See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/274783054

Occurrence of Grapevine Pinot gris virus in Friuli Venezia Giulia (Italy): field
monitoring and virus quantification by real-time RT-PCR

Article  in  Bulletin OEPP/EPPO Bulletin · April 2015

DOI: 10.1111/epp.12196

CITATIONS READS

23 1,232

10 authors, including:

Gian LUCA Bianchi Luca De Sabbata

Hospital Universitari i Politècnic la Fe ERSA FVG
13 PUBLICATIONS   137 CITATIONS    1 PUBLICATION   23 CITATIONS   

SEE PROFILE SEE PROFILE

Gianluca Governatori Maria Teresa Marrazzo

Regional Agency for Rural Development of Friuli Venezia Giulia E.R.S.A
10 PUBLICATIONS   70 CITATIONS    24 PUBLICATIONS   1,623 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Molecular and ultrastructural investigations of plant-virus interaction in Grapevine Pinot gris - disease (GPGV) View project

All content following this page was uploaded by Gian LUCA Bianchi on 09 February 2016.

The user has requested enhancement of the downloaded file.

Bulletin OEPP/EPPO Bulletin (2015) 45 (1), 22–32 ISSN 0250-8052. DOI: 10.1111/epp.12196

Occurrence of Grapevine Pinot gris virus in Friuli Venezia Giulia

(Italy): field monitoring and virus quantification by real-time RT-PCR
G. L. Bianchi, F. De Amicis, L. De Sabbata, N. Di Bernardo, G. Governatori, F. Nonino,
G. Prete, T. Marrazzo, S. Versolatto and C. Frausin
ERSA, Plant Protection Service, via Sabbatini 5, 33050, Pozzuolo del Friuli (UD), Italy; e-mail: gianluca.bianchi@ersa.fvg.it

Since 2003 the presence of a new syndrome characterized by symptoms of stunting, chlo-
rotic mottling, leaf deformation, reduced yields and quality has been reported in some white
berry varieties of Vitis vinifera in Trentino-Alto Adige and Friuli Venezia Giulia vineyards.
The identification of a new virus, provisionally called Grapevine Pinot gris virus (GPGV),
in a cv. Pinot gris vine suggested an association between this new syndrome and the virus
presence (Giampetruzzi et al., 2012), however the contemporary presence of GPGV in both
symptomatic and asymptomatic plants has still to be explained. In this work, a large-scale
monitoring over a 3-year period (2012–14) of Friuli Venezia Giulia vineyards and nurseries
has shown a widespread presence of GPGV in symptomatic plants and also in asymptomatic
vines, even if at a slightly lower percentage. Quantitative analyses of the virus titer revealed
a great variability in the viral content of both symptomatic and asymptomatic plants but the
mean GPGV quantity in symptomatic vines was significantly higher than in asymptomatic
plants.

Introduction
Since 2003 the presence of a new syndrome characterized
by symptoms of stunting, chlorotic mottling, mosaic and
deformation of leaves, reduced yields and low quality of
berries has been reported in some varieties of Vitis vinifera
in Trentino-Alto Adige and Friuli Venezia Giulia vineyards
(Northern Italy) (Fig. 1). Pinot gris, Traminer, Friulano
(Tocai) and Glera (Prosecco) are the most commonly
affected cultivars in the Friuli Venezia Giulia region.
Symptoms appear soon after sprouting and in most cases,
after a stage of poor vegetation, plants recover from symp-
toms and start to develop normally so that in late summer
it is difficult to find symptomatic leaves.
These symptoms were initially ascribed to different
causes, such as damage from thrips or mites, boron defi-
ciency, viruses, phytoplasmas and, because of the small
number of symptomatic plants, they were often underesti-
mated. It was only in a few vineyards, located in the Gori-
zia province (Friuli Venezia Giulia region, Italy), that the
syndrome affected a great number of vines, with a conse-
quent significant loss of production.
In 2012, deep sequencing of the small RNA population
of two cv. Pinot gris vines collected in the Trentino region
(Italy), one symptomatic and the other asymptomatic, led to
the identification of a new virus, with the provisional name
of GPGV (Grapevine Pinot gris virus) which could be
involved in this disease (Giampetruzzi et al., 2012). As the
presence of GPGV was reported in both symptomatic and
asymptomatic deep sequenced plants, this research could
not establish a clear link between the new virus and the
observed syndrome. Moreover, the two vines revealed the
presence of five other well-known viruses and viroids:
Grapevine rupestris stem pitting associated virus
(GRSPaV), Grapevine rupestris vein feathering virus
(GRVFV), Grapevine Syrah virus 1 (GSyV-1), Hop stunt
viroid (HSVd) and Grapevine yellow speckle viroid 1
(GYSVd-1) which could interact with GPGV and thus
affect disease expression (Giampetruzzi et al., 2012).
The genome organization of GPGV was identical to that
of Grapevine berry inner necrosis virus (GINV), a trichovi-
rus already reported in Japan, which caused very similar
symptoms; but their sequence differences allowed classifi-
cation in two independent species (Giampetruzzi et al.,
2012).
The GPGV virus was subsequently recorded by RT-PCR
in other Italian regions (Emilia-Romagna, Veneto and Friuli
Venezia Giulia) as well as in the Republic of Korea, Slove-
nia, Slovakia, the Czech Republic and Greece (Martelli,
2014). During spring 2014, GPGV was found in two dis-
tinct areas of Apulia (Southern Italy) in several vines of the
table grape cvs. Black Magic and Supernova (Morelli
et al., 2014).
The analysis of the complete genome sequence of three
Slovak isolates of GPGV revealed a close relationship to
the Italian isolate, together with an elevated divergence in
the 50 extremity (Glasa et al., 2014). As all GPGV-infected
Slovak and Czech vines were infected by other viruses, the
authors could not link any typical symptom to the virus
(Glasa et al., 2014).

22 ª 2015 The Authors. Journal compilation ª 2015 OEPP/EPPO, EPPO Bulletin 45, 22–32

Fig. 1 Symptoms of chlorotic mottling and leaf deformation observed
on Vitis vinifera leaves cv. Pinot gris.
In 2012 the Plant Protection Service started a large-
scale GPGV monitoring in Friuli Venezia Giulia region.
In this article, the results of 3 years (2012–2014) of field
observations and RT-PCR analyses are presented and the
role of GPGV as the etiologic agent of the syndrome is
discussed.
Materials and methods
Plant materials
Samples were collected mainly in May-June; in order to
evaluate the seasonal variation of GPGV, 34 vines were sam-
pled again in September 2014. Total RNA was extracted
from petioles of symptomatic and asymptomatic Vitis
vinifera and rootstock plants. 1 g of petioles was placed in
an extraction bag (Bioreba, Reinach, Switzerland) and frozen
at 40°C. Samples were then homogenized with 5 mL of
lysis buffer (MacKenzie et al., 1997) without 2-mercaptoeth-
anol using a Texor homogenizer (Lavorazioni Meccaniche
Linzi, Mereto di Tomba, UD, Italy). 1 mL of homogenate
was transferred to a 2 mL microcentrifuge tube, mixed with
100 lL of 20% (wt/vol) sarkosyl and incubated 10 min at
70°C in a Midi Dual 14 Oven (Hybaid, Teddington Middle-
sex, UK) at the maximum agitation speed. Samples were
then centrifuged for 1 min at 800 9 g in a ALC PK121R
centrifugette microcentrifuge (ALC International, Cologno
Monzese, MI, Italy) and 900 lL of homogenate was trans-
ferred to a new 2 mL microcentrifuge tube for automated
RNA purification with RNeasy plant mini kit (Qiagen,
Hilden, Germany) on the QIAcube robotic workstation
(Qiagen). The final elution volume was set to 100 lL. The
eluted RNA was stored at 80°C until further use.
Primers and probes design
Primers and hydrolysis probes for GPGV detection were
designed on the whole genome virus sequence published by
ª 2015 The Authors. Journal compilation ª 2015 OEPP/EPPO, EPPO Bulletin 45, 22–32
GPGV in Friuli Venezia Giulia 23
Giampetruzzi et al. (2012, Accession no. FR877530) using
the Beacon Designer 7 software (Premier Biosoft Interna-
tional, Palo Alto, CA, USA). The genomic regions for the
RNA dependent RNA polymerase and for the coat protein
were used for the development of two real-time RT-PCR
assays (Table 1). All the primer/probe sets were tested in
silico for GPGV specificity using NCBI nucleotide BLAST
(Zhang et al., 2000) and the amplicons were verified by gel
electrophoresis.
One-step real-time RT-PCR
GPGV monitoring of field samples was performed by sim-
plex or multiplex real-time RT-PCR. In 2012, samples were
tested only for the presence of the GPGV RNA dependent
RNA polymerase (GPgVPozRT-F,-R and probe), while in
2013 and 2014 they were assayed for both the RNA depen-
dent RNA polymerase and the coat protein gene
(GPgV504F, GPgV588R and GPgV CP542 probe) with a
multiplex RT-PCR.
Real-time RT-PCR was performed in 25-lL reaction vol-
ume mixtures with 5 lL of template RNA, 400 nM each
primer, 100 nM each hydrolysis probe, 12.5 lL of the 29
QuantiFast Multiplex RT-PCR Master Mix and 0.25 lL
QuantiFast RT Mix. The above-mentioned reagents are the
components of the QuantiFast Multiplex RT-PCR + R kit
(Qiagen). The following thermal protocol was used: 50°C
for 30 min; 95°C for 5 min; 45 cycles of denaturation at
95°C for 5 s and annealing/extension at 60°C for 30 s.
Every RNA sample was analyzed in duplicate and the
quantification cycle (Cq) values were averaged during data
analysis; moreover, every plate included non-template
(water) controls, as well as positive (total RNA from virus
infected plants) and negative (total RNA from healthy
plants) controls.
All RT-PCR reactions were performed on a CFX96
Real-time PCR thermalcyler (Bio-Rad, Hercules, CA,
USA).
Amplification data were analyzed using the CFX Man-
ager Software 3.0 (Bio-Rad). In order to allow comparabil-
ity between assays, the baseline threshold was always set to
100 RFU (relative fluorescence units) and samples were
considered positive for GPGV when the mean quantification
cycle (Cq) values were ≤34 or ≤37, for the PCR system
designed using the capsid protein or the RNA dependent
RNA polymerase, respectively.
PCR amplificability evaluation of RNA (RNA quality
control)
Prior to GPGV analyses, all RNA samples were evaluated
for PCR amplificability using either a real-time RT-PCR
assay based on the presence of the ubiquitous Grapevine
rupestris stem pitting-associated virus (GRSPaV) or the
grapevine chaperonine endogenous gene. In the first assay,
the following oligonucleotides were used: sense
24 G. L. Bianchi et al.

Table 1 Primers and probes for real-time RT-PCR and for plasmid preparation

Primer/probe name Length (bases) Sequence 50 -30 Nucleotide position Acc. No.

GPgVPozRTF 23 ACCAATCTAATAAAGACTTCAAA 803–825 FR877530

GPgVPozRTR 18 AGGATCTCCGACTCATAT 906–889 FR877530
GPgVPozRT probe 24 [FAM]-TCTGTAAGTCTCCACCGTTCTGTC-[BHQ1] 836–859 FR877530
GPgV504F 20 GAATCGCTTGCTTTTTCATG 7092–7111 FR877530
GPgV588R 22 CTACATACTAAATGCACTCTCC 7176–7155 FR877530
GPgV CP542 probe 24 [T.RED]-AGACTAATGCTATCACGGCTTCGG-[BHQ2] 7130–7153 FR877530
GPgV424f* 21 AGGCTAAGGTGACCAGACTCA 414–434 FR877530
GPgV 1 F 20 ATGTCGATTCGTCAGGAGCT 6589–6608 FR877530
GAPDH-1F† 23 TCAAGGTCAAGGACTCTAACACC 75–97 EF192466
GAPDH-3F 18 GCTGCTGCCCATTTGAAG 221–238 EF192466
GAPDH-1R† 21 CCAACAACGAACATAGGAGCA 300–280 EF192466
GAPDH probe 23 [JOE]- GGTTGTCATCTCAGCCCCAAGCA-[BHQ1] 253–275 EF192466
ChaPozFrna2 20 GGATCTGAAGCCCCTGAATG 1321–1340 AY680699
ChaPoz1R 23 GAAGTCATTCCCTGCATACTTGG 2116–2094 AY680699
ChaPozP1 probe 25 [T.RED]-GAAACCACTGTCTGTGAGCCCAGGA-[BHQ2] 2053–2077 AY680699
GRSP-RT2F 22 AATAATTCCCCGATTTCAAGGC 8583–8604 NC_001948
GRSP-RT2Ra 25 AGGATTTAGCATGGAAAGGGAATAC 8665–8641 NC_001948
GRSP-RT2Rb 25 AGGATTTAGCATAGAAAGGGAATAC 8665–8641 NC_001948
GRSP2Poz probe 26 [CY5]-TGGGTTAAGCCTGTTCGCTGGAATAC-[BHQ2] 8605–8630 NC_001948
GRVFVPozFa 19 CCCAAAGTCCAAGAGTCGC 5970–5988 AY706994
GRVFVPozFb 19 CCCAAAGTCCAAGAATCGC 5970–5988 AY706994
GRVFVPozR 18 GGTGAAGGCGGCTGAGTC 6059–6042 AY706994
GRVFV-P probe 26 [CY5]-CCCCTTCCAGTGGGTTGCTCTCATAA-[BHQ2] 6008–6033 AY706994
GSyV-1PozF 20 CTCAGCCTTCTCTGCCTCTG 56–75 GU372365
GSyV-1PozR 20 TCAACGGTGAAGATGGTGGA 176–157 GU372365
GSyV-1PozP probe 24 [JOE]-CCCTTCCAATGGGTCGCACTTGTT-[BHQ1] 121–144 GU372365
GYSVd-1 PozFa 20 GTGGTTCCTGTGGTTTCACC 20–39 X87917
GYSVd-1 PozFb 20 GTGGTTCCTGTGGTTACACC 20–39 X87917
GYSVd-1 PozR 18 GACGTCGACCAGCTCAGG 145–128 X87917
GYSVd-1P probe 23 [FAM]-AGAAGAAGATAGGGGCAGAGGGG-[BHQ1] 65–87 X87917
HSVdPozFa 17 CCGCATAAGGCATGCAA 20–36 X87928
HSVdPozFb 17 CCGCAAAAGGCATGCAA 20–36 X87928
HSVdPozR 20 CATGCCTCTCGCTGGATTCT 116–97 X87928
HSVdPozP probe 22 [JOE]-CTTACCTGAGAAAGGAGCCCCG-[BHQ1] 61–82 X87928
*
Giampetruzzi et al. (2012).
†
Monteiro et al. (2013).

GRSP-RT2F, antisense GRSP-RT2Ra+GRSP-RT2Rb, probe
GRSP2Poz and the same reaction mixture, final oligo con-
centrations and thermal protocol used for GPGV one-step
real-time RT-PCR assay.
When the GRSPaV-test failed or a mean Cq value ≥30
was obtained, using a baseline threshold always set to 100
RFU, another system based on a grapevine reference gene
was used. In particular, a primer couple was designed
within two exons spanning a 650 bp-region comprising 2
introns and another exon of the grapevine chaperonine 21
gene (Acc. No. AY680699). Under normal real-time RT-
PCR cycling conditions, amplification of this large PCR
product was not favored and therefore genomic DNA
amplification was prevented. Real-time RT-PCR for the
chaperonine 21 gene was performed making use of the
QuantiFast Multiplex RT-PCR + R kit (Qiagen) and the
following primers/probe mixture: ChaPozFrna2, ChaPoz1R
and ChaPozP1 probe, each at a final concentration of
0.2 lM.
Similarly to the GRSPaV real time RT-PCR system, a
mean Cq value <30, with a baseline threshold set to 100
RFU, was used as a threshold for amplificability of the
isolated RNA.
Detection of GPGV-associated viruses
When GPGV was discovered for the first time, it was asso-
ciated with the presence of 5 more viruses: Grapevine ru-
pestris stem pitting associated virus (GRSPaV), Grapevine
rupestris vein feathering virus (GRVFV), Grapevine Syrah
virus 1 (GSyV-1), Hop stunt viroid (HSVd) and Grapevine
yellow speckle viroid 1 (GYSVd-1). In order to disclose
any interaction between these pathogens and GPGV, the
262 samples collected in 2013 were further analyzed.
Two duplex one-step real-time RT-PCR were designed
for the contemporary detection of GRVFV + GSyV-1 and
HSVd + GYSVd-1, respectively. The 25 lL real-time RT-
PCR mixture contained 5 lL total RNA, 400 nM each

ª 2015 The Authors. Journal compilation ª 2015 OEPP/EPPO, EPPO Bulletin 45, 22–32

sense and anti-sense primer, 100 nM each hydrolysis probe,
12.5 lL of the 29 QuantiFast Multiplex RT-PCR Master
Mix and 0.25 lL QuantiFast RT Mix (Qiagen). The prim-
ers/probe combinations were the following: sense
GRVFVPozFa+GRVFVPozFb, antisense GRVFVPozR and
GRVFV-P probe for amplification of GRVFV; sense
GSyV-1PozF, antisense GSyV-1PozR and GSyV-1PozP
probe for amplification of GSyV-1; sense GYSVd-1 Po-
zFa+GYSVd-1 PozFb, antisense GYSVd-1 PozR and GY-
SVd-1P probe for amplification of GYSVd-1; sense
HSVdPozFa+HSVdPozFb, antisense HSVdPozR and
HSVdPozP probe for HSVd-detection (Table 1).
All RT-PCR reactions were performed on a CFX96
Real-time PCR thermalcyler (Bio-Rad) with the following
program: 50°C for 30 min; 95°C for 5 min; 45 cycles of
denaturation at 95°C for 5 s and annealing/extension at
60°C for 30 s.
For GRSPaV detection, a simplex RT-PCR described in
the previous paragraph was used.
Standard plasmid DNA controls
Three plasmids were generated for quantitative assays:
pGPGV-RDRP harbouring a GPGV RNA dependent RNA
polymerase sequence; pGPGV-CP with the GPGV capsid
protein sequence and pGAPDH for the reference plant glyc-
eraldehyde 3-phosphate dehydrogenase (GAPDH) gene
(Acc. No. EF192466).
The cDNA derived from a GPGV-infected vine cv. Pinot
gris was used as template for the isolation of a 493 bp frag-
ment corresponding to a portion of the putative RNA
dependent RNA polymerase and a 588 bp amplicon repre-
senting most of the coat protein gene. In order to amplify
the first transcript, the following primers were used: sense
GPgV424f, antisense GPgVPozRTR; for the second tran-
script sense GPgV 1 F, antisense GPgV588R (Table 1).
The PCR reaction was set up using the Advantage-HF PCR
kit (Clontech Laboratories Inc., Mountain View, CA, USA)
as follows: 5 lL cDNA, 2.5 lL 109 HF PCR buffer,
2.5 lL 109 HF dNTP mix, 0.5 lL 509 Advantage-HF
Polymerase Mix, 800 nM each primer, purified H2O to final
volume 25 lL.
Similarly, the GAPDH sequence was isolated using GAP-
DH-1F and GAPDH-1R primers from a cv. Pinot gris vine.
All reactions were carried out with the iCycler iQ multi-
color Real-Time PCR thermalcycler (Bio-Rad) and run with
the following program: 94°C, 1 min; 35 cycles at 94°C,
15 s; 60°C, 30 s; 68°C, 1 min; final extension 68°C, 3 min.
The amplified products of both reference and target
genes were purified using Nucleospin PCR & gel clean up
columns (Macherey-Nagel, Dueren, Germany) and cloned
in a pGEM-T vector (Promega Corporation, Madison, WI,
USA) following the supplier’s instructions. The recombi-
nant plasmids were transferred to Escherichia coli JM101
competent cells and subsequently purified using QIAprep
Spin Miniprep Kit (Qiagen) according to the manufacturer’s
ª 2015 The Authors. Journal compilation ª 2015 OEPP/EPPO, EPPO Bulletin 45, 22–32
GPGV in Friuli Venezia Giulia 25
instructions. Plasmid DNA concentration was determined
by measuring absorbance at 260 nm with an Epoch spectro-
photometer (Biotek, Winooski, VT, USA). Plasmid DNA
copy number was then calculated on the basis of plasmid
DNA concentration and its molecular weight (Applied Bio-
systems, 2003). Plasmid DNA was stored at 20°C.
PCR efficiency and LOD
In order to determine PCR efficiency and the limit of detec-
tion (LOD), calibration curves were generated from dilution
series of recombinant plasmids, in which the cloned
sequence was present at 5 9 106, 5 9 105, 5 9 104,
5 9 103, 5 9 102, 50, 25 and 12.5 copies. Each dilution
point was run in ten replicates. The CFX Manager Software
3.0 (Bio-Rad) automatically calculated PCR efficiency, line
equation and R2.
Two-step real-time RT-PCR assay for relative virus
quantification
cDNA synthesis
Reverse transcription (RT) was carried out using the iScript
cDNA Synthesis kit and a blend of oligo(dT) and random
hexamer primers (Bio-Rad). The total volume of the RT
mix was 20 lL per reaction, containing 4 lL 59 iScript
reaction mix, 1 lL iScript reverse transcriptase and 15 lL
of total RNA template. The reaction was incubated for
5 min at 25°C; 60 min at 42°C and 5 min at 85°C in an
iCycler iQ multicolor Real-Time PCR (Bio-Rad). The
resulting cDNA was stored at 40°C.
Simplex real-time PCR
GPGV quantification in cDNA samples was performed by
simplex quantitative real-time PCR. The primers/probe sets
were the same as those used in the one-step real-time RT-
PCR and complementary to the coat protein target sequence
(Table 1). In each PCR run, serial dilutions of control plas-
mids were included with known amounts of input copy
number in order to draw calibration curves for the target
gene and for the endogenous plant reference gene (GAP-
DH). For each sample, 2 independent estimates were per-
formed. The real-time system for the GAPDH reference
gene comprised the following oligonucleotides: GAPDH-
3F, GAPDH-1R and GAPDH probe (Table 1).
The total volume of the real-time PCR mix was 25 lL
per reaction, containing 12.5 lL 29 iQ Supermix (Bio-
Rad), 400 nM each primer, 100 nM each hydrolysis probe
and 2.5 lL of cDNA. Each reaction was performed using a
CFX96 Real-time PCR thermalcyler (Bio-Rad) with the fol-
lowing PCR conditions: 3 min at 95°C and 50 cycles of 5 s
at 95°C and 30 s at 60°C.
Real-time PCR data analyses
The quantification plots and calibration curves were ana-
lyzed using the CFX Manager Software 3.0 (Bio-Rad) with
26 G. L. Bianchi et al.

the threshold manually set at 100 RFU. Slope, R2 and PCR
efficiency of calibration curves were automatically calcu-
lated by the software.
The % ratio between the mean starting quantities (SQ)
of GPGV target gene and GAPDH was calculated for
each sample. All data were statistically analyzed by one-
way ANOVA with P ≤ 0.05, using the software package
CoStat version 6.101 (CoHort Software, Monterey, CA,
USA).
Results
Cq-values were measured in 10 replicates and plotted
against the known copy numbers of the standard samples.
A strong linear relationship between the Cq and the log of
the copy number was verified (R2 ≥ 0.99). The slope of
standard curve was 3.4, and the efficiency of the reaction
calculated by 10(1/slope)1 ranged between 94.1–97.6%
(Table 2).
The new real-time RT-PCR assays were sensitive enough
to detect 25 copies of pGPGV-RDRP and 12.5 copies of
pGPGV-CP and proved suitable for target cDNA quantifica-
tion in infected tissues.

The real-time RT-PCR system: specificity and
sensitivity
The primers and probes for GPGV detection were designed
in two distinct regions of the GPGV sequence (Acc. no.
FR877530; Giampetruzzi et al., 2012), including the RNA
dependent RNA polymerase gene and the coat protein gene.
By aligning the FR877530 sequence with the Slovak iso-
lates of GPGV (Acc. nos. KF134123-24-25; Glasa et al.,
2014), it is clear that the first RT-PCR assay spans a vari-
able region which is ascribed to the RNA dependent RNA
polymerase gene by Giampetruzzi et al. (2012) or to the
methyltransferase gene by Glasa et al. (2014) (Fig. 2).
Specificity of primers and probes was assessed in silico
using nucleotide BLAST (Zhang et al., 2000) and no sig-
nificant homology for other plant or viral sequences was
found (data not shown).
The sequencing of the amplified product obtained with
the coat protein RT-PCR system confirmed a high degree
of identity with GPGV sequence Acc. no. FR877530, rang-
ing from 96 to 100% depending on the sequenced amplicon
(data not shown). The amplified products were also verified
using gel electrophoresis (data not shown).
The linear range of quantification of the real-time PCR
assays for GPGV RNA dependent RNA polymerase gene,
GPGV coat protein gene and GAPDH reference gene was
determined by using serial dilutions of recombinant stan-
dard plasmids ranging from 5 9 106 to 12.5 copies to
determine the limit of detection (LOD) and the linearity of
the assay.
GPGV monitoring in the Friuli Venezia Giulia region
From 2012 to 2014, a total of 1294 samples were collected
from different vineyards and nurseries across the region.
480 symptomatic and 814 asymptomatic Vitis vinifera
plants were sampled among susceptible varieties (Pinot gris,
Traminer, Friulano/Tocai and Glera/Prosecco) from produc-
tive vineyards and scion mother plant nurseries. Vines were
selected during May-June from both vineyards unaffected
by the syndrome and vineyards with noticeable symptoms.
In the latter case, both symptomatic and asymptomatic
plants were sampled. For each vine, about 5–20 leaves
(depending on the size of petioles) were harvested and the
total RNA extracted from petioles was quality assessed and
subsequently subjected to one-step real-time RT-PCR for
GPGV detection.
During the first year of monitoring, samples were ana-
lyzed only for the presence of the GPGV RNA dependent
RNA polymerase gene.
In the second year, a multiplex one-step real-time RT-
PCR was used for the contemporary detection of both
GPGV RNA dependent RNA polymerase gene and coat
protein gene. In some cases (17.9%) the results obtained
with the two RT-PCR systems were discordant (Table 3),
but these samples were considered GPGV-infected. In
2014, a greater number of samples was analyzed only for
the presence of the GPGV coat protein gene.
The number of vines that tested positive for GPGV and
their distribution across symptomatic and asymptomatic
clusters are reported in Fig. 3.

A
KF134124.1 SK01 7093 GAATCGCTTGCTTTTTCATGTCGAAAGTGAGAAGCAAAAGACTAATGCTATCACGGCTTCGGGGGAGAGTGCATTTAGTATGTAG 7177
KF134125.1 SK13 7093 GAATCGCTTGCTTTTTCATGTCGAAAGTGAGAAGCAAAAGACTAATGCTATCACGGCTTCGGGGGAGAGTGCATTTAGTATGTAG 7177
KF134123.1 SK30 7093 GAATCGCTTGCTTTTTCATGTCGAAAGTGAGAAGCAAAAGACTAATGCTATCACGGCTTCGGGGGAGAGTGCATTTAGTATGTAG 7177
KF686810.1 SK30-1 7093 GAATCGCTTGCCTTTTCATGTCGAAAGTGAGAAGCAAAAGACTAATGCTATCACGGCTTCGGGGGAGAGTGCATTTAGTATGTAG 7177
FR877530.1 7092 GAATCGCTTGCTTTTTCATGTCGAAAGTGAGAGGCAAAAGACTAATGCTATCACGGCTTCGGGGGAGAGTGCATTTAGTATGTAG 7176
AB731567.1 504 GAATCGCTTGCTTTTTCATGTCGAAAGTGAGAAGCAAAAGACTAATGCTATCACGGCTTCGGGGGAGAGTGCATTTAGTATGTAG 588
Coat Protein amplicon 1 GAATCGCTTGCTTTTTCATGTCGAAAGTGAGAAGCAAAAGACTAATGCTATCACGGCTTCGGGGGAGAGTGCATTTAGTATGTAG 85

B
FR877530.1 803 ACCAATCTAATAAAGACTTCAAAGGGGCATTATTCTGTAAGTCTCCACCGTTCTGTCGGTTCCCACCACTTTTTTCAGATAAGTAAATATGAGTCGGAGATCCT 906
KF134124.1 SK01 813 ACCAATCTGATAAAGACTTCAAAGGGGCATTATTCTGTAAGTCTCCATCGCTCCGTCGGTTCCCATCACTTCTTTCAGATAAGTAAATATGAGTCAGAGATCCT 916
KF134125.1 SK13 813 ACCAATCTGATTAAGACTTCAAAGGGGCATTATTCTGTAAGTCTCCACCGTTCCGTCGGTTCCCATCACTTCTTTCAGATAAGTAAATATGAGTCGGAGATCCT 916
KF134123.1 SK30 813 ACCAATCTGATAAAGACTTCAAAGGGGCATTATTCTGTAAGTCTCCACCGTTCCGTCGGTTCCCATCACTTCTTTCAGATAAGTAAATATGAGTCGGAGATCCT 916
KF686810.1 SK30.1 813 ACCAATCTGATAAAGACTTCAAAGGGGCATTATTCTGTAAGTCTCCACCGTTCCGTCGGTTCCCATCACTTCTTTCAGATAAGTAAATATGAGTCGGAGATCCT 916
RNAdRp amplicon 1 ACCAATCTAATAAAGACTTCAAAGGGGCATTATTCTGTAAGTCTCCACCGTTCTGTCGGTTCCCACCACTTTTTTCAGATAAGTAAATATGAGTCGGAGATCCT 104

Fig. 2 Alignment of all the GPGV sequences available in GenBank database release 204.0 (Benson et al., 2013) in the regions used for primers and
probes design. A - coat protein region; B - RNA dependent RNA polymerase region. The primers and probes used in this work are underlined.

ª 2015 The Authors. Journal compilation ª 2015 OEPP/EPPO, EPPO Bulletin 45, 22–32
 GPGV in Friuli Venezia Giulia 27

Table 2 Calibration curves parameters. The standard curves were obtained by amplification of dilutions starting from 5 9 106 to 12.5 copies of the
recombinant plasmids pGPGV-RDRP, pGPGV-CP and pGAPDH

RT-PCR assay Plasmid PCR efficiency, % R2 Line equation LOD

GPGV Coat protein pGPGV-CP 96.8 0.992 y = 3.397x + 39.816 12.5

GPGV RNA dependent RNA polymerase pGPGV-RDRP 94.1 0.994 y = 3.473x + 43.339 25
GAPDH pGAPDH 97.6 0.990 y = 3.380x + 41.925 25

Table 3 Distribution of 47 samples tested in 2013 having discordant

results on the two real-time RT-PCR assays GPGV monitoring in asymptomatic vines: rootstocks
and initial materials
Number of vines positive Number of vines
for GPGV RNA dependent positive for GPGV
In 2014, 114 rootstock samples were collected from nur-
RNA polymerase coat protein series producing basic and certified material and analyzed
for the presence of the GPGV coat protein: 42 samples
Asymptomatic vines 3 30 (36.8%) tested positive for the virus (Fig. 4).
Symptomatic vines 7 7
Moreover, 84 samples from the ERSA collection of the
primary source of registered clones belonging to grape vari-
eties from North-Eastern Italy were analyzed. Interestingly,
96.7% 45 samples (53.6%) tested positive for GPGV. These plants
100% 94.3% had been kept in an insect proof screen house in Pan-
87.1% 94.3%
80% tianicco (UD) for at least 10 years and were previously
61.5% 79.3%
60%
subjected to biological indexing of graft-transmissible
38.5%
viruses using different indicator plants such as: Vitis
40%
rupestris cv. St George for the detection of viruses of the
20% grapevine fanleaf complex and Grapevine fleck virus
3.3%
5.7% 12.9% (GFkV); Vitis vinifera cv. Cabernet franc for the grapevine
0% 20.7%
S 5.7% leafroll complex; LN33hybrid, K5BB rootstock and Vitis
A
S A rupestris cv. Rupestris du Lot for rugose wood complex;
2012
S 110 Richter rootstock for grapevine vein necrosis disease;
GPGV Negative 2013 A
2014 Vitis riparia cv. Gloire de Montpellier for vein mosaic.
GPGV Positive

Fig. 3 Graphical representation of 2012–2014 GPGV monitoring in

productive vineyards and scion mother plant nurseries of the Friuli
Venezia Giulia region. Samples are grouped on the basis of symptom
presence (S) or absence (A) and GPGV positivity or negativity. The
results are presented as percentage of vines calculated on the basis of
the total number of vines analyzed per year: 86 in 2012 (60 S + 26 A);
262 in 2013 (122 S + 140 A) and 946 in 2014 (298 S + 648 A). S –
symptomatic; A – asymptomatic.
Detection of GPGV-associated viruses
More than 98% of the 262 vines collected in 2013 were
infected by GRSPaV, HSVd and GYSVd-1. The two Mar-
afivirus GSyV-1 and GRVFV were present in around 15%
of samples equally distributed between symptomatic and
asymptomatic plants.

16 GPGV Positive
14 GPGV Negative
12
Number of plants

10
8
6
4
2
0

Fig. 4 GPGV survey in 114 rootstocks

collected in nurseries producing basic and
certified material.

ª 2015 The Authors. Journal compilation ª 2015 OEPP/EPPO, EPPO Bulletin 45, 22–32
28 G. L. Bianchi et al.

Table 4 Quantification data of 207 field samples collected from

Quantification of GPGV different vineyards and nurseries. Samples were classified in three
The GPGV coat protein gene was quantified using a sim- levels characterized by different relative GPGV titer (%). Ar:
Asymptomatic rootstocks; Ap-Av: Asymptomatic plants collected from
plex real-time quantitative RT-PCR assay in a random sam-
Asymptomatic vineyards; Ap-Sv: Asymptomatic plants collected from
ple of 207 vines collected in May-June 2014 from Symptomatic vineyards; Sp-Sv: Symptomatic plants collected from
symptomatic vineyards of susceptible varieties and in Symptomatic vineyards
asymptomatic vineyards of susceptible varieties and root-
stocks (Fig. 5). % GPGV Ar Ap-Av Ap-Sv Sp-Sv Total
The relative viral concentration was calculated by divid-
0.001–10.00 18 14 13 4 49
ing the viral copy number by the reference plant gene copy 10.01–100.00 22 33 27 28 110
number (normalization) and was expressed as a percentage. >100.01 10 9 9 20 48
The distribution of samples on the basis of their GPGV Total 50 56 49 52 207
content is reported in Table 4. All the populations of
GPGV-infected plants showed a great variability in the
viral content, ranging from a very low virus titer (below atic plants samples characterized by a GPGV level >100%
0.1%, when the virus copy number was more than 1000 were more abundant than in other populations.
times lower than the reference gene copy number) to a titer After anomalous data exclusion by Dixon’s test, which
greater than 100% (when the virus content was much excluded most of the above-mentioned borderline samples
greater than the GAPDH level). Interestingly, the vines with a viral content higher than 100%, the average viral
characterized by a very low virus content mainly belonged load was calculated over at least 40 samples representative
to the asymptomatic group, while in the group of symptom- of four distinct populations:

Fig. 5 GPGV quantification in field samples

by real-time RT-PCR. The two calibration
curves are obtained by amplification of
dilution series containing pGPGV-CP (Texas
red) and pGAPDH (Joe) at 5 9 106,
5 9 105, 5 9 104, 5 9 103, 5 9 102 and 50
copies per reaction. By comparing the Cq
values of the unknown samples to the
standard curves, the software allows the
quantification of initial copy numbers
(Starting Quantity).

ª 2015 The Authors. Journal compilation ª 2015 OEPP/EPPO, EPPO Bulletin 45, 22–32
 GPGV in Friuli Venezia Giulia 29

(1) Symptomatic plants collected from Symptomatic vine-
yards (Sp-Sv)
(2) Asymptomatic plants collected from Symptomatic vine-
yards (Ap-Sv)
(3) Asymptomatic plants collected from Asymptomatic
(syndrome-free) vineyards (Ap-Av)
(4) Asymptomatic rootstocks (Ar).
The mean GPGV quantity, variation range, standard
deviation (SD) and variation coefficient (CV) for each pop-
ulation were the following: Sp-Sv 64.9% (0.03% to 181%,
SD 48.4%, CV 74.6%); Ap-Sv 25.8% (0.001% to 89%, SD
22.4%, CV 86.8%); Ap-Av 28.1% (0.001% to 65%, SD
24.1%, CV 85.9%); Ar 23.1% (0.03% to 86%, SD 24.9%,
CV 108.0%).
Statistical analysis (ANOVA) based on the Duncan’s
multi-range test at P ≤ 0.05% demonstrated that there was
a significant difference in the mean virus content between
the Sp-Sv group and the other populations (Table 5).
17 symptomatic plants collected from symptomatic vine-
yards (Sp-Sv) and 17 asymptomatic plants collected from
symptomatic vineyards (Ap-Sv) in May-June 2014 were
also sampled in September 2014 and analyzed for virus
quantification. All the sampled leaves were asymptomatic,
even when collected from vines showing symptoms on their
oldest leaves and shoots. The GPGV quantification data
obtained from samples taken in May-June were compared
to those from the same plants that were taken in September
and an ANOVA was performed after anomalous data exclu-
sion by Dixon’s test.
Statistical analysis based on the Duncan’s multi-range test
revealed that a significant decrease (P ≤ 0.05%) in the virus
content of both populations occurred between May-June and
September. The statistically significant difference observed
between the viral content of Sp-Sv and Ap-Sv populations
collected in May-June was not seen when the same popula-
tions were analyzed in September (Table 5).
Discussion
GPGV monitoring in field samples
The availability of the GPGV genome sequence (Giam-
petruzzi et al., 2012) has allowed the development of
molecular diagnostic methods based on conventional RT-
PCR (Giampetruzzi et al., 2012; Glasa et al., 2014). In
order to perform a large-scale GPGV field monitoring, two
new real-time RT-PCR methods for the rapid screening of
a large number of plants were developed.
The first real-time RT-PCR system was designed in the
variable GPGV genome region of the RNA dependent RNA
polymerase gene, while the second real-time RT-PCR sys-
tem amplified the highly conserved sequence of the GPGV
coat protein gene (Fig. 2).
In the absence of a GPGV reference strain, the specificity
of these methods was verified only in silico by comparison
of the amplification targets with all the nucleotide
sequences available in GenBank and they were identical to
GPGV. Both real-time RT-PCR assays were shown to have

Table 5 Statistical analysis of quantification

data of GPGV positive plants Mean GPGV%* Number of samples

Field samples collected in May–June

Symptomatic plants of Symptomatic vineyards 64.9 a 40
Asymptomatic plants of Symptomatic vineyards 25.8 b 40
Symptomatic plants of Symptomatic vineyards 64.9 a 40
Asymptomatic plants of Asymptomatic vineyards 28.1 b 40
Symptomatic plants of Symptomatic vineyards 64.9 a 40
Asymptomatic rootstocks 23.1 b 40
Asymptomatic plants of Asymptomatic vineyards 28.1 a 40
Asymptomatic plants of Symptomatic vineyards 25.8 a 40
Asymptomatic plants of Symptomatic vineyards 25.8 a 40
Asymptomatic rootstocks 23.1 a 40
Symptomatic plants of Asymptomatic vineyards 28.1 a 40
Asymptomatic rootstocks 23.1 a 40

Comparison between samples collected in May-June and in September from symptomatic

vineyards
Symptomatic leaves of Symptomatic plants: May–June 281.7 a 17
Asymptomatic leaves of Asymptomatic plants: May–June 44.8 b 14
Symptomatic leaves of Symptomatic plants: May–June 281.7 a 17
Asymptomatic leaves of Symptomatic plants: September 2.5 b 16
Asymptomatic leaves of Asymptomatic plants: May–June 44.8 a 14
Asymptomatic leaves of Asymptomatic plants: September 2.7 b 17
Asymptomatic leaves of Symptomatic plants: September 2.5 a 16
Asymptomatic leaves of Asymptomatic plants: September 2.7 a 17
*
Within the column, values for each population followed by a letter in common are not
significantly different, P ≤ 0.05, according to LSD test.

ª 2015 The Authors. Journal compilation ª 2015 OEPP/EPPO, EPPO Bulletin 45, 22–32
30 G. L. Bianchi et al.
a high level of analytical sensitivity and could detect as
few as 50/25 copies of GPGV target genes (Table 2).
A field survey of GPGV in productive vineyards and
scion mother plant nurseries of susceptible varieties and
rootstock varieties showed a widespread presence of the
virus across Friuli Venezia Giulia. GPGV was present in
around 95% of analyzed symptomatic plants but also in
61.5–87.1% of asymptomatic vines depending on the moni-
toring year. Saldarelli et al. (2013) have reported a 70% of
GPGV-infected asymptomatic vines in cv. Traminer and
Pinot gris vineyards. This work confirms the presence of
GPGV in a large number of asymptomatic plants, even if
the percentage values may differ due to different specificity
and sensitivity of the detection methods used.
In 2012-GPGV monitoring, when only the RNA depen-
dent RNA polymerase RT-PCR system was used, the rela-
tive percentage of asymptomatic samples negative to RT-
PCR was higher (38.5%) than the average recorded value
in 2013 and 2014 (12.9% and 20.7%, respectively). This
could be explained by the fact that the sequence variability
in the RNA dependent RNA polymerase genome region
could prevent amplification of some GPGV variants. Simi-
larly, when both real-time RT-PCR systems were used,
results did not always agree (Table 3). Subsequently, the
more reliable real-time RT-PCR system based on the
GPGV coat protein gene was chosen as the preferential
GPGV diagnostic method.
A small proportion of symptomatic plants tested negative
for GPGV using these screening tests, which could be due
to several factors such as a GPGV level below the limit of
detection, incorrect symptom identification in grapevines
simultaneously infected by other viruses (true negatives)
and the presence of GPGV isolates with variable sequences.
In agreement with Giampetruzzi et al. (2012), the GPGV
field survey results confirmed a close relationship between
the presence of GPGV and the new syndrome, but at the
same time, the presence of the virus in a number asymp-
tomatic plants prevented GPGV from being clearly identi-
fied as the etiologic agent of the new syndrome.
GPGV quantification
In order to find a relationship between the expression of
symptoms and virus titer, GPGV was quantified in 207
samples. In this study, the standard serial dilution curves
obtained with recombinant plasmids met the requirements
for correct virus quantification. Therefore the real-time RT-
PCR system based on the GPGV coat protein gene was
used to detect GPGV quantitatively in field samples. As
absolute virus quantification is affected by RNA extraction
yields and reverse transcription efficiency, qPCR data were
normalized using GAPDH as reference gene. GAPDH was
selected as internal control for its expression stability in
Vitis vinifera (Monteiro et al., 2013).
Except a few borderline cases where the correspondence
between symptoms and virus titer was evident (asymptom-
ª 2015 The Authors. Journal compilation ª 2015 OEPP/EPPO, EPPO Bulletin 45, 22–32
atic plants with relative virus level close to 0% or symp-
tomatic plants with a relative virus level >100%), all the
populations, both symptomatic and asymptomatic, showed a
great variability in the virus content.
The mean GPGV content in a symptomatic population
(Sp-Sv) was statistically significantly higher than the aver-
age value for the other studied asymptomatic populations
(Ap-Sv, Ap-Av and Ar). No other statistically significantly
correlations were recorded between different asymptomatic
populations.
Considering these data, it is not possible to suggest a
quantitative threshold or critical level that could be associ-
ated with symptoms expression on infected vines, but is
important to underline the higher mean level of virus in
symptomatic plants, thus confirming the potential role of
GPGV in the development of the syndrome. A possible
explanation of this behaviour may be related to the pres-
ence of isolates having different virulence or with the pres-
ence of other pathogens or stress factors in the plant.
The comparison between quantification data collected in
May-June and in September demonstrated a statistically sig-
nificant decrease in the viral content of Sp-Sv and Ap-Sv
populations while no statistically significant differences
were observed between the two populations in September.
Therefore the GPGV level of asymptomatic leaves may
change during the vegetative season.
GPGV-associated viruses
The 2013 monitoring also excluded a possible role of the
other virus identified with deep sequencing by Giampetruzzi
et al. (2012), because GRSPaV, HSVd and GYSVd-1 were
always present in symptomatic and asymptomatic plants at
high percentage; while the Marafivirus GRVFV and GsyV-1
were present at a lower percentage.
GPGV spread
GPGV discovery in the ERSA collections of clones stored
in a screen-house is the proof that GPGV was already pres-
ent in the candidate clones whose clonal selection began at
least 10 years ago. These plants were subjected to biologi-
cal indexing of graft-transmissible virus using different
indicator plants including Vitis riparia cv. Gloire de Mont-
pellier and the presence of GPGV was never detected. Con-
versely, GPGV was efficiently transmitted by grafting to
Vitis riparia inducing specific symptoms (Saldarelli et al.,
2013).
In 2014, field observations of symptoms across the Friuli
Venezia Giulia region has revealed that the syndrome is
widespread in productive vineyards of susceptible cultivars,
but, except for some isolated cases, the percentage of
affected vines is limited (Fig. 6). Moreover, the health state
of certified-scions is not currently of major concern, as
symptoms affect less than 1% of plants of all the monitored
nurseries. However, this situation could rapidly evolve.

Fig. 6 Classification of Friuli Venezia Giulia vineyards on the basis of the percentage of visually inspected symptomatic vines.
Field-observations during a 3-year period in a cv. Pinot
gris vineyard indicated a progressive increase of symptom-
atic vines (from 14.7 to 33.9%) while the incidence in a cv.
Traminer vineyard was stable (around 3%) (Saldarelli
et al., 2013). GINV, a close relative of GPGV, is transmit-
ted by erineum mites (Kunugi et al., 2000), but the means
of GPGV spread has not yet been ascertained. Although
GPGV was found in individuals of Colomerus vitis fed on
GPGV-infected vines, the results of transmission trials to
grapevine seedlings were unsuccessful (Beber et al., 2013).
Rootstocks can also play a significant role in the spread
of GPGV: field-transplanted grafted-plants derived from
GPGV-negative screen-house clones were further analyzed
and despite being asymptomatic they turned to be GPGV-
positive (data not shown). GPGV could then be graft-
transmitted or vector-borne.
Conclusions
If GPGV is the etiologic agent of the new syndrome, it is
necessary to explain the virus presence in asymptomatic
vines. Several aspects should be considered in future studies:
virulence variability among different GPGV isolates; con-
temporary presence of other grapevine viruses that could
affect GPGV in syndrome development; different infection
ª 2015 The Authors. Journal compilation ª 2015 OEPP/EPPO, EPPO Bulletin 45, 22–32
GPGV in Friuli Venezia Giulia 31
levels; uneven virus distribution across plant tissues. More-
over, as the virus was already discovered in a range of white
and red-berry cultivars (Glasa et al., 2014), GPGV monitor-
ing should be extended to a greater number of asymptomatic
varieties in order to better understand its spread. Also GPGV
quantification in a larger number of vines could disclose a
threshold effect for symptom expression.
Acknowledgements
The authors thank the ERSA phytosanitary inspectors and
technicians for sample collection: F. Bregant, A. De Biasio,
G. Franco, A. Gallas, G. Gori, M. Mossenta and S. Saro.
The authors also thank the DOC agricultural technicians:
G. Bigot, M. Corbatto, F. Degano, G. Marchi, M. Masotti
and D. Maurigh. The authors are very grateful to Dr. C.
Cattivello for statistical analysis.

sence du Grapevine Pinot gris virus (GPGV)
Pre
en Friuli Venezia Giulia (Italie). Suivi en plein
champ et quantification du virus par la RT-PCR
en temps re
el
Depuis 2003 la pr
esence d’un nouveau syndrome
caract
eris
e par des sympt^
omes de rabougrissement, des
 32 G. L. Bianchi et al.
marbrures chlorotiques, des d
eformations foliaires, et une
r
eduction du rendement et de la qualit
e a
et
e signal
ee sur
des vari
et
es a baies blanches de Vitis vinifera dans des
vignobles en Trentino-Alto Adige et Friuli Venezia Giulia.
L’identification d’un nouveau virus, provisoirement appel
e
Grapevine Pinot gris virus (GPGV), dans une vigne de
c
epage Pinot gris a sugg
er
e une association entre ce
nouveau syndrome et la pr
esence du virus (Giampetruzzi
et al., 2012), bien que la pr
esence simultan
ee du GPGV
dans des plantes symptomatiques et asymptomatiques
doivent encore ^etre expliqu
ee. Dans cette
etude, un suivi a
grande
echelle des vignobles et p
epinieres de Friuli -Venezia
Giulia sur une p
eriode de trois ans (2012-2014) a permis de
constater que le GPGV est largement r
epandu dans les
plantes symptomatiques, mais
egalement dans les plantes
asymptomatiques, bien qu’a des pourcentages l
egerement
inf
erieurs. Les analyses quantitatives du titre du virus ont mis
en
evidence une grande variabilit
e de la charge virale des
plantes tant symptomatiques qu’asymptomatiques, mais la
quantit
e moyenne de GPGV dans les vignes symptomatiques

etait significativement plus
elev
ee que dans les plantes
asymptomatiques.
Bcтpeчaeмocть Grapevine Pinot Gris Virus
(GPGV) в Фpиyли-Beнeция-Джyлия (Итaлия).
Пoлeвoй мoнитopинг и виpycнaя
квaнтификaция c пoмoщью ПЦP в peaльнoм
вpeмeни
Haчинaя c 2003 гoдa o пoявлeнии нoвoгo cиндpoмa c
cимптoмaми кapликoвocти, xлopoтичecкoй кpaпчaтocти,
дeфopмaции лиcтьeв, cнижeния ypoжaйнocти и кaчecтвa
cooбщaлocь пpимeнитeльнo к нeкoтopым copтaм бeлoгo
винoгpaдa Vitis vinifera нa винoгpaдникax в
Tpeнтинo-Aльтo-Aдиджe и Фpиyли-Beнeция-Джyлия.
Идeнтификaция нoвoгo виpyca, вpeмeннo нaзвaннoгo
Grapevine Pinot Gris Virus (GPGV) нa винoгpaдe copтa
Пинo Гpи, вызвaлa пpeдпoлoжeниe o cвязи этoгo нoвoгo
cиндpoмa c нaличиeм виpyca (Giampetruzzi et al., 2012),
oднaкo нaблюдaeмoe в нacтoящee вpeмя нaличиe GPGV
oднoвpeмeннo нa cимптoмныx и бeccимптoмныx
pacтeнияx вce eщe нyждaeтcя в oбъяcнeнии. B xoдe этoй
paбoты нa пpoтяжeнии тpex лeт (2012-14) пpoвoдилcя
кpyпнoмacштaбный мoнитopинг нa винoгpaдникax и
питoмникax Фpиyли-Beнeция-Джyлия, кoтopый
пpoдeмoнcтpиpoвaл шиpoкoe pacпpocтpaнeниe GPGV нa
cимптoмныx pacтeнияx, нo тaкжe и нa бeccимптoмныx
лoзax, xoтя и в нecкoлькo мeньшeй cтeпeни.
ª 2015 The Authors. Journal compilation ª 2015 OEPP/EPPO, EPPO Bulletin 45, 22–32
View publication stats
Кoличecтвeнныe aнaлизы виpycнoгo титpa пoкaзaли
бoльшyю вapиaбeльнocть виpycнoгo кoнтeнтa кaк
cимптoмныx, тaк и бeccимптoмныx pacтeний, oднaкo
cpeднee кoличecтвo GPGV нa cимптoмныx лoзax былo
знaчитeльнo бoльшим, чeм нa бeccимптoмныx
pacтeнияx.
References
Applied Biosystems (2003) Creating standard curves with genomic
DNA or plasmid DNA templates for use in quantitative PCR. http://
tools.lifetechnologies.com/content/sfs/brochures/cms_042486.pdf
[accessed on 11 November 2014]
Beber R, de Lillo E, Malagnini V, Gualandri V, Poggi Pollini C, Ratti
C et al. (2013) Transmission trials of Grapevine Pinot gris virus by
the eriophyoid mite Colomerus vitis. Journal of Plant Pathology 95,
S4.36.
Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I, Lipman DJ,
Ostell J et al. (2013) GenBank. Nucleic Acids Research 4, D36–D42.
Giampetruzzi A, Roumi V, Roberto R, Malossini U, Yoshikawa N, La
Notte P et al. (2012) A new grapevine virus discovered by deep
sequencing of virus- and viroid-derived small RNAs in cv Pinot gris.
Virus Research 163, 262–268.
Glasa M, Predaj na L, Kom
ınek P, Nagyov
a A, Candresse T & Olmos
A (2014) Molecular characterization of divergent grapevine Pinot
gris virus isolates and their detection in Slovak and Czech
grapevines. Archives of Virology 159, 2103–2107.
Kunugi Y, Asari S, Terai Y & Shinkai A (2000) Studies on the
grapevine berry inner necrosis virus disease. 2. Transmission of
grapevine berry inner necrosis virus by the grape erineum mite
Colomerus vitis in Yamanashi. Bulletin of Yamanashi Fruit Tree
Experimental Station 10, 57–63.
MacKenzie DJ, McLean MA, Mukerji S & Green M (1997) Improved
RNA extraction from woody plants for the detection of viral
pathogens by Reverse Transcription-Polymerase Chain Reaction.
Plant Disease 81, 222–226.
Martelli GP (2014) Directory of virus and virus-like diseases of the
grapevine and their agents. Journal of Plant Pathology 96,
S105–S120.
Monteiro F, Sebastiana M, Pais MS & Figueiredo A (2013) Reference
gene selection and validation for the early responses to downy
mildew infection in susceptible and resistant Vitis vinifera cultivars.
PLoS One 8, e72998.
Morelli M, de Moraes Catarino A, Susca L, Saldarelli P, Gualandri
V & Martelli GP (2014) First report of Grapevine Pinot gris virus
from table grapes in southern Italy. Journal of Plant Pathology 96,
439.
Saldarelli P, Beber R, Covelli L, Bianchedi P, Credi R, Giampetruzzi A
et al. (2013) Studies on a new grapevine disease in Trentino
vineyards. Journal of Plant Pathology 95, S4.60.
Zhang Z, Schwartz S, Wagner L & Miller W (2000) A greedy
algorithm for aligning DNA sequences. Journal of Computational
Biology 7, 203–214.