Professional Documents
Culture Documents
Preface
Preface
Without a doubt, historians will describe 20th and 21st centuries as the oil-based society. One
hundred years ago oil exploitation began, first as a source of energy and later to include oil as
a source of raw material. In addition to the 1 trillion barrels that have already been harvested,
recent estimations shows that about 3 trillion barrels of oil remain to be recovered worldwide,
half from proven reserves and half from undeveloped or undiscovered sources. Oil production
is expected to peak sometime between 2010 and 2020, and then fall inexorably until the end
of this century. After the production peak, the more expensive fuel sources will come into
production. These include hard-to-extract oil deposits, tarry sands, and Synfuels from coal
that requires alternative or complementary to conventional oil refining technologies.
Our society has an inexorable challenge: to increase the production of goods and
services for people, using new process technology that should be energetically efficient and
environmental friendly. This also will be the case for the petroleum industry. Improvements
in conventional oil refining processes such as cracking, hydrogenation, isolnerization,
alkylation, polymerization, and hydrodesulfurization, certainly will occur. Nevertheless, non-
conventional biotechnological processes could be implemented, in contrast to the available
processes, biological processing may offer less severe process conditions and higher
selectivity tbr specific reactions. Biochemical processes are expected to be low demand
energy processes and certainly environmentally compatible.
The primary target of the petroleum industry is to enhance and maintain a continuous
oil production. Preconceived ideas and lnisconceptions about biotechnology continue to limit
the applications of biological processes in the chemical industry. Nevertheless, there are
biotechnological processes that have been demonstrated to be industrially successful and that
are shown to be sufficiently stable, productive and econolnic for commercial applications.
Even if wastewater treatment and soil bioremediation are common biotechnological
applications in the oil industry, petroleum biotechnology is still in its infancy. Doubtless,
though, biotechnology will play an increasingly important role in future industrial processes.
in this book, experts from 11 countries critically discuss the developments and perspectives of
biotechnological processes for the petroleum industry.
An integrated approach into the possibility of using petroleum biotechnology
throughout the value chain of an oil company is presented. The authors discuss the evaluation
of biotechnology as a general toolbox for solving some of the technology problems of today
and future possibilities to implement new refinery processes. Petroleum refining could be
enhanced by biochemical reactions in which the specificity exceeds by far these of chemical
reactions. The selective removal of sulfur, nitrogen, and metals fl'om petroleum by
biochelnical reactions perlbrmed by microorganisms and/or enzylnes is discussed. Increasing
supply of heavy crude oils and bitumens has increased the interest in the conversion of the
high-molecular weight fi'actions of these materials into refined fuels and petrochemicals. This
upgrading has typically been accomplished either with high-temperature and expensive
processes thermal conversion (cracking or coking) or by catalytic hydroconversion. In
contrast to the available processes, biological processing may offer less severe process
conditions and higher selectivity to specific reactions. Enzymatic transtbrmations of
asphaltenes in non- conventional media, and biological upgrading to improve the quality of
certain crude oils and liquid fuels could be envisaged, using biocatalysts to decrease
aromaticity and sensitize aromatic heterocycles to subsequent heteroatom removal.
Bioprocessing would complement conventional refining technologies and result in improved
fuel quality at lower capital and operating costs and with reduced environmental impact.
Innovative new processes could be explored, such as methanol production from
methane. Methane monooxygenases are unique among known catalytic systems in their
ability to convert methane to methanol under ambient conditions using dioxygen as the
oxidant. Tile unusual reactivity and broad substrate profiles of methane monooxygenases
suggest many possible applications in the petrochemical industry. In addition, the ability of
anaerobic bacteria to convert petroleum into methane and thereby generate useful energy is a
very interesting alternative. On the other hand, biological production of hydrocarbons by
bacteria is revisited and its potential is explored, not only as an environmentally-fiiendly fuel
supply, but also as a renewable source for basic petrochemicals.
Microbial colonization of metal surtS,ces drastically changes the classical concept of
the electrical interface commonly used in inorganic corrosion. Corrosion is a leading cause tbr
pipe failure, and is a main component of the operating and maintenance costs of gas and oil
industry pipelines. The cost of corrosion to the gas and oil industries was estimated in 2001 to
be about $13.4 billion/yr and of this as much as $2 billion/yr may be due to microbiaily-
induced corrosion. In order to moderate the economic importance of corrosion in the oil
industry, molecular tools are used to study its microbial complexity.
The current knowledge of the indigenous deep subsurthce microbial community in
petroleum reservoirs shows an enormous physiological diversity and constitutes a complex
ecosystem with an active biogeochemical cycling of carbon and minerals. '%outing ~' of oil
reservoirs by the formation of hydrogen sulfide has been a problem since the beginning of
commercial oil production. Sulfate-reducing bacteria are the culprits that produce this noxious
gas, leading to souring. This microbial process in wastewaters and oil field waters can be
controlled by another group of microbes, known as nitrate-reducing bacteria. The use of
nitrate to control microbially-produced sulfide in oil fields is a proven biotechnology that is
grossly under-used by the petroleum industry. Its effectiveness has been demonstrated in
many laboratory investigations and in some field studies. Nitrate has replaced biocides in
some of the oil fields in the North Sea, and the results have been very positive. It is now very
clear that land-based oil field operators should seriously consider using this proven
biotechnology to control, and possibly eliminate, microbially-induced souring and the
problems associated with H2S fbrmation.
Environmentally-related biotechnological processes were pioneered in the petroleum
industry. Oil spill bioreinediation technologies epitomize modern environmental techniques,
working with natural processes to remove spilled oil from the environment while minimizing
undesirable environmental impacts. The application of biological wastewater treatment in the
frame of a process integration treatment technology will hopefully close the water cycle
allowing ~zero discharge" in the petroleum industry. Nowadays, water should be considered
as one of the main raw materials of the petroleum industry and its treatment and retlse with
advanced treatment technology should be applied. On the other hand, phytoreinediation is an
emerging technology that is based on sound ecological engineering principles~ and that has
developed into a more acceptable technology for the relnediation of soils and groundwater
polluted with residual concentrations of petroleum hydrocarbons. The advantages of using
phytoremediation include cost effectiveness, aesthetic advantages, and long-term
applicability. Finally, biological air treatment systems are among the established technologies
that can be applied to control volatile organic compounds and odor emissions, and they are
applicable for a wide range of volatile pollutants lbund in the petroleum industry. Biological
treatment of polluted air ernissions results from the competence of active microorganisms,
including bacterim yeast, and fungi, to transform certain organic and inorganic pollutants into
compounds with lower health and environmental impact. Their applications are growing
continually based on scientific and technological developments.
vii
The powerful tools of molecular biochemistry can be used to improve the enzyme
stability and efficiency. These techniques may be applied to the particular needs of the
petroleum industry. In addition, the enzymes isolated from extremophilic microorganisms are
extremely thermostable and generally resistant to non-conventional conditions such as organic
solvents and extreme pH. Thus, many enzymes and enzymatic proteins are still to be
discovered.
Rafaei Vazquez-Duhalt
The only way to discover the limits of the possible is to go beyond them into the impossible.
(Arthur C. Clarke).
xiii
List of Contributors
S. Alcfintara
lnstituto Mexicano del Petr61eo
Eje Central Lfizaro Cfirdenas 152, C.P. 07730, Mdxico D.F.
P. J. J. Alvarez
Department of Civil and Environmental Engineering, Seamans Center
University of Iowa, Iowa City, Iowa, U.S.A.- 52242
R. Auria
Laboratoire IRD de Microbiologie, Universit6 de Provence
CESB/ESIL, Case 925, 163 Avenue de Luminy 13288, Marseille Cedex 9 France
M. Ayala
Instituto Mexicano del Petrdleo.
Eje Central L/tzaro Cfirdenas 152, San Bartolo Atepehuacan 07730 Mdxico DF, Mdxico
H. Bach
Department of Molecular Microbiology and Biotechnology, TeI-Aviv University
Tel-Aviv, 69978, Israel
N.-K. Birkeland
Department of Biology, University of Bergen, Box 7800, N-5020 Bergen, Norway
O.G. Brakstad
Sintef Materials and Chemistry, Trondheim, Norway
J. R. Clark
ExxonMobil Research & Engineering Co.
Annandale, NJ 08801
H. Dalton
Department of Biological Sciences, University of Warwick
Coventry CV4 7AL, United Kingdom
I.A. Davidova
Institute for Energy and the Environment and Department of Botany and Microbiology,
University of Oklahoma, Norman, OK 73019, USA.
E. Duque
Estacidn Experimental del Zaidin, CSIC
C / Profesor Albareda 1, 18008 Granada, Spain
xiv
R.E. Ecktbrd
Department of Biological Sciences, University of Alberta
Edmonton, Alberta, Canada T6G 2E9
H. Enomoto
Department of Geoscience and Technology, Graduate School of Environmental Studies,
Tohoku University, Aramaki, Aoba-ku, Sendal 980-0845, Japan
P.M. Fedorak
Department of Biological Sciences, University of Alberta
Edmonton, Alberta, Canada T6G 2E9
J. M. Foght
Department of Biological Sciences, University of Alberta
Edmonton, Alberta Canada T6G 2E9
K. Fuj iwara
Chugai Technos Co. Ltd.
9-20 Yokogawa-Shinmachi Nisi-ku Hiroshima City 733-0013, Japan
M.T. Gallegos
Estaci6n Experimental del Zaidin, CSIC
C / Profesor Albareda !, 18008 Granada, Spain
L.M. Gieg
Institute for Energy and the Environment and Department of Botany and Microbiology,
University of Oklahoma, Norman, OK 73019, USA.
M.R. Gray
Department of Chemical and Materials Engineering, University of Alberta
Edmonton, Alberta, Canada T6G 2G6
D.L. Gutnick
Present address, Biotechnology Research Laboratories. Taro Pharmaceuticals U.S.A.,
3 Skyline Drive, Hawthorne, New York, 10532, U.S.A.
L.K. Herrera b
Faculty of Engineering, University of Antioquia, Medellin, Colombia
C.X. Hong
PetroChina Company Limited, Jilin Oilfield Company
Jilin province, China
R. Kalnath
Department of Civil and Environmental Engineering, Seamans Center
University of Iowa, lowa City, Iowa, U.S.A.- 52242
XV
J.J. Kilbane 11
Gas Technology Institute, 1700 S. Mt. Prospect Rd., Des Plaines IL 60018
K.M. Kirkwood
Department of Chemical and Materials Engineering, University of Alberta
Edmonton, Alberta, Canada T6G 2G6
H.Kr. Kotlar
Statoil ASA, R & D Center, Postuttak, N-7005 Trondheim, Norway
S. Le Borgne b
Instituto Mexicano del Petr61eo, Eje Central Lfizaro Cfirdenas 152, Col. San Bartolo
Atepehuacan, 07730 M6xico D.F., Mexico
S. Markussen
Department of Marine Environmental Technology, Trondheim, Norway
S. Marquds
Estacidn Experimental del Zaidin, CSIC
C / Profesor Albareda 1, 18008 Granada, Spain
M. Morales-lbarria
Instituto Mexicano del Petr61eo
Eje Central Lfizaro Cfirdenas 152, C.P. 07730, M6xico D.F.
M. Nanny
Institute for Energy and School of Civil Engineering and Environmental Science,
University of Oklahoma, Norman, OK 73019, USA.
K. Ohno
Technology Research Center, Japan National Oil Corporation
I-2-2 Hamada, Mihama-ku, Chiba 261-0025, Japan
P. Olguin-Lora
Instituto Mexicano del Petr61eo
Eje Central Lfizaro Cfirdenas 152, C.P. 07730, Mdxico D.F.
R. C. Prince
ExxonMobil Research & Engineering Co.
Annandale, NJ 08801
J.L. Ramos
Estaci6n Experimental del Zaidin, CSIC
C / Profesor Albareda I, 18008 Granada, Spain
xvi
E. Razo-Flores,
lnstituto Potosino de lnvestigaci6n Cientifica y Tecnol6gica
Camino a la Presa San Jos6 2055,. C.P. 78216, San Luis Potosi, SLP, M6xico.
,I. A. Rentz
Department of Civil and Environmental Engineering, Seamans Center
University of Iowa, Iowa City, Iowa, U.S.A.- 52242
S. Revah
Department of Process Engineering, Universidad Aut6noma Metropolitana-lztapalapa
(UAM-I). Apdo. Postal 55-534, 09340 Mexico D.F., Mexico
J. L. Schnoor
Department of Civil and Environmental Engineering, Seamans Center
University of Iowa, Iowa City, Iowa, U.S.A.- 52242
A. Segura
Estacidn Experimental del Zaidin, CSIC
C / Profesor Albareda !, 18008 Granada, Spain
T.J. Smith
Biomedical Research Centre, Sheffield Hallam University
Howard Street, Sheffield S I I WB, United Kingdom
J.M. Suflita
Institute for Energy and the Environment and Department of Botany and Microbiology,
University of Oklahoma, Norman. OK 73019, USA.
Y. Sugai
Akita University Venture Business Laboratory
1-1 Tegatagakuen-cho Akita City ,010-8502, Japan
B. Valderrama
Departamento de Ingenieria Celular y Biocatfilisis, Universidad Nacional Aut6noma de
M6xico, AP 510-3, Cuernavaca, Morelos, 62250, Mdxico.
R. Vazquez-Duhalt
lnstituto de Biotecnologia, UNAM.
Apartado Postal 510-3 Cuernavaca, Morelos 62250 M6xico
H.A. Videla
Department of Chemistry. College of Pure Sciences, INIFTA, University of
La Plata, Argentina
A. Winnberg
Department of Biotechnology, N7465 Trondheim, Norway
xvii
N. Yazawa
Technology Research Center, Japan National Oil Corporation
I-2-2 Hamada, Mihama-ku, Chiba 261-0025, Japan
X. Zhu
Gas Technology Institute, 1700 S. Mt. Prospect Rd., Des Plaines IL 60018
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Elsevier B.V. All rights reserved.
Chapter 1
1. I N T R O D U C T I O N TO AN I N T E G R A T E D A P P R O A C H
The history of biotechnology goes thousands of years back in time. One of the
very first written statements of biotechnology is found in the Bible, telling that
Lot was drinking wine, made through fermentation around 2000 B.C.E. In
modem time Antoni van Leeuwenhoeck was the first to observe a micro-
organism in a primitive microscope in 1684. Louis Pasteur discovered how to
protect against diseases by vaccination, using heat-inactivated organisms,
around 1863. In 2002 the gene sequence of the human genome was completed.
Biotechnology is continuously expanding, and will play an increasingly
important role in future industrial process. Petroleum biotechnology is a very
young and exiting part of these industrial possibilities
It is well established that petroleum reservoirs contain active and diverse
populations of microorganisms. Microbial growth within oil reservoirs has
traditionally been associated with biofouling and souring. Furthermore, the
potentials for microbial improved oil recovery (MIOR) have been investigated
for many decades (see chapter 15)[1]. Recently, nitrate injection was introduced
as a method for curing reservoirs "contaminated" by sulphate-reducing
prokaryotes (see chapter 11)[2]. However, petroleum biotechnology possesses
several other opportunities besides MIOR and nitrate injection. This chapter will
focus on some of these issues.
The primary target of the petroleum industry is to enhance and maintain a
continuous oil production. In 1998/1999 Statoil initiated an R&D program
looking into the possibility of using petroleum biotechnology as an integrated
approach throughout the value chain of the oil company.
There were three main objectives:
1: Evaluation of biotechnology as a general toolbox for solving some of the
technology problems of today.
2: Investigate future possibilities; e.g. to start refinery processes in the reservoir
using dedicated microorganisms.
3: To generate a resource base for new genetic information achieved from the
organisms in the reservoir.
These objectives may be achieved through focusing on biotechnology as a
new business concept of interest to the company. Coverage of all aspects of
biotechnology would be an enormous task. However, the enhanced in-house
understanding of reservoir microbiology has served as a basis for the few
selected areas described below:
9 N e w techniques in exploration andproduction:
Application of molecular biology techniques as new tools for specific
identification and characterization of hydrocarbon sources during exploration
and production. Samples may come from drill cuttings from exploration
wells; produced oil and formation water; sediments from sea floor seep zones;
etc.
~ Biological well treatments (preventive medication):
Clogging of wells by scaling, hydrates, etc. may be prevented by applying
environmentally friendly biological produced chemicals. This may be
achieved by developing self-sustained, natural existing or bioengineered
microbial populations placed inside the reservoir. The target is to produce
biological substances that can replace traditional chemicals, and that this
remediation will increase treatment lifetime to ensure a continuous oil
production.
9 Bioreactors:
Low energy biological processes for up-grading of oil to improve quality and
thereby reduce penalty pricing. Various types of bioreactors and enzyme
systems can replace traditional catalysts for certain chemical reactions, waste
handling or the production of bio-energy.
9 N e w application ofextremophiles:
New thermophilic and piezophilic enzyme system can enable new bio-
engineering processes and products for applications in the above-mentioned
areas, or give rise to entirely new products and business opportunities.
Fig. 3. DGGE analysis of PCR-amplified 16S rDNA sequences from two North Sea oil
reservoirs, reservoir A (1, 2) and reservoir B (3, 4, 5). Only sample 2 contained fluids with
seawater penetration.
Thermophilic species of Thermotogales, Archaeoglobus, Thermoanaero-
bacter, Methanococcus and Thermococcus have been reported from high-
temperature oil reservoirs [6-9, 14]. Several of these microbes are typical sulfur-
utilizers, being active in desulphurization of crude oil. These microbes may be
the predominant sources for HzS generation rather than typical sulphate-
reducing bacteria, and interestingly several of them were enriched in culture
media designed for SRB.
Fig. 4. FISH enumeration of the total concentrations of cells (DAPI), bacteria (EUB338),
archaea (ARCH915), Arcoglobus (ARGLO605) and thermotogales (THERSI672) in produced
fluids from two North Sea reservoirs, Reservoir A and Resevoir B wl and w2.
10
3.1. Pre-refining
Up-grading of crude oils by biocatalytic processes may take place anywhere
from down-hole to the refinery; in the reservoir, at the wellhead, during tanking,
transport and storage. The pre-refining opportunity is to utilize the time slot
from the start of drainage in the reservoir to the crude reaches the refinery stage.
At any of these stages, a specially designed biocatalyst could be introduced (see
Fig. 1). Although there will be considerable differences between traditional
crude oils and the heavy crudes in physical handling as well as refinery
processes, the chemistry of the compounds that need to be bio-converted could
be close relatives within the same classes.
Fig. 5. Schematic outline of the procedure for making blocked mutants with an inactive
enzyme by gene disruption.
Fig. 6. Bioconversion of light gas oil by the speciallydesigned Sphingomonas spp. N2.
Fig. 8. Bio-reactor for conversion ofPAH's in a real feedstock from crude oil
17
Study of pure enzyme vs. whole cell based biocatalysts. In future investigations
this will include "the aromatic ring opening dioxygenase system". The
Sphingomonas yanoikuyae N2 will be used as a model system for comparing
enzyme and whole cell biocatalysts. In many instances it is an advantage to use
pure enzyme systems instead of whole cells as biocatalysts (see chapter 3).
Enzyme reactions are specific and easy to control, they can be carried out in
non-aquatic environments, and enzymes, as other chemical catalysts, will not
consume carbon i.e. the carbon content in the fuel will be preserved. The
opening of the aromatic ring (e.g. naphthalene, Fig. 9) is a four step enzymatic
process starting with a dioxygenase reaction, then a dehydrogenation followed
by a second dioxygenase reaction and finally an isomerization. The first
oxygenation requires NADH, but the formed NAD + is recycled to NADH in the
dehydrogenation reaction. The challenge is to develop a system where this
multistep enzyme reaction could proceed efficiently in a cell free system.
HO ...H
,,,
OH [c~5-1,2-Dd'xydgox'y1,2-
- dd~yckonaphthelene]
J [1,2-dihyda-e~-1,2-dlhyda~maIpX~me ilehylbrege~l.~e]
OH
~ O H [ 1,2-Dxhyd~oxy-naphihelene]
J ~ Inactivate
I~OH I S'hc71alclehydel
CHO
~~ H
00"
[Sehcylatel
i ,.a~yh,. l,~.,,yl,.. I
OH
Fig. 9" Metabolic pathway of naphthalene showing the enzymes involved See reference [57].
18
3.2.2. Bioreactors
Bioconversion of refinery fractions may take place using growing or resting
cells, "dead" cells, or immobilized cells or enzymes as biocatalysts. Aromatic
ring-opening involves a multistep metabolic pathway. Multistep enzymatic
reactions often require co-factors and/or reducing power (NAD (P) H) that has
to be regenerated or supplied for the enzymatic reaction to take place. Thus,
whole cells, rather than pure enzymes, are often required. The biocatalysts are
usually contained in the aqueous phase and the reaction take place either in this
phase or at the interface between the aqueous and the organic/oil phase. The
components in the refinery fraction that are being up-graded usually show low
water solubility, while the converted products usually are more soluble in the
aqueous phase than in the organic/oil phase. Mass transfer of substrates and
products between the water and oil phase is a major challenge. To achieve
adequate mass transfer, reactors capable of generating a large interface between
oil and water should be chosen. Various types of bioreactors have been
employed by others [58], including stirred tank reactors, airlift reactors,
emulsion phase contactors reactor and fluidized bed reactors. The current
investigation has used stirred tank reactors run in batch, fed-batch and
continuous mode with free growing or resting cells. However, immobilized cells
and enzymes are included in the next phase of studies.
in productivity occur in the well. The preventive actions are to avoid the onset of
these predicted situations.
With the advance in drilling and completion, increasing number of complex
and expensive wells are being installed, e.g. multilateral, multi-zones, sidetrack
and horizontal. The infrastructures that are in place, such as flow lines and
platforms, also enable the targeting and drainage of the additional reserves found
near the exiting fields. Very often these additional oil and/or gas are produced
via tieback and satellite facilities. Successful treatments of stimulation, scale
squeeze and tubing deposit removal in these wells can no longer rely on the
traditional method of bullheading. Special tools such as coil tubing and
inflatable plug will be needed to place the chemicals accurately down-hole.
Intervention in these wells will be prohibitory expensive due to tools hire,
personnel and extended period of deferred oil production (tools run). It is
important to realize that for certain type of completion, well re-entry is almost
impossible despite accepting the financial penalty. There is clearly a need to
develop an intervention free system for these wells that allow the flow of oil
unhindered and preferably with the chemicals pre-delivered down-hole.
For mining bitumen, $10 OPEX is probably the lower limit Courtesy of
George Stosur
Fig. 11. OPEX profile in developments of new technology for mining bitumen. The curve
shows the measured cost until 1998, then the further projection. The bars in 99, 00 and 01 are
the actual cost. (Maurice B. Dusseault, personal communication).
21
The strategies of this new technology are illustrated in fig. 12 and include:
9 Placement of the treatment during the completion stage. This can be done
either by bullheading the specially designed organism together with nutrients
into the formation, or by coiled tubing (CT) deployment.
9 Use of porous particles soaked with the product placed inside the gravel
packs at the completion face.
9 Use of micro encapsulation, with the desired microorganism together with
nutrition inside the capsules. Inject far beyond the critical matrix in the well.
If successful, this concept constitutes the only possible self sustained and
lasting method by which production chemicals can be produced in situ and to
allow wells to operate free of most interventions.
22
Acknowledgement
The authors would like to thank Statoil for the permission to publish this
book chapter and for their support in the "Applied Biotechnology" program.
Many thanks to our special adviser, H~kon Ruesl~tten, for valuable help and
discussions.
REFERENCES
[1] M.J. McInerney and K.L. Sublette, In: C.J Hurst, G.R Knudsen, M.J McInemey, L.D
Stetzenbach, and M.V. Walter (eds.), Manual of Environmental Microbiology, ASM
Press, Washington, D.C., 1997, pp. 600-607
[21 M. Nemati, T.J. Mazutinec, G.E. Jenneman, G. Voordouw, J. Ind. Microbiol.
Biotechnol. 26 (2001) 350.
[3] D. Lee, D. Lowe and P. Grant, 47th Annu. Cim. Petrol. Soc. Tech. Mtg. (Calgery),
Vol.2, Pap. no. cim. 96- 09.
[4] R.S. Bryant, SPE/DOE- 35356 1 (1996) 127.
[5] J.T. Rosnes, T. Torsvik, and T. Lien, Appl. Environ. Microbiol. 57 (1991) 2302.
[6] K.O. Stetter, R. Hubert, E. B16chl, M. Kurr, R.D. Eden, M. Fielder, H. Cash and I.
Vance, NATURE 365 (1993) 743.
[7] S. L'Haridon, A.L. Reysenbach, P. Glenat, P. Prieur and C. Jeanthon, NATURE. 377
(1995) 223.
[8] Y. Takahata, M. Nishijima, T. Hoaki and T. Marauyama, Appl. Environ. Microbiol. 66
(2000) 73.
[9] V.J. Orphan, L.T. Taylor, D. Hafenbradl and E.F. DeLong, Appl. Environ. Microbiol.
66 (2000) 700.
[10] I. Spark, I. Patey, B. Duncan, A. Hamilton, C. Devine and C. McGovem-Traa, Clay
Minerals 35 (2000) 5.
25
[40] T. Ishige, A. Tani, Y. Sakai and N. Kato, Appl. Environ. Microbiol. 66 (2000) 3481.
[41] Z. Wang, M. Fingas, E.H. Owens, L. Sigouin and C.E. Brown, J. Chromatogr. A. 926
(2001) 275.
[42] D.R. Kadavy, B. Plantz, C.A. Shaw, J. Myatt, T.A. Kokjohn and K.W. Nickerson, Appl.
Environ. Microbiol. 65 (1999) 1477.
[43] M. Hofrichter, F. Bublitz and W. Fritsche, Fuel. Proc. Technol. 52 (1997) 43.
[44] A.Y. Zekri and R. E1-Mehaideb, J. Petrol. Sci. Eng. 37 (2003) 123.
[45] T.L. Potter and B. Duval, Environ. Sci. Technol. 35 (2001) 76.
[46] W. Dott and D. Schoenen, Zentralbl. Bakteriol. Mikrobiol. Hyg. 180 (1985) 436.
[47] K.A. Powell, S.W. Ramer, S.B. Del Cardayre, W.P. Stemmer, M.B. Tobin, P.F.
Longchamp and G.W. Huisman, Angew. Chem. Int. Ed. Engl. 40 (2001) 3948.
[48] D.L. Gutnick and H. Bach, Appl. Microbiol. Biotechnol. 54 (2000) 451.
[49] A.C. Greene, B.K. Patel and A.J. Sheehy, Int. J. Syst. Bacteriol. 47 (1997) 505.
[50] M.R. Bruins, S. Kapil and F.W. Oehme, Ecotoxicol. Environ. Saf. 45 (2000) 198.
[51] T. Bugg, J.M. Foght, M.A. Pickard, M.R. Gray, Appl. Environm. Microbiol. 66 (12)
(2000) 5387.
[52] D.T. Gibson and R.E. Parals, Curr. Opinion in Biotechnol. 11 (2000) 236.
[53] D.R. Boyd, N.D. Sharma and C.C.R. Allen, Curr. Opinion in Biotechnol. 12 (2001) 564.
[54] P.M. Fedorak, M.A. Pickard, M.R. Gray and J.M. Foght, Prepr. Symp. Am. Chem. Soc.
Div. Fuel Chem. 43 (3) (1998) 515.
[55] J.M. Foght, P.M. Fedorak, M.A. Pickard and M.R. Gray, 48. Ann. Tech. Meet. Petr.
Soc. (Calgary), Paper 97-13:1-9. (1997)
[56] H.K. Kotlar, K. Rasmussen, K. Grande, M. Ramstad, S. Markussen, A. Winnberg, S.
Zotchev and M. Gimmestad, In proceedings of 225th ACS National Meeting, New
Orleans, LA, March 23-27 2003.
[57] The University of Minnesota Biocatalysis/Biodegradation Database
http://umbb d. ahc.umn. edu/naph/nap h_image_m ap.html
[58] B.L. McFarland, D.J. Boron, W. Deever, J.A. Meyer, A.R. Johnson and R.M. Atlas,
Crit. Rev. Microbiol. 24 (2) (1998) 99.
[59] H.P. Klenk, R.A. Clayton, J.F. Tomb, O. White, K.E. Nelson, K.A. Ketchum, R.J.
Dodson, M. Gwinn, E.K. Hickey, J.D. Peterson, D.L. Richardson, A.R. Kerlavage, D.E.
Graham, N.C. Kyrpides, R.D. Fleischmann, J. Quackenbush, N.H. Lee, G.G. Sutton, S.
Gill, E.F. Kirkness, B.A. Dougherty, K. McKenney, M.D. Adams, B. Loftus, S.
Peterson, C.I. Reich, L.K. McNeil, J.H. Badger, A. Glodek, L.X. Zhou, R. Overbeek,
J.D. Gocayne, J.F. Weidman, L. McDonald, T. Utterback, M.D. Cotton, T. Spriggs, P.
Artiach, B.P. Kaine, S.M. Sykes, P.W. Sadow, K.P. DAndrea, C. Bowman, C. Fujii,
S.A. Garland, T.M. Mason, G.J. Olsen, C.M. Fraser, H.O. Smith, C.R. Woese and J.C.
Venter, NATURE 390 (1997) 364.
[60] C.J. Bult, O. White, G.J. Olsen, L.X. Zhou, R.D. Fleischmann, G.G. Sutton, J.A. Blake,
L.M. FitzGerald, R.A. Clayton, J.D. Gocayne, A.R. Kerlavage, B.A. Dougherty, J.F.
Tomb, M.D. Adams, C.I. Reich, R. Overbeek, E.F. Kirkness, K.G. Weinstock, J.M.
Merrick, A. Glodek, J.L. Scott, N.S.M. Geoghagen, J.F. Weidman, J.L. Fuhrmann, D.
Nguyen, T.R. Utterback, J.M. Kelley, J.D. Peterson, P.W. Sadow, M.C. Hanna, M.D.
Cotton, K.M. Roberts, M.A. Hurst, B.P. Kaine, M. Borodovsky, H.P. Klenk, C.M.
Fraser, H.O. Smith, C.R. Woese and J.C. Venter, SCIENCE 273 (1996) 1058.
[61 ] M.R. Rondon, P.R. August, A.D. Bettermann, S.F. Brady, T.H. Grossman, M.R. Liles,
K.A. Loiacono, B.A. Lynch, I.A. MacNeil, C. Minor, C.L. Tiong, M. Gilman, M.S.
Osburne, J. Clardy, J. Handelsman and R.M. Goodman, Appl. Envir. Microbiol. 66
(2000) 2541.
27
[62] G.W. Tyson, J. Chapman, P. Hugenholz, E.E. Allen, R.J. Ram., P.M. Richardson, V.V.
Solovyev, E.M. Rubin, D.S. Rokshar and J.F. Banfield, NATURE 428 (2004) 37.
[63] S. Voget, C. Leggewie, A. Uesbeck, C. Raasch, K.-E. Jaeger and W.R. Streit, Appl.
Envir. Microbiol. 69 (2003) 6235.
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Published by Elsevier B.V. 29
Chapter 2
aGas Technology Institute, 1700 S. Mt. Prospect Rd., Des Plaines, Illinois 60018
blnstituto Mexicano del Petr61eo, Eje Central L~.zaro Cfirdenas 152, Col. San
Bartolo Atepehuacan, 07730 M6xico D.F., Mexico
1. INTRODUCTION
available crude oils. However, the bottom line is that light crude oil is more
readily recovered, and more readily processed/refined, than heavy oil.
Consequently, deposits of light, low heteroatom content oil are preferentially
brought into full production while known deposits of heavy/high heteroatom
content petroleum are produced at less than full capacity or may even be idle.
Moreover, as a deposit of light oil is harvested, the lighter fractions are
preferentially removed such that after primary or secondary production mainly
heavy oil remains. Because of this irreversible trend, the time when available
crude oil is predominantly or exclusively heavy with a high heteroatom and
heavy metals content is not far off.
The chief concern is for the sulfur content of petroleum, but the nitrogen
and metal content of petroleum is also of concern due to environmental,
processing and corrosion concerns [23]. In North America, over 3 trillion barrels
of known petroleum reserves are largely untapped or underutilized because of
their high sulfur content and viscosity [22]. It is well known in petroleum
chemistry that sulfur and heavy metals are preferentially associated with the
higher molecular weight fractions of oil [4, 7]. So, not only is light oil easier to
produce because of its physical properties, but it also contains significantly less
undesirable impurities in comparison with heavy oils. Sulfur, nitrogen and heavy
metal impurities are of great environmental concern since they originate acid
rain as a consequence of sulfur and nitrogen oxides emissions from the
combustion of petroleum derived fuels, and potential health effects due to high
concentrations of heavy metals on combustion ashes [2, 10, 24, 25]. Some sulfur
and nitrogen heterocycles are suspected carcinogens [8, 12] and sulfur
compounds in oil have been implicated in the corrosion of pipelines and refinery
equipment [7, 24, 26]. Heavy metals content, mainly nickel and vanadium,
contributes to the poisoning of catalysts used in hydrodesulfurization or in
catalytic cracking [5, 20, 23]. In addition to catalysts poisoning by heavy metals,
sulfur and nitrogen in heterocyclic compounds are capable of poisoning catalysts
by causing electronic modifications in Pd, Pt, Ni, and Ru compounds. The
poisoning of catalysts exasperates the problems associated with the processing
of heavy oils and residuum by interfering with the methods employed to reduce
the heteroatom content and molecular weight, i.e. hydrotreatment and cracking.
The quantity of heavy oils to be processed is increasing not only due to
the depletion of light oils but also to the increasing demand for cleaner
transportation fuels and other low molecular weight products, so the importance
of technologies capable of dealing with heavy oils and residuum has increased
[ 11, 27]. This increased demand for lower molecular weight petroleum products
seems incompatible with the use of heavy oils as primary feedstocks because of
their metals, nitrogen and sulfur content that increases the production of coke
and gas and accelerates catalyst deactivation [6]. But at the same time, the need
to obtain greater quantities of gasoline, diesel and aviation fuels from each
33
2. BIODESULFURIZATION
Effective technologies for the treatment of heavy crude oils have been and
continue to be a topic of keen interest. Hundreds of processes related to the
desulfurization of heavy oils have been described in the patent literature, and the
interest in such processes has steadily increased [2, 29]. Hydrodesulfurization
can be used to desulfurize heavy oils and residuum, but does not lead to a
significant decrease in molecular weight. The predominant method for
upgrading heavy oils to decrease molecular weight and increase the yield of
transportation fuels is the use of fluid catalytic cracking (FCC) [4, 30].
However, FCC cannot achieve desulfurization. Moreover hydrodesulfurization
and FCC catalysts are poisoned in the process of treating heavy oils because of
the presence of sulfur and nitrogen heterocycles and heavy metal contaminants
[5, 31 ]. Therefore, a combination of technologies is needed to address both the
removal of heteroatoms and the decrease in molecular weight in order to
mitigate environmental problems and to get the greatest yield of value added
34
products. Of all of the chemical forms of sulfur in crude oil, the most recalcitrant
to hydrodesulfurization is the thiophenic sulfur in thiophene and
dibenzothiophene derivatives. Because of the abundance of alkylated
dibenzothiophenes in crude oil and the recalcitrance of these compounds to
hydrodesulfurization, there is a high level of interest in technologies that can
effectively desulfurize dibenzothiophenes [2].
Researchers have been examining the possibility of biodesulfurization of
petroleum or other fossil fuels for over 4 decades [32]. Presently, there is no
commercial operation for biodesulfurization of fossil fuels, however several
economic studies indicate a favorable prospect of developing such a technology
[10, 24, 25, 27, 33]. Numerous microorganisms have been described in the
literature that are capable of utilizing dibenzothiophene (DBT) as sole source of
carbon, energy and sulfur. However, the complete degradation of organosulfur
compounds is not beneficial for upgrading crude oils and derived fuels. The
selective cleavage of carbon-sulfur bonds in DBT and derivatives is preferred,
this way sulfur is selectively removed and the calorific value of the treated fuel
remains intact.
The first microorganism that was shown to be capable of selectively
cleaving carbon-sulfur bonds in crude oil, coal, and a wide range of model
compounds, resulting in the selective removal of sulfur and the retention of
carbon and calorific value, is Rhodococcus erythropolis IGTS8 (ATCC 53968)
[34]. Subsequently, numerous other bacteria capable of selectively cleaving
carbon-sulfur bonds in DBT were isolated and characterized. The biochemical
pathway used by these aerobic microorganisms to desulfurize DBT compounds
has been termed the 4S pathway due to the progressive oxidation of sulfur that
occurs through 4 steps [2, 35]. The selective removal of sulfur from DBT and
from crude oil by anaerobic bacteria has also been reported. Sulfate-reducing
bacteria such as Desulfovibrio desulfuricans have been shown to metabolize
DBT to H2S and biphenyl [36]. The desulfurization of oil under anaerobic
conditions avoids costs associated with aeration, and has the advantage of
liberating sulfur as a gas. However, an anaerobic biodesulfurization process has
not been developed due to low reaction rates, safety and cost concerns, and the
lack of identification of specific enzymes and genes responsible for anaerobic
desulfurization. Consequently, aerobic biodesulfurization has been the focus of
the majority of research [2, 32].
Table 1.
Range of organosulfur substrates used as sole source of sulfur for growth
by M. phlei GTIS 10
Substrate Used as sole source of sulfur for
growth
Dibenzothiophene +
Dibenzothiophene sulfoxide +
Dibenzothiophene sulfone +
4,8-Dimethyl dibenzothiophene +
2-Methyl dibenzothiophene +
Dibenzothiophene-2,8-dicarbaldehyde +
Benzothiophene +
Thiophene +
2-Ethyl thiophene +
2-Thiophene carboxylic acid
2-Thiophene carbonitrile
3-Thiophene carboxylic acid
Trithiane +
Thianthrene +
Thianaphthene
Trans- 1,2-dithiane-4,5-diol +
1,4-Dithiane-2,5-diol +
1,3-Ddithiane +
1,4-Dithiane +
Trimethylsilyl- 1,3-dithiane +
Thioxanthrene-9-one +
1,4,7-Trithiacyclononane
1,4,7-Trithiacyclodecane
Thiodiglycol +
Thioxanthene +
Phenyl sulfoxide
Thionin
Sulfanilamide
2-Nitrophenyl disulfide +
4-Nitrophenyl disulfide +
3-Nitrophenyl disulfide
4-Aminophenyl disulfide
Tolyl disulfide
Benzyl disulfide +
Phenyl disulfide
Dimethylsulfoxide +
2,2'-Thiobis(4,6-dichlorophenol)
Diphenylthiocarbazone +
5,5'-Dithio-bis(2-nitrobenzoic acid)
2(Methylmercapto)benzimidazole +
2-Methyl-b-naphthothiazole
2-Phenylbenzothiazole
Thiazole +
37
DszC LDszD
FMN -~ "-NADH
,,
S
II
0
1 ~ FMNI'12'~/,,r NAD
DszC ~DszD
FMN -~ ~-NADH
1 ~ FMNH2~.~,/~ NAD
DszA ~DszD
FMN J "~NADH
II
O
DszB I
HO
Fig. 1. The 4S metabolic pathway for DBT desulfurization. DszC is the DBT
monooxygenase, DszA the DBT sulfone monooxygenase, DszB the HPBSi desulfinase and
DszD is a flavin reductase. I, DBT; II, DBT sulfoxide; HI, DBT sulfone; IV,
hydroxyphenylbenzenesulfinate; V, 2-hydroxybiphenyl.
38
Table 2.
Concentrations of metabolites of dibenzothiophene produced by M. phlei GTIS10 and R.
erythropolis IGTS8
conjugal transfer of plasmids containing the dsz genes or the transposition of dsz
genes is sparse, the distribution of dsz genes in bacterial cultures strongly
support the hypothesis that these genes are commonly subjected to horizontal
transfer in nature. Indeed the DNA sequences of dsz genes from numerous
bacterial cultures isolated in geographically distinct locations have been found to
be nearly identical. Various Rhodococcus [68], Mycobacterium [37], Gordona
[59], Corynebacterium [69], Arthrobacter [70], Enterobacter [39],
Stenotrophomonas [39], Klebsiella [39], Bacillus [71], and Nocardia [72]
species have been isolated that possess dsz gene sequences that are identical or
highly homologous to the DNA sequence of the dsz gene of R. erythropolis
IGTS8. However, some variation in the sequences of the dsz genes has been
observed. The dsz genes of the moderate thermophile Paenibacillus sp. A 11-2
and Nocardia asteroides are only 52-65% and 89% homologous to R.
erythropolis IGTS8, respectively [61, 73]. Moreover, PCR amplification of dsz
genes from soil samples revealed relatively few variations in dsz gene
sequences, with the majority of variations found in dszA, and even then
homology to the R. erythropolis IGTS8 dszA sequence was 95% or more [66].
It is interesting to note that while several bacterial genera apparently
participate in horizontal transfer of dsz genes in nature, and laboratory studies
demonstrate that dsz genes and enzymes function well in Pseudomonas and E.
coli strains, a naturally occurring desulfurization-competent Pseudomonas sp. is
rarely encountered [74] and a desulfurization competent E. coli isolate has never
been reported [2]. The reasons for the restricted range of distribution of dsz
genes in nature are currently unknown, but one factor may be the ability of
bacterial species to withstand exposure to substrates such as petroleum.
Laboratory studies indicated that Pseudomonas sp. containing dsz genes could
efficiently metabolize DBT in aqueous culture or DBT added in a solvent such
as hexadecane. However, the ability of these same Pseudomonas cultures to
metabolize DBT in diesel oil or other petroleum product is much reduced [75,
76]. Naturally occurring desulfurization-competent bacterial cultures are almost
exclusively gram positive or gram variable and it may be that the cell
wall/membrane structure of gram negative bacterial species is less able to
tolerate exposure to petroleum compounds and solvents. There are many
thousands of gram positive and gram variable bacterial species, yet the observed
occurrence of dsz genes in naturally occurring desulfurization-competent
bacterial isolates is restricted to only a few species. Clearly, more remains to be
learned about the role dsz genes play in microbial ecology and the functioning of
desulfurization enzymes in different bacterial hosts [77].
Other topics regarding biodesulfurization that are not well understood are
the access of desulfurization enzymes to insoluble and high molecular weight
substrates, and the mechanism by which the sulfur liberated from organosulfur
substrates by the desulfurization enzymes is subsequently incorporated into
43
biomass. When R. erythropolis IGTS8 was first isolated, it was obtained from an
enrichment culture growing in a defined mineral salts medium devoid of
inorganic sulfur [78, 79]. All essential nutrients were present in abundance with
the exception of sulfur, which was supplied in the form of coal or DBT creating
an environment where any bacterial species that could utilize organically bound
sulfur had a strong selective advantage. The mixed culture that grew with DBT
as the sole source of sulfur was streaked onto a variety of agar plates allowing
pure cultures to be obtained from each of the types of colonies present. Then
each pure culture was tested individually to determine if it could utilize DBT as
a sole source of sulfur for growth.
It soon became clear that none of the pure cultures most readily isolated
from the desulfurization-competent mixed culture were capable of utilizing DBT
as a sole sulfur source. Perseverance in investigating this desulfurization-
competent mixed culture eventually led to the isolation of a relatively slow
growing pure culture that was demonstrated to utilize DBT as a sole source of
sulfur, and this culture was subsequently identified as R. erythropolis IGTS8
[34]. R. erythropolis IGTS8 was present at low abundance in the original
desulfurization-competent mixed culture and even when pure cultures of R.
erythropolis IGTS8 and a desulfurization-deficient, but faster growing, bacterial
culture such as Enterobacter cloacae, were combined in various ratios and used
to inoculate growth experiments in sulfur-limited media where DBT was the
sole source of sulfur, R. erythropolis IGTS8 invariably emerged as the least
abundant species in the resulting culture [34].
These results cannot be explained if DBT is taken up into the cytoplasm
of R. erythropolis IGTS8 and only then is DBT converted to 2-HBP and sulfite,
unless it is also hypothesized that sulfite is then excreted. While intracellular
metabolism of DBT by R. erythropolis IGTS8 is stated to occur [46] there is no
evidence for DBT transport/uptake in desulfurization competent Rhodococcus
cultures [25], nor is there evidence for mass transfer limitations in DBT
metabolism [25, 80]. If sulfur is liberated intracellularly within R. erythropolis
IGTS8 and sulfur is the growth limiting nutrient, it seems unlikely that sulfite
would be excreted extracellularly unless intracellular oxidation of sulfite to
sulfate were not possible. Sulfate has been demonstrated to be the form of
inorganic sulfur that is utilized by R. erythropolis IGTS8 [81 ] while sulfite has
been demonstrated to be the form of sulfur obtained as a product of the
desulfurization of DBT [43]. Further research into sulfite and sulfate metabolism
by desulfurization competent cultures is warranted.
One hypothesis that is consistent with the observation that faster growing
desulfurization-deficient bacterial species can dominate mixed cultures when R.
erythropolis IGTS8 is the only desulfurization competent culture present, is that
desulfurization of DBT occurs in association with the external surface of R.
erythropolis IGTS8 cells. The Dsz proteins are known to have membrane-
44
spanning domains [47, 82] so that the desulfurization pathway may function in
association with the cell membrane such that extracellular substrates and
intracellular cofactors can both be accessed. A further consideration regarding
the localization of the Dsz enzymes is the size of some of the substrates that can
be metabolized. Solid coal particles and high molecular weight coal derived
polymers can be effectively desulfurized [83-85], yet there has never been a
report documenting the intracellular uptake of substrates such as coal by any
bacterial species. Moreover, the size of coal particles vastly exceeds the size of
bacterial cells in experiments where biodesulfurization has been demonstrated to
remove 72% of organic sulfur without otherwise altering the composition of the
coal [85]. There is no evidence whatsoever that desulfurization enzymes are
excreted from R. erythropolis IGTS8 cells, but the size of substrates metabolized
and the ability of other bacterial species to successfully compete for sulfur
liberated from organosulfur substrates by R. erythropolis IGTS8 make it likely
that desulfurization does not occur intracellularly, but in association with the
external surface of cells.
A consequence of the fact that desulfurization-deficient bacterial species
can successfully compete for sulfur liberated from organosulfur substrates by R.
erythropolis IGTS8 is that a selective pressure favoring the evolution of a high
specific activity for desulfurization enzymes is created. In a mixed culture
environment where sulfur is the growth limiting nutrient and R. erythropolis
IGTS8 is the only desulfurization-competent culture, this bacterium must
liberate many times more sulfur than it needs to meet its own nutritional
requirements because competition from other bacteria leaves only a fraction of
the utilizable sulfur actually available for use by R. erythropolis IGTS8 [34]. If
this dynamic typified the natural environment for R. erythropolis IGTS8 and
other desulfurization competent cultures it would be reasonable to expect that a
high level of desulfurization activity would have evolved in such cultures.
However, that is not the case and even when grown as pure cultures, all
naturally occurring desulfurization competent cultures have levels/activities of
desulfurization enzymes that are growth limiting rather than capable of
supplying sulfur in excess of the needs of the culture [2]. This further illustrates
that we have much to learn about the role of Dsz enzymes in nature and the
characterization of the microenvironment occupied in nature by R. erythropolis
IGTS8 and other desulfurization-competent bacteria. Nevertheless, it is worth
considering that enrichment cultures and directed evolution experiments
designed to obtain cultures with higher levels of desulfurization activity may
benefit from the intentional use of mixed cultures.
identical desulfurization genes are unknown. However, it is clear that the host
contributes to the functioning of the desulfurization pathway in yet
uncharacterized ways so that the manipulation of the dsz (or tds) genes alone
may be insufficient to yield bacterial cultures with substantially higher
desulfurization activity, such as would be required for a commercial
biodesulfurization process.
1.4
-~ 1.2
o
:= r- 0.8
~ trn 0.6
( , ~ (D 0.4
....,...
0
E 0.2
::zL
i m m
0 , , , am m , 11------O , ,
20 30 40 50 60 70 8s
Temperature (~
Fig. 2. Resting cells of M. phlei GTIS10 exhibit specific desulfurization activity at higher
temperatures than resting cells of R. erythropolis IGTS8. The amount of 2-HBP produced by
the conversion of DBT by each culture after incubation for 24 hours at various temperatures
was quantified by HPLC analysis. Rate of change in 2-HBP concentration was calculated
from the linear portion of the curve, generally the first 4 hours of the incubation. The specific
desulfurization activity values recorded are averages of three replicate samples from three
separate experiments for a total of nine data points. Standard deviation was less than 10 %. o,
M. phlei GTIS 10; m, R. erythropolis IGTS8.
48
The highest rate of 2-HBP formation was obtained without the cloned
FMN oxidoreductase, perhaps because the accumulation of intermediates
inhibited the Dsz enzymes. The maximum amount of 2-HBP produced was 0.2
mM regardless of the amount of DBT added or the incubation time, which
suggests that inhibition by 2-HBP is also a key factor limiting biodesulfurization
efficiency in E. coli, and probably in other bacterial hosts as well [52]. Oshiro et
al. [94] screened 80 bacterial and 20 yeast cell extracts to find flavin reductases
with the best ability to support DszC and DszA activity. A flavin oxidoreductase
from Paenibacillus polymyxa was found to be the best allowing 3.5 to 5-fold
better activity of DszC and DszA as compared with the Rhodococcus flavin
oxidoreductase.
Rhodococcus strains containing increased copies of dszABC genes on
plasmids or integrated into the chromosome have resulted in higher DBT
conversion rates, but also in the accumulation of pathway intermediates as
DBTSO and DBTSO2 [58, 96]. When the copy number of the dszD gene was
increased in Rhodococcus erythropolis KA 2-5-1 cultures containing their
natural complement of dszABCD genes, then DBTSO and DBTSO2
accumulation occurred. However, if the copy number of all of the dszABCD
genes was increased then the accumulation of intermediates was avoided, but
only when the correct balance between dsz genes was achieved [58]. Derivatives
of R. erythropolis KA 2-5-1 originally had a specific desulfurization activity of
0.05 mmol/g DCW/hr while derivative cultures that, in addition to their natural
complement of dszABCD genes, contained a plasmid with one copy of the
dszABC genes had a specific desulfurization activity of 0.14 mmol/g DCW/hr;
0.19 mmol/g DCW/hr with dszABCD genes on a plasmid, and 0.28 mmol/g
DCW/hr with two copies of dszABC genes and one dszD gene on a plasmid.
Derivative cultures that contained additional copies of the dszABC operon or the
dszD gene did not yield cultures with higher enzymatic activity. Similar results
were obtained for the expression of various combinations of dsz and tds genes in
Rhodococcus, E. coli, and Pseudomonas hosts [96, 97], demonstrating that in
order to obtain bacterial cultures with the highest possible desulfurization
activities it is necessary to obtain the proper ratio of desulfurization enzymes
and cofactors.
The results of experiments in which different copy numbers,
combinations of dsz/tds genes and promoters were used also revealed that a limit
in desulfurization activity is reached that can not be overcome by increasing the
amount of the Dsz/Tds enzymes in cells [24, 76, 93, 95, 98]. There are other
factors affecting desulfurization activity and/or the intrinsic properties of the
Dsz/Tds enzymes needs to be improved if higher desulfurization activity is to be
achieved. A way of improving the intrinsic properties of enzymes is directed
evolution.
49
yet been tested in pilot scale experiments so the costs and efficiency of such a
process are not yet known.
Energy BioSystems Corporation (EBC) conducted a comprehensive
evaluation, particularly as regards crude oil and fractions, of the
biodesulfurization technology originally developed by the Institute of Gas
Technology (IGT) [now known as the Gas Technology Institute (GTI)] under a
program funded by the U.S. Department of Energy. Encouraged by their
experimental results and feedback from the petroleum industry, EBC licensed
the technology, and assembled a team of executives, engineers, and scientists
from the petroleum industry, committed to the commercialization of
biodesulfurization technology.
The development of bioprocesses for biodesulfurization of petroleum
have been almost exclusively focused on the use of biocatalysts that are
derivatives of, or related to, R. erythropolis IGTS8, and diesel has been the
target for the development of the first biodesulfurization processes [24, 25].
EBC was the first organization to seriously attempt the development of a
commercial biodesulfurization process. They chose diesel fuel desulfurization as
the target for initial process development efforts because environmental
regulations mandating a reduction of the maximum permissible concentration of
sulfur in diesel to 50 ppm had been proposed and existing refinery processes
were not able to efficiently and economically meet this requirement [25]. The
most abundant organosulfur compounds in diesel includes DBT and its
derivatives which are recalcitrant to traditional hydrodesulfurization but are
good substrates for biodesulfurization [2].
The application of any technology, chemical or biochemical, to the
treatment of petroleum requires a highly efficient process as the resulting
products are low priced commodities [ 105]. Moreover, the volume of petroleum
processed, even at a small refinery, dwarfs the scale of bioprocesses typically
used in the pharmaceutical and biotechnology industries. To address these
process concerns, EBC claimed to have achieved a 200-fold improvement in the
specific activity of the R. erythropolis IGTS8 biocatalyst using a combination of
medium improvement, reaction conditions and genetic engineering [24].
Moreover, process engineering research increased the volumetric reaction rate
(oil/water ratio), biocatalyst life and solved separations issues. Specific details
about EBC's biodesulfurization process and the results achieved were not
published, but a desulfurization rate of 20 ~tmole DBT/min/g DCW was stated
as a target for a commercially successful process [25]. The literature contains a
large amount of information regarding the use of genetic engineering to achieve
higher desulfurization rates as previously discussed in this chapter. It has been
shown that R. erythropolis IGTS8 biocatalysts are capable of functioning at 9-
to-1 oil-to-water ratios [ 106], and maximum cell yields in fed batch fermentation
52
The key reasons that EBC did not succeed in developing a commercially
viable biodesulfurization process included changes in the environmental
regulations and improvements in hydrodesulfurization technologies. When EBC
began process engineering efforts to develop a commercial process for the
biodesulfurization of diesel, the environmental regulations specified a maximum
total sulfur content of 50 ppm and the existing hydrodesulfurization processes
could not efficiently achieve that goal. However, while EBC was involved in the
challenging task of implementing the first bioprocess in the petroleum industry
(other than waste remediation), stricter environmental regulations were proposed
decreasing the maximum permissible sulfur content in diesel to 10 to 15 ppm.
Additionally, during this same time frame, improvements were made in
hydrodesulfurization technology that allowed these lower sulfur levels to be
reached [ 109].
Integrating a biodesulfurization process into a refinery is the only way to
treat a product such as diesel, but this requires a substantial modification of
current operations in a refinery and requires that the biodesulfurization process
operate at the same speed and reliability as other refinery processes so as not to
disrupt normal refining operations. It is very challenging for any new technology
to be embraced by a conservative industry such as the petroleum industry so that
employing biodesulfurization as a component of refinery operations met with
understandable opposition. However, alternative ways of implementing a
biodesulfurization process exist (see chapter 4)[ 104].
54
Fig. 4. Overview of the Energy Biosystems Corporation process for the simultaneous
biodesulfurization diesel oil and the production of a sulfinate/surfactant byproduct.
3. BIODENITROGENATION OF PETROLEUM
The removal of organically bound nitrogen from crude oil, without the loss of
significant calorific value, requires the selective cleavage of carbon-nitrogen
bonds. The selective cleavage of carbon-sulfur bonds in crude oil using
biocatalysts has been demonstrated [2, 24, 113] and it may be possible to
selectively cleave carbon-nitrogen bonds using biocatalysts developed from
microorganisms capable of metabolizing compounds such as quinoline and
carbazole [114]. The cleavage of carbon-nitrogen bonds resulting in the
conversion of quinoline to 8-hydroxycoumarin and ammonia has been
demonstrated [ 115], and the genes that encode the enzymes participating in the
quinoline degradation pathway have been identified and sequenced [116]. The
removal of nitrogen from crude oil by a quinoline degrading culture,
Pseudomonas ayucida IGTN9m, has also been demonstrated [115]. However,
the abundance of quinoline relative to other organonitrogen compounds in crude
oil is low and existing quinoline degradation enzymes have a narrow substrate
range. Consequently, even though removal of 68% of quinoline from crude oil
was demonstrated the total nitrogen content was reduced by only 5%. An
appropriate topic for future research is the development of cultures that express
higher levels of quinoline degrading enzymes that have wider substrate ranges,
but it is also important to develop biocatalysts that can remove nitrogen from
other compounds typically found in petroleum such as carbazole.
CarA YH2 j H2 ?H 2
Car
qZ 9 ~"----~ O --~oCaFC
~COOH
HO OH HOOC H
OH
CarA
NH
2~~ ] deaminase [ ~ ~
~"N / HO OH HO OH
REFERENCES
[ 106] S. Patel, J. J. Kilbane, and D. A. Webster, J. Chem. Technol. Biotechnol. 69 (1997) 100.
[107] O. Yoshikawa, Y. Ishii, K-I. Koizumi, T. Ohshiro, Y. Izumi, and K. Maruhashi, J.
Biosci. Bioeng. 94 (2002) 447.
[ 108] L. Linguist, and M. Pacheco, Oil & Gas Journal (1999), pp. 45-48.
[ 109] S. T. Oyama, and Y-K. Lee, American Chemical Society, Fuel Chemistry Division 48
(2003), 173-174.
[ 110]S. Reeson, Energy World 235 (1996) 9.
[111 ]M. S. Lin, T. Premuzic, J. H. Yablon, and W. M. Zhou, Appl. Biochem. Biotechnol. 57-
58 (1996) 659.
[112]E. T. Premuzic, M. S. Lin, M. Bohenek, and W. M. Zhou, Enegy & Fuels 13 (1999)
297.
[113] J. J. Kilbane II, Final Report, Energy BioSystems Project No. 40308-02 (1992).
[114]M. J. Benedik, P. R. Gibbs, R. R. Riddle, and R. C. Wilson, Trends in Biotechnology 16
(1998) 390.
[ 115]J. J. Kilbane, R. Ranganathan, K. J. Kayser, L. Cleveland, C. Ribiero and M. M.
Linhares, Appl. Environ. Microbiol. 66 (2000) 688.
[ 116]U. Frerichs-Deeken, B. Goldenstedt, R. Gahl-Janben, R. Kappl, J. Huttermann, and S.
Fretzner, European J. Biochem. 270 (2003) 1567.
[117] S. Mitra-Kirtley, O. C. Mullins, J. van Elp, S. J. George, J. Chen, and S. P. Cramer, J.
Am. Chem. Soc. 115 (1993) 252.
[ 118]J. J. Kilbane II, A. Daram, J. Abbasian, and K. J. Kayser, Biochem. Biophys. Res.
Comm. 297 (2002) 242.
[119]H. Habe, Y. Ashikawa, Y. Saiki, T. Yoshida, H. Nojiri, and T. Omori, FEMS Microbiol.
Lett. 211 (2002), 43.
[120]K. Kirimura, H. Nakagawa, K. Tsuji, K. Matsuda, R. Kurane, and S. Usami, Biosci.
Biotechnol. Biochem. 63 (1999) 1563.
[121]H. Nojiri, J. W. Nam, M. Kosaka, K. I. Morii, T. Takemura, K. Furihata, H. Yamane,
and T. Omori, J. Bacteriol. 181 (1999) 3105.
[122]N. Oichiyama, T. Omori, and T. Kodama, Biosci. Biotech. Biochem. 57 (1993)455.
[123]J. Schneider, R. J. Grosser, K. Jayasimhulu, W. Xue, B. Kinkle, and D. Warshawsky,
Can. J. Microbiol. 46 (2000) 269.
[124]J. M. Shepherd, and G. Lloyd-Jones, Biochem. Biophys. Res. Comm. 247 (1998) 129.
[125]R. R. Riddle, P. R. Gibbs, R. C. Wilson, and M. J. Benedik, J. Ind. Microbiol.
Biotechnol. 30 (2003) 6.
[126]S. I. Sato, J. W. Nam, K. Kasuga, H. Nojiri, H. Yamane, and T. Omori, J. Bacteriol. 179
(1997) 4850.
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Elsevier B.V. All rights reserved. 67
Chapter 3
aInstituto Mexicano del Petr61eo. Eje Central Lfizaro Cfirdenas 152, San Bartolo
Atepehuacan 07730 Mfxico DF, Mfxico
1. I N T R O D U C T I O N
i i i
of product per liter per hour have been achieved. Biocatalytic reactions that have
been successfully applied in the industry, at large scale, include: production of
high fructose corn syrup, fatty acids and triglyceride oils, aspartame, acrylamide,
antibiotic precursors, amino acids, S-2-chloropropionic acid, polylactic acid and
cyclodextrins [8].
At first glance, enzymes seem to be more expensive than chemical
catalyst. Enzyme prices ranges from $ 100 per kilogram, as for crude
preparations of amylase, to $100,000 per kilogram, as for lactic dehydrogenase.
However, the key cost to consider in biocatalysis should be not the cost of the
enzyme itself, but rather the cost-contribution of the final product. This cost
contribution could be as low as $ 0.10 per kilogram as in the case of aspartase in
the L-aspartic acid production. When compared with the cost of other catalyst,
especially those with similar selectivity, the prices of enzymes are not very
different (Table 1).
Still the industrial use of enzymatic catalysts is limited by their instability
under harsh conditions, which are usually found in large-scale processes.
Nevertheless, chemical and genetic modifications of enzymes to improve both
activity and stability, together with solvent engineering and new catalytic
activities from extremophiles microorganisms will provide better biocatalysts
for the specific needs of the petroleum industry. Non-conventional uses of
enzymatic transformation are still in their infancy. Non-aqueous systems, high
temperatures and hydrophobic substrates are the three main characteristics of oil
industry that represent the most important challenges for the enzymatic catalysis
to be applied in the petroleum refining industry. The success of biocatalysis in
the petroleum industry depends on the development of biocatalysts able to
perform transformations of oil products in non-aqueous systems and stable
under the conditions usually found in the refineries.
Table 1
Bulk enzyme and chemical catalyst prices a.
2. DESULFURIZATION
need an aqueous phase to accomplish sulfur removal, while enzymes are able to
function in media containing very low water content. Thermodynamic water
activity (aw) influences both enzyme activity and stability, as water acts as a
lubricant altering the flexibility of enzyme molecules. Protein mobility and
therefore protein unfolding is restrained in a low water content medium.
However, a certain amount of protein-bound water is essential to allow enough
molecules flexibility to execute catalysis [40]. Thus it is possible to optimize
enzyme performance in hydrophobic media by controlling aw [10, 41-42]. In
addition, it has been shown that in certain organic media enzymes are active and
more thermostable than in aqueous media [12, 13, 43], and it is possible to
perform enzymatic transformations at temperatures higher than 100~
Although sulfur elimination might not be achieved by a single enzymatic
step, the enzyme-mediated transformation of sulfur-containing compounds may
facilitate its removal. An enzymatic procedure to reduce the sulfur content from
straight-run diesel has been described [44]. A fungal chloroperoxidase from
Caldariomyces fumago was able to oxidize the sulfur-containing fraction of
untreated diesel containing 1.6% sulfur, in the presence of low concentrations of
hydrogen peroxide.
Figure 2 shows gas chromatograms with both Flame Ionization (FID,
general) and Flame Photometric (FPD, sulfur selective) detectors. The
distribution of compounds in straight-run diesel fuel before and after oxidation
with chloroperoxidase, are shown in panel a and b, respectively. The oxidation
is clearly detected by the increase of boiling point (retention time) of these
compounds on the gas chromatogram monitored by the sulfur selective detector
(FPD). The higher boiling point of the oxidized compounds allowed its removal
by a distillation step. Microdistillation of both chloroperoxidase-oxidized and
untreated diesel fuels monitored by FID and FPD (Fig. 3) shows that the
hydrocarbon distillation profile changes slightly after enzymatic treatment. In
contrast, the sulfur selective detector (FPD) shows a significant change of the
distillation profile, in which most of organosulfur compounds were effectively
oxidized and their boiling points increased after enzymatic treatment.
Table 2
Process characteristics of enzymatic and metabolic desulfurization.
Control F ID
0~_
I
j
I0
1
20
1
30
Conlrol FPD
g
~o
"G 0 ~0 20 30
I I o~'~o"o~ I lll b
~o 20 30 J
I
Biocotaly~.ic I I
oxidotion I I
[
0 'I ' " , .... l
o IO 20 30
T,me (min)
Fig. 2. Gas chromatograms of straight run diesel fuel before (a) and after (b) chloroperoxidase
treatment [44].
Control-~
FID
15-
~o-
._
5-
0
40
FPD CPOtrea~ed~
~ 3O
Control~~
o
.-= 20
._
10
I ,
0 , i
100 200 500 400 500
Boiling point (*C)
Table 3
Sulfur content of straight-run diesel fuel after enzymatic oxidation with chloro-
peroxidase from Caldariomycesfumago followed by a distillation to 325~ as final
distillation point.
Table 4
Sulfur-containing substrates of chloroperoxidase.
Thianthrene 1310 ~ s ~
s
Bithiophene 840
s
Diphenyl sulfide 831
Ts-o
Benzothiophene 557
Dibenzothiophene 126
Diphenyl disulfide 52
CS.s0
In order to overcome the described shortcomings, several tools may be
used to enhance enzyme desulfurization, such as protein engineering, solvent
engineering and immobilization procedures. Biocatalyst design should be
conducted contemplating parallel increments in activity and stability. It has been
observed that improvement of one characteristic might result detrimental for
other biocatalyst properties [18]. Thus by selecting for simultaneous
enhancements of different properties, more suitable biocatalysts might be
obtained [36, 18].
78
Asphaltenic and viscous heavy oils from bituminous deposits are a huge energy
reserve to be exploited in next decades. More than 70 countries possess
bituminous deposits. In Canada only, the oil reserve considered to be technically
recoverable is estimated to be 280-300 Gb (billion of barrels), larger than the
Saudi Arabia oil reserves estimated at 240 Gb [59]. These highly asphaltenic
resources must be rigorously treated in order to convert them into an upgraded
crude oil before them can be refined to produce gasoline and other fuels.
Asphaltene, the highest molecular weight fraction of petroleum, is a dark
amorphous solid specially rich in heteroatoms (S, O, N), and metals (Fe, Ni, V)
[60-62]. Many problems associated with either recovery, separation or
processing of heavy oils and bitumens, are related to the presence of high
concentration of asphaltenes. This fraction is thought to be largely responsible
for other adverse oil properties such as high viscosity and the propensity to form
emulsions, polymers and coke. The molecular structure of asphaltenes has been
an enigma for seven decades [62]. From numerous investigations there are
indications that asphaltenes are condensed aromatic cores containing alkyl and
alicyclic moieties. Heteroatoms, such as nitrogen, oxygen and sulfur are present
as non- and heterocyclic groups. A significant amount of porphyrins
(petroporphyrins) can be found containing mainly nickel and vanadium. A
hypothetical asphaltene molecule is shown in Fig. 4. The complexity of the
asphaltene chemical nature is evident by the difficulty of analysis of both their
molecular weight and structure.
The asphaltenic fraction is recognized as the most recalcitrant fraction of
oil. So far, there is no clear evidence that asphaltenes are degraded by microbial
79
activity (see chapters 1 and 4). Some reports on oil biodegradation claim the
degradation of asphaltenic fraction by mixed bacteria [63, 64]. However, none
of these reports described the analytical results of extractable materials
recovered from appropriate sterile controls. On the other hand, although
microorganisms have been found associated with bitumens containing high
amounts of asphaltenes [65], the asphaltenic fraction did not support bacterial
growth and no changes in asphaltene content could be found after bioconversion
of heavy oils and asphaltenes [66, 67]. Because the asphaltene content was
usually determined gravimetrically after n-alkane precipitation, the reported
changes could be attributed to the disruption of the asphaltenic matrix by the
production of surfactants during bacterial growth, liberating trapped
hydrocarbons. Therefore, most of the asphaltene losses during microbial activity
could be considered to be abiotic losses [68].
Nevertheless, a clear experimental evidence that enzymes are able to
modify asphaltene molecules has been reported [69]. Chloroperoxidase from the
fungus Caldariomyces fumago was able to transform petroporphyrins and
asphaltenes, and this modification was significantly higher in systems containing
organic solvent than in aqueous systems [69, 70]. Asphaltenes and
petroporphyrins are highly hydrophobic materials, thus mass transfer limitations
are expected in aqueous reactions. The biocatalytic oxidation of a
petroporphyrin rich-fraction of asphaltenes in the ternary solvent system and in
the presence of hydrogen peroxide was performed. Chloroperoxidase catalyzed
reaction produced notable spectral changes in the petroporphyrin rich-fraction of
asphaltenes (Fig. 5). The destruction of petroporphyrins by chloroperoxidase in
the presence of hydrogen peroxide leads to the removal of Ni and V from
asphaltene molecules, as in the case of synthetic nickel and vanadium
porphyrins (Table 5).
On the other hand, a doubly modified cytochrome c (PEG-Cyt-Met) was
able to catalyze the oxidation of a petroporphyrin rich-fraction of asphaltenes in
the ternary solvent system and in the presence of 100 mM of tert-butyl
hydroperoxide [71]. As chloroperoxidase, the PEG-Cyt-Met catalyzed reaction
produced spectral changes in the petroporphyrin rich-fraction of asphaltenes
(Fig. 5). The oxidative porphyrin ring disruption entails the simultaneously
release of metal. The biocatalytic process with PEG-Cyt-Met removed 95% of
the vanadium and 74 % of the nickel (Table 5). The destruction of the
petroporphyrin molecules is conformed by the Soret band loss and metal
removal.
80
b
0.8
t.-
8 0.6
-2
~ o.4
<
0.2
Table 5
Nickel and Vanadium removal from petroporphyrin rich fractions of asphaltenes by
chloroperoxidase-mediated reaction.
the spectra from both untreated and treated samples showed an important 5.29
ppm signal, probably due to protons from non aromatic (C = C) double bonds,
which are not detectable in whole asphaltenes fractions. The main differences of
enzyme treated samples when compared with the untreated fraction appeared in
the saturated hydrocarbon region: a quartet placed on 2.28 ppm, a triplet placed
on 2.49 ppm, and a singlet placed on 3.63 ppm. These signals seem to be
originated from the hydrocarbon chains of polar compounds, may be from
oxygenated compounds as 13C spectrum shows (see below). The singlet shift can
be attributed to ether or alcohol groups. The ester-amide signal (4.3-4.36 ppm)
was very important in the oxidized sample, while was minor in the control
petroporphyrins.
The 13C NMR analysis showed the presence of 58.78 ppm and 46.11 ppm
shifts in the control, which are attributed to the C-N bond (Fig. 9). These signals
disappeared in the oxidized petroporphyrins. Signals between 10 ppm and 60
ppm are usually assigned to the hydrocarbon chains. The NMR spectrum from
oxidized petroporphyrins showed a more intense terminal methyl (-CH3) signal
than in the untreated sample. The (-CH2-) / (-CH3) intensities ratio was lower in
the treated asphaltenes fraction than in the untreated ones, which could be
attributed to the presence of shorter alkyl chains or more branched chains. Thus,
this lower ratio could be the consequence of molecule cracking. The aromatic
region of the spectra (110 ppm to 160 ppm) showed significant differences. The
control showed a signal-hill between 133 ppm and 146 ppm, which include the
carbon atoms corresponding to heteroatom moieties (S, N, O), aromatic carbons
bonded to alkyl moieties, and aromatic carbons bonded to other aromatic
carbon. This signal-hill disappeared in the oxidized fraction, suggesting a loss of
heteroatoms or alkyl derivatives in the aromatic molecules. A reduction in the
number of substituted aromatic carbons and an increase of the number of
aromatic carbons bonded to hydrogen are observed.
The enzymatic treatment of asphaltenes is an interesting alternative for the
removal of heavy metals in order to reduce catalyst poisoning in hydrotreatment
and cracking processes. On the other hand, enzymatic cracking of asphaltenes
molecules should not be excluded. The enormous amount of energetic resource
found as asphaltenes-rich deposits justify the exploration of alternative
upgrading technologies.
83
loo ~ ~ /:~
Control
95
90
o~ 85
80
~_ 70
r
o~ 65
60
55
50
4000 3500 3000 2500 2000 1500 1000 500
(cm-1)
Fig. 6. FTIR spectra of untreated and biocatalytically treated porphyrin-rich fractions from
asphaltenes. FTIR was performed using the film-spreading technique [71].
6001 Control
400
300 ~
2 O0 4 O0 6 O0 8 O0 10 O0 12 O0 14 O0
600
Enzymatically treated
e-
.....
e.-
-,-, 500
400-
3OO
' ' ' I , , , T , , , i , , , i , , , t , , , i ,
2 oo 4 oo 6 oo 8 oo 10 oo 12 oo ~4 oo
Elutlon time ( m i n )
Fig. 7. Absorbance contours from gel permeation chromatography (GPC) of untreated and
biocatalytically treated porphyrin-rich fractions from asphaltenes [71].
84
~H spectrum
Control
~H spectrum
Enzymatically tre
__5___
i i 1 i i i .... | ~ 1
8 6 4 2 0
ppm
t3C spectrum
Control
13C spectrum
Enzymatically treated
I
I
. . .
2 0 150 100
ppm
Fig. 9. ~3C NMR analysis of control and enzymatically treated petroporphyrin-rich fraction of
asphaltenes.
85
9 Electron impact
0 Charge transfer
v
>.,
t~
(D
03 0 9
o~ d,
o . 9
7.0 7.5 8.0 8.5 9.0
Fig. 10. The influence of ionization potential of PAHs on the specific activity oflignin
peroxidase oxidation [82].
Table 6
Products from in vitro oxidation of polycyclic aromatic hydrocarbons by lignin
peroxidase from Phanerochaetechrysosporium.
4.3. V e r s a t i l e p e r o x i d a s e
Active lignin-degrading strains of Pleurotus eryngii were shown to
produce a peroxidase, different from P. chrysosporium peroxidases, that can
efficiently oxidize Mn(II) to Mn(III), but can also carry out Mn(II)-independent
activity on aromatic substrates [101 ]. This novel manganese-lignin peroxidase
hybrid enzyme, now called versatile peroxidase (VP), was also described in
Bjerkandera sp. BOS55. This enzyme is able to oxidize various phenolic and
nonphenolic substrates such as 2,6-dimethoxyphenol, guaiacol, ABTS, and
veratryl alcohol, in the absence of Mn(II) [102]. Similar hybrid peroxidases have
been reported in Pleurotus eryngii [103-106], Pleurotus pulmonarius [107],
88
Table 7
In vitro PAHs oxidation with manganese peroxidase in lipid
peroxidation reactions [96].
Oxidation rate
Aromatic compound (nmol/h)
Fluorene 3.10
Benz(a) antrhrac ene 1.08
Benzo(a)pyrene 0.96
Anthracene 0.93
Dibenz(a,c)anthracene 0.60
Benzo(e)pyrene 0.31
Diphenylmethane 0.30
Benzo(c)phenanthrene 0.21
Benzo(b)fluoranthene 0.19
Fluoranthene 0.14
Phenanthrene 0.06
Table 8
Oxidation of aromatic compounds by versatil peroxidase at pH 4.0 in the absence
of Mn(II) [113].
Table 9
Kinetic constants of purified cytochrome P448 from Saccharomyces
cerevisiea for oxidation ofbenzo(a)pyrene[115, 116].
Fig. 11. Engineering cytochrome P450 BM-3 for oxidation of polycyclic aromatis hydrocarbons
[127].
4.5. Cytoehrome e
Cytochromes c are part of the energy-conserving electron transport
systems. In living systems no catalytic activity of cytochrome c has been
described. The ability of cytochrome c to act as catalyst in vitro has been
reviewed [132]. Lipid peroxidation, hydroperoxide cleavage, hydroxylation of 4-
nitrophenol and oxidation of 2-keto-4-thiomethyl butyric acid in the presence of
hydrogen peroxide have been reported. Peroxidase activity of cytochrome c has
been also demonstrated by the oxidation of various electron donors including
ABTS (2-2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) and 4-amino-
antipyrine. In addition, cytochrome P450-1ike oxidative reactions such as N- and
O-demethylations, S-oxidations and olefin epoxidation are catalyzed by free and
immobilized cytochrome c in the presence of hydrogen peroxide or other organic
hydroperoxide [ 132, 133, 134]. It has also been observed that aromatic substrates
of cytochrome c interact with the heme group as ligand rather than as a substrate
[133, 135].
Table 10
Specific activity of yeast cytochrome c on aromatic compounds [135].
Table 11
Kinetic constants of wild-type and variants of yeast iso-1-
cytochrome c for pyrene oxidation [ 135].
Table 12
Oxidation of polycyclic aromatic hydrocarbon by unmodified- and methylated
poly(ethylene)glycol-modified-cytochrome c [ 137].
4.6. Hemoglobin
In the presence of hydrogen peroxide, hemoglobin has been reported to
oxidize aniline [138], lipids [139], S- and N-heterocycles [134, 140, 141] and
other organic substrates [ 141 ]. This protein could be considered as an antioxidant
in red blood cells [ 142]. Biocatalytic activity of hemoglobin on PAHs has been
tested with 12 compounds in the presence of hydrogen peroxide [143]. Among
the aromatic compounds tested, 6 were oxidized (Table 13). As in the case of
95
4.7. Chloroperoxidase
Chloroperoxidase from Caldariomyces fumago (CPO) is a 42 kDa
extracellular heme glycoenzyme containing ferriprotoporphyrin IX as prosthetic
group [146]. CPO exhibits a broad spectrum of chemical reactivities; even
though in vivo it functions mainly as a peroxide-dependent chlorinating enzyme,
it also catalyzes peroxidase-, catalase- and cytochrome P450-type reactions of
dehydrogenation, H202 decomposition and oxygen insertion, respectively, in
vitro [ 147].
Table 13
Biocatalytic oxidation of aromatic compounds by hemoglobin and hydrogen
peroxide [143].
Table 14
Specific activity of chloroperoxidase from Caldariomyces
fumago against aromatic compounds.
reported for other peroxidases. Lignin peroxidase is able to oxidize PAH's and
form quinones up to a PAH's IP of 8.0 eV [85] and manganese peroxidase from
P. chrysosporium shows a threshold value for PAH's substrates of 8.1 eV [98].
4.8. Laeease
Laccases (EC 1.10.3.2) are copper-containing enzymes widespread in
white rot fungi which catalyze the oxidation of a variety of aromatic phenols and
anilines, reducing oxygen to water. Their characteristics have been
comprehensively reviewed [ 148, 149]. While the substrate range for laccase is
normally limited to phenolic substrates, it can be extended to nonphenolic
compounds with the addition of mediating substrates such as ABTS and HBT
[ 150-155]. In vitro oxidation of PAH's has been demonstrated by purified fungal
laccases [ 156-160]. The rate of oxidation of several PAH's has been shown to be
enhanced by the addition of the cooxidant ABTS [ 158-161 ]. Purified laccase of
C. gallica transformed 7 of 10 PAHs examined in the presence of ABTS (Table
15). Benzo[a]pyrene, 9-methylanthracene, 2-methylanthracene, anthracene,
biphenylene, acenaphthene, and phenathrene were oxidized by laccase [160].
The synthetic or natural mediating substances acts as free-radical mediators.
These mediators are sbstrates for laccase and tranformed into free radicals by
one electron subtraction, and then they diffuse and oxidize the aromatic
compound prducing, as peroxidases, mainly quinones. Unlike peroxidases, no
clear relationship between the substrate ionization potential and first-order rate
constant could be detected.
0 i | !
~
>
3- 1~ Polycyclic aromatic
.m
O
compounds
< _ 3 9 9
.O
m 6~
O
_
4o
9 10
ca0
v
O9
8O
O _
11oo12
-1 , , , ,
Fig. 12. Influence of the PAH ionization potential on the chloroperoxidase activity.
98
Table 15
First rate constants of reactions of C. Gallica laccase with polycyclic aromatic
hydrocarbons [ 160].
.~,.
c
t-
loo
E
0I,,.,..
80 ! "..,
-
6o ' mMHBT
v
0 40
I,,-,
c'-
< 20
0 2 4 6 8 10
Time (h)
Fig. 13. Effects of the free-radical mediators HBT and ABTS on the anthracene oxidation by
purified laccase from C. gallica [ 160].
99
Short-chain alkanes such as methane, ethane and propane are the most
abundant and cheapest hydrocarbons available. Nevertheless, they are not
used directly as raw material for production of more valuable products,
mainly because C-H bonds in alkanes are not easily activated. Thus, alkanes
are used mainly as fuels to produce energy. However, the direct alkane
activation to produce valuable petrochemicals would exploit an inexpensive
hydrocarbon feedstock. Based on commercial and process viability, some of
the most promising routes for direct alkane activation have been identified
[162]. Table 18 shows some of the potential routes to produce important
petrochemicals as well as the conventional industrial feedstocks and currently
used processes. It has been estimated that the alternative technologies could
represent cost savings of up to USD 380/metric ton over the conventional
processes [ 162]. Efficient production of petrochemicals by direct activation of
alkanes remains a challenge. Particularly, oxidation of alkanes into useful
products is one of the major issues in catalysis research. Yields must be kept
low when using metal-based catalysts in order to keep selectivity [163].
Besides, as products are more reactive than substrates, subsequent oxidation
of partially oxidized alkanes leads to undesirable or low-value products.
There are several reports in the literature regarding the transformation
of saturated hydrocarbons by microorganisms. There have been found
microorganisms able to mineralize or degrade C1 to C44 alkanes. Table 19 lists
the enzymes identified to catalyze the most common transformation, usually
an hydroxylation, of different alkanes. This section will briefly describe
substrate specificity, activities and limitations of the most representative
enzymatic systems for alkane oxidation.
Table 18
Processes for production of basic and intermediate petrochemicals [ 162].
Table 19
Enzymes able to catalyze the oxidation of alkanes.
Fig. 14. Steps involved in the oxidation reaction catalyzed by alkane hydroxylase and
methane monooxygenase(A) and cytochromeP450 (B).
Table 20
Relative activities of alkane hydroxylase for the oxidation of
medium-chain alkanes [ 177].
Table 21
Alkane hydroxylation by different enzymatic systems [ 172]
6. O P O R T U N I T I E S AND CHALLENGES
In this century all industries, including the petroleum industry, should apply
energetically efficient production processes with reduced environmental
impact: this is their main challenge. In addition to the expected improvements
of conventional processes, the use of new and non conventional techniques
for petroleum refining should be evaluated. Doubtless, biotechnology is
among the non conventional techniques to be explored. Enzymatic catalysis
with high transformation efficiency, high specificity and mild reaction
conditions offers a wide range of possibilities. The analysis of the available
data on microbial and enzymatic transformations of oil products shows
104
several opportunities for some sectors of the petroleum industry, such as deep
desulfurization and denitrogenation, and asphaltene upgrading.
The powerful tools of molecular biochemistry can be used to improve
the enzyme stability and efficiency. These techniques may be applied to the
particular needs of the petroleum industry. Protein engineering is generally
understood as the use of site-directed or random mutagenesis to alter the
properties of a protein or enzyme. In addition, the enzymes isolated from
extremophilic microorganisms are extremely thermostable and generally
resistant to non conventional conditions such as organic solvents and extreme
pH. Thus, many enzymes and enzymatic proteins are still to be discovered. In
addition, over the past two decades people have seen many examples of the
improvement ofbiocatalysts by chemical and genetic techniques.
Still, there is not any enzymatic process ready to by applied in the
petroleum refining industry, and three main research fields may be suggested
to obtain an enzyme catalysts to be used in the petroleum industry:
1) The search of new enzymatic activities upon petroleum products,
specially from extreme environments. New microorganisms are currently
discovered from extreme environments such as thermal vents in the ocean
deep and fossilized salt rocks. The enzymes isolated from extremophilic
microorganisms are extremely thermostable and generally resistant to organic
solvents and extreme pH. Enzymes from these microorganisms working in
non-aqueous systems at temperatures higher as 200~ (operating conditions
found in refineries) could be expected. Moreover at high temperatures, the
hydrocarbons bioavailability and solubility is increased. All these unknown
organisms are a potential source of new enzyme forms with different
physicochemical properties: the potential source of biocatalytic activity for
the oil industry could be there.
2) The improvement of the enzymatic activities in very low water
systems, in order to increase the transformation rates using petroleum
fractions without further addition of water. Since petroleum is a hydrophobic
material, it is suitable to speculate that new enzymatic processes for the oil
industry should be carried out in non-aqueous systems. The use of reaction
mixtures containing organic solvents reduces mass transfer limitations,
promoting the establishment of productive interactions between the enzyme
and the hydrophobic substrates (oil-derived compounds). In addition, a
biocatalyst placed in a non-aqueous medium shows interesting properties,
such as improved thermostability, higher substrate accessibility, adjustable
selectivity, and high storage stability. The study of the relationship between
the solvent properties and the enzyme activity seems to be essential to
understand and to improve the biocatalytic processes.
105
Table 22
Improvement of cytochrome P450 BM-3 for the catalysis of small alkanes oxidation [ 179]
REFERENCES
[ 16] L. Giver, A. Gershenson, P.O. Freskgard and F.H. Arnold, Proc. Natl. Acad. Sci.
USA 95 (1998) 12809.
[17] H. Zhao and F.H. Arnold, Protein Eng. 12 (1999) 47.
[ 18] J.R. Cherry, M.H. Lamsa, P. Schneider, J. Vind, A. Sevendsen, A. Jones and A.H.
Pedersen, Nat. Biotechnol. 17 (1999) 379.
[ 19] A. Aksoy, H. Tumturk and N. Hasirci, J Biotechnol. 60 (1998) 37.
[20] P. Wang, M.V. Sergeeva, L. Lim and J.S. Dordick, Nat. Biotechnol. 15 (1997) 789.
[21] C.P. Govardhan, Curr Opin. Biotechnol. 10 (1999) 331.
[22] N.L. St Clair and M.A. Navia, J. Am. Chem. Soc. 114 (1992) 7314.
[23] S.S. Wong and C.L.J. Wong, Enzyme Microb. Technol. 14 (1992) 866.
[24] M. Ayala, E. Horjales, M.A. Pickard and R. Vazquez-Duhalt, Biochem. Biophys.
Res. Comm. 295 (2002) 828.
[25] J.P. Lenders and R.R. Crichton, Biotechnol. Bioeng. 26 (1984) 1343.
[26] R.A.K. Srivastava, Enzyme Microb. Technol. 13 (1991) 164.
[27] H.F. Gaertner and A.J. Puigserver, Enzyme Microb. Technol. 14 (1992) 150.
[28] D. Garcia, F. Ort6ga and J.L. Marty, Biotechnol. Appl. Biochem. 27 (1998) 49.
[29] M.J. Hemfiiz, J.M. Sfinchez-Montero and J.V. Sinisterra, Enzyme Microb. Technol.
24 (1999) 181.
[30] H. Garcia-Arellano, B. Valderrama, G. Saab-Rinc6n and R. Vazquez-Duhalt,
Bioconjugate Chem. 13 (2000) 1336.
[31] EPA (2000) EPA420-F-00-057
[32] A.M. Aitani, M.F. Ali and H.H. A1-Ali, Petrol. Sci. Technol. 18 (2000) 537.
[33] L. Linguist and M. Pachecho, Oil Gas J. Feb 22 (1999) 46.
[34] M.A. Kertesz and C. Wietek, Appl. Microbiol. Biotechnol. 57 (2001) 460.
[35] J. Klein, D.E.A. Catcheside, R. Fakoussa, L. Gazso, W. Fritsche, M. H6fer, F.
Laborda, I. Margarit, H.J. Rehm, M. Reich-Walber, W. Sand, S. Schacht, H.
Schmiers, L Setti and A. Steinbfichel, Appl. Microbiol. Biotechnol. 52 (1999) 2.
[36] W.M. Coco, W.E. Levinson, M.J. Crist, H.J. Hektor, A. Darzins, P.T. Pienkos, C.H.
Squires ad D.J. Monticello, Nat. Biotechnol. 19 (2001) 354.
[37] M.J. Grossman, M.K. Lee, R.C. Prince, K.K. Garrett, G.N. George and I.J. Picketing.
Appl. Environ. Microbiol. 65 (1999) 181.
[38] M.J. Grossman, M.K. Lee, R.C. Prince, V. Minak-Bernero, G.N. George and I.J.
Picketing, Appl. Environ. Microbiol. 67 (2001) 1949.
[39] M. Naito, T. Kawamoto, K. Fujino, M. Kobayashi, K. Maruhashi and A. Tanaka,
Appl. Microbiol. Biotechnol. 55 (2001) 374.
[40] J.A. Rupley and G. Carreri, Adv. Protein Chem. 41 (1991) 37.
[41 ] A.M. Klibanov, Trends Biotechnol. 15 (1997) 97.
[42] P.J. Halling, Curr. Opin. Chem. Biol. 4 (2000) 74.
[43] M. Tuena de G6mez-Poyou and A. G6mez-Poyou, Crit. Rev. Biochem. Mol. Biol. 33
(1998) 53.
[44] M. Ayala, R. Tinoco, V. Hernandez, P. Bremauntz and R. Vazquez-Duhalt, Fuel
Process Technol. 57 (1998) 101.
[45] M. Ayala, N.R. Robledo, A. Lopez-Munguia and R. Vazquez-Duhalt, Environ. Sci.
Technol. 34 (2000) 2804.
[46] R. Vazquez-Duhalt, M. Ayala and F.J. Marquez-Rocha, Phytochemistry 58 (2001)
929.
[47] M.P.J. van Deurzen, F. van Rantwijk and R.A. Sheldon, Tetrahedron 53 (1997)
13183.
107
[80] R.L. Farrell, K.E. Murtagh, M. Tien, M.D. Mozuch and T.K. Kirk, Enzyme Microb.
Technol. 11 (1989) 322.
[81] D. Sanglard, M.S.A. Leisola and A. Fiechter, Enzyme Microb. Technol. 8 (1986) 209.
[82] K.E. Hammel, B. Kalyanaraman and T.K. Kirk, J. Biol. Chem. 261 (1986) 16952.
[83] J.A. Field, R.H. Vledder, J.G. van Zelst and W.H.Rulkens, Enzyme Microb. Technol.
18 (1996) 300.
[84] S.D. Haemmerli, M.S.A. Leisola, D. Sanglard and A. Fiechter, J. Biol. Chem. 261
(1986) 6900.
[85] R. Vazquez-Duhalt, D.W.S. Westlake and P.M. Fedorak, Appl. Environ. Microbiol. 60
(1994) 459.
[86] M. Tatarko and J.A. Bumpus, Lett. Appl. Microbiol. 17 (1993) 20.
[87] K.E. Hammel and P.J. Tradone, Biochemistry 27 (1988) 6563.
[88] R. Vazquez-Duhalt, D.W.S. Westlake, and P.M. Fedorak, Appl. Microbiol.
Biotechnol. 42 (1995) 675.
[89] M.H. Gold, J.K. Glenn and M. Alic, Methods Enzymol. 161 (1988) 74.
[90] C. Cripps, J.A. Bumpus and S.D. Aust, Appl. Environ. Microbiol. 56 (1990) 1114.
[91] E.A. Pease and M. Tien, J. Bacteriol. 174 (1992) 3532.
[92] M.J.J. Kotterman, R. A. Wasseveld and J.A. Field, Appl. Environ. Microbiol. 62
(1996) 880.
[93] J.A. Field, E. de Jong, G. Feijoo-Costa and J.A.M. de Bont, Trends Biotechnol. 11
(1993) 44.
[94] J i . Popp and T.K. Kirk, Arch. Biochem. Biophys. 288 (1991) 145.
[95] M.A. Moen and K.E. Hammel, Appl. Environ. Microbiol. 60 (1994) 1956.
[96] B.W. Bogan, R.T. Lamar and K.E. Hammel, Appl. Environ. Microbiol. 62 (1996)
1788.
[97] B.W. Bogan, B. Schoenike, R.T. Lamar and D. Cullen, Appl. Environ. Microbiol. 62
(1996) 2381.
[98] B.W. Bogan and R.T. Lamar, Appl. Environ. Microbiol. 61 (1995) 2631.
[99] M.J.J. Kotterman, R.A. Wasseveld and J.A. Field, Appl. Environ. Microbiol. 62 (1996)
880.
[100] B.W. Bogan and R.T. Lamar, Appl. Environ. Microbiol. 62 (1996) 1597.
[ 101] M.J. Martinez, F.J. Ruiz-Duenas, F. Guillen and A.T. Martinez. Eur. J. Biochem. 237
(1996) 15412.
[102] T. Mester and J.A. Field, J. Biol. Chem. 273 (1998) 15412.
[103] A. Heinfling, M.J. Martinez, A.T. Martinez, M. Bergbauer and U. Szewzyk, FEMS
Microbiol. Lett. 165 (1998) 43.
[104] A. Heinfling, J. Ruiz-Duefias, M.J. Martinez, M. Bergbauer, U. Szewzyk, and A.T.
Martinez, FEBS Lett. 428 (1998) 141.
[ 105] F.J. Ruiz- Duefias, M.J. Martinez and A.T. Martinez, Mol. Microbiol. 31 (1999) 223.
[ 106] F.J. Ruiz- Duefias, M.J. Martinez and A.T. Martinez, Appl. Environ. Microbiol. 65
(1999) 4705.
[ 107] S. Camarero, B. Bockle, M.J. Martinez and A.T. Martinez, Appl. Environ.
Microbiol. 62 (1996) 1070.
[108] S. Sarkar, A.T. Martinez and M.J. Martinez, Biochim. Biophys. Acta. 1339 (1997)
23.
[ 109] Y. Wang, R. Vazquez-Duhalt and M.A. Pickard, Can. J. Microbiol. 47 (2001) 277.
109
[ 110] Y. Wang, R. Vazquez-Duhalt and M.A. Pickard, Curr. Microbiol. 43 (2002) 77.
[ 111 ] S. Camarero, S. Sarkar, F.J. Ruiz-Duefias, M.J. Martinez and A.T. Martinez, J.
Biol. Chem. 274 (1999) 10324.
[ 112] M. Ayala, M.C. Baratto, R. Basosi, R. Vazquez-Duhalt and R. Pogni, J. Mol.
Catalysis B: Enzymatic 16 (2001) 159..
[113] Y. Wang, R. Vazquez-Duhalt and M.A. Pickard, Can. J. Microbiol. 49 (2003) 675.
[ 114] P.R. Ortiz de Montellano, Cytochrome P450, Structure, Mechanism and Biochemistry,
Plenum Press, New York, 1986.
[ 115] D.J. King, M.R. Azari and A. Wiseman, Xenobiotica 14 (1984) 187.
[ 116] M.R. Azari and A. Wiseman, Enzyme Microb. Technol. 4 (1982) 401.
[ 117] J. Capdevilla, R.W. Estabrook and R.A. Prough, Arch. Biochem. Biophys. 200 (1980)
186.
[118] W. Dehnen, R. Tomingas and J. Roos, Anal. Biochem. 53 (1973) 373.
[ 119] S.L. Kelly, D.C. Lamb, B.C. Baldwin and D.E. Kelly, Biochem Biophys. Res. Comm.
197 (1993) 428.
[120] S. Masaphy, D. Levanon, Y. Henis, K. Venkateswarlu and S.L. Kelly, Biotechnol.
Lett. 17 (1995) 969.
[121] A.P. Koley, J.T.M. Buters, R.C. Robinson, A. Markowitz and F.K. Friedman, Arch.
Biochem. Biophys. 336 (1996) 261.
[122] P. Anzenbacher, T. Niwa, L.M. Tolbert, S.R. Sirimanne and F.P. Guengerich,
Biochemistry 35 (1996) 2512.
[123] A.D. Rahimtula, P.J. O'Brien, H.E. Seifreid and D.M. Jerina, Eur. J. Biochem. 89
(1978) 133.
[124] M. Shou, K.W. Krausz, F.J. Gonzalez and H.V. Gelboin, Carcinogenesis 17 (1995)
2429.
[125] W.L. Backes, M. Hogaboom and W.J. Canady, J. Biol. Chem. 257 (1982) 4063.
[126] W.L. Backes, G. Cawley, C.S. Eyer, M. Means, K.M. Causey and W.J. Canady, Arch.
Biochem. Biophys. 304 (1993) 27.
[127] O-S. Li, J. Ogawa, R.D. Schmid and S. Shimizu, Appl. Environ. Microbiol. 67
(2001) 5735.
[128] S.M. Fowler, P.A. England, A.C.G. Westlake, D.R. Rouch, D.P. Nickerson, C. Blunt,
D. Braybrook, S. West, L.L. Wong and S.L. Flitsch, J. Chem. Soc. Chem. Commun.
(1994) 2761.
[129] S. Modi, W.U. Primrose, L.Y. Lian and G.C.K. Roberts, Biochem J. 310 (1995) 939.
[ 130] H. Joo, Z. Lin and F. H. Arnold, Nature 399 (1999) 670.
[131 ] C.F. Harford-Cross, A.B. Carmichael, F.K. Allan, P.A. England, D.A. Rouch and L-
L. Wong, Protein Eng. 13 (2000) 121.
[132] R. Vazquez-Duhalt, J. Mol. Cat. B: Enzymatic 7 (1999) 241.
[133] R. Vazquez-Duhalt, D.W.S. Westlake and P.M. Fedorak, Enzyme Microb. Technol. 15
(1993) 494.
[134] N.L. Klyachko and A.M. Klibanov, Appl. Biochem. Biotechnol. 37 (1992) 53.
[135] E. Torres, J.V. Sandoval, F.I. Rosell, A.G. Mauk and R. Vazquez-Duhalt, Enzyme
Microb. Technol. 17 (1995) 1014.
[136] R. Akasaka, T. Mushino and M. Hirobe, J. Chem. Soc. Perkin Trans. 1 (1994) 1817.
[137] R. Tinoco and R. Vazquez-Duhalt, Enzyme Microb. Technol. 22 (1997) 8.
[138] J.J. Mieyal, R.S. Ackerman, J.L. Blumer and L.S. Freeman, J. Biol. Chem. 251 (1976)
3436.
[139] Y. Yoshida, K. Kashiba andE. Niki, Biochim. Biophys. Acta 1201 (1994) 165.
111
[ 172] M.W. Peters, P. Meinhold, A. Glieder and F.H. Arnold, J. Am. Chem. Soc. 125
(2003) 13442.
[173] J. Shanklin, C. Achim, H. Schmid, B.G. Fox and E. Mtinck, Proc. Natl. Acad. Sci.
USA 94 (1997) 2981.
[174] A. Ratajczak, W. GeiBd6rfer and W. Hillen, J. Bacteriol. 180 (1998) 5822.
[ 175] L.G. Whyte, T.H.M. Smits, D. Labb6, B. Witholt, C.W. Greer and J.B. van Beilen,
Appl. Environ. Microbiol. 68 (2002) 5933.
[176] A. Tani, T. Ishige, Y. Sakai and N. Kato, J. Bacteriol. 183 (2001) 1819.
[177] A. Bosetti, J.B. van Beilen, H. Preusting, R.G. Lageveen and B. Witholt, Enzyme
Microb. Technol. 14 (1992) 702.
[178] D.L. Craft, K.M. Madduri, M. Eshoo and C.R. Wilson, Appl. Environ. Microbiol. 69
(2003) 5983.
[ 179] A. Glieder, E.T. Farinas and F.H. Arnold, Nat. Biotechnol. 20 (2002) 1135.
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Elsevier B.V. All rights reserved. ll3
Chapter 4
1. INTRODUCTION
Increasing supply of heavy crude oils and bitumens, mainly from Canada,
Mexico and Venezuela, has increased the interest in transportation and
conversion of the high-molecular weight fractions of these materials into refined
fuels and petrochemicals. The high viscosity of these crudes requires addition of
a solvent in order to allow pipelining over a significant distance. The cost of
suitable solvents, such as naphtha or natural gas condensate, has led to study of
new methods to reduce the viscosity of heavy crudes. Once they enter a refinery,
processing of heavy crudes and bitumens requires conversion of the vacuum
residue components, including the asphaltenes, into distillable oils. This
upgrading has typically been accomplished with either thermal conversion
(cracking or coking) or by catalytic hydroconversion. Thermal processing can
range from mild cracking, to reduce viscosity, to severe cracking with attendant
formation of coke. These high-temperature processes require expensive
investment in process equipment and supporting infrastructure for supply of
hydrogen and treatment of hydrogen sulfide in cracked off-gases.
In contrast to the available processes, biological processing may offer less
severe process conditions and higher selectivity to specific reactions. This
chapter reviews the characteristics of the molecules in the vacuum residue
fraction of crude oils, and examines the prospects for using biological processes
to improve the value of these materials.
114
2. M O L E C U L E S OF INTEREST
Heavy crude oils pose new upgrading challenges, in addition to the upgrading
needs common to lighter crudes. These problems are related to two types of high
molecular weight molecules present in these oils: waxes and asphaltenes. Waxes
are long-chain paraffinic molecules, or alkanes, which typically cause
operational problems if longer than 40 carbon atoms [3]. Asphaltenes, on the
other hand, are not classified by structure, but are defined as a solubility class,
including material that is soluble in toluene but not in n-pentane (or alternatively
n-heptane). There are two different views on the molecular structure of
asphaltenic material. The first represents asphaltenes as having a single large
condensed polycyclic aromatic core, with aliphatic chains attached on the
periphery (Fig. l a) [1, 4-6]. This type of structure, however, does not account
for all of the physical and chemical properties of asphaltenes. The second
(a
(b) .~~
Fig. 1. Representative models of asphaltene molecules showing either (a) a single large
condensed polycyclic aromatic core [1] or (b) multiple smaller polycyclic aromatic cores with
aliphatic bridges [2].
115
3.2.3. Hydrogenation
Typical H/C ratios for bitumens and residues range from 1.4-1.6 mol/mol.
Hydrogenation is required to increase the H/C ratio of these feeds to a level
suitable for transportation fuels (diesel and jet fuels, around 1.8 mol/mol) [ 19].
The primary target is the aromatics, including the heterocyclic sulfur and
nitrogen species. The use of microorganisms specifically for aromatic ring
hydrogenation has not been explored, although ring hydrogenation has been
observed in the biodegradation pathways of some aromatic compounds.
The explosive 2,4,6-trinitrotoluene (TNT) is subject to biotransformation in
a variety of anaerobic and aerobic bacterial systems, as well as fungal systems
(reviewed in Ref. [30]). In some aerobic bacteria, the initial reaction is
hydrogenation of the ring, forming hydride- and dihydride-Meisenheimer
complexes (Fig. 2a) [26, 27, 31]. Hydride-Meisenheimer complexes are
similarly formed in the biodegradation of picric acid (2,4,6-trinitrophenol) [32,
33]. For the better-characterized picric acid system, these reactions are catalyzed
by a hydride transferase enzyme, with NADPH serving as the hydride source via
reduced coenzyme F-420 [34, 35].
(a)
C,v~H 3 N OH3 OH3
NO 2 NO2 NO2
TNT Hydride-MeisenheimerDihydride-Meisenheimer
complex complex
(b) 0 0 0
Fig. 2. Examples of hydrogenation reactions in the biodegradation of (a) TNT [26, 27] and (b)
naphthalene [28, 29].
119
(a)
- OH
n-Dodecane n-Dodecanol
0
I I
= O = ~ O H
n-Dodecanal n-Dodecanoic acid
(b) A A A A ~])AOAO.,.'~
H T
= / v v v v -71 v "OH
/
n-Dodecane 2-(1-Methylundecyl) succinic acid
(c) OH
O
H O ~ o H
under nitrate-reducing conditions [45, 46] and n-dodecane [39] under sulfate-
reducing conditions. The addition of fumarate to alkanes does not occur at a
terminal methyl C-H, but rather at either a C2 or C3 subterminal methylene C-H
[39, 46], producing a branched dicarboxylic acid (Fig. 3b), which is degraded
through fatty acid metabolism. As with the aerobic pathway described above,
anaerobic alkane degradation therefore proceeds from the terminus of the
molecule.
A subterminal attack on long-chain n-alkanes may occur in some aerobic
bacterial cultures. A mutant Rhodococcus strain, designated KSM-B-3M,
accumulated cis-unsaturated metabolites of n-hexadecane, 1-chlorohexadecane,
and heptadecanonitrile, which were not growth substrates [47]. (The first two
compounds did support growth of the wild-type strain.) In all three compounds
the unsaturation was at position 9. Unsaturated products were also detected for
1-hexadecanol, 1,2-epoxyhexadecane, hexadecyl benzene, and hexadecyl
chloroformate. The mutant had likely lost the ability to cleave the alkane chain
at the unsaturated bond, resulting in the inability to grow on these substrates
[47].
The degradation of phytanyl octadecyl ether by a mixed soil culture and by
Rhodococcus ruber (DSMZ 7512) also showed evidence of an initial
subterminal dehydrogenation [48]. Degradation occurred initially on the linear
side chain, and initial degradation products were the phytanyl ethers of C2 to C8
primary alcohols. The corresponding carboxylic acids appeared next as the
alcohols disappeared from the cultures. The final products were the phytanyl
ethers of acetic acid and propanoic acid. One other metabolite was observed,
phytanyl octadec-9-enyl ether. The formation of unsaturated products was
proposed to be analogous to the dehydrogenation of C~8 fatty acids in the cell
membrane, which also occurs at position 9. The alternate degradation pathway
proposed starts with the observed intemal dehydrogenation, followed by a
hypothesized olefinic oxidation to a secondary alcohol, oxidation to a ketone,
Baeyer-Villiger oxidation to an ester, ester cleavage, and 13-oxidation [48].
A subterminal attack of this type has not been shown for a diterminally
substituted alkyl chain, but a similar pathway has been shown as the mechanism
of degradation for both small and large cyclic alkanes. Both cyclohexane
(reviewed in Ref. [49]) and cyclododecane [40] are oxidized via an alcohol to a
cyclic ketone. The ketones are oxidized to lactones by Baeyer-Villiger
monooxygenases, followed by ester cleavage to an co-hydroxycarboxylic acid
(Fig. 3c) and oxidation to a dicarboxylic acid [40] that can be degraded through
central metabolic pathways. The Baeyer-Villiger monooxygenases appear to
have fairly narrow substrate specificities. Cyclododecanone monooxygenase
from R. ruber strain CD4 could also oxidize cyclopentadecanone, but not
cyclohexanone or cyclooctanone [40]. In growth assays, R. ruber strain SC1,
isolated on cyclododecanone, could also grow on C~5, C13, Cl~, and Cl0 cyclic
122
ketones, but not on C8, C7, or C6 cyclic ketones [50]. Conversely, cyclohexanone
monooxygenases are known to favour shorter chain cyclic ketones. For example,
two enzymes from Brevibacterium sp. strain HCU could oxidize C4-C7 cyclic
ketones, but not C8-C~2 compounds [51 ].
Molecular weight reduction in the residue fraction of heavy oils requires
cleavage of alkyl bridges, where both ends of the carbon chain are blocked by
attachment to aromatic groups. The more common aerobic and anaerobic
bacterial alkane-degradation pathways are not appropriate for molecular weight
reduction in crude oil, because they only activate the free end of the molecule to
create a fatty acid for central metabolic pathways. More relevant research has
been done with long-chain n-alkanes and cycloalkanes. This work shows that an
alkyl chain can be cleaved through bacterial attack in the absence of a terminal
methyl group. This reaction is more directly analogous to the alkyl bridges
found in high molecular weight crude oil components, and is a promising
avenue for further work.
either from the oil or from existing deposits. The ability of bacteria to degrade
solid alkanes is limited by mass transfer rates. For instance, liposome
encapsulation was required to achieve biodegradation ofhexatriacontane (n-C36)
by a Pseudomonas isolate which did not grow on the crystalline compound [38].
The usefulness of biological treatments for removal of deposits may therefore be
limited to the production of solubilizing agents rather than direct transformation
or degradation of the crystallized molecules. Isolated bacteria and consortia
from paraffin deposits, hydrocarbon contaminated soils and waters, and brine
have been shown to produce biosurfactants, as well as to degrade hydrocarbons
from samples of paraffin deposits and paraffinic oils [56]. In a flow system, a
consortium of these bacteria decreased the paraffin content of a heavy oil. The
treated oil also had a lower freezing point and a decreased low temperature
viscosity, but the effect of these changes on deposition in the flow system was
not reported [56]. To the extent that microorganisms adsorb wax or asphaltic
material, then bacteria could serve to disperse the deposits and prevent
deposition on surfaces, however, no systematic research has been conducted in
this area.
energy added through mixing is essential, since the emulsified state is not
usually thermodynamically stable. Emulsifying agents associate at the interface
of the two phases and impart kinetic stability to the emulsion, either through
reduction of interfacial tension (chemical stabilization), or by providing a barrier
to coalescence (physical stabilization). Resolution of emulsions, or de-
emulsification, proceeds via two steps: flocculation or aggregation of droplets,
and coalescence of droplets to form a continuous second phase. De-emulsifiers
may promote one or both of these phenomena [58].
Crude oil emulsions are complex, and vary from location to location. The
emulsifying agents may be amphiphilic molecules from the oil, especially the
resin fraction, including naphthenic acids. Many crude oil emulsions are
stabilized by fine solids, including clays, scale, or wax crystals [59], or bacteria
themselves [60], which present a barrier to droplet coalescence. Asphaltenes are
especially important in heavy crude oil emulsions. After association with the
interface, asphaltenes agglomerate to form a skin, which prevents coalescence of
droplets. Resins are also believed to play a part in stabilizing this skin [58].
Complex emulsion structures, such as water-in-oil-in-water emulsions, have also
been observed [61 ]. De-emulsification in the oil industry is challenging due to
the variety of possible emulsion properties, and treatments are currently tailored
to each site and adapted over time [59].
Biological de-emulsification has been studied using a variety of
microorganisms. Whole bacterial cells have received the most research [62-69],
but Streptomyces spores [70], bacterial metabolites [71], and yeast cells [64]
have also been studied. The organisms and emulsion systems used are
summarized in Table 1. The majority of studies have examined model,
chemically stabilized emulsions consisting of water, hydrocarbon, and a
commercial surfactant. This research has allowed some assessment of the mode
of action. De-emulsification ability appears to be associated with the surface of
the bacterial cells. Depending on their hydrophobicity, cells may aggregate at
the oil-water interface, promoting flocculation and coalescence of droplets [72].
Differences in hydrophobicity may account for changes in effectiveness of
microbes in different growth phases, as well as for differing abilities to resolve
O/W or W/O emulsions. In general, it appears that more hydrophilic cells are
required to treat W/O emulsions, while relatively more hydrophobic cells are
able to resolve O/W emulsions [62, 65, 66, 69, 70].
The ability of bacterial cells to de-emulsify both model and oilfield O/W
and W/O emulsions has been demonstrated, but the potential for treating the true
spectrum of real crude oil emulsions has not been rigorously tested. As with
chemical treatments, no single biological treatment will likely be effective for all
chemically stabilized crude oil emulsions. Biological products may still be a
valuable complement to existing chemical technologies.
125
Table 1
Biological systems shown to de-emulsify oil-water emulsions
Organism Emulsion system Comments Refs.
Nocardia amarae O/W emulsions: 9 Older, more hydrophobic [62, 65, 66,
strain LL-Se6 Alkanes / water cultures more effective 69]
(ATCC 27808) Kerosene / water
Oilfield emulsions
W/O emulsions: 9 Younger cultures (exponential
Water / kerosene growth phase) more effective
Oilfield emulsions
Corynebacterium W/O emulsions" Younger cultures (exponential [64, 69]
petrophilum Oilfield emulsions growth phase) more effective
(ATCC 21404)
Micrococcus sp. O/W emulsions: 9 More effective for O/W [63]
Kerosene / water emulsions
W/O emulsions: Solvent washing increased O/W,
Water / kerosene decreased W/O de-emulsification
Mixed aerobic W/O emulsions: 9 More effective when grown on [67, 68, 73]
bacterial culture Water / kerosene crude oil or motor oil than on
Oilfield emulsions carbohydrates
Streptomyces sp. O/W emulsions 9 9 Only aerial spores were effective [70]
strain AA8321 Kerosene / water 9 Effectiveness increased with
Alkanes / water culture age and hydrophobicity
Diesel / water
Gasoline / water
Paraffin oil / water
Soybean oil / water
Bacillus subtilis W/O emulsions: 9 Free acetoin in medium [71]
Water / crude oil identified as active component
Torulopsis W/O emulsions: 9 Rate increased with cell [64]
bombicola Oilfield emulsions concentration
(ATCC 22214)
R~'(CH2)mCOOH ~(CH2)mCOOH
R
CH3(CH2)mCOOH
R~(CH2)rnCOOHR _ ~ ~ (CH2)rnCOOH
Fig. 4. Representative naphthenic acids structures (based on Ref. [74]). ( R - alkyl group; m -
number of carbons in the side chain excluding the carboxyl group)
128
1011
1010
(a)
109
108 9 Whole oils and
tag
1011 | | l | ! i i
1010 (b) 9
10 9
10 8
Q. 10 7 9 Residuals, 293 K
E
v 10 6 9 Synthetic crude oils, 373 K
.D
10 ~ 9 Crude oils and natural
O
O
10 4 bitumens, 293 K
>
10 3
10 2
10 ~ .#
A
9 ! j
10 o v i i i i
0 5 10 15 20 25 30 35 40
Asphaltene content (weight %)
Fig. 5. Viscosity data for whole oils, residuals, and distillates [88], oil sand bitumens and
topped crudes [84], oil fractions [85], synthetic crude oils [86], and crude oils and natural
bitumens [20] showing correlation to (a) average molecular weight and (b) asphaltene content.
(Analysis temperatures are indicated in the legends)
130
Table 2
Selected organic sulfur compounds successfully used for enrichment of
microorganisms able to use the compounds as sole sulfur source under sulfur-
limited conditions
Compound Procedures used Refs.
Ametryne and 9 Culture maintenance alternated between [90]
prometryne selective liquid and non-selective solid media
(herbicides)
Naphthalenesulfonic 9 Substrate purification by high pressure liquid [91]
acids chromatography
Benzenesulfonic acids 9 "Scrupulously clean glassware" (procedure
(detergents) not given)
Organic sulfur in coal 9 Effluent from reactor mutagenized and [92]
reinoculated to accelerate strain evolution
Endosulfan Use of an Escherichia coli culture to [93]
(an insecticide) scavenge sulfate from medium, followed by
filter sterilization to produce a sulfur-free
medium
131
Table 3
Selected dibenzothiophene desulfurizing bacteria and altemate sulfur sources
Organism Selected altemate organic sulfur sources used Refs.
Aerobic mesophiles:
Rhodococcus erythropolis 1,4,7-Trithiacyclononane; 1,4-dithiane; trithiane; [94]
strain IGTS8 thianthrene
Rhodococcus sp. Dimethyl sulfide; some alkyl and aromatic sulfonates [95,
strain SY1 96]
Rhodococcus erythropolis Dimethyl sulfone; methanesulfonic acid; [97]
strain D- 1 2-mercaptoethanol
Gordonia sp. Dimethyl and benzyl sulfides; benzyl disulfide; [98]
strain CYKS 1 trithiane; thiophene; 2-methylthiophene
Nocardia sp. Dimethyl, benzyl, and phenyl sulfides; methyl, [99]
strain CYKS2 benzyl, and p-tolyl disulfides; thiophene;
2- and 3-methylthiophene
Rhodococcus erythropolis 4-Methyl DBT; 4,6- and 2,8-dimethyl DBT; [100]
strain KA2-5-1 3,4,6-trimethyl DBT; 3,4,6,7-tetramethyl DBT;
2- and 3-ethyl DBT
Aerobic thermophiles (up to 60~ 9
Paenibacillus sp. 2,8- and 4,6-dimethyl DBT [101]
strain A 11-2
Mycobacterium phlei 2,8- and 4,6-dimethyl DBT; 3,4-benzo DBT [102]
strain WU-F1
Anaerobic, sulfate-reducing bacteria:
Desulfovibrio desulfuricans Phenyland benzyl sulfide; benzothiophene [103]
strain M6
was also hypothesized, but not directly observed. JVH1 was shown to use a
variety of compounds with aliphatic carbon-sulfur bonds as sulfur sources
(including dialkyl sulfides, thiacycloalkanes, and aryl-terminated sulfides), but
not thiophenic compounds. This selective ability to cleave compounds with
aliphatic carbon-sulfur bonds is extremely interesting for research into
biological viscosity reduction in heavy crude oils.
(a)
(b) o,p
phy-S ~ phy.:S O"
O O
T Midchainand T
p-oxidations
Sulfur _ O~,(3
Phy~S"c18 oxidation~sPhy~S..c18
1 Terminal
13-oxidatiand
ons 1
Phy~S~oH
13-oxidations
PhytS~oH PhyIS~oH
O
Phy~SV~oH
Fig. 6. (a) Structure of phytanyl octadecyl sulfide. (b) Metabolites produced by Rhodococcus
erythropolis ATCC 13260 and proposed reactions in the degradation of phytanyl octadecyl
sulfide [ 15].
134
F F
PFPS F SF . ~ ~ F
F ] F F
F F
PFPSO
F F
PFPSO2
F F
F F
F SO2
PFPP-OHF ~
F" "~ "F
OH
#
[SO32]
F 0
F.y~y'"v~OH
PFPP-aci
F" ~ "F
F
Fig. 7. Proposed pathway of PFPS metabolism in Rhodococcus sp. strain JVH1 [104].
Compounds in brackets were not directly observed. (PFPP-OH- 3-pentafluorophenylpropan-
1-ol; PFPP-acid- 3-pentafluorophenylpropanoic acid).
(a) (CH3)2<~
S HCHO / ~ 2HCHO = 2HCOOH
CH3SH = S 2- = SO4 2-
(b)
(CH3)2S< ~ X-CH3
CHaSH
.•_ _
2X-CH3
S2-
= 2HCOOH
=_ SO42
(c)
(CH3)2S--~'(CH3)2SO"--~(CH3)2SO2x,
~ CH3SO3"x,~= OH4
CH3OH SO3 2-
Fig. 6. Dimethyl sulfide biodegradation pathways. (a) aerobic marine thiobacilli and
hyphomicrobia [106]. (b) Thiobacillus sp. strain ASN-1 [107]. (c) Rhodococcus sp. strain
SY 1 [95]. (X - cobalamin carrier of methyltransferase)
(a) 0 O O
HO/~/S~/~OH
Thiodiglycol
-~ H O / ~ / S v ~ o H -_ Ho S. o.
[(2-Hydroxyethyl)thio] Thiodiglycolic acid
acetic acid
0
II
[Biomass + CO 2 + $042- ]
H o ~ S ~ o H
Thiodiglycol sulfoxide
(b)
CI/~/S~ ~ CI/~/oH and Cl/~/SO2 H
2-Chloroethyl ethyl sulfide 2-Chloroethanol 2-Chloroethylsulfinicacid
Fig. 7. Metabolites formed in the biodegradation of the sulfur mustard analogues (a)
thiodiglycol [ 111 ] and (b) 2-chloroethyl ethyl sulfide [ 114]. Products in brackets were not
directly observed.
For the sulfur-mustard analogue TDG, both sulfur oxidation and terminal
carbon oxidation were observed in a bacterium using the compound as a carbon
source. These reactions were apparently independent and mutually exclusive
with the sulfoxide produced accumulating as a dead-end metabolite. Carbon-
sulfur bond cleavage was assumed to occur subsequent to terminal carbon
oxidation, but only in the absence of sulfur oxidation. Some fungal strains were
also able to degrade sulfur mustard analogues, although metabolites were not
identified. As with DMS, 2-chloroethyl ethyl sulfide was subject to sulfur-
specific degradation by a DBT-desulfurizing strain, demonstrating again that the
desulfurization enzymes may have a sufficiently broad substrate specificity to
allow attack on both thiophenes and aliphatic sulfides.
5. CONCLUSIONS
Acknowledgments.
The authors would like to thank Dr. P.M. Fedorak and Dr. J.D. Van
Hamme for access to and information on works in press. Funding was provided
by Alberta Energy Research Institute under the COURSE program and by the
Natural Sciences and Engineering Research Council of Canada.
REFERENCES
[25] C.L. Coyle, M. Siskin, D.T. Ferrughelli, M.S.P. Logan, and G. Zylstra, Biological
activation of aromatics for chemical processing and/or upgrading of aromatic
compounds, petroleum coal, resid, bitumen and other petrochemical streams, US Patent
No. 6 156 946 (2000).
[26] C. Vorbeck, H. Lenke, P. Fischer, and H.-J. Knackmuss, J. Bacteriol., 176 (1994) 932.
[27] C. Vorbeck, H. Lenke, P. Fischer, J.C. Spain, and H.-J. Knackmuss, Appl. Environ.
Microbiol., 64 (1998) 246.
[28] X. Zhang, E.R. Sullivan, and L.Y. Young, Biodegradation, 11 (2000) 117.
[29] X. Zhang and L.Y. Young, Appl. Environ. Microbiol., 63 (1997) 4759.
[30] A. Esteve-Nt~fiez, A. Caballero, and J.L. Ramos, Microbiol. Mol. Biol. Rev., 65 (2001)
335.
[31 ] C.E. French, S. Nicklin, and N.C. Bruce, Appl. Environ. Microbiol., 64 (1998) 2864.
[32] P.-G. Rieger, V. Sinnwell, A. Preuss, W. Francke, and H.-J. Knackmuss, J. Bacteriol.,
181 (1999) 1189.
[33] C. Behrend and K. Heesche-Wagner, Appl. Environ. Microbiol., 65 (1999) 1372.
[34] S. Ebert, P.-G. Rieger, and H.-J. Knackmuss, J. Bacteriol., 181 (1999) 2669.
[35] G. Heiss, K.W. Hofmann, N. Trachtmann, D.M. Walters, P. Rouvi6re, and H.-J.
Knackmuss, Microbiology, 148 (2002) 799.
[36] C.S. Harwood, G. Burchhardt, H. Herrmann, and G. Fuchs, FEMS Microbiol. Rev., 22
(1999) 439.
[37] R.M. Atlas and R. Bartha, Microbial Ecology: Fundamentals and Applications, 4th ed.,
Menlo Park, CA, 1998.
[38] R.M. Miller and R. Bartha, Appl. Environ. Microbiol., 55 (1989) 269.
[39] K.G. Kropp, I.A. Davidova, and J.M. Suflita, Appl. Environ. Microbiol., 66 (2000)
5393.
[40] J.D. Schumacher and R.M. Fakoussa, Appl. Microbiol. Biotechnol., 52 (1999) 85.
[41 ] J. Heider, A.M. Spormann, H.R. Beller, and F. Widdel, FEMS Microbiol. Rev., 22
(1999) 459.
[42] A.M. Spormann and F. Widdel, Biodegradation, 11 (2000) 85.
[43] F. Widdel and R. Rabus, Curr. Opin. Biotechnol., 12 (2001) 259.
[44] J.D. Van Hamme, A. Singh, and O.P. Ward, Microbiol. Mol. Biol. Rev., 67 (2003) 503.
[45] H. Wilkes, S. K~ihner, C. Bolm, T. Fischer, A. Classen, F. Widdel, and R. Rabus, Org.
Geochem., 34 (2003) 1313.
[46] R. Rabus, H. Wilkes, A. Behrends, A. Armstroff, T. Fischer, A.J. Pierik, and F. Widdel,
J. Bacteriol., 183 (2001) 1707.
[47] K. Koike, K. Ara, S. Adachi, H. Takigawa, H. Moil, S. Inoue, Y. Kimura, and S. Ito,
Appl. Environ. Microbiol., 65 (1999) 5636.
[48] A. Jenisch-Anton, A. Mikolajczak, A. Rabenstein, J. Klindworth, U. Fischer, and W.
Michaelis, Biodegradation, 10 (1999) 383.
[49] Q. Cheng, S.M. Thomas, and P. Rouvi6re, Appl. Microbiol. Biotechnol., 58 (2002) 704.
[50] K. Kostichka, S.M. Thomas, K.J. Gibson, V. Nagarajan, and Q. Cheng, J. Bacteriol.,
183 (2001) 6478.
[51 ] P.C. Brzostowicz, K.L. Gibson, S.M. Thomas, M.S. Blasko, and P. Rouvi6re, J.
Bacteriol., 182 (2000) 4241.
[52] P. Singh, A. Youyen, and H.S. Fogler, AIChE J., 47 (2001) 2111.
[53] J.R. Becker, Crude Oil Waxes, Emulsions, and Asphaltenes, Tulsa, OK, 1997.
[54] M.M. Santamaria and R.E. George, in the Proc. of the SPE Annual Technical
Conference & Exhibition, Dallas, TX, 1991, pp. 351-353.
141
[55] F.G. Brown, in the Proc. of the SPE Permian Basin Oil and Gas Recovery Conference,
Midland, TX, 1992, pp. 251-259.
[56] I. Lazar, A. Voicu, C. Nicolescu, D. Mucenica, S. Dobrota, I.G. Petrisor, M. Stefanescu,
and L. Sandulescu, J. Pet. Sci. Eng., 22 (1999) 161.
[57] D.P. Rimmer, A.A. Gregoli, J.A. Hamshar, and E. Yildirim, in L.L. Schramm (ed),
Emulsions: Fundamentals and Applications in the Petroleum Industry, Washington, DC,
1992, pp. 295-312.
[58] L.L. Schramm, in L.L. Schramm (ed), Emulsions: Fundamentals and Applications in the
Petroleum Industry, Washington, DC, 1992, pp. 1-49.
[59] R. Grace, in L.L. Schramm (ed), Emulsions: Fundamentals and Applications in the
Petroleum Industry, Washington, DC, 1992, pp. 313-339.
[60] L. Dorobantu, Stabilization of oil/water emulsions by hydrophobic bacteria, M.Sc.
thesis, University of Alberta, Edmonton, AB, 2004.
[61 ] R.J. Mikula, in L.L. Schramm (ed), Emulsions: Fundamentals and Applications in the
Petroleum Industry, Washington, DC, 1992, pp. 79-129.
[62] W.L. Cairns, D.G. Cooper, J.E. Zajic, J.M. Wood, and N. Kosaric, Appl. Environ.
Microbiol., 43 (1982) 362.
[63] M. Das, Bioresour. Technol., 79 (2001)
[64] Z. Duvnjak and N. Kosaric, Biotechnol. Lett., 9 (1987) 39.
[65] N.C.C. Gray, A.L. Stewart, W.L. Cairns, and N. Kosaric, Biotechnol. Lett., 6 (1984)
419.
[66] N.C.C. Gray, A.L. Stewart, W.L. Cairns, and N. Kosaric, in C. Ratledge, P. Dawson,
and J. Rattray (eds), Biotechnology for the Oils and Fats Industry, USA, 1984, pp. 255-
268.
[67] N. Nadarajah, A. Singh, and O.P. Ward, Process Biochem., 37 (2002) 1135.
[68] N. Nadarajah, A. Singh, and O.P. Ward, World J. Microbiol. Biotechnol., 18 (2002)
435.
[69] A.L. Stewart, N.C.C. Gray, W.L. Cairns, and N. Kosaric, Biotechnol. Lett., 5 (1983)
725.
[70] S.H. Park, J.-H. Lee, S.-H. Ko, D.-S. Lee, and H.K. Lee, Biotechnol. Lett., 22 (2000)
1389.
[71] K.L. Janiyani, H.J. Purohit, R. Shanker, and P. Khanna, World J. Microbiol.
Biotechnol., 10 (1994) 452.
[72] W.L. Cairns, R. Rumble, and N. Kosaric, in C. Ratledge, P. Dawson, and J. Rattray
(eds), Biotechnology for the Oils and Fats Industry, USA, 1984, pp. 223-239.
[73] O. Ward, A. Singh, and J. Van Hamme, J. Ind. Microbiol. Biotechnol., 30 (2003) 260.
[74] J.S. Clemente, N.G.N. Prasad, M.D. MacKinnon, and P.M. Fedorak, Chemosphere, 50
(2003) 1265.
[75] D.C. Herman, P.M. Fedorak, and J.W. Costerton, Can. J. Microbiol., 39 (1993) 576.
[76] E. Slavcheva, B. Shone, and A. Turnbull, Br. Corros. J., 34 (1999) 125.
[77] M.D. MacKinnon and H. Boerger, Water Poll. Res. J. Canada, 21 (1986) 496.
[78] D.C. Herman, P.M. Fedorak, M.D. MacKinnon, and J.W. Costerton, Can. J. Microbiol.,
40 (1994) 467.
[79] J.W.S. Lai, L.J. Pinto, E. Kiehlmann, L.I. Bendell-Young, and M.M. Moore, Environ.
Toxicol. Chem., 15 (1996) 1482.
[80] F.M. Holowenko, M.D. MacKinnon, and P.M. Fedorak, Water Res., 35 (2001) 2595.
[81] F.M. Holowenko, M.D. MacKinnon, and P.M. Fedorak, Water Res., 36 (2002) 2843.
[82] J.S. Clemente, T.-W. Yen, and P.M. Fedorak, J. Environ. Eng. Sci., 2 (2003) 177.
142
[83] J.S. Clemente, M.D. MacKinnon, and P.M. Fedorak, Environmental Science &
Technology, (in press)
[84] T. Wakabayashi, Fuel, 76 (1997) 1049.
[85] M.R. Riazi and T.E. Daubert, Oil Gas J., 85(52) (1987) 110.
[86] A. Wemer, F. Behar, J.C. de Hemptinne, and E. Behar, Fluid Phase Equilib., 147 (1998)
343.
[87] A. Wemer, J.C. de Hemptinne, F. Behar, E. Behar, and C. Boned, Fluid Phase Equilib.,
147 (1998) 319.
[88] P.J. Closmann and R.D. Seba, J. Can. Pet. Technol., 29(4) (1990) 115.
[89] J.D. Payzant, D.D. McIntyre, T.W. Mojelsky, M. Torres, D.S. Montgomery, and O.P.
Strausz, Org. Geochem., 14 (1989) 461.
[90] A.M. Cook and R. Htitter, Appl. Environ. Microbiol., 43 (1982) 781.
[91] D. Ztirrer, A.M. Cook, and T. Leisinger, Appl. Environ. Microbiol., 53 (1987) 1459.
[92] J.J. Kilbane, in D.L. Wise (ed), Bioprocessing and Biotreatment of Coal, New York,
NY, 1990, pp. 487-506.
[93] T.D. Sutherland, I. Home, M.J. Lacey, R.L. Harcourt, R.J. Russell, and J.G. Oakeshott,
Appl. Environ. Microbiol., 66 (2000) 2822.
[94] K.J. Kayser, B.A. Bielaga-Jones, K. Jackowski, O. Odusan, and J.J. Kilbane, J. Gen.
Microbiol., 139 (1993) 3123.
[95] T. Omori, L. Monna, Y. Saiki, and T. Kodama, Appl. Environ. Microbiol., 58 (1992)
911.
[96] T. Omori, Y. Saiki, K. Kasuga, and T. Kodama, Biosci. Biotechnol. Biochem., 59
(1995) 1195.
[97] Y. Izumi, T. Ohshiro, H. Ogino, Y. Hine, and M. Shimao, Appl. Environ. Microbiol., 60
(1994) 223.
[98] S.-K. Rhee, J.H. Chang, Y.K. Chang, and H.N. Chang, Appl. Environ. Microbiol., 64
(1998) 2327.
[99] J.H. Chang, S.-K. Rhee, Y.K. Chang, and H.N. Chang, Biotechnol. Progr., 14 (1998)
851.
[ 100]M. Kobayashi, T. Onaka, Y. Ishii, J. Konishi, M. Takaki, H. Okada, Y. Ohta, K.
Koizumi, and M. Suzuki, FEMS Microbiol. Lett., 187 (2000) 123.
[101]J. Konishi, Y. Ishii, T. Onaka, K. Okumura, and M. Suzuki, Appl. Environ. Microbiol.,
63 (1997) 3164.
[102]T. Furuya, K. Kirimura, K. Kino, and S. Usami, FEMS Microbiol. Lett., 204 (2001)
129.
[103]H.Y. Kim, T.S. Kim, and B.H. Kim, Biotechnol. Lett., 12 (1990) 761.
[104]J.D. Van Hamme, P.M. Fedorak, J.M. Foght, M.R. Gray, and H.D. Dettman, Appl.
Environ. Microbiol., (2004, in press)
[ 105]H. Fuse, O. Takimura, K. Murakami, Y. Yamaoka, and T. Omori, Appl. Environ.
Microbiol., 66 (2000) 5527.
[106]D.P. Kelly and N.A. Smith, Adv. Microb. Ecol., 11 (1990) 345.
[107]P.T. Visscher and B.F. Taylor, Appl. Environ. Microbiol., 59 (1993) 3784.
[108]P.T. Visscher and B.F. Taylor, Appl. Environ. Microbiol., 59 (1993) 4083.
[109]R.S. Oremland, M.J. Whiticar, F.E. Strohmaier, and R.P. Kiene, Geochim. Cosmochim.
Acta, 52 (1988) 1895.
[110]D.A. Irvine, J.P. Earley, D.P. Cassidy, and S.P. Harvey, Water Sci. Technol., 35 (1997)
67.
143
[ 111 ] T.-S. Lee, Biodegradation and Biotransformation of Thiodiglycol, the Main Hydrolysis
Product of Sulfur Mustard, Ph.D. thesis, University of Maryland, College Park, MD,
1998.
[112]V. Garcia-Ruiz, L.E. Martin-Otero, and A. Puyet, Biotechnol. Progr., 18 (2002) 252.
[113]N. Itoh, M. Yoshida, T. Miyamoto, H. Ichinose, H. Wariishi, and H. Tanaka, FEBS
Lett., 412 (1997) 281.
[114]J.J. Kilbane and K. Jackowski, J. Chem. Technol. Biotechnol., 65 (1996) 370.
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Elsevier B.V. All rights reserved. 145
Chapter 5
J. M. Foght
1. INTRODUCTION
This review discusses the potential for biological upgrading to improve the
quality of certain crude oils and liquid fuels, using whole cell biocatalysts to
decrease aromaticity and sensitize aromatic heterocycles to subsequent
heteroatom removal. Some specific examples of research directed towards future
applications are presented; however, much of this concept is hypothetical and
requires further research to prove its potential. This chapter presents information
about the aerobic bacteria currently being tested as aromatic ring opening
biocatalysts and speculates on the application of their activities to biological
petroleum upgrading ("bio-processing"). The review does not deal with
reactions achieved with biological desulfurization (BDS), nor with purified
enzymes. For treatments of those topics, see Chapters 2 and 3, respectively.
II
:omatic activat:onI' pro:e_~ss
B mixture of alkylaromatics,
monohydroxy aromatics
drogenation/hydrogenolysis
III
)
BioARC process
D COOH
hydrogenation
0
EO ~ H pyruvate
~ CHO
VI
~....~ furthermetabolism
Fig. 1. Classical "upper pathway" for phenanthrene ring cleavage (adapted from Refs. [7, 8])
showing stepwise oxidation and metabolites from the "aromatic activation" [6] and BioARC
[9] processes. Theoretical products after hydrogenation are indicated. Compounds: I,
phenanthrene; H, cis-3,4-dihydroxy-3,4-dihydrophenanthrene; III, 3,4-dihydroxyphen-
anthrene; IV, 2-hydroxy-2H-benzo[h]chromene-2-carboxylic acid; V, trans-4-(1-hydroxy-
naph-2-yl)-2-oxobut-3-enoic acid; VI, 1-hydroxy-2-naphthoaldehyde. Enzymatic steps: A;
aromatic dioxygenase; B, dihydrodiol dehydrogenase; C, extradiol dioxygenase; D,
isomerase; E, hydratase-aldolase.
148
NI
H
III
HO OH
~ ~ N ~NH2
IV
OH
Fig. 2. Classical angular attack on carbazole showing main pathway (adapted from Ref. [11 ])
and some minor products [12]. Compounds: I, carbazole; II, postulated intermediate; III, 2'-
aminobiphenyl-2,3-diol; W, 2-hydroxy-6-oxo-6-(2'aminophenyl)-hexa-2,4-dienoic acid; V,
2-hydroxypenta-2,4-dienoic acid; VI, anthranilic acid. Other metabolites selected from Ref.
150
[12].
Currently, aromatic bio-processing has focused on the di- and tricyclic
homologues in crude oil and middle distillate fuels (like diesel) for biological
reasons. The monoaromatics can present severe toxicity problems for biocatalyst
cells at quite low concentrations [13]. At the other extreme, aromatics larger
than three fused rings tend to be quite recalcitrant to biological treatment [ 1] and
therefore are unfavorable substrates for bio-processing. The chemical reason for
targeting di- and tricyclic aromatics is that conventional hydrotreatment yields
cycloalkanes which still have low fuel value compared with straight chain
alkanes; opening one or more aromatic rings to produce side-chain alkyl groups
should improve the fuel value of the products.
The alkyl-substituted homologues exhibit varying susceptibilities to
biological oxidation, with the general rule that increasing molecular weight and
substitution decrease susceptibility to biological attack (e.g., see Refs. [14, 15]
and discussion in Ref. [16] on alkyl substitution of dibenzothiophenes). A
practical biocatalyst must achieve ring opening of many or all of these
substituted aromatics in addition to the unsubstituted parent compounds (i.e.
have a broad aromatic substrate range), but not oxidize non-target hydrocarbons
in the feedstocks such as alkanes.
emulsions and ultimately the separation of the two liquid phases and the
biocatalyst. In fact, many of the same technical problems previously reported
with bench-scale and pilot-scale biodesulfurization processes will likely be
encountered with aromatic ring oxidation. Several types of reactors may be
suitable for petroleum biocatalysis (reviewed in Ref. [26]), with the choice
depending on process economics and product recovery considerations. Two
reactor types are described here: conventional stirred tank bioreactors and
electro-spray reactors.
For the BioARC process, and possibly also for bio-denitrogenation, problems of
separating and recovering the polar products from the aqueous phase must be
addressed, as well as their treatment after recovery (e.g. chemical hydrogenation
or further bio-processing to produce specialty chemicals).
Aromatic ring cleavage, as exploited in the BioARC process [17, 19], and
hydroxylation, as used in the patented "aromatic activation" process [6], require
multiple, sequential enzymatic steps and various co-factors such as NADH and
FMNH2. Whole cells are the most readily applicable biocatalysts to encompass
these requirements, rather than treatment with a series of pure enzymes.
Fortunately, there is a relatively long history of research into biodegradation of
aromatic hydrocarbons and heterocycles for purposes of bioremediation, which
can be tapped for relevant information. Bio-processing of oil can be seen as a
logical extension of natural biodegradation capabilities. The key difference is
that biodegradation aims to achieve complete oxidation of the substrate
(mineralization to CO2), whereas bio-processing should oxidize or cleave the
aromatics without carbon loss. This generally requires truncation or
modification of existing catabolic pathways through genetic manipulation
(Section 4).
Generally desirable attributes of aromatic bio-processing biocatalysts
include:
suspension;
. Tolerance towards any toxic effects of the feedstock or biocatalytic
products;
, Non-pathogenicity of the biocatalyst for safe handling and disposal;
10. The ability to scale up active biomass production to commercial scale
operations.
and peroxidases (e.g., [47, 48]), and may be suitable for the "aromatic
activation" process. However, fungi that accumulate quinones or trans-
dihydrodiol-PAHs without ring cleavage would not be suitable for the BioARC
process. This chapter does not consider the fungal enzymes, which are reviewed
in Chapter 3.
Table 1
Bacteria with broad aromatic substrate ranges for oxidizing di- and tri-cyclic aromatic
hydrocarbons and heterocycles. This table is not a comprehensive list, but rather an
indicator of the diversity of genera with potential for aromatic bio-processing.
Gram negative
Alcaligenes denitrificans WW 1 N, MeN, P, A [49]
Burkholderia sp. RP007 N,P,A [50]
Comamonas testosteroni N,P [51]
Cycloclasticus pugetii N,P,A [52]
Cycloclasticus sp. A5 N, P, F, D [53]
Neptunomonas naphthovorans NAG-2N- 113 N, MeN, P, Ac [54]
Pseudomonads
Pseudomonas putida G7 (NAH7) N, P, A reviewed in [7]
Pseudomonas fluorescens LP6a N, MeN, P, A, F, D [9, 55]
Pseudomonas resinovorans CA10 C, Df [56]
Ralstonia sp. RJGII. 123 C [57]
Sphingomonads
Sphingomonas paucimobilis EPA505 N, P, A [58, 59]
Sphingobium yanoikuyae B8/36 N, P, A, Ac, D, C [6]
Sphingomonas sp. ANT 17 N, MeN, P, F, D [60]
Novosphingobium aromaticivorans F199 MeN, P, Ac, F, D, [61, 62]
Xanthomonas ampellina C [63]
Gram positive
Bacillus sp. N, P, A [64]
Microbacterium esteraromaticus B21 P [65]
Mycobacterium sp. PYR-1 P, A [66]
Mycobacterium gilvum B 1 N,P [65]
Nocardioides sp. KP7 P [67]
Porphyrobacter sp. B51 P [65]
Rhodococcus sp. NCIMB 12038 N, Ie, Io [68]
Terrabacter (Staphylococcus auriculans) sp. F, Df [69]
DBF63
* N, naphthalene; Me-N, methylnaphthalenes; P, phenanthrene; A, anthracene; Ac,
acenaphthene; F, fluorene; D, dibenzothiophene; C, carbazole; Df, dibenzofuran; Ie,
indene; Io, indole.
158
Suitable new candidate biocatalysts surely exist and could be enriched and
isolated from suitable environments where natural selection processes favor
desirable catabolic phenotypes. Using conventional microbial methods,
enrichment can be facilitated by judicious application of additional selective
pressures in the laboratory, with subsequent genetic manipulation to remove
undesirable properties or add novel phenotypes. To identify a new potential
biocatalyst it may be adequate to screen the mixed community for the desired
genetic complement by DNA:DNA hybridization or PCR, followed by chemical
confirmation of catabolism. However, isolation of truly novel biocatalysts (i.e.,
those with little homology to known aromatic catabolism genes; Section 3.2)
requires classical microbiological selection and biochemical screening
techniques. Notably, Kilbane et al. [70] found that simple chemostat and shake-
flask enrichments of novel bacteria capable of selectively removing the N
heteroatom from quinoline were unsuccessful, and that repeated rounds of
enrichment and mutagenesis were required to select a strain with the desired
catabolic activity.
Functional analogues of the nah genes have been described, including the
ndo [75], dox [76] and pah [77] genes in Pseudomonas spp., phb genes in
Sphingomonas paucimobilis EPA505 [58], phn genes in Burkholderia sp. RP007
[50], phd genes in Comamonas testosteroni strains [51] and Nocardioides sp.
KP7 [67], nag genes in Ralstonia (Pseudomonas) sp. U2 [78], and nid genes in
Mycobacterium sp. PYR-1 [72]. Some of these operons are genetically
homologous to the nah genes (nah-like), whereas others are unconventional
(non-nah-like) in that their sequences and (or) gene arrangements differ from the
classical nab genes (see comprehensive review in Ref. [7]). For example, some
dox and ndo genes are virtually identical [76], whereas the phdA gene is only
60% homologous to other nab dioxygenase genes [67] and the phn genes not
only show little homology with archetypal ndo genes but are also organized
differently within the operon [50]. In the case of the sphingomonads (reviewed
in Ref. [59]), Sphingobium (Sphingomonas) yanoikuyae B1 and N.
aromaticivorans F 199 harbour aromatic catabolism genes that are only distantly
related to the well-studied pseudomonad PAH catabolic genes but appear to be
conserved among other sphingomonads. Lack of cross-hybridization and
sequence similarity among non-homologous PAH-degrading organisms [79, 80]
may hinder molecular screens to identify new, unconventional candidate
biocatalysts in the environment.
In some bacteria the catabolic gene organization is considerably more
complicated than the nah-like operons. For example, the chromosomal genes for
aromatic catabolism in several sphingomonads are disjointed and redundant
[59], possibly resulting from repeated lateral gene transfers [7]. Aromatic
catabolism in S. yanoikuyae B 1 involves six operons with convoluted pathways
for mono- and polycyclic aromatic catabolism [83]. Some catabolic operons are
flanked by insertion elements or associated with transposons [56, 84], forming
potentially mobile "catabolic cassettes". This could account for their apparent
lateral transfer and occurrence in diverse bacteria, but also has implications for
the genetic stability of some candidate biocatalysts. Repeated insertion into large
plasmids or the chromosome may also account for the presence of multiple
isofunctional enzymes; such redundancy may complicate efforts to engineer
mutants blocked at specific enzymatic steps (Section 4).
Much less has been published about Gram positive PAH-degrading
bacteria, such as Mycobacterium sp. PYR-1 which has both dioxygenase and
monooxygenase activity against PAH and an unusual gene order in the catabolic
operon [72]. The aromatic dioxygenase genes in this strain cluster
phylogenetically with other Gram positive dioxygenase genes, including
Rhodococcus and Nocardioides spp. [72], rather than the well-studied Gram
negative nah genes.
160
Fig. 3. A. Generalized operon organization for classical nah-like genes, adapted from Refs. [7,
71 ].The arrows indicate the direction of transcription, and shading indicates genes for related
enzymes. Aabcd encode the initial dioxygenase; B the dehydrogenase, C the extradiol
dioxygenase, D the isomerase, E the hydratase-aldolase, F the salicylaldehyde dehydrogenase.
Q is uncharacterized. "R" is the divergently transcribed regulatory gene described for P.
putida NAH7 [81 ]. G, H,/, N, L, J, and K comprise the lower pathway operon for salicylate
degradation, which may be separated from the upper operon by several kilobases. B~ Gene
organization of the Pseudomonas sp. LD-2 carbazole catabolic operon, adapted from Ref.
[82]. Genes for related enzyme subunits are indicated by shading, carA genes encode the
multi-subunit terminal oxygenase, carB the meta-cleavage enzyme, and carC the hydrolase.
unexpected, as these non-toxic compounds are carbon sources for the organism.
Why the organism would develop such an effiux system is unknown; it is
possible that the hydrocarbons are gratuitous substrates rather than primary
substrates for the pump. The effect of effiux on aromatic biocatalysis has not yet
been investigated in this organism or any other to date.
derivatives (steps A and B, Fig. 1). The second step is chemical dehydration at
high temperature (200 - 600~ in the presence of CO and absence of O2.
Notably, the chemical hydrogenation or hydrogenolysis treatment described in
the patent does not require prior separation of the aqueous and organic phases
(although the effect of the presence of biocatalyst cells is not addressed). This
treatment theoretically achieves ring cleavage and (or) removal of aromatic N
and S heteroatoms, yielding product streams with lower molecular weight and
decreased heteroatom content. Depending on the reaction conditions, chemical
hydrogenolysis of dihydroxybiphenyls yields phenols, alkyl-phenols,
monohydroxybiphenyls, methylated dihydroxybiphenyls, cyclohexyl- and
cyclopentylbenzenes, alkylbenzenes and dihydronaphthalenes, among other
products. However, no specific examples of heteroatom removal were described
in the patent, nor the efficiency of conversion given for the mixed substrates
present in authentic feedstocks.
Several bacterial strains were suggested to be suitable biocatalysts for the
process, including mutant strains of P. putida F blocked either at the
dehydrogenation step (Step B, Fig. 1) so that cis-dihydrodiols accumulate, or at
the catechol dioxygenase step (Step C, Fig. 1) so that 1,2-dihydroxy compounds
accumulate. Alternatively, dioxygenase genes from strains of Pseudomonas
spp., C. testosteroni or S. yanoikuyae are proposed as sources of genes for
creating recombinant biocatalysts by cloning.
5.3. Bio-denitrogenation
Several species of nitrogen heterocycles are found in petroleum, including
the predominant "non-basic" carbazoles, pyrroles, and indoles, and the "basic"
quinolines and pyridines. Two general modes of attack on these nitrogen
heterocycles are recognized (reviewed in Ref. [2]). Quinolines are sequentially
mono-oxygenated to yield hydroxyquinolines, with subsequent N removal and
further oxidation. Carbazole, however, undergoes an unusual "angular
dioxygenation" at the 1,9 position [ 112, 113 ], generating 2'-aminobiphenyl-2,3-
diol, followed by a ring-opened meta-cleavage metabolite and finally anthranilic
acid (Fig. 2), with side-reactions generating additional minor products [12, 57].
The extensive metabolism required to remove the nitrogen heteroatom from
these metabolites would also remove carbon, thus reducing fuel value unless the
metabolites could be recovered for separate processing.
One approach to circumvent this carbon loss would be to block the
angular attack pathway after ring cleavage but before carbon loss, to generate an
aromatic metabolite with a free amine group (Compounds III or IV, Fig. 2), then
hydrogenating this "sensitized" molecule under mild conditions to specifically
remove the nitrogen. Genes encoding the angular attack enzymes have been
cloned, sequenced, and characterized [56, 114, 115], facilitating future genetic
manipulation by analogy with other aromatic-oxidizing systems, and as
169
described in Section 4.1, Riddle et al. [82] deleted genes from the carbazole
operon to achieve metabolite accumulation.
~' i 591
r~
,,o.
:lo-
zo
|o-
i/ll
%;- 1ooo loco
............... ~oo:o
'~ " "
i
,o~.,
30 ~
I i I | " * " ~J'l"
,
""
,,
,oi 11, III ....
, ::]Scan596 ~ . Os,,cH0,__M'.,~
] 1/6070 ~. ~H
I 201
io
~ t i ,6....09 /
:/4'1
:'9:'6
.~ ]20s
/ oo s~o;*" ,~o ,.~o ~oo ~so 3oo .o Mr,.
MIz
6. CONCLUSIONS
quality at lower capital and operating costs and with reduced environmental
impact. However, the reality awaits further research.
Acknowledgments.
The author acknowledges the financial support of ChevronTexaco (USA),
the National Centre for Upgrading Technology (Canada) and N S E R C (Canada)
in developing the BioARC process, and R. Shong, H. Dettman, M. Gray, and K.
Kirkwood for helpful suggestions on the manuscript.
REFERENCES
[26] B.L. McFarland, D.J. Boron, W. Deever, J.A. Meyer, A.R. Johnson and R.M. Atlas,
Crit. Rev. Microbiol., 24 (1998) 99.
[27] E. Deziel, Y. Comeau and R. Villemur, Biodegradation, 10 (1999) 219.
[28] J. Marcoux, E. Deziel, R. Villemur, F. Lepine, J.-G. Bisaillon and R. Beaudet, J. Appl.
Microbiol., 88 (2000) 655.
[29] A.J. Daugulis, TIBTech., 19 (2001) 457.
[30] L.-Q. Yu, T.A. Meyer and B.R. Folsom, Oil/Water/Biocatalyst Three Phase Separation
Process. US Patent No. 5 772 901 (1998).
[31] E.N. Kaufman, J.B. Harkins, M. Rodriguez, C. Tsouris, P.T. Selvaraz and S.E. Murphy,
Fuel Processing Technol., 52 (1997) 127.
[32] C. Tsouris, A.P. Borole, E.N. Kaufman and D.W. DePaoli, Ind. Eng. Chem. Res., 38
(1999) 1877.
[33] E.N. Kaufman, J.B. Harkins and A.P. Borole, Appl. Biochem. Biotechnol., 73 (1998)
127.
[34] M.A. Heitkamp and W.P. Stewart, Appl. Environ. Microbiol., 62 (1996) 4659.
[35] M. Naito, T. Kawamoto, K. Fujino, M. Kobayashi, K. Maruhashi and A. Tanaka, Appl.
Microbiol. Biotechnol., 55 (2001) 374.
[36] D.Z. Contreras, J.R. Garcia, A.L. Perez and L.F. Linares, Proc. 2nd Intl. Cone Petrol.
Biotechnol., (2003) Paper BRC-013.
[37] R. Munoz, B. Guieysse and B. Mattiasson, Appl. Micro Biotech., 61 (2003) 261.
[38] A.J. Daugulis and C.M. McCracken, Biotechnol. Lett., 25 (2003) 1441.
[39] M.R. Fries, J. Zhou, J. Chee-Sanford and J.M. Tiedje, Appl. Environ. Microbiol., 60
(1994) 2802.
[40] K.J. Rockne, J.C. Chee-Sanford, R.A. Sanford, B.P. Hedlund, J.T. Staley and S.E.
Strand, Appl. Environ. Microbiol., 66 (2000) 1595.
[41] X. Zhang and L.Y. Young, Appl. Environ. Microbiol., 63 (1997) 4759.
[42] A. Schmid, A. Kollmer, B. Sonnleitner and B. Witholt, Bioprocess Engineer., 20 (1999)
91.
[43] J.D. Van Hamme, A. Singh and O.P. Ward, Microbiol. Mol. Biol. Rev., 67 (2003) 503.
[44] L.P. Wackett, Nature Biotechnol., 21 (2003) 136.
[45] D.J. Monticello, Curr. Opinion Biotechnol., 11 (2000) 540.
[46] L. Dorobantu, M.Sc. thesis, University of Alberta, Edmonton, AB, 2004.
[47] M.A. Pickard, R. Roman, R. Tinoco and R. Vazquez-Duhalt, Appl. Environ. Microbiol.,
65 (1999) 3805.
[48] Y. Wang, R. Vazquez-Duhalt and M.A. Pickard, Can. J. Microbiol., 49 (2003) 675.
[49] W.D. Weissenfels, M. Beyer, J. Klein and H.J. Rehm, Appl. Microbiol. Biotechnol., 34
(1991) 528.
[50] A.D. Laurie and G. Lloyd-Jones, J. Bacteriol., 181 (1999) 531.
[51] A.K. Goyal and G.J. Zylstra, Appl. Environ. Microbiol., 62 (1996) 230.
[52] S.E. Dyksterhouse, J.P. Gray, R.P. Herwig, J. C. Lara and J.T. Staley, Int. J. Syst.
Bacteriol., 45 (1995) 116.
[53] Y. Kasai, K. Shindo, S. Harayama and N. Misawa, Appl. Environ. Microbiol., 69
(2003) 6688.
[54] B.P. Hedlund, A.D. Geiselbrecht, T.J. Bair and J.T. Staley, Appl. Environ. Microbiol.,
65 (1999) 251.
[55] J.M. Foght and D.W.S. Westlake, Biodegradation, 7 (1996) 353.
[56] K. Maeda, H. Nojiri, M. Shintani, T. Yoshida, H. Habe and T. Omori, J. Mol. Biol., 326
(2003) 21.
174
Chapter 6
1. INTRODUCTION
CH4 + 02 + 2H + + 2 e - --> C H 3 O H + H 2 0
Thus, MMOs activate the kinetically inert 02 molecule to react at 30-45 °C, 1
atmosphere pressure with the unreactive hydrocarbon methane (C-H bond
e n e r g y - 119 kcal mol -~) to produce methanol with stoichiometric yield and
high turnover (up to 6.0 s-~ [1]). In addition to this important transformation,
they also catalyse the oxygenation of a diversity of adventitious substrates,
including numerous petroleum constituents and by-products, which have led to
intense interest in their exploitation for biocatalyis and bioremediation. In this
chapter, we review the biological distribution of MMOs, their structural and
catalytic properties and then discuss their applications and potential for
transformation of petroleum-related products. Lastly, we discuss how MMOs
may inspire the synthesis of biomimetic catalysts to facilitate methane to
methanol conversion and other commercially important transformations.
178
MMOs have been found only in methanotrophic bacteria, which are Gram-
negative organisms that group within the a - and y-proteobacteria and can utilise
methane as their sole source of carbon and energy. Methanotrophic bacteria, and
therefore the MMOs that they produce, are widespread in the environment; they
are found in mesophilic and extreme (e.g. as low as 4 ~ [2] and up to 72 ~ [3])
conditions and are estimated to be responsible for oxidation of up to 60 % of the
1188 Tg of methane produced globally each year by natural and anthropogenic
sources [4].
Two forms of MMO are known, particulate (pMMO) and soluble
(sMMO). Many methanotrophs, such as Methylomicrobium album BG8 and
Methylomonas methanica, produce only the membrane-associated pMMO.
Others, such as Methylococcus capsulatus (Bath) and Methylosinus
trichosporium OB3b can elaborate either form [5], dependent on the copper-to-
biomass ratio of the culture. Such organisms produce the copper-containing
pMMO at high copper-to-biomass ratios and the nonheme iron-containing
sMMO at low copper-to-biomass ratios [6]. It is relatively straightforward,
during cultivation in laboratory- or industrial-scale bioreactors, to control the
medium copper concentration and culture density to obtain either form of MMO.
An easy colorimetric test, based on the oxidation of naphthalene [7], which is a
substrate of sMMO alone, allows rapid confirmation of the form of MMO that
the culture is expressing.
Although sMMO and pMMO both oxygenate methane to methanol, they
show no similarity in the amino-acid sequences of their protein components,
their requirements for metal cofactors or their location within the cell. They also
differ markedly in their substrate profiles and requirements for electron donors.
It is remarkable that the particulate and soluble MMOs represent evolutionarily
unrelated molecular solutions to a single chemical problem that are frequently
found in the same bacterial cells.
3. SOLUBLE METHANE M O N O O X Y G E N A S E
although in many cases almost indistinguishable results have been obtained with
the Ms. trichosporium system.
3.1. s M M O structure
sMMO comprises three components (Fig. 1): (1) a hydroxylase with an
((z[37)2 structure in which the (z, 13 and ~/subunits have masses of 61, 45 and 20
kDa, respectively; (2) a 39-kDa NAD(P)H-dependent reductase; (3) a third
component known as protein B or the coupling/gating protein, which comprises
a single polypeptide of 16 kDa [8]. The (z subunits of the hydroxylase each
contain a g-(hydr)oxo-bridged binuclear iron site [ 10-12] that is coordinated by
four glutamate and three histidine sidechains and is the site of 02 activation. X-
ray crystallography of the hydroxylases from Mc. capsulatus (PDB accession
codes 1MMO, 1MTY) and Ms. trichosporium (1MHY, 1MHZ) has shown that
the hydroxylase is a predominantly (z-helical structure in which the binuclear
iron centres reside within the c~ subunits, in a hydrophobic pocket that is almost
certainly critical in binding substrates [13-15]. Indeed, energy minimisation
calculations have suggested that the most favourable binding site for methane
and other small substrates lies inside this pocket, within 3 A of the binuclear
iron centre (Fig. 2) [16].
The reductase component, which is required for the supply electrons from
NADH or NADPH, contains flavin adenine dinucleotide (FAD) and Fe2S2
prosthetic groups. Protein B has no prosthetic groups. NMR structural analysis
(PDB accession codes 1CKV [17] and 2MOB [ 18]) has shown that it has a core
tx/13 structure with highly mobile regions at the N- and C-termini.
Fig. 1. Components of sMMO. The individual polypeptides of the enzyme are named
according to the genes that encode them [9].
180
Fig. 2. Active site structure of sMMO based on crystallographic data in Ref. [14]. The iron
atoms are shown as large grey spheres and the residues that ligate them as a grey ball-and-
stick representation. The residues forming the hydrophobic active site pocket [ 16] are shown
in white and two solvent molecules that bridge the dinuclear iron site in black.
XC~ ..
2e- I y O ~
. /~
/ O\ ~ Fen Fe n
Fern FeIn H red Noncovalent
ROH I g ~ H Ox enzyme-O~
complex
O
/ON
Fe IIl
ROH
" Fe lIl T
P* 1
Fe m Fem
~0._0 /
RH
Few
ON,~-iv ~. Fem Fem
,or
He0 H+
Fig. 3. Principal intermediates during the sMMO catalytic cycle. References are given in the text.
sMMO; they are probably oxidised to highly reactive ketenes which then attack
catalytically essential groups on the enzyme [33].
Table 1
Principal oxidation reactions catalysed by sMMO
Substrate Major detected product(s); relative Specific activity Reference
molar proportions of multiple (nmol of product (type of
products are shown in parentheses. min -1 mg-1) 1 assay) 2
Alkanes
Methane Methanol 84 32 (SE)
Ethane Ethanol 68 32 (SE)
Propane Propan- 1-ol (39); propan-2-ol (61) 69 32 (SE)
Butane Butan-l-ol (54); butan-2-ol (46) 77 32 (SE)
Pentane Pentan-l-ol (28); pentan-2-ol (72) 73 32 (SE)
Hexane Hexan-l-ol (63); hexan-2-ol (37) 40 32 (SE)
Heptane Heptan-l-ol (22); heptan-2-ol (78) 27 32 (SE)
Octane Octan-l-ol (9); octan-2-ol (91) 9 32 (SE)
2-Methylpropane 2-Methylpropan-2-ol (70); 2- 33 26 (PP)
methylpropan- 1-ol (30)
2-Methylpropane 2-Methylpropan-2-ol (70); 2- 33 26 (PP)
methylpropan- 1-ol (30)
2,3-Dimethylpentane 3,4-Dimethylpentan-2-ol 20 26 (PP)
Alkenes
Ethene Epoxyethane 148 32 (SE)
Propene Epoxypropane 83 32 (SE)
But- 1-ene 1,2-Epoxybutane 49 32 (SE)
cis-But-2-ene cis-2,3-Epoxybutane (47); cis-2- 33 26 (PP)
buten-l-ol (53)
trans-But-2-ene trans-2,3-Epoxybutane (27); trans-2- 39 26 (PP)
buten-l-ol (73)
Alicyclic hydrocarbons
Cyclohexane 3 Cyclohexanol 25 34 (SE)
Methylene 1-Cyclohexane- 1-methanol (13.7); 26 (PP)
cyclohexane methylene cyclohexane oxide (75.8);
4-hydroxymethylene cyclohexane
(lo.5)
[3-Pinene 6,6-Dimethylbicyclo[3.1.1 ]hept-2- 26 (PP)
ene-2-methanol (72.3); [3-pinene
oxide.
Adamantane 1-Adamantol (50); 2-adamantol (50) 3 26 (PP)
cis-l,4-Dimethyl 1-cis-4-Dimethylcyclohexanol (35); 1.3 26 (PP)
cyclohexane 1-trans-4-dimethylcyclohexanol (61);
cis-2,5-dimethylcyclohexanol (4)
cis-l,3-Dimethyl 3,5-Dimethylcyclohexanol (80); 1- 0.5 26 (PP)
cyclohexane cis-3-dimethylcyclohexanol (14); 1-
trans-3-dimethylcyclohexanol (6);
Halogenated aliphatics
Vinyl chloride 3 748 31 (PP)
Trichloroethene 3 Formate (35); CO (53); glyoxylate 682 31 (PP)
(5); dichloroacetate (5); chloral (6)
185
mechanism of C-H bond breakage rather than one involving radical or cation
intermediates [51 ].
5. M E T H A N E M O N O O X Y G E N A S E IN B I O C A T A L Y I S
Table 2
Principal oxidation reactions catalysed by pMMO
Substrate Product(s); relative molar proportions of multiple Reference
products are shown in parentheses.
Alkanes
Methane Methanol
Ethane Ethanol 52
Propane Propan-2-ol (ca. 100); propan-l-ol (trace) 52
Butane Butan-2-ol (95); butan-l-ol (5) 52
Pentane Pentan-2-ol (95); pentan-l-ol (5) 52
Alkenes
Propene Epoxypropane 52
But-l-ene 1,2-Epoxybutane (58); but-3-en-2-ol (42) 52
1,3-Butadiene 1,2-Epoxybut-3-ene 52
cis-But-2-ene 2,3-cis-Epoxybutane 52
trans-But-2-ene 2,3-trans-Epoxybutane 52
Chlorinated aliphatics
Trichloroethene 1 Carbon dioxide 54
~sMMO of Ms. trichosporium OB3b; other entries refer to Mc. capsulatus (Bath).
189
6. M E T H A N E M O N O O X Y G E N A S E BIOMIMETICS
7. FUTURE PROSPECTS
The unusual reactivity and broad substrate profiles of MMOs suggest many
possible applications in synthetic chemistry and bioremediation for the enzymes
and biomimetics based on them. Our recent development of a system for site-
directed mutagenesis of the soluble enzyme [64] opens the way for fine-tuning
of the catalytic versatility of sMMO for more precise and profitable
biotransformations than are possible with the wild-type enzyme. Coupled with
the sequencing of the Mc. capsulatus genome, which is currently being
undertaken by the University of Bergen and The Institute for Genomic Research,
genetic technology may shortly enable metabolic engineering of novel pathways
incorporating engineered methane monooxygenases for the synthesis of valuable
pharmaceuticals and other products using methane and other inexpensive
starting materials.
Acknowledgements
We gratefully acknowledge research funding from the Biotechnology and Biological
Sciences Research Council (UK), British Gas (UK), British Petroleum (UK), Idemitsu (Japan)
and the Gas Research Institute (GRI) (Chicago, IL).
REFERENCES
[1] B.G. Fox, W.A. Froland, J.E. Dege and J.D. Lipscomb, J. Biol. Chem., 264 (1989)
10023.
[2] J.P. Bowman, S.A. McCammon and J.H. Skerratt, Microbiology, 143 (1997) 1451.
[3] L. Bodrossy, K.L. Kovfics, I.R. McDonald and J.C. Murrell, FEMS Microbiol. Lett., 170
(1999) 335.
[4] W.S. Reeburgh, S. C. Whalen and M. J. Alperin, in J.C. Murrell and D.P. Kelly (eds.),
Microbial growth on C1 compounds, Intercept, Andover UK, 1993, pp. 1-14.
[s] R.S. Hanson and T.E. Hanson, Microbiol. Rev., 60 (1996) 439.
[6] S.H. Stanley, S.D. Prior, D.J. Leak and H. Dalton, Biotechnol. Lett., 5 (1983) 487.
[7] G.A. Brusseau, H.-C. Tsien, R.S. Hanson and L.P. Wackett, Biodegradation, 1 (1990)
19.
[8] J. Colby and H. Dalton, Biochem. J., 171 (1978) 461.
[91 A.C. Stainthorpe, V. Lees, G.P. Salmond, H. Dalton and J.C. Murrell, Gene, 91 (1990)
27.
[10] M.P. Woodland, D.S. Patil, R. Cammack and H. Dalton, Biochim. Biophys. Acta, 873
(1986) 237.
[ 11 ] A. Ericson, B. Hedman, K.O. Hodgson, J. Green and H. Dalton, J. Am. Chem.
Soc. 110 (1988) 2330.
[ 12] J.G. DeWitt, J.G. Bentsen, A.C. Rosenzweig, B. Hedman, J. Green, S. Pilkington, G.C.
Papaefthymiou, H. Dalton, K.O. Hodgson and S.J. Lippard, J. Am. Chem. Soc., 113
(1991)9219.
[13] A.C. Rosenzweig, C.A. Frederick, S.J. Lippard and P. Nordlund, Nature, 366 (1993)
537.
191
[ 14] A.C. Rosenzweig, H. Brandstetter, D.A. Whittington, P. Nordlund, S.J. Lippard and
C.A. Frederick, Proteins, 29 (1997) 141.
[ 15] N. Elango, R. Radhakrishnan, W.A. Froland, B.J. Wallar, C.A. Earhart, J.D. Lipscomb
and D.H. Ohlendorf, Protein Sci., 6 (1997) 556.
[16] A.R. George, P. C. Wilkins and H. Dalton, J. Molec. Catal. B, 2 (1996) 103.
[17] K.J. Walters, G.T. Gassner, S.J. Lippard and G. Wagner, Proc.Natl.Acad.Sci.USA, 96
(1999) 7877.
[18] S.L. Chang, P.J. Wallar, J.D. Lipscomb and K.H. Mayo, Biochemistry, 38 (1999) 5799.
[19] J. Lund and H. Dalton, Eur. J. Biochem., 147 (1985) 291.
[20] K.E. Liu, A.M. Valentine, D. Wang, B.A. Salifoglou and S.J. Lippard, J. Am. Chem.
Soc., 117 (1995) 10174.
[21] B. Brazeau and J.D. Lipscomb, Biochemistry, 39 (2000) 13503.
[22] L. Shu, J.C. Nesheim, K. Kauffmann, E. Mtinck, J.D. Lipscomb and L. Que Jr., Science,
275 (1997) 515.
[23] A.M. Valentine, S.S. Stahl and S.J. Lippard, J. Am. Chem. Soc., 121 (1999) 3876.
[24] S.-K. Lee, J.C. Nesheim and J.D. Lipscomb, J. Biol. Chem., 268 (1993) 21569.
[25] B.J. Brazeau, B.J. Wallar and J.D. Lipscomb, J. Am. Chem. Soc., 123 (2001) 10421.
[26] J. Green and H. Dalton, J. Biol. Chem., 264 (1989) 17698.
[27] K. Yoshizawa, T. Yamabe and R. Hoffmann, New J. Chem., 21 (1997) 151.
[28] Y. Jin and J.D. Lipscomb, Biochim. Biophys. Acta, 1543 (2000) 47.
[29] M.H. Baik, M. Newcomb, R.A. Friesner and S.J. Lippard, Chem. Rev., 103 (2003)
2385.
[30] R.J. Deeth and H. Dalton, J. Biol. Inorg. Chem., 3 (1998) 302.
[31] B.G. Fox, J.L. Boumeman, L.P. Wackett and J.D. Lipscomb, Biochemistry, 29 (1990)
6419.
[32] J. Colby, D.I. Stirling and H. Dalton, Biochem. J., 165 (1977) 395.
[33] S.D. Prior and H. Dalton, J. Gen. Microbiol., 131 (1985) 155.
[34] K.J. Burrows, A. Cornish, D. Scott and I.J. Higgins, J. Gen. Microbiol., 130 (1984)
3327.
[35] A.S. Lindner, P. Adriaens and J.D. Semrau, Arch. Microbiol., 174 (2000) 35.
[36] H.-H.T. Nguyen, K.H. Nakagawa, B. Hedman, S.J. Elliott, J.H. Yip, S.J. Jacobs, B.J.
Hales, M.E. Lidstrom and S.I. Chan, J. Biol. Chem., 269 (1994) 14995.
[37] D.D.S. Smith and H. Dalton, Eur. J. Biochem., 182 (1989) 667.
[38] A.K. Shiemke, S.A. Cook, T. Miley and P. Singleton, Arch. Biochem. Biophys., 321
(1995) 421.
[39] J.A. Zahn and A.A. DiSpirito, J. Bacteriol., 178 (1996) 1018.
[40] H.-H.T. Nguyen, S.J. Elliott, J.H.-K. Yip and S.I. Chan, J. Biol. Chem., 273 (1998)
7957.
[41] P. Basu, B. Katterle, K.K. Andersson and H. Dalton, Biochem. J., 369 (2003) 417.
[42] R.L. Lieberman, D.B. Shrestha, P.E. Doan, B.M. Hoffman, T.L. Stemmler and A.C.
Rosenzweig, Proc. Natl. Acad. Sci. USA, 100 (2003) 3820.
[43] D.-W. Choi, R.C. Kunz, E.S. Boyd, J.D. Semrau, W.E. Antholine, J.-I. Han, J.A. Zahn,
J.M. Boyd, A.M. de la Mora and A.A. DiSpirito, J. Bacteriol., 185 (2003) 5755.
[44] S. Stolyar, A.M. Costello, T.L. Peeples and M.E. Lidstrom, Microbiology, 145 (1999)
1235.
[45] B. Gilbert, I.R. McDonald, R. Finch, G.P. Stafford, A.K. Nielsen and J.C. Murrell,
Appl. Environ. Microbiol., 66 (2000) 966.
[46] A.K. Nielsen, K. Gerdes and J.C. Murrell, Molec. Microbiol., 25 (1997) 399.
[47] S. Stolyar, M. Franke and M.E. Lidstrom, J. Bacteriol., 183 (2001) 1810.
192
[48] A.A. DiSpirito, J.A. Zahn, D.W. Graham, H.J. Kim, C.K. Lerive, T.S. Derrick, C.D.
Cox and A. Taylor, J. Bacteriol., 180 (1998) 3606.
[49] H.-H.T. Nguyen, A.K. Shiemke, S.J. Jacobs, B.J. Hales, M.E. Lidstrom, K.O. Hodgson
and S.I. Chan, J. Am. Chem. Soc., 118 (1996) 12766.
[50] S.A. Cook and A.K. Shiemke, Arch. Biochem. Biophys., 398 (2002) 32.
[51 ] S.S.-F. Yu, L.-Y. Wu, K.H.-C. Chen, I.I. Luo, D.-S. Huang and S.I. Chan, J. Biol.
Chem., 278 (2003) 40658.
[52] S.J. Elliott, M. Zhu, L. Tso, H.-H.T. Nguyen, J.H.-K. Yip and S.I. Chan, J. Am. Chem.
Soc., 119 (1997) 9949.
[53] S. Lontoh, A.A. DiSpirito, C.L. Krema, M.R. Whittaker, A.B. Hooper and J.D. Semrau,
Environ. Microbiol., 2 (2000) 485.
[54] S. Lontoh, J.A. Zahn, A.A. DiSpirito and J.D. Semrau, FEMS Microbiol. Lett., 186
(2000) 109-113.
[55] A.O. Richards, S.H. Stanley, M. Suzuki and H. Dalton, Biocatalysis, 8 (1994) 253.
[56] S.H. Stanley, A.O. Richards, M. Suzuki and H. Dalton, Biocatalysis, 6 (1992) 177.
[57] M. Suzuki, H. Dalton, A.O. Richards and S.H. Stanley, Canadian patent # 1,322,734.
(1993).
[58] S. Slade, T.J. Smith and H. Dalton, unpublished observations.
[59] P.W. Baker, H. Futamata, S. Harayama and K. Watanabe, 38 (2001) 87.
[60] M.C. White, A.G. Doyle and E.N. Jacobsen, J. Am. Chem. Soc., 123 (2001) 7194.
[61] D. Lee and S.J. Lippard, J. Am. Chem. Sot., 123 (2001) 4611.
[62] E.Y. Tshuva, D. Lee, W. Bu and S.J. Lippard, J. Am. Chem. Soc., 124 (2002) 2416.
[63] P.-P.J.H.M. Knops-Gerits and W.P. Goddard, Catal. Today, 81 (2003) 263.
[64] T.J. Smith, S.E. Slade, N.P. Burton, J.C. Murrell and H. Dalton, Appl. Environ.
Microbiol., 68 (2002) 5265.
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Published by Elsevier B.V. 193
Chapter 7
Biocorrosion
1. INTRODUCTION
thick), due to the deposition of inorganic ions and high relative molecular mass
organic compounds, is formed in a first stage. This initial film is able to alter the
electrostatic charges and wettability of the metal surface facilitating its further
colonization by bacteria. In a short time, (minutes or hours according to the
aqueous environment where the metal is immersed), microbial growth and EPS
production results in the development of a biofilm. This biofilm is a dynamic
system and the different transport processes and chemical reactions occurring at
the biofouled interface will take place from now on, through the biofilm
thickness [6] (Fig. 1).
Microbial colonization of metal surfaces drastically changes the classical
concept of the electrical interface commonly used in inorganic corrosion.
Important changes in the type and concentration of ions, pH values and
oxidation-reduction potential are induced by the biofilm, altering the passive or
active behavior of the metallic substratum and its corrosion products, as well as
the electrochemical parameters used for assessing corrosion rates [7].
Simultaneously with the biological changes that lead to biofilm
accumulation, a sequence of inorganic changes takes place at the metal surface
immediately after its immersion in an aggressive aqueous medium. This
sequence involves the process of metal dissolution and corrosion product
formation.
SUBSTRATE _ -.~
.... o o..
DEATHI
\ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \
Both biological and inorganic processes occur within the same time
period, but following opposite directions at the metal/solution interface.
Whereas corrosion and corrosion product accumulation occur from the metal
surface towards the solution, biofilm formation is the result of accumulation
processes directed from the bulk towards the metal surface (Fig. 2) [8]).
Thus, a very active interaction between the corrosion product layers and
the biofilms can be expected. The consequent corrosion behavior of the metal
will vary according to the degree of this reciprocal interaction and a concept of a
new biologically conditioned interface must be kept in mind [9]. The approach
for a sound interpretation of any microbial corrosion case must then be
interdisciplinary, and include a thorough process analysis combined with well
defined microbiological and electrochemical methodologies.
Biocorrosion has been focusing increasing attention from different
research areas in the last two decades as an answer to the demand of a wide
variety of industries. Fortunately an increasing intellectual and technical cross-
fertilization of ideas between researchers from different disciplines like
microbiology, electrochemistry and materials science has allowed a considerable
improvement in the understanding of biocorrosion to be reached.
with the cathodic depolarization theory (CDT) of von Wolzogen Kuhr & Van
der Vlugt [10] (Fig. 3), a copious list of papers and reviews on the anaerobic
corrosion of iron has been published [11-13]. Bacterial biofilms may develop
anaerobic regions, even in aerobic bulk water environments [2], thus allowing
SRB a very favorable environment for growth. The final result of these
processes within biofilms is to produce a wide variety of sites on the metal
surface that are markedly different from neighboring sites from a
physicochemical standpoint, thus facilitating the initiation of localized corrosion
processes.
Fig. 3. Sequence of reactions of the Cathodic Depolarization Theory. The three elements of
biocorrosion (metal/solution/microorganisms) are involved in different reactions of the whole
process.
Fig. 5. AFM image of a SRB biofilm on AISI 316 SS (from Ref. [21]).
Fig. 6. XPS spectra of a biogenic sulfide film (top) and of an abiotic sulfide film (bottom)
(from Ref. [23]).
r "" 1.6
E
o
Plates imbedded
-~ 1.2
9-- 1.0
o 0.8
o
'~
o 0.6
o
0.4
o
ct0
o 0.2
0
0 100 200 300 400 500 600
Time (Days)
Fig. 7. Hydrogen permeation through 50D steel, cathodically protected or unprotected and
coated or uncoated, exposed to open seawater and embedded in marine mud. 1 = Grit blasted
plus cathodic protection. 2 = CTE coating plus cathodic protection. 3 -- anti-fouling paint. 4 -
grit basted only. 5 - As received (with mill scale, uncoated) (from Ref. [29]).
bacteria and the metal). Indeed, the local environment surrounding the metal
surface is very different from that without bacteria, even if the same levels of
sulfide are detectable.
These areas are particularly important, as pipelines and the bottoms of the
legs of offshore platforms can be buried in marine muds where anaerobic
conditions are predominant and SRB activity is intense (Fig. 8). Moreover, sour
environments, such as those frequently found in oil production activities, are
particularly aggressive due to high levels of hydrogen available at the metal
surface or in a crack, as a consequence of sulfide poisoning of the recombination
reaction at the cathode [31 ]. In such habitats hydrogen effects can be altered by
the presence of organic molecules on the metal surface and the existence of a
biofilm with its EPS matrix. This feature can explain the differences between
general embrittlement effects (as measured by hydrogen flux) and crak tip
effects (as measured by crack growth). Embrittlement results in the general
lowering of strength of the material causing it to fail in a catastrophic way at a
lower load as it has been reported in high sulfide biological environments more
than in low sulfide abiotic environments, even though the rest of the crack
growth curve is very similar (Fig. 9) [28].
EPS and other organic molecules related to biofilms hinder dissolution
and dissociation reactions and adsorption processes in the crack. Even under low
frequency cyclic loading the crack tip opens and closes rapidly. Thus, any effect
of the environment must occur fast and organic material dragged into the crack
could have a blocking impact.
The results referred here serve to illustrate the complex nature of the
interactions between SRB biofilm and the steel. In many cases, bacterial
metabolism within the biofilm generates sulfides, and consequently, this is the
main cause of the corrosiveness of the environment. However, microbial
metabolic activity is also responsible for the release of EPS which may have a
blocking effect on hydrogen entry into the metal.
3. B I O C O R R O S I O N OF ALUMINUM ALLOYS IN F U E L / W A T E R
SYSTEMS
Fig. 8. Composite diagram of an offshore structure showing the main sites ofbiodeterioration
problems: 1. marine fouling; 2. drill cuttings around legs; 3. oil storage and transport; 4.
water-filled legs; 5. production system; 6. seawater injection system; 7. downhole pipework;
8. reservoir problems (from Ref. [31]).
Fig. 9. Crack growth rates of a RQT 501 steel in biologically active H2S seawater
environments; solid line: crack growth rate in seawater; dotted line: crack growth rate in 520
ppm HzS in abiotic natural seawater (from Ref. [28]).
Fig. 10. Simplified scheme of the initiation of pitting attack on aluminum alloys in fuel/water
systems (from Ref. [45]).
5. M I C R O B I A L INHIBITION OF CORROSION
6. E L E C T R O C H E M I C A L INTEPRETATION OF BIOCORROSION
Table 1
Biocides used in industrial water systems. Properties and usual concentrations.
Chlorine: effective against bacteria and algae; oxidizing; pH dependent; concentration range:
0.1-0.2 mg/1 (continuous treatment)
Chlorine dioxide: effective against bacteria, in a lesser extent against fungi and algae;
oxidizing; not dependent on the pH; concentration range: 0.1-1.0 mg/1
Bromine: effective against bacteria and algae; oxidizing; wide pH range; concentration
range: 0.05-0.1 mg/1
Ozone: effective against bacteria and biofilms; oxidizing; pH dependent; concentration
range: 0.2-0.5 rag/1
Methylene-bis-thiocyanate: effective against bacteria; non-oxidizing; hydrolyses at pH
higher than 8.0; concentration range: 1.5-8.0 mg/1
Isothiazolones: effective against bacteria, algae and biofilms; non-oxidizing; not dependent
on the pH; concentration range: 0.9-10 mg/1
QUATS: effective against bacteria and algae; non-oxidizing; surface activity; concentration
range: 8-35 mg/1
Glutaraldehyde: effective against bacteria, algae, fungi and biofilms; non-oxidizing; wide
pH range; concentration range: 10-70 mg/1
THPS (tetra kis-hydroximethil phosphonium): effective against bacteria, algae and fungi;
low environmental toxicity; specific action againts BRS.
211
8. M O N I T O R I N G BIOCORROSION
Monitoring programs for biofouling and biocorrosion have been mainly focused
in the assessment of planktonic populations in water samples, and generalized
corrosion by using corrosion coupons or some kind of resistance or polarization
resistance probes.
The main objections to these monitoring programs are: i) the planktonic
population does not properly reflect the type and number of organisms living in
the biofilm and causing biodeterioration problems; ii) susceptibility of
planktonic microorganisms to antimicrobial agents markedly differs from that of
sessile microorganisms within the biofilm, mainly because of the protective
action of their EPS. Thus, the monitoring methods adopted must provide
information of well-established biofilms like those developed in system water.
From the corrosion side, the electrical resistance method is appropriate for
indicating a change in the general corrosion rate, but the results are difficult to
interpret in the presence of localized corrosion like pitting, the most frequent
form of attack found in biocorrosion cases [48]. If biofilms or localized
corrosion are present, the polarization resistance will reveal that something is
happening, but may not give an accurate measure of the corrosion rate. Only the
use of any of these techniques jointly with other electrochemical methods or
parameters assessing localized corrosion hazard can provide valuable data for
monitoring the deleterious effects ofbiocorrosion and biofouling.
Owing to the variables of dissimilar nature involved in biofouling and
biocorrosion, an effective monitoring program, either for the laboratory or the
field, must necessarily supply information on water quality, corrosive attack,
sessile and planktonic bacteria populations, biofilms characteristics, and
chemical composition of inorganic and biological deposits [53].
212
atomic force microscope (AFM) permit biofilm observation in real time and
without intoducing distortion of the samples. There is an increasing number of
references using these innovative technologies in recent biocorrosion literature
[61-63].
A combination of CSL and microelectrode techniques allowed correlation
of oxygen concentration profiles with biofilm structure [64]. CSL facilitates the
visualization of biofilm structures by eliminating the interference arising from
out of focus objects [65]. Observations performed under flow conditions and
using physiologically active biofilms, provided information to construct a new
conceptual model ofbiofilm structure.
On the corrosion side, new electrochemical test methods for the study of
localized corrosion phenomena in biocorrosion analysis and monitoring have
been reported [66]. As an example, an electrochemical sensor for monitoring
biofilms on metallic surfaces in real time has been recently presented [67]. The
system provides an immediate indication of the condition of biological activity
on probe surfaces and it is a powerful tool to optimize biocide treatment (Fig.
12).
Acknowledgement
H.A. Videla acknowledges the financial support of the Agencia de Promoci6n
Cientifica y Tecnol6gica of Argentina through the project PICT/99 6782 on
Biodeterioration of materials.
215
Fig. 12. Scheme of an electrochemical sensor for monitoring biofilms (from Ref. [67])
REFERENCES
[1] H.A. Videla, Corrosion/96, paper No. 223, NACE International, Houston, TX (1996).
[2] H.A. Videla and W.G. Characklis, Int. Biodeterior. Biodegr., 29 (1992) 195.
[3] R.G.J. Edyvean and H.A. Videla, Interdisc. Sci. Rev., 16 (1991), 267.
[4] G.G. Geesey, Am. Soc. Microbiol. News, 48, (1982) 9.
[5] W.G. Characklis and K.C. Marshall, Biofilms: A Basis for an interdisciplinary
approach. In: Biofilms, W.G. Characklis and K.C. Marshall (eds.) John Wiley and Sons
Ltd, New York, 1990, pp. 3-15.
[6] W.G. Characklis, Biotech. Bioeng., 23, (1981) 1923.
[7] H.A. Videla, Metal Dissolution/redox in Biofilms. In: Structure and Function of
Biofilms, W.G. Characklis and P.A. Wilderer (eds.) John Wiley & Sons, Chichester,
U.K, 1989, pp. 301-320.
[8] H.A. Videla, Microbially induced corrosion: An updated overview. In: Biodeterioration
and Biodegradation 8, H.W. Rossmoore (ed.) Elsevier Applied Science, London, UK,
1991, pp. 63-88.
[9] H.A. Videla, Electrochemical aspects ofbiocorrosion. In: Bioextraction and
biodeterioration of metals, C.C. Gaylarde and H.A. Videla (eds.) Cambridge University
Press, Cambridge, UK, 1995, pp. 85-127.
216
[ 10] G.A.H. von Wolzogen Ktihr and L.R. Van der Vlugt, Water (den Haag), 18, (1934) 147
(Translation in Corrosion 17, (1961) 293).
[ 11 ] J.D.A. Miller, Metals, in: Microbial biodeterioration, A.D. Rose (ed.), Academic Press,
New York, 1981, pp. 149-202.
[12] R.C. Salvarezza and H.A. Videla, Corrosion, 36 (1980) 550.
[13] G. Gragnolino and O.H. Tuovinen, International Biodeterioration, 20 (1984) 9.
[14] R.C. Salvarezza, H.A. Videla and A.J. Arvia, Corros. Sci., 22 (1982) 815.
[15] R.C. Salvarezza, H.A. Videla and A.J. Arvia, Corros. Sci., 23 (1983) 717.
[16] H.A. Videla, Corrosion of mild steel induced by sulfate-reducing bacteria-a study of
passivity breakdown by biogenic sulfides. In: Biologically Induced Corrosion, S.C.
Dexter (ed.), NACE-8, Houston, TX, 1986, pp. 162-171.
[ 17] H.A. Videla, Electrochemical interpretation of the role of microorganisms in corrosion.
In: Biodeterioration 7, D.R. Houghton, R.N. Smith and H.O.W. Eggins (eds.) Elsevier
Applied Science, London, UK, 1988, pp. 359-371.
[ 18] C.A. Acosta, R.C. Salvarezza, H.A. Videla and A.J. Arvia, Electrochemical behaviour
of mild steel in sulfide and chloride containing solutions, Passivity of Metals and
Semiconductors, M. Froment (ed.) 1984, pp. 387-392.
[ 19] J.W. Costerton and G.G. Geesey, The microbial ecology of source colonization and of
consequent corrosion. In: Biologically Induced Corrosion, S.C. Dexter (ed.) NACE-8,
Houston, TX, NACE, 1986, pp. 223-232.
[20] H.A. Videla, C.L. Swords, M.F.L. de Mele, R.G. Edyvean, P,Watkins and I.B. Beech,
Corrosion/98, paper No. 289, NACE International, Houston, TX (1998).
[21] H.A. Videla, R.G. Edyvean, C.L. Swords, M.F.L. de Mele and I.B. Beech,
Corrosion/99, paper No. 163, NACE International, Houston, TX (1999).
[22] H.A. Videla, Biofouling, 15 (2000) 37.
[23] H.A. Videla, C.L. Swords and R.G. Edyvean, Corrosion/2002, paper No. 02557, NACE
International, Houston, TX (2002).
[24] I.B. Beech, V. Zinkevich, R. Tapper and R. Avci, Journal of Microbiological Methods,
36(1999) 3.
[25] W. Lee, Z. Lewandowski, P.H. Nielsen and W.A. Hamilton, Biofouling, 8 (1995) 165.
[26] Tumbull (ed) Hydrogen transport and cracking in metals, London Institute of Materials,
UK, 1995.
[27] S.G. G6mez de Saravia, M.F.L. de Mele, H.A. Videla and R.G.J. Edyvean, Biofouling,
11 (1997) 1.
[28] C.J. Thomas, R.G.J. Edyvean and R. Brook, Biofouling, 1 (1988) 65.
[29] R.G.J. Edyvean, J. Benson, C.J. Thomas, I.B. Beech, and H.A. Videla, Corrosion/97,
paper No. 206, NACE International, Houston, TX (1997).
[30] R.G.J. Edyvean, J. Benson, I.B. Beech and H.A. Videla, Microbiological influences on
hydrogen effects on steels. In: Hydrogen Energy Progress XII, vol. 3, J.C. Bolcich and
T.N. Veziroglu (eds.) 1998, pp. 1755-1762.
[31] R.G.J. Edyvean, International Biodeterioration, 23 (1987) 199.
[32] E.C. Hill, Biodegradation of petroleum products. In: Petroleum Microbiology, R.M.
Atlas (ed.), Chap. 15, MacMillan Publishing Co., New York, 1984, p. 579-617.
[33] P. Me Kenzie, A.S. Akbar and J.D. Miller, Fungal Corrosion of Aircraft Fuel Tank
Alloys, Technical paper, The Institute of Petroleum, London, UK (1977) 37.
[34] H.G. Hedrick, Materials Protection, 9 (1970) 27.
[35] D.G. Parbery, Material und Organismen, 6 (1971) 161.
[36] M.F.L. de Mele, R.C. Salvarezza and H.A. Videla, International Biodeterioration
Bulletin, 15 (1979) 39.
217
[37] R.C. Salvarezza, M.F.L. de Mele and H.A. Videla, Intemational Biodeterioration
Bulletin, 15 (1979) 125.
[38] R.C. Salvarezza, M.F.L. de Mele and H.A. Videla, Br. Corros. J., 16 (1981) 162.
[39] R.C. Salvarezza and H.A. Videla, Electrochemical behavior of aluminum in
Cladosporium resinae cultures, in: Biodeterioration 6, S. Barry, D.R. Houghton, G.C.
Llewellyn and C.E. O' Rear (eds.) CAB International Mycological Institute, London,
UK, 1986, p. 212-218.
[40] R.J. Watkinson, Hydrocarbon degradation, in: Microbial Problems and Corrosion in Oil
and Oil Products Storage, E.C. Hill (ed.) The Institute of Petroleum, London, UK, 1984,
pp. 50-56.
[41] R.A. Neihof and M. May, Intemational Biodeterioration Bulletin, 19 (1983) 59.
[42] H.A. Videla, P.S. Guiamet, S.M. do Valle and E.H. Reinoso, Corrosion/88, paper No.
91, NACE, Houston, TX (1988).
[43] D. Allsopp and K.J. Seal, Introduction to Biodeterioration, Edward Arnold, London,
1986.
[44] S. Holmes, Microbiology of hydrocarbon fuels. In: Proceedings 2nd International
Conference on Long-Term Storage Stabilities of Liquid Fuels, Southwest Research
Institute, San Antonio, TX, 1986, 336.
[45] H.A. Videla, Practical Cases. In: Manual of Biocorrosion, Chapter 7, Boca Raton,
Florida: CRC Lewis Publishers, 1996, pp. 179-220.
[46] H.A. Videla, Corrosion inhibition in the presence of microbial corrosion. In: Reviews
on Corrosion Inhibitor Science and Technology, Vol 2, A. Raman and P. Labine (eds.),
Chapter IX, NACE Intemational, Houston, TX, 1996, pp. 1-11.
[47] H.A. Videla, Corrosion Inhibition by Bacteria. In: Manual of Biocorrosion, Chapter 5,
Boca Raton, Florida: CRC Lewis Publishers, 1996, pp. 121-135.
[48] S.C. Dexter, D.J. Duquette, O.W. Siebert and H.A. Videla, Corrosion/89, paper No.
616, NACE International, Houston, TX (1989).
[49] D.J. Duquette, Electrochemical techniques for evaluation of Microbiologically
Influenced Corrosion processes. Advantages and disadvantages In: Argentine-USA
Workshop on Biodeterioration (CONICET-NSF), H.A. Videla (ed.) Aquatec Quimica
S.A., Sao Paulo, Brazil, 1996, pp. 15-32.
[50] F. Mansfeld and B.J. Little, Corrosion/90, paper No. 108, NACE International,
Houston, TX (1990).
[51] J.M. Brook and P.R. Puckorius, Corrosion/91, paper No. 212, NACE Intemational.
Houston. TX (1991).
[52] H.A. Videla, M.R. Viera, P.S. Guiamet and M.F.L. de Mele, Corrosion/99, paper No.
186, NACE Intemational, Houston, TX (1999).
[53] H.A. Videla, Detection, Identification and Monitoring. In: Manual of Biocorrosion,
Chapter 6, Boca Raton, Florida: CRC Lewis Publishers, 1996, pp. 137-178.
[54] H.A. Videla, F. Bianchi, M.M.S. Freitas, C.G. Canales and J.F. Wilkes, Monitoring
biocorrosion and biofilms in industrial waters: a practical approach. In: Microbiological
Influenced Corrosion Testing, J.R. Kems and B.J. Little (eds.) ASTM Publications STP
1232, American Society for Testing and Materials, Philadelphia, PA, 1994, pp. 128-
137.
[55] H.A. Videla, P.S. Guiamet, O.R. Pardini, E. Echarte, D. Trujillo and M.M.S. Freitas,
Corrosion/91, paper No. 103, NACE International, Houston, TX (1991).
[56] Z. Lewandowski, Dissolved oxygen gradients near microbially colonized surfaces. In:
Biofouling and biocorrosion in industrial water systems, G.G. Geesey, Z. Lewandowski
and H.C. Flemming (eds.) Lewis Publishers, Boca Raton, FL, 1994, pp. 175-188.
218
[57] W.G. Characklis, Biofilm processes, in: Biofilms, W.G. Characklis and K.C. Marshall
(eds.) John Wiley & Sons, New York, 1990, pp. 195-231.
[58] Z. Lewandowski, T. Funk, F. Roe and B. Little, Spatial distribution ofpH at mild steel
surfaces using an iridium oxide microelectrode. In: Microbiologically Influenced
Corrosion Testing, J.R. Kearns and B.J. Little (eds.) ASTM Publications STP 1232,
Philadelphia, PA, 1994, pp. 61-69.
Chapter 8
Gas Technology Institute, 1700 S. Mt. Prospect Rd., Des Plames IL 60018
1. INTRODUCTION
the medicine, food, and cosmetic industries has largely replaced microbial
growth tests. These modern biotechnology methods are only beginning to be
employed in the gas and oil industry for problems related to microbiologically
influenced corrosion but it is likely that genetic techniques will be the methods
of choice for monitoring MIC in the future. Initial efforts to introduce the use of
genetic techniques for monitoring MIC or other environmental samples have
involved a type of DNA hybridization test called reverse sample genome
probing (RSGP). There are other hybridization-based genetic techniques
including whole cell in situ fluorescent hybridization, DNA amplification
followed by hybridization (dot-blot hybridization) or gel electrophoresis
(denaturing gradient gel electrophoresis) [17-21] that could also be used to
examine MIC samples, but this has not yet occurred. Another type of genetic
test method that could be used to investigate MIC samples is based on DNA
amplification using the polymerase chain reaction (PCR). PCR-based
approaches include quantitative competitive PCR (cPCR), quantitative real-time
PCR (q-PCR), and reverse transcriptase PCR (RT-PCR) [22-25]. This chapter
summarizes the status of genetic tests to monitor MIC and discusses possible
applications of genetic monitoring techniques for the future.
Before accurate and reliable genetic tests can be developed to quantify microbial
species in a given environment it is helpful to first determine the composition of
the microbial community as completely as possible. Molecular analysis of
bacterial community structure of environmental samples has become a useful
means of examining microbial communities. Molecular analysis involves
extraction and purification of nucleic acids from environmental samples, PCR
amplification of nucleic acids, followed by cloning of PCR products into a
vector and sequencing of cloned PCR products, or followed by community
fingerprinting techniques such as DGGE to separate the amplified PCR products
[14, 17]. Each DGGE band is presumably representative of a specific bacterial
population and the number of distinctive bands is indicative of total community
richness. In addition, separated DDGE bands can also be cloned and sequenced.
The comparison of DNA sequences of 16S rRNA genes with DNA sequence
databases such as GenBank allows the identity of the species of microorganisms
present in environmental samples to be determined. A greater understanding of
the full range of bacterial species present in gas and oil production operation
environments where corrosion is occurring will improve our understanding of
the problem and our ability to detect and control it.
Genetic techniques have been used to characterize the microbial
communities present in natural gas pipelines and a thorough report has recently
been published by the authors [ 18]. The important observations obtained from
that study were that while the composition of microbial communities from
different pipelines varies significantly, there were some commonly encountered
species or types of microorganisms. Denitrifiers (bacteria that utilize nitrate and
nitrite), such as Comamonas denitrificans, were found to be the most commonly
encountered type of microorganism in gas pipelines. The presence of
denitrifying bacteria in gas pipelines has not previously been reported in the
literature and it is not routinely monitored in microbiological testing of gas
pipeline samples. However, the frequent occurrence of denitrifiers in gas
pipelines, and the proven ability of denitrifiers to contribute to corrosion [37,
38], suggests that denitrifiers should be monitored and that nitrate plays a key
role in metabolism of biofilm microorganisms present in gas pipelines. This is
particularly interesting because gas pipeline liquids do not typically contain
significant levels of nitrate (< 5 mg/L). Even though the absolute concentration
of nitrate may be low, the ability of different members in a microbial community
to oxidize as well as to reduce nitrogen compounds may lead to continuous
cycling of nitrogen within microbial communities, similar to what has been
223
found for sulfur [39]. Moreover, many sulfate reducing bacteria can also utilize
nitrate [38-40].
Other results obtained from characterizing the microbial populations
within gas pipeline samples were that methanogens were frequently present in
pipeline and biofilm samples, and that sulfate reducers were often present at
lower levels than indicated by microbial growth tests. The presence of
methanogens in gas pipelines was unexpected, but it is significant because any
microbial process, such as methanogenesis, that consumes hydrogen is capable
of accelerating corrosion by cathodic depolarization (a process which pulls the
cathodic reduction of protons by removal of the product and thereby accelerates
anodic metal dissolution) [8, 41, 42].
These results highlight the fact that the composition of microbial
communities in gas pipelines has not been thoroughly investigated and prior to
the genetic studies described here the entirety of our knowledge about
microorganisms in gas pipelines was restricted to information gathered by
growing bacteria in various media under laboratory conditions. There are many
types of bacteria, and testing for all types of bacteria using growth experiments
would be very tedious, and in fact it has never been done. We only have data
concerning those types of bacteria that have been tested for, so our view of the
microbial ecology of gas pipelines is biased indeed. A commonly held belief
regarding microbial corrosion is that SRB are the most important contributors to
corrosion. Since traditional microbial growth tests most frequently test for SRB,
and very few other types of microorganisms, it is not surprising that this belief is
widely held. However, our genetic tests of gas pipeline samples were not biased
in looking for any particular type of microorganism, and SRB were not among
the most abundant microorganisms in any of the pipeline samples characterized.
However, when these same pipeline samples were used to inoculate bacterial
growth tests using SRB medium, SRB were invariably found. The differences in
the number of particular types of bacteria detected by microbial growth tests and
by genetic tests were investigated further, and it was found that the species of
SRB that grew in laboratory media inoculated with gas pipeline samples were
not the same species of SRB detected when the gas pipeline samples were
examined directly. In other words, by growing bacteria in a particular medium
an artificial environment is created where nutrient concentrations, and other
factors we have yet to fully appreciate, differ significantly from the conditions
that are present in gas pipelines. Thus, the composition of microbial
communities detected in laboratory growth experiments differs profoundly from
the composition of microbial communities actually present in a gas pipeline.
224
4. L A C K OF S P E C I F I C I T Y OF M I C R O B I A L G R O W T H TESTS
The traditional means of quantifying bacterial populations present in gas and oil
production samples is to perform microbial growth tests. The growth media used
are not highly selective, and they may allow a range of types of bacteria to grow
and not just the type of bacteria that is intended to be quantified in a given
growth test. However, the accuracy of these microbial growth tests had not
previously been tested to quantify what percentage of bacteria was actually the
type of bacteria targeted. Accordingly tests were performed using traditional
microbial growth media intended for the quantification of specific types of
bacteria, and pure cultures of known bacterial types were then tested to
determine how selective these growth media were. Typical results are shown in
Table 1. Each bacterial culture tested in Table 1 was a pure bacterial culture
isolated from a gas pipeline sample.
It can be seen from the results shown in Table 1 that bacterial growth
media that are intended to support the growth of a particular type of bacteria are
not completely selective and other types of bacteria grow. This is particularly
problematic when the purpose of the microbial growth test is to determine the
quantity of a specific type of bacteria present in a sample. None of the microbial
media tested here, which include all those growth media typically used m
evaluating MIC in the gas industry, allow for the exclusive growth of the
intended type of bacteria. Moreover, only a very small number of pure bacterial
species were tested here, and the results obtained using complex mixed cultures
typical of gas pipelines could show even more widespread growth. The
implication of these results for monitoring MIC is that quantitative results using
microbial growth tests can be misleading as growth observed is not always due
to the type/species of microorganisms that is supposedly being quantified.
Table 1
Growth of pure bacterial cultures in various types of microbial growth media after 6 days
incubation at 30 ~
Growth medium
Microbial type Cultures DNB HAB MET IRB SRB APB
Methanogen Methanoarcina _ + +
5. D E V E L O P I N G AN I M P R O V E D GENETIC M E T H O D TO
QUANTIFY BACTERIA
spiked into gas pipeline samples. This is best seen by inspecting the ratio
between the actually detected gene copy number from the spiked PCR reaction
and the calculated copy number per reaction (copy number detected from un-
spiked reaction, plus the copies spiked into the reaction). If all of the DNA
added in spiked samples was accurately quantified the ratio of detected and
calculated would be 1; values above 1 means an overestimate of the actual
concentration, and values below 1 means an underestimate of spiked gene
copies. The average ratios of the detected and calculated were 1.02 + 0.09, 0.69
• 0.1, 1.2 + 0.15, 0.87 + 0.09, and 1.22 + 0.16 for bacteria, archaea, SRB,
denitrifiers, and methanogens, respectively, which are considered very accurate
for the analysis of complex environmental samples [24].
The data in Table 3 illustrate that genetic tests employing quantitative
PCR techniques provide accurate and reliable data concerning the quantity of
various types of bacteria that may be present in gas pipeline samples.
Table 2
Real-time PCR quantification of gas pipeline samples grown in various microbial growth media
Growth Conc. of various microbes in growth medium (/ml) Percentage of total microbes (%)
Sample ID Medium Bacteria Archaea Methanogen Denitrifier Archaea Methanogen Denitrifier
MET 4.20E+09 6.75E+04 8.15E+05 0.00 0.02
MET 2.04E+07 1.61E+05 2.81E+06 0.69 12.02
MET 1.00E+10 6.75E+04 1.04E+06 0.00 0.01
MET 1.52E+11 5.65E+08 3.51E+10 0.30 18.74
MET 1.02E+l 1 6.65E+09 4.35E+10 4.36 28.52
MET 6.92E+07 ND ND ND ND
MET 1.22E+07 ND ND ND ND
MET 7.24E+06 ND ND ND ND
Table 3
Accuracy of real-time PCR quantification of bacteria, archaea, SRB, denitrifiers, and
methanogens in natural gas pipeline samples
Bacteria detected (copy/rnx) Bacteria calculated (copy/rnx) Ratio
Sample ID w/spiking w/o spiking + spiked copies det:cal
7.32E+08 7 97E+08 0.92
1.16E+08 1.04E+08 1.12
4.56E+06 4.54E+06 1.01
1.14E+08 1.05E+08 1.08
6 40E+05 6 73E+05 0 95
9.76E+08 1.05E+09 0.93
2.61E+09 2.35E+09 1.11
Spiking: 5.36E+05 copies of 16S rRNA genes of Pseudomonas aerugmosa PAO-1 per reaction.
Table 4
Quantification of bacteria, archaea, SRB, denitrifiers, and methanogens in natural
gas pipeline samples (/mL)
Sample ID Bacteria Archaea SRB Denitrifier Methanogen
1.99E+08 1.59E+03 8.12E+03 7.95E+06 1.18E+04
2.58E+07 1.49E+05 1.98E+03 4.05E+04 2.18E+05
1.00E+06 5.93E+01 5.29E+01 4.00E+03 ND
2.75E+07 1.75E+03 9.51E+03 1.02E+05 4.14E+03
3.42E+04 4.67E+01 ND 1.96E+02 ND
2.62E+08 6.97E+06 6.75E+05 1.64E+05 3.70E+07
5.88E+08 6.33E+05 4.11E+04 6.48E+06 3.25E+06
ND - not detected
6. CONCLUSIONS
Quantifying various types of bacteria that may be present in gas and oil
production operation samples is a difficult challenge. Traditional tests employ
microbial growth media of various types that are intended to foster the growth of
particular types of microorganisms. Unfortunately, microbial growth media are
not uniquely selective and microorganisms other than the intended type often
grow in the test medium. In some cases, even though significant growth occurs
the concentration of the target population of bacteria is below detection limits.
Thus, if the results of growth in microbial test media are used to determine the
quantity of various types of bacteria present m gas and oil production operation
samples the results obtained can be very misleading. Traditional microbial
growth tests require weeks of incubation, are not accurate, and do not provide
information about what microbial species were actually present in the
environment. An improved means of quantifying various types of bacteria
present in gas pipeline samples is using genetic techniques, such as RSGP and q-
PCR. Other industries such as medicine, food, and cosmetics share with gas and
oil industry the need to detect, identify, and quantify microorganisms. These
other industries have largely abandoned microbial growth tests in favor of
genetic methods. Hybridization test methods such as RSGP are not typically
used in characterizing environmental samples, but future improvements in
microarray technology may change this situation, q-PCR has been adopted by
other industries as the method of choice for rapid quantification of
microorganisms, but this technique has not yet been in the gas and oil industry.
In this chapter data was presented that demonstrated that q-PCR can obtain data
within a few hours that specifically and accurately quantifies bacterial types
present in gas pipeline samples. The gas pipeline samples are analyzed directly
without any cultivation or other manipulation in the laboratory that would alter
the composition of the microbial community. Therefore, q-PCR provides data
231
concerning the actual microbial community present in the gas pipeline. GTI has
developed an accurate and reliable method to quantify bacterial types present in
gas pipeline samples and is now offering this service to the industry.
REFERENCES
Chapter 9
1. INTRODUCTION
While chemical surfactants are both inexpensive and efficient, they may
have very negative effects on the environment. Increasing awareness on the part
of the consumer, coupled with the potential for legislation governing excessive
use of such chemicals offers new opportunities for biotechnological alternatives.
The potential advantages of such products include, 1. biodegradability resulting
in lower levels of pollution, 2. selectivity and specificity towards hydrocarbon
substrates, 3. potential for using recombinant DNA technology to engineer
changes in surfactant structure and function, 4. compatibility with chemical
products leading to novel formulations, 5. natural products may have unique
characteristics which cannot be produced by simple chemical synthesis. One
such product, which is used in the oil industry is xanthan gum, a microbial
polymeric exopolysaccharide with unique, sheer thinning rheological properties
[5]. In this Chapter we will focus primarily on microbial biosurfactants as
bioemulsifiers and their potential applications in the petroleum industry.
reviews dealing with low molecular weight biosurfactants have been published
[7,9,13-16], the subject will be treated only briefly in this section.
of citric acid and two cadaverine molecules. The hydrophobic moiety contains
two acyl groups of from 6-10 carbons.
Table 1-A
Structures of selected glycopeptides and particulate biourfactants
Compound Organism Reference
Aerobactin Aerobacter aerogenes [23]
62-1 c.. . . .
I
c---o c=o
I
I
NOH
I
NON
I
(CH2)4 COOH
I
(CH2)4
CH2
I
I
/ / c ~-------o
I
OH R= (C II 3)2 C n (C H 2).C I-I = C I-I
or (C H 3)2C I'I (C II 2).C II 2C rI 2
n=Oto4
o H~ o o
237
Table 1-A
Structures of selected glycopeptides and particulate biourfactants
Compound Organism Reference
Pentasaccharide Nocardia corynebacteroides [27]
14, .-.~R H CH2OH
i1"12t'~ - I'~r'~ _~I_,H.o ., OH H
R ~ \ # O ~ H H R H ~ I L...,
- - T l'l 'oizr ~ '~01 H .L / J - ~ R H O ' ~ ~ -,,
H H ., .. I HO" 7 ~ ! /O~ r~u.l.-..~L......-~L'rl2TM
. ~O~ C
HI 6H IH - H H H
R= CH3COO
CH3CH2COOand CH3(CH2)2COO
CH3(CH2)6COO
HOOC(CH2)2COO
Rhamnolipids
Mono- P s e u d o m o n a s aeruginosa KY4025 [2]]
o o
O---C--C--C--O--CII---C--C----~
(a% (a+z~
L L
a-t
oH /1 - - ' - ~
--C --OH
I H2
(CN3)6
I
~ j
O CH 3
1
OH
I
OH
238
Table 1-A
Structures of selected glycopeptides and particulate biourfactants
Compound Organism Reference
Di- Pseudomonas aeruginosa S7B 1 [21]
Cl-la CHa
I
~o~
Io HO~C
~ OH
R=OCtCnk, c ~ , ,.=6-12
HO 2_L...,~o HO H
H
R= palmltoyl or myeoloyl m m e t y
239
Table 1-A
Structures of selected glycopeptides and particulate biourfactants
Compound Organism Reference
-Tetraester Rhodococcus sp. ~ OH [30]
R3
c~
~m~cr ~--am~add
~orF~=~oo~mca~
M~8-~ S2orR4=sumric a:id
I~ ~or ~ =od~mcar~ld~mcadd
H H
Table 1-B
Structures of selected lipopeptides
Compound Organism Reference
[32]
Amphisin Pseudomonas sp. DSS73 ~o .~ ---5/
:o~ o ~:~L~_~
~~ ~0~OH
PheoD ~ H I s -
I
H D-Asp
k-----t_-Asp
E
D-Glu
I
Ileu-L--D-O I
rn-----L-Lys I
L-lieu
O~H OH "
241
Table 1-B
Structures of selected lipopeptides
Compound Organism Reference
~\~c
~\ H
~\o~
Gramicidin S Bacillusbrevis
r
\ [36]
~0 0 H~~ 0
Table 1-B
Structures of selected lipopeptides
C omp oun d Organ is m Referen ce
~6
iscr G'17
C'15
G-'13
~5
~7
~3
,~-4~
~~ NH
HN'~~N ~
[19]
N-4 909 H2N
o H 0
~
N2<
243
T a b l e 1-B
Structures of selected lipopeptides
Compound Organism Reference
Polymyxin B Bacilluspolymyxa \
.~,, [s9]
.. o. .~-7 2
H2N~
HN NH
~ N N O NH;
II
0
Putisolvin II Pseudomonasputida PCL [4/]
1445 Leu
H3C~(H2C)4~C~Leu-Giu-Leu-Ile-GIn-Ser-Val-Ile-Ser X]e
o /
II
Xle=Ile orLeu 0
244
Table 1-B
Structures of selected lipopeptides
Compound Organism Reference
. '~
o o ")/
cl
245
Table 1-B
Structures of selected lipopeptides
Compound Organism Reference
Tensin Pseudomonas fluorescens I ~ [45]
_ N.~J~,~ N = N ~,~.... /
N Nil
H
N---.---it--~/~.NH
246
Table 1-B
Structures of selected lipopeptides
Compound Organism Reference
WLIP Pseudomonas reactans [48]
~ H ~ o H~ .
N NH
H
and/or capacity for emulsification need not be directly related to the natural role
of the surface-active molecule. A standard measure for surface activity is the
reduction of surface tension. This method may vary somewhat from instrument
to instrument and is somewhat cumbersome since frequently measurements
must be made at several concentrations. Generally, a good candidate for a
surfactant lowers the surface tension from 70mN/m to below 30mN/m. An
additional screen based on surface activity was to search for organisms, which
produced materials which lyse eukaryotic cells [50-53]. The problem with this
approach was that it also enriched for microbial pathogens. Moreover, it was
shown to have the weakest correlation with other modes of screening and to
yield the highest number of false positives [ 14]. Another useful and effective
screen involves examining the capacity of a drop of culture broth from a
putative surfactant producer to collapse an aqueous droplet formed on a
hydrophobic surface [54-55]. The surfactant in this case increases the contact
angle and droplet collapse can be estimated as a function of surfactant
concentration and related to standard materials. The droplet collapse method is
rapid and yields relatively low numbers of false positives [ 14]. The oil spreading
technique involves placing a droplet of a surfactant containing solution on a
surface coated with a liquid hydrocarbon. The surface activity causes oil
spreading leaving a clear zone at the point of application the diameter of which
is a qualitative measure of surface activity [56]. Recently the three screening
methods, lysis of blood agar, droplet collapse and oil spreading were compared
with surface tension measurements for 205 natural isolates. The oil spreading
technique appeared to give the highest correlation with the surface tension
lowering, although there was strong negative correlation between clear zone
diameter and droplet collapse suggesting that the two procedures measured
similar activities and could be correlated well with surface tension
measurements. It was suggested that an effective protocol for screening natural
isolates is to use the droplet collapse method and subsequently employ the oil
spreading technique for more quantitative preliminary evaluations [ 14].
The wide variability in structures (see Table 1A and 113) and the
production and secretion of biosurfactants by organisms, which do not grow on
hydrocarbons indicates that there is probably no general biological role for all
biosurfactants [57]. Moreover, unless the search is for a closely related analog
whose synthesis may be catalyzed by similar gene products, it is unlikely that
modem methods in molecular ecology will be productive in identifying new
organisms or products. Recently, natural isolates from arid soil samples from the
Southwestern U.S. were screened for their ability to produce extracellular
materials in the culture broth, which lowered surface tension at the air/water
interface [12]. According to this screen over two percent of the isolates
produced surfactants when grown on a rich medium. Interestingly, biosurfactant
producers were found in both uncontaminated soils as well as in soils showing
248
acid side chain to provide the hydrophobic tail. Homologous of this complex are
found in Bacilli, which produce cyclic lipopeptides such as surfactin.
3. BIOEMULSIFIERS
Table 2
Composition of biosurfactants . .
Table 3A
Production and surface activity ofbioemulsifiers
,, ,
Lipids
Rhodococcus sp. Q 15 glucose, acetate 36 I77]
Nocardia erythropohs ATCC 4277 hexadecane, 29 [1591
kerosene
Saccharomyces uvarum n-decane 20 [781
Lipopeptides
Bacillus hqueniformis JF-2 glucose 25-34 [79]
Corynebactertum lepus kerosene 0.35 30 [160]
Amphisin Pseudomonas sp. DSS73 glucose 27 I8Ol
Arthrofactin Pseudomonas sp. MIS 38 L-broth 24 [561
Bacitracin Bacillus hquentformis 27 [34]
Hodersin Pseudomonas sp. glucose 27 18o]
Lokisin Pseudomonas sp. DSS41 glucose 27 18o]
Lychesin A Bacillus liquentformis BAS50 glucose 0.16 28 [38]
Serrawettin Serratta hquefaciens MG1 glucose 28 [42]
Surfactin Bacillus subtihs ATCC 21332 glucose 3-4 27 [431
Tensin Pseudomonas fluorescens 96.578 glucose 27 18Ol
Viscosin Pseudomonas vtscosa glucose 26.5 [/91
Viscosinamide Pseudomonas fluorescens DR54 glucose 27 18o]
* in g/l.
Surface Tension in mN/m.
257
Table 3B
Production and surface activity ofbioemulslfiers
Compound Organism C-source Yield" ST A Reference
Glycolipids
Rhodococcus e rythropo lis Mihagol L 32 [25]
DSM 43215 Mihagol S 8
Flavolipid Flavobacterium sp MTN 11 glucose 0.1 26 [24]
Pentasaccharide Nocardia corynebacteroides nC14-15 2.8 26 [27]
SM1
Rhamnolipids Pseudomonas putida 21BN hexadecane, 1 29 [167]
glucose
Sophorose Candida bombicola ATCC glucose, 70 31 [168]
22214 safflower oil
Torulopsis petrophilum glucose 43 [31]
Candida bogoriensis glucose 2 [8/]
Others biosurfactants
Synthetic surfactants
Water 72
* in g/1.
A
Table 4
Enhancement of apoemulsan activity on different hydrophobic substrates by recombinant
esterase
Hydrophobic substrate Emulsifying Activity Ratio
Anthracene 966
Crude oil 4.3
Dicyclohexane 8.9
Diesel oil 5.7
Eicosane 1800
Fluoranthene 593
Heptadecane 28
Immersion oil 10.4
2-Methyl Naphthalene 1984
Mineral oil 6.6
Octadecane 2250
Petroleum refinery sludge 2
Pyrene 420
Soya oil 1260
Squalene 600
Tetracosane 506
spite of the fact that A. venetianus RAG-1 is thus far the only natural isolate
which has been shown to produce emulsan [ 180]. According to convention, the
specific genes for emulsan biosynthesis were termed wee; the first letter
signifies that the gene is a biosynthetic gene from a polysaccharide biosynthetic
cluster, the second land third letters identifying the specific product (emulsan,
exopolysaccharide). In accordance with convention, some gene products exhibit
similar functions in all organisms, and thus are allowed to retain their original
names. Figure 3 summarizes a hypothetical biosynthetic pathway for
apoemulsan, with, the rightward operon encoding proteins involved in precursor
synthesis and activation, aminoglycosyl transferases for assembling the
trisaccharide subunit on the inner side of the cytoplasmic membrane, a
polymerase, decorating enzymes for the acylation of the aminosugars, a
translocase which moves the polymer from the cytoplasmic face of the
membrane to the outer or periplasmic face, and enzymes involved in subsequent
translocation of the polymer through a specific channel or porin to the outer
surface of the cell [180].
Regulation and the production of viscoemulsan. Located in the
intercistronic region are two putative 0v~ promoters. The leftward operon
consists of three repeating frames wza, wzb and wzc, which encode a porin, a
protein tyrosine phosphate phosphatase and a protein tyrosine kinase,
respectively [ 180-181 ]. Knockout mutants in any of these genes resulted in
defects in emulsan production. Both Wzc and Wzb proteins of RAG-1 were
cloned and over-expressed in E. coli. The Wzc Ptk was shown to be an
autophosphyorylase in which a tyrosine (s) in the C-terminal portion of the
protein is phosphorylated and subsequently dephosphorylated by the
phosphatase [182]. Similarly, the phosphotyrosine of Wzc from RAG-1 was
shown to be dephosphorylated by Wzb [ 181]. According to other reports, the
phosphorylated form of Wzc is expected to negatively regulate polymer export
through the porin Wza. Elevated levels of extracellular biopolymer production
would then be initiated with the activity of Wzb, the phosphatase, which
removes the phosphates, permiting the enhanced export. Consistent with the
hypothesis was the finding that knockout mutants in the phosphatase were also
emulsan deficient. However, the results did not explain why knockouts in Wzc
would be emulsan deficient as well. Apparently there is a requirement for the
Wzc protein even in its non-phosphorylated state. The Wzc protein contains a
series of five tyrosine residues in close proximity to each other at the C
terminus. When these tyrosines were deleted, the resulting protein was made but
could be phosphorylated and surprisingly, a high molecular mass
polysaccharide, termed viscoemulsan, was produced [ 181 ]. This product appears
to contain the same constituents as emulsan, but is not active as an emulsifier
(Nakar, In preparation). The introduction of a wild-type allele of wzc gave rise
to the production of a wild-type allele of emulsan suggesting that the protein
262
tyrosine kinase may act to control the size of the exported polymer. It is also of
interest that the Wzc protein is required for viscoemulsan production even
though it cannot be phosphorylated [ 181 ] suggesting that there is an additional
role for the protein. A model to describe the role of phosphorylation and
dephosphorylation is shown in Fig. 4 [181 ]. According to this model Wzc, Wzb,
Wza proteins and others interact in a multienzyme complex to control the export
of the exopolysaccharide. The process is initiated by dephosphorylation of the
protein relaxing the control on the porin diameter and enabling larger amounts
of polymer to be translocated to the external surface of the cell. Under
conditions of rapid growth and high ATP, all of the tyrosine residues are
phosphorylated and polymer production is low. In fact, emulsan production does
not take place in rich media, although its biosynthesis has been shown to occur.
The polymer can be detected immunologically. The manipulation of the export
process coupled with the modifications of the biosynthetic genes offers new
approaches to the generation of new and novel products and is currently in
progress.
15
....................... iI
20 25
~r ~
mlp wzc wzbwza A B C wzx wzy D E F G H I J K gaPJugd pgl gate pgm
%GG: 373839 38 393128 3029 42 39 42384042 39 41 39 39 39
Fig. 3. The w e e cluster for the biosynthesis of emulsan. The scale of the cluster size is in
kilobases. The black arrows represent putative orf sequences. White arrows represent partially
sequenced orf's. Putative promoter sites are indicated with thin black arrows. The names of
the genes are shown below the corresponding orf's. Orf's labeled solely with capital letters
are putative pathway specific genes encoding Wee A-K respectively.
for an esterase from another member of the genus Acinetobacter, the strain A.
calcoaceticus BD4 [ 188] and its miniencapsulated derivative BD413. While this
enzyme shows strong sequence and structural homology to the RAG-l enzyme,
it did not display any emulsification enhancement when added to apoemulsan
[139].
Specificity towards hydrocarbons. As shown in Table 4 the recombinant
esterase protein enhances emulsification of apoemulsan towards a variety of
pure and crude hydrophobic substrates. EEt' activity was observed with mutants
of the esterase defective in catalytic activity, suggesting a role for the protein
other than as an enzyme.
Esterase exhibits EEP activity towards other polysaccharides.
Surprisingly, the interaction of the recombinant RAG-1 esterase with the water
soluble, rhamnose-containing exopolysaccharide from A. calcoaceticus BD4 led
to the formation of a new bioemulsifier complex. In sharp contrast, the esterase
from BD4 did not enhance emulsifying activity of apoemulsan towards
hydrophobic substrates [ 140]. Remarkably, the recombinant esterase from RAG-
1 exhibited EEP activity with over 25 different natural biopolymers, none of
which exhibited any emulsifying activity in the absence of the protein. In these
cases, the enhancement was not dependent on catalytic activity of the
recombinant protein (Bach and Gutnick, in preparation). The results point to a
new approach to generation of amphipathic emulsifiers, which is no longer
dependent on fermentation to produce the polymer emulsifier. Among the
inexpensive materials, which can be converted into bioemulsifiers using this
unique formulation with the RAG-I esterase are cellulose, dextran, starch,
xanthan, alginic acid, and a variety of plant and bacterial polysaccharides
including the inactive viscoemulsan described above (Table 5). The mode of
action of the EEP remains to be elucidated although evidence is discussed below
demonstrating that there is a unique motif in the RAG-1 esterase, which is
missing from other homologues.
Mapping the EEP domain. Initial observations showed that limited
proteolysis of the recombinant esterase yielded a fragment of about 10 kDa,
which retained the ability to enhance emulsification of hydrophobic substrates
such as hexadecane. Accordingly, a series of site directed mutants were
generated and over-expressed to produce different fragments of the esterase.
Since the fragments were rapidly degraded even in strains of E. cob lacking Clp
or Lon proteases, fragments were prepared which were fused in frame to the C-
terminus of the maltose binding protein [189]. The various constructs are shown
in Fig. 5. The each over-expressed fusion was tested with apoemulsan using the
model hydrophobic substrate, hexadecane as a substrate for emulsification.
Virtually all the enhancing activity was localized to the C-terminal third of the
esterase. It was of interest that the maltose binding protein itself exhibited no
EEP activity. Moreover the fusion protein containing the active polypeptide was
265
no less active than the intact enzyme. Removal of the terminal 15 amino acids
from the C-terminus completely abolished the EEP activity. Sequence analysis
showed that this 15 amino acid C-terminal peptide is unique to the RAG-1
esterase and probably accounts for the unique characteristics of this protein.
However, as shown in Table 2, many organisms produce emulsifiers consisting
of protein/polysaccharide complexes [7, 9, 190]. In most cases the protein
requirement has yet to be clarified and it is possible that there are other proteins
or peptides, which exhibit unique EEP activity. Regardless, EEP technology
offers a new approach to bioemulsifier production and paves the way for new
families of inexpensive, non-toxic, amphiphiles.
Fig. 4. Hypothetical model for the role of protein tyrosine kinase (Wzc) and protein tyrosine
phosphatase (Wzb) in emulsan export. 1. Dephosphorylated Wzc allows for polymerization
and translocation of emulsan. 2. Phosphorylation of Wzc halts the process, thereby
determining the size of the exported polymer. 3. Emulsan release and beginning of a new
round of polymerization, translocation and release. Wza-translocation channel; Wzb-protein
tyrosine phosphatase; Wzc-Protein tyrsoine kinase; Wzx-polymerase; Wzy-translocase.
266
3.4.1. A lasan
Acinetobacter radioresistans radioresistens KA53 produces a
bioemulsifier complex (103 kDa) consisting of three proteins and a
polysaccharide [73]. The emulsifying activity was associated primarily with the
AlnA protein. Interestingly, the N-terminal sequence of a recombinant form of
the AlnA protein produced in E. coli showed strong homology to the outer
membrane protein, OmpA [191]. The recombinant form of AlnA was more
active as an emulsifier than the complex. It was also shown to solubilize
polyaromatic hydrocarbons and at higher concentrations of the substrate, to form
hexamers [ 192]. The crude alasan complex also formed alkane/water emulsions
at an optimum pH of 5. This activity was significantly enhanced after heating at
100~ Interestingly, the alasan producing strain does not grow on hydrocarbons
or on oil substrates and the biological role of this complex remains to be
elucidated.
Table 5
Enhancement of the emulsifying activity of different polysaccharides by recombinant
esterase in the presence ofhexadecane
Emulsifying activity
Polysaccharide (U/mg polysaccharide/mg esterase) ...
Agarose 963
Alginic acid 496
Apoemulsan 5430
BD-4 exopolysaccharide 3396
Carrageenan 3345
Cellobiose 626
Cellulose 766
Chitin 540
Colanic acid 2050
Dextran 583
Emulsan 6752
Ficoll 400 263
Gum Arabic 1895
Pectin 1830
Polyvinyl Pyrrolydone 1950
Potato starch 544
Pullulan 3400
Stewartan 1196
Xanthan 2720
Xylan ., 1854 ....
267
3.4.2. Liposan
Liposan is a polymeric bioemulsifier produced by the yeast Candida
lipolytica ATCC 8662 [76]. The protein polysaccharide complex consists of
83% polysaccharides and 17% protein. When grown on hexadecane organism
appeared to colonize the hexadecane droplets. Liposan emulsified alkanes with a
chain length between C6 and C 18 with the emulsifying activity increasing with
increasing chain length. Liposan has also been shown to emulsify various crude
oils such olive and corn oils, gas oil, kerosene, paraffin, halowax 1000 and a
series of aliphatic and aromatic hydrocarbons.
3.4.3. Biodispersan
This polymer is produced by Acinetobacter sp. A2. The extracellular
product exhibited a molecular mass of 51,400. This polyanionic polysaccharide
is a dispersant, which disperses limestone and aids lowers the energy required
for grinding limestone to form a powder, which is an ingredient in paper [74,
194].
RAG-1 Esterase
F1 II ..... w,-- i
"1
F3 I~ ..I
"1
F4
"-I
F5 I~- .-,.J
Fig. 4. Generated esterase constructs fused in frame to the C-terminus of the maltose binding
protein.
268
4. POTENTIAL APPLICATIONS
4.1. G e n e r a l c o m m e n t s
The petroleum industry consumes millions of tons of surfactants each
year in a large number of applications (see chapters 4 and 19). Surfactants are
used in oil field applications (drilling muds, enhanced oil recovery),
environmental and equipment clean-up and maintenance, viscosity reduction
and oil transportation, emulsion breakage and dewatering of crude oil prior to
refining, and more recently, water/oil based fuels. Generally, the surfactant
packages include a combination of surface-active agents, and frequently include
compatible solvents and specialized chemicals depending on the quality of the
specific oils and sludges. As described in this Chapter, biological products and
processes can be employed in all of these applications. In this section we will
consider only a few larger scale experiments using biosurfactants. The
successful trials indicate that at least in terms of product efficacy, these
materials have potential. However, their profitability has yet to be unequivocally
demonstrated. In this section we will discuss a few large- scale field trials
pointing to the possibility of employing biosurfactants and emulsifiers in the oil
industry.
Unlike biotechnology products for other sectors such as health care or
pharmaceuticals, where the cost of development and even the cost of obtaining
269
approval from the regulatory agencies, are offset by the high prices and
profitability of the product, the cost of applications in the oil industry must be
kept relatively competitive with products of the chemical industry. This is a
particularly difficult constraint considering that production of many of the
biotechnological products may involve large-scale fermentation processes,
which exert a considerable impact on the cost of the product, particularly if
extensive downstream processing is required. Several approaches may be used
to enhance the cost effectiveness ofbiosurfactants.
need not be purified to any significant extent and may not require expensive
downstream processing [203].
Enhanced productivity can in principle be obtained by transferring
biosynthetic genes into an organism such E. coli K-12 which is easy to grow and
which utilizes a "friendlier" source of carbon and energy [204-205].
At least in pilot scale, most biosurfactants are produced in batch
fermentations. Cooper and co-workers developed a semi-continuous approach to
producing biosurfactants via self-recycling system [206]. Similarly, emulsan
was produced in a similar protocol in which the product was allowed to grow
and accumulate in early stationary phase followed by the removal of 90% of the
cells and emulsan, which was harvested downstream. The fermentor was filled
with fresh media and the culture again entered exponential and early stationary
growth, the major portion of the emulsan recovered and the cycles repeated in
the same fermentor for several semi-continuous production runs. The cost of
production is thus significantly reduced (Cooper, D., Personal communication).
Another way to cut the cost of production is to upgrade the producing
strain in order to enhance overall productivity [8, 199]. This approach has been
used in the case of the emulsan producing strain A. venetianus RAG-1 [166].
The positive selection for emulsan overproducers was based on the fact that the
emulsan polyanion binds the toxic cation cetyl-trimethylammonium bromide
(CTAB). Among the mutants of RAG-1 resistant to CTAB, were those such as
strain A. venetianus CTR49, which overproduce the extracellular polyanion and
are thus significantly more resistant to the CTAB than the parent. In the
laboratory, mutants of this variety produced up to twice as much emulsan per
gram of ethanol carbon source than the wild-type.
stabilize the emulsion [207-209] and prevent coalescence of the phases, and they
can also contain a compatible solvent. The solvent need not be a water based
solvent, but it should be able to dissolve both the low molecular weight
surfactants as well as the biopolymer. Materials such as pine oil, liquid
terpenoids, dimethyl sulfoxide, and various light crude oils have all been
included in various surfactant packages [210]. In addition to solubilizing all of
the components into a pumpable mixture, the solvent addition has also been
shown to enhance the cleaning of oil contaminated tanks by removing the last
remnants of sludge and other flammable materials from the walls of the
container rendering the tank not only clean, but also gas-free. The choice of
suitable components for various surfactant packages must also take into account
other potential components, which must be included. For example, if routine
cleaning operations include rinses with anticorrosive materials, the formulation
package must be designed on the basis of compatibility with such components.
Similarly, emulsion based fuels may need to be formulated together with
materials which lower sulfur emissions. Specially designed surfactant
formulations may also require compatibility with a variety of materials including
flame retardants, biocides etc.
somewhat higher than with a regular hydrocarbon fuel since the surface area is
larger. What is even more interesting is that the quality of the burn was
indistinguishable from that of a light high quality fuel oil suggesting that
emulsion based fuels can be a viable alternative for some applications [207-
210,213].
Interestingly, these larger scale burn experiments were performed with a
biosurfactant containing formulation. However, at Petroferm U.S.A. specialty
chemical formulations were developed some of which did not contain the
emulsan, but was composed of chemical surfactants, a solvent and other
components. Emulsion based fuels have become more and more popular,
because they permit the efficient combustion of various hydrocarbons which are
normally difficult to burn. Arguably, the best studied system is the water-
bitumen emulsion system, termed Oriemulsion which has been commercialized
and is currently exported from Venezuela throughout the world. The emulsion is
chemical based, and resembles the initial Petroferm formulations.
5. C O N C L U D I N G R E M A R K S
REFERENCES
[1] C.A. Houston, (2002) Colin A. Houston & Associates, Inc, NY.
[2] J.L. Salanger, Surfactants-Types and Uses, Laboratorio FIRP, Merida, Venezuela,
(1999).
[3] R. Modler and Y. Ishikawa, Surfactants, Specialty Chemicals Update Program - SRI
Consulting: CA. (2001).
[4] G. Bognolo, Sustainable Surfactants, Renewable Feedstocks for the 21 st Century,
Competitive Industrial Materials from Non-Food Crops, Sand Hutton, York, UK,
(1998).
[5] I.W. Sutherland, Biotechnol. Adv., 12 (1994) 393.
[6] D.L. Gutnick and W. Minas, Biochem. Soc. Trans., 15 (1987) Suppl. 22S.
[7] E. Rosenberg and E.Z. Ron, Appl. Microbiol. Biotechnol., 52 (1999) 154.
[8] Y. Shabtai, O. Pines and D.L. Gutnick, Develop. Indust. Microbiol., 26 (1985) 291.
[9] J.D. Desai and I.M. Banat, Microbiol. Molec. Biol. Rev., 61 (1997) 47.
[10] C. Rubinovitz, D.L. Gutnick and E. Rosenberg, J. Bacteriol., 152 (1982) 126.
[11] H.J.A. Asmer, S. Lang, F. Wagner and V. Wray, J. Am. Oil Chem. Soc., 65 (1988)
1460. [12] A.A. Bodour, K.P. Drees and R.M. Maier, Appl. Environ. Microbiol., 69
(2003) 3280.
[13] A.A. Bodour and R.M. Miller-Maier, Biosurfactants: types, screening methods, and
applications., Encyclopedia of Environmental Microbiology, Wiley, NY, 2002, pp.750-
770.
[14] N.H. Youssef, K.E. Duncan, D.P. Nagle, K.N. Savage, R.M. Knapp and M.J.
Mcinerney, J. Microbiol. Meth., 56 (2004) 339.
275
[44] A. Segre, R.C. Bachmann, A. Ballio, F. Bossa, I. Grgurina, N.S. Iacobellis, G. Marino,
P. Pucci, M. Simmaco and J.Y. Takemoto, FEBS Lett., 255 (1989) 27.
[45] T.H. Nielsen, C. Thrane, C. Christophersen, U. Anthoni, and J. Sorensen, J. Appl.
Microbiol., 89 (2000) 992.
[46] T.R. Burke, M. Knight and B. Chandrasekhar, Tetrahedron Lett., 30 (1989) 519.
[47] T.H. Nielsen, C. Christophersen, U. Anthoni, and J. Sorensen, J. Appl. Microbiol., 86
(1999) 80.
[48] R.J. Mortishire-Smith, J.C. Nutkins, L.C. Packman, C.L. Brodey, P.B. Rainey, K.
Johnstone and D.H. Williams, Tetrahedron, 47 (1991 ) 3645.
[49] J.E. Zajic and W. Seffens, CRC Critical Rev. Biotechnol., 1 (1984) 87.
[50] P.G. Carrillo, C. Mardaraz, S.J. Pitta-Alvarez and A.M. Giuletti, World J. Microbiol.
Biotechnol., 12 (1996) 82.
[51] I.M. Banat, Biotechnol. Lett., 15 (1993) 591.
[52] H. Yonebayashi, S. Yoshida, K. Ono and H. Enomoto, Sekiyu Gakkaishi, 43 (2000) 59.
[53] C.N. Mulligan, D.G. Cooper and R.J. Neufeld, J. Ferment. Technol., 62 (1984) 311.
[54] D.K. Jain, D.L. Collins-Thompson, H. Lee and J.T. Trevors, J. Microbiol. Methods., 13
(1991)271.
[55] A.A. Bodour and R.M. Miller-Maier, J. Microbiol. Meth., 32 (1998) 273.
[56] M. Morikawa, Y. Hirata and T. Imanaka, Biochim. Biophys. Acta, 1488 (2000) 211.
[57] E.Z. Ron and E. Rosenberg, Environ. Microbiol., 3 (2001) 229.
[58] C. Fuqua, M.R. Parsek and E.P. Greenberg, Ann. Rev. Gen., 35 (2001) 439.
[59] D.G. Davies, M.R. Parsek, J.P. Pearson, B.H. Iglewski, J.W. Costerton and E.P.
Greenberg, Science, 280 (1998) 295.
[60] G. Medina, K. Juarez, B. Valderrama and G. Soberon_Chavez, J. Bacteriol., 185 (2003)
5976.
[61 ] L. Eberl, S. Molin and M. Givskov, J. Bacteriol., 181 (1999) 1703.
[62] E. Dickinson (ed.), Food Emulsions and Foams, The Royal Society of Chemistry,
London, 1987, pp. 1-29.
[63] G.O. Philips, D.J. Wedlock and P.A. Williams (eds.), Gums and Stabilizers for the Food
Industry, IRL Press, Oxford, 1988, pp. 249-263.
[64] A. Stephen (ed.), Food Polysaccharides and their Applications, Marcel Dekker, N.Y.
1995, pp. 501-515.
[65] A. Reisfeld, E. Rosenberg and D.L. Gutnick, Appl. Microbiol., 24 (1972) 363.
[66] A. Oberbremer, R. Miller-Hurting and F. Wagner, Appl. Microbiol. Biotechnol., 32
(1990) 485.
[67] Y. Zhang and R.M. Miller, Appl. Environ. Microbiol., 58 (1992) 3276.
[68] M.F. Van Dyke, P. Couture, M. Brauer, H. Lee and J.T. Trevors, Can. J. Microbiol., 39
(1993) 1071.
[69] M.A. Providenti, C.A. Flemming, H. Lee and J.T. Trevors, FEMS Microb. Ecol.,17
(1995) 15.
[70] M. Marin, A. Pedregosa and F. Laborda, Appl. Microbiol. Biotechnol., 44 (1996) 660.
[71] D.G. Cooper and B.G Goldenberg, Appl. Environ. Microbiol., 53 (1987) 224.
[72] C. Calvo, F. Martinez-Checa, F.L. Toledo, J. Porcel and E. Quesada, Appl. Microbiol.
Biotechnol., 60 (2002) 347.
[73 ] S. Navon-Venezia, Z. Zosim, A. Gottlieb, R. Legmann, S. Carmeli, E.Z. Ron and E.
Rosenberg, Appl. Environ. Microbiol., 61 (1995) 3240.
[74] E. Rosenberg, C. Rubinobitz, R. Legmann and E.Z. Ron, Appl. Environ. Microbiol., 54
(1988) 323.
277
[75] A. Zuckerberg, A. Diver, Z. Peeri, D.L. Gutnick and E. Rosenberg, Appl. Environ.
Microbiol., 37 (1979) 414.
[76] M.C. Cirigliano and G.M Carman, Appl. Environ. Microbiol., 50 (1985) 846.
[77] G. Whyte, S.J. Slagman, F. Pietrantonio, L. Bourbonniere, S.F. Koval, J.R. Lawrence,
W.E. Inniss and C.W. Greet, Appl. Environ. Microbiol., 65 (1999) 2961.
[78] S.J. Hamza, A.S. Abbas and A.A. Halob, J. Islamic Academy Sci., 7 (1994) 1.
[79] S. Lin, M.A. Minton, M.M. Sharma and G. Georgiou, Appl. Environ. Microbiol., 60
(1994) 31.
[80] T.H. Nielsen, D. Sorensen, C. Tobiasen, J.B. Andersen, C. Christophersen, M. Givskov
and J. Sorensen, Appl. Environ. Microbiol., 68 (2002) 3416.
[81 ] A.J. Cutler and R.J. Light, J. Biol. Chem., 254 (1979) 1944.
[82] D.R. Cameron, D.G. Cooper and R.J. Neufeld, Appl. Environ. Microbiol., 54 (1988)
1420.
[83] M. Shimazu, M. Saito and K. Yamauchi, Agric. Biol. Chem., 49 (1985) 189.
[84] M. Hattori and K. Takahashi, Food Hydrocol., 7 (1993) 325.
[85] C.W. Cumper and A.E. Alexander, Trans. Faraday Soc., 46 (1950) 235.
[86] E. Dickinson, B.S. Murray, G. Stainsby and D.M.W. Anderson, Food Hydrocol., 2
(1988)477.
[87] M. Shimazu, T. Kamiya and K. Yamauchi, Agric. Biol. Chem., 45 (1981) 2491.
[88] J.E. Kinsella, Crit. Rev. Food Sci. Nutr., 21 (1984) 197.
[89] R.D. Waniska and J.E. Kinsella, J. Agric. Food Chem., 33 (1985) 1143.
[90] E. Dickinson and M. Lal, Adv. Molec. Rel. Intern. Processes, 17 (1980) 1.
[91 ] J.A. Defeijter and J. Benjamins, J. Colloid Interf. Sci., 9 (1982) 289.
[92] E. Dickinson and S.E. Euston, Molec. Phys., 68 (1989) 407.
[93] E. Dickinson and S.E. Euston, J. Chem. Soc. Faraday Trans., 86 (1990) 805.
[94] E. Dickinson (ed.), Food Polymers, Gels and Colloids, The Royal Society of Chemistry,
Cambridge, 1991, pp 113-122.
[95] G.O. Philips, D.J. Wedlock and P.A. Williams (eds.), Gums and Stabilizers for the Food
Industry, Oxford University Press, Oxford, 1992, pp. 351-362.
[96] N.S. Hettiarachchy and G.R. Ziegler (eds.), Protein, Functionality in Food System,
Marcel Dekker, N.Y., 1994, pp. 225-259.
[97] K. Watanabe, H. Toyokawa, A. Shimada and S. Arai, J. Food Sci., 46 (1981) 1467.
[98] M. Saito, M. Ogasawara, K. Chikuni and M. Shimizu, Biosci. Biotechnol. Biochem., 59
(1995) 388.
[99] Z. Mozaffar and Z.U. Haque, Food Hydrocol., 5 (1994) 573.
[100] S.W. Lee, M. Shimizu, S. Kaminogawa and K. Yamauchi, Agric. Biol. Chem., 51
(1987) 161.
[101 ] M. Saito, K. Chikuni, M. Monma and M. Shimizu, Biosci. Biotechnol. Biochem., 57
(1993) 952.
[102] M. Watanabe, N. Fujii and S. Arai, Agric. Biol. Chem., 46 (1982) 1587.
[103] E. Dickinson and D. Lorient (eds.), Food Macromolecules and Colloids, The Royal
Society of Chemistry, Cambridge, 1995 pp. 1-19.
[104] G. Williamson, C.B. Faulds, J.A. Matthews, V.J. Morris and G.J. Brownsey, Carbohyd.
Polymers, 13 (1990) 3 87.
[105] J.R. Mitchell and D.A. Ledward (eds.), Functional properties of food macromolecules,
Elsevier Applied Science, London, 1986, pp. 315-354.
[106] Y.A. Antonov, N.P. Lashko, Y.K. Glotova, A. Malovikova and O. Markovich, Food
Hydrocol., 10 (1996) 1.
[107] V.B. Tolstoguzov and E.E. Braudo, J. Disp. Sci. Technol., 6 (1985) 575.
278
[108] K.D. Schwenke and R. Mothes (eds.), Food Proteins. Structure and Functionality, VCH,
Weinheim, 1993, pp. 203-209.
[109] G.O. Philips, P.A. Williams and D.J. Wedlock (eds.), Gums and Stabilisers for the Food
Industry, IRL Press, Oxford, 1994, pp. 115-124.
[110] V. Grinberg and V.B. Tolstoguzov, Food Hydrocol., 11 (1997) 145.
[111] N. Garti, Y. Slavin and A. Aserin, Food Hydrocol., 13 (1998) 145.
[112] N. Garti and M.E. Leser, Polym. Adv. Technol., 12 (2001) 123.
[113] W. Liu and T. Sato, Carbohydr. Research, 160 (1987)267.
[114] J. Greener, B.A. Contestable and M.D. Bale, Macromolecules, 20 (1987) 2490.
[115] E. Dickinson (ed.), Food Emulsions and Foams, The Royal Society of Chemistry,
London, 1987, pp. 1-29.
[116] G.O. Philips, P.A. Williams and D.J. Wedlock (eds.) Gums and Stabilizers for the Food
Industry, IRL Press, Oxford, 1990, pp. 157-175.
[117] G.L. Hasenhuettle and R.W. Hartel (eds.), Food Emulsifiers and their Applications,
Thomson Publishing, 1997.
[118] S.E. Hill, A.P. Ledward and J.R. Mitchell (eds.), Functional Properties of Food
Macromolecules, Aspen Publisher, Maryland, 1998, pp. 252-277.
[119] Y. Cao, E. Dickinson and D.J. Wedlock, Food Hydrocol., 5 (1991) 443.
[120] E. Dickinson, V.B. CJalazka and D.M.W. Anderson, Carbohyd. Polymers, 14 (1991)
373.
[121 ] E. Dickinson and P. Walstra (eds.) Food colloids and polymers: stability and
mechanical properties, The Royal Society of Chemistry, Cambridge, 1993, pp. 3-15.
[122] V. Ya, V. Grinberg and V.B. Tolstoguzov, Food Hydrocol., 11 (1997) 145.
[123] A. Kato, T. Sato and K. Kobayashi, Agric. Biol. Chem., 53 (1989) 2147.
[124] A. Kato, Y. Sasaki, R. Furuta and K. Kobayashi, Agric. Biol. Chem., 54 (1990) 107.
[125] S. Nakamura, A. Kato and K. Kobayashi, J. Agric. Food Chem., 40 (1992) 735.
[ 126] M. Hattori, S. Imamura, K. Nagasawa and K. Takahashi, Biosci. Biotech. Biochem., 58
(1994) 174.
[127] M. Hattori, S. Imamura, K. Nagasawa and K. Takahashi, J. Agric. Food Chem., 42
(1994) 2120.
[128] E. Dickinson and V.B. Galazka, Food Hydrocol., 5 (1995) 281.
[129] K. Nagasawa, K. Takahashi and M. Hattori, Food Hydrocol., 10 (1996) 63.
[130] J.M.V. Blanshard and J.R. Mitchell (eds.) Polysaccharides in Food, Butterworths,
London, 1979, pp. 205-217.
[131 ] J.R. Mitchell and D.A. Ledward (eds.), Functional Properties of Food Macromolecules,
Elsevier Applied Science, London, 1986, pp. 385-415.
[132] M. Ahmed and E. Dickinson, Colloid Surface, 47 (1990) 353.
[133] N. Garti and D. Reichman, Food Hydrocol., 8 (1994) 155.
[134] R.C. Randall, G.O. Philips and P.A. Williams, Food Hydrocol., 2 (1988) 131.
[135] J.E. Mckay, G. Stainsby and E.L. Wilson, Carbohyd. Polymers, 5 (1985) 223.
[136] K. Nishinari and E. Doi (eds.) Food Hydrocolloid-structures, properties and functions,.
Plenum Press, N.Y., 1982, pp. 211-224.
[137] Y.A. Antonov, J. Lefevre and J. Doublier, Appl. Polymer Sci., 71 (1999)471.
[138] P. Harris (ed.), Food Gels, Elsevier Applied Science, London, 1990, pp. 291-359.
[139] H. Bach, Y. Berdichevsky and D. Gutnick, Appl. Environ. Microbiol., 69 (2003) 2608.
[140] D.L. Gutnick and H. Bach. US Patent No. 6 512 014 (2003).
[141 ] S. Ohashi, F. Ura, M. Takeuchi, H. Lida, K. Sakaue, T. Ochi, S. Ukai and K. Hiramatsu,
Food Hydrocol., 4 (1990) 323.
[142] E. Dickinson and K. Pawlowsky, Food Hydrocol., 12 (1998)417.
279
[143] K. Maenaka, G. Kawai, K. Watanabe, F. Sunada and I. Kumagai, J. Biol. Chem., 269
(1994) 7070.
[144] J.W. Goodwin (ED.), Colloidal Dispersions, The Royal Society of Chemistry, London,
1982, pp. 99-128.
[145] M.A. Muchkin, E.S. Wajnermann and V.B. Tolstoguzov, Nahrung, 20 (1976) 313.
[146] R.G. Chilvers and V.J. Morris, Carbohyd. Polymers, 7 (1987) 111.
[147] H.R. Kruyt (ed.), Colloid Science: reversible systems, Elsevier, Amsterdam, 1949,pp.
232-258.
[148] D.A. Imeson, A.P. Ledward and J.R. Mitchell, J. Sci. Food Agric., 28 (1977) 661.
[149] E. Rosenberg, A. Zuckerberg, C. Rubinovitz and D.L. Gutnick, Appl. Environ.
Microbiol., 37 (1979) 402.
[150] E. Rosenberg, A. Perry, D.T. Gibson and D.L. Gutnick, Appl. Environ. Microbiol., 37
(1979) 409.
[151 ] D. Gutnick, Biopolymers, 26 (1987) $223.
[152] N. Kosaric (ed.), Biosurfactants and Biotechnology, Marcel Dekker, N.Y., 1987, pp.
211-246.
[153] K.J. Towner, E. Bergogne-Berezin and C.A. Fewson (eds.) The Biology of
Acinetobacter, Plenum Press, N.Y., 1991, pp. 411-441.
[154] D.L. Gutnick, E. Rosenberg and Y. Shabtai. US Patent No. 4 234 689 (1980).
[155] D.L. Gutnick, E. Rosenberg, I. Belsky andZ. Zosim. US Patent No. 4 311 830 (1982).
[156] D.L. Gutnick, E. Rosenberg, I. Belsky and Z. Zosim. US Patent No. 4 395 354 (1983).
[157] N. Kaplan, E. Rosenberg, B. Jann and K. Jann, Eur. J. Biochem., 152 (1985) 453.
[158] D.L. Gutnick, Personal Communication, (2004).
[159] C.R. Macdonald, D.G. Cooper and J.E. Zajic, Appl. Environ. Microbiol., 41 (1981) 117.
[160] D.G. Cooper, J.E. Zajic and D.F. Gerson, Appl. Environ. Microbiol., 37 (1979) 4.
[161 ] A. Gorkovenko, J. Zhang, R.A. Gross, A.L. Allen and D.L. Kaplan, Can. J. Microbiol.,
43 (1997) 384.
[162] A. Gorkovenko, J. Zhang, R.A. Gross, D.L. Kaplan and A.L. Allen, Carbohydr. Polym.,
39(1999)79.
[163] A.K. Johri, W. Blank and D.L. Kaplan, Appl. Microbiol. Biotechnol., 59 (2002) 217.
[164] J. Zhang, A. Gorkovenko, R.A. Gross, A.L. Allen and D. Kaplan, Int. J. Biol.
Macromol., 20 (1997) 9.
[165] I. Belsky, D.L. Gutnick and E. Rosenberg, FEBS Lett., 101 (1979) 175.
[166] Y. Shabtai and D.L. Gumick, Appl. Environ. Microbiol., 49 (1985) 192.
[167] B.K. Tuleva, G.R. Ivanov and N.E. Christova, Naturforsch, 57C (2002) 356.
[168] A.M. Davila, R. Marchal and J.P. Vandecasteele, Appl. Microbiol. Biotechnol., 47
(1997) 496.
[169] Z. Zosim, D.L. Gutnick and E. Rosenberg, Biotechnol. Bioeng., 25 (1983) 1725.
[170] D.L. Gutnick and H. Bach, Appl. Microbiol. Biotechnol., 54 (2000) 451.
[171 ] S. Goldman, Y. Shabtai, C. Rubinobitz, E. Rosenberg and D. Gutnick, Appl. Environ.
Microbiol., 44 (1982) 165.
[172] Y. Shabtai and D.L. Gutnick, J Bacteriol., 161 (1985) 1176.
[173] S.D. Wang and D.I.C. Wang, Biotechnol. Bioeng., 36 (1990) 402.
[174] O. Pines and D. Gutnick, J. Bacteriol., 157 (1984) 179.
[175] O. Pines, Y. Shoham, E. Rosenberg and D.L. Gutnick, Appl. Microbiol. Biotechnol., 28
(1988) 93.
[176] Y. Shoham, M. Rosenberg and E. Rosenberg, Appl. Environ. Microbiol, 46 (1983) 573.
[177] M. Rosenberg and E. Rosenberg, J. Bacteriol., 148 (1981) 51.
280
[ 178] M. Rosenberg, A. Perry, E.A. Bayer, D.L. Gutnick, E. Rosenberg and I. Ofek, Infect.
Immun., 33 (1981) 29.
[179] T. Ophir and D. Gutnick, Appl. Environ. Microbiol., 60 (1994) 740.
[180] D. Nakar and D.L. Gutnick, Microbiology, 147 (2001) 1937.
[181 ] D. Nakar and D.L. Gutnick, J. Bacteriol, 185 (2003) 1001.
[182] Mijakovic, S. Poncet, G. Boel, A. Maze, S. Gillet, E. Jamet, P. Decottignies, C.
Grangeasse, P. Doublet, P. Le_Marechal and J. Deutscher, Embo J., 22 (2003) 4709.
[183] Y. Shoham, E. Rosenberg and D.L. Gutnick, US Patent No. 4 704 360 (1983).
[184] P.G. Reddy, R. Allon, M. Mevarech, S. Mendelovitz, Y. Sato and D.L. Gutnick, Gene,
76 (1989) 145.
[185] R. Alon, Esterase from the oil-degrading Acinetobacter lwoffii RAG-l expression of
the est gene and protein characterization. Ph.D. Thesis, Tel-Aviv University (1993).
[186] R.N. Alon and D.L. Gutnick, FEMS Microbiol. Lett., 112 (1993) 275.
[187] R.N. Alon, L. Mirny, J.L. Sussman and D.L. Gutnick, FEBS Lett, 371 (1995) 231.
[188] R.G. Kok, J.J. Van_Thor, I.M. Nugteren_Roodzant, M.B. Brouwer, M.R. Egmond, C.B.
Nudel, B. Vosman and K.J. Hellingwerf, Mol. Microbiol., 15 (1995) 803.
[189] H. Bach, Y. Mazor, S. Shaky, A. Shoham_Lev, Y. Berdichevsky, D.L. Gutnick and I.
Benhar, J. Mol. Biol., 312 (2001) 79.
[190] N. Sar and E. Rosenberg, Curt. Microbiol., 9 (1983) 309.
[ 191 ] A. Toren, E. Orr, Y. Paitan, E.Z. Ron and E. Rosenberg, J. Bacteriol., 184 (2002) 165.
[192] A. Toren, E.Z. Ron, R. Bekerman and E. Rosenberg, Appl. Microbiol. Biotechnol, 59
(2002) 580.
[193] E. Pessione, M.G Giuffrida, L. Prunotto, C. Barello, R. Mazzoli, D. Fortunato, A. Conti
and C. Giunta, 3 (2003) 1070.
[194] E. Rosenberg, C. Rubinobitz, A. Gottlieb, S. Rosenhak and E.Z. Ron, Appl. Environ.
Microbiol., 54 (1988) 317.
[195] W.H. Taylor and E. Juni, J. Bacteriol., 81 (1961 )688.
[196] N. Kaplan, Z. Zosim and E. Rosenberg, Appl. Environ. Microbiol., 53 (1987) 440.
[197] O. Abian, C. Mateo, G. Fernandez_Lorente, J.M. Guisan and R. Fernandez_Lafuente,
Biotechnol. Progr., 19 (2003) 1639.
[198] F. Arendt, M. Hinsenveld, and W.J. van den Brink (eds.), Contaminated soil '90,
Kluwer Academic Publishers, Dordrecht, The Netherlands, 1990, pp. 491-492.
[199] C.N. Mulligan, T.Y.K. Chow and B.F. Gibbs, Appl. Microbiol. Biotechnol., 31 (1989)
486.
[200] G.L. Ghurye, C. Vipulanandan and R.C. Willson, Biotechnol. Bioeng., 44 (1994)661.
[201 ] M.E. Mercade, M.A. Manresa, M. Robert, M.J. Espuny, C. De Andres and J. Guinea,
Bioresource Technol., 43 (1993) 1.
[202] M.E. Mercade and M.A. Manresa, J. Am. Oil Chem. Soc., 71 (1994) 61.
[203] H.J. Daniel, R.T~ Otto, M. Binder, M. Reuss, and C. Syldatk, Appl. Microbiol.
Biotechnol., 51 (1999) 40.
[204] U.A. Ochsner, A. Fiechter and J. Reiser, J. Biol. Chem., 269 (1994) 19787.
[205] U.A. Ochsner, J. Reiser, A. Fiechter and B. Witholt, Appl. Environ. Microbiol., 61
(1995) 3503.
[206] W.C. Mccaffrey and D.G. Cooper, J. Ferment. Bioeng., 79 (1995) 146.
[207] M.E. Hayes, K.R. Hrebenar, P.L. Murphy, L.E. Futch Jr., J.F. Deal m and P.L. Bolden
Jr. US Patent No. 4 684 372 (1987).
[208] M.E. Hayes, K.R. Hrebenar, P.L. Murphy, L.E. Futch Jr., J.F. Deal Ill and P.L. Bolden
Jr. US Patent No. 4 793 826 (1988).
281
[209] M.E. Hayes, K.R. Hrebenar, P.L. Murphy, L.E. Futch Jr., J.F. Deal 111and P.L. Bolden
Jr.US Patent No. 4 821 757 (1989).
[210] M.E. Hayes, K.R. Hrebenar, J.L. Minor and L.M. Woodworth, US Patent No. 4 886 519
(1989).
[211 ] D.L. Gutnick and E. Rosenberg, Ann. Rev. Microbiol., 31 (1977) 379.
[212] I.M. Banat, N. Samarah, M. Murad, R. Home and S. Benerjee, World J. Microbiol.
Biotechnol., 7 (1991) 80.
[213]M.E. Hayes, K.R. Hrebenar, J.F. Deal II1 and P.L. Bolden Jr. US Patent No. 4 666 457
(1987).
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Elsevier B.V. All rights reserved. 283
Chapter 10
1. INTRODUCTION
large gas fields, sometimes associated with oil reservoirs, or be obtained from
unconventional sources such as shale, coalbeds, or tight sands. The use of
natural gas is becoming increasingly popular due to its abundance across the
globe. Further, the lower price of natural gas relative to oil makes it an attractive
energy source [5]. Natural gas is also a cleaner energy source than oil or coal,
and thus can help reduce greenhouse gas emissions [6]. Natural gas combustion
produces only about 56% and 71% of the CO2 associated with the equivalent
amount of energy produced from coal or oil, respectively [Energy Information
Administration (1999). Natural Gas 1998: Issues and Trends (http://www.eia.
doe. gov/oil_gas/natural_gas/analysis_publications/natural_gas_ 1998_issues_and
_trends/it98.html). Moreover, methane use results in less NOx, SO2, and
particulates per equivalent amount of energy generated, relative to other sources.
Despite the increasing use of natural gas and its attendant environmental
advantages, world reliance on oil is unlikely to wane in the near future given the
existing energy infrastructure and the aforementioned dependence of many
societies on this energy form. However, there is a biotechnological link between
oil and natural gas that is the product of the relatively recent recognition that
many hydrocarbons are susceptible to anaerobic biodegradation and can be
converted to methane and carbon dioxide [7-9]. Unlike the well-documented
patterns of aerobic oil biodegradation [10], anaerobic hydrocarbon metabolism
was essentially dismissed as ecologically insignificant for many years. This
view has been completely altered in recent years with the growing appreciation
for the metabolism of hydrocarbons coupled with the consumption of electron
acceptors other than oxygen.
Not surprisingly then, the majority of world oil reserves are believed to be
biodegraded to at least some degree, but it was generally accepted that aerobic
oxidation processes were largely responsible for such alterations [11, 12].
Recent evaluations of many petroliferous formations have convincingly argued
that it is actually anaerobic processes that predominate in oil and gas reservoirs,
sometimes leading to the production of biogenic methane [12-14]. Geological
evidence has suggested that such methanogenic processes occur very slowly
over millennia, and are most important in reservoirs shallower than 4 km and at
temperatures of less than 80~ [12, 15, 16]. Microbial decay of oils in deep
subsurface reservoirs can clearly reduce oil quality, and a better understanding
of the microbial principles behind such decay will be important to help
distinguish between degraded, low-value oils and untouched, high-value oils
[11]. However, if methanogenesis continues to be identified as an important
process in deep reservoirs worldwide, the recovery of methane gas as an
alternate form of energy from otherwise unrecoverable or biodegraded sources
might have far-reaching economic and environmental implications.
The purpose of this chapter is to review evidence for anaerobic
hydrocarbon biodegradation and to provide an overview of some of the more
285
2. ANAEROBIC H Y D R O G E N M E T A B O L I S M
only initiate alkane degradation via fumarate addition, but most probably share
the entire degradation pathway.
Polycyclic aromatic hydrocarbons (PAHs) are also susceptible to
anaerobic decay. Naphthalene can be completely mineralized by pure cultures of
sulfate-reducing and denitrifying bacteria [87, 88]. Enrichments from coal-tar
contaminated sediments and garden soil were reported to mineralize [~4C]-
naphthalene with soluble Fe(III) and insoluble FeOOH, although not more than
15% of added radioactive substrate was recovered as 14C02 [89]. Anaerobic
degradation of phenanthrene was also demonstrated in sediments [22, 90] and by
a sulfate-reducing enrichment culture [91 ]. Studies with marine sediments also
indicated the loss of 2 to 5-ringed PAHs under anaerobic conditions, with the
smaller PAHs degrading more rapidly than the heavier molecular weight
counterparts [90]. It has been shown that unsubstituted PAHs, such as
naphthalene and phenanthrene, are initially attacked by carboxylation to form 2-
naphthoic acid and phenanthrenecarboxylic acid, respectively [91, 92]. The
carbon in both cases arises from inorganic CO2. 2-Methylnaphthalene is
converted to 2-naphthoic acid following the anaerobic oxidation of the methyl
group [93]. A mechanism for the activation of 2-methylnaphthalene is the
addition of fumarate to the methyl group [92, 94]. The product of this reaction,
naphthyl-2-methyl-succinic acid, is subsequently oxidized to 2-naphthoic acid
which further decomposes by ring reduction reactions to form the fully saturated
decalin-2-carboxylic acid prior to ring cleavage and ultimate mineralization [91,
92, 95].
Alicyclic hydrocarbons can comprise a substantial fraction (often up to
~12% wt/wt) of the organic molecules in petroleum mixtures. Despite this
quantitative importance, little is known about the metabolic fate of this class of
materials. Recently, a study of the anaerobic metabolism of a model alicyclic
hydrocarbon, ethylcyclopentane, revealed that it too was initially activated by
fumarate addition to form ethylcyclopentylsuccinic acid [25]. Wilkes et al. [84]
recently observed that when the denitrifying strain HxN1 was incubated with
crude oil, a series of C4 to Cs n-alkanes as well as cyclic alkanes, were activated
to their corresponding alkylsuccinates and methyl-branched fatty acids. Further,
cyclopentane, cyclohexane, and their methyl-and ethyl substituted congeners
were rapidly consumed in live incubations of sulfate-amended anoxic sediment
enrichments from a gas condensate-contaminated aquifer [26]. Though alicyclic
biodegradation was more extensive under sulfate-reducing conditions, there was
biodegradation of simpler alicyclic compounds under methanogenic conditions.
In parallel methanogenic incubations, 90% of cyclopentene and methyl-
cyclopentene was lost in 100 days [26]. Thus, this class of materials is also
susceptible to methanogenic biodegradation.
290
3. C H E M I C A L T H E O R Y AND THE S U S C E P T I B I L I T Y OF
HYDROCARBONS TO FUMARATE ADDITION REACTIONS
RH--~ R + H (1)
the relatively higher bond dissociation energies, fumarate addition to the alkyl
side chain of an alkylated alicyclic hydrocarbon is therefore unexpected.
Table 1
Bond Dissociation Energies (AHe9s) at 298 K for various hydrocarbons in the reaction
RH -9 R" + H" Bolded hydrogen atom represents abstracted hydrogen.
Alicyclic Alkanes
A I ~ I Aromatics
Y-C6HsCI-I(CH3)2
( iso-prop ylbenzene - substituted)
Y = 2,5 dimethyl 86.7 [ 107]
Y = 4-t-butyl 83.5 [ 107]
C6H5C(CH3)2CH2-H (t-butylbenzene) 98.7 [ 107]
Naphthalene-H
(C1 position) 112.2 +/- 1.3 [108]
(C2 position) 111.9 +/- 1.4 [ 108]
Naphthalene-CH2-H
(CH3 at C~ position) 85.1 +/- 1.5 [105]
(CH3 at C2 position) 85.6 [ 107]
293
4. G E O C H E M I C A L INDICATORS OF M E T H A N O G E N I C OIL
BIODEGRADATION
yet been identified in oils, but they may be so polar that they primarily partition
to the aqueous phase.
5. P R O S P E C T S F O R H Y D R O C A B O N M E T H A N O G E N E S I S
to produce methane gas that could help decrease the viscosity of oil and aid in
further recovery. What if such an inoculation procedure resulted in at least some
fraction of the available energy being recovered as usable methane gas? Such
speculative technology is quite far from being addressed or realized, especially
from an economic point of view, but initial laboratory experimentation on this
topic has been promising (Fig. 1). Samples (10 g) taken from a field in Nowata,
OK that had undergone secondary oil recovery procedures (water flooding) were
used to test the importance of a methane-producing oil-degrading inoculum
enriched from a gas-condensate contaminated aquifer [9]. When residual oil
core samples were ground or broken into small portions, the oil-degrading
inoculum was effective in stimulating methanogenesis relative to a variety of
controls. The latter included a heat-inactivated preparation, an oil-unamended
control, and production water from the same field that received the inoculum (
Fig. 1).
Interestingly, the rate of methanogenesis was much greater with the
residual oil core samples than that observed when a standard oil or even when
the formation (Nowata) crude alone served as a substrate for the inoculum.
While the reasons for this result are under investigation, it is clear that such
inocula may play a potential role for the enhanced recovery of methane from oil
trapped in mature reservoirs.
2500-
0
2000
E
::k
1500
c-
r
1000
500
Fig. 1. Methane production from residual oil in core samples inoculated with a methanogenic
bacterial enrichment capable of anaerobic hydrocarbon metabolism. Symbols: Oil unamended
control (,); Nowata crude oil (m); Production water (X); An artificially weathered Alaska
north slope oil standard (A); Crushed core (o); Pebbled core (o). Heat inactivated and
uninoculated controls are not depicted, but were uniformly negative.
300
REFERENCES
[1] National Research Council (NRC). (2003). Committee on Oil in the Sea: Inputs, Fates,
and Effects, Ocean Studies Board and Marine Board, Divisions of Earth and Life
Studies and Transportation Research Board, NRC. In: Oil in the sea III : Inputs, fates,
and effects. The National Academies Press, Washington, D.C.
[21 Energy Information Administration (EIA). (2004).
www.eia.doe, gov/oiaf/ieo/index.html.
[3] C. Hall, P. Tharakan, J. Hallock, C. Cleveland, and M. Jefferson. Nature 426 (2003)
318.
[4] J.B. Curtis and S.L. Montgomery. AAPG Bull. 86 (2002) 1671.
[5] S.M. A1-Fattah and R.A. Startzman. SPE Journal, May (2000) 62-72.
[6] S. Bachu and S. Stewart. J. Can. Petrol. Technol. 41 (2002) 32.
301
[7] Zengler, K., H.H. Richnow, R. Rosell6-Mora, W. Michaelis, and F. Widdel. Nature 401
(1999) 266.
[8] Anderson, R.T. and D.R. Lovley.. Nature 404 (2000) 722.
[9] Townsend, G.T., R.C. Prince, and J. M. Suflita.. Environ. Sci. Technol. 37 (2003)
5213.
[10] Prince, R. C. (2002). Petroleum and other hydrocarbons, biodegradation of. In
Encyclopedia of Environmental Microbiology; Bitton, G. Ed.; John Wiley, New York,
pp. 2402-2416.
[ 11 ] R61ing, W.F.M., I.M. Head, and S.R. Larter. Res. Microbiol. 154 (2003) 321.
[12] Head, I. M., D.M. Jones, and S.R. Larter. Nature 246 (2003) 344.
[13] Sakata, S., Y. Sano, Maekawa, T., and Igari, S.-I. Org. Geochem. 26 (1997) 399.
[ 14] Pallasser R.J. Org. Geochem. 31 (2000) 1363.
[ 15] Wenger, L.M., C.L. Davis, G.H. Isaksen. (2001). Multiple controls on petroleum
biodegradation and impact on oil quality. SPE paper 71450.
[ 16] Larter, S., A. Wilhelms, I. Head, M. Koopmans, A. Aplin, R. DiPrimo, C. Zwach, M.
Erdmann, N. Telnaes. Org. Geochem. 34 (2003) 601.
[ 17] Tissot, B.P. and D.H. Welte. 1984. Petroleum Formation and Occurrence. Springer-
Verlag, Berlin.
[ 18] Prince, R. C., R.M. Garrett, R.E. Bare, M.J. Grossman, G.T. Townsend, J.M. Suflita, K.
Lee, E.H. Owens, G.A. Sergy, J.F. Braddock, J.E. Lindstrom, and R.R. Lessard. Spill
Sci. Technol. Bull. 8 (2003) 145.
[19] Britton, L. 1984. Microbial degradation of aliphatic hydrocarbons. In D. T. Gibson
(Ed.), Microbial degradation of organic compounds, Marcel Dekker, Inc., New York,
pp. 89-129.
[20] Gibson, D.T. and V. Subramanian. 1984. Microbial degradation of aromatic
hydrocarbons. In T.D. Gibson (ed.), Microbial degradation of organic compounds,
Marcel Dekker, Inc., New York, pp.181-252.
[21] Krumholz, L.R., M.E. Caldwell, and J. M. Suflita. (1996). Biodegradation of"BTEX"
hydrocarbons under anaerobic conditions. In Bioremediation Principles and
Applications. (R.L. Crawford and D. L. Crawford, Eds.) Cambridge University Press,
Great Britain, pp. 61-99.
[22] Coates, J.D., R.T. Anderson, and D.R. Lovley. Appl. Environ. Microbiol. 62 (1996)
1099.
[23] Widdel, F., and R. Rabus. Curr. Opin. Biotechnol. 12 (2001) 259.
[24] Spormann, A.M. and F. Widdel. Biodegradation 11 (2000) 85.
[25] Rios-Hernandez, L.A., L.M. Gieg, and J.M. Suflita. Appl. Environ. Microbiol. 69
(2003) 434.
[26] Townsend, G.T., R.C. Prince, and J.M. Suflita. FEMS Microbiol. Ecol. (2004). (in
press).
[27] Biegert, T., G. Fuchs, and J. Heider. Eur. J. Biochem. 238 (1996) 661.
[28] Beller, H.R. and A.M. Spormann. J. Bacteriol. 179 (1997) 670-676.
[29] Leuthner, B., C. Leutwein, H. Schulz, P. H6rth, W. Haehnel, E. Schiltz, H. Sch~igger,
and J. Heider. Mol. Microbiol. 28 (1998) 615.
[30] Krieger C.J., W. Roseboom, S.P.J. Albracht, and A.M. Spormann. J. Biol. Chem. 276
(2001) 12924.
[31] Rabus, R. andJ. Heider. Arch. Microbiol. 170 (1998) 377.
[32] Beller, H.R. and A.M. Spormann. Appl. Environ. Microbiol. 63 (1997) 3729.
[33] Kane, S.R., H.R. Beller, T.C. Legler, and R.T. Anderson. Biodegradation 13 (2002)
149.
302
[34] Beller, H.R. and E.A. Edwards. Appl. Environ. Microbiol. 66 (2000) 5503.
[35] Zengler, K., J. Heider, R. Rosell6-Mora, and F. Widdel. Arch. Microbiol. 172 (1999)
204.
[36] Heider, J., A.M. Spormann, H.R. Beller, and F. Widdel. FEMS Microbiol.Rev. 22
(1999) 459.
[37] Leutwein C. and J. Heider. Arch. Microbiol. 178 (2002) 517.
[38] Leutwein, C. and J. Heider. J. Bacteriol. 183 (2001)4288.
[39] Harwood, C.S., G. Burchhardt, H. Hen'mann, and G. Fuchs. FEMS Microbiol.Rev. 22
(1999) 439.
[40] Chee-Sanford, J.C., J.W. Frost, M.R. Fries, J. Zhou, and J. Tiedje. Appl. Environ.
Microbiol. 62 (1996) 964.
[41] Edwards, E.A., L.E. Wills, M. Reinhard, and D. Grbic-Galic. Appl. Environ. Microbiol.
58 (1992) 794.
[42] Rueter, P., R. Rabus, H. Wilkes, F. Aeckersberg, F. A. Rainey, H.W. Jannasch, and F.
Widdel. Nature 372 (1994) 455.
[43] Elshahed, M.S., L.M. Gieg, M.J. McInemey, and J.M. Suflita. Environ. Sci. Technol.
35 (2001) 682.
[44] Rabus, R., H. Wilkes, A. Schramm, G. Harms, A. Behrends, R. Amann, and F. Widdel.
Environ. Microbiol. 1 (1999) 145.
[45] Edwards, E.A. and D. Grbic-Galic. Appl. Environ. Microbiol. 60 (1994) 313.
[46] H~iner, A., P. H6hener, and J. Zeyer. Appl. Environ. Microbiol. 61 (1995) 3185.
[47] Dolfing J., J. Zeyer, P. Binder-Eicher, and R.P. Schwarzenbach. Arch. Microbiol. 154
(1990) 336.
[48] Fries, M.R., J. Zhou, J. Chee-Sanford, and J.M. Tiedje. Appl. Environ. Microbiol. 60
(1994) 2802.
[49] Rabus, R. and F. Widdel. Arch. Microbiol. 163 (1995) 96.
[50] Hess, A., B. Zarda, D. Hahn, A. H~ner, D. Stax,, P. H6hener, and J. Zeyer. Appl.
Environ. Microbiol. 65 (1997) 2136.
[51 ] Harms, G., K. Zengler, R. Rabus, F. Aeckersberg, D. Minz, R. Rossell6-Mora, and F.
Widdel. Appl. Environ. Microbiol. 65 (1999) 999.
[52] Krieger, C.J., H.R. Beller, M. Reinhard, and A.M. Spormann. J. Bacteriol. 181 (1999)
6403.
[53] Achong, G.R., A.M. Rodriguez, and A.M. Spormann. J. Bacteriol. 183 (2001) 6763.
[54] Beller, H.R. and A.M. Spormann. (1999). FEMS Microbiol. Lett. 178 147.
[55] Beller, H.R., A.M. Spormann, P.K. Sharma, J.R. Cole, and M.Reinhard. Appl.
Environ. Microbiol. 62 (1996) 1188.
[56] Ball, H.A., H.A. Johnson, M. Reinhard, and A.M. Spormann. J. Bacteriol. 178 (1996)
5755.
[57] Johnson, H.A., D.A. Pelletier, and A.M. Spormann. J. Bacteriol. 183 (2001) 4536.
[58] Kniemeyer, O., T. Fischer, H.Wilkes, F.O. G16ckner, and F. Widdel. Appl. Environ.
Microbiol. 69 (2003) 760.
[59] Burland, S.M. and E.A. Edwards. (1999). Appl. Environ. Microbiol. 65 529.
[60] Coates, J.D., R. Chakraborty, J.G. Lack, S.M. O'Connor, K.A. Cole, K.S. Bender, and
L.A. Achenbach. Nature 411 (2001) 1039.
[61 ] Ulrich, A C. and E.A. Edwards. Environ. Microbiol. 5 (2003) 92.
[62] Edwards, E.A. and D. Grbic-Galic. Appl. Environ. Microbiol. 58 (1992) 2663.
[63] Lovley, D.R., J.D. Coates, J.C. Woodward, and E.J.P. Phillips. Appl. Environ.
Microbiol. 61 (1995) 953.
303
[64] Coates, J.D., R.T. Anderson, J.C. Woodward, E.J.P. Phillips, and D.R. Lovley.
Environ. Sci. Technol. 30 (1996) 2784.
[65] Weiner, J. and D.R. Lovley. Appl. Environ. Microbiol. 64 (1998) 775.
[66] Lovley, D.R., J.C. Woodward, and F.H. Chapelle. Nature 370 (1994) 128.
[67] Anderson, R.T., J.N. Rooney-Varga, C.V. Gaw, and D.R. Lovley. Environ. Sci.
Technol. 32 (1998) 1222.
[68] Caldwell, M.E., R.S. Tanner, and J.M. Suflita. Anaerobe 5 (1999) 595.
[69] Grbic-Galic, D. and T. Vogel. Appl. Environ. Microbiol. 53 (1987) 254.
[70] Kazumi, J., M.E. Caldwell, J.M. Suflita, D.R. Lovley, and L.Y. Young. Environ. Sci.
Technol. 31 (1997) 813.
[71] Weiner, J. and D.R. Lovley. Appl. Environ. Microbiol. 64 (1998) 1937.
[72] Coates, J.D., R. Chakraborty, and M.J. Mclnemey. Res. Microbiol. 153 (2002) 621.
[73] Caldwell, M.E. and J.M. Suflita. Environ. Sci. Technol. 34 (2000) 1216.
[74] Phelps, C.D., X. Zhang, and L.Y. Young. Environ. Microbiol. 3 (2001) 600.
[75] Aeckersberg, F., F. Bak, and F. Widdel. Arch. Microbiol. 156 (1991) 5-14.
[76] Aeckersberg, F., F. Rainey, and F. Widdel. Arch. Microbiol. 170 (1998) 361.
[77] So, C.M. and L.Y. Young. Appl. Environ. Microbiol. 65 (1999) 2969.
[78] Ehrenreich, P., A. Behrends, J. Harder, and F. Widdel. Arch. Microbiol. 173 (2000) 58.
[79] Kropp, K.G., I.A. Davidova, and J.M. Suflita. Appl. Environ Microbiol. 66 (2000)
5393.
[80] Caldwell, M.E., R.M. Garrett, R.C. Prince, and J.M. Suflita. Environ. Sci. Technol. 32
(1998)2191.
[81] Rabus, R., H. Wilkes, A. Behrends, A. Armstroff, T. Fischer, and F. Widdel. J.
Bacteriol. 183 (2001) 1707.
[82] Davidova, I., L. Gieg, K. Kropp, M. Nanny, J. Suflita. (2004) (submitted for
publication)
[83] So, C.M., C.D. Phelps, and L.Y. Young. Appl. Environ. Microbiol. 69 (2003) 3892.
[84] Wilkes, H., S. Ktihner, C. Bolm, T. Fischer, A. Classen, F. Widdel, and R. Rabus. Org.
Geochem. 34 (2003) 1313.
[85] Callaghan, A.V., L.M. Gieg, K.G. Kropp, J.M. Suflita, and L.Y. Young. (2003).
Fumarate addition during hexadecane degradation by the sulfate-reducer AK-01.
American Society for Microbiology 103-rd General Meeting, Washington, D.C.,
Abstract Q-038, p. 521.
[86] Wilkes, H., R. Rabus, T. Fischer, A. Armstroff, A. Behrends, and F. Widdel. Arch.
Microbiol. 177 (2002) 235.
[87] Galushko, A., D. Minz, B. Schink, and F. Widdel. Environ. Microbiol. 1 (1999) 415.
[88] Rockne, K.J., J.C. Chee-Sanford, R.A. Sanford, B.P. Hedlund, J.T. Staley, and S.E.
Strand. Appl. Environ. Microbiol. 66 (2000) 1595.
[89] Ramsay, J.A., H. Li, R.S. Brown, and B. Ramsay. Biodegradation 14 (2003) 321.
[90] Rothermich, M.M., L.A. Hayes, and D.R. Lovley. Environ. Sci. Technol. 36 (2002)
4811.
[91] Zhang, X. and L.Y. Young. Appl. Environ. Microbiol. 63 (1997) 4759.
[92] Annweiler, E., W. Michaelis, and R.U. Meckenstock. Appl. Environ. Microbiol. 68
(2oo2) 852.
[93] Sullivan, E.R., X. Zhang, C. Phelps, and L.Y. Young. Appl. Environ. Microbiol. 67
(2001) 4353.
[94] Annweiler, E., A. Materna, M. Safinowski, A. Kappler, H.H. Richnow, W. Michaelis,
and R.U. Meckenstock. Appl. Environ. Microbiol. 66 (2000) 5329.
[95] Zhang X, Sullivan E. R, and L.Y Young. Biodegradation. 11 (2000) 117.
304
[96] Baciocchi, E., F. D'Acunzo, C. Galli, and O. Lanzalunga. J. Chem. Soc. Perkin Trans.
2.2 (1996) 133.
[97] March, J. 1968. Advanced Organic Chemistry Reactions, Mechanisms, and Structur.e.
McGraw-Hill Book Company, New York, New York.
[98] Ruscic, B., M. Litorja, and R. Asher. J. Phys. Chem. A. 103 (1999) 8625.
[99] Saekins, P.W., M.J. Pilling, J.T. Niiranen, D. Gutman, and L.N. Krasnoperov. J. Phys.
Chem. 96 (1992) 9847.
[100] Pedley, J.B, R.D. Naylor and S.P. Kirby. 1986. Thermodynamic Data of Organic
Compounds. 2no ed., Chapman and Hall, New York
[ 101 ] Castelhano, A.L. and D. Griller. J. Amer. Chem. Soc. 104 (1982) 3655.
[102] Tumanov, V.E. and E.T. Denisov. Neftekhimiya. 41 (2001) 109.
[103] Wenthold, P.G., and R.R. Squires. J. Am. Chem. Soc. 116 (1994) 6401.
[104] Ellison, G.B., G.E. Davico, V.M. Bierbaum, and C.H. DePuy. Int. J. Mass Spectrum.
Ion Processes. 156 (1996) 109.
[105] McMillen, D.F. and D. M. Golden. Ann. Rev. Chem. 33 (1982) 493.
[ 106] Denisov, E.T. and T.G. Denosova. (2000). Handbook of Antioxidants. CRC Press, New
York.
[107] Kromkin, E.A., V.E. Tumanov, and E.T. Denisov. Neftekhimiya. 42 (2002) 3.
[ 108] Reed, D.R. and S.R. Kass. J. Mass Spectrom. 35 (2000) 534.
[ 109]Hunt, J.M. 1979. Petroleum Geochemistry and Geology, 2nd Ed. W.H.
Freeman and Company, New York, pp. 413.
[ 110] Domin6, F., R. Bounaceur, G. Scacchi, P.-M. Marquaire, D. Dessort, B. Pradier, and O.
Brevart. Org. Geochem. 33 (2002) 1487.
[ 111 ] Sassen, R., A.V. Milkov, E. Ozgul, H.H. Roberts, J.L. Hunt, M.A. Beeunas, J.P.
Chanton, D.A. DeFreitas, and S.T. Sweet. Org. Geochem. 34 (2003) 1455.
[112] Sherwood Lollar, B., T.D.Westgate, J.A. Ward, G.F. Slater, and G. Lacrampe-
Couloume. Nature 416 (2002) 522.
[113] Nauhaus, K., A. Boetius, M. Krfiger, and F. Widdel. Environ. Microbiol. 4 (2002)
296.
[ 114] Orphan, V.J., C. H. House, K.U. Hinrichs, K. D. McKeegan and E. F. DeLong.
Science 293 (2001) 484.
[ 115] Beller, H.R. Biodegradation. 11 (2000) 125.
[ 116] Gieg, L.M. and J.M. Suflita. Environ. Sci. Technol. 36 (2002) 3755.
[ 117] Griebler, C., M. Safinowski, A. Vieth, H.H. Richnow, and R.U. Meckenstock.
Environ. Sci. Technol. 38 (2004) 617.
[ 118] Barrow, M.P., L.A. McDonnell, X. Feng, J. Walker, and P.J. Derrick. Anal. Chem. 75
(2003) 860.
[119] Gabryelski, W. and K.L. Froese. Anal. Chem. 75 (2003) 4612.
[ 120] Lo, C.C., B.G. Brownlee, and N.J. Bunce. Anal. Chem. 75 (2003) 6394.
[121] Phelps, C.D., J. Battistelli, and L.Y. Young. Environ. Microbiol. 4 (2002) 532.
[122] Martus, P. and W. Puttman. Sci. Total Environ. 307 (2003) 19.
[ 123 ] Belyaev, S.S., K. Laurinavichus, A.Y. Obraztsova, S.N. Gorlatov, and M.V. Ivanov.
Microbiologiya. 51 (1982) 997.
[124] Nazina, T.N., E.P. Rozanova, and S.I. Kuznetsov. Geomicrobiol. J. 4 (1985) 103.
[ 125] Palmer, S.E. (1993). Effect ofbiodegradation and water washing on crude oil
composition. In Engel M.H., Macko S.A. (Eds.), Organic Geochemistry. Plenum Press,
New York, pp. 511-533.
[126] James, A.T. and B.J. Bums. Bull. Am. Assoc. Petrol. Geol. 68 (1984) 957.
305
[127] Ivanov, M.V., S.S. Belyaev, A.M. Zyakun, V.A. Bondar, and K.K. Laurinavichus.
Geokhimiya. 11 (1983) 1647.
[128] Borzenkov I.A., S.S. Belyaev, Y.M. Miller, I.A. Davydova, and M.V. Ivanov.
Microbiology 66 (1997) 104.
[129] Nazina, T,N., A.E. Ivanova, I.A. Borzenkov, S.S. Belyaev, and M.V. Ivanov.
Geomicrobiol. J. 13 (1995) 181.
[130] Bonch-Osmolovskaya, E.A., M.L. Miroshnichenko, A.V. Lebedinsky, N.A. Chernyh,
T.N. Nazina, V.S. Ivoilov, S.S. Belyaev, E.S. Boulygina, Y.P. Lysov, A.N. Perov, A.D.
Mirzabekov, H. Hippe, E. Stackebrandt, S. L'Haridon, and C. Jeanthon. Appl. Environ.
Microbiol. 69 (2003) 6143.
[131] Watanabe, K., Y. Kodama, N. Hamamura, and N. Kaku. Appl. Environ. Microbiol. 68
(2002) 3899.
[132] Davidova, I.A., K.G. Kropp, K.E. Duncan, and J.M. Suflita. (2002). Anaerobic
biodegradation of n-alkanes by sulfate-reducing bacterial cultures. Abstracts of the
Intemational Symposium on Subsurface Microbiology. Copenhagen, Denmark,
September 8-13.
[133] Orphan,, V.J., S.K. Goffredi, E.F. Delong, and J.R. Boles. Geomicrobiol. J. 20 (2003)
295.
[ 134] Connan, J. 1984. Biodegradation of crude oils in reservoirs. In J. Brooks, and D.H.
Welte (Eds.), Advances in Petroleum Geochemistry. Academic Press, London, pp. 89-
129.
[ 135] McInemey, M.J. and D.W.S. Westlake. 1990. Microbial enhanced oil recovery. In:
Microbial Mineral Recovery, H.H.L. Ehrlich and C.L. Brierley (Eds.), McGraw-Hill,
NY, pp. 409-445.
[ 136] Rao, D. J. Can. Petrol. Technol. 40 (2001) 11.
[137] Aycaguer, A.-C., M. Lev-On, and A.M. Winer. Energy & Fuels 15 (2001) 303.
[138] Oldenburg, C.M., K. Pruess, and S.M. Benson. Energy & Fuels 15 (2001) 293.
[139] Oldenburg, C.M. Energy & Fuels 17 (2003) 240.
[140] Killesreiter, H. Erdoel und Kohle, Erdgas, Petrochemie 38 (1985) 405.
[141] Frauenfeld, T.W.J., R.K. Ridley, R.K., and D.M. Nguyen. J. Petrol. Technol. 40
(1988) 333.
[142] Mayne, C.J. and R.W. Pendleton. Soc. Petrol. Eng. AIME 1 (1986) 131.
[143] Alvarez, M.R., M.F. Hilton, and H.L. Oil & Gas J. 82 (1984) 95.
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Elsevier B.V. All rights reserved. 307
Chapter 11
1. I N T R O D U C T I O N
The presence of hydrogen sulfide (HzS) in oil fields can be the result of abiotic
or biotic processes. In the later case, sulfate-reducing bacteria (SRB) are the
culprits that produce this nocuous gas, leading to "souring" that is defined as the
process whereby petroleum reservoirs experience an increase in the production
of HzS during the economic production life of the field [1 ]. The increase in HzS
content leads to a decrease in the economic value of the gas and oil, as well as
operational problems associated with the HzS.
This microbial process in wastewaters and oil field waters can be
controlled by another group of microbes, known as nitrate-reducing bacteria
(NRB). Their metabolic activities stop sulfate reduction by SRB, and in many
cases the NRB can actually consume sulfide, thus decreasing HzS concentration
in the waters. Jenneman et al. [2] have referred to these sulfide-consuming
bacteria as "sulfide bioscavengers". Hitzman and Sperl [3] used the term
"biocompetitive exclusion" to describe the microbial process in which NRB use
volatile fatty acids and out-complete SRB to prevent or decrease sulfide
production, and enhance oil recovery.
This chapter will review (a) H2S in the petroleum industry, (b) the
metabolism of SRB leading to sulfide production, (c) the occurrence, types and
activities of NRB that might be found in oil field waters, (d) some laboratory
studies that have elucidated the mechanisms by which NRB control sulfide
produced by SRB, (e) some oil field experiences with nitrate injection to control
sulfide in wastewaters, surface waters and oil field waters, and (f) some of the
U.S. patents that apply to this microbial process.
308
Although nitrite, rather than nitrate, addition has been studied, this chapter
focuses solely on the use of nitrate to control sulfide in oil field waters. This is a
proven biotechnology that is under-utilized by the petroleum industry.
Frazer and Bolling[ 10] described the souring of the Kuparuk River field
on the North Slope of Alaska. The field was initially sweet, but after injection of
Beaufort Sea water, detectable levels of HzS began to appear at the producing
wells. The connate water contained essentially no sulfate. However, the sulfate
in the sea water stimulated bacterial sulfate reduction in the reservoir that had a
temperature of about 70~
The Skjold oil field in the North Sea soured upon the onset of
waterflooding [ 11 ]. Oil and gas production began from this field in 1982 and sea
water injection began in April 1985. In September 1985, the first recorded HzS
production was measured to be 1.8 ppm in the gas phase. In 2002, the
concentrations varied from 10 to 1000 ppm [11]. In late 1999, this field
produced 1150 kg HzS d -1.
These examples clearly demonstrate that waterflooding can stimulate
bacterial sulfate reduction, leading to souring. Although these examples refer to
offshore oil fields, souring also occurs in land-based oil fields using
waterflooding [ 12-15]. As a result of the bacterial production of toxic HzS, the
value of the oil decreases as the oil field sours.
Fig. 1. Iron metal corrosion mediated by SRB in a biofilm. The process is caused by the
consumption of H2 causing cathodic depolarization. Adapted from Ref. [18].
311
Removal of dissolved gases (02, H2S and C02) from drilling and
produced fluids is necessary to minimize corrosion damage. HzS in oil base
drilling fluid is removed by gas separators and vacuum degassers, and then
neutralized. Controlling corrosion in HzS-containing environments requires
proper selection of materials, including the use of low-hardness steels,
application of inhibitors and complete exclusion and removal of O2 from water
used in petroleum production [21]. Clearly, the presence of HzS greatly
increases the cost of exploration for oil and natural gas, and the cost of
production and storage of petroleum.
Plugging (or biofouling) of injection wells is also caused by SRB. The
sulfide they produce, precipitates soluble iron in the injection or formation water
forming colloidal FeS [23]. This colloidal material becomes associated with
bacterial cells and oil, forming a gummy mass that can clog reservoirs and plug
injection wells. The activities of SRB can also produce calcite (CaCO3) that can
add to the plugging problem.
Under primary oil recovery, typically less than 30% of the original oil is
produced, so that improved or enhanced methods are used to recover some of
the remaining oil [24]. These processes, known as secondary and tertiary
recovery methods, include the addition of energy into the reservoir and are
accomplished by injecting some type of fluid through injection wells. This is
referred to as enhanced oil recovery and involves water injection, gas injection,
steam injection, combustion, miscible fluid displacement and polymer injection
[24]. In this paper, only water injection or waterflooding will be discussed.
Waterflooding involves pumping water into the reservoir to stimulate
production. The injected water provides pressure to force the oil out of the rock
and to sweep it toward producing wells as shown in Fig. 2. Waterflooding has
been attempted in almost every type of reservoir, with its greatest success in
relatively homogenous reservoirs having sufficient permeability to allow water
injection at a reasonable rate [24]. Up to 60% of the oil can be recovered with
waterflooding [5]. Water handling can become a major operational procedure.
For example, in some western Canadian oil fields, the proportion of water in the
oil-water emulsion brought to the surface can be 95% by volume [15]. That is,
the volume of water handled is 19 times greater than the volume of oil produced.
Water used as injection water can be of three types: formation water, sea
water or fresh water. Formation water is subsurface brackish or brine water
produced from a petroleum or non-petroleum producing formation. Sea water
may also include water from a salty (non-potable) lake. Fresh water, containing
312
less than 2000 ppm dissolved solids, is primarily water that can be made potable
by flocculation, filtration and chlorination [25].
Because oil field reservoir rocks are porous, they are susceptible to plugging by
solids suspended in or precipitated from an injection fluid [26]. This makes
water quality testing necessary to determine parameters such as: amount and
composition of suspended solids, clay sensitivities, presence of bacteria,
compatibility of two or more waters, and compatibility of the injection solution
with reservoir rock. An example of incompatible waters occurs when sulfate
scales, such as barium sulfate, calcium sulfate or strontium sulfate are formed by
mixing waters containing sulfate with waters containing barium, calcium or
strontium ions [26]. As well, the gases O 2, HzS and CO 2 found in injection
waters and implicated in corrosion [25-26], must be monitored. Water quality
testing, should be continued after the enhanced oil recovery operation hasstarted,
to ensure that the system is maintained at optimum conditions [25]. Water
treatment methods are outlined by Rose et al. [27].
Fig. 2. A simple waterflooding operation. Oil, gas and water are collected from the production
wells and the produced water is separated from the oil and gas. The produced water is
combined with source water and injected into the oil-beating rock to pressurize the formation
and sweep the oil to the producing wells.
313
4. SULFATE-REDUCING BACTERIA
Ask any person who works in the oil field or who is involved with the transport
or storage of crude oil to name some bacteria, and most will immediately
respond "sulfate-reducing bacteria" or "SRB". These bacteria are well-known,
and in the oil field environment, they are a nuisance because their metabolic
activities produce H2S that can sour reservoirs, create plugging through FeS
formation and induce corrosion [28]. SRB have the unique ability to utilize
sulfate as a terminal electron acceptor. This is an anaerobic respiratory process
used to generate energy for the biosynthetic reactions involved in cell growth
and maintenance [29].
The SRB are a diverse group of prokaryotes that are found in many
anaerobic environments. These bacteria have been the subject of several books
[30-33] and countless articles. The phylogeny of SRB has recently been
reviewed [34], and based on rRNA sequences, they fall into four groups" Gram-
negative mesophiles, Gram-positive endospore-formers, thermophilic bacteria,
and thermophilic Archaea.
4H2 + SO4=+ 2H+ --> H2S + 4H20 G ~ = -38 kJ (mol H2) -~ (1)
314
As late as the 1970's, only a few genera of SRB were recognized, and
these were known to use only a few growth substrates, most notably lactate,
pyruvate or H2. Now it is apparent that SRB are capable of using various
compounds for electron donors.
Based on their metabolic capabilities, heterotrophic SRB fall into two
groups: those that cannot oxidize acetate, and those that carry out complete
oxidation of acetate to CO2 [36]. Reaction (3) illustrates the overall reaction of
lactate-utilizing SRB that cannot oxidize acetate. One mol of acetate
accumulates for each tool of lactate that is consumed.
The complete oxidation of acetate is given by reaction (4), showing that less
energy is available per mol of acetate than per mol of lactate (reaction 3).
5. N I T R A T E - R E D U C I N G BACTERIA
reduce nitrate to ammonium [53-56]. In the presence of nitrate, some SRB will
preferentially use nitrate, and some will use both concomitantly [54].
Thiobacillus denitrificans is listed as one of the chemolithotrophs in
Fig. 4. In general, this species is not tolerant to high sulfide concentrations, but
Sublette and Woolsey [57] enriched Thiobacillus denitrificans strain F that
initially tolerated up to 1.75 mM sulfide, and later up to 2.5 mM sulfide [58].
This strain has been used in studies to demonstrate its ability to reduce H2S
concentrations in porous rock cores [59-60] and in sour produced waters
[58,61].
Gevertz et al. [62] described two novel bacterial isolates that are obligate
chemolithotrophs, using nitrate as a terminal electron acceptor, and sulfide as an
energy source. Both grow under anaerobic conditions. One isolate is a denitrifier
that closely resembles Thiomicrospria denitrificans, and it has been called
Thiomicrospria strain CVO (Fig. 4). The other isolate was called Arcobacter
strain FWKO B, and it reduces nitrate to nitrite.
Chemoorganotrophs
(Heterotrophs)
I
Facultative anaerobes Strict anaerobes
l
N20, N 2
l
NH4§
Fig. 3. Examples of some heterotrophic bacteria that could be stimulated by the presence of
nitrate in anaerobic environments that contain suitable organic substrates.
319
Chemolithotrophs
(Aut~176
Obligatechemolithotrophs Facultativechemolithotrophs
1
Thiobacillus
1
ThiomicrospiraArcobacter
denitri~cans ~, strainlCVO strainF~KOB
1 1
Paracoccus
pantot~phus
Injection of nitrate into an oil field might also stimulate the activity of
bacteria similar to P. pantotrophus [63] (formerly Paracoccus denitrificans [64]
and Thiosphaera pantotropha strain GB17 [65]). This bacterium was isolated
from a denitrifying effluent treatment system. It is a facultative anaerobe and
facultative autotroph (Fig. 4) that uses nitrate as an electron acceptor. It grows
autotrophically with sulfide as an electron donor, or heterotrophically with a
variety of organic compounds (including acetate which is commonly found in
produced waters [66-67]) as electron donors [65]. We are not aware of any
research that has detected facultative chemolithotrophs in oil field waters.
The bacteria shown in Fig. 4 all have the capability of oxidizing sulfide
while reducing nitrate. These are referred to as nitrate-reducing, sulfide-
oxidizing bacteria (NR-SOB). Greene et al. [68] compared the sulfide tolerance
of four species of NR-SOB. In their liquid medium, sulfide was oxidized by
Thiobacillus denitrificans strain F at concentrations less than 0.5 mM, by
Thiomicrospira denitrificans and Arcobacter sp. strain FWKO B at up to 3 raM,
and by Thiomicrospira strain CVO at up to 15 mM.
320
Although only a few NR-SOB have been identified in oil field waters,
Loka Bharathi et al. [69] isolated over 100 strains of anaerobic colorless NR-
SOB from sea water and a sulfide-rich creek. Their data showed that different
isolates oxidized sulfide at different rates. For example, one isolate oxidized all
of the sulfide in the medium within 9 days, whereas another isolate oxidized
only 2.9% of the sulfide in the same time. Thus, it is likely that different NR-
SOB in the produced water from oil fields would oxidize sulfide at different
rates.
from western Canada and west Texas [72], although culture methods detected
NRB (Table 1).
Eckford et al. [74], in Table 1, surveyed five oil fields in western Canada
for various types of NRB. Different media formulations were used to selectively
enumerate thiosulfate-oxidizing NRB, heterotrophic NRB, or NR-SOB. None of
the 18 water samples contained detectable numbers of thiosulfate-oxidizing
NRB. As was observed by Adkins et al. [70], the numbers of NRB were very
low or non-detectable near the wellheads [74]. However, NRB were detected in
source and preinjection waters, and in samples from water storage tanks and flee
water knock out units. Although much of the work on NRB in oil field waters
has neglected the heterotrophic NRB, the numbers of heterotrophic NRB were
greater than the numbers of autotrophic NRB in 12 of the 15 samples compared.
In one oil field, heterotrophic NRB were found, but no autotrophic NRB were
detected (Ref. 74, Table 1).
NRB were detected in biofilms on coupons in the anaerobic part of the
water injection system of the Veslefrikk field in the North Sea [75], (Table 1).
The medium used to enumerate these attached bacteria contained organic acids
as carbon sources, providing counts of heterotrophic NRB. These numbers
increased dramatically after nitrate injection (Table 1).
The literature surveyed in Table 1 represents 15 different oil fields that
have been examined for NRB. Each of the oil fields contained detectable
numbers of NRB at one or more sampling locations. Thus, each field had a
microbial community containing NRB with the potential to be stimulated by
nitrate amendment.
Table 1
Detection and enumeration of NRB in oil field waters.
Refs. Oil fields Methods Comments
70 Oklahoma, MPN with molasses Samples collected near wellheads.
USA and sucrose as electron Medium would detect heterotrophic
donor NRB. MPN values were 4 mL ~.
Table 2
Laboratory and field studies using nitrate to control sulfide production in wastewaters
Ref. Summary
83 Three pulp mills discharged sulfite wastes into the Androscoggin River in Maine
U.S.A. This resulted in H2S production in the fiver and odor problems in nearby
towns. In 1949, a total 641 tons (582 Mg) of NaNO3 were added to the river. This
controlled H2S production and odors. Most of the nitrate was reduced to ammonium.
84 To control odor, waste sodium nitrate liquor (containing both nitrate and nitrite) was
added to a storage lagoon that held aerobically digested waste activated sludge.
Initially, the redox potential of the water was near-100mv, but after several months of
nitrate addition, it rose to near +300 mV. There was low odor potential when the
redox was above +100. Acetate concentrations decrease in the lagoon, and N2
production from denitrification provided mixing within the sludge.
78 Laboratory studies were done with a 10-fold dilution of sewage sludge amended with
20 mM sulfate and one of three electron donors: glucose, acetate, or H2. The addition
of 59 mM nitrate completely inhibited sulfide production. Nitrate, nitrite and N20
were detected in the inhibited samples, and the oxidation of the redox indicator,
resazurin, was attributed to the presence of N20. The numbers of SRB decreased with
prolonged incubation of the oxidized medium.
85 Oily sludge from a settling tank at the U.S. Navy Craney Island Fuel Depot in
Virginia was placed in serum bottles and amended with nitrate, stimulating indigenous
NRB. Sulfate reduction was diminished with 50 mM nitrate, and sulfide accumulation
was prevented with as little as 16 mM nitrate. Nitrite and nitrous oxide were products
of nitrate reduction. Sulfide was oxidized to sulfur or sulfate. The results indicated
that nitrate would be useful for preventing sulfide formation in oily wastes produced
onboard marine vessels.
58 This paper reviewed bench-scale processes developed for the sulfide removal from
gases and aqueous solutions by Thiobacillus denitrificans. When HaS was introduced
to batch anoxic or aerobic cultures of T. denitrificans, the HzS was immediately
metabolized. Oxidation of HzS to sulfate was accompanied by growth. T. denitrificans
was immobilized by co-culture with floc-forming heterotrophs and this mixture was
used to treat water that was contaminated with sulfide. The sulfide-active floc was
stable for 5 months of operation with no external organic carbon required to support
the growth of the heterotrophs. T. denitrificans strain F, which tolerates higher sulfide
concentrations, was also used in some studies.
326
Table 3
Laboratory studies using nitrate to control sulfide production columns or cores
Ref. Summary
59 This study investigated the efficacy of nitrate and the sulfide-tolerant Thiobacillus
denitrificans strain F in controlling HzS concentrations in cores of sandstone.
Formation water from a gas storage facility in Redfield, Iowa, U.S.A. was injected
into two core systems, with hydraulic retention times (HRTs) of 3.2 h and 16.7 h.
With the addition of nitrate alone, no thiobacilli were cultured from the core system,
but nitrate was consumed and the concentrations of sulfide in effluent decreased by
about 40% in the core with the shorter HRT, and 98% with the longer HRT. Thus, an
indigenous microbial community capable of oxidizing sulfide while using nitrate as
the electron acceptor was present. Inoculation with strain F reduced the effluent
sulfide by about 80% in the core with the shorter HRT.
60 The test materials for this study included core material from the St. Peter formation at
Redfield, Iowa, U.S.A. and water from the same formation, supplemented with
acetate and enriched with SRB to 107 cells mL -~. The core material did not contain
large numbers of organisms capable of using nitrate, and no strain F-like organisms
were detected. When nitrate and strain F were injected into the core, sulfide
concentrations decreased, demonstrating the ability of strain F to control sulfide in
the core.
Brine from an oil field near Coleville, Saskatchewan, Canada was filtered,
supplemented with phosphate and nitrate and pumped into a porous (1288 mD)
ceramic core 19.1 cm long. When 5 mM nitrate was shut in the column, all of the
sulfide was removed in 3 d and the numbers of NRB increased. Under various flow
regimes, with sulfide-containing brine, sulfide removal was between 87 and 100%.
Elemental sulfur, bacteria and CaCO3 were produced, but there was no significant
permeability changes across the core following all treatments.
Four of the five studies in Table 3 detected NRB in the cores or produced
waters used in the experimental systems. In the fifth study, [49] the investigators
inoculated the column with a mixture of enrichment cultures, including NRB.
Two of the studies, Refs. 59 and 60, focused on the activities of thiobacilli.
None were detected in the cores or waters, similar to the findings of Eckford and
Fedorak [74]. Inoculating these two cores with Thiobacillus denitrificans strain
F stimulated sulfide reduction when nitrate was injected into the cores (Refs. 59-
60, Table 3).
Two of the studies [2, 86], (Table 3) relied solely on the formation water
as the source of NRB. One study supplemented the medium with short-chain
organic acids [86], whereas the other study did not supplement with organic
compounds [2]. Thus, these studies likely enriched for different nutritional types
of NRB. Nonetheless, souring was inhibited in both studies. Indeed, sulfide
production was controlled in each of the five studies summarized in Table 3.
Table 4
Laboratory studies on controlling sulfide production in produced waters by adding nitrate to
stimulate natural microbial communities.
Ref. Summary
87 Waters from four west Texas oil fields were used to determine which amendments
were required to stimulate sulfide removal. In two of the samples, addition of 40
mM nitrate and phosphate was not sufficient to promote microbial removal of
sulfide over a 28-d incubation. However, sulfide removal was observed when
acetate or formate plus vitamins or yeast extract were added to these two waters that
had been supplemented with nitrate and phosphate. These results illustrate the
importance ofheterotrophic activity in sulfide removal.
14 Two waterflooded, souring oil fields in Oklahoma, U.S.A. and Alberta, Canada were
studied. SRB and NRB were found in produced waters from both oil fields. The
majority of the sulfide production appeared to occur after the oil was pumped
aboveground, rather than in the reservoir. Sulfide production was greatest in the
water storage tanks in the Alberta field. Laboratory experiments showed that adding
5 and 10 mM nitrate to produced waters from the Oklahoma and Alberta oil fields,
respectively, decreased the sulfide content to negligible levels and increased the
numbers of NRB.
15 Produced waters from three sulfide-containing westem Canadian oil fields were
amended with nitrate only. In less than 4 d, the sulfide was removed from the waters
from two of the oil fields (designated P and C), whereas nearly 27 d were required
for sulfide removal from the water from the third oil field (designated N). Nitrate
stimulated large increases in the numbers of the heterotrophic NRB and NR-SOB in
the waters from oil fields P and C, but only the NR-SOB were stimulated in the
water from oil field N. These data suggest that the stimulation of the heterotrophic
NRB is required for rapid removal of sulfide from some oil field produced waters.
329
2
O LLJ -- - - - - ~ ~ ,~ I __
I
0 7 14 21 28 35 42
10 -d
_
b
6-
m ~ m
4i w l - -
2 -
rl-t-~ [3 D D D
0 7 14 21 28 35 42
Time (days)
Fig. 5. Chemical analyses of microcosms that contained produced water from the Coleville oil
field in Canada. Nitrate amended (a), unamended (b). From Ref. 15.
incubation, the heterotrophic NRB numbers remained high, whereas the NR-
SOB numbers dropped to near their original count (Figs. 6a and 6b). The SRB
numbers did not change in the nitrate-amended microcosm and showed a slight
increase in the unamended microcosm with a m a x i m u m at day 7 (Fig. 6c).
N'mate
--O--~
1.E+08 _
3:
W
1.E+06
I 1.E+04
1.E+02
1.E-~) I
0 7 14 21 28 35 42
1.E+10 -
b
1.E+08-
Z
1.E+06-
(
1 .E+04 I [ 1 1 ~ I
0 7 14 21 28 35 42
1.E+08 -
C
1.E+06-
~ 1.E+04
(
1 .E+02 I I 1 1 I f
0 7 14 21 28 35 42
Time (days)
Fig. 6. Heterotrophic NRB (a), NR-SOB (b) and SRB (c) counts is samples from microcosms
that contained produced water from the Coleville oil field in Canada (Fig. 5). Error bars show
95% confidence intervals. From Ref. [ 15].
331
Table 5
Laboratory studies using co-cultures and nitrate to control sulfide production.
Ref. Summary
72 Mixtures of strains CVO and FWKO B were incubated in medium with different
concentration of sulfide. Using RSGP, it was demonstrated that CVO dominated in
co-cultures with low (1 mM) sulfide, but FWKO B dominated with high (15 mM)
sulfide. CVO or FWKO B were co-cultured with Desulfovibrio strain Lac6. Sulfide
drop from 1 mM to 0 mM in 24 h in the presence of CVO. Over a 277-h incubation,
sulfide remained between 1 and 2 mM in the presence of FWKO B.
91 Strain CVO was added to cultures of Desulfovibrio strain Lac6 that were growing in
various concentrations of nitrate or lactate. In pure culture, sulfate reduction by the
Desulfovibrio sp. was unaffected by the nitrate concentrations up to 10 mM. Sulfide
concentrations decreased rapidly after the addition of CVO. This effect was due to the
increase in the redox potential of the medium, as indicated by the oxidation of
resazurin.
68 Strain CVO was grown in co-cultures with four different Desulfovibrio strains. Two
of these did not have nitrite reductase, and their growth was stopped in the presence of
CVO as it produced nitrite and elevated the redox potential of the medium. However,
two of the strains had nitrite reductase, and they reduced the nitrite formed by strain
CVO. The SRB decreased the redox potential and continued to produce sulfide. This
illustrated that the action of strain CVO cannot inhibit SRB that possess nitrite
reductase.
Table 6
Field studies and operations using nitrate to control sulfide production.
Ref. Summary
12 Ammonium nitrate (45 T) was injected into a souring oil field at the Southeast Vassar Verta
Sand Unit in Oklahoma, U.S.A. At the time of injection, no nitrate was detected in three
adjacent production wells. Forty-five days after injection, nitrate was detected at these wells,
and the sulfide concentrations were reduced by 40 to 60%.
71 In 1994, a solution of NH4NO3 and NaHzPO4 was injected into three wells in the Coleville field
in Saskatchewan, Canada. Prior to treatment, the produced waters from these wells contained
between 52 and 160 mg sulfide L -1. After injection, there were shut-in periods of between 24
and 70 h before pumping resumed. The sulfide concentrations dropped by as much as 98% of
the initial concentrations, with ranges between 40% and 60% being sustained for several hours.
The numbers of NRB increased by 100- to 10,000-fold.
88 In 1996, a solution of NH4NO3 and NaHzPO4 was injected into two injection wells in the
& Coleville field for 50 d. Two producer wells were monitored for 90 d after the injection began.
13 After 10 d, the sulfide in the producers decreased by as much as 50 to 60% of the initial
concentrations of 60 and 40 mg L l. The cumulative sulfide removal from the two producers
were estimated to be 50 and 70 kg over the 90-d test period. The numbers of NRB increased at
least 1,000-fold during the time of nitrate injection.
51 Samples were taken from the Coleville field in 1996. These were taken 8 d before and 20, 55,
and 82 d after the injection of a solution of NH4NO3 and NaHzPO4 began. RSGP analyses,
using 47 DNA standards, showed that strain CVO became the dominant community member
immediately after injection. The abundance of CVO decreased within 30 d after completion of
nitrate injection.
11 Studies were done in the Skjold oil field in the North Sea in 2000. Three injection strategies
were used. In each case, the highest nitrate concentrations were used at the beginning of the
treatment, then the concentration was decreased. First, nitrate (4.5 to 1.7 mM) was injected into
one well for 1 month; second, nitrate (3.8 to 1.8 mM) was injected into this well plus another
well for 2 months; third, nitrate (4.4 mM to a mean of 2.8 mM) was injected into all of the
other wells for 3 months. Only one of the monitored production wells showed marked
reduction in H2S. This well was in the highly fractured zone of the reservoir, and nitrate
reached it within 24 h of the start of injection. The amount of H2S in the produced gas dropped
from 240 ppm to between 30 to 60 ppm. After nitrate addition, the numbers of mesophilic NRB
and NR-SOB increased about 10,000- and 1,000-fold, respectively.
75 Data were presented after 32 months of adding nitrate to water injected from the Veslefrikk
platform in the North Sea. Glutaraldehyde injection was stopped in January 1999, and replaced
by continuous 0.25 mM nitrate injection. Microbial counts in biofilms were monitored and
corrosion was measured by weight loss from C-steel biocoupons. After 32 months, the
numbers of SRB decreased 20,000-fold and after 18 months, the number of NRB increased
60,000-fold. Most of the NRB were heterotrophic facultative anaerobes. Sulfate-reducing
activity (measured using 35S-sulfate) decrease 50-fold. Prior to nitrate treatment, the corrosion
rate was 0.7 mm y-1. This fell to 0.02 mm y-1 after 4 months of nitrate injection.
335
Table 7
Examples of United States patents for the control of sulfide through the application of NRB.
5,405,531 Hitzmanet al. Method for reducing the amount of and preventing the
1995 formation of hydrogen sulfide in an aqueous system
5,750,392 Hitzmanet al. Composition for reducing the amount of and preventing the
1998 formation of hydrogen sulfide in an aqueous system,
particularly in an aqueous system for oil field applications
for offshore oil fields. The costs did not include the cost of transporting the
chemicals. The estimated prices per litre of the chemicals were: US$0.25 for
nitrate (as a 40% solution of CaNO3), $2.50 for glutaraldehyde (as a 50%
solution), and $4.00 for THPS (as a 50% solution). Although the cost of nitrate
was lower, the solution was continuously injected at a dose of 60 mg L ~. In
contrast, the two biocides were injected for 1 h, twice per week at a dose of
500 mg L -1. Based on treating 200,000 barrels of produced water per d, the
yearly costs for chemicals were US$575,000 for nitrate, $345,00 for
glutaraldehyde, and $500,000 for THPS. Per 100 barrel of water treated, these
costs become US$0.79, and $0.47, and $0.68, respectively.
From these two cost analyses, the use of nitrate for sulfide control is
competitive with other chemicals. The cost of treating 100 barrels of water
calculated from the data given by Jenneman et al. [88] is higher than that
reported by Herbert [92], because Jenneman et al. [88] also injected
monosodium phosphate, which is 8 times as expensive as the ammonium nitrate.
Herbert [92] used only calcium nitrate. The need to add a phosphate source to
stimulate NRB would have to be evaluated for each oil field.
Besides the cost, other factors must be considered when choosing
chemicals for controlling sulfide in produced waters. Most notably, workers
safety and potential environmental impact of spilled chemical must be
considered. Nitrate salts are far less toxic than the biocides commonly used in
oil fields, and therefore its use presents few safety issues for oil field workers.
Spilled biocides have negative affects on the environment. In contrast, nitrate is
widely used as an agricultural fertilizer, so spills on land present no major
problem. Nitrate is listed as a substance that poses little or no risk to the marine
environment [75]. However, caution must be used to avoid contamination of
fi'esh surface waters or potable ground waters with nitrate (or any biocide).
7. C O N C L U D I N G R E M A R K S
there are plans to use nitrate in the Gulf of Mexico when sea water injection
begins in the near future (Stephen Maxwell, Commercial Microbiology Inc.,
personal communication). In contrast, there is little or no use of nitrate in land-
based souring oil fields in North America. It is now very clear that land-based
oil field operators should seriously consider using this proven biotechnology to
control, and possibly eliminate, microbially-induced souring and the problems
associated with HzS formation.
REFERENCES
[ 19] R.N. Tuttle and R.D. Kane (eds.), H2S Corrosion in Oil and Gas Production - A
Compilation of Classic Papers, National Association of Corrosion Engineers, Houston,
Texas, USA, 1981. pp. 1018-1038.
[20] A. Ikeda and M. Kowaka, Chem. Econ. Eng. Rev., 10 (1978) 12.
[21 ] T.A. Bertness, G.V. Chilingarian and M. A1-Basson, In G.V. Chilingarian, J.O.
Robertson, Jr. and S. Kumar (eds.), Surface Operations in Petroleum Production II,
Elsevier Science Publishing Co. Inc., New York, USA, 1989, pp. 283-317.
[22] I.B. Beech, In G. Bitton (ed.), Encyclopedia of Environmental Microbiology, Wiley and
Sons, New York, USA, 2002, pp. 465-475.
[23] W.P. Iverson and G.J. Olson, In R.M. Atlas (ed.), Petroleum Microbiology, Macmillan
Publishing Company, New York, USA, 1984, pp. 633-683.
[24] F.A. Giuliano (ed.), Introduction to Gas and Oil Technology, 3rd edition, Prentice Hall,
Inc., Englewood Cliffs, New Jersey, USA, 1989.
[25] A.G. Collins and C.C. Wright, In E.C. Donaldson, G.V. Chilingarian and T.F. Yen.
(eds.), Enhanced Oil Recovery I: Fundamentals and Analysis, Elsevier Science
Publishing Co. Inc., New York, USA, 1985, pp. 151-221.
[26] C.C. Wright and G.V. Chilingarian, In G.V. Chilingarian, J.O. Robertson, Jr. and S.
Kumar (eds.), Surface Operations in Petroleum Production II, Elsevier Science
Publishing Co., Inc. New York, USA, 1989, pp. 319-372.
[27] S.C. Rose, J.F. Buckwalter and R.J. Woodhall (eds.), The Design Engineering Aspects
of Waterflooding, Society of Petroleum Engineers, Richardson, Texas, USA, 1989.
[28] T.R. Jack, In F.T. Premuzic and A. Woodhead (eds.), Microbial Enhancement of Oil
Recovery- Recent Advances, Elsevier Science Publishing, BV. Amsterdam, 1993, pp.
7-16.
[29] J.M. Akagi, In L.L. Barton (ed.), Sulfate-Reducing Bacteria, Plenum Publishing Corp.,
New York, USA, 1995, pp. 89-112.
[30] J.R. Postgate, The Sulphate-Reducing Bacteria, Cambridge University Press,
Cambridge, UK. 1979.
[31 ] J.R. Postgate, The Sulphate-Reducing Bacteria, 2nd edition, Cambridge University
Press, Cambridge, UK, 1984.
[32] J.M. Odom and R. Singleton, Jr. (eds.), The Sulfate-Reducing Bacteria: Contemporary
Perspectives, Springer-Verlag, New York, USA, 1992.
[33] L.L. Barton (ed.), Sulfate-Reducing Bacteria, Plenum Publishing Corp., New York,
USA, 1995.
[34] H.F. Castro, N.H. Williams and A. Orgam, FEMS Microbiol. Ecol., 31 (2000) 1.
[35] H. Cypionka, In L.L. Barton (ed.), Sulfate-Reducing Bacteria, Plenum Publishing Corp.,
New York, USA, 1995, pp. 151-184.
[36] N. Pfennig, F. Widdel and H.G. Trtiper, In M.P. Starr, H. Stolp, H.G. Triiper, A. Balows
and H.G. Schegel (eds.), The Prokaryotes, A Handbook of Habitats, Isolation, and
Identification of Bacteria, Vol. 1, Springer-Verlag, Berlin, 1981, pp. 926-947.
[37] L.L. Barton and F.A. Tomei, In L.L. Barton (ed.), Sulfate-Reducing Bacteria, Plenum
Publishing Corp., New York, USA, 1995, pp. 1-32.
[38] T.A. Hansen, In J.M. Odom and R. Singleton, Jr. (eds.), The Sulfate-Reducing Bacteria:
Contemporary Perspectives, Springer-Verlag, New York, USA, 1993, pp. 21-40.
[39] F. Widdel and R. Rabus, Curr. Opin. Biotechnol., 12 (2001) 259.
[40] J. Heider, A.M. Spormann, H.R. Beller and F. Widdel, FEMS Microbiol. Rev., 22
(1999) 459.
[41] D. White, The Physiology and Biochemistry of Prokaryotes, Oxford University Press
Inc., New York, USA, 1995.
339
[42] A. Azadpour, L.R. Brown and A.A. Vadie, J. Ind. Microbiol., 16 (1996) 263.
[43] G.D. Faugue, In L.L. Barton (ed.), Sulfate-Reducing Bacteria, Plenum Publishing Corp.,
New York, USA, 1995, pp. 217-242.
[44] D.E. Brink, I. Vance and D.C. White, Appl. Microbiol. Biotechnol., 42 (1994) 469.
[45] J.T. Rosnes, T. Torsvik and T. Lien, Appl. Environ. Microbiol., 57 (1991) 2302.
[46] M. Magot, B. Ollivier and B.K.C. Patel, Antonie van Leeuwenhoek, 77 (2000) 103.
[47] J. Boivin, Mater. Perform., 34(2) (1995) 65.
[48] T.R. Jack and D.W.S Westlake, In L.L. Barton (ed.), Sulfate-Reducing Bacteria, Plenum
Publishing Corp., New York, USA, 1995, pp. 265-292.
[49] S. Mylar, B.-L. Lillebo, E. Sunde, J. Breeder, and T. Torsvik, Appl. Microbiol.
Biotechnol., 58 (2002) 400.
[50] J. Tiedje, In A.J.B. Zehnder (ed.), Biology of Anaerobic Microorganisms, Wiley, New
York, USA, 1988, pp. 179-244.
[51] A.J. Telang, S. Ebert, J.M. Foght, D.W.S. Westlake, G.E. Jenneman, D. Gevertz and G.
Voordouw, Appl. Environ. Microbiol., 63 (1997) 1785.
[52] S. Mylar and T. Torsvik, Int. J. Syst. Bacteriol., 50 (2000) 1611-1619.
[53] R.G.L. McCready, W.D. Gould, and R.W. Barendregt, Can. J. Microbiol., 29 (1983)
231.
[54] G.J. Mitchell, J.G. Jones and J.A. Cole, Arch. Microbiol., 144 (1986) 35.
[55] H.-J. Seitz and H. Cypionka, Arch. Microbiol., 146 (1986) 63.
[56] T. Dalsgaard and F. Bak, Appl. Environ. Microbiol., 60 (1994) 291.
[57] K.L. Sublette and M.E. Woolsey, Biotechnol. Bioeng., 34 (1989) 565.
[58] K.L. Sublette, M.J. Mcinemey, A.D. Montgomery and V. Bhupathiraju, In C.N. Alpers
and D.W. Blowes (eds.), Environmental Geochemistry of Sulfide Oxidation, American
Chemical Society, Washington, DC, USA, 1994, pp. 68-78.
[59] M.J. McInemey, V.K. Bhupathiraju and K.L. Sublette, J. Ind. Microbiol., 11 (1992) 53.
[60] M.J. McInemey, N.Q. Wofford and K.L. Sublette, Appl. Biochem. Biotechnol., 57/58
(1996) 933.
[61 ] K.L. Sublette, D.E. Morse and K.T. Raterman, Presented at the 68th Annual Technical
Conference and Exhibition of the Society of Petroleum Engineers Houston, Texas, SPE
paper 26396, Society of Petroleum Engineers, Richardson, Texas, USA, October 3-6,
1993.
[62] D. Gevertz, A.J. Telang, G. Voordouw and G.E. Jenneman, Appl. Environ. Microbiol.,
66 (2000) 2491.
[63] F.A. Rainey, D.P. Kelly, E. Stackebrandt, J. Burghardt, A. Hiraishi, Y. Katayama and
A.P. Wood, Int. J. Syst. Bacteriol., 49 (1999) 645.
[64] W. Ludwig, G. Mittenhuber and C.G. Friedrich, Int. J. Syst. Bacteriol., 43 (1993) 363.
[65] L.A. Robertson and J.G. Kuenen, J. Gen. Microbiol., 129 (1983) 2847.
[66] W.W. Carothers and Y.K. Kharaka, Am. Assoc. Petrol. Geol. Bull., 62 (1978) 2441.
[67] T. Barth, Appl. Geochem., 6 (1991) 1.
[68] E.A. Greene, C. Hubert, M.. Nemati, G.E. Jenneman and G. Voordouw, Environ.
Microbiol., 5 (2003) 607.
[69] P.A. Loka Bharathi, S. Nair and D. Chandramohan. J. Mar. Biotechnol., 5 (1997) 172.
[70] J.P. Adkins, L.A. Comell and R.S. Tanner, Geomicrobiol. J., 10 (1992) 87.
[71] D. Gevertz, G.E. Jennemen, S. Zimmerman and J. Stevens, In R. Bryant (ed.),
Proceedings of the Fifth Intemational Conference on Microbial Enhanced Oil Recovery
and Related Biotechnology for Solving Environmental Problems, Richardson, Texas,
USA, 1995, pp. 295-309.
[72] A.J. Telang, G.E. Jenneman and G. Voordouw, Can. J. Microbiol., 45 (1999) 905.
340
[73] G. Voordouw, J.K. Voordouw, R.R. Karkhoff-Schweizer, P.M. Fedorak and D.W.S.
Westlake, Appl. Environ. Microbiol., 57 (1991) 3070.
[74] R.E. Eckford and P.M. Fedorak, J. Ind. Microbiol. Biotechnol., 29 (2002) 83.
[75] T. Thorstenson, G. Bodtker, B.-L.P Lillebo, T. Torsvik, E. Sunde and J. Beeder, Paper
02033 Proceedings of the NACE Expo 2002 Annual Conference and Exposition,
Denver, Colorado, USA, April 7-11, 2002.
[76] E.G. Beauchamp, J.T. Trevors and J.W. Paul, Adv. Soil Sci., 10 (1989) 113.
[77] R.K. Thauer, K. Jungermann and K. Decker, Bacteriol. Rev., 41 (1977) 100.
[78] G.E. Jenneman, M.J. Mclnemey and R.M, Knapp, Appl. Environ. Microbiol., 51 (1986)
1205.
[79] G.E. Jenneman, A.D. Montgomery and M.J. Mclnemey, Appl. Environ. Microbiol., 51
(1986) 776.
[80] H.-E. Jacob, In J.R.. Norris and D.W. Ribbons (eds.), Methods in Microbiology, Vol. 2,
Academic Press Inc., New York, USA, 1970, 93-123.
[81] S. Moura, C. Bursakov and J.J.G. Moura, Anaerobes, 3 (1997) 279.
[82] W.T. Carpenter, Water Works Sewerage, 79 (1932) 175.
[83] W.A. Lawrance, Sewage Ind. Wastes, 22 (1950) 820.
[84] R.A. Poduska and B.D. Anderson, J. Water Pollut. Control Fed., 53 (1981) 299.
[85] K.L. Londry and J.M. Suflita, J. Ind. Microbiol. Biotechnol., 22 (1999) 582.
[86] M.A. Reinsel, J.T. Sears, P.S. Stewart and M.J. Mclnemey, J. Ind. Microbiol., 17 (1996)
128.
[87] M. Wright, G.E. Jenneman and D. Gevertz, Proceedings of the 4th Intemational
Petroleum Environmental Conference: Environmental Issues and Solutions in
Exploration, Production and Refining. San Antonio, Texas, USA, (on CD-ROM), 1997.
[88] G.E. Jenneman, P.D. Moffitt, G.A. Bala and R.H. Webb, Paper SPE 38768, presented at
the 1997 SPE Annual Technical Conference and Exhibition, San Antonio, Texas, USA,
October 5-8, 1997.
[89] M. Nemati, G.E. Jennenman and G. Voordouw, Biotechnol. Prog., 17 (2001) 852.
[90] R.M. Lacatena, S. Lunetto, A. Robertiello, M. Marzorati and F. de Ferra, Presented at
2nd International Conference on Petroleum Biotechnology, Mexico City, November 5-7,
2003.
[91] M. Nemati, G.E. Jennenman and G. Voordouw, Biotechnol. Bioeng., 74 (2001) 424.
[92] B. Herbert, Lecture presented at Reservoir Microbiology Forum 9: Use of Nitrates to
Control Bacterial Problems, September 9, 2003, London, UK.
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Elsevier B.V. All rights reserved. 341
Chapter 12
any aromatic substrate, the xylS gene is expressed at low levels from the cyv~
dependent promoter Ps2, ensuring the presence of basal levels of XylS protein.
This protein as such is not able to activate transcription. When a substrate of the
meta pathway, e.g. 3-methylbenzoate, is present in the growth medium, the XylS
protein interacts with it and becomes active to promote transcription from the
Pm promoter, which controls expression of the meta pathway. Expression from
Pm requires RNA polymerase with either 32 in the early exponential phase or
38 thereafter. The XylR protein, which regulates its own transcription from two
~7~ promoters, is synthesized in sufficient amounts under all growth
conditions. When a substrate of the upper pathway, e.g. toluene, is present in the
culture medium, the binding of this effector to the protein triggers a series of
molecular events that result in the activation of transcription from two c~54-
dependent promoters: Ps 1 for the xylS gene, and Pu, which drives expression of
the upper pathway. This latter activation requires the integration host factor
(IHF). As a consequence of Psl activation, the XylS protein is overproduced,
and even in the absence of a meta pathway effector, transcription from Pm
occurs. The current knowledge of the molecular biology of each step on the
regulatory pathway is reviewed in detail below.
c~ edt
#
Pq Pr2
,-// .......
2~ylSl] [~~xxylR~
~ . ~ r
-,~. §
IHF l+ ..
COOH
Fig. 2. The TOL pathway regulatory network. Elliptical boxes indicate the inactive form of
the regulatory proteins. Shaded square boxes indicate the active form of the regulatory
proteins. Lines represent the connections between regulatory proteins and promoters, where
(+) is activation of transcription and (-) is inhibition of transcription; GR, global regulation.
The dotted line indicates transcription activation of overproduced XylS in the absence of
effector. The sigma factor(s) involved in transcription initiation are indicated above each
promoter. Aromatic substrates of the pathways that act as effectors of the regulatory proteins
are indicated. The regulatory circuits are explained in the text.
347
transition from the inactive to the active form may be mediated by effector
binding. Recent studies further pinpointed residues Asp137 and His153 as
crucial for interactions with the effector molecule [50]. In addition to
influencing effector specificity, these two residues were shown to contact
specific residues in the RNA polymerase c~ subunit carboxy terminal domain (c~-
CTD) [50].
XylS mutants such as XylSArg41Cys, XylSPro37Gly XylSGly44Ser,
XylSSer229Ile, XylSAsp274Val, and XylSAsp274Glu mediated transcription
from Pm in the absence of effectors [46, 47]. These results support the
hypothesis that XylS exists in vivo in a dynamic equilibrium between an inactive
and an active form, with respect to transcriptional stimulation. Within the
family, some regulators such as MarA are present in solution as monomers,
whereas most of the members of the family are found as dimers [51-54]. XylS is
likely active as a dimer and in vivo and in vitro assays have shown that Leu193
and Leu 194 in XylS play a crucial role in dimerization [55].
It is predicted that the DNA binding domain of XylS consists of seven or-
helix units which fold to assemble two helix-turn-helix (HTH) motifs that
interact with two neighboring major grooves on one face of the target DNA.
Involvement of the XylS C-terminal domain in DNA binding was first predicted
after the finding of mutations in this domain that rendered mutant regulators able
to promote high transcription levels in the absence of effectors [47, 48].
Mutation analysis of the predicted conserved positions of the HTH motifs of
XylS showed that the most conserved positions in the family seem to be
essential to preserve the structure of this domain [56]. Deletion of the 209 N-
terminal residues of XylS rendered a C-terminal domain-protein able to bind Pm
promoter and, when overproduced, able to activate transcription in vivo to levels
similar to those in the wild type protein. However, activity was clearly reduced
when the C-terminal fragment was synthesized at physiological levels. As
expected, the truncated protein was not responsive to effector-mediated control
[57].
receptor from the environment and the direct sensor of the aromatic molecule.
This was surmised from the ability of the protein to activate transcription from
the Pu promoter in the presence of a wide range of toluene derivatives, and by
experiments with XylR mutants with altered effector specificity [75, 76, 77, 78].
These data, obtained in the heterologous host E. coli, led to the conclusion that
XylR was directly activated via interaction with the effector. XylR is closely
related to the DmpR regulator for phenol degradation in Pseudomonas sp.
CF600, which recognizes phenol and derivatives, but not toluene, as an effector
[79]. Further evidence for the direct interaction of the A-domain of these
proteins with the effector molecule came from the construction of a chimeric
protein in which the receptor domain of DmpR was replaced by the
corresponding domain of XylR, resulting in a hybrid regulator that responded to
toluene for activation of the Po promoter of the phenol degradation pathway
[80]. DNA shuffling assays to create hybrid A-domains between DmpR and
XylR confirmed that the residues 110 to 186 of both proteins were responsible
for the effector profile of these regulators [80].
The A-domain operates as an intramolecular repressor of the central
activating domain of the protein [81, 82]. In fact, a XylR derivative in which the
A domain has been deleted is able to activate Pu in the absence of an aromatic
effector. The truncated derivative of XylR depleted of the A domain and
therefore unable to respond to effector-dependent modulation showed intrinsic
ATP binding and hydrolysis activity, located in the central activation domain
(C-domain). This activity was stimulated by the presence of a DNA fragment
containing the native XylR binding site in Pu (UAS) [83]. Furthermore, binding
of ATP to this truncated protein alone was able to induce conformational
changes in the protein. Initially, a cyclic model to explain XylR activation of Pu
was proposed by P6rez-Martin and de Lorenzo [83], according to which ATP
binding to the XylR central domain led to multimerization of the regulator
bound to its UAS in Pu, followed by ATP hydrolysis. This in turn triggered 54_
dependent transcription initiation in Pu, allowing the system to return to its
initial disassembled state [83]. Recently, Shingler and co-workers studied the
analogous regulator DmpR, and suggested an alternative mechanism to explain
effector-dependent activation of o54-dependent promoters. According to their
model, DmpR dimers are activated after binding of the effector molecule to the
A domain, followed by a conformational change that allows ATP binding to the
central domain and oligomerization to a hexameric conformation, probably
required to promote transcription initiation. Finally, ATP hydrolysis leads to
dissociation of the hexameric structure and dissociation of the effector [83].
nonactivated XylR with the Psl UAS [94], and an ATP-dependent repression
level resulting from the cooperative oligomerization of activated XylR at the
UAS in Psl [89]. As soon as the protein is activated and the UAS is strongly
bound by the regulator, XylR expression is minimized, thus limiting the period
of time during which the Psl and Pu promoters of the TOL plasmid are in an
activated state [89].
The role of IHF in Ps 1 expression deserves special attention. Analysis of
Psl activity in isogenic IHF-plus and minus backgrounds showed that in the
presence of toluene, the highest levels of expression were achieved in the
absence of IHF [97]. This may reflect a better access of either XylR to its
binding site or of G54-RNApolymerase to the -12/-24 region of Ps 1, or both. On
the other hand, it may be the consequence of structural hindrance, as the DNA
bending induced by IHF bound to two sites may give rise to a highly ordered
structure that restricts the access of regulatory proteins to the corresponding
promoters. The high level of expression from Psl in the IHF-minus background
in the presence of effectors contrasts with the diminished expression from the
TOL plasmid Pu promoter for the upper pathway in an IHF-deficient
background. The most noticeable difference between the two promoters is the
position of the IHF binding site, which in Pu lies between the UASs and the -
12/-24 box. In addition to affecting Psl expression, the close proximity of the
regulatory sequences in the intergenic region results is a high expression level
from Ps2 in the absence of c~54, i.e., when RNA polymerase is unable to bind to
the Ps 1 promoter [97].
In general, the physiological consequence of this organization is that in
the absence of any effector in the culture medium, Ps2, Prl and Pr2 promoters
are slightly repressed. In the presence of toluene, activation of Psl causes a
stronger repression of both xylR promoters. As a result, the level of XylR
decreases at approximately 30 monomers per cell [98], which are apparently
sufficient to promote high expression of both xylS and the upper pathway. Under
these conditions the XylS protein is overproduced, which allows induction of
expression from the Pm promoter even in the absence of meta pathway
substrates. Therefore in the presence of toluene or a substituted derivative, both
the upper and the meta pathways are coordinately expressed to optimize total
degradation of the aromatic (Fig. 2).
expression appeared only at the end of the exponential phase, this behavior was
named exponential silencing [ 105]. However, it is worth noting that exponential
silencing is only observed in rich medium; in defined minimal media with
succinate (for example) as a carbon source, expression of both Psl and Pu is
observed immediately after induction [102, 103, 106]. Growth rate as a
determinant of Pu and Psl expression was ruled out through a series of
continuous culture experiments that compared different growth rates controlled
by different limiting substrates. The results led to the conclusion that repressive
conditions correlated with a high energy status of the cells [99, 100]. In other
words, in all conditions tested where excess carbon was available, the system
was repressed. However, when oxygen was the growth-limiting substrate, a
situation where carbon was also present in excess, a certain degree of
derepression was observed although activity never reached maximum values
(Fig. 3).
Stationary = 0.38
phase
6~
benzoate~
• ~
t ._ 0 "32
-I 11 Pm
.4
.***o**~ ', ! F,:sH J
6
toluene
Anabolic
limitation
' ' IHF
0.70
Fig. 3. Integration of cell signals that lead to modulation of the expression of the Pm and Pu
promoters.
354
3. R E G U L A T I O N OF THE TOD P A T H W A Y
toluene_j~
O D
''§ T/
Fig. 4. Organization of the tod genes and its regulatory circuit. Top. The tod genes are
organized in two operons expressed from sigma-70 dependent promoters upstream from todX
and todS. The TodS protein (O) is synthesized in an active form that in the presence of
toluene phosphorylates TodT (Vl), which functions as the activator of the todX...H operon.
357
4. R E G U L A T I O N OF THE TOLUENE-4-MONOOXYGENASE
PATHWAY
@
CH3
tmoABCDEF
.
OH OH OH OH OH
p-HBHO
[]
Fig. 5. Regulation of toluene degradation in P. mendocina KR1. The upper part of the figure
summarizes the oxidation of toluene to protocatechuate and the genes needed for each
reaction. The lower part shows a scheme of the cluster of tmo/pcu/pob genes in this strain.
tmoABCDEF, toluene-4-monooxygenase genes; c, putative cytochrome c gene; pcuRCAXB,
p-cresol utilization genes; pobR1 and pobA1, regulator and p-hydroxybenzoate hydroxylase,
respectively; tmoST, two-component signal transduction system; p-HBOH, p-hydroxybenzyl
alcohol; p-HBHO, p-hydroxybenzyl aldehyde; p-HBA, p-hydroxybenzoate; PCA,
protocatechuate. Reproduced with permission from [ 132].
In a recent study, several Pseudomonas putida strains were analyzed with regard
to toluene tolerance [ 145]. Three of these strains have been classified as highly
resistant (P. putida DOT-T 1E, P. putida S 12 and P. putida MTB6). In P. putida
DOT-T1E, three efflux pumps are involved in solvent tolerance: TtgABC [ 146],
TtgDEF [147] and TtgGHI [148]. The same three efflux pump operons are
present in the P. putida MTB6 chromosome although their participation in
organic solvent extrusion has not been studied in detail. Pseudomonas putida
S 12 contains two of these efflux pumps encoded by the arpABC genes (98%
identical to ttgABC) [ 149], and the srpABC (99% identical to ttgGHI), although
only one of these efflux pumps, SrpABC, has been involved in solvent tolerance
in the S 12 strain [151 ]. P. putida F1 has two efflux pumps ttgABC and sepABC
[ 152] and is more tolerant to toluene that P. putida KT2440, which only has the
ttgABC pump, but it is more sensitive than DOT-T1E.
In P. putida DOT-T1E, solvent tolerance is an inducible process, as
growth of P. putida DOT-T1E in the presence of toluene supplied in the gas
phase has a clear effect on cell survival: the sudden addition of 0.3% (vol/vol)
toluene to P. putida DOT-T1E pre-grown with toluene in the gas phase resulted
in survival of almost 100% of the initial cell number, whereas only 0.01% of the
cells pre-grown in the absence of toluene tolerated exposure to this aromatic
hydrocarbon (Fig. 6) [146, 153]. The three efflux pumps in this strain should
therefore work together in this strain to achieve the maximal level of solvent
tolerance, and they are probably tightly regulated in order to produce an optimal
response to solvent stress.
Most of the regulatory genes that encode for proteins involved in control
of the expression of the efflux pumps belonging to the RND family are located
adjacent to the structural genes of the pump, divergently transcribed from the
efflux pump operon [ 154].
GGTGGGTCGTCAT.~TGTTTGTTGGTACTTACATTCATAT.Z~GGAATCGTTCGAT.~TA
..... <] -1]) -3,5
........................... P~gR
..............................................
111 . I ~ I c> , c
B P~DEF
-35 -10
CTGTTTCGCAAAAACCACATAGTGATACACTATTCTGCAATGCGGGCCATGCATTGTGATT
GAC~GCGTTTTTGGTGTATCACTATGTGAT.~GACGTTACGCCCGGTACGT-~CACT~
PttgT(-151)
C PGZ
-3s -lo I>
C T C A G G C T T G C T T G C G T C A A G A G T A T C A C A T A A T G C T A C A C T C TAC C G C A T T A C G A T T C A G C A A
p,~ -q
GAGTCCG~CG~CGCAGTTCTCATAGTGTATTACGATGTGAGATGGCGT~TGCTAAGTCGTT
............ PttgVW
"'""~176176176176
.... ..... '~176
..................................................................................................
O
Fig. 6. Organization of the ttgABC (A), ttgDEF (B) and ttgGHI (C) operons and their
respective regulatory genes. The regulatory regions of each gene cluster are zoomed. TtgR
(A), TtgT (B) and TtgV (C) DNA binding regions, deduced from DNAseI footprinting, are
shadowed. Putative palindromic (arrows) or symetric (bold and underlined) recognition sites
for each repressor are indicated. The +1 and the direction of transcription are marked with
small triangles for each promoter (except for ttgT one, which distance from PttgDEF is
indicated). The-10 and the-35 positions of each promoter are also shown.
364
mutant was 100 times lower than in the wild type. Expression studies of the
ttgDEF operon at the transcriptional level revealed that this pump is not
expressed during growth under normal laboratory conditions, and demonstrated
its inducible character in the presence of organic solvents (toluene or styrene)
(Table 1) [147].
The wild type multiple antibiotic resistance was not affected in a TtgDEF-
deficient strain; moreover, no increase in antibiotic resistance was obtained by
pre-inducing the culture with toluene [147], suggesting that the substrate
specificity of this pump is limited to organic solvents. There was also no
induction of the ttgDEF operon in the presence of several antibiotics in the
culture media (Terfin et al., unpublished).
Upstream from the ttgDEF operon and divergently transcribed, there is an
open reading frame whose product shares homology with several members of
the lclR family of transcriptional regulators. This gene, called ttgT, encodes for
a protein 70% identical to the SrpS-negative regulator of SrpABC solvent efflux
pump of P. putida S 12 (see below).
A ttgT knockout mutant showed a small increase in ttgDEF expression
under non-inducing conditions, suggesting its involvement in the negative
regulation of this operon. The fact that in this mutant strain there was still a
strong induction of the ttgDEF expression in the presence of organic solvents
suggested that TtgT is not the only protein involved in the induction of this
operon by organic solvents (Terfin et al., unpublished).
Differently from ttgR, ttgT gene expression remained unaltered regardless
of the organic solvent present in the growth medium, which suggested that
expression from ttgDEF and ttgT promoters was not coordinated. Moreover, in
the TtgT-deficient mutant, the activity of the ttgT promoter was similar to that of
the wild-type, indicating that TtgT does not regulate its own transcription (Terfin
et al., unpublished).
Gel shift experiments showed that TtgT was able to specifically bind a
DNA fragment containing the ttgT-ttgDEF intergenic region (Terfin et al.,
unpublished). DNAse I footprint assays revealed a single binding site along the
ttgT-ttgDEF intergenic region which covers only the ttgDEF promoter region (-
37 to +5 from the transcription start point) and not the ttgT one, consistent with
the in vivo expression studies described above. Therefore TtgT is directly
involved in ttgDEF operon repression, probably by competing with the RNA
polymerase for access to the efflux pump promoter. Analysis of the operator
sequence does not reveal the presence of a clear single inverted repeat. Recent
results of our laboratory suggests the induction of this efflux pump in a ttgT-
deficient background by organic solvents is mediated regulator by the TtgV
regulator.
366
Acknowledgments
Work in our laboratory was supported by grants of the European
Commission (QLK3-CT-1999-00041, QLK3-CT-2001-00435 and QLK3-CT-
2000-0170) and a grant from the Human Science Foundation (RGY0021/2001).
We thank C. Lorente for reading the manuscript and improving the language.
REFERENCES
[9] H.J. Heipieper and J.A.M. de Bont, Appl. Environ. Microbiol. 60 (1994) 4440.
[10] H.J. Heipieper, G.Meulenbeld, Q. van Oirschot and J.A.M. de Bont, Appl Environ
Microbiol. 62 (1996) 2773.
[11] B. Loffeld and H. Keweloh, Lipids 31 (1996) 811.
[12] A. von Wallbrun, N.H.Richnow,, Neumann, G., Meinhardt, F., and Heipieper, H.J.,
(2003), J. Bacteriol., 185 1730.
[ 13] F.J. Weber and J.A.M. de Bont, Biochim. Biophys. Acta 1286 (1996) 225.
[ 14] G. Mosqueda, M.I. Ramos-Gonzfilez and J. L. Ramos, Gene, 232 (1999) 69.
[15] P. Godoy, M.I. Ramos-Gonzalez and J.L. Ramos, J. Bacteriol. 18 (2001) 5285.
[ 16] Q. Zhao, X.Z. Li, A. Mistry, R. Srikumar, L. Zhang, O. Lomovskaya and K. Poole,
Antimicrob. Agents. Chemother. 42 (1998) 2225.
[ 17] V.Koronakis, A. Sharft, E. Koronakis, B. Luisi and C. Hughes, Nature 405 (2000) 914.
[18] S. Murakami, R. Nakashima, E. Yamashita and A. Yamaguchi, Nature 419 (2002) 587.
[19] H.I. Zgurskaya and H. Nikaido J. Mol. Biol. 285 (1999) 409.
[20] E.W. Yu, G. McDermott, H.I. Zgurskaya, H. Nikaido and D.E. Jr. Koshland, Science
300 (2003) 976.
[21 ] H.I. Zgurskaya and H. Nikaido, J. Bacteriol. 182 (2000) 4264.
[22] C.A. Elkins and H. Nikaido, Drug Resist. Update 6 (2003) 9.
[23] S.J. Assinder and P.A. Williams, Adv. Microb. Physiol., 31 (1990) 1.
[24] P.A. Williams, R.M. Jones and G. Zylstra, (2004), Genomics of catabolic plasmids. In
Pseudomonas, vol. I, Chapter 6, pp. 165-196, Ed. J.L. Ramos, Kluwer
Academic/Plenum Publishers.
[25] S. Harayama, N. Mermod, M. Rekik, P.R. Lehrbach and K.N. Timmis, J. Bacteriol.,
169 (1987) 558.
[26] S. Harayama and K.N. Timmis (1989), Catabolism of aromatic hydrocarbons by
Pseudomonas. In Genetics of Bacterial Diversity, ed. D. Hopwood, K. Chater, 151-174.
New York Academic.
[27] C. Nakai, H. Kagamiyama and M. Nozaki, J. Biol. Chem., 258 (1983) 2923.
[28] A. Polissi and S. Harayam, EMBO J. 12 (1993) 3339.
[29] J.P. Shaw and S. Harayama, Eur. J. Biochem., 191 (1990) 705.
[30] M. Suzuki, T. Hayakawa, J.P. Shaw, M. Rekik and S. Harayama, J. Bacteriol. 173
(1991) 1690.
[31] D.T. Gibson, J. R. Koch and R. E. Kallio, Biochemistry, 7 (1968) 2653.
[32] G.M. Whited and D. T. Gibson, J. Bacteriol., 173 (1991) 3010.
[33] K.M. Yen, M. R. Karl, L. M. Blatt, M. J. Simon, R. B. Winter, P. R. Fausset, H. S. Lu,
A.A. Harcourt and K. K. Chen, J. Bacteriol., 173 (1991) 5315.
[34] R.H. Olsen, J. J. Kukor and B. Kaphammer, J. Bacteriol., 176 (1994) 3749.
[35] A. Fishman, Y. Tao and T.K. Wood, J. Bacteriol., (2004) in press.
[36] G. Baggi, P. Barbieri, E. Galli and S. Tollari, Appl. Environ. Microbiol., 53 (1987)
2129.
[37] G. Bertoni, F. Bolognese, E. Galli and P. Barbieri, Appl. Environ. Microbiol., 62
(1996) 3704.
[38] G. Bertoni, N. Fujita, A. Ishihama and V. de Lorenzo, EMBO J., 17 (1998) 5120.
[39] G. Bertoni, S. Marqu6s and V. de Lorenzo, Mol. Microbiol., 27 (1998) 651.
[40] J.L. Ramos, E. Duque, J.J. Rodriguez-Herva, P. Godoy, A. Haidour and J.L. Ramos,
J. Biol. Chem. 272 (1997) 3887.
[41] Egan S.M., (2002) J. Bacteriol., 184 5529.
[42] M.T. Gallegos, R. Schleif, A. Bairoch, K. Hofmann and J. L. Ramos, Microbiol. Mol.
Biol. Rev., 61 (1997) 393.
369
[43] J.L. Ramos, C. Mich/m, F. Rojo, D. Dwyer and K. Timmis, J. Mol. Biol., 211 (1990)
373.
[44] R.Tobes and J. L Ramos, Nucleic Acids Res., 30 (2002) 318.
[45] J.L. Ramos, A. Stolz, W. Reineke and K. N. Timmis, Proc. Natl. Acad. Sci. USA, 83
(1986) 8467.
[46] C. Mich~n, L. Zhou, M. T. Gallegos, K. N. Timmis and J. L. Ramos, J. Biol. Chem.,
267 (1992) 22897.
[47] L.M. Zhou, K. N. Timmis and J. L. Ramos, J. Bacteriol., 172 (1990) 3707.
[48] J.L. Ramos, F. Rojo, L. Zhou and K. N. Timmis, Nucleic Acids Res., 18 (1990) 2149.
[49] J.L. Ramos, A. Wasserfallen, K. Rose and K.N. Timmis, Science 235 (1987) 593.
[50] R. Ruiz and J. L. Ramos, J. Biol. Chem., 277 (2002) 7282.
[51 ] N. LaRonde-LeBlanc and C. Wolberger, Biochemistry, 39 (2000) 11593.
[52] C.A. Poore, C. Coker, J.D. Dattelbaum and H. L. Mobley, J. Bacteriol., 183 (2001)
4526.
[53] S. Rhee, R. G. Martin, J. L. Rosner and D. R. Davies, Proc. Natl. Acad. Sci. USA, 95
(1998) 10413.
[54] S.M. Soisson, B. MacDougall-Shackleton, R. Schleif and C. Wolberger, Science, 276
(1997) 421.
[55] R. Ruiz, S. Marquds and J. L. Ramos, J. Bacteriol., 185 (2003) 3036.
[56] M. Manzanera, S. Marqu6s and J. L. Ramos, FEBS Lett., 476 (2000) 312.
[57] N. Kaldalu, U. Toots, V. de Lorenzo and M. Ustav, J. Bacteriol., 182 (2000) 1118.
[58] M.M. Gonz/tlez-P6rez, S. Marqu6s, P. Dominguez-Cuevas and J. L. Ramos, FEBS
Lett., 519 (2002) 117.
[59] M.T. Gallegos, S. Marqu6s and J. L. Ramos, J. Bacteriol., 178 (1996) 6427.
[60] M.M. Gonz~lez-P6rez, J. L. Ramos, M. T. Gallegos and S. Marqu6s, J. Biol. Chem.,
274 (1999) 2286.
[61] B. Kessler, V. de Lorenzo and K. Timmis, J. Mol. Biol., 230 (1993) 699.
[62] B. Kessler, M. Herrero, K. N. Timmis and V. de Lorenzo, J. Bacteriol., 176 (1994)
3171.
[63] B. Kessler, S. Marqu6s, T. Kohler, J. L. Ramos, K. N. Timmis and V. de Lorenzo, J.
Bacteriol., 176 (1994) 5578.
[64] N. Kaldalu, T. Mandel and M. Ustav, Mol. Microbiol., 20 (1996) 569.
[65] K. Miura, S. Inouye and A. Nakazawa, Mol. Gen. Genet., 259 (1998) 72.
[66] I. Artsimovitch, K. Murakami, A. Ishihama and M. M. Howe, J. Biol. Chem., 271
(1996) 32343.
[67] S. Busby and R. H. Ebright, Mol. Microbiol., 23 (1997) 853.
[68] A. Dhiman and R. Schleif, J. Bacteriol., 182 (2000) 5076.
[69] S. Marqu6s, M. T. Gallegos and J. L. Ramos, Mol. Microbiol., 18 (1995) 851.
[70] S. Marqu6s, M. Manzanera, M. M. Gonz/tlez-P6rez, M. T. Gallegos and J. L Ramos,
Mol. Microbiol., 31 (1999) 1105.
[71] T. Yura and K. Nakahigashi, Curr. Opin. Microbiol., 2 (1999) 153.
[72] S. Inouye, A. Nakazawa and T. Nakazawa, Gene, 66 (1988) 301.
[73] S. Kustu, E. Santero, J. Keener, D. Popham and D. Weiss, Microbiol. Rev., 53 (1989)
367.
[74] A.K. North, K. E. Klose, K. M. Stedman and S. Kustu, J. Bacteriol., 175 (1993) 4267.
[75] M.A. Abril, C. Michfin, K. N. Timmis and J. L. Ramos, J. Bacteriol., 171 (1989)
6782.
[76] A. Delgado and J. L. Ramos, J. Biol. Chem., 269 (1994) 8059.
[77] A. Delgado, R. Salto, S. Marqu6s and J. L. Ramos, J. Biol. Chem., 270 (1995) 5144.
370
Chapter 13
1. INTRODUCTION
One of the greatest challenges faced by the modem world is the dissociation
from the heavy dependency of the energy technologies upon the chemical bonds
of hydrocarbons. The imminent exhaustion of conventional oil sources, ranging
from a pessimistic ultimate recovery volume of 0.6 trillions of barrels to a highly
optimistic volume of 3.9 trillions of barrels [4], results in a stringent requirement
for the development of alternative technologies. It is important to note that the
world is not to run out of hydrocarbons, given the substantial amount of low-
grade, hard-to-extract supplies such as the Canadian tar sands or the abundant
heavy oil reservoirs in Venezuela and Mfxico. Nevertheless, exploiting these
reservoirs is likely to be much more expensive financially, energetically,
politically and especially environmentally.
Biotechnology has greatly impacted modem industry, from the now
conventional production of goods by the use of fermentations to the novel
synthesis of valuable fine chemicals using enzymes [5, 6, 7, 8]. Notwithstanding
its enormous potential, the incorporation of biotechnological tools into the oil
industry has faltered [9]. In particular, the search of alternative hydrocarbon
sources through biotechnological media has not been assessed. Here, I compile
information regarding the biological production of hydrocarbons by bacteria and
explore its potential, not only as an environmentally-friendly fuel supply, but
also as a renewable source for basic petrochemicals.
374
Table 1
Taxonomical distribution of eubacterial and archaeal species able to
synthesize and accumulate hydrocarbons.
This ability is not restricted to eubacteria. Some archeal species from the
genus Sulfolobus, Thermoplasma, Methanosarcina and Halobacterium, have
been demonstrated able to synthesize and accumulate hydrocarbons such as
squalene and other acyclic isoprenoids (C20-C25). [31, 32]. Furthermore,
individual species that produce hydrocarbons as major components have been
isolated from mesophilic, thermophilic, psycrophilic, acidophilic, alkalinophilic,
376
3. BIOSYNTHETIC PATHWAYS
C2-elongation Decarboxylation
Oleic acid ..- ..~ LCFA ..~ Hydrocarbons
(malonyl
condensation)
Fig. 1 Metabolic pathways for aliphatic hydrocarbonbiosynthesis (Modified from [3] and
[ 1]). LCFA- Long Chain Fatty Acids
377
I0 20 30 40 50 60 70
.... i . . . . . . . . I .................... I ........ i ............ I .... I
Photobacterium MIKKIPLIIG GEVQDTSEHD VRELTLNNN~ VNVPIITDKD AESITSLKIE NKLNINQIVN FLYTVGQKWK
Acinetobacter .................. MN AKLKKLFQQKVDGKTIIVTG ASSGIGLTVS ................. KYL
Simmondsia .......... MEVEKELKTF SEVWISAIAA ACYCRFVPAV APHGGALRLL LLLPWLLFI FLPLRLSSFH
Consensus : * .* : .:
Fig. 2. Multiple alignment of fatty acyl CoA reductases from the proteobacteria Acinetobacter
calcoaceticus [43] and Photobacterium leiognathi [44] and from the plant Simmondsia
chinensis (jojoba) [42]. Residues conforming the predicted catalytic triad are highlighted.
Group I (Plants) Arabidopsis thaliana (9758166, 9758167, 9758170, 4678926, 15218662, 9758168,
9758165, 8778260, 8778259, 9758169, 15218659, 9758164, 9759288, 15218667). Oryza sativa
(38345254, 38345253, 38347115, 20146429). Vitis vinifera (27728714, 27728716, 27728718)
Fig. 3. Deduced Fatty Acyl CoA reductases are organized in three different groups on
the basis of sequence similarity. Sequence identification numbers in parenthesis.
380
HSCoA O
CH~_c~O_--~ II
CH~--C--SCoA C"+CH2+C"3
acetate ~ C02 ,,4~CO2
Fig. 4. Proposed pathway for formation of n-heptane from acetate in Pinus jeffreyi.
Adapted from [2]
CHa
) c,_c~_c~ ~
I -"OH
CHF'CH2 NH2
CO2
isoleucine H20
CH3 / ~ ~O CH3 / \ / ~ / CH3
+ = / CH--CH2-t CH~ CH= CH1cHr CH~-CH
CH~_CH/2C
H-CH2"~CH2~C'OH CH~_CH2 -- 19 ~ 18 ~CH~-CH
3
CH~--C~
~jO fatty acid
"OH
acetate
Fig. 5 Relationship between isoleucine and acetate, the anteiso C15 fatty acid and the
C29 hydrocarbon with anteiso branch methyls in both ends. Modified from [1].
381
All this information leads to the idea that ability of bacteria to synthesize
hydrocarbons is widespread and that it probably occurs by more than one
mechanism which are significantly different compared to those described in
plants.
4. D O W N S T R E A M P R O C E S S I N G
The isolation and refinement of bacterial hydrocarbons has not been approached
at production scale. Nevertheless, there is abundant information regarding the
operations developed for a similar procedure with B. braunii. The process of
extracting hydrocarbons from these cells can be thought of as consisting of three
major operations. The first is that of harvesting the cells from the growth
medium. This involves the concentration or flocculation of cells from the liquid
where it is grown. This operation can be achieved through a variety of means
that include filtration, mechanical centrifugation or concentration, gravitational
concentration or chemical flocculation. The most efficient method for large-
scale hydrocarbon recovery is chemical flocculation. For efficient extraction, the
cells must be concentrated to a semi-dry paste.
The second step is that of the actual physical extraction of the
hydrocarbon fuel from the cells. Under suitable conditions, up to 70% of the
total hydrocarbon content can be released by 30 min of contact with solvents.
The selected solvent should be immiscible with water, with a density
significantly different than water, should be non-toxic and reusable. In view of
these considerations, hexane appears to be the solvent of choice [59]. Growth
and hydrocarbon production are not affected by repeated extraction with hexane.
In fact, a higher content of hydrocarbons has been observed in hexane-treated
biomass relative to controls. Nevertheless, recovery yields are influenced by the
physiological status of the culture. Scale up of the extraction can be difficult,
given the algae propensity to aggregate. Extensive clumping shields a large
fraction of the biomass from exposure to solvent. Alternative methods aimed to
increase the oil extraction yield have been explored. Recovery yields are
markedly increased relative to freely suspended controls when cells immobilized
by adsorption in polyurethane foam were continuously extracted with hexane
[60]. Supercritical fluid extraction is another technology that has been applied
[61].
The third operation would be the collection and concentration of the
hydrocarbon product. Although biosynthetic hydrocarbons can be directly used
in internal combustion engines after extraction with hexane, its performance is
improved by further modification. Cellular hydrocarbons can be converted to
gasoline (60 to 70%), light cycle oil (10 to 15%), heavy cycle oil (2 to 8%) and
coke (5 to 10%) after catalytic cracking [62]. The yield of gasoline obtained by
382
5. FUTURE PROSPECTS
Aknowledgements
The author thanks Shirley Ainsworth for assistance during the
bibliographical investigation. This work was supported by PEMEX grant 138.
383
REFERENCES
[34] J. Oro, T.G. Tornabene, D.W. Nooner and E. Gelpi, J. Bacteriol., 93 (1967) 1811.
[35] J.B. Davis, Chem. Geol., 3 (1968) 155.
[36] J.G. Jones, J. Gen. Microbiol., 59 (1969) 145.
[37] J. Templier, C. Largeau and E. Casadevall, Phytochemistry, 23 (1984) 1017.
[38] X. Wang and P.E. Kolattukudy, FEBS Lett., 370 (1995) 15.
[39] J. Vioque, T. Sirakova and P.E. Kolattukudy, J. Phycol., 35 (1999) 121.
[40] X. Wang and P.E. Kolattukudy, Biochem. Biophys. Res. Commun., 208 (1995) 210.
[41] J. Vioque and P.E. Kolattukudy, Arch. Biochem. Biophys., 340 (1997) 64.
[42] K.D. Lardizabal, J.G. Metz, T. Sakamoto, W.C. Hutton, M.R. Pollar and M.W. Lassner,
Plant Physiol., 122 (2000) 645.
[43] S. Reiser and C. Sommerville, J. Bacteriol., 179 (1997) 2969.
[44] J.W. Lin, Y.F. Chao and S.F. Weng, Biochem. Biophys. Res. Commun., 191 (1993)
314.
[45] J. Benach, S. Atrian, R. Gonzalez-Duarte and R. Ladenstein, J. Mol. Biol., 282 (1998)
383.
[46] M.W. Dennis and P.E. Kolattukudy, Arch. Biochem. Biophys., 287 (1991) 268.
[47] F. Schneider-Belhaddad and P.E. Kolattukudy, Arch. Biochem. Biophys., 377 (2000)
341.
[48] M. Dennis and P.E. Kolattukudy, Proc. Natl. Acad. Sci. U. S. A., 89 (1992) 5306.
[49] M. Bard, D.A. Bruner, C.A. Pierson, N.D. Less, B. Biermann, L. Frye, C. Koegel and R.
Barbuch, Proc. Natl. Acad. Sci. U. S. A., 93 (1996) 186.
[50] B.A. Arthington, L.G. Bennett, P.L. Skatrud, C.J. Guylm, R.J. Barbuch, C.D. Ulbright
and M. Bard, Gene, 102 (1991) 39.
[51] J.R. Reed, P. Hemandez, G.J. Blomquist, R. Feyereisen and R.C. Reitz, Insect Biochem.
Mol. Biol., 26 (1996) 267.
[52] S. Gencic and D.A. Grahame, J. Biol. Chem., 278 (2003) 6101.
[53] E. Kocsis, M. Kessel, E. DeMoll and D.A. Grahame, J. Struct. Biol., 128 (1999) 165.
[54] P.W. Albro, J. Bacteriol., 108 (1971) 213.
[55] P.W. Albro, T.D. Meehan and J.C. Dittmer, Biochemistry, 9 (1970) 1893.
[56] S. Kikuchi, D.L. Rainwater and P.E. Kolattukudy, Arch. Biochem. Biophys., 295 (1992)
318.
[57] P.W. Albro and J.C. Dittmer, Biochemistry, 8 (1969) 1913.
[58] P.W. Albro and J.C. Dittmer, Biochemistry, 8 (1969) 3317.
[59] J. Frenz, C. Largeau, E. Casadevall, F. Kollerup and A.J. Daugulis, Biotehnol. Bioeng.,
34 (1989) 755.
[60] J. Frenz, C. Largeau and E. Casadevall, Enzyme Microb. Technol., 11 (1989) 717.
[61] R.L. Mendes, J.P. Coelho, H.L. Fernandes, I.J. Marrucho, J.M.S. Cabral, J.M. Novais
and A.F. Palavra, J. Chem. Technol. Biotechnol., 62 (1995) 53.
[62] H. Kitazato, S. Asaoka and H. Iwamoto, Sekiyu Gakkaishi, 32 (1989) 28.
[63] P. Pedroni, J. Davison, H. Beckert, P. Bergman and J. Benemann, J. Energy Environ.
Res., 1 (2001) 136.
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Elsevier B.V. All rights reserved. 385
Chapter 14
wells that have never been water-flooded [6, 7], strongly indicating an
indigenous origin. The presence of an indigenous microbial community is
further supported by the isolation of novel species that never has been recovered
from any other sources, and by the physiological characteristics of some isolates
indicating a close adaptation to the respective in situ reservoir conditions.
Recovery of closely related strains from remote oil fields [7-9] also supports the
existence of a widespread microbial biosphere in oil-bearing strata. However,
the problems associated with recovery of biological samples from oil wells are
extensive. Sampling from wellheads is the only way of collecting samples from
petroleum reservoirs, and the possible sources of contamination are numerous. It
is furthermore possible that exogenous mesophilic bacteria can propagate in top
facilities of the oil field installations. Occasionally, aerobic and microaerophilic
bacteria are recovered from produced oil-well water, but available chemical data
suggest that oxygen is absent in oil reservoirs, and these isolates should thus not
be considered as being truly indigenous to deep oil wells. In addition to SRB
and fermentative bacteria, Voordouw et al. [10] detected several aero- and
microaerophilic bacteria in a 600 rn deep water flooded oil reservoir in Canada.
Nitrate-reducing bacteria were recovered from a similar shallow oil field [ 11 ]. It
is postulated that oxygen and nitrate is able to reach these shallow oil-bearing
formations through diffusion or convection from surface layers, giving support
to a limited community of bacteria respiring with nitrate or oxygen [ 10, 11 ].
The number of bacterial cells in water produced from oil reservoirs is
highly variable. Total bacterial counts demonstrated the presence of more than
106 cells per ml in water from a non-water flooded reservoir in California [6],
and from sulfide-rich production water from a German water-flooded petroleum
reservoir up to 6.3 x 106 colony-forming units of sulfate-reducing bacteria per
ml has been obtained [12]. Although only a few bacteria per ml have been
detected in water produced from some oil wells, these results show that the
bacterial density can be significant. In the present chapter our current knowledge
of these microorganisms is reviewed.
Table 1
Sulfate-reducing p r o k a r y o t e s recovered from oil field p r o d u c t i o n waters
3. METHANOGENIC ARCHAEA
at 65~ and has an upper growth-limit at 80~ has been recovered from oil-
fields in Tataria and Western Siberia [38]. Two other thermophilic methanogens
have been recovered from oil wells, which both share with M.
thermoalcaliphilum, the ability to use hydrogen as energy source and CO2 as
carbon source (Table 3). Although positive enrichments of acetate-utilizing
methanogens at 60~ have been obtained, it has not yet been possible to obtain
pure cultures of acetoclastic thermophilic methanogens from oil wells [37, 38,
39]. A plausible reason is that thermophilic methane production from acetate in
these environments might be a result of interspecies hydrogen transfer [37].
Several mesophilic methanogens have been isolated, including
hydrogenotrophic types as well as strains utilizing methylamines and acetate
(Table 3).
4. F E R M E N T A T I V E B A C T E R I A AND A R C H A E A
Table 2
Examples of methanogenic reaction and their standard free energy changes.
b3
Table 3
Methanogens recovered from oil reservoirs
Table 4
F e r m e n t a t i v e b a c t e r i a and A r c h a e a r e c o v e r e d f r o m oil reservoirs
4.2. Archaea
Hyperthermophilic fermentative Archaea belonging to the genus
Thermococcus were first isolated from Japanese oil reservoirs in 2000 [46].
Although the isolates were not described at the species level, they were
nutritionally very similar to other thermococci, growing on proteinaceous
substrates, yeast extract and amino acids. Although the in situ reservoir
temperature ranged from 50 to 58~ the optimal temperature of the isolates was
above 80~ [43, 46]. The number of hyperthermophilic cocci that were present
395
carbohydrates, glycerol, fumarate, peptides and yeast extract, and is the only
spirochete so far isolated from the deep subsurface. Evidence for the presence of
a closely related spirochete in North Sea oil wells has, however, been obtained
using direct molecular techniques (Birkeland, unpublished).
5. IRON R E D U C E R S
6. CULTURE-INDEPENDENT APPROACHES
7. CONCLUSIONS
REFERENCES
[27] G.N. Rees, G.S. Grassia, A.J. Sheehy, P.P. Dwivedi and B.K.C. Patel, Int. J. Syst.
Bacteriol., 45 (1995) 85.
[28] J. Beeder, T. Torsvik and T. Lien, Arch. Microbiol., 164 (1995) 331.
[29] T. Itoh, K.-i. Suzuki, P.C. Sanchez and T. Nakase, Int. J. Syst. Bacteriol., 49 (1999)
1157.
[30] K.O. Stetter, G. Laurer, M. Thomm and A. Neuner, Science, 236 (1987) 822.
[31] K.O. Stetter, Syst. Appl. Microbiol., 10 (1988) 172.
[32] A. Labes and P. Sch6nheit, Arch. Microbiol., 176 [2001) 329.
[33] S. Burggraf, H.W. Jannasch, B. Nicolaus and K.O. Stetter, Syst. Appl. Microbiol., 13
(1990) 24.
[34] I.A. Borzenkov, S.S. Belyaev, Y.M. Miller, I.A. Davidova and M.V. Ivanov,
Microbiology (Engl. Tr.), 66 (1997) 104.
[35] S.S. Belyaev and M.V. Ivanov, Ecol. Bull., 35 (1983) 273.
[36] M.V. Ivanov, S.S. Belyaev, A.M. Zyakun, V. Bondars and K. Laurinivicius,
Geokhimiya 11 (1983) 1647.
[37] E.A. Bonch-Osmolovskaya, M.L. Miroshnichenko, A.V. Lebedinsky, N. A. Chernyh,
T.N. Nazina, V.S. Ivoilov, S.S. Belyaev, E.S. Boulygina, Y.P. Lysov, A.N. Perov, A.D.
Mirzabekov, H. Hippe, E. Stackebrandt, S. L'Haridon and C. Jeanthon, Appl. Environ.
Microbiol., 69 (2003) 6143.
[38] I.A. Davydova-Charakhch'yan, V.G. Kuznetsova, L.L. Mityushina and S.S. Belyaev,
Microbiology [Engl. Tr.], 61 (1992) 299.
[39] R.K. Nilsen and T. Torsvik, Appl. Environ. Microbiol., 62 (1996) 728.
[40] E. Miranda-Tello, M.L. Fardeau, P. Thomas, F. Ramirez, L. Casalot, J.L. Cayol, J.L.
Garcia and B. Ollivier, Int. J. Syst. Evol. Microbiol., 54 (2004) 169.
[41] S. L'Haridon, M.L. Miroshnichenko, H. Hippe, M.L. Fardeau, E.A. Bonch-
Osmolovskaya, E. Stackebrandt and C. Jeanthon, Int. J. Syst. Evol. Microbiol. 52 (2002)
1715.
[42] S. L'Haridon, M.L. Miroshnichenko, H. Hippe, M.L. Fardeau, E. Bonch-Osmolovskaya,
E. Stackebrandt and C. Jeanthon, Int. J. Syst. Evol. Microbiol., 51 (2001) 1327.
[43] Y. Takahata, M. Nishijima, T. Hoaki and T. Maruyama, Int. J. Syst. Evol. Microbiol., 51
(2001) 1901.
[44] M.E. Davey, W.A. Wood, R. Key, K. Nakamura and D.A. Stahl, System. Appl.
Microbiol. 16 (1993) 191.
[45] R. Huber and K.O. Stetter, In: A. Balows, H.G. Trtiper, M. Dworkin, W. Harder and
K.H. Schleifer (eds.), The prokaryotes, 2nd edn., Springer, Berlin Heidelberg New York,
(1992) 3809.
[46] Y. Takahata, M. Nishijima, T. Hoaki and T. Maruyama, Appl. Environ. Microbiol., 66
(2000) 73.
[47] M.L. Miroshnichenko, H Hippe, E. Stackebrandt, N.A. Kostrikina, N.A. Chernyh, C.
Jeanthon, T.N. Nazina, S.S. Belyaev, E.A. Bonch- Osmolovskaya, Extremophiles, 5
(2001) 85.
[48] S. Rengpipat, T.A. Langworthy and J.G. Zeikus, Syst. Appl. Microbiol., 11 (1988) 28.
[49] G. Ravot, M. Magot, B. Ollivier, B.K.C. Patel, E. Ageron, P.A.D. Grimont, P. Thomas
and J.L. Garcia, FEMS Microbiol. Lett., 147 (1997) 81.
[50] V.K. Bhupatiraju, A. Oren, P.K. Sharma, R.S. Tanner, C.R. Woese and M.J. McInemey,
Int. J. Syst. Bacteriol., 44 (1994) 565.
[51] V.K. Bhupatiraju, and M.J. McInerney, C.R. Woese and R.S. Tanner, Int. J. Syst.
Bacteriol., 49 (1999) 953.
[52] A. Oren, Can. J. Microbiol., 32 (1986) 4.
402
[53] M. Magot, M.L. Fardeau, O. Arnauld, C. Lanau, B. Ollivier, P. Thomas and B.K.C
Patel, FEMS Microbiol. Lett., 155 (1997) 185.
[54] J.L. Cayol, B. Ollivier, B.K.C. Patel, G. Ravot, M. Magot, E. Ageron, P.A.D. Grimont
and J.L. Garcia, Int. J. Syst. Bacteriol. 45 (1995) 783.
[55] M.L. Fardeau, M. Magot, B.K. Patel, P. Thomas, J.L. Garcia, B. Ollivier, Int. J. Syst.
Evol. Microbiol., 50 (2000) 2141.
[56] G.N. Rees, B.K.C. Patel, G.S. Grassia and A.J. Sheehy, Int. J. Syst. Bacteriol. 47 (1997)
150.
[57] R.J. Menes and L. Muxi, Int. J. Syst. Evol. Microbiol., 52 (2002) 157.
[58] M. Magot, G. Ravot, X. Campaignolle, B. Ollivier, B.K.C. Patel, M.L.Fardeau, P.
Thomas, J.L. Crolet and J.L. Garcia, Int. J. Syst. Bacteriol. 47 (1997) 818.
[59] I.A. Davydova-Charakhch'yan, A.N. Mileeva, L.L. Mityushina and S.S. Belyaev,
Microbiology (Engl. Tr.), 61 (1992) 306.
[60] R. Sleat, R.A. Mah and R. Robinson, Int. J. Syst. Bacteriol., 35 (1985) 10.
[61 ] M. Vargas, K. Kashefi, E.L. Blunt-Harris and D.R. Lovley, Nature, 395 (1998), 65.
[62] D.R. Boone, Y. Liu, Z.J. Zhao, D.L. Balkwill, G.R. Drake, T.O. Stevens, H.C. Aldrich,
Int. J. Syst. Bacteriol., 45 (1995) 441.
[63] S.V. Liu, J. Zhou, C. Zhang, D.R. Cole, M. Gajdarziska-Josifovska and T.L. Phelps,
Science, 277 (1997) 1106.
[64] A.G. Cairns-Smith, A.J. Hall and M.J. Russell, Orig. Life Evol. Biosph., 22 (1992) 161.
[65] K.M. Semple and D.W.S Westlake, Can. J. Microbiol., 33 (1987) 366.
[66] T.N. Nazina, A.E. Ivanova, O.V. Golubeva, R.R. lbatulin, S.S. Belyaev and M.V.
Ivanov, Microbiology (Engl. Tr.), 64 (1995) 203.
[67] A.C. Greene, B.K.C. Patel and A.J. Sheehy, Int. J. Syst. Bacteriol., 47 (1997) 505.
[68] A.I. Slobodkin, C. Jeanthon, S. L'Haridon, T. Nazina, M. Miroshnichenko, E. Bonch-
Osmolovskaya, Curr. Microbiol., 39 (1999) 99.
[69] G. Voordouw, S.M. Armstrong, M.F. Reimer, B. Fouts, A.J. Telang, Y. Shen and D.
Gevertz, Appl. Environ. Microbiol., 62 (1996) 1623.
[70] J.-Y. Leu, C.P. McGovern-Traa, A.J.R. Porter and W.A. Hamilton, Anaerobe, 4 (1998)
165.
[71] G. Voordouw, J.K. Voordouw, R.R. Karkhoffschweizer, P.M. Fedorak and D.W.S.
Westlake, Appl. Environ. Microbiol., 57 (1991) 3070.
[72] G. Voordouw, Y. Shen, C.S. Harrington, A.J. Telang, T.R. Jack, D.W.S. Westlake,
Appl. Environ. Microbiol., 59 (1993) 4101.
[73] T. Lien and J. Beeder, Int. J. Syst. Bacteriol., 47 (1997) 1124.
[74] A.S Galushko and E.P. Rozanova, Microbiology (Engl. Tr.), 60 (1991) 102.
[75] T. Lien, M. Madsen, I.H. Steen and K. Gjerdevik, Int. J. Syst. Bacteriol., 48 (1998) 469.
[76] J.-Y. Leu, C.P. McGovem-Traa, A.J. Porter, W.A. Hamilton, Lett. Appl. Microbiol., 29
(1999) 246.
[77] E.P. Rozanova, T.N. Nazina and A.S. Galushko, Microbiology (Engl. Tr.) 57 (1988)
634.
[78] T.N. Nazina and E.P. Rozanova, Microbiology [Engl. Tr.], 47 (1978) 142.
[79] R.K. Nilsen, T. Torsvik and T. Lien, Int. J. Syst. Bacteriol., 46 (1996) 397.
[80] M. Magot, P. Caumette, J.M. Desperrier, R. Matheron, C. Dauga, F. Grimont and L.
Carreau, Int. J. Syst. Microbiol., 42 (1992) 398.
[81] E.P. Rozanova and A.I. Khudyakova, Microbiology [Engl. Tr.] 43 (1974) 1069.
[82] S.S. Belyaev, R. Wolkin, W.R Kenealy, M.J. De Niro, S. Epstein and J.G. Zeikus, Appl.
Environ. Microbiol., 45 (1983) 691.
[83] T.K. Ng, P.J. Weimer and L.J. Gawel, Geomicrobiol. J., 7 (1989) 185.
403
[84] B. Ollivier, M.L. Fardeau, J.L. Cayol, M. Magot, B.K.C. Patel, G. Prensier and J.L.
Garcia, Int. J. Syst. Bacteriol., 48 (1998) 821.
[85] A.Y. Obraztsova, O.V. Shipin, L.V. Bezrukova and S.A. Belyaev, Microbiology [Engl.
Tr.] 56 (1988) 523.
[86] B. Ollivier, J.L. Cayol, B.K.C. Patel, M. Magot, M.L. Fardeau and J.L. Garcia, FEMS
Microbiol. Lett., 147 (1997) 51.
[87] A.Y. Obraztsova, V.E. Tsyban, K.S. Laurina Vichus, L.V. Bezrukova andS.S. Belyaev,
Microbiology [Engl. Tr.], 56 (1987) 807.
[88] S. Ni and D.R. Boone, Int. J. Syst. Bacteriol. 41 (1991) 410.
[89] G. Ravot, M. Magot, M.-L. Fardeau, B.K.C. Patel, P. Thomas, J.-L. Garcia and B.
Ollivier, Int. J. Syst. Bacteriol. 49 (1999) 1141.
[90] T. Lien, M. Madsen, F.A. Rainey and N.-K. Birkeland, Int. J. Syst. Bacteriol., 48 (1998)
1007.
[95] G. Ravot, M. Magot, M.L. Fardeau, B.K.C. Patel, G. Prensier, A. Egan, J.L. Garcia and
B. Ollivier, Int. J. Syst. Bacteriol., 45 (1995) 308.
[97] M.L. Fardeau, B. Ollivier, B.K.C. Patel, M. Magot, P. Thomas, A. Rimbault, F.
Rocchiccioli and J.L. Garcia, Int. J. Syst. Bacteriol. 47 (1997) 1013.
[98] C. Jeanthon C, A.L. Reysenbach, S. L'Haridon, A. Gambacorta, N.R. Pace, P. G16nat
and D. Prieur, Arch. Microbiol., 164 (1995) 91.
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Elsevier B.V. All rights reserved. 405
Chapter 15
1. INTRODUCTION
<Recovery Increase>
Fluidity Viscosity
reduction [ Temperature~
increase
Degradation ~
Steam,
In situ combustion
MEOR.
In situ combustion
/ tension
Increase of
pressure
Rock Alkali,
permeability dissolution MEOR
<Upgrading>
Degradation to light Oil MEOR,
In situ combustion
Desulfurization and denitrification MEOR
(2) Second step: understanding of the MEOR test field. That is, the
collection of scientific data about the fundamental microbiology and
reservoir related to the MEOR field trial.
2. TEST FIELD
The test field, Fuyu oilfield, is located in the northeastern area of China (Fig. 2
A and B). Oil production in this area began in 1973, and waterflooding was
instituted in 1983. Current production is conducted using sucker rod pumping.
(h) Russia ,~
) Beijing~~ e
30 ~ ~ t . 0
4 Hone K t"$1"l
[[ Oc;ia~nc
20" ~~. ~ "4 - - - 20 ~
E /o 9 )'~
/ /~27 20-274//
S / ~ lEast24-23Block l / J 1 6 ~22-272//
~/" 9 '9 'L 9 /..Z-2D4
~ 2 9 22-27///
/ //9/ 24-22
.... /a24-232 24-7~'~ , , I Z 2 5 , . O _ 2-~ ---2 6 0 - ~,,2 6 4
o-u ~ - ' we'~N-24111r
~'/ ~ 24-22~'*"'%24.~; i'N~~2 bz~26-252J
/7 ,26.212 '~26"922"'26-~ 9 ~
// 9 26-21 o26-~1__ 9 ~6-231 ~>24- 26-244 7'-'-'4
/ / 9 2a207~9,,
,4 2s J. ~1 5? ? ~ z a ",,~ _
A m _ - %,I)~14~ ~715 ,~ 28-~] za~ "~ Producingwell
/ ""-'J,eo~ 9~.9128-222~Z 9~'9a ,1~ Injectingwell
9 z.o-,~ 9 "'"" 9 - e 7' ~ o Coringwell
28-194 28-2Ck 28-214 28-224/ 50 m
Table 1
Reservoir data for test area
Block East 24-23 East 24-26
Reservoir Areas [kill 2] 0.562 0.219
Res. Depth [m] 300-450 320-450
Res. Temperature [~ 28.0 28.0
The reservoir data for test area is shown in Table 1. The target reservoir is
sandstone and its depth is from 300 to 450 m. The temperature of the reservoir is
approximately 30 ~ The average permeability is approximately 240 md and
porosity is 27%. The present water cut of most wells averages more than 90%
and there are heterogeneous fracture zones between each injection well and
production well.
3. T H E C O L L E C T I O N OF S C I E N T I F I C K N O W L E D G E O F T H E
F U N D A M E N T A L M I C R O B I O L O G Y R E L A T E D TO MEOR
The PCR-RFLP analysis includes two major contrived conditions. One is the
primer setting and PCR condition. Highly conserved regions of 16S rDNA are
used as universal primer; amplifications of 16S rDNA of all microbes are
accomplished using only one condition. Another is the selection of the three
restriction endonucleases MspI, HhaI and AluI. Through computer simulation,
these endonucleases are shown to be particularly effective in generating many
restriction fragments in various microbes, mainly resulting in moderate-size
fragments of 100 to 1000 bp that are easily distinguished.
3.2. Investigation of microbes inhabiting the reservoir rock which have the
ability to propagate using molasses.
To obtain closed reservoir core samples, a #J15 well and #J16 well were
drilled in the test area [11] (see Fig. 2(b)). A total of 8 and 4 samples of the
reservoir rock were collected from, respectively, the #J15 and #J16 wells (see
Fig. 4). Whole cores obtained from each layer were cut off using a hatchet;
samples of reservoir rock were then collected by scratching the center of the
whole core's cross section with a small sterilized pickax. Within two days,
microbes inhabiting these samples were analyzed using the combination of
plating and PCR-RFLP analysis described above.
Within the #J15 reservoir rock, we observed and isolated a total of 177
species having the ability to propagate on molasses. Of these, 59 were
determined to have unique RFLP profiles based on RFLP analysis. A total of 87
species having the ability to propagate on molasses were isolated from the
r e s e r v o i r r o c k o f # J 1 6 ; o f t h e s e , 47 w e r e d e t e r m i n e d to
have unique RFLP profiles based on RFLP analysis. Moreover, homology
analysis (phylogenetic relationships) based on the RFLP profiles demonstrated
that almost all of the microbes were different from the general soil bacteria, and
some types of yeasts were detected in the high permeability zones and their
surroundings.
412
Four producing wells were selected for this experiment and the Huff and Puff
molasses injection process shown in Fig. 5 [12]. The Huff and Puff process
encompassed several steps. From the surface facilities, a 10% molasses solution
was shipped in sterilized tank trucks and transported to the well site. At the well
site, 200 kl per well of molasses solution was injected into the reservoir at an
injection rate of 30 kl h -1. After injection, these wells were shut in for 20 days
before production resumed.
414
Fig. 5. Injection process of molasses solution by Huff & Puff injection method
Table 2
The number of species distinguished by RFLP profile
(in ground water, molasses, reservoir brine)
The number of The number of species
species detected grown more than 107 cUum1-1
in the samples using 4% molasses.
Ground water 7 ( 10-103) 3
Molasses 5 (102-103) 1
Reservoir brine from
#26-231 2 (10-104) 0
#24-241 8 (102-103) 1
#20-28 4 (104-105) 0
#T-59 6 (102-103) 0
Table 3 shows the microbes detected in the injected fluid before injection.
These injected fluids were collected from tank trucks at each well site. Within
the four injection fluid samples, the number of species distinguished by their
RFLP profile was three to five, and the concentration of viable cells of each
species was 104 to 107 cfu m1-1. Of these, almost all species grew to more than
107 cfu ml -~ using molasses. Moreover, based on their RFLP profiles, almost all
microbes detected in the injected fluid matched microbes which were isolated
from the ground water.
Table 4 shows microbes detected in the production water after the
injection test. In samples obtained from the four wells, three predominant
species are distinguished by their RFLP profiles. These species, in viable cell
concentrations of 103 to 107 cfu ml l were also detected in the 5 to 13 samples of
production water collected daily throughout the 20-day test period. Moreover,
based on their RFLP profiles, these microbes matched microbes which were
isolated from the ground water.
Fig. 6 (A, B, C and D) shows the production history of the producing
wells in which the molasses solution was injected. It is apparent from these data
that molasses injection into the target reservoir did not result in increased oil
recovery.
416
Table 3
The number of species distinguished by RFLP profile
(in injected fluid)
The number of The number of species
species detected grown more than 107 cfu ml -~
in the samples using 4% molasses.
Injected fluid for
#26-231 4 (104-107) 4
#24-241 4 (10 4.10 6) 4
#20-28 3 ( 106-107) 3
#T-59 5 (106-107) 5
( ) ; Concentration of viable cells [cfu m1-1]
Table 4
Predominant species in production water
distinguished by RFLP profile
(In production water)
Frequency of
RFLP profile detection (times)
A 5 (104-106)
B 8 (103-105)
C 13 (103-107)
In the initial stages of the experiment, oil field conditions were investigated in
detail in order to determine what in situ metabolic processes can be supported in
the reservoir. It was assumed that selective plugging of highly permeable zones
would be effective for this reservoir, because there are many horizontal fractures
near the production wells, caused by the hydraulic fracturing operations.
Successful selective plugging field operations have been reported previously
[22-24], and this methodology is regarded as an effective MEOR process.
Fig. 7 shows the plugging mechanism in highly permeable zones. In
conventional water flooding, water injected into the reservoir flows
predominantly into large channels for a long period of time. When microbes are
injected, they also enter primarily the large channels, growing and producing
insoluble polymer in these places. As a result, insoluble polymer, including
microbial cell mass, selectively plugs high permeability zones, and injection
water is diverted from the large channels into previously un-swept areas of the
reservoir.
2 lxl0111
,...,
500
~D
lxlO
7
/ - 100 ,~
lxl0 6 ~
V] 0
o
Fig. 9 shows the growth and production of insoluble polymer from the
strain CJF-002. It is apparent from these data that one of the notable features of
CJF-002 is its ability to grow and produce insoluble polymer when fed molasses.
Moreover, the cells of the strain CJF-002 are small enough to pass through the
pore throat of average sandstone.
Fig. 10 shows the visual image (A) and SEM images (B and C) of
insoluble polymer. Cellulase can degrade this insoluble polymer.
Results of sugar composition (Table 5) and methylation analysis (Table 6)
also indicated that the insoluble polymer produced by strain CJF-002 is a
cellulose derivative.
Fig. 10. Visual image and SEM images of insoluble polymer by strain CJF-002
(A);Visual image, (B and C);SEM images (After 1 day incubation )
Table 5.
Sugar composition of insoluble polymer
Sugar
Detected substance composition
Glucose 97.31
Mannose 1.32
Arabinose 0.42
Galactose 0.95
Uronic acid 0.0
*Grown with 4% molasses
422
Table 6.
Result of methylation analysis of insoluble polymer
1,4, 5-tri-O-acethyl-2,3,6-tri-O-
2 20' 50" ---*4Glc 88917 29.22
methylglucitol
Table 7.
Summary of PCR amplification for various species by spacer primers
CJF-002 280
Acinetobacter calcoacelis IFO 12552
Aeromonas hydrophila IFO 13286
Alcaligenes faecalis IFO 14479
Azotobacter vinelandii IFO 12018
Bacillus subtilis IFO 3134
Rhodococcus erythropolis IFO 12320
Staphylococcus aureus IFO 12732
Pseudomonas fluorescens IFO 14160
Enterobacter cloacae IFO 13535
Citrobacter freundii IFO 13546
Escherichia coli IFO 13898
Erwinia carotovora IFO 14082
Klebsiella pneumoniae IFO 13541
Clostridiumacetobutylicum IFO 13948
Clostridium butyricum IFO 13949
Teble 8.
The components of reservoir brine
Synthetic brine (1000ml)
Table 9.
Result of competitive vulture test
CJF-O02
Molasses
-,,q jv -,~
Shut-in Water 9 l.,,q
y y
12000 18
"7
- 16 o
~ 10000
E - 14
u5
8000 - 12 E
o~ I 0 - 10 ~
6000
8
4000 - 6
- 4
2000
2
0
1 2 3 4 5 6 7 8 9
Day
Fig. 14. Result of laboratory waterflooding experiment.
Teble 10.
Result of Huff & PuffTest by strain CJF-002
* 1) 1 . - 4. 10m3 of CJF-002 culture broth & 80m 3 of molasses were injected separately.
*2) 5. and 6.10m 3 of CJF-002 culture broth & 80m 3 of molasses were injected
simultaneously.
*3) The ratio of samples with CJF-002 to samples of produced water analyzed.
*4) Oil production; Increase , Same level
*5) Water cut; Decrease , Same level
5.0 100
A 90
4.0 A ~OA A 8O
A AAAAAA
"T 70
o
,,.a
3.0 60
50
2.0 9 00 9 0000 40
9 30
1.0 20
00000000 0000 10
0.0 0
5/1/99 8/1/99 11/1/99 2/1/00
8
lxlO
E
6
r lxl0
lxl0 4
(D
lxl0 2
.,..~
>
4 8 12 16
Days after resuming production (days)
Fig. 16. Result of microbial monitoring at well 22-264
O" Viable cell number before Injection
O" Total viable cell number after resuming production
I1" CJF-002 viable cell number after resuming production
--...I
9
oo Monthly Oil Rate (ton) 9
~ Monthly Water Rate (ton) .-
o
0
o ~ ~ _ ~ V ~ ,~o ~o
j.-~ I ~ ~ I
~~~ ~o ~. ~o
~ -.,i.~,.. ~~" ~~ _. _ ~ ~ ~"
~ ~i o
~ , i 8, ~,~
o.~"
.-'' .... (3"q
t~ ............. ~--:: ..
433
i '$'$e~em m m | u
I!
2000
Apr. May Jun. Jul. Aug. Sep. Oct. Nov. Dec.
Northern Area
CJF-002 Injection imi
Molasses Injection | m E ~5-20 %
0.1% 1%
Southen Area
CJF-002 Injection gml
Molasses Injection | m E I--5-20'
0.1% ]%
o
"
,I, 0 0 9
0 0
lxlO .
o
o lxl0 2 *
o O
i i 1 i I i J r I t i
7/11 7/18 7/25 8/1 8/8 8/15 8/22 8/29 9/5 9/12 9/19 9/26
10% 20%
CJF-O02 MolassesO.l% 1% 5% I /
"7
8 Oo
lxl0 [ o ,-~ o o 9 ooO
9=o= 1 xlO 6
l ~ ~ ~ ~ ~176o ~ oo~eyo~
~176 ? ~176
~~o...
% ~%~ ~ ~
,,.a
o0 O0 0 o o9 9 9 0
o 9149 o o~
o lxl04
. . .//...o
lxl0 2
I I ,, ~ 1 I I I
Incubation Facility
~ t a 9 9 9 m m u mm'm 9 mum 9 m 9 m nm mmam m u m 9 m m m m m w I O Q ~ .
Well Site
25m_~4-252
9 ~:=]
: 500kl
: Water tank Filter : Mani
II
fold Molasses tank
"..
9 Incubating tank
~ ' "n "
3km
E:::=--
~ _" #26-252
Injection of
i ~njection ~ 1 molasses
i [only CJF-002 with 10%
.~or 1 week ~, .............. .:"
2000
Apr. May Jun. "')ul. Aug. Sep. Oct. Nov. Dec.
Northern Area
CJF-002 Injection
Molasses Injection
Southen Area
CJF-002 Injection R
Molasses Injection B~m 10%
A 10% molasses solution was then injected along with strain CJF-002.
After two months of CJF-002 and molasses injections, water injection was
continued as usual. The strain CJF-002 and other microbes were measured as in
the first trial, described above.
The microbial concentrations in injection water taken from the manifold
are shown in Fig. 25. The strain CJF-002 and non-CJF-002 microbial
concentrations were at almost same levels during injection of the strain CJF-002
and molasses. Theoretical concentration, that is, approximately 10s cfu ml -~ of
strain CJF-002 was routinely detected in the injection water. In other words,
results of this microbial monitoring indicate that the strain CJF-002 can increase
in cell number and produce the insoluble polymer in the reservoir.
Figure 26 shows the results of the microbial monitoring of production
water from well #J18. Notably, the concentration of strain CJF-002 detected in
the production water was relatively high, approximately 103 to 106 cfu ml -~, for
20 days following the initial injection. Consequently, the strain CJF-002 was
detected in all producing wells in this test area. Parts of insoluble polymer which
may have come off the reservoir rock were also detected in all producing wells
by HPLC analysis combined with cellulase degradation. This result proves that
the strain CJF-002 has the ability to produce insoluble polymer in porous media
in the reservoir. Results also show that the concentrations of the injected
CJF-002 and molasses during the second trial are enough to sustain the strain
CJF-002's competitiveness and survivability.
The oil production of all wells in the test area is shown in Fig. 27.
Eventually, the oil production increased by more than two times for at least one
year, and incremental oil production reached 3,392 tons [approximately 24,521
bbls] after microbial injection. Total water cut also fell from 88% to 65%.
Notably, a dramatic increase in oil production was observed approximately 20
days after beginning injections. Even after the final CJF-002 and molasses
injection, the great improvements in oil production and water cut continued, and
the oil recovery rate after one year was still doubled. These results indicate that
438
the increased oil production is related to the high concentration of the strain
CJF-002 which was detected at the manifold in the 20 days following the initial
injection.
The authors believe that the principal cause of the sustained increase in oil
recovery over the following year is the stability of the insoluble polymer in the
reservoir. Degradation by strain CJF-002 and the other microbes inhabiting the
reservoir is one factor that may affect the stability of the insoluble polymer.
Some microbes producing cellulase, such as Clostridium sp., are generally
well-known, and some researchers have reported that the microbes belonging to
these species inhabit reservoirs. In our preliminary experiment, however, we
confirmed that the insoluble polymer is not degradable by any microbes
inhabiting the target reservoir or by the strain CJF-002 (data not shown).
Another factor influencing insoluble polymer stability is the possible
absorption of insoluble polymer into reservoir rocks. Considering the results of
the biofilm formation test described above, it is presumed that the insoluble
polymer produced by strain CJF-002 will adhere to the surface of reservoir rock
in the target reservoir.
~ lxlO 6 o~ 9 _ #A k
lxl04
o
o 9 9 9 A
.~ lxl0 2
o
o
t I I I I I
r 9
9o ~
o ~ s 1 4 9 []9 ~-F0r, 20 days o ooo~ ~176
o oooo
~ lxl d o
60 ~
- ~
" r _ ===
9 ml
A
AA A
~ A
.A mum mu
~ A
9 [] 9
9
3o o
AA ~
A A A AA A A A A A
50 50 ,-
k (1)
o 40
.,~_, 40
30 30 ~
o 20 20
10 ncrease of Oil Production 10
I I l I I I I l I I I I I ! 0
5 / 1 5/31 6/30 7/30 8/29 9/28 10/2811/2712/2~ 1/26 2/25 3/27 4/26 5/26 6~25
2001 2002
Fig. 27. Behavior of total oil production at all test area
(2nd trial)
zx Total liquid production 9 Oli production
9 Water cut
440
6
8X10
6
6x10
O
6
4x10
cD
2xlO
6 I
i 1 I
10 15 20 25 30 35
Carbon number
Fig. 28. Comparisonof carbon number of production oil
from well 24-2541 before and atter microbial treatment
(2nd trial)
--*- Before treatment 14.3 - ~ After treatment 4.7
* ( ) indicate water cut, %
Figure 28 shows the carbon number of production oil from well #24-254 ~
after microbial treatment. The carbon number of production oil shifted to a low
molecular weight which can be recovered easily. This result indicates that the
production oil after microbial treatment was produced from previously unswept
zones.
In addition, the effectiveness of the microbial treatment was evaluated
through a comparison of tracer tests using NH4SCN solution. After the first and
second microbial treatment, 30,000 ppm of NH, SCN solution was injected into
the reservoir through two injecting wells. The cumulative quantity of that tracer
was approximately 500 kg. In well #22-27, tracer could not be detected before
the treatment, but could be detected after the treatment (see Fig. 29 (A)). In
contrast, in well #26-25, tracer could be detected before, but not after the
treatment (see Fig. 29 (B)). Furthermore, in the other wells, changes in tracer
peak or time of detection were observed. These results show that the microbial
treatment modified the sweep pattern of injection water.
The results described above prove that the insoluble polymer increases the
volumetric sweep efficiency by diverting injection water from the most highly
permeable zones to previously unswept oil-beating zones. Moreover,
considering the results of the second trial, injection of strain CJF-002 and
molasses for 20 days when the oil production rate decreases may be effective in
continuing to increase oil recovery.
441
60
(A) #22-27
r 50
o 40
E 30
O 20
r 10 9 0
o O~Q-~
0
0 500 1000 1500 2000
Time from tracer injection (hr)
100
(B) #26-25
& 80
~O
~ 60 oO
oo 0
0
=
O
40 o
0 o
0
o Oo o
o 20 O(2D o
9 O o
9 9 9 O 9 9 1 4 99
~_-.~A 9 9 9 1 4 9 & 9 1 4 9 1 4 9 1 4 9 1 4 99 9 9 ,& & 9 1 4 9 ,
Fig. 29. Result o f tracer test at well 22-27 and well 26-25 (2nd trial)
9 Before microbial treatment A After microbial treatment
6. CONCLUSION
3) Transplanting microbes into the high permeability zones of the reservoir and
demonstrating the resulting insoluble polymer production are best accomplished
with operations which reflect and respond to data monitoring the behavior of the
injected microbe.
5) It is clear that the following points are very important for development of the
MEOR technique:
a) Understanding of microbes related to MEOR (including microbes
inhabiting the ground water, molasses and reservoir environments, in addition to
the injecting microbe).
b) Monitoring of behavior of these microbes at field trials.
c) Designing of field operations which reflect those monitoring data.
d) Establishing techniques for transplanting microbes and demonstrating
microbial metabolic function in the reservoir.
In the present study, valuable data to demonstrate the MEOR effect were
successfully collected and the results obtained from this research support the
theory that MEOR can effectively increase oil recovery. Though the results are
seen in only a few cases yet at most, the authors believe that this is an example
of a successful application of MEOR to a broad range of reservoirs.
Acknowledgements
We would like to thank Japan National Oil Corporation, PetroChina
Company Limited Jilin Oilfield Company and Chugai Technos. Company
Limited for the permission to present this paper. We also thank Tohoku
University and KRI Inc. for their constant support in microbial analysis at Fuyu
oilfield. We are also very grateful to fellows for their continuous assistance
during this collaborative research project.
444
REFERENCES
Chapter 16
1. INTRODUCTION
1.1. Common Target Contaminants
Total petroleum hydrocarbons (TPH) comprise a diverse mixture of
hydrocarbons that occur at petrochemical sites and storage areas, waste disposal
pits, refineries and oil spill sites. TPHs are considered persistent hazardous
pollutants, and include compounds that can bioconcentrate and bioaccumulate in
food chains [1], are acutely toxic [2], and some such as benzene [3] and
benzo[a]pyrene are recognized mutagens and carcinogens [4]. Since this group
includes chemicals that have physical and chemical characteristics that vary over
orders of magnitude, TPHs are divided into two categories (Fig. 1). Gasoline
range organics (GRO) corresponds to small chain alkanes (C6-C10) with low
boiling point (60 °- 170°C) such as isopentane, 2,3-dimethyl butane, n-butane and
n-pentane, and volatile aromatic compounds such as the monoaromatic
hydrocarbons benzene, toluene, ethylbenzene, and xylenes (BTEX). Diesel
range organics (DRO) includes longer chain alkanes (C10-C40) and hydrophobic
chemicals such as polycyclic aromatic hydrocarbons (PAH).
Whereas most of these contaminants do have natural sources,
concentration and release of contaminants through anthropogenic activities has
led to significant contamination of soil and groundwater. The extent of
petroleum hydrocarbon contamination throughout the United States is reflected
by the large number of Superfund sites and Leaking Underground Storage Tanks
(LUST) sites that contain these contaminants (Fig. 2 and 3). These sites often
contain high concentrations of contamination. However, individual
contaminants behave differently. Some contaminants such as BTEX compounds
are highly mobile in the environment, while others such as PAHs tend to bind
448
strongly to soil particles near the source or remain entrapped within an organic
phase.
i) BTEX
~ 1~ CH2CH3
CloH22
Fig. 2. United States Superfund sites containing petroleum hydrocarbon contamination for
FY1982 to FY1999 (834 total projects, [6]).
Fig. 3. Total United States underground storage tank corrective actions (FY 1992 to FY 2003,
[7]).
450
2. PHYTOREMEDIATION MECHANISMS
Phytoremediation utilizes physical, chemical, and biological processes to
remove, degrade, transform, or stabilize contaminants within soil and
groundwater. Hydraulic control, uptake, transformation, volatilization, and
rhizodegradation are important processes used during phytoremediation (Fig. 4)
and are discussed below.
2.1. Hydraulic Control
Phytoremediation applications can be designed to capture contaminated
groundwater plumes to prevent off-site migration and/or decrease downward
migration of contaminants, as illustrated in Fig. 5. Trees and grasses act as a
solar "pump" removing water from soils and aquifers through transpiration.
Contaminant plume capture relies on the formation of a cone of
depression within an aquifer due to uptake of water by plants and subsequent
transpiration.
451
Table 1
Advantages and disadvantages of phytoremediation over traditional technologies such as
pump and treat of contaminated groundwater and soil excavation and above-ground treatment.
Advantages Disadvantage s
Relatively low cost Longer remediation times
Easily implemented and maintained Climate dependent
Several mechanisms for removal Effects to food web might be unknown
Environmentally friendly Ultimate contaminant fates might be unknown
Aesthetically pleasing Results are variable
Reduces landfilled wastes
Harvestable plant material
Fig. 5. Plan view of trees planted on a line (similar to an interdiction well field) to capture a
shallow groundwaterplume (Modified after [9]).
Phase I - Conversion
Phase II- Conjugation
Phase I I I - Compartmentation
454
1.00]
0.754 Benzene
LL Toluene
ocO 0.50
I--
m-Xylene
0.2
0.00-I I ' I I I
0 2 4 6
Log Kow
Fig. 6. Estimated transpiration stream concentration factors (TSCF) for BTEX using Eq. 2.
lipophilicity of a pesticide determines its fate in a barley plant [11]. High Kow
values (an indicator of hydrophobicity) corresponded to a greater possibility that
the compound would be retained in the roots (Eq. 3). Burken and Schnoor
(1998) published similar results for the sorption of a wide range of organic
contaminants to roots of hybrid poplar plants grown hydroponically (Eq. 4) [ 12].
Where the Root Concentration Factor (RCF) (L/kg dry roots) is the ratio
of organic chemical sorbed on the root (mg/kg of fresh root tissue) to that in
hydroponic solution (mg/L). This equilibrium partitioning coefficient has
generally proved to be a good indicator of whether a plant retains a contaminant
in the root, which increases the probability of microbial degradation (not
withstanding significant bioavailability limitations). However, a few exceptions
exist such as phenol and aniline, which bind irreversibly to the root (especially
aniline) and are chemically transformed. They are not appreciably desorbed
because they are covalently bound as metabolic products in plant tissue [35].
Benzo[a]pyrene
400-
300-
E3
LL
on,' 200-
100-
Pyrene~l'
Phenanthren~
0
I I I t"'
0 2 4 6
Log Kow
Figure 7 uses Eq. 4 to estimate RCF values for a few common PAHs. The
hydrophobic (high sorption) characteristics of PAHs and other DRO compounds
result in high retention in the root zone. Fortunately, the rhizosphere of most
plants promotes a wealth of microorganisms that can contribute significantly to
the degradation of petroleum hydrocarbons during phytoremediation. Thus,
though a plant may not directly act upon these contaminants, a plant can
influence the microbial community within its root zone to a great extent.
Potential rhizosphere interactions that may be important for
phytoremediation of petroleum hydrocarbons include:
3. PILOT STUDIES
While numerous studies have been carried out at the lab-scale, very little has
been published about field scale implementation of phytoremediation.
Nedunuri et al. [57] investigated total petroleum hydrocarbon (TPH) removal at
several field sites contaminated with crude oil, diesel fuel, or petroleum refinery
wastes, at initial TPH concentrations of 1,700 to 16,000 mg/kg. Plant growth
varied by species, but the presence of some species led to greater TPH
disappearance than with other species or in unvegetated soil. At a crude oil-
contaminated field site near the Gulf of Mexico, an annual rye-soybean rotation
plot and a St. Augustine grass-cowpea rotation plot had significantly (P < 0.05)
greater TPH disappearance than did sorghum-sudan grass or unvegetated
control plots, at 21 months. At a diesel fuel-contaminated Craney Island field
site in Norfolk, Virginia, the fescue plot had significantly (P < 0.10) greater
TPH removal than did an unvegetated plot. At a refinery waste site, statistical
analyses were not presented due to the short time since establishment of the
plots, but Nedunuri et al. reported that qualitatively, the vegetated plots had
greater TPH removal than the unvegetated control plots. After investigating the
potential to use phytoremediation at a site contaminated with hydrocarbons, the
Alabama Department of Environmental Management granted a site, which
involved about 1500 cubic yards of soil of which 70% of the baseline samples
contained over 100 ppm of total petroleum hydrocarbon (TPH). After 1 year of
vegetative cover, approximately 83% of the samples contained less than 10-
ppm TPH [58].
460
Table 2
Potential clean-up mechanisms during phytoremediation of hydrocarbon-
contaminated sites based on physical properties of the target pollutants such as
octanol-water partitioning coefficient (Kow)and Henry's dimensionless constant (KH).
Potential Removal
Contaminants Sources Kow* KH* Mechanisms
Gasoline Range Organics (GRO)
BTEX Refineries,LUST, 135-1585 <0.01 HydraulicControl
Fuel spills Phytovolatilization
Gasoline -10 -5 x 10.4 HydraulicControl
LUST
Oxygenates Phytovolatilization
Diesel Range Organics (DR0)
Coal-gasification,
PAH petroleum distillation, >104 <2 x 10.5 Rhizoremediation
wood preservation,
waste disposal
4. F I E L D SCALE C O N S I D E R A T I O N S
Site Treatability
Plant selection and planting density
Irrigation, agronomic inputs and maintenance
Cost Estimation
Mathematical Modeling
Clean-up time required
Analysis of failure modes
4.1. Site Treatability
4.1.4. Weather
Phytoremediation might be best suited for tropical countries where plant
growth occurs all year round. In temperate climates, the active contribution of
phytoremediation is restricted to the growing period only. Winter operations
462
may pose problems for phytoremediation when deciduous vegetation loses its
leaves, transformation and uptake cease, and soil water is no longer transpired.
However, a combination of grasses can be used to prolong the growing period.
4.2. Plant Selection Criteria
Plants should be selected according to the needs of the application, the
contaminants of concem and their potential to thrive on contaminated soil.
Design requirements should include the use of native plants to avoid
introduction of invasive species. Apart from this, vegetation should be fast
growing, hardy, easy to plant and maintain. The main aim is to ensure that roots
expand throughout the entire contaminated zone. In temperate climates with
shallow contaminated aquifers, phreatophytes, such as Populus sp. (hybrid
poplar, cottonwood, aspen) and Salix sp. (willow) are often selected because of
fast growth, deep rooting ability down to the surface of groundwater, large
transpiration rates, and the fact that they are native throughout most of the
country. Among tropical plants tested for use in Pacific Islands, three coastal
trees, kou (Cordia subcordata), milo (Thespesia populnea), and kiawe (Prosopis
pallida) and the native shrub beach naupaka (Scaevola serica) tolerated field
conditions and facilitated clean-up of soils contaminated with diesel fuel [59].
Grasses are often planted in tandem with trees at sites with organic
contaminants as the primary remediation method. They provide a tremendous
amount of fine roots in the surface soil, which is effective at binding and
transforming hydrophobic contaminants such as TPH, BTEX, and PAHs.
Grasses are often planted between rows of trees to provide for soil stabilization
and protection against wind-blown dust that can move contaminants off-site.
Legumes such as alfalfa (Medicago sativa), alsike clover (Trifolium hybridum ),
and peas (can be used to restore nitrogen to poor soils. Fescue (Vulpia myuros),
rye (Elymus sp.), clover (Trifolium sp.) and reed canary grass (Phalaris
arundinacea) have been used successfully at several sites, especially
petrochemical wastes. Once harvested, the grasses can be disposed off as
compost or burned.
Plant tolerance to high contaminant concentrations is also a very
important factor to keep in mind. The phytotoxicity of petroleum hydrocarbons
is a function of the specific contaminant composition, its concentration, and the
plant species used. Major adverse effects typically include reduced germination
and growth if contaminant concentrations are sufficiently high. In general, TPH
values of 15 percent or greater can result in significant reductions in plant
growth and in some cases mortality. Compared with uncontaminated soil, soils
with 2% TPH reduced alfalfa yields by 32 percent [61]. Production of biomass
by ryegrass was reduced 46 percent at a soil concentration of 0.5 percent (5000
mg/kg) hydrocarbons [47]. It was found that plants pre-grown in clean soil and
subsequently transplanted to the contaminated soil grew nearly as well as the
463
control, showing that toxicity was associated with germination and/or early plant
growth. Similarly, poor rooting of ryegrass compared to legumes appeared to
adversely affect the removal of TPH from Gulf War-contaminated soils [62].
Also, although the germination of sunflower seeds and beans was greater than
that of maize, vegetative growth was greater for maize than beans,
demonstrating that germination and later plant growth may be affected
differently [63].
Aged spills tend to be much less phytotoxic than flesh ones, possibly
because of the lower bioavailability of toxic compounds in the aged spills.
However, the speciation of petroleum hydrocarbons is also very important in
determining phytotoxicity. A fuel oil with 30 percent aromatics resulted in LCs0
germination (oil concentration lethal to 50 percent of test plants) values of
7 percent (70,000 mg/kg) for sunflower seeds. The volatile fraction can prove
most toxic to plants. Aromatic volatile petroleum hydrocarbons such as benzene
have been used as herbicides in the past years, illustrating their phytotoxicity
when applied to plant leaves [64]. In contrast, no phytotoxic effects were
observed in hybrid poplar trees exposed to a simulated groundwater containing a
mixture of VOCs including BTEX, chlorinated aliphatics, and alcohols at a total
concentration of 169 mg/L [65]. Reduction of the volatile fraction may be
accomplished through management, such as by tillage of the soil. If initial
efforts at plant establishment at a site fail, replanting the area may ultimately
lead to success as concentrations or bioavailability of the more phytotoxic
components decline.
Solution-phase concentrations of hydrocarbons are also important,
particularly for aquifer remediation applications of phytoremediation. Additional
components with phytotoxic effects include various unsaturated hydrocarbons
and acidic hydrocarbons such as alicyclics with carboxylic acid groups
(naphthenic acids) [64].
A screening test and knowledge from the literature of plant attributes is
essential for selection of plants. Most experts recommend a mixture of grasses
or legumes to address surface soils contaminated with petroleum hydrocarbons.
However, design engineers should work in interdisciplinary teams that include a
botanist and/or agricultural specialist to identify and select plants that will grow
well at the site. Preliminary greenhouse studies should also be used to identify
plants that can thrive and enhance transformation of contaminants of concern to
non-toxic or less toxic products.
The U.S. Department of Agriculture also provides two databases on plants
(http://Plant-Materials.nrcs.usda.gov/ and http ://plants.usda.gov/). For
information specifically pertaining to plants used for phytoremediation of
petroleum hydrocarbons, the Phytopet database compiled by the Department of
Soil Science, University of Saskatchewan in co-operation with Environment
Canada is available at http://www.phytopet.usask.ca.
464
4.3.1. Irrigation
Results suggest that irrigation can enhance bioremediation of certain
diesel components. For terrestrial phytoremediation applications, it is often
desirable to include irrigation costs on the order of 10-20 inches of water per
year, in the design. Spray irrigation is less efficient than drip irrigation as it
encourages the growth of weeds that compete for nutrients with plants and
hinder their delivery to the contaminated zone. Irrigation of the plants is
especially important during the start of the project. However, after the first year,
hydrologic modeling can beused to estimate the rate of percolation to
groundwater under imgation conditions. Over time, irrigation can be withdrawn
from the site, provided the area receives sufficient rainfall to sustain the plants.
Table 3
Macro- and Micro-nutrients required for healthy plant growth.
Including all these costs, the start-up cost for phytoremediation at $10,000
- 25,000/ acre is still considerably less expensive than other competing
technologies (Table 4). However, since phytoremediation usually requires five
or more years, it is very important to make sure that funding for operation and
maintenance is available during the life of the project.
4.5. Operation and Maintenance Issues
Operation and maintenance (O & M) is vital to ensure vigorous growth of
plants. Some of the major problems in the field have been weeds, killing frosts
or drought, insect or disease infestation, beaver or deer browse, and damage by
voles. It has been estimated that at least 30 percent of the plants may need to be
replanted in the second or third year. Phreatophytic trees are also a source of
concern since there is a potential for the expanding roots to enter and restrict
flow of subsurface drains and sewers and break power and communication
cables and small pipelines. Further, mowing, pruning, harvesting, monitoring
vegetation for contaminants, irrigation and fertilizer costs should be included in
the initial estimated costs. Jordahl, et aL (2002) provides a good summary of key
siting and O&M issues that occur during the life of a field-scale project [85].
Table 4.
Five-Year Cost Comparison of Phytoremediation by Hybrid Poplar Trees versus
Conventional Pump and Treat [84]
1. Phytotransformation
Design and Implementation $ 50,000
Monitoring Equipment
Capital 10,000
Installation 10,000
Replacement 5,000
5-Year Monitoring
Travel and administration 50,000
Data collection 50,000
Reports (annual) 25,000
Sample analysis 50,000
TOTAL $ 250,000
2. Pump and Treat (3 wells and Reverse Osmosis System)
Equipment $100,000
Consulting 25,000
Installation/Construction 100,000
5-Year Costs
Maintenance 105,000
Operation (electricity) 50,000
Waste disposal 180,000
Waste disposal liability 100,000
TOTAL $ 660,000
469
5. Mathematical Modeling
5.1. Groundwater Capture and Transpiration
One must understand where the water is moving at a site in order to
estimate contaminant fate and transport. For applications involving groundwater
remediation, a simple capture-zone calculation [86] can be used to estimate
whether the phytoremediation "pump" can be effective at intercepting and
extracting the plume of contaminants. Trees can be grouped for consideration as
average withdrawal points. The goal of such a phytoremediation effort is to
create a water table depression where contaminants will flow to the vegetation
for uptake and treatment or volatilization. It is important to realize that organic
contaminants are not taken-up at the same concentrations that are present in the
soil or groundwater. Rather, there is a transpiration stream concentration factor
(a fractional efficiency of uptake) that accounts for the partial uptake of
contaminant (due to membrane barriers at the root surface).
where:
U = uptake rate of contaminant, mg/day
TSCF = transpiration stream concentration factor, dimensionless
T = transpiration rate of vegetation, L/day
C = aqueous phase concentration in soil- or ground-water, mg/L
k = U/Mo (6)
where:
k = first order rate constant for uptake, yr ~
U = contaminant uptake rate, kg/yr
Mo = mass of contaminant initially, kg
Then, an estimate for mass remaining at any time is expressed by equation (7)
below.
where:
M = mass remaining, kg
t = time, yr
Solving for the time required to achieve clean up of a known action level:
where:
t = time required for clean-up to action level, yr
M = mass allowed at action level, kg
Mo = initial mass of contaminant, kg
471
degradation rates. Also, it cannot simulate growth of multiple plant species that
might be used in field-scale applications.
6. REGULATORY ISSUES
Under Superfund laws, EPA (1998) [88] lists nine criteria for
consideration:
1. Overall protection of human health and the environment
2. Compliance with Applicable and Relevant and Appropriate Requirements
3. Long-term effectiveness and permanence
4. Reduction of contaminant toxicity, mobility, or volume
5. Short-term effectiveness (including the length of time needed to
implement the technology and associated risks to workers, residents, and the
environment during that time)
6. Implementability (including availability of goods and services)
7. Cost including capital, operation and maintenance, and monitoring
8. State (and federal) acceptance of the technology and its evaluation of its
performance
473
One emerging issue requiring consideration is the use of plants that could be
genetically modified to exhibit beneficial traits for phytoremediation, such as
increased water uptake for hydraulic control, drought and pest tolerance, and
increased enzyme activity for faster and more complete phytotransformation of
organic contaminants. A similar potential innovation is the inoculation of the
rhizosphere with genetically modified organisms (GMOs) that overexpress
catabolic enzymes for enhanced rhizoremediation.
The use of (microbial and/or plant) GMOs represents a research frontier
with broad implications. The potential benefits of using GMOs are significant,
and extend beyond improved contaminant removal efficiency and lower O&M
costs. For example, GMO's might facilitate coupling phytoremediation with the
production of marketable non-food (cash) crops that could be used for energy
production (e.g., biomass production for fuel wood, biodiesel, or fuel ethanol) or
raw materials for commercial products (e.g., pulp for paper or feedstock for
cosmetic or pharmaceutical industries). Nevertheless, although GMOs have been
extensively used in agriculture, little research has been conducted to assess their
long-term life cycle impacts, including the consequences of increased genetic
drift across species on biodiversity and biological community structure. This
gives rise to much speculation and polarization regarding the consequences of in
vitro genetic manipulation, which represents a significant political barrier to the
use of GMOs in phytoremediation. Furthermore, the need for GMOs may be
questionable for many projects, considering that indigenous species often
perform adequately and that we have not tapped the full potential of wild species
due to our limited understanding of various phytoremediation mechanisms,
including the regulation of enzyme systems that degrade pollutants.
In summary, the potential benefits and risks associated with the use of
genetic manipulation suggest that we need to be very cautious of GMOs, but not
475
8. CONCLUSIONS
Over the past 15 years, phytoremediation has developed into a more acceptable
technology for the remediation of soils and groundwater polluted with residual
concentrations of petroleum hydrocarbons. However, regulators as well as
consumers are still wary about the efficiency, predictability and applications of
the technique. The ITRC guidelines and decision tree has supported the use of
phytoremediation for most field-scale applications. Yet, at this point there is an
urgent need for strong evidence supporting the potential of phytoremediation in
protecting human as well as ecological receptors from exposure to contaminants,
using rigorous methods of risk analysis. For direct application to field projects, it
would be desirable if more protocols for designing preliminary greenhouse
experiments reflecting field-environments and cheap innovative methods of
encouraging growth of healthy plants were published. Research examining the
long-term fate of contaminants in the environment would be particularly
relevant. Also important is the difficult task of evaluating acceptable endpoints
(e.g., humification) using standard ecological toxicity or bioavailability assays
that might support phytoremediation.
Albeit, phytoremediation is an emerging technology that is based on
sound ecological engineering principles. Phytoremediation is a practical and
cost-effective approach with aesthetical and atmospheric-carbon-sequestration
ancillary benefits, and is particularly attractive for rural areas with residual and
shallow contamination. Phytoremediation also holds great potential to manage a
wide variety of environmental pollution problems, including the cleanup of soils
and groundwater contaminated with hydrocarbons and other hazardous
substances, the attenuation of pollutants dispersing through the environment in
agricultural drainage, landfill leachates, and other forms of surface runoff or
sub-surface migration, and the assimilation of industrial wastewater effluents to
support efforts to move towards a zero-discharge policy from industrial facilities
(e.g., refineries). Although phytoremediation is not a panacea that would be
universally applicable, it is rapidly achieving pedagogical maturity and it has
already earned an important place in the menu of alternatives from where we
select solutions for our environmental pollution problems.
476
REFERENCES
[61 ] C.C. Wiltse, W. L. Rooney, Z. Chen, A. P. Schwab, and M. K. Banks, J. Environ. Qual.,
27 (1998) 169.
[62] Yateem, A., A.S. E1-Nawawy, and N. A1-Awadhi,. Soil and Groundwater Cleanup,
1999, pp. 31-33.
[63] C.H. Chaineau, J. L. Morel, and J. Oudot, J. Environ. Qual., 26 (1997) 1478.
[64] Baker, J.M. 1970. Environ. Pollut., 1 (1970) 27.
[65] Ferro, J. Kennedy, R. Kjelgren, J. Rieder, and S. Perrin, Int. J. Phytoremediation, 1
(1999) 9.
[66] J. Giddens, J. Environ. Qual., 5 (1970) 179.
[67] Amadi, A. A. Dickson, and G.O. Maate, Wat. Air Soil Pollut., 66 (1993) 59.
[68] S.L. Hutchinson, N. K. Banks, and A. P. Schwab, J. Environ. Qual., 30 (2001) 395.
[69] E.J. Joner, S. C. Corgie, N. Amellal, and C. Leyval, Soil Biol. Biochem., 34 (2002)
859.
[70] M.R.T. Palmroth, J. Pichtel, and J. A. Puhakka, Bioresource Technol., 84 (2002) 221.
[71] J. L. Walworth, C. R. Woolard, and K. C. Harris, Cold Regions Sci. Technol., 37 (2003)
81.
[72] T.M. Phillips, A. G. Seech, D. Liu, H. Lee, and J. T. Trevors, Environ. Toxicology, 15
(2000) 99.
[73] D. Breeveld, and M. Sparrevik, Biodegradation, 11 (2000) 391.
[74] D. W. Graham, V. H. Smith, D. L. Cleland, and K. P. Law, Wat., Air, and Soil Poll.,
111 (1999) 1.
[75] L.M. Carmichael, and F. K. Pfaender, Biodegradation, 8 (1997) 1.
[76] C.R. Johnson and K.M. Scow, Biodegradation, 10 (1999) 43.
[77] R.W. Lee, S.A. Jones, E.L. Kuniansky, G. Harvey, B.S. Lollar, and G.F. Slater, Int. J.
Phytoremed., No. 2 (2000) 193.
[78] L. E. Erickson, M. K. Banks, L. C. Davis, A. P. Schwab, N. Muralidharan, K. Reilley,
and J.C. Tracy, Environ. Progress, No. 13 (1993) 226.
[79] J. A. Rentz, B. Chapman, P. J. J. Alvarez, and J. L. Schnoor, Int. J. Phytoremed., No. 5
(2003) 57.
[80] J.M. Lynch, The Rhizosphere, New York, Wiley, 1990.
[81 ] D. S. Neuman, M. Wagner, J. H. Braatne, and J. Howe, Stress Physiology- abiotic, In:
Biology of Populus and its implications for management and conservation, (eds. R. F.
Stettler, H. D. Bradshaw, Jr., P. E. Heilman, and T. M. Hinckley), NRC Research Press,
National Research Council of Canada, Ottawa, ON, 1996, pp. 423-458.
[82] Ferro, J. Chard, R. Kjelgren, B. Chard, D. Turner, and T. Montague, Int. J. Phytoremed.,
No. 3 (2001) 105.
[83] S. S. Koenigsberg and R. D. Norris, Accelerated Bioremediation Using Slow Release
Compounds, Regenesis Bioremediation Products, San Clemente, CA, 1999.
[84] E.G. Gatliff, Phytoremediation. Ground Water Monitoring Review, Winter/1996.
[85] J. L. Jordahl, M. F. Madison, H. M. E. Smesrud, and M. Q. Motte, (Eds. S. C.
McCutcheon and J. L. Schnoor), In: Phytoremediation- Degradation and Control of
Contaminants, Wiley Interscience, New York, NY, 2002.
[86] P. A. Domenico and F. W. Schwartz, Physical and Chemical Hydrogeology, NY, John
Wiley & Sons, Inc., 1998.
[87] G.J. Thoma, T. B. Lam, and D. C. Wolf, Int. J. Phytoremed., 5 (2003) 47.
[88] Environmental Protection Agency (EPA), Phytoremediation Handbook for Site
Manager, 1998 Draft.
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Elsevier B.V. All rights reserved. 479
Chapter 17
1. M E T H O D S OF O D O R AND VOC C O N T R O L
1.2. Methods for VOC, VIC and odor control from stationary sources.
To select an appropriate control method it is essential to consider the
physical, thermodynamic and reaction properties of the pollutant. These
properties, the conditions of the stream and the extent of treatment required
480
2. B I O L O G I C A L METHODS
2.1. I n t r o d u c t i o n
The basis of biological air treatment systems (BATS) is the competence of
active microorganisms, including bacteria, yeast, and fungi, to transform certain
organic and inorganic pollutants into compounds with lower health and
environmental impact. These compounds result generally from oxidative
reactions and include carbon dioxide, water, nitrate, and sulfate. Since
microorganisms are unable to transform the pollutants directly in the gas phase,
the first step is the solubilization in the biologically active aqueous phase.
Microbes utilize these molecules as a source of nutrients and energy for growth,
producing more biomass, which is partly recycled. The performance of the
process is determined by the relative rates of the physical, chemical and
biological processes. Several books have been published that cover different
aspects of BATS [2, 3, 4].
I I
[ Che!ical [
I,,, ....... i I
,Condensation ,Combustion ,Biofilters
,Absorption ,Flares 9B~otrickling filters
-Adsorption -Thermal 9Rotating contactors
,Masking .Catalyhc ,Bioscrubbers
,Membrane 9Chemical precipitation 9Suspended cell reactors
,Oxidation ,Membrane
9Liquid phase
9Solid phase
9Advanced oxidation
9Plasma technology
Although the basic-transfer and reaction mechanisms are the same for all
the BATS, there are different equipment configurations. These can be grouped,
as shown in Table 1, depending on the state of biomass and liquid phase in the
reactor.
inexpensive and abundant, and have been used for many applications. They can
retain water and generally contain an initial microbial population with enough
mineral nutrients [6]. Suitable structural characteristics are obtained by mixing
with a coarser fraction, including plastics or ceramics, to prevent high pressure
drop and to limit bed compaction. The natural supports may degrade with time
and lose their structure and water-retaining capacity, inducing channeling and
performance loss [7]. In some cases, re-mixing the support with some fresh
material and nutrients allows to recover the activity [8], but eventually, it will
need to be replaced. With proper maintenance, the support can be used for
several years. As mentioned above, biofilters can use inert, natural or synthetic
supports such as activated carbon, ceramics, lava rock, polyurethane foam,
vermiculite and perlite. On one hand, these supports lack the nutrients required
to sustain the microbial activity, therefore it is necessary to intermittently add
them. On the other hand, they are not degraded and, in theory, could be
engineered to have optimal properties such as controlled head loss, porosity,
adsorptive capacity, etc. This remains an area of active research [2, 3, 4].
The high surface and low water content favor degradation of the less-
hydrophilic pollutants (Henry's constant, H >10). Empty bed retention time
(EBRT) is generally between 30 seconds and 2 minutes. Due to the type of
supports used, the height of the packed bed is generally about 0.8 to 1.2 m,
making thus necessary to have a large footprint, which may be a disadvantage
for situations where space is limited.
Table 1.
Classification of biological reactors
'V
Support
(~ Timer
Polluted air in
~ ~ Fan
Polluted air in
Recirculatic
Water,mediumfeed Clean
i Air
"1. .. !
Fig. 4. Schematic representation ofbiotrickling filter (BT)
484
~
Clean air ~ -~ I o o' o Exhaust
,~/JI~H .(~o_.~~, b ~(~.o~ air
'. ./!ltt~,:,'t c~'c~'o,~gc
Gas-liquid iii!ili
:::::',:::::::'iil
.:::: Bioreactor "~ob
"o -~t::-~--b
o
~ iiili! !!!iiiil
~,,,,,,,,~iI
: ',',::',',: : : -'~"oo O.:og
~c .'7J2 0 o
,,ll,ll,, 0
2.3. Mechanism
BATS involve complex physical, chemical and biological interactions, [2,
3,4] which will be shortly reviewed:
H = Cg/Ci (1)
Where
H: dimensionless Henry's constant
Cg" gas phase concentration (g L ~)
C~" liquid phase concentration (g L l)
H2S(g) ~ H2S(I)
HzS0) ~ HS- + H + Ka~-I X 10 "7 , pKa - 7.0
HS- ~ s-Z+ H + Ka2= 1.3 x 10-13 , pKa = 12.9
Table 2
Henry's coefficient for some common compounds at 25 o C
(adapted from Ref. 18).
where:
J" mass flux (g m -2 s-1)
D "diffusion coefficient (m 2 s -1)
Cl" liquid concentration (g m -3)
x: distance in the biolayer (m)
where:
g ' n e t cell growth (h -~)
X" biomass concentration (g~ L -~)
Yxs: biomass yield from the pollutant (gx g pollutant"l)
m: maintenance coefficient (g pollutant gx "1 hl)
488
Specific growth rate (it) depends on the concentration of the limiting substrate"
p = pmax C/ (4)
K, +Ct
where:
~max" maximum cell growth (h ~)
Ks" half saturation constant (g L -l)
In BATS, mixed populations are generally found and their behavior can
be described by a net growth rate as:
dX
dt = p X (5)
BATS are open biological systems as the air is never filtered. The large
variety of microorganisms (fungi, yeast, and bacteria) come from the initial
inoculum, from the biofilter packing material (compost, peat, etc..) and from the
incoming air [2, 3, 4, 12]. The microorganisms present in the biofilters are
similar to those found in the natural ecosystems or other biological processes
such as compost or water treatment plants. Although bacteria are dominant in
biofilters, fungi are frequently observed. Recent studies showed that some fungi
[20, 21, 22, 23] can degrade toluene and hexane vapors at higher rates than
bacteria.
For a successful biological air treatment, the pollutants have to be
biodegradable. In general, organic compounds with low molecular weight,
highly soluble in water and simple-bond structures are the best candidates.
Alcohols, aldehydes, ketones, and some simple aromatics have very good
biodegradability, while phenols, aliphatic and chlorinated hydrocarbons show
moderate to slow degradation (Table 4). Ethers, like diethyl and dimethyl ethers
are generally easily degraded while MTBE (Methyl tert butyl ether) is reported
to be very recalcitrant.
Table 4
Biodegradability of pollutants [Ref. 24].
EC=Q(Cgi,,-Cgou,) m-3 1
v [g h] (7)
Petroleum products such as gasoline, fuel oils, and diesel fuels are among the
most important water, soil and air pollutants. They are complex mixtures of
organic compounds containing a significant volatile fraction. Hydrocarbons are
composed of four main structural classes: 1) n-alkanes (linear saturated
hydrocarbons), 2) isoalkanes (branched saturated hydrocarbons), 3)
cycloalkanes (saturated cyclic alkanes) and 4) aromatics [25]. Moreover, in the
case of gasoline, other oxygenated additives such as the ethers MTBE, ethyl t-
butyl ether (ETDE) or t-amyl methyl ether (TAME) or alcohols such as ethanol,
can be added to improve combustion and consequently air quality.
Hydrocarbons may be released into the atmosphere by evaporation during
production, transport and storage.
Table 5 presents some examples of the degradation of volatile organic
compounds from gasoline by BATS. The removal efficiency of volatile
individual compound in the gasoline varies from 5 % to 99 %. Aromatics are
generally removed more efficiently than n-alkanes. Light aliphatic compounds
(<C5), which are poorly soluble and highly volatile, are generally not removed
by more than 50 %, even at a 6-rain residence time [26]. This preferential
removal is promoted by the relative high solubility of aromatics compared to n-
490
alkanes. Recent studies showed that biofilter performance was improved using
filamentous fungi [22]. An elimination capacity of toluene of 258 g m -3h -~ (RE -
98 %) was attained. This value was higher than those obtained for bacterial
biofilters [27-28]. It is hypothesized that the aerial fungal mycelia, which are in
direct contact with the gas, give a larger superficial area and allow a direct mass
transfer of the volatile compound. Poor degradation of hydrophobic n-alkanes in
biofilter could strongly be increased using filamentous fungi as shown in Ref.
[23].
Very few reports have been published addressing MTBE biofiltration.
Except for the results obtained by Fortin et al, 1999 [29], elimination capacities
of MTBE are generally lower than 10 g m 3 h 1. MTBE is a highly soluble
compound in water but the ether bond and the tert-butyl moiety have been
shown to limit MTBE biodegradability. Cometabolism has proved to be a good
way to increase biomass production and MTBE degradation. Microbial consortia
[30], can degrade MTBE by cometabolism with n-alkanes (hexane, pentane and
heptane) present in gasoline. Cometabolism with pentane using a single bacteria
(Pseudomonas aeruginosa) can be used to degrade MTBE in a biofilter packed
with vermiculite [31 ].
Biofilters used to treat gasoline from a soil vapor extraction operation
showed that higher molecular weight compounds were almost completely
removed while lower molecular weight were less degraded [32]. The
predominant compounds remaining in the outlet of the biofilter were tentatively
identified as methyl-substituted alkanes and cycloalkanes in the C6 to C9 range.
A pilot-scale biofilter system treating gasoline vapors presented total
hydrocarbon-elimination capacities of 16 g m -3 h -~ [33]. Linear alkanes and
aromatics were rapidly degraded, while branched alkanes had lower removal
efficiencies. Pilot-scale biofilter elimination capacities for hexane, isooctane and
toluene were 3.2 ghexane m-3 h'l 3 1 g~so-octanem-3 h-I and 1 5 gtoluene m-3 h -~
9 ~ 9
respectively. Removal efficiencies for toluene were the highest and the most
stable.
4. CONCLUSIONS
BATS are among the established technologies that can be applied to control
VOC and odor emissions. For their choice, the characteristics of the stream
(flow, temperature, presence of particles, humidity, etc.), the pollutant
(composition, concentration, reactivity, solubility and biodegradability) and the
required performance have to be considered. BATS are applicable for a wide
range of volatile pollutants found in the petroleum industry and their
applications are growing continually based on scientific and technological
developments.
491
Table 5
Examples of treatment of volatile petroleum hydrocarbons by BATS
REFERENCES
[1] H. Rafson (ed.), Odor and VOC Control Handbook. McGraw Hill Professional. USA
1998.
[2] J.S. Devinny, M. Deshusses and T. S. Webster, Biofiltration for air pollution control.
CRC Press, Boca Raton, F1. USA, 1999.
[3] C. Kennes and M. C. Veiga MC (eds.), Bioreactors for waste gas treatment. Kluwer
Academic Publishers, The Netherlands, 2001.
[4] Z. Shareefdeen and A. Singh (eds.) Biotechnology for Odour and Air Pollution,
Springer-Verlag, Germany (in press).
[5] M. Morales, S. Hemfindez, T. Comab6, S. Revah and R. Auria Environ. Sci. Technol.
37 (2003) 985.
[6] B. Cardenas-Gonzalez, S. Ergas, M. Switzenbaum and N. Phillibert, Environ. Progress
18 (1999) 205.
[7] J.M. Morgan-Sagastume, S. Ergas, S. Revah and A. Noyola, J. Air Waste Manage.
Assoc. 53 (2003) 1011.
[8] R. Auria, G. Frere, M. Morales, M. E. Acufia and S. Revah S, Biotechnol Bioeng 68
(2000) 448.
[9] D. Gabriel and M. Deshusses, PNAS 100 (2003) 6308.
[ 10] J.W. Van Groenestijn, In C. Kennes and M. C. Veiga MC (eds.), Bioreactors for waste
gas treatment. Kluwer Academic Publishers, The Netherlands, (2001) 133.
[ 11 ] S.P.P. Ottengraf In: Biotechnology 8, Rehm HJ and Reed G (eds), VCH
Verlagsgesellschaft Weinheim, Germany, (1986) 426.
[12] J.W. Van Groenestijn and P. G. Hesselink, Biodegradation 4 (1993) 283.
[ 13] S. Ergas, In C. Kennes and M. C. Veiga MC (eds.), Bioreactors for waste gas treatment.
Kluwer Academic Publishers, The Netherlands, (2001) 163.
[14] A. Bielefeldt, In C. Kennes and M. C. Veiga MC (eds.), Bioreactors for waste gas
treatment. Kluwer Academic Publishers, The Netherlands, (2001) 215.
[15] R.P. Bowker, In H. Rafson (ed.), Odor and VOC Control Handbook. McGraw Hill
Professional. USA (1998) 8.192.
[16] R. von Rohr and P. Ruediger In C. Kennes and M. C. Veiga MC (eds.), Bioreactors for
waste gas treatment. Kluwer Academic Publishers, The Netherlands, (2001) 201.
[17] B. Davison, J. Barton, T Klasson and, A. Francisco Biotechnol. Bioeng. 68, (2000) 279.
[18] T. Card, In H. Rafson (ed.), Odor and VOC Control Handbook. McGraw Hill
Professional. USA (1998) 2.1.
[19] A. Fischer, M. Muller and J. Klasmeier, Chemosphere 54 (2004) 689.
[20] H.H.J. Cox, R. E. Moerman, S. Vanbaalen, W. N. Vanheiningen, H. J. Doddema and
W. Harder, Biotechnol. Bioeng. 53 (1997) 259.
493
Chapter 18
1. I N T R O D U C T I O N
Crude oils are the liquid fossil residues of aquatic algae, sometimes with minor
contributions from terrestrial plants, that grew in the distant past. Then as now,
we can imagine that most of this material was biodegraded and recycled on an
essentially annual timescale, but a small fraction became buried and underwent
diagenesis and catagenesis to become oil [1]. This process usually took millions
of years, and was dependent on the depth of burial and the temperature. Some
oil dates from the Precambrian (>570 million years ago), but most is rather
younger; the average age of commercially important oil is about 100 million
years, with the majority being from the Jurassic and Cretaceous (180 to 85
million years ago) [2].
Commercially important oil has migrated from its source rock to a
reservoir, and it is not unusual for these reservoirs to leak. If the leak reaches the
surface, it is known as an oil seep. Humans have used material from such seeps
for thousands of years. Early uses include hafting stone axes to their handles, as
an embalming agent, and as a medical nostrum. Genesis (11,3) says that bitumen
was used as the mortar for the Tower of Babel, and Exodus (2,3) that Moses'
basket was made waterproof with a bitumen daub. It seems likely that several
religions started around natural gas seeps, either as eternal flames or as sources
of hallucinogenic vapors [3]. But these were only very minor uses, and it is only
in the last century and a half that oil has come to play a truly central role in
modem society [4]. Terrestrial seeps were the first locations to be drilled when
oil production began in earnest in the nineteenth century, such as the 1860 Drake
well in Pennsylvania, but marine seeps were drilled by the end of the century.
496
Oil fuels the modem world on an enormous scale; annual consumption is of the
order of 3.5 billion US gallons (1.2 x 10 ~~ liters) per day [8]. Much of this is
produced at sea; more than 25% of US production is from the Continental Shelf,
and 25% of Saudi Arabia's production, 80% of Nigeria's, and 100% of
Angola's, Australia's, Brazil's and Malaysia's production is offshore. This
production is associated with some oil and grease discharges into the marine
environment associated with the produced water; some 2,700 tonnes per year in
the US, and more than ten times this in the rest of the world [5]. This input is
dwarfed, however, by oil in municipal run-off from the land, and from the
standard operation of marine shipping (Figure 2). Catastrophic spills from
tankers and other ships are well known, but in fact their contribution to total oil
input into the oceans is relatively small, some 8% of the global input, 2% of
North American input. Nevertheless, since such spills are large on the local
scale, they often require environmentally appropriate and cost-effective
responses. Fortunately, despite the increasing volume of transported oil, the
amount spilled from catastrophic spills has been generally decreasing over the
last few decades [9]. The major exception to this decline was the appalling
environmental crime in the Arabian Gulf in 1991, where Iraqi forces deliberately
released more than a million tonnes (about 260 million gallons or a billion liters)
of oil into the sea near Kuwait [ 10]. An additional 350 million gallons (1.2 x l 09
1) were deposited in the Gulf as fallout from the smoke plumes of the > 700 oil
well fires in the Kuwait oil fields [ 11 ], making this by far the largest man-made
release of oil into the marine environment to date.
497
Fig. 1. Map of the major oil seeps into the World's oceans. Data taken from reference [5].
498
Natural Seeps
Extraction
!--I Transportation
Consumption
Fig. 2. Oil input into the World's oceans. Data taken from reference [5].
When oil gets into the oceans from a seep, urban runoff or a spill from a
production facility, pipeline or a tanker, it becomes subject to a group of
phenomena that are usually grouped under the term "weathering" [20]. Almost
all oils float, allowing the smallest molecules to evaporate [21, 22]. These
500
molecules are either degraded photochemically [23] or are washed from the
atmosphere in rain and then biodegraded [24], likely far from the spill site.
Under particularly aggressive aeration in water, such as in surf, evaporation may
extend to molecules with >30 carbon atoms [25], but evaporation is more
usually limited to molecules with less than about 15 carbon atoms [21]. Thus
evaporation is the likely fate of most of a gasoline spill, three-quarters or more
of a diesel spill, and perhaps 20-40% of a typical crude oil. Heavy fuels, such as
the Bunker fuels used in ships, and bitumen emulsions (Orimulsion| [26]) do
not contain a significant volatile fraction.
Two competing emulsification processes occur as water and oil mix;
water can become entrained in the oil to form an emulsion known as mousse
[27], or oil can disperse into the water column as a suspension of small droplets,
as happened during the 1993 Braer spill off the Shetland Islands [28]. Mousses
are remarkably persistent, and are thought to be the precursors of tarballs that
can last for decades [29]. As we shall discuss below, chemical dispersants that
break emulsions and stimulate the natural dispersion process are effective tools
in the oil spill response "toolkit".
Oil also interacts with small mineral particles in a process originally
termed "Clay-oil flocculation" [30], and now termed "Oil-Mineral Fines
Interactions" [31 ]. Like dispersion, this dramatically increases the surface area
of the oil.
Aliphatic hydrocarbons are remarkably insoluble, but small aromatics,
particularly the notorious BTEX (benzene, toluene, ethylbenzene and the
xylenes) and small polar molecules such as naphthenic acids dissolve from
floating slicks or dispersed oil, and even from oils immobilized on shoreline
sediments and particles [32]. Again, their eventual fate is biodegradation.
Aromatic hydrocarbons can be photochemically oxidized [33], converting
them to polar products that are probably polymerized species. The process is
most effective on the larger and more alkylated forms, and although such
hydrocarbons are only a minor component of crude oils [2], they have important
toxicological properties [34], and are on the USEPA list of priority pollutants
[35] and the EU list of priority substances in the field of water policy [36]. Since
light cannot penetrate very far into a dark oil slick, photooxidation has little
effect on the bulk properties of spilled oil. Nevertheless it may be important in
generating a polymerized "skin" that enhances the stability of tarballs and
"pavements" on beaches. Layers of immobile, hardened oil and sediment,
termed pavements, form when oil reaches a shoreline as a heavy, thick slick. Oil
becomes trapped in the sediment, and the oil and the sediment become saturated
with each other [37]. Oil incorporated into such pavements is effectively
preserved from weathering processes until this heavy, solidified material is
physically disrupted, so a major goal of spill clean-up operations is to prevent
the formation of pavements.
501
The weathering processes described above distribute and change the oil in
various ways, but they do not actually remove oil from the environment. Only
two processes, combustion and biodegradation, actually eliminate oil by
converting it to carbon dioxide and water. Some spills do spontaneously ignite,
as happened to the Haven spill in the Mediterranean [38], and deliberate ignition
is an accepted response option in some situations, such as that of the New
Carissa off the coast of Oregon [39]. Under optimal conditions burning may
consume >90% of a spill, but there is usually only a small window of
opportunity for success [40].
Far more generally, it is biodegradation that removes oil from the
environment. As mentioned above, a diverse group of microorganisms has
evolved to degrade hydrocarbons, many able to live with hydrocarbons as their
sole source of carbon. They are probably ubiquitous, having been found in
almost all natural environments where they have been searched for, and
obviously very effective, since they have been consuming the vast majority of
the oil entering the world's oceans from natural seeps for millions of years
(600,000 tonnes, >600 million liters, per year). What separates these organisms
from other heterotrophs is their ability to transform hydrocarbons into organic
alcohols and acids that enter cellular metabolism. Under aerobic conditions the
most common microbial activation of hydrocarbons involves the addition of one
or both atoms of molecular oxygen. Alternatively, the activation may involve
the addition of hydrogen peroxide. The activation of aromatic hydrocarbons is
discussed by Foght in chapter 5, and many pathways are available in the
University of Minnesota Biocatalysis/Biodegradation Database [41] and in a
recent encyclopedia article [42]. Here it suffices to say that the vast majority of
hydrocarbons are biodegradable under aerobic conditions. Thus refined
products, such as gasoline, diesels and jet fuels, that are almost entirely
hydrocarbons, are essentially completely biodegradable. McMillen et al. [43]
examined the short-term biodegradability of 17 crude oils in soil microcosms,
and found that the API gravity was the most useful predictor of biodegradability.
At 0.5 wt% oil in soil with appropriate nutrients, moisture and aeration, more
than 61% of the most degradable oil (API = 46 ) was lost in four weeks, while
only 10% of the least degradable oil (API - 15 ) was consumed under the same
conditions. Further degradation occurred on a longer timescale, and the literature
reports biodegradation potentials as high as 97% for particularly light oils [44].
An important distinction between hydrocarbon-degrading microorganisms
and animals and plants is that many microbes degrade polycyclic aromatic
hydrocarbons to carbon dioxide, water and biomass. Animals and plants can also
activate these molecules, but they do so with enzyme systems that form stable
502
6. SPILL R E S P O N S E
6.1. At sea:
When oil is spilled at sea, deployment of mechanical equipment designed
for containment and recovery is often a slow and inefficient, if not ineffective,
response. The rapid spreading of the oil, the slow rate at which mechanical
equipment (once deployed) can encounter spreading oil, and interference from
waves and currents often limits recovery effectiveness to less than 20% of the
oil spilled, significantly less under conditions of severe wind and weather [55,
56]. Unrecovered oil remains in the environment, and undergoes the weathering
processes described above, with the most severe environmental consequences
resulting when oil strands on shorelines [57, 55]. Beached oil increases the
likelihood of contamination for habitats and animals found in subtidal, intertidal
and supratidal areas, which include some of the most productive and diverse
portions of the marine environment.
Burning spilled oil in a contained and controlled manor, so as not to
jeopardize the bulk of remaining cargo or other response assets, can rapidly
remove bulk oil from the water surface. However, it is a logistical and
operational challenge to contain the oil, arrange and control its placement out of
the immediate area of spill response activity, and ensure sufficient oil thickness
to sustain an efficient burn [40]. Many of the logistical and physical constraints
working against efficient mechanical containment and recovery also confound
attempts to collect and burn oil on water. When the oil does burn, the unburned
residue is comprised mostly of the heavy, longer chain hydrocarbons, which are
relatively resistant to ready microbial degradation [58].
Dispersants are widely recognized by many regulatory agencies as an
effective at-sea response that provides a net environmental benefit when
compared to reliance on mechanical recovery alone (see chapter 9). Application
of chemical dispersants facilitates the breakup of the oil slick, moving oil from
the water surface into the water column as neutrally buoyant oil droplets ranging
from 1 to 100 micrometers in diameter, due to the mixing action of waves and
currents. Subsequently, this plume of oil droplets rapidly distributes throughout
the water column, mixing into lateral and deeper water masses and reducing oil
concentrations below levels of concern for marine life. The rate and
effectiveness of this process depends on the nature of the spilled oil (its API
gravity and viscosity, degree of weathering, extent of emulsification, and pour
point) and the ability of the dispersant formulation to mix with the oil.
Dispersants have been an effective aspect of oil spill response over the
past 30 years, with applications to major and smaller oil spill incidents in many
of the world's oceans (Fig. 3). From 1970 through 1998, dispersants have been
used on approximately 37% of oil spills covered in a worldwide database by the
Oil Spill Intelligence Reporter [59]. In addition to countless small-scale tests
504
that have been conducted in laboratories around the world, critical assessments
of dispersant performance have been organized by private and government
research organizations, often cooperatively, using controlled releases of large
volumes of oil and dispersant applications under real world conditions (Fig. 3).
These studies have led to modem dispersant formulations with improved
effectiveness and greater environmental safety. A range of dispersant products
are stockpiled around the world for spill response, and a few have been shown to
be effective over a broad range of oil types and environmental conditions [60].
An important environmental consideration associated with dispersant use
is assessing the environmental tradeoff between intentionally exposing water
column plants and animals to dispersed oil and the often significant effects of
unrecovered oil left to drift at sea to potentially strand on a shoreline. In most
cases, these considerations demonstrate a net environmental benefit to the use of
dispersants because the short-term, transient exposure of water column
communities has much less ecological effect than the prolonged, wide-spread
contamination of oil reaching shorelines [57, 55, 61 ].
The environmental risks of dispersed oil are further decreased by the
rapid degradation of the small, dispersed oil droplets moving through the water
column, compared to the persistence observed for bulk oil stranded on
shorelines and incorporated into sediments. The large surface to volume ratio
characteristic of micron-sized dispersed oil droplets provides a colonizing
substrate for oil degrading bacteria and a source of degradable hydrocarbon to
support their growth. And, because the small oil droplets are widely dispersed in
the water column, the supply of nitrogen and phosphorus nutrients needed to
support bacterial degradation of the diluted oil is sufficient to maintain a viable
degrader community in association with the oil droplet. Furthermore, laboratory
studies have shown that some dispersants can enhance the initial rate of oil
degradation due to the presence of constituents that serve as initial substrates for
nascent bacterial growth [62, 63].
Laboratory studies of the fate of dispersed oil droplets have characterized
the process by which it becomes a physical substrate for supporting a microbial
community as well as a chemical substrate to support their growth. Within 2 to
4 days, the dispersed oil droplet becomes colonized by oil degrading microbes
[63-65]. Subsequently, this can become a full floating heterotrophic community
consisting of oil, bacteria, protozoa and even nematodes. Macnaughton et al.
[65] reported that by day 16, the size of the clusters increased and sank in test
microcosms, most likely the result of reduced buoyancy due to oil
biodegradation and increased biomass associated with the droplets.
505
Fig. 3. Dispersant response to oil spills. Data taken from reference 59.
6.2. On shore:
If oil reaches shore then the first response is to collect it [66]. Oil typically
lands on only the upper portion of the intertidal zone, and on sandy beaches it
may be possible to collect the oiled sand with mechanical equipment. This was
done, for example, with the spill from the Sea Empress [67]. Particularly heavy
oils may be best picked up by hand, as in the case of the spill from the Prestige
[68]. On rocky beaches it may be possible to wash oil back into the sea where it
can be collected with skimmers, as was done following the spill from the Exxon
Valdez [69].
Once the bulk oil has been removed by physical techniques, residual oil is
eventually naturally biodegraded. Bioremediation aims to stimulate the rate of
natural biodegradation, without causing any additional adverse impact, by at
least partially alleviating whatever is limiting microbial growth. In most porous,
and therefore aerobic shorelines, the most likely limitation is biologically
available nitrogen and phosphorus, and effective bioremediation protocols have
applied various forms of fertilizers to deliver these nutrients.
Research on this topic has been going on for decades in many parts of the
world (Fig. 4; reviewed in 42, 44, 70-77). The simplest approach is to alleviate
the nutrient limitation of oil biodegradation by adding fertilizers. This was the
basis for the successful bioremediation of the spill from the Exxon Valdez [78-
506
80]. Two different fertilizers were used, an oleophilic fertilizer, Inipol EAP22|
designed to adhere to oil and deliver nutrients at the oil-water interface [81 ] and
a slow-release granular agricultural product (Customblen| that would release
nutrients over many weeks through the beach gravel. Inipol EAP22 is a
microemulsion with an external oil phase of oleic acid and trilaureth-4-
phosphate, containing an internal phase of urea in aqueous solution, co-
solubilized with butoxy-ethanol to adjust the viscosity. It contains 7.4% nitrogen
and 0.7% phosphorus by weight, and was applied with airless sprayers
transported on small shallow-draft catamarans. Customblen| is a high quality
agricultural fertilizer designed to release its nutrients over several weeks. It
consists primarily of ammonium nitrate, calcium phosphate and ammonium
phosphate, encapsulated in polymerized linseed oil. Customblen contains 28%
nitrogen and 3.5% phosphorus by weight, and was applied by workers walking
the beaches with broadcast spreaders. An extensive monitoring program
demonstrated that the fertilizer applications were successful at stimulating the
rate ofbiodegradation some two- to five-fold [78-80]
A quite similar approach was used on a limited scale following the spill
from the Sea Empress [82]. Much of this spill was treated with dispersants while
at sea, and most of the residue that landed on shore was collected by work
crews, but some oil landed on a relatively steep (gradient 10-12.5%) shingle and
pebble beach at Bulwell Bay. Because the beach was so steep, slow-release
fertilizer was placed in 1 m mesh bags, and secured to the beach with steel pegs.
Again, the rate of biodegradation was stimulated more than two-fold on the
fertilized part of the beach.
To our knowledge, these are the only two occasions when bioremediation
by the addition of relatively simple fertilizers was used following a spill, but
there have been field and laboratory tests all over the world that have found
similar results (see Figure 4). All sorts of fertilizers have been used, usually with
success, including soluble and slow release forms of inorganic and organic
nitrogen. Our most recent experiments were on Spitsbergen, the largest island of
Svalbard, Norway, (approximately 78 ~ N, 17' E.) [83, 84]. Slow release and
soluble fertilizers were applied in much the same way they were in Alaska, and
they led to an approximate doubling of the rate of biodegradation, even in this
cold, Arctic environment.
A slightly more complex approach has been championed by Rosenberg
and colleagues [71, 85, 86]. In this case the fertilizer is an insoluble polymer of
urea and formaldehyde, and it is applied together with an oil-degrading bacterial
inoculum that can use this nitrogen source. The approach was apparently able to
stimulate the biodegradation of a small spill (100 tons) of a heavy crude oil on a
sandy beach between Haifa and Acre in Israel in the early 1990's [71, 86].
507
Fig. 4. Bioremediation response to oil spills. Data taken from references 7 0 - 80.
Others have suggested that what really limits oil biodegradation in the
environment is the absence of effective oil degrading microorganisms, and they
therefore seek to add such organisms. Most recently this has been attempted on
heavy oil spilled by the Nakhodka in the Sea of Japan [87, 88]. Assessing this
work is problematic. The published analyses of the field work rely on digital
photography of representative oiled rocks, and no detailed chemical analyses
have been presented that can be compared with what has been found in other
spills. Earlier microbial inocula did not perform well in standardized tests [89].
An important corollary to any oil spill remediation is that it should have a
net environmental benefit [90]. By aiming to stimulate natural processes,
bioremediation is likely to have minimal adverse effects if carried out carefully
and conscientiously, but there are obvious potential risks that must be evaluated.
Potential adverse impacts include the possibility that the fertilizer applications
might be acutely toxic to marine biota, might stimulate nearshore algal blooms,
might cause the production of biosurfactants that could result in increased
removal of oil from the shorelines by tidal flushing and lead to broader shoreline
impacts, or might generate toxic by-products. Careful monitoring following the
spill from the Exxon Valdez [91] and a field trial in the Arctic [92] failed to
detect any adverse environmental impact from the careful application of
fertilizers, while the rate of hydrocarbon biodegradation was stimulated two- to
five-fold.
508
7. CONCLUSIONS
REFERENCES
[1] J.M. Hunt, Petroleum Geochemistry and Geology, 2nd edition. W.H. Freeman, New
York. 1996.
[2] B.P Tissot and D.H. Welte, Petroleum Formation and Occurrence. Springer-Verlag,
Berlin. 1984.
[3] J.Z. De Boer, J.R. Hale, and J. Chanton, New evidence of the geological origins of the
ancient Delphic oracle (Greece). Geology, 29 (2001) 707.
[4] D. Yergin, The Prize, the epic quest for oil, money and power. Simon and Schuster,
New York. 1992.
[5] National Research Council, Oil in the Sea III: Inputs, Fates and Effects, National
Academy Press, Washington DC, 2002.
[6] E.M Levy and K. Lee, Can. J. Fish. Aquat. Sci. 45 (1988) 349.
[7] R.C. Prince, Petroleum and other hydrocarbons, biodegradation of. In Encyclopedia of
Environmental Microbiology (G. Bitton, ed.) John Wiley, New York, 2002 pp. 2402-
2416.
[8] Anonymous. Industry at a glance. World Oil 224 (2003) 75.
[9] D.S. Etkin, Historical overview of oil spills from all sources. In: Proceedings of the
1999 International Oil Spill Conference. American Petroleum Institute, Washington
DC. 1999 pp. 1097-1102.
[ 10] H.J. Barth, Mar. Poll. Bull. 46 (2003) 1245.
[11] A.N. A1Ghadban, F. Abdali, and M.S. Massoud, Environ. International 24 (1998) 23.
[12] K. Peters and J.M. Moldowan, The Biomarker Guide; Interpreting molecular fossils in
petroleum and ancient sediments. Prentice-Hall, Englewood Cliffs, NJ. 1993.
[13] R.C. Prince, D.L. Elmendorf, J.R. Lute, C.S. Hsu, C.E. Haith, J.D. Senius, G.J. Dechert,
G.S. Douglas, and E.L. Butler, Environ. Sci. Technol. 28 (1994) 142.
[ 14] W.K. Robbins and C.S. Hsu, Petroleum Composition. In: Kirk-Othmer Encyclopedia of
Chemical Technology, Fourth Edition. John Wiley & Sons, New York. 1996 pp. 352-
370.
[15] Y.A. Ibrahim, M.A. Abdelhameed, T.A. A1-Sahhaf, and M.A. Fahim, Petrol. Sci.
Technol. 21 (2003) 825.
[16] J Burdon, Soil Science, 166 (2001) 752.
509
[17] K. Qian, R.P. Rodgers, C.L. Hendrickson, M.R. Emmett and A.G. Marshall, Energy &
Fuels, 15 (2001) 492.
[18] K. Qian, W.K. Robbins, C.A. Hughey, H.J. Cooper, R.P. Rodgers and A.G. Marshall,
Energy & Fuels, 15 (2001) 1505.
[19] A.D. Uhler, S.A. Stout, K.J. McCarthy, S. Emsbo-Mattingly, G.S. Douglas and P.W.
Beall, Contaminated Soil Sediment and Water, April/May (2002) 20.
[20] R.C. Prince, R.M. Garrett, R.E. Bare, M.J. Grossman, T. Townsend, J.M. Suflita, K.
Lee, E.H. Owens, G.A. Sergy, J.F. Braddock, J. E Lindstrom. and R.R. Lessard, Spill
Sci. Technol. Bull, 8 (2003) 145.
[21] M.F. Fingas, The evaporation of oil spills: development and implementation of new
prediction methodology. In Proceedings of the 1999 International Oil Spill Conference,
American Petroleum Institute, Washington DC, 1999 pp. 185-194.
[22] Y. Wang and Y. Huang, Appl. Geochem. 18 (2003) 1641.
[23] M.D. Hurley, O. Sokolov, T.J. Wallington, H. Takekawa, M. Karasawa, B. Klotz, I.
Barnes, and K.H. Becker, Environ. Sci. Technol. 35 (2001) 1358.
[24] K.M. Arzayus, R.M. Dickhut, and E.A. Canuel, Environ. Sci. Technol. 35 (2001) 2178.
[25] R.C. Prince, R.T. Stibrany, J. Hardenstine, G.S. Douglas and E.H. Owens, Environ. Sci.
Technol. 36 (2002) 2822.
[26] Bitor Corporation (2004) www.orimulsionfilel.com/
[27] M.F. Fingas, B. Fieldhouse, J. Lane and J.V. Mullin, What causes the formation of
water-in-oil emulsions? In Proceedings of the 2001 International Oil Spill Conference,
American Petroleum Institute, Washington DC, 2001 pp. 109-114.
[28] R. Thomas and T. Lunel, The Braer Incident; dispersion in action. In Proceedings of the
Sixteenth Arctic Marine Oilspill Program Technical Seminar, Edmonton, Alberta, 1993
pp. 843-859.
[29] R. Goodman, Spill Sci. Technol. Bull. 8 (2003) 117.
[30] J.R. Bragg and E.H. Owens. Clay-oil flocculation as a natural cleansing process
following oil spills: Part l-studies of shoreline sediments and residues from past spills.
In: Proceedings of the Seventeenth Arctic and Marine Oilspill Program (AMOP)
Technical Seminar. Ottawa, Canada. 1994 pp. 1-24.
[31 ] E.H. Owens and K. Lee, Mar. Poll. Bull. 47 (2003) 397.
[32] E. Lafargue and P. Le Thiez, Org. Geochem. 24 (1996) 1141.
[33] R.M. Garrett, I.J. Picketing, C.E. Haith, and R.C. Prince, Environ. Sci. Technol. 32
(1998) 3719.
[34] International Agency for Research on Cancer. IARC Monograph on the evaluation of
the carcinogenic risk of chemicals to humans. Polynuclear aromatic hydrocarbons, Part
1, Chemical, environmental and experimental data, Vol. 32. World Health Organization,
Geneva. 1983
[35] L.H. Keith and W.A. Telliard, Environ. Sci. Technol. 13 (1979) 416.
[36] European Commission, DECISION No 2455/2001/EC OF THE EUROPEAN
PARLIAMENT AND OF THE COUNCIL of 20 November 2001 establishing the list of
priority substances in the field of water policy and amending Directive 2000/60/EC,
Official Journal of the European Union L331, 1-5, 15 December 2001.
[37] E.H. Owens, J.R. Harper, W. Robson and P.D. Boehm, Arctic 40 (1987) 109.
[38] M. Martinelli, A. Luise, E. Tromellini, T.C. Sauer, J.M. Neff and G.S. Douglas, The
M/C Haven oil spill: Environmental assessment of exposure pathways and resource
injury. Proceedings of the 1995 Oil Spill Conference, American Petroleum Institute,
Washington, D.C. 1995 pp. 679-685.
510
[39] J.J. Gallagher, H.B. Hile and J.A. Miller, The old New Carissa; a study in patience.
Proceedings of the 2001 Oil Spill Conference, American Petroleum Institute,
Washington, D.C. 2001 pp. 85-90.
[40] I. Buist, Spill Sci. Technol. Bull. 8 (1993) 341.
[41 ] The University of Minnesota Biocatalysis/Biodegradation Database (2004)
htlp://umbbd.ahc.unm.edu/
[42] R.C. Prince, Crude oil biodegradation In The Encyclopedia of Environmental Analysis
and Remediation, Volume 2, 1327-1342. John Wiley, New York. 1998.
[43] S.J. McMillen, A.G. Requejo, G.N. Young, P.S. Davis, P.D. Cook, J.M. Kerr, and N.R.
Gray, Bioremediation potential of crude oil spilled on soil. In: Microbial Processes for
Bioremediation (R.E. Hinchee, C.M. Vogel, and F.J. Brockman, eds.). Battelle Press,
OH. 1995 pp, 91-99.
[44] R.C. Prince, Crit. Rev. MicrobioI. 19 (1993) 217.
[45] C.J. Omiecinski, R.P. Remmel and V.P.. Hosagrahara, Toxicol. Sci. 48 (1999) 151.
[46] V.J. Melendez-Colon, A. Luch, A. Seidel, and W.M. Baird, Cancer Res. 59 (1999)1412.
[47] R. Margesin and F. Schinner, Appl. Microbiol. Biotechnol. 56 (2001) 650.
[48] H. Feitkenhauer, R. Muller and H. M~irkl, Biodegradation 14 (2003) 367.
[49] A.G. Rike, K.B. Haugen, M. Borresen, B. Engene. and P. Kolstad, Cold Regions Sci.
Technol. 37 (2003) 97.
[50] M.J. Gauthier, B. Lafay, R. Christen, L. Fernandez, M. Acquaviva, P., Bonin and J.C.
Bertrand, Int. J. System. Bacteriol. 42 (1992) 568.
[51 ] A.M. Spormann and F. Widdel, Biodegradation 11 (2000) 85.
[52] J.A. Cunningham, H. Rahme, G.D. Hopkins, C. Lebron, and M. Reinhard, Environ. Sci.
Technol. 35 (2000) 1663.
[53] M.E. Caldwell, R.M. Garrett, R.C. Prince and J.M. Suflita, Environ. Sci. Technol. 32
(1998)2191.
[54] J.D. Coates, J. Woodward, J. Allen, P. Philp and D.R. Lovley, Appl. Environ.
Microbiol. 63 (1997) 3589.
[55] A. Lewis and D. Aurand, Putting Dispersants to Work: Overcoming Obstacles. API
Technical Report IOSC-004. 1997 International Oil Spill Conference Issue Paper. API.
Washington, DC. 1997.
[56] D.S. Etkin and P. Tebeau, Assessing progress and benefits of oil spill response
technology development since Exxon Valdez. Proceedings of the 2003 International Oil
Spill Conference, American Petroleum Institute, Washington, DC, 2003 pp. 843-850.
[57] National Research Council, Using Oil Dispersants on the Sea. National Academy
Press. Washington, DC. 1989.
[58] R.M. Garrett, C.C. Guanette, C.E. Haith and R.C. Prince, Environ. Sci. Technol. 34
(2000) 1934.
[59] D.S. Etkin, Factors in the Dispersant use decision-making process" historical overview
and look to the future, Proceedings of the twenty-first Arctic and Marine Oil Spill
Program (AMOP) Technical Seminar. Environment Canada. Ottawa. 1998 pp. 281-304
[60] R.R. Lessard and G. DeMarco. Spill Sci. Technol. Bull. 6 (2000) 59.
[61 ] International Petroleum Industry Environmental Conservation Association (IPIECA),
Oil Spill Preparedness and Response. Volume 5" Dispersants and their Role in Oil Spill
Response. London. 2000.
[62] R. Varadaraj, M.L. Robbins, J. Bock, S. Pace and D. MacDonald, Dispersion and
biodegradation of oil spills on Water. In: Proceedings of the 1995 International Oil
Spill Conference, American Petroleum Institute, Washington, DC. 1995 pp. 101-106.
511
[63] R. Swannell and F. Daniel, Effect of dispersants on oil biodegradation under simulated
marine conditions. Proceedings of the 1999 International Oil Spill Conference,
American Petroleum Institute, Washington, DC, 1999, pp. 169-176.
[64] J.E. Lindstrom and J.F. Braddock, Mar. Poll. Bull. 44 (2002) 739.
[65] S.J. Macnaughton, R. Swannell, F. Daniel and L. Bristow, Spill Sci. Technol. Bull. 8
(2003) 179.
[66] B.E. Ornitz and M.A. Champ, Oil Spills First Principles. Elsevier, New York. 2002.
[67] T. Lunel, K. Lee, R. Swannell, P. Wood, J. Rusin, N. Bailey, C. Halliwell, L. Davies,
M. Sommerville, A. Dobie, D. Mitchell and M. McDonagh, Shoreline clean up during
the Sea Empress incident: the role of surf washing (clay oil flocculation), dispersants
and bioremediation. In Proceedings of the Nineteenth Arctic and Marine Oil Spill
Program Seminar. Environment Canada, 1996 pp. 1521-1540.
[68] J. Bohannon, X. Bosch and J. Withgott, Science 298 (2002) 1695.
[69] S.A. Nauman, Shoreline clean-up: equipment and operations. In Proceedings of the
1991 International Oil Spill Conference, American Petroleum Institute, Washington
DC, 1991 pp. 141-148.
[70] R.M. Atlas, Crit. Rev. Microbiol. 5 (1977) 371.
[71 ] E. Rosenberg, R. Legman, A. Kushmaro, R. Taube, E. Adler and E.Z. Ron,
Biodegradation 3 (1992) 337.
[72] R.P.J. Swannell, K. Lee and M, McDonagh, Microbiol. Rev. 60 (1996) 342.
[73] Q. Lin, I.A. Mendelssohn, C.B. Henry, P.O. Roberts, M.M. Walsh, E.B. Overton and
R.J. Portier, Environ. Tech. 20 (1999) 825.
[74] M. Mathew, J.P. Obbard, Y.P. Ting, Y.H. Gin and H.M. Tan, Acta Biotechnol. 19
(1999) 225.
[75] K. Lee and S. deMora, Environ. Tech. 20 (1999) 783.
[76] I. Head and R.P.J. Swannell, Curr. Opin. Biotechnol. 10 (1999) 234.
[77] S. Harayama, H. Kishira, Y. Kasai and K. Shutsubo, J Mol Microbiol Biotechnol. 1
(1999) 63.
[78] J.R. Bragg, R.C. Prince, E.J. Harner, and R.M. Atlas, Nature 368 (1994) 413.
[79] R.C. Prince, J.R. Clark, J.E Lindstrom, E.L. Butler, E.J. Brown, G. Winter, M.J.
Grossman, R.R. Parrish, R.E. Bare, J.F. Braddock, W.G. Steinhauer, G.S. Douglas, J.M.
Kennedy, P.J. Barter, J.R. Bragg, E.J. Harner and R.M. Atlas, Bioremediation of the
Exxon Valdez oil spill: monitoring safety and efficacy. In Hydrocarbon Remediation(R.
E. Hinchee, B. C. Alleman, R. E. Hoeppel and R. N. Miller, eds.) Lewis Publishers,
Boca Raton, FL., 1994 pp. 107-124.
[80] R.C. Prince and J.R. Bragg, Bioremediation J. 1 (1997) 97.
[81] A. Ladousse and B. Tramier, Results of 12 years of research in spilled oil
bioremediation: Inipol EAP22. In: Proceedings of the 1991 International Oil Spill
Conference, American Petroleum Institute, Washington DC, 1991 pp. 577-582.
[82] R.P.J. Swannell, D. Mitchell, G. Lethbridge, D. Jones, D. Heath, M. Hagley, M. Jones,
S. Petch, R. Milne, R. Croxford and K. Lee, Environmental Technol. 20 (1999) 863.
[83] C.C. Gu6nette, G.A. Sergy, E.H. Owens, R.C. Prince and K. Lee, Spill Sci. Technol.
Bull. 8 (2003), 245.
[84] R.C. Prince, R.E. Bare, R.M. Garrett, M.J. Grossman, C.E. Haith, L.G. Keim, K Lee,
G.J. Holtom, P. Lambert, G.A. Sergy, E.H. Owens and C.C. Gu6nette, Spill Sci.
Technol. Bull. 8 (2003) 303.
[85] E. Rosenberg, R. Legman, A. Kushmaro, E. Adler, H. Abir and E.Z. Ron, J Biotechnol.
51 (1996) 273.
512
[86] E. Rosenberg and E.Z. Ron, Non-polluting compositions to degrade hydrocarbons and
microorganisms for use thereof. US Patent 5780290 1998
[87] T. Hozumi, H. Tsutsumi, and M. Kono, Mar. Poll. Bull. 40 (2000) 308.
[88] H. Tsutsumi, M. Kono, K. Takai, T. Manabe, M. Haraguchi, I. Yamamoto, and C.
Oppenheimer, Mar. Poll. Bull. 40 (2000) 320.
[89] A.D. Venosa, J.R. Haines and D.M. Allen, J. Ind. Microbiol. 10 (1992) 1.
[90] J.M. Baker, Net environmental Benefit Analysis for oil spill response. In Proceedings of
the 1995 International Oil Spill Conference, American Petroleum Institute, Washington
DC, 1995 pp. 611-614.
[91 ] R.C. Prince, J.R. Clark and K. Lee, Bioremediation effectiveness; removing
hydrocarbons while minimizing environmental impact. In Proceedings of the Ninth
International Petroleum Environmental Conference, Albuquerque, NM. 2002,available
at: http://ipec.utulsa.edu/lpec/Conf2002/prince clark l e e 109.pdf
[92] K. Lee, G. Wohlgeschaffen, G.H. Tremblay, B.T. Johnson, G.A. Sergy, R.C. Prince,
C.C. Gurnette and E.H. Owens, Spill Sci. Technol. Bull, 8 (2003) 273.
Studies in Surface Science and Catalysis 151
R. Vazquez-Duhalt and R. Quintero-Ramirez (Editors)
© 2004 Elsevier B.V. All rights reserved. 513
Chapter 19
1. INTRODUCTION
Table 1
Main water-soluble contaminants generated by the petroleum
industry.
m,
Family Compounds
Aromatic hydrocarbons Benzene
Toluene
Ethylbenzene
Xylene
Oxygenated compounds Phenols
Organic acids
Aldehydes
Metyl tert-butyl ether
Sulfur compounds Hydrogen sulfide
Mercaptans
Nitrogen compounds Ammonium
Amines
Urea
Table 2
Main transformations carried out during biological petroleum wastewater treatment.
The average phenol and alkyl phenols concentrations are 30.5 g 1-1 and 28.2 g 1-~,
respectively.
There are several reports about the toxic effect produced by phenolic
compounds on the acetoclastic methanogenic activity (AMA) of the granular
sludge. Table 3 shows the inhibitory concentrations that reduce in 50% (ICs0)
the AMA. In general, the susceptibility of a granular sludge to the inhibitory
effect of phenolic compounds is affected by the impact of its "acclimation
history". The phenol-degrading acid-forming bacteria are more susceptible to
phenol inhibition than the methanogens [5]. Most granules have a layered
structure that protects bacteria, particularly methanogens. In the case of a
phenol-acclimated granular sludge, it is possible that a phenol-degraders layer
develops in the external zone of the granules, preventing the inward diffusion of
the toxic compounds. This outer layer can prevent the methanogens deactivation
either by reducing the exposure level or by a partial or complete
biotransformation into nontoxic intermediates such as volatile fatty acids [5].
The selection and multiplication of an acetoclastic flora more resistant to those
toxic compounds might be another protection mechanism.
The inhibitory mechanism of the phenolic compounds is governed by their
hydrophobicity that increases the ability of these compounds to solubilize into
the lipid bacterial membranes, altering the membrane functions, such as ion
transports causing cellular lysis. High linear correlations of methanogenic
toxicity data to the logarithm of octanol-water partition coefficients of phenolic
compounds (log P) have been proposed as shown in Fig. 1. This simple model
adequately estimates the ICs0 values for anaerobic granular sludge in the
presence of phenolic compounds.
Table 3
Inhibitory concentrations that reduce in 50%
(ICs0) the acetoclastic methanogenic activity
of granular sludge (phenol-acclimated and
non-acclimated) in batch assays [6-8].
Compound IC50
(m~ 1-1)
Phenol 470- 7802
o-cresol 433 - 844
m-cresol 443 - 919
p-cresol 389 - 1525
3,4-dimethylphenol 329- 378
2-ethylphenol 195 - 207
4-methylphenol 657
4-ethylphenol 289
518
Log P
1.6 1.8 2 2.2 2.4 2.6 2.8
-0.2 ,,, I,, , I,., I,,, I,,. t, D, . t , . ,
-0.4 ( ~ (3)
8"
-0.6
8' -0.8
--I
(1) ~ ~ 9O (5)
6
~ 1 ~ ) (9")" - (6)
-1.2
Fig. 1. Relationship between IC50 of phenolic compounds and the octanol/water partition
coefficient (Log P). Synthetic "spent-caustic phenols mixture" (X), data from reference [6]
(o), data from reference [7] (7]) and data from reference [8]. (A). (1), phenol; (2), 4-methyl-
phenol; (3), 4-ethylphenol; (4), o-cresol; (5), m-cresol; (6), p-cresol; (7), 3,4-dimethylphenol;
(8), 2-ethylphenol; (9), "syntheticphenols mixture".
Log (1/1(;50)= 0.77 Log P - 2.28, r 2 = 0.90
Table 4.
Continuous anaerobic treatment results of mixtures of phenolic
compounds treated in upflow anaerobic sludge bed reactors.
OLR
Mixture (g COD 1-1d -1~
) COD removal (%) Reference
Phenol
7 94 [9]
p-Cresol
Phenol
2.95 81.8 [9]
p-Cresol
o-Cresol
Phenol
0.66 85 [13]
p-Cresol
o-Cresol
3. B I O T R A N S F O R M A T I O N OF S- AND N - B E A R I N G I N O R G A N I C
C O M P O U N D S FROM SOUR STREAMS
The microbial treatment of sour wastewater resulting from either oil production
or refining and other fossil fuels has been subject of intensive worldwide
studies. The term "sour" was originated to describe those wastes contaminated
with sulfide [23]. In refineries, sour wastewaters are generated from sour steam
condensates that have been in contact with petroleum products, specifically from
thermal or hydrogen cracking operations, where a carrier steam is used for
injection or aeration [24]. Common total sulfur contents in sour water are around
1194 mg 1-~. Because of the high sulfide, ammonium and phenols content, sour
wastewater must be treated before its release into the environment. Both, aerobic
and anaerobic processes have been reported to treat sour waste streams.
A B C D
a b c d e f g h x J k ] m
I I I I I I I I I i i I I
.
P
"7 a
o,1
4-
o
qioqP
o
2-
~" ~'~ ~ ~A, "
r "- .A ibm i l l 9 9 m Z ~ x A ~
0 9 I --11-
.........
n I I
_Ae
-- i I --~
V 1 "-r---
0 10 50 60 20 70 80 30 40
90 100 10
Days
Fig. 2. Performance of the recirculation reactor system under different culture conditions.
Capital letters corresponds to the following dilution rates (dl) 9 A, 0.5; B, 1; C, 2 and D, 3.
Subtitle letters show the Rmt evaluated: 2: b, c; 1.5: d; 1, e, k; 0.75: f, 1: m; 0.5: a, g; 0.35: h;
0.25: i; 0.15: j. Sulfide influent (m), sulfate (m), elemental sulfur (A), thiosulfate (o) and
sulfide effluent (A).
524
3.2. A n a e r o b i c processes
Thiobacillus denitrificans is a gram-negative, chemoautotroph and
facultative anaerobic bacteria, which oxidizes reduced sulfur compounds to
obtain its growth energy and it is able to use nitrate as electron acceptor.
According to Cadenhead and Sublette [31], this microorganism shows clear
advantages to oxidize sulfide over other Thiobacilli, such as Thiobacillus
thioparus, Thiobacillus versutus and Thiobacillus thiooxidans.
Sulfide is commonly oxidized to sulfate (Eq. 3) or elemental sulfur (Eq. 4)
under anoxic conditions, and where nitrate is used as a terminal electron
acceptor being reduced to elemental nitrogen.
Sour waste streams, including sour water, sour gases and refinery spent-
sulfidic caustics, have been successfully treated using Thiobacillus denitrificans.
For instance, the organic compounds such as benzene, toluene and phenol are
525
4. O X Y G E N A T E D FUEL ADDITIVES
OH3
I
H3C-C-OH
I
H2C~OH
2-methyl-2hydroxy-I propanoi
CH3
HC~
/ I I H3C--C-OH
I
CH2-C--O ~ H3C~C---O ~ H3C--CH-OH I
/C~o
hydroxy acetone acetone 2-propanol HO
2-hydroxy
isobutyric acid
CH3
O, I
~CH-C'-O
HO
pyruvic acid 2, 3 dihydroxy-2-methyl
1,3-dtcarboxyhc acid methacryhc actd
t~ ~ co~
C02
Fig. 3. Proposed metabolic pathway for aerobic MTBE biodegradation Adapted from Fayolle
et al. [49] and Steffan et al. [57].
529
similar to biofilters, but they have an aqueous phase trickling over the
packed bed. The liquid contains essential nutrients and it is usually
recycled. Biotrickling filters are more complex than biofilters but are
usually more effective, especially for the treatment of compounds that
generate acidic by-products (see chapter 17).
5. P E R S P E C T I V E S
~ ,.-.i
Products
Fig. 4. Schematic representation of the close water cycle in the petroleum industry.
534
REFERENCES
[ 1] M.R. Beychock, Aqueous Wastes from Petroleum and Petrochemical Plants, John
Wiley & Sons, London (1967).
[2] F. Bern6 and J. Cordonnier, Industrial Water Treatment: Refining, Petrochemicals
and Gas processing Techniques, Gulf Publishing, Houston (1995).
[3] H. Macarie, Water Sci. Yechnol., 42:5-6 (2000) 201.
[4] R.E. Speece, Anaerobic biotechnology for Industrial Wastewaters, Archaea Press,
Nashville (1996) 25-68.
[5] J.H Tay, Y.X He and Y.G Yan, Water Environ. Res. 72 (2000) 189.
[6] P. Olguin-Lora, L. Puig-Grajales and E. Razo-Flores, Environ. Technol., 24 (2003)
999.
[7] R. Sierra-Alvarez and G. Lettinga, Appl. Microbiol. Biotech., 34 (1991) 544.
[8] B. Donlon, E. Razo-Flores, J. Field and G, Appl. Environ. Microbiol., 61 (1995)
3889.
[9] E. Razo-Flores, M. Iniestra-Gonzfilez, J.A. Field, P. Olguin-Lora and L. Puig-
Grajales, J. Environ. Eng., 129 (2003) 999.
[10] H. Fang and G. Zhou, Water Sci. Technol., 42:5 (2000) 237.
[11] P. Hwang and S. Cheng, Water Sci. Technol., 24:5 (1991) 133.
[12] H. Fang, T. Chen, Y. Li and H. Chui, Water Res., 30 (1996) 1353.
[13] K. Tawfiki, K. L6pine, J. Bisaillon, R. Beaudet, J. Hawari and S. R Guiot,
Biotechnol. Bioeng., 67 (2000) 419.
[14] S.R. Guiot, K. Tawfiki-Hajji and F. Lepine, Water Sci. Technol., 42:5-6 (2000)
245.
[ 15] G. Zhou and H. Fang, Bioresource Technol., 61 (1997) 47.
[ 16] R. Kleerebezem, J. Mortier, L.W. Hulshoff-Pol and G. Lettinga, Water Sci.
Technol., 36:2-3 (1997) 237.
[ 17] R. Kleerebezem and G. Lettinga, Water Sci. Technol., 42:5-6 (2000) 259.
[ 18] H. Macarie, Ph. D. Thesis, Universit6 de Provence Marseille, France (in Frech)
1992.
[19] D.O. Mountfort, W.J. Krumholz and M.P. Bryant, Int. J. System. Bacteriol., 134
(1984) 216.
[20] S. Shelley, Chem. Eng., 98 (1991) 90.
[21 ] S.S. Cheng, C.Y. Ho and J.H. Wu. 8th Int. Conf. On Anaerobic Digestion. Sendai,
Japan (1997)
[22] R. Kleerebezem and H. Macarie, Chem. Eng., April, (2003) 56.
[23] K. Sublette, R.M. Kolhatkar and K. Raterman, Biodegradation, 9 (1998) 259.
[24] C. Buisman, R. Post, P. Ijspeert, G. Geraats and G. Lettinga, Acta Biotechnol., 9
(1989) 255.
[25] A. Janssen, R. Sleylter, C. van der Kaa, J. Jochemsen, J. Bontsema, S. Ma and G.
Lettinga, Biotechnol. Bioeng., 47 (1995) 327.
[26] J. Visser, L. Robertson, H. Verseveld and J. Kuenen, Appl. Environ. Microbiol., 63
(1997) 2300.
[27] A. Janssen, S. Ma, P. Lens and G. Lettinga, Biotechnol. Bioeng., 53 (1997) 32.
[28] S. Alcfintara, A. Velasco, A. Mufioz, J. Cid, S. Revah and E. Razo-Flores, Environ.
Sci. Technol., 38 (2004) 918.
[29] S. Alcfintara, I. Estrada, M. Vasquez and S. Revah, Biotechnol. Lett., 21 (1999) 81.
535
[30] B.J. Arena, H.N. Robson, A.L. de Vegt and C.J. Buisman, National Petroleum
Refiners Asociation, Annual Meeting (1988).
[31 ] P. Cadenhead and K. Sublette, Biotechnol. Bioeng., 35 (1990) 1150.
[32] B. Rajganesh, M. Selvaraj, K. Sublette and C. Camp, Appl. Biochem. Biotechnol.,
51/52 (1995) 735.
[33] K. Sublette and M. Woolsey, Biotechnol. Bioeng., 34 (1989) 565.
[34] E.W. Kim and J. H. Bae, Water Sci. Technol., 42:3-4 (2000) 233.
[35] B. Krishnakumar and V. B. Manilal, Biotechnol. Lett., 21 (1999) 437.
[36] J. Reyes-Avila, E. Razo-Flores and J. G6mez, Water Res., (2004) submitted.
[37] F. Fdez-Polanco, M. Fdez-Polanco, N. Fernandez, M. Umefia, P. Garcia and S.
Villaverde, Water Sci. Technol., 44' 4 (2001) 15.
[38] M.R. Betlach and J.M. Tiedje, Appl. Environ. Microbiol., 42 (1981) 1074.
[39] P.J. Gommers, W. Buleveld, F.J. Zuiderwijk and J.G. Kuenen, Water Res. 22
(1988) 1075.
[40] R. Johnson, J. Pankow, D. Bender D., C. Price and J. Zogorsky, Environ. Sci.
Technol., 32 (2000) 210.
[41] J. Brown, S. Bay, D. Greenstein and W. Ray, Report Southern California Coastal
Water Research Project. www.sccwrp.org/pubs/annrpt/99_00/abstl l_ar34.htm
[42] C.Achten, A. Kolb and W. Puttmann, Environ. Sci.Technol., 36 (2002) 3652.
[43] S. Fiorenza and H. Rifai, Bioremediation Journal, 7 (2003) 1.
[44] G. Reyna, E. Vega, E. Reyes, V. Mfigica, V. Chow, J. Watson and J. Arriaga. 94th
Annual Conference and Exhibition of the Air and Waste Management Association.
Orlando, FL (2001).
[45] L. Manzanares, L. Mufioz, C. Romero, V. Nevarez, E. Ramirez, M. Delgado and A.
Keer. 94th Annual Conference and Exhibition of the Air and Waste Management
Association. Orlando, FL (2001).
[46] R. Iturbe, R. Flores and L.Torres, Water Air Soil Poll., 14 (2003) 261.
[47] C. Buenrostro and A. Dovali. DGCH. (2001) Study for determining and evaluating
methyl tert-butyl ether (MTBE). Oficio GDF-SOS/01-523. In Spanish.
[48] USEPA 1997, EPA822-F-97-009, Office of Water, 34.
[49] F. Fayolle, J. Vandecasteele and F. Monot, Appl. Microbiol. Biotechnol., 56 (2001)
339.
[50] N. Fortin, M. Morales, Y. Nakagawa, D. Focht and M. Deshusses, Environ.
Microbiol., 3 (2001) 407.
[51] J. Salanitro, Curr. Op. Biotechnol., 6 (1995) 337.
[52] J. Wilson, J. Cho, B. Wilson and J. Vardy. U.S. Environmental Protection Agency.
2000. Natural attenuation of MTBE in the subsurface under methanogenic
conditions. EPA/600/R-00/006. U.S. EPA Office of Research and Development:
Washington, D.C.
[53] P. Bradley, F. Chapelle and J. Landmeyer, Appl. Environ. Microbiol., 67 (2001)
1975.
[54] K. Finneran and D. Lovley, Environ. Sci. Technol., 35 (2001) 1785.
[55] R. Steffan, S. Vainberg, C. Condee, K. McClay and P. Hatzinger. In G.
Wrickramayake, A. Gavaskar, B. Alleman, V. Magar (eds.) Bioremediation and
phytoremediation of chlorinated and recalcitrant compounds. Batelle, Columbus,
OH (2000) 165.
536
[56] M. Hyman and K. O'Reilly. In: Alleman B, Lesson A (eds.) In situ bioremediation
of petroleum hydrocarbon and other organic compounds. Battelle, Columbus, OH.
(1999) 7.
[57] R. Steffan, K. Mc Clay, S. Vainberg, C. Condee and D. Zhang, Appl. Environ.
Microbiol., 63 (1997) 4216.
[58] R. Deeb, K. Scow and L. Alvarez, Biodegradation, 11 (2000) 171.
[59] R. Prince, Crit. Rev. Microbiol., 26 (2002) 163.
[60] USEPA 2003. MTBE treatment case study website, http://clu-in.org/products/mtbe/
December 2003.
[61 ] B. Wilson and J. Wilson, Contaminated Soil Sediment and Water (2002) 47.
[62] J. Salanitro, P. Johnson, G. Spinnler, P. Maner, H. Wisniewski and C. Bruce,
Environ. Sci. Technol., 34 (2000) 4152.
[63] R. Wilson R., K. Scow and D. Mackay, Environ. Sci. Technol., 36 (2001) 190.
[64] K. Hrystova, B. Gebreyesus, D. Mackay and K. Scow, Appl.Environ. Microbiol.,
69 (2003) 2616.
[65] R. Steffan, P. Hatzinger, Y. Farhan and S. Drew. NGWA/API Conference on
Petroleum Hydrocarbons and Organic Chemicals in groundwater: Prevention,
detection and Remediation. Westville, OH (2001).
[66] J. Landmeyer, F. Chapelle, H. Herlong and P. Bradley, Environ. Sci. Technol., 35
(2001) 1118.
[67] R. Steffan, J. Johnson and S. Drew. In Sublette K (eds.) Proceedings of the 7th
International Petroleum Environmental Conference. IPEC, Albuquerque, NM
(2000) 1-12.
[68] J. Morrison, M. Suidan and A. Venosa, J. Environ. Eng., 128 (2002) 836.
[69] W. Stringfellow and K. Oh, J. Environ. Eng., 128 (2002) 852.
[70] S. Vainberg, A. Togna, P. Sutton and R. Steffan, J. Environ. Eng., 128 (2002) 852.
[71 ] J. O'Connell and S. Zigan. In, E. Moyer, P. Kostecki (eds.) MTBE remediation
Handbook. Amherst Scientific Publishers. Amherst Massachusets. (2003)
[72] N. Fortin and M. Deshusses, Environ. Sci. Technol., 33 (1999) 2980.
[73] J. Eweis, J. Scarano, B. Converse, D. Chang and E. Schroeder. Report American
Petroleum Institute Contract # 97000-2577(1999).
[74] D. Dupasquier, S. Revah and R. Auria, Environ.Sci.Technol., 36 (2002) 247.
[75] W.W. Eckenfelder Jr. and A.J. Englande Jr., Water Sci. Technol., 34:10 (1996) 1.
[76] R.F. Dunn and M.M. E1-Halwagi, J. Chem. Technol. Biotechnol., 78 (2003) 1011.
[77] J. Sipma, A.H. Janssen, L.W. HulshoffPol and G. Lettinga, Biotechnol. Bioeng.,
82 (2003) 1.