRIzol (Thermo Fisher Scientific). For each sample, 1 μg of RNA
was reverse transcribed to cDNA using random primers and RevertAid
First Strand cDNA Synthesis kit (Thermo Fisher Scientific). Resulting
cDNA was diluted 1:10 in nuclease free water and 1 µl was used for each
quantitative real-time PCR (RT-qPCR). RT-qPCRs were performed in a
3
Biomedicine & Pharmacotherapy 149 (2022) 112868
10 µl volume with PowerUp SYBR green 2 × Master Mix (Applied Bio­
systems) in a StepOne RT PCR system. Each experiment was repeated
thrice. Primers were designed using Primer-BLAST NCBI (Table 1). Large
ribosomal protein P0 (RPLP0) and GAPDH were used as reference genes.
The parameters were set as follows: 50 ◦ C for 2 min, 95 ◦ C for 2 min, and
40 amplification cycles of 95 ◦ C for 15 s and 60 ◦ C for 30 s, 95 ◦ C for 15 s,
60 ◦ C for 1 min and 95 ◦ C for 15 s for melt curve. For each cDNA sample-
primer pair combination, two replicates were performed, and average Ct
calculated. Expression of each gene of interest was calculated from the
average PCR cycle thresholds using the 2− ΔCt method.
2.10. Western Blot assay
Four eyes/group (both time points) were used for protein estimation.
The total proteins were extracted from the retina of rats using RIPA lysis
buffer at 4 ◦ C. The concentration of tissue protein was determined by
Bradford assay. Sodium dodecyl sulfate-polyacrylamide gel at concen­
trations of 10% was used to separate the tissue protein by gel electro­
phoresis, and polyvinyl difluoride membrane-containing proteins were
blocked with milk solution (5%) and/or bovine serum albumin for 60
min. The cellular membrane was incubated with primary antibodies, Akt
(1:1000;Cat#4060, Cell signaling Technology, USA), phospho Akt
(1:1000;Cat#9271,Cell signaling Technology, USA),ERK(1:2000;
Cat#9102, Cell signaling Technology, USA), phospho ERK(1:1000;
Cat#3510, Cell signaling Technology, USA),and β-actin (1:1000;Cat#
PA5–85271,Invitrogen,USA) overnight at 4 ◦ C. Membranes were incu­
bated with peroxidase-conjugated secondary antibodies, and Image
Quant LAS 500 was used to capture the images. Fiji (Image J) was used
to determine mean fluorescence intensity of bands.
2.11. Immunohistochemistry
Two eyes per group were used for immunolabelling and processed
using a modified protocol [24]. Sections were washed and blocked in
10% normal goat serum (NGS) for 1 h. Incubation in primary antibody,
VEGFR1 (PA5–16487,1:200, Invitrogen) prepared in 0.01 M PBS con­
taining 10% NGS and 0.1% triton X-100 at 4 ◦ C overnight. After
washing, sections were incubated with secondaries, goat anti-rat Alexa
Fluor 568 (1:500, Invitrogen, #A11011) and DAPI (4′ ,6-Dia­
midino-2-phenylindole) (1:500, Sigma, MO, USA) for 1 h. Imaging was
done using confocal microscope (Nikon Confocal A1).
2.12. Statistical Analysis
Statistical analysis was performed using Graphpad Prism 8.2.144 and
Microsoft excel. Data are expressed as the mean ± SEM of percentage of
cell toxicity with respect to control. For dopamine analysis in serum and
tissue, two-way ANOVA was performed to determine whether retinal
dopamine content differed significantly between the experimental
groups followed by Bonferroni’s post-hoc analysis (p < 0.05 *). For RT-
PCR analysis, multiple Student’s t tests were used to determine whether
the expressions of the treatment groups were different from the control
group. Western blot and mean fluorescence intensity were analyzed by
Student t test to compare the values obtained from two groups (two-
tailed) while the comparison between three or more groups was
analyzed by one-way ANOVA. All analyses were performed with a priori
significance set at α < 0.05 (* p < 0.05; ** p < 0.01; *** p < 0.001).
3. Results
3.1. ARPE-19 cell response to L-Dopa+IGF-1 treatment
On analyzing cells for cytotoxicity, we found that the combination of
L-Dopa and IGF-1 did not reduce ARPE-19 cell viability and morphology
when compared to control group (Fig. 1). The growth and number of
cells in treatment group of L-Dopa+IGF-1 increased from the number of
S. Upreti et al. Biomedicine & Pharmacotherapy 149 (2022) 112868

Table 1
List of Primers used in the experiment.
S.No. Gene Primer Sequence (5′ − 3′ )

1 VEGF receptor 1 TTCGTCCAACTTCTGGGCTCTT CTCCTCTTCCTTCTCTTTCTCCCC

2 VEGF receptor 2 TAGCACGACAGAGACTGTGAGG TGAGGTGAGAGAGATGGGTAGG
3 Dopamine receptor D1 CGCCCAGTCTGAAAGTTCCT TGAAGAAAGGGAGCCAGCAG
4 Dopamine receptor D2 GCCAACCTGAAGACACCACT ATCCATTCTCCGCCTGTTCAC
5 Dopamine receptor D4 GAGTGCAGAAATTCAAGCCGT GGATTTGCAGTCAGGGGCTA
6 IGF-1 receptor CCAACAAGTTCGTCCACAG AGTCCGTCTCGTAGATGTC
7 Ribosomal Protein Lateral Stalk Subunit P0 AGTACCTGCTCAGAACAC TCGCTCAGGATTTCAATGG

Fig. 1. Representative images of effect of L-Dopa+IGF-1 on cell morphology after 24 h (A). (a) ARPE-19 cells were cultured in serum-supplemented basal media,
without high glucose (50 mM) (control) treatment, (b) ARPE-19 cells were cultured in serum-supplemented basal with high glucose (50 mM) and (c) ARPE-19 cells
were cultured in serum-supplemented basal with high glucose (50 mM) and combination of L-Dopa+IGF-1. (B) The dose response curves for determination of IC50
values of L-dopa and IGF-1 showed that the IC50 of L-Dopa was 69.1 μM and IGF-1 was 1.14 nM respectively.(C)The CI values of L-Dopa and IGF − 1 was found to be
less than 1, which shows synergistic effect of the drug. Scale bars denote 500 µm at 40 × magnification.

cells seen in HG-treated group.
The pre-treatment of L-Dopa alone and IGF-1 alone after hypergly­
cemia, resulted in reduced number of cells with increasing concentra­
tions when compared to control (not shown here). The IC50 of L-Dopa
was found to be 69.1 µM and that of IGF-1 was 1.41 nM. For estimation
of optimal combination ratio for maximal synergy, the IC50 of L-Dop­
a+IGF-1 was tested in two combinations: combination I (IGF-1
100 nM+L-Dopa 10 μM) and combination II (IGF-1 100 nM+L-Dopa
30 nM) respectively. The combination index study revealed that the
combination of L-Dopa and IGF-1 acted synergistically at IC50 values for
combination I (IGF-1 100 nM+L-Dopa 10 μM). The CI value was 0.57
which is less than 1 and indicates that the two drugs in combination had
a synergistic effect on cells.
3.3. Reduced angiogenesis obtained in the combination group when
assessed in vitro by CAM assay
Chick chorioallantoic membrane (CAM) assay is one of the most
reliable assays known for studying angiogenesis (Fig. 3). Visualized for
its effects after 48 h, the analysis of blood vessels in CAM was done based
on thickness of vessel, branching, and sprouting of vessel. We found that
the combination of L-Dopa+IGF-1 considerably reduced angiogenesis
more than the drugs used alone.
3.4. Intravitreal IGF-1 improves microstructural differences and
morphometry in diabetic retina

3.2. Effect of L-Dopa+IGF-1 on viability and tube formation of HUVECs
To investigate the effect of L-Dopa+IGF-1 on high-glucose-induced
endothelial cells injury, we treated HUVECs with combination of L-
Dopa+IGF-1 for 24 h after 24 h high glucose treatment (50 mM)
(Fig. 2). MTT assay showed that L-Dopa+IGF-1 partially prevented high-
glucose-induced endothelial cells injury better than IGF-1 alone and
comparable to L-Dopa alone (Fig. 2a).
The changes in blood glucose levels (Supplementary Table 1) and
weight of rats at both time points were duly recorded (Supplementary
Table 2). Morphological changes when compared with respective age
matched controls (Fig. 4) showed a decrease in number of RGCs in inner
nuclear layer (INL) and outer nuclear layer (ONL), with increased
vascular permeability and loss in structural integrity, resulting in RGC
necrosis initiation in DM-treated group of 12 weeks (Fig. 4A). RGCs with
shrunken pyknotic nuclei and surrounded by new vessels appeared in
junctions between GCL and IPL and between IPL and INL in DM-treated
group with visible basal laminar thickening in 16 weeks (Fig. 4B). In

4
S. Upreti et al. Biomedicine & Pharmacotherapy 149 (2022) 112868

Fig. 2. Representative image of effect of L-Dopa supplemented with IGF-1 on morphology (A), tube formation capability (B) and viability of human umbilical vein
endothelial cells (HUVECs) (C). (A) Cells showing normal morphology in control group supplemented with vehicle(a). Cells treated with HG at 50 mM for 24 h (b),
cells treated with HG at 50 mM and IGF-1 (c) and cells treated with L-Dopa+IGF-1 after HG (d). (B) Cells in control with no treatment (a), Cells treated with HG alone
(b), HG-IGF-1 alone (c) and HG-L-Dopa+IGF-1 (d) for tube formation assay. (C) Cells in control with no treatment, cells treated with HG alone, HG-IGF-1 alone and
HG-L-Dopa+IGF-1 for 24 h, the cell viability was determined by MTT assay. These results revealed that L-Dopa alone and L-Dopa supplemented with IGF-1 increased
cell viability of HUVECs significantly (p < 0.05 *). Each bar represents mean±SEM where n = 3. *p < 0.05 vs control and DM-treated. Scale bar equals 500 µm.

Fig. 3. Representative photographs showing

the anti-angiogenic effect of different treatment
groups on chick embryo chorioallantoic mem­
brane (CAM). (a) Representative image for
positive control (saline). (b) Representative
image for negative control (High glucose (HG)
at 50 mM). (c) Representative illustration of the
inhibition of angiogenesis in HG-treated-L-Dopa
where angiogenesis reduced compared to HG
treated group. (d) IGF-1 treated group showed
more vessels compared to HG-treated-L-Dopa
alone treated group. (e) Significant reduction in
number of vessels was seen in HG treated-L-
Dopa+IGF-1-treated group.

5
S. Upreti et al. Biomedicine & Pharmacotherapy 149 (2022) 112868

Fig. 4. Representative photomicrographs of hematoxylin and eosin-stained retinal sections observed at 12 weeks (A) and 16 weeks (B). (A) In 12 weeks rats (a)
Normal retinal layers in control group. (b) DM-treated group showing decreased RGCs, increased diameter of retinal vessels and presence of micro vessels with visible
thinning of IR. (c) DM-L-Dopa-treated group showing ballooning degeneration with pyknotic nuclei and mild edema. (d) DM-L-Dopa+IGF-1-treated group showing
better number of RGCs with restored thickness of IR. (B) In 16 weeks, control group with linear arrangement of layers (a) and DM-treated group showing distorted
morphology of GCL with vacuolated ganglion cells and decreased thickness of IR (b) was visible. DM-L-Dopa-treated group showing improved arrangement of GCL
with some micro vessels (c) and (d) DM-L-Dopa+IGF-1-treated group showing restored IR thickness and less or no presence of micro vessels was observed. (C)
Quantification of IR thickness measured on retinal sections. The graph shows variations in thickness of IR (GCL+IPL) scanned over a period of 16 weeks. N = 4.Each
bar represents mean±SEM. p * ** *< 0.05, * **p < 0.05 and * *p < 0.05 vs DM-treated (negative control).

Fig. 5. Representative photomicrographs of ultrastructure of retinal capillary at 12 weeks (a-d) and 16 weeks (e-f) respectively. Retinal vessels were observed to be
normal in IPL and INL of 12 weeks control group (a); STZ only treated DM group (b); diabetic rats subjected to L-Dopa alone (c); diabetic rats subjected to com­
bination of L-Dopa+IGF-1 (d) retinal capillary of control group at 16 weeks (e); deformed RBCs in DM-treated group (f); DM-L-Dopa-treated (g) and realignment of
BM as seen in DM-L-Dopa+IGF-1-treated groups (h). Scale bar equals 1–5 µm. H=heterochromatin; Ed=endothelial cells; BM=basement membrane; RBC=red blood
cell; SM=smooth muscle; black arrow=capillary lumen; P = pericyte.

6
S. Upreti et al.
treatment groups of DM-L-Dopa-treated and DM-L-Dopa+IGF-1-treated,
few scattered blood vessels and maintained continuity of GCL with
reduced loss of RGCs was found in both 12 and 16 weeks.
Thinning of IPL, INL and ONL occurs due to desquamation of cells
with multiple pyknotic nuclei and widening of intercellular spaces in
RGCs of DM group (Fig. 4C). Damage caused by loss of RGCs and scat­
tered endothelial cells became more prominent in 12 weeks, but treat­
ment modality proved effective with significant difference between DM-
treated and DM-L-Dopa+IGF-1-treated groups’ IR thickness (80 ± 1.8 vs
106 ± 2.7, ****p < 0.05). Meanwhile, new vessels in junction between
GCL and IPL and those between IPL and INL in retinae of 16 weeks,
resulted in significant variation in IR thickness (66.2 ± 5.6 vs 95.9
± 8.6, **p < 0.05) between DM-treated vs DM-L-Dopa+IGF-1-treated
retinas respectively.
RGC, retinal ganglion cells; GCL, ganglion cell layer; IPL, inner
plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer;
ONL, outer nuclear layer.
3.5. Ultrastructure changes
Pair of eyeballs from each group was studied to see how L-Dopa with
IGF-1 affects ultrastructure of capillaries in the transition period of the
two time points (Fig. 5). In 12 weeks, control, BM was complete with
unobstructed lumen (Fig. 5a). In DM-treated group, stratified BM,
bulging lumen with distorted smooth muscle was observed (Fig. 5b).
Whereas, in DM-L-Dopa-treated animals, lumen gradually smoothened
with progressive improvement in BM (Fig. 5c) and optimal protective
effects of the treatment were visible in DM-L-Dopa+IGF-1-treated group
where smoothened BM, with some displaced pericytes were seen
(Fig. 5d).
Retinal capillary BM, endothelial cells, and pericytes of rats at 16
weeks had normal morphological structures without apparent patho­
logical changes in control group (Fig. 5e). Thickened and discontinuous
BM was observed. Endothelial cells turned hyperplasic and bulged into
lumen and pericytes became confined to capillary wall or were lost
(Fig. 5f). Furthermore, capillary BM of treatment groups of DM-L-Dopa-
treated and DM-L-Dopa+IGF-1-treated were complete and continuous
while degree of thickening also improved. Endothelial cell proliferation
decreased, lumen bulging reduced and pericytes showed sporadic edema
(Fig. 5g), with significantly improved capillary seen in DM-L-Dopa+IGF-
1 treated group (Fig. 5h).
Fig. 6. Effect of STZ on concentrations of dopamine in (A) retina (pg/mg wet tissue) and in (B) serum (pg/ml) at 12 and 16 weeks after diabetes and treatment with
L-Dopa and L-Dopa+IGF-1. Each bar represents mean±SEM where n = 3. *p < 0.05 vs DM-treated.
7
Biomedicine & Pharmacotherapy 149 (2022) 112868
3.6. Dopamine level changes significantly between DM-treated and DM-
DA+IGF-1 treated conditions
High performance lipid chromatography analysis of samples signifies
changes in dopamine content of control, DM-treated, DM-L-Dopa-
treated and DM-L-Dopa+IGF-1-treated groups at both 12 weeks and 16
weeks in retinal tissue and serum. Dopamine level of control rats
sacrificed at 12 weeks was 111 ± 1 ng/mg of wet tissue (Fig. 6A) but
went down to 34 ± 0.8 ng/mg of wet tissue in DM-treated group. On
treatment with L-Dopa alone, the levels in DM-L-Dopa-treated retina
were restored to 59 ± 0.4 ng/mg of wet tissue (*p < 0.05). Animals
receiving IGF-1 with L-Dopa showed increased dopamine level at 54
± 0.4 ng/mg of wet tissue (*p < 0.05). In comparison, 16 weeks dopa­
mine levels varied from 30 ± 0.33 in control to 3.8 ± 0.2, 23.2 ± 0.3
(*p < 0.05) and 25.3 ± 0.5 (*p < 0.05) in DM-treated, DM-L-Dopa-
treated and DM-L-Dopa+IGF-1-treated groups, respectively.
Serum levels of dopamine were also checked to ensure that they
corroborate with results of tissue specimen. Dopamine content in con­
trol, DM-treated, DM-L-Dopa-treated and DM-L-Dopa+IGF-1-treated
groups was found to be 9.7 ± 0.1, 7.5 ± 0.14, 8.7 ± 0.2 (*p < 0.05) and
8.3 ± 0.03 pg/ml of serum at 12 weeks (Fig. 6B). At 16 weeks, dopamine
content in control, DM-treated, DM-L-Dopa-treated and DM-L-Dop­
a+IGF-1-treated group was found to be 5.2 ± 0.001, 1.5 ± 0.1, 3.15
± 0.01(*p < 0.05) and 4.38 ± 0.12 (*p < 0.05) ng/ml of serum
respectively. A reduction in dopamine levels of control groups of both
tissue and serum in 16 weeks was seen as basal dopamine level is known
to reduce in rats with aging [30].
3.7. Variations in expression of VEGF receptor 1, VEGF receptor 2 are
modulated by changes in IGF-1 receptor levels and dopamine receptor
levels
Variation in mRNA expression of VEGF receptor 1 and VEGF receptor
2 in rat retinas were analyzed after diabetes initiation. We found the
expression of VEGF receptor 1 was increased in rat retina at 12 weeks
[27,31] but became weak at 16 weeks after development of diabetes
(p < 0.05 *). Increased expression of VEGF receptor 1 was attenuated by
both DM-L-Dopa-treated and DM-L-Dopa+IGF-1-treated groups
(*p < 0.05) at 12 weeks but significantly only in DM-L-Dopa-treated
group in 16 weeks (*p < 0.05) (Fig. 7A). Expression levels of VEGF re­
ceptor 2 after initial increase in DM-treated groups of both 12 and 16
weeks [32] reduced significantly in both DM-L-Dopa-treated and
DM-L-Dopa+IGF-1-treated groups of both time points (Fig. 7B).
Dopamine D1 receptor, D2 receptor and D4 receptors were used to
assess changes in their respective transcript levels to further confirm
S. Upreti et al. Biomedicine & Pharmacotherapy 149 (2022) 112868

Fig. 7. Quantitative real-time RT-PCR analysis of (A)VEGF receptor 1, (B)VEGFR receptor 2, (C) dopamine D1 receptor, (D) dopamine D4 receptor, (E) dopamine D2
receptor and (F) IGF-1 receptor from DM-treated, DM-L-Dopa-treated and DM-L-Dopa+IGF-1-treated groups (n = 4, each group) and normal controls (n = 4). The
mRNA levels were normalized to RPLP0 housekeeping gene. Each bar represents mean±SEM, *p < 0.05.

counteracting effect of L-Dopa+IGF-1 treatment on diabetes (Fig. 7C).
The expression of dopamine D1 receptor increased in DM-treated groups
of 12 as well as 16 weeks but decreased significantly (*p < 0.05) in DM-
L-Dopa-treated and significantly in DM-L-Dopa+IGF-1-treated group. At
the same time expression of dopamine D4 receptor increased in DM
group of 12 as well as 16 weeks which then reduced in both DM-L-Dopa-
treated and DM-L-Dopa+IGF-1-treated groups but significantly
(*p < 0.05) only in DM-L-Dopa-treated group. Contrary to this, the
expression of dopamine D2 receptor decreased in 12 as well as 16 weeks
of DR in DM-treated group. Expression of dopamine D2 receptor
increased significantly in DM-L-Dopa+ IGF-1-treated group of 12 weeks
with increase also seen in 16 weeks in both L-Dopa-treated groups but
significantly (*p < 0.05) only in DM-L-Dopa-treated group of 16 weeks
(Fig. 7D).
The expression of IGF-1 receptor decreased in diabetic rats at 12 as
well as 16 weeks in DM-treated group. Increase in the expression of IGF-
1 receptor in the DM-L-Dopa-treated group in 12 weeks but decreased
significantly in 16 weeks (Fig. 7E). On application of IGF-1 along with L-
Dopa, IGF-1 receptor levels did not change significantly in 12 weeks but
increased significantly in 16 weeks (Fig. 7F).
3.8. L-Dopa+IGF-1 alleviates streptozotocin induced degeneration
To understand the molecular mechanisms involved in overcoming
the effect of stz damage on retina, we examined both ERK and Akt
pathways, since they are the key signaling pathways regulating cell
growth and survival but aberrantly activated in diseases like cancers and
diabetic retinopathy (Figs. 8 and 9). Western blot analysis of ERK and
phospho-ERK (Fig. 8A) revealed, by densitometric analysis of four
paired samples in each experimental group (given in parentheses as the
mean ± SE), that L-Dopa without treatment resulted in slightly
increased level of ERK (Fig. 8B) and significant increase in expression of
p-ERK (Fig. 8C) in DM-treated groups. The combination of L-Dopa+IGF-
1 reduced ERK and p-ERK expression considerably when compared with
control and DM groups. This suggests that ERK pathway mediates
changes in diabetic retina after STZ induced damage and is overcome
considerably by treatment of L-Dopa+IGF-1.
Analysis of protein levels of Akt and p-Akt (Fig. 9) revealed that Akt
(Fig. 9B) and p-Akt levels increased in DM-treated group as compared to
control (Fig. 9C). In the L-Dopa alone group, expression of Akt increased
and p-Akt decreased compared to control. L-Dopa+IGF-1 decreased both
Akt and p-Akt expression significantly when compared to control and

8
S. Upreti et al. Biomedicine & Pharmacotherapy 149 (2022) 112868

Fig. 8. Western blotting determined the expression of ERK and p-ERK following treatment with L-Dopa alone and L-Dopa+IGF-1 after diabetes induction in rats of 16
weeks (A). The quantitation of ERK (B) and p-ERK (C) was determined by normalizing to β actin. Data are presented as mean±SE of mean from two different ex­
periments.*p < 0.05 .

Fig. 9. Western blotting determined the expression of Akt and p-Akt following treatment with L-Dopa alone and L-Dopa+IGF-1 after diabetes induction in rats of 16
weeks (A). The quantitation of Akt (B) and p-Akt (C) was determined by normalizing to β actin. Data are presented as mean±standard error of mean from two
different experiments.*p < 0.05 .

9
S. Upreti et al. Biomedicine & Pharmacotherapy 149 (2022) 112868

Fig. 10. Immunohistochemistry of retinal sections showing VEGF receptor 1 expression (A) and mean fluorescence intensity (B). (A) control (a-c), DM (d-f), and
treatment group of DM-L-Dopa+IGF-1 receptor (g-i) respectively. Bars represent mean ± SEM of at least 2 independent experiments. Scale bar= 100 µm.*p < 0.05 .

also comparable to L-Dopa alone. diabetic retinopathy, to further establish the protective function of
L-Dopa when combined with IGF-1 which, is also speculated to possess
neuroprotective function [38]. We found a significant positive correla­
3.9. Immunofluorescence studies suggest that VEGF receptor 1 expression
tion between progression of diabetic retinopathy and decreased dopa­
lowers with L-Dopa+IGF-1 combination
mine levels. When L-Dopa was supplemented with IGF-1, it acts in
tandem with L-Dopa to overcome neurodegenerative and vascular
Previously it has been shown that expression of VEGF receptor 1
changes, often encountered in late-stage retinopathy.
increased in retinal vasculatures of diabetic rats [33] and blockade of
In order to check whether the dose of L-Dopa and IGF-1 to be used in
VEGF receptor 1 reduces inflammation thereby preventing leakage [31],
animals does not prove to be cytotoxic, we evaluated cell viability by
but it remains unknown as to how its expression is affected by IGF-1
MTT assay on ARPE-19 cells. The proliferation of ARPE-19 cells was
stimulation with L-Dopa in diabetic rats. We therefore examined VEGF
inhibited by high glucose at 50 mM. L-Dopa+IGF-1 at a concentration
receptor 1 expression in diabetic rat retina (Fig. 10) and found that
range of 0–50 µM, did not endanger the survival and morphology of
VEGF receptor 1 expression was increased in DM-treated groups of 16
ARPE-19 cells (Fig. 1). Even though the anti-angiogenic potential of L-
weeks (12 weeks not shown here) (Fig. 10d-f) compared with nondia­
Dopa has already been established in several studies [39,40], the ability
betic controls where there was no or barely detectable immunoreactivity
of L-Dopa to ameliorate proangiogenic activity of IGF-1 in proliferative
(Fig. 10a-c) and immunofluorescence staining further confirmed its
diabetic retinopathy has not been explored yet. In this regard, when
vascular localization. Increased vascular effect was noted to have
HUVECs were treated with L-Dopa+IGF-1, the cell morphology did not
decreased in DM-L-Dopa+IGF-1-treated group (Fig. 10g-i).
differ much from those treated with IGF-1 alone, (Fig. 2 A) and the cell
viability showed significant improvement when compared to the DM
4. Discussion
group (p < 0.05 *) (Fig. 2C). As the endothelial cell tube formation
assay is a useful method to determine genes and pathways that poten­
As the dopaminergic system is a promising target for developing
tially play an important role in activation or inhibition of angiogenesis
strategy against diabetic retinopathy [34], dopamine precursor L-Dopa,
[41], we examined the potential of our drug treatment of L-Dopa+IGF-1
has been found to be neuroprotective against early retinal dysfunction
against IGF-1 alone in HUVEC cells. The density of the network of tu­
associated with diabetic retinopathy in both diabetic humans and ani­
bules formed by endothelial cells was very robust in DM group or hy­
mals [5,17,35,36] and also on neovascularization in cancer [37]. We
perglycemic condition. When exposed to DM-L-Dopa+IGF-1, the
wanted to analyze the efficacy of L-Dopa with IGF-1 in late stages of

10
S. Upreti et al.
network began to loosen and break as compared to that seen in IGF-1
alone (Fig. 2B).
Since, the CAM is a highly vascularised membrane found in fertilized
chicken eggs, with a vast vascular network of capillaries, veins and ar­
teries, it can be easily manipulated and observed for experimental study
of angiogenesis [42]. The use of the CAM assay as an efficient biological
screening tool on the focus of cell induced angiogenesis is important and
hence, when we tested our combination of L-Dopa+IGF-1 against
L-Dopa alone or IGF-1 alone, we found that the number of vessels
reduced considerably from those seen in positive control (Fig. 3).
Adequate dopamine levels result in normalization of morphology
and improved vessel function by acting on pericytes and endothelial
cells [36] and when we observed the treatment groups of DM-L-Dopa-­
treated and DM-L-Dopa+IGF-1-treated for morphological differences,
we found improved structural features which can be attributed to
dopamine biosynthesis aided by L-Dopa(Fig. 4). We chose data points to
be a maximum of 16 weeks to better assess contrasting opinions on
characterization of early and late-stage diabetic retinopathy as, symp­
toms of neovascularization like acellular capillaries, ghost like pericytes
occurs between 16 and 36 weeks, and vascular changes are visible as
early as 2 weeks of hyperglycemia [43,44]. Since, neuronal defects are
characterized by reduction in thickness of inner retina [45], we observed
that at 12 weeks, marked morphological alterations like reduced
thickness and breakage in all inner layers were visible (Fig. 4A). A
definite increase in vascular lesions due to increased vessel permeability
were visible at 16 weeks of diabetes (Fig. 4B). Consistent with previous
studies where decreased IR thickness is characterized as primary pa­
thology in diabetic retinopathy, much before appearance of vascular
lesions [46], significant decrease in thickness of IR was overcome by
treatment with L-Dopa+IGF-1 better than L-Dopa alone (Fig. 4C) when
quantitative measurement of GCL+IPL thickness was used [47–49].
Ultrastructural analysis of retinal capillaries on treatment with L-
Dopa or L-Dopa+IGF-1 revealed considerable recovery of capillaries
with intact endothelial cells, reduced microaneurysm formation, vessels
with less deformed RBCs and reduced BM thickening in both 12 and 16
weeks (Fig. 5c, d,g and h) which could only be analyzed but not quan­
tified here. Such changes in BM and vasculature are often attributed to
protein kinase C activation in diabetic retinopathy [50].
It has been found that L-Dopa if given at a lower dose or intermit­
tently, may reverse measurable early-stage diabetic retinopathy [36].
Since retinal dopamine reduction in diabetes originates from decreased
biosynthesis of dopamine, we believe that exogenous supplementation
of L-Dopa with IGF-1 further co-stimulates production of dopamine to
overcome this deficiency. Level of dopamine as measured in retinal
tissue and serum showed a significant decrease in animals of DM-treated
group as observed previously [51] when compared to control group of
both 12 and 16 weeks (Fig. 6A and B). Hence, IGF-1 supplicated with
L-Dopa restored dopamine levels in both tissue and serum, in
DM-L-dopa-treated and in DM-L-Dopa+IGF-1-treated groups signifi­
cantly back to comparable levels of control in agreement with a similar
study [52].
When the transcript levels of dopamine receptors D1, D4 and D2
were checked, increase in dopamine D1receptor and D4 receptor
expression indicates the binding of L-Dopa to these receptors is not al­
ways influenced by its depletion in diabetic retinopathy conditions [9,
53]. But application of L-Dopa with IGF-1 could restore the expression of
dopamine D4 receptor significantly to the level of control in both 12-
and 16-week stages better than L-Dopa alone (Fig. 7C, D, and E). The
expression of dopamine D2 receptor is affected by loss of dopamine in
retinopathy conditions as indicated in previous studies [54,55].
Administration of L-Dopa+IGF-1 could restore dopamine D2 expression
levels comparable to control in 12 as well as 16 weeks and with L-Dopa
alone in 12 weeks. This observation leads to the conclusion that
downstream targets of IGF-1 in its signaling cascade at some point
modulate, dopaminergic neurotransmission and improve the efficacy of
dopamine in restoring retinal function in retinopathy conditions.
11
Biomedicine & Pharmacotherapy 149 (2022) 112868
Multiple studies have concluded that accelerated retinopathy results
from increased IGF-I production and this leads to development of PDR
[50,56,57]. In recent studies IGF-1 mRNA was found to be reduced in
eye in early stages [6,58,59] and it has been suggested that exogenous
treatment with IGF-1 may be beneficial [58]. Since it has been proven
that IGF-1 is antiapoptotic and enhances nerve metabolism [60], we
found that L-Dopa and IGF-1 co-administered in combination could
downregulate VEGF receptor 1/VEGF receptor 2 activation witnessed in
16 weeks DM-treated group (Fig. 7 A and B). Since studies regarding
modulation of synthesis of IGF-1 or blocking IGF-1 could attenuate
retinal angiogenesis [61] we also found that IGF-1 when combined with
L-Dopa might reduce ability of IGF-1 to induce VEGF receptor expres­
sion. Some reports where mRNA and protein expression of VEGF re­
ceptor 1 and receptor 2 was seen in normal retina [61–63] suggest
physiological functions of VEGF, but few data is available on expression
patterns of VEGF receptors in the retinal vasculature of control or
DM-treated eyes [35,44,55,62].
The expression of IGF-1 receptor and VEGF receptors is interrelated
with respect to the prevalence of retinopathy and occurrence of neo­
vascularization. In postnatal stages during artificially induced retinop­
athy, IGF-1 mRNA levels are low in humans, mice, and diabetic rats after
5 months of diabetes and show that IGF-1 levels are much less than those
in control [64]. Although activation of IGF-1R initiates cascade of PI3/
pAkt pathway and expression of phospho-VEGF [65] but increase in
IGF-1 mRNA levels in retinopathy condition is also associated with
suppressed VEGF mRNA levels [66]. The expression of IGF-1 receptor
was much less than control in both 12 week and 16-week time points in
DM-treated group (Fig. 7F) and levels of VEGF receptor 1 and VEGF
receptor 2 increased in DM-treated group as described previously [21].
In addition, increased VEGF mRNA levels in ischemic retina of patients
with advanced diabetic retinopathy and proliferative diabetic retinop­
athy is associated with high levels of VEGF in the vitreous [1,28,67]. On
administering L-Dopa, IGF-1 receptor level increased in 12 weeks due to
increase in IGF-1 which is validated by decrease in VEGF receptor 1 and
VEGF receptor 2 expressions at 12 weeks (Fig. 7A and B). At 16 weeks of
diabetes when neovascularization started, IGF-1 receptor levels were
sufficiently low as evident from comparably higher levels of VEGF re­
ceptor 1 and VEGF receptor 2 and L-Dopa treatment was unable to
enhance it. When IGF-1 was given along with L-Dopa, its level increased,
although no significant change was observed for IGF-1 receptor
expression in 12 weeks but significant enhancement in 16 weeks caused
downregulation of VEGF receptor 1 and to some extent VEGF receptor 2
levels.
The signaling mechanisms that lead to phosphorylation of IGF-1 and
in turn activate VEGF and it’s binding to VEGF receptor 1 and VEGF
receptor 2 induces activation of PI-3 K and Akt pathways [22,68]. IGF-1
plays an important role in cell proliferation by governing PI3K/Akt
signaling and effects of which maybe mediated through the
Mitogen-activated protein kinase kinase/extracellular regulated protein
kinases (MAPK/ERK) signaling pathway. IGF-1 triggers ERK pathway
activation through the Ras/Raf/MEK cascade. Activated ERK (p-ERK)
directly activates various downstream kinases and transcription factors
and these signaling pathways have been implicated in the stimulation of
cell proliferation. We observed significant downregulation of ERK in
treatment group of L-Dopa+IGF-1 which, implies that the combination
restricts formation of new blood vessels thereby restricting progression
of PDR (Fig. 8). Since, the suppression of Akt/ERK phosphorylation in­
hibits angiogenesis [69], the activation of IGF-1 leads to overexpression
of its downstream target Akt and phosphorylates Akt. The transcript
level of p-Akt in DM group could be downregulated in DM-L-Dopa and
DM-L-Dopa+IGF-1 group (Fig. 9). It has been shown that inhibition of
IGF-1 inhibits phosphorylation of IGF-1, Akt and ERK1/2 [61]. Down­
regulation in Akt/p-Akt in L-Dopa or L-Dopa+IGF-1 treatment supports
the concept that suppression of protein kinase B (Akt) causes inhibition
of angiogenesis and neovascularization [70].
Observation of VEGF receptor 1 expression is important and normal
S. Upreti et al.
expression of VEGF receptor 1 in RNFL and IPL was found in control rats
(Fig. 10a-c). After diabetes induction, VEGF receptor 1 became densely
expressed in the GCL, IPL, INL, OPL, and ONL in diabetic rats (Fig. 10d-
f), in conjunction with previous studies [71–74]. Abrogation of VEGF
expression takes place in the treatment group of DM-L-Dopa+IGF-1-­
treated better when compared to DM-treated group (Fig. 10g-i). This
balance in the receptor expression induced by L-Dopa+IGF-1 treatment
is probably what stopped/slowed neovascularization in 16 weeks and
delayed the progression of proliferative retinopathy which was also
confirmed by measurement of mean fluorescence intensities (Fig. 10B).
IGF-1 works to enhance dopamine levels in diabetic condition and acts
coherently to maintain IGF-1 levels that can regulate VEGF receptor
expression. Low levels of IGF-1 may disrupt functioning of VEGF and
only rapid control of hyperglycemia with insulin results in rise in IGF-1R
levels [75]. Return to normoglycemia with long-term insulin therapy
presumably normalizes VEGF and IGF-1 levels, resulting in an eventual
reduction in retinopathy [76].
5. Conclusion
We provide comprehensive proof of action of L-Dopa and IGF-1
working synergistically on late-stage retinopathy to diminish the pro­
fuse vascularization of the retina observed during PDR. Adequate
availability of L-Dopa in the microenvironment of the retina could
reverse the proangiogenic effect of IGF-1 and in turn influence the level
of VEGF receptors.
The effect of hyperglycemia and its subsequent abrogation through
treatment with L-Dopa+IGF-1 was not only established through
morphological and biochemical assays but also supported by changes in
transcript levels of mRNA and protein. Since, it is already known that
diabetic retinopathy related neuronal degeneration in retinal neurons
occurs due to activation of phophatidylinositol 3-kinase (PI3)/Akt ki­
nase pathway, we found that L-Dopa+IGF-1 regulates PI3K/Akt
pathway which also modulates expression of VEGF receptor 1 and VEGF
receptor 2 and implies that suppression of angiogenesis takes place in 16
weeks. The hypothesis was also replicated in CAM model for substantial
evidence of the potential of L-Dopa in combination with IGF-1 slowing
down or delaying neovascularization during progression to PDR.
This is the first study to report the anti-angiogenic effect of a pro-
angiogenic growth factor like IGF-1, when combined with L-Dopa, en­
hances its protective function and rescues the retina from PDR. Hence,
our study provides enough evidence to corroborate our claims of syn­
ergsistic function of dopamine with IGF-1 in reducing adverse effects of
PDR.
Funding
This work was sponsored by DST-Science and Engineering Research
Board, New Delhi, India (EMR/2016/004054).
CRediT authorship contribution statement
Shikha Upreti: Methodology, Formal analysis, Validation, Data
curation, Investigation, Writing - review & editing. Seema Sen: Data
curation, Investigation, Resources. Tapas Chandra Nag: Writing - re­
view & editing. Madhumita P. Ghosh: Conception, Design, Methodol­
ogy, Resources, Data curation, Writing - review & editing, Project
administration, Funding acquisition.
Author’s Contribution
SU: Methodology, Formal analysis, Validation, Data curation,
Investigation, And Writing - review and editing. SS: data curation,
investigation, and resources. TCN: writing - review & editing. MG:
conception and design, methodology, resources, data curation, writing -
review & editing, project administration and funding acquisition.
12
Biomedicine & Pharmacotherapy 149 (2022) 112868
Conflict of interest statement
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgement
We would like to thank Science and Engineering Research Board
(Department of Science and Technology) for funding this study under
the grant number EMR/2016/004054. The authors wish to thank Dr
Tapas Chandra Nag and his staff and technicians at AIIMS EM facility,
New Delhi for providing technical support for TEM processing and im­
aging. We are also grateful to Dr Seema Sen from R.P Centre, AIIMS for
providing access for processing hematoxylin and eosin sections. The
authors would also like to thank Dr Subrajit Biswas from Amity Institute
of Molecular Medicine and Stem Cell Research, Amity University, Noida
and his student Maryam for providing the cells and assistance in con­
ducting experiments on HUVEC. We would also like to thank Dr Anil
Tiwari,Shroff eye Hospital, New Delhi for gifting us ARPE-19 cells.
Lastly, we would also like to thank Dr Ajit Verma, Amity Institute of
Microbial Technology, Amity University, Noida for allowing access to
the confocal facility.
Conflict of Interest
The authors declare no conflict of interest.
Appendix A. Supporting information
Supplementary data associated with this article can be found in the
online version at doi:10.1016/j.biopha.2022.112868.
References
[1] J.J. Steinle, Sympathetic neurotransmission modulates expression of inflammatory
markers in the rat retina, Exp. Eye Res. 84 (2007) 118–125, https://doi.org/
10.1016/j.exer.2006.09.006.
[2] C.T. Motz, K.C. Chesler, R.S. Allen, K.L. Bales, L.M. Mees, A.J. Feola, A.Y. Maa, D.
E. Olson, P.M. Thule, P.M. Iuvone, A.M. Hendrick, M.T. Pardue, Novel detection
and restorative levodopa treatment for preclinical diabetic retinopathy, Diabetes
69 (2020) 1518–1527, https://doi.org/10.2337/db19-0869.
[3] C. Nishimura, K. Kuriyama, Alterations in the retinal dopaminergic neuronal
system in rats with streptozotocin-induced diabetes, J. Neurochem. 45 (1985)
448–455, https://doi.org/10.1111/j.1471-4159.1985.tb04008.x.
[4] M.J. Gastinger, R.S.J. Singh, A.J. Barber, Loss of cholinergic and dopaminergic
amacrine cells in streptozotocin-diabetic rat and ins2 akita -diabetic mouse retinas,
Invest. Ophthalmol. Vis. Sci. 47 (2006) 3143–3150, https://doi.org/10.1167/
iovs.05-1376.
[5] M.K. Kim, M.H. Aung, L. Mees, D.E. Olson, N. Pozdeyev, P. Michael, P.M. Thule, M.
T. Pardue, U. States, dopamine deficiency mediates early rod-driven inner retinal
dysfunction in diabetic mice, Invest Ophthalmol. Vis. Sci. 59 (2018) 572–581,
https://doi.org/10.1167/iovs.17-22692.
[6] M.H. Aung, H. Park, M.K. Han, T.S. Obertone, J. Abey, F. Aseem, P.M. Thule, P.
M. Iuvone, M.T. Pardue, Dopamine deficiency contributes to early visual
dysfunction in a rodent model of type 1 diabetes, J. Neurosci. 34 (2014) 726–736,
https://doi.org/10.1523/JNEUROSCI.3483-13.2014.
[7] H.W. Van Dijk, P.H.B. Kok, M. Garvin, M. Sonka, J.H. Devries, R.P.J. Michels, M.E.
J. Van Velthoven, R.O. Schlingemann, F.D. Verbraak, M.D. Abra, Selective loss of
inner retinal layer thickness in type 1 diabetic patients with minimal diabetic
retinopathy, Invest. Ophthalmol. Vis. Sci. 50 (2009) 3404–3409, https://doi.org/
10.1167/iovs.08-3143.
[8] R. Brandies, S. Yehuda, The possible role of retinal dopaminergic system in visual
performance, Neurosci. Biobehav. Rev. 32 (2008) 611–656, https://doi.org/
10.1016/j.neubiorev.2007.09.004.
[9] C.R. Jackson, G. Ruan, F. Aseem, J. Abey, K. Gamble, G. Stanwood, R.D. Palmiter,
P.M. Iuvone, D.G. Mcmahon, Retinal dopamine mediates multiple dimensions of
light-adapted vision, J. Neurosci. 32 (2012) 9359–9368, https://doi.org/10.1523/
JNEUROSCI.0711-12.2012.
[10] I. Nir, R. Haque, P.M. Iuvone, Diurnal metabolism of dopamine in dystrophic
retinas of homozygous and heterozygous retinal degeneration slow (rds) mice,
Brain Res 884 (2000) 13–22, https://doi.org/10.1016/s0006-8993(00)02855-9.
[11] S.E. Doyle, W.E. Mcivor, M. Menaker, Circadian rhythmicity in dopamine content
of mammalian retina: role of the photoreceptors, J. Neurochem. 83 (2002)
211–219, https://doi.org/10.1046/j.1471-4159.2002.01149.x.
S. Upreti et al.
[12] H. Lahouaoui, C. Coutanson, H.M. Cooper, M. Bennis, O. Dkhissi-benyahya,
Diabetic retinopathy alters light-induced clock gene expression and dopamine
levels in the mouse retina, Mol. Vis. 22 (2016) 959–969.
[13] N. Inokuchi, T. Ikeda, Y. Imamura, C. Sotozono, S. Kinoshita, Y. Uchihori, Vitreous
levels of insulin-like growth factor-I in patients with proliferative diabetic
retinopathy, Curr. Eye Res. 23 (2001) 368–371, https://doi.org/10.1076/
ceyr.23.5.368.5441.
[14] F.E. Merimee, T.J. Zapf, J. Insulin-like, growth factors in the fed and fasted states,
J. Clin. Endocrinol. Metab. 55 (2010) 999–1002, https://doi.org/10.1210/jcem-
55-5-999.
[15] J.L. Wilkinson-berka, C. Wraight, G. Werther, The role of growth hormone, insulin-
like growth factor and soma- tostatin in diabetic retinopathy, Curr. Med. Chem. 13
(2006) 3307–3317, https://doi.org/10.2174/092986706778773086.
[16] P. Raman, Ã. Dnb, A.K. Singal, Ã. Ms, A. Behl, Effect of insulin-like growth factor-1
on diabetic retinopathy in pubertal age patients with type 1 diabetes, asia pacific,
J. Ophthalmol. 8 (2019) 319–323, https://doi.org/10.1097/
APO.0000000000000250.
[17] J.F. Payne, V. Tangpricha, J. Cleveland, M.J. Lynn, R. Ray, S.K. Srivastava, Serum
insulin-like growth factor-I in diabetic retinopathy, Mol. Vis. 17 (2011)
2318–2324.
[18] V. Poulaki, A.M. Joussen, N. Mitsiades, C.S. Mitsiades, E.F. Iliaki, A.P. Adamis,
Insulin-Like Growth Factor-I Plays a Pathogenetic Role in Diabetic Retinopathy,
Am. J. Pathol. 165 (2004) 457–469, https://doi.org/10.1016/S0002-9440(10)
63311-1.
[19] A. Pristerà, C. Blomeley, E. Lopes, S. Threlfell, E. Merlini, D. Burdakov, S. Cragg,
F. Guillemot, S.L. Ang, Dopamine neuron-derived IGF-1 controls dopamine neuron
firing, skill learning, and exploration, Proc. Natl. Acad. Sci. USA 116 (9) (2019)
3817–3826, https://doi.org/10.1073/pnas.1806820116.
[20] A.E. Ayadi, M.J. Zigmond, A.D. Smith, IGF-1 protects dopamine neurons against
oxidative stress: association with changes in phosphokinases, Exp. Brain Res 234
(7) (2016) 1863–1873, https://doi.org/10.1007/s00221-016-4572-1.
[21] A.M. Penha, F. Schaeffel, M. Feldkaemper, Insulin, insulin-like growth factor-1,
insulin receptor, and insulin-like growth factor-1 receptor expression in the chick
eye and their regulation with imposed myopic or hyperopic defocus, Mol. Vis. 17
(2011) 1436–1448.
[22] S.R. Panjala, S.A. Thomas, J.J. Steinle, Effects of insulin-like growth factor-1 (IGF-
1) receptor signaling on rates of apoptosis in retina of dopamine beta hydroxylase
(Dbh-/-) knockout mice, Auton. Neurosci: Basic Clin. 152 (1–2) (2010) 21–26,
https://doi.org/10.1016/j.autneu.2009.08.014.
[23] W.M. Zawada, D.L. Kirschman, J.J. Cohen, K.A. Heidenreich, C.R. Freed, Growth
factors rescue embryonic dopamine neurons from programmed cell death, Exp.
Neurol. 140 (1) (1996) 60–67, https://doi.org/10.1006/exnr.1996.0115.
[24] S.F. Abcouwer, Angiogenic factors and cytokines in diabetic retinopathy, J. Clin.
Cell. Immunol. 1 (2013) 1–12, https://doi.org/10.4172/2155-9899.Angiogenic.
[25] Y. Dong, C. Qian, G. Wan, A. Schizandrin, Protects human retinal pigment
epithelial cell line ARPE-19 against HG-Induced cell injury by regulation of miR-
145, Mol. Ther. 19 (2020) 42–49, https://doi.org/10.1016/j.omtn.2019.10.026.
[26] W. Wang, A.C.Y. Lo, Diabetic retinopathy: pathophysiology and treatments, Int. J.
Mol. Sci. 19 (2018) 1816, https://doi.org/10.3390/ijms19061816.
[27] C.-Y. Gong, B. Lu, Q.-W. Hu, L.-L. Ji, Streptozotocin induced diabetic retinopathy in
rat and the expression of vascular endothelial growth factor and its receptor, Int. J.
Ophthalmol. 1 (2013) 573–577, https://doi.org/10.3980/j.issn.2222-
3959.2013.05.03.
[28] C.J. Gibson, C.J. Watkins, R.J. Wurtman, Tyrosine administration enhances
dopamine synthesis and release in light-activated rat retina, J. Neural Transm. 160
(1983) 153–160, https://doi.org/10.1007/BF01243274.
[29] P.S. Rao, N. Rujikarn, J.D.H. Tyras, A specific sensitive HPLC method for
determination of plasma dopamine, Ch 28 (1989) 307–310, https://doi.org/
10.1007/BF02260781.
[30] A. Kovács-Valasek, E. Pöstyéni, V. Dénes, A. Mester, G. Sétáló Jr., R. Gábriel, Age-
related alterations of proteins in albino wistar rat retina, Cells Tissues Organs 210
(2021) 135–150, https://doi.org/10.1159/000515447.
[31] J. He, H. Wang, Y. Liu, W. Li, D. Kim, H. Huang, Blockade of vascular endothelial
growth factor receptor 1 prevents inflammation and vascular leakage in diabetic
retinopathy, J. Ophthalmol. 2015 (2015), 605946, https://doi.org/10.1155/2015/
605946.
[32] C.-Y. Gong, B. Lu, Y.-C. Sheng, Z.-Y. Yu, J.-Y. Zhou, L.-L. Ji, The development of
diabetic retinopathy in goto-kakizaki rat and the expression of angiogenesis-related
signals, Chin. J. Physiol. 59 (2016) 100–108, https://doi.org/10.4077/cjp.2016.
bae383.
[33] R. Simó, J.M. Sundstrom, D.A. Antonetti, Ocular Anti-VEGF therapy for diabetic
retinopathy: the role of VEGF in the pathogenesis of diabetic retinopathy, Diabetes
Care. 37 (2014), https://doi.org/10.2337/dc13-2002.
[34] T.J. Wubben, Dopamine and early retinal dysfunction in diabetes: insights from a
phase 1 study, Diabetes 69 (2020) 1339–1340, https://doi.org/10.2337/dbi20-
0009.
[35] H. Zhang, Y. Gao, J. Zhang, K. Wang, T. Jin, H. Wang, K. Ruan, F. Wu, Z. Xu, The
effect of total lignans from Fructus Arctii on Streptozotocin-induced diabetic
retinopathy in Wistar rats, J. Ethnopharmacol. 255 (2020), 112773, https://doi.
org/10.1016/j.jep.2020.112773.
[36] K. Chesler, C. Motz, H. Vo, A. Douglass, R.S. Allen, A.J. Feola, M.T. Pardue,
Initiation of L-DOPA treatment after detection of diabetes-induced retinal
dysfunction reverses retinopathy and provides neuroprotection in rats, Transl. Vis.
Sci. Technol. 10 (2021) 8, https://doi.org/10.1167/tvst.10.4.8.
[37] D. Chakroborty, C. Sarkar, H. Yu, J. Wang, Z. Liu, P. Sarathi, Dopamine stabilizes
tumor blood vessels by up-regulating angiopoietin 1 expression in pericytes and
13
Biomedicine & Pharmacotherapy 149 (2022) 112868
Krüppel-like factor-2 expression in tumor endothelial cells, Proc. Natl. Acad. Sci. U.
S. A. (2011) 1–6, https://doi.org/10.1073/pnas.1108696108.
[38] W. Song, W. Jiang, C. Wang, J. Xie, X. Liang, Y. Sun, L. Gong, W. Liu, L. Qu,
Jinmaitong, a traditional chinese compound prescription, ameliorates the
streptozocin-induced diabetic peripheral neuropathy rats by increasing sciatic
nerve IGF-1 and IGF-1R Expression, Front. Pharmacol. 10 (2019) 255, https://doi.
org/10.3389/fphar.2019.00255.
[39] M. Taleb, Y. Ding, B. Wang, N. Yang, X. Han, C. Du, et al., Dopamine delivery via
pH-sensitive nanoparticles for tumor blood vessel normalization and an improved
effect of cancer chemotherapeutic drugs, Adv. Health Mater. 9 (18) (2019),
1900283, https://doi.org/10.1002/adhm.201900283.
[40] C. Sarkar, D. Chakraborty, P.S. Dasgupta, S. Basu, Dopamine is a safe
antiangiogenic drug which can also prevent 5-fluorouracil induced neutropenia,
Int J. Cancer 137 (3) (2014) 744–749.
[41] M.T. Gentile, O. Pastorino, M. Bifulco, L.C. D Amato, HUVEC Tube-formation Assay
to Evaluate the Impact of Natural Products on Angiogenesis, J. Vis. Exp. 148
(2019), https://doi.org/10.3791/58591.
[42] G. Wang, J. Liang, L. Gao, Z. Si, X. Zhang, et al., Baicalin administration attenuates
hyperglycemia-induced malformation of cardiovascular system, Cell Death Dis. 9
(2018) 234, https://doi.org/10.1038/s41419-018-0318-2.
[43] M. Lorenzi, C. Gerhardinger, Early cellular and molecular changes induced by
diabetes in the retina, Diabetologia 44 (2001) 791–804, https://doi.org/10.1007/
s001250100544.
[44] A.K.W. Lai, A.C.Y. Lo, Animal models of diabetic retinopathy: summary and
comparison, J. Diabetes Res. (2013), 106594, https://doi.org/10.1155/2013/
106594.
[45] G. Scuderi, S. Fragiotta, L. Scuderi, C.M. Iodice, A. Perdicchi, Ganglion cell
complex analysis in glaucoma patients: what can it tell us? Eye Brain 12 (2020)
33–44, https://doi.org/10.2147/EB.S226319.
[46] J. Chhablani, A. Sharma, A. Goud, H.K. Peguda, H.L. Rao, V.U. Begum,
G. Barteselli, Neurodegeneration in type 2 diabetes: evidence from spectral-domain
optical coherence tomography, Investig. Ophthalmol. Vis. Sci. (2015) 6333–6338,
https://doi.org/10.1167/iovs.15-17334.
[47] Y.J. Choi, J.W. Jeoung, K.H. Park, D.M. Kim, Glaucoma detection ability of
ganglion cell-inner plexiform layer thickness by spectral-domain optical coherence
tomography in high myopia, Investig. Ophthalmol. Vis. Sci. (2013) 2296–2304,
https://doi.org/10.1167/iovs.12-10530.
[48] J.W. Jeoung, Y.J. Choi, K.H. Park, D.M. Kim, Macular ganglion cell imaging study:
glaucoma diagnostic accuracy of spectral-domain optical coherence tomography,
Investig. Ophthalmol. Vis. Sci. (2013), https://doi.org/10.1167/iovs.12-11273.
[49] S. Bonnin, R. Tadayoni, A. Erginay, P. Massin, Correl. Ganglion Cell Layer.
Thinning Poor Vis. Funct. Resolut. Diabet. Macular Edema (2015), https://doi.org/
10.1167/iovs.14-15503.
[50] C. Hernández, M. Dal Monte, R. Simó, G. Casini, Neuroprotection as a therapeutic
target for diabetic retinopathy, J. Diabetes Res. 2016 (2016), 9508541, https://doi.
org/10.1155/2016/9508541.
[51] V. Pérez-Fernández, D.G. Harman, J.W. Morley, M.A. Cameron, Optimized method
to quantify dopamine turnover in the mammalian retina, Anal. Chem. 89 (2017)
12276–12283, https://doi.org/10.1021/acs.analchem.7b03216.
[52] C.T. Motz, K.C. Chesler, R.S. Allen, K.L. Bales, L.M. Mees, A.J. Feola, A.Y. Maa, D.
E. Olson, P.M. Thule, P.M. Iuvone, A.M. Hendrick, M.T. Pardue, Novel detection
and restorative levodopa treatment for preclinical diabetic retinopathy, Diabetes
69 (2020) 1518–1527, https://doi.org/10.2337/db19-0869.
[53] K. Okimura, Y. Nakane, T. Nishiwaki-Ohkawa, T. Yoshimura, Photoperiodic
regulation of dopamine signaling regulates seasonal changes in retinal
photosensitivity in mice, Sci. Rep. 11 (2021) 1843, https://doi.org/10.1038/
s41598-021-81540-w.
[54] G. Ogata, T.W. Stradleigh, G.J. Partida, A.T. Ishida, Dopamine and full-field
illumination activate D1 and D2-D5-type receptors in adult rat retinal ganglion
cells, J. Comp. Neurol. 520 (2012) 4032–4049, https://doi.org/10.1002/
cne.23159.
[55] M.L. Firsov, L.A. Astakhova, The role of dopamine in controlling retinal
photoreceptor function in vertebrates, Neurosci. Behav. Physiol. 46 (2016)
138–145, https://doi.org/10.1007/s11055-015-0210-9.
[56] T. Kondo, D. Vicent, K. Suzuma, M. Yanagisawa, G.L. King, M. Holzenberger, C.
R. Kahn, Knockout of insulin and IGF-1 receptors on vascular endothelial cells
protects against retinal neovascularization, J. Clin. Invest. 111 (2003) 1835–1842,
https://doi.org/10.1172/JCI17455.
[57] J. Ruberte, E. Ayuso, M. Navarro, A. Carretero, V. Nacher, V. Haurigot, M. George,
C. Llombart, A. Casellas, C. Costa, A. Bosch, F. Bosch, Increased ocular levels of
IGF-1 in transgenic mice lead to diabetes-like eye disease, J. Clin. Invest. 113
(2004) 1149–1157, https://doi.org/10.1172/JCI19478.
[58] C. Gerhardinger, K.D. McClure, G. Romeo, F. Podestà, M. Lorenzi, IGF-I mRNA and
signaling in the diabetic retina, Diabetes 50 (2001), https://doi.org/10.2337/
diabetes.50.1.175.
[59] D.V. Nguyen, S. Li Calzi, L.C. Shaw, J.L. Kielczewski, H.E. Korah, M.B. Grant, An
ocular view of the IGF-IGFBP system, Growth Horm. IGF Res 23 (2013) 45–52,
https://doi.org/10.1016/j.ghir.2013.03.001.
[60] A.I. Arroba, L. Rodríguez-de la Rosa, S. Murillo-Cuesta, L. Vaquero-Villanueva, J.
M. Hurlé, I. Varela-Nieto, Á.M. Valverde, Autophagy resolves early retinal
inflammation in Igf1-deficient mice, Dis. Model. Mech. 9 (2016) 965–974, https://
doi.org/10.1242/dmm.026344.
[61] G. Xi, C. Wai, D. Clemmons, Inhibition of aberrant IGF-I signaling in diabetic male
rat retina prevents and reverses changes of diabetic retinopathy, J. Diabetes Res.
2019 (2019), 6456032, https://doi.org/10.1155/2019/6456032.
S. Upreti et al.
[62] Z. Yu, B. Lu, C. Gong, L. Ji, Streptozotocin induced diabetic retinopathy in C 57
mice and the expression of some pro - angiogenic molecules, Int. Eye Sci. 16 (2016)
1–6, https://doi.org/10.3980/j.issn.1672-5123.2016.1.01.
[63] T. Namakachi, A. Matkovits, T. Seki, S. Shioda, Distribution and protective
function of pituitary adenylate cyclase-activating polypeptide in the retina IN
RETINAL TISSUE, Front. Endocrinol. (Lausanne). 3 (2012) 1–10, https://doi.org/
10.3389/fendo.2012.00145.
[64] Q. Yang, Y. Zhang, J. Jiang, M. Wu, Q. Han, Q. Bo, G. Yu, Y. Ru, X. Liu, M. Huang,
L. Wang, X. Zhang, J. Fang, X. Li, Protective effects of a novel drug RC28-E
blocking both VEGF and FGF2 on early diabetic rat retina, Int. J. Ophthalmol. 11
(2018) 935–944, https://doi.org/10.18240/ijo.2018.06.07.
[65] N. Gupta, S. Mansoor, A. Sharma, A. Sapkal, J. Sheth, P. Falatoonzadeh,
B. Kuppermann, M. Kenney, Diabetic retinopathy and VEGF, Open Ophthalmol. J.
7 (2013) 4–10, https://doi.org/10.2174/1874364101307010004.
[66] L. Moons, C. Vanhole, P. Carmeliet, S. Vanhaesebrouck, H. Danie, N. Intensive,
C. Unit, Oxygen-Induced Retinopathy in Mice: Amplification by Neonatal IGF-I
Deficit and Attenuation by IGF-I Administration, Pediatr. Res. 65 (2009) 307–310,
https://doi.org/10.1203/PDR.0b013e3181973dc8.
[67] J. Peter, R. Folberg, A. Itin, H. Gnessin, I. Hemo, E. Keshet, Upregulated expression
of vascular endothelial growth factor in proliferative diabetic retinopathy, 241 LP –
245, Br. J. Ophthalmol. 80 (1996), https://doi.org/10.1136/bjo.80.3.241.
[68] P. Kermer, N. Klocker, M. Labes, M. Bahr, Insulin-like growth factor-I protects
axotomized rat retinal ganglion cells from secondary death via PI3-K-dependent
Akt phosphorylation and inhibition of caspase-3 In vivo, J. Neurosci. 20 (2000)
722–728.
[69] F. Qui, h Tong, Y. Wang, J. Tao, H. Wang, L. Chen, Inhibition of miR-21-5p
suppresses high glucose-induced proliferation and angiogenesis of human retinal
microvascular endothelial cells by the regulation of AKT and ERK pathways via
maspin, Biosci. Biotechnol. Biochem 82 (8) (2018) 1366–1376, https://doi.org/
10.1080/09168451.2018.1459179.
14
Biomedicine & Pharmacotherapy 149 (2022) 112868
[70] P. Wang, X.F. Tian, J.B. Rong, D. Liu, G.G. Yi, Q. Tan, Protein Kinase B (Akt)
promotes pathological angiogenesis in murine model of oxygen-induced
retinopathy, Acta Histochem Cytochem 44 (2) (2011) 103–111.
[71] H.-Y.L. Park, J.H. Kim, C.K. Park, Neuronal cell death in the inner retina and the
influence of vascular endothelial growth factor inhibition in a diabetic rat model,
Am. J. Pathol. 184 (2014) 1752–1762, https://doi.org/10.1016/j.
ajpath.2014.02.016.
[72] X. Zhang, M. Lassila, M.E. Cooper, Z. Cao, Retinal expression of vascular
endothelial growth factor is mediated by angiotensin type 1 and type 2 receptors,
Hypertension 1 (2004) 276–281, https://doi.org/10.1161/01.
HYP.0000113628.94574.0f.
[73] A.N. Witmer, H.G. Blaauwgeers, H.A. Weich, K. Alitalo, G.F.J.M. Vrensen, R.
O. Schlingemann, Altered expression patterns of VEGF receptors in human diabetic
retina and in experimental VEGF-induced retinopathy in monkey, Invest.
Ophthalmol. Vis. Sci. 43 (2002) 849–857.
[74] A. Campos, J. Martins, E.J. Campos, R. Silva, A.F. Ambrósio, Choroidal and retinal
structural, cellular and vascular changes in a rat model of Type 2 diabetes, Biomed.
Pharmacother. 132 (2020), 110811, https://doi.org/10.1016/j.
biopha.2020.110811.
[75] A.J. Barber, D.A. Antonetti, T.S. Kern, C.E.N. Reiter, R.S. Soans, J.K. Krady, S.
W. Levison, T.W. Gardner, S.K. Bronson, The Ins2 akita mouse as a model of early
retinal complications in diabetes, Investig. Ophthalmol. Vis. Sci. (2005)
2210–2218, https://doi.org/10.1167/iovs.04-1340.
[76] L.E.H. Smith, W. Shen, C. Perruzzi, S. Soker, F. Kinose, X. Xu, G. Robinson,
S. Driver, J. Bischoff, B. Zhang, J.M. Schaeffer, D.R. Senger, Regulation of vascular
endothelial growth factor-dependent retinal neovascularization by insulin-like
growth factor-1 receptor, Nat. Med. 5 (1999) 1390–1395, https://doi.org/
10.1038/70963.