Epitope mapping of a cross-reactive monoclonal antibody against the

factor H-binding protein of Neisseria meningitidis

Annamaria Castello1, Isabella Costa1, Ida Pernice1, Roberta Galbo1, Orazio Romeo1, Dan Granoff2, Carla Lo Passo1
1Dipartimento Scienze della Vita “M. Malpighi”, Università di Messina, Messina
2Children’s Hospital Oakland Research Institute, Oakland, CA, USA

INTRODUCTION RESULTS
Neisseria meningitidis is an encapsulated gram-negative bacterium, major cause of Forty-five positive clones were identified by screening phage libraries with JAR36
(Figure 2 ).
bacterial meningitis and sepsi worldwide. Although polysaccharide-protein
conjugated vaccines are available for the prevention of diseases caused by strains PHAGELISA
Among these clones there were 15
independent sequences. From the
with group A, C, W-135 or Y capsules, no broadly protective vaccine is available
comparison of amino acid composition,
against group B strains. The factor H binding protein (fHbp), a 27-kDa membrane- obtained by characterization of the
anchored lipoprotein of N. meningitidis, is a promising vaccine candidate that elicits nucleotide sequence of the positive clones
insert, it was not possible to identify a
serum bactericidal antibodies in humans. The presence of factor H (fH) on the
common consensus sequence among the
bacterial surface is critical to circumvent host defense while, in the absence of peptides that reacted with JAR36 (Table
bound fH, the organism becomes susceptible to bacteriolysis. Based on sequence 2), suggesting that the epitope is
Figure 2. Binding of phage clones to JAR36
variability of the entire protein, fHbp has been divided into three variant groups or discontinuous. We hypothesized that the
most abundant amino acids in the bound
two sub-families. A panel of anti- fHbp mAbs has been produced from mice peptides might be important for the
Table 2.Aminoacid sequences of the phage-
immunized with the 3 variants of fHbp and their epitopes were previously mapped, displayed peptides mimicking the JAR 36 interaction between the immunogen and the
epitopea
except for the mAb designated JAR36, a murine IgG mAb isolated from a mouse mAb. Since JAR36 reacts with fHbps from
variant groups 2 and 3, and more
immunized with variant 3. In this study, we report epitope mapping of JAR36, this
specifically with those sequences
mAb cross-reacts with all fHbp sequences in V.2 and V.3 groups, binds to the containing a variable E (VE) segment from
bacterial surface and elicits complement-mediated bactericidal activity in lineage 2 [6;7], we focused our attention on
the amino acids more frequently occurring
combination with other anti-fHbp mAbs. We screened bacteriophage-displayed
in the peptide sequences, and located
random peptide libraries to identify amino acid residues contributing to the JAR36 between positions 186 and 255 in the
epitope. Mapping predictions were validated by constructing, through site-specific sequence of fHbp ID 28. (Figure 3 ).
mutagenesis, corresponding rfHbps single-point variants, and analyzing their Tryptophan does not occur in any known
fHbp sequence and glycine has only a
reactivity with the mAb. hydrogen as its side chain. Consequently,
we predicted a major contribution of the
MATERIALS AND METHODS
electrostatically charged residues
The epitope recognized by JAR36 is located in the variable E (VE) segment of aspartate and/or lysine to the JAR36
a positive phage clones ranked by their
modular groups II, III, V, VI, VII in the C-terminal region of a chimeric fHbp reactivity with JAR 36; epitope.
(Figure 1 ). A multiple sequence alignment of the VE segment, comprising residues b deduced amino acid sequences of the peptide
inserts displayed through pVIII fusion on the
186 to 255, from these fHbp variants [1; 2]. phage library clones positive for JAR 36;
c reactivity of phage clone with mAb JAR 36,
determined by ELISA;
Figure 1.Schematic representation of the modular architecture of fHbp. d SD value is the standard deviation of the mean
A, Seven different fHbp sequence variants, designated by ID (n = 2)
numbers, are shown along with their classifications into
modular groups and variant groups. fHbp is composed of five
variable segments, each from one of two genetic lineages
[Beernink, Granoff, 2009; Pajon et al., 2010]. fHbp ID 1 and ID
28 are designated as comprising variable segments from lineage Figure 3. Location of residues predicted to
1 (shaded) and 2 (white), respectively. Each distinctive VE affect binding of JAR36 mAb. A
segment is designated by two numbers, separated by a decimal homology model of fHbp ID 28 was
point with the first number, 1 or 2, referring to the genetic constructed using Swiss-Model based
lineage, and the second number referring to the ID number of on the atomic coordinates of the
the segment as annotated on the website crystal structure of fHbp ID 1 (PDB
http://pubmlst.org/neisseria/fHbp/. The variants that bind accession number 3KVD) [Cendron et
the mAb JAR 36 are designated with an asterisk. B, Amino acid al., 2011] The figure was generated by
sequences of the six distinct variable E (VE) segments shown in using PyMol (http://www.pymol.org).
panel A. The residues D and K, which were over-represented in
the phage sequences, are shown in bold in the sequence of
E.2.6, which is present in fHbp ID 28. Mapping validation through site-specific mutagenesis
We examined the positions of relevant aspartate and lysine residues in a homology
Peptides binding to JAR36 mAb were selected by panning five phage libraries
model of the fHbp ID 28 protein (Figure 3 ). We then substituted the residues
(pVIII-9aa, pVIII-9aa.cys, pVIII-12aa, pVIII-Cys.Cys, pVIII-15aa) constructed
K199, D201 and K203 with alanine and expressed and purified the fHbp mutants.
in the two-gene/phagemid vector pC89 [3].
Binding of JAR36 or human fH to site-specific mutants of fHbp ID 28 was
Phage display technology Affinity selection
measured by ELISA (Figure 4 ).

A B C

Figure 4. Binding of JAR36 or human fH to site-specific mutants of fHbp ID 28 by ELISA. A, Binding of mAb JAR36
to fHbp ID 28 wild-type, K199A, D201A and K203A mutants. B, Binding of control mAb JAR33. C, Binding of
human fH.

CONCLUSIONS
 Three single amino acids positions composing the JAR36 epitope were predicted
and the corresponding fHbp mutants were prepared.
 The K199A and K203A point mutants show decreased binding to human fH, but
not to JAR36.
Construction of site-specific mutants
 The amino acid residue substitution, D201A in fHbp affects the binding of
Table 1. Oligonucleotides used for site-specific mutagenesis
JAR36, but not that of human fH, thus Aspartate 201 is a necessary component
Mutants were constructed using MUTANT FORWARD PRIMER REVERSE PRIMER
of the JAR36 epitope.
the Phusion Site-Directed K199A GCAGCAGATGAAAAATCACACG GAGTTCGGCGGCGGCA REFERENCES
1. Beernink PT, Granoff DM.The modular architecture of meningococcal factor H-binding protein. Microbiology, 2009, 155:
Mutagenesis Kit (Finnzymes OY, D201A GCTGAAAAATCACACGCCG TGCTTTGAGTTCGGCGG
2873-2883.
Finland) (Table 1 ). K203A
K245A
GCATCACACGCCGTCAT
CAGTTCACGAAATCGGCATC
TTCATCTGCTTTGAGTTCGGC
CTTCCCCTATCTTCACGGTTGC
2. Pajon R, Beernink PT, Harrison LH, Granoff DM. Frequency of factor H-binding protein modular groups and susceptibility
to cross-reactive bactericidal activity in invasive meningococcal isolates. Vaccine, 2010, 28: 2122-2129.
3. Felici, F., Castagnoli, L., Musacchio, A., Jappelli, R., Cesareni, G. Selection of antibody ligands froma large library of
oligopeptides expressed on a multivalent exposition vector. J. Mol. Biol., 1991, 222: 301–310.
4. Masignani V, Comanducci M, Giuliani MM, Bambini S, Adu-Bobie J, Arico B, Brunelli B, Pieri A, Santini L, Savino S, Serruto
Expression and purification of recombinant fHbps D, Litt D, Kroll S, Welsch JA, Granoff DM, Rappuoli R, Pizza M. Vaccination against Neisseria meningitidis using three
variants of the lipoprotein GNA1870. J Exp Med., 2003, 197: 789-799.
Factor H binding protein was expressed from pET21b based plasmids in E.coli 5. Beernink PT, Granoff DM. Bactericidal antibody responses induced by meningococcal recombinant chimeric factor H-
as described previously [4; 5]. binding protein vaccines. Infect. Immun., 2008, 76: 2568–2575.
6. Schwede T, Kopp J, Guex N, Peitsch MC. SWISS-MODEL: An automated protein homology-modeling server. Nucleic Acids
Res., 2003, 31: 3381-3385.
7. Cendron L, Veggi D, Girardi E, Zanotti G. Structure of the uncomplexed Neisseria meningitidis factor H-binding protein
fHbp (rLP2086). Acta Crystallogr Sect F Struct Biol Cryst Commun, 2011, 67: 531-535.