Aquaculture 513 (2019) 734391

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Effects of dietary carbohydrate sources on growth performance, glycogen T

accumulation, insulin signaling pathway and hepatic glucose metabolism in
largemouth bass, Micropterus salmoides
⁎
Songlin Lia,b,c, Chunyan Sanga, An Wanga, Jiacan Zhanga, Naisong Chena,b,c,
a
National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, No. 999, Hucheng Ring Road, Lingang New City, Shanghai
201306, China
b
Research Centre of the Agriculture Ministry on Environmental Ecology and Fish Nutrition, Shanghai Ocean University, Shanghai 20136, China
c
Shanghai Collaborative Innovation for Aquatic Animal Genetics and Breeding, Shanghai Ocean University, Shanghai 201306, China

A R T I C LE I N FO A B S T R A C T

Keywords: The present study was conducted to investigate the effects of dietary carbohydrate sources, α-cassava-starch,
Carbohydrate sources potato starch, pea starch and dextrin, on growth performance, glycogen accumulation, insulin signaling pathway
Growth and hepatic glucose metabolism in largemouth bass (initial body weight: 36.34 ± 0.30 g) for 11 weeks. Results
Feed utilization showed that pea starch significantly improved the specific growth rate (SGR), daily weight gain (DWG) and net
Glucose metabolism
fish yield (NFY) of largemouth bass compared to other starch, which maybe related to the depressed feed
Largemouth bass
conversion ratio (FCR). Meanwhile, fish fed the diet with pea starch obtained the minimum hepatic glycogen
content, which is significantly lower than that of α-cassava starch. The above result indicated that the fish was
more tolerant to pea starch than other carbohydrate sources in accordance with the result of postprandial
glucose content. The expression of insulin receptor (IR), insulin receptor substrate 1 (IRS1) and phosphoinositide
3-kinase regulatory subunit 1 (PI3KR1) was significantly up-regulated in fish fed the diet with pea starch than
others, indicating the significantly higher activity of insulin pathway in the pea starch group at least at the
transcription level. Meanwhile, pea starch led to a significantly increased expression of glucokinase (GK) and
liver-type 6-phosphofructokinase isozyme (PFKL), while dietary starch sources had no significant influence on
the expression of phosphoenolpyruvate carboxykinase (PEPCK) and fructose-1,6-bisphosphatase-1 (FBP1). The
improved glycolysis and poor inhibited gluconeogenesis may account for the reduced hepatic glycogen content
of pea starch. Therefore, pea starch was most suitable starch among the sources used for largemouth bass.

1. Introduction et al., 2002; Amoah et al., 2008).

Carbohydrate has been always widely used in aquafeed due to its
potential role in generating the least-cost formulation and reducing
catabolism of protein and lipid for energy (Stone, 2003), although fish
do not have a specific requirement for dietary carbohydrate (NRC,
2011). Starch, the principal carbohydrate component of grains, also
contribute to improving feed physical quality with good binding and
expansion properties (Sørensen et al., 2010). In fact, carnivorous fish
possess limited ability to utilize carbohydrate, and long-term intake of
excessive carbohydrate would result in abnormal hepatic glycogen ac-
cumulation along with prolonged postprandial blood glucose, which
might seriously affect the growth performance and even lead to pa-
thological conditions of cultured fish (Goodwin et al., 2002; Hemre
Starch mainly consists of amylose and amylopectin (Tester et al.,
2004). The amylopectin starch possesses much more surface area and
less intramolecular hydrogen bonds (Singh et al., 2010), and this
characterization of amylopectin make it easier to be digested than the
former one (Gominho-Rosa et al., 2015). Meanwhile, amylose has few
branches and could form resistant starch with complexed crystalline
structures that resist digestion and mimic dietary fiber (Berry, 1986).
Therefore, the ratio of amylose to amylopectin would impact the di-
gestibility of starch (Giuberti et al., 2015; Gominho-Rosa et al., 2015;
Liu et al., 2014). Additionally, the starch digestibility could be also
affected by different molecular complexity among starch sources
(Glencross et al., 2012; Yin et al., 2011). Previous studies in teleost has
also demonstrated that dietary starch sources would affect the growth

⁎
Corresponding author at: National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, No. 999, Hucheng Ring Road,
Lingang New City, Shanghai 201306, China.
E-mail address: nschen@shou.edu.cn (N. Chen).

https://doi.org/10.1016/j.aquaculture.2019.734391
Received 20 December 2018; Received in revised form 25 March 2019; Accepted 7 August 2019
Available online 08 August 2019
0044-8486/ © 2019 Elsevier B.V. All rights reserved.
S. Li, et al. Aquaculture 513 (2019) 734391

performance and glucose metabolism of some fish species (Gatesoupe Table 1

et al., 2014; Cui et al., 2010; Couto et al., 2017), while the results are Formulation and chemical composition of experimental diets (%dry matter).
often noncomparable and even contradictory. Therefore, it's essential to Ingredients Carbohydrate sources
seek the opportunity dietary sources to cope with the limited glucose
utilization of specified fish species. α-cassava- Potato Pea starch Dextrin
In mammals, the insulin pathway is mainly involved in regulating starch starch

glucose metabolism (Titchenell et al., 2017). Briefly, phosphoinositide Fish meala 48.0 48.0 48.0 48.0
3-kinase (PI3K) is recruited to insulin receptor substrates (IRSs) fol- Shrimp meala 4.0 4.0 4.0 4.0
lowing the incorporation of insulin and insulin receptors (IRs), and then Wheat gluten meala 6.0 6.0 6.0 6.0
Akt is phosphorylation activated to control multiple metabolic pro- Fermented soybean meala 9.0 9.0 9.0 9.0
Corn gluten meala 7.0 7.0 7.0 7.0
cesses involved in glucose metabolism (Titchenell et al., 2017). Mean-
Squid viscera meala 2.0 2.0 2.0 2.0
while, the insulin signaling pathway could be significantly affected by Brewer's yeast meala 2.0 2.0 2.0 2.0
dietary starch sources in mammals (He et al., 2010). Also, the structural Soybean phospholipid 2.5 2.5 2.5 2.5
properties of starch would affect the insulin response (Yin et al., 2011). Vitamin mixtureb 1.0 1.0 1.0 1.0
Mineral mixturec 1.0 1.0 1.0 1.0
Although the influence of carbohydrate sources on the growth perfor-
Ca(H2PO3)2 1.0 1.0 1.0 1.0
mance and glucose metabolism has been recently studied in fish, no Rapeseed oil 4.0 4.0 4.0 4.0
information was available on the response of insulin signaling pathway Starch 10.0 10.0 10.0 10.0
to dietary sources. Zeolite powder 2.5 2.5 2.5 2.5
Largemouth bass (Micropterus salmoides), a freshwater carnivorous Proximate analysis (Mean values, % dry weight)
species, has been widely cultured in China due to its fast growth, effi- Crude protein 52.54 52.26 52.51 52.40
cient feed conversion and high market value, and the total culture Crude lipid 10.01 10.64 10.22 11.02
Ash 13.54 13.27 13.30 13.14
production of China in 2017 was up to 457,000 tons (Yearbook, 2018).
Crude fiber 0.66 0.63 0.68 0.65
However, the extremely limited glucose utilization of this fish seriously Digestible Starch 11.38 11.39 12.27 11.22
restricts the use of aquafeed since excessive dietary carbohydrate would Resistant Starch 0.62 0.65 0.49 0.82
lead to abnormal hepatic glycogen, which may further impact the Gross energy (MJ/kg) 18.69 18.58 18.63 18.66
growth performance and health of this fish (Goodwin et al., 2002; a
Supplied by Nonghao Feed Corporation (Shanghai, China): white fish meal,
Amoah et al., 2008). Therefore, the present study was conducted to
crude protein, 72.59%, crude lipid, 9.50%; shrimp meal, crude protein, 69.62%,
investigate the effects of dietary carbohydrate, α-cassava-starch, potato
crude lipid, 8.06%; wheat gluten meal, crude protein, 83.52%; fermented
starch, pea starch and dextrin, on growth performance, feed utilization soybean meal, crude protein, 56.27%, crude lipid, 0.56%; corn gluten meal,
and glucose metabolism to filter out the opportunity dietary carbohy- crude protein, 68.34%, crude lipid, 8.21%; squid viscera meal, crude protein,
drate for largemouth bass. In addition, the response of insulin signaling 50.03%, crude lipid,37.08%; brewer's yeast meal, crude protein, 48.02%, crude
pathway to dietary carbohydrate sources was also investigated. lipid, 0.52%;
Vitamin Premix (mg kg−1 diet): vitamin A, 16000 IU; vitamin D3, 8000 IU;
b

2. Materials and methods vitamin K3, 14.72; vitamin B1, 17.80; vitamin B2, 48; vitamin B6, 29.52; vitamin
B12, 0.24; vitamin E, 160; vitamin C, 800; niacinamide, 79.20; calcium-pan-
2.1. Experimental diets and experimental proceduce tothenate, 73.60; folic acid, 6.40; biotin, 0.64; inositol, 320; choline chloride,
1500; L-carnitine, 100.
Mineral Premix (mg kg−1 diet): Cu (CuSO4), 2.00; Zn (ZnSO4), 34.4; Mn
c

Four isonitrogenous (52%) and isolipidic (10%) diets were for-

mulated to contain 10% α-cassava starch, potato starch, pea starch or
dextrin, respectively, which was provided by Yantai Shuangta Food Co.,
Ltd. Thereinto, fish meal, shrimp meal, fermented soybean meal and
corn gluten meal were used as major protein sources. Rapeseed oil and
soybean phospholipid were used as the main lipid sources (Table 1). All
the low-lipid ingredients were grounded through 75 μm mesh, and
thereafter mixed thoroughly according to the experimental formula.
After that, the mixed lipid ingredients, rapeseed oil and soybean
phospholipid, were blended with the above mixture. Thereafter, water
was added to produce a stiff dough, and the dough was extruded
through a 2.5 mm die by a pelleting machine (Xinchang Chenshi Me-
chanical Factory, Zhejiang Province, China). The extruded pellets were
cooked in an oven for the gelatinization of starch at 105 °C for 15 min,
and then dried in a ventilated oven at 55 °C. After that, the diets were
stored at −20 °C until used.
The experimental largemouth bass were obtained from a commer-
cial hatchery (Jiangsu, China) and reared in an indoor temperature-
controlled re-circulating freshwater system (Shanghai, China) for two
weeks' acclimation with feeding a commercial largemouth bass diet.
Then, the fish with similar size (average initial weight 36.3 ± 0.3 g)
were used as test fish and were distributed into 12 fiberglass cylindrical
tanks at a stocking density of 35 individuals per tank (water volume:
800 L) after being fasted for 24 h. Each diet was randomly assigned to
triplicate tanks, and the test fish were fed to apparent satiation twice
daily (8:00 and 16:00 h.) for 11 weeks. All excess and uneaten feed
pellets were collected after every meal for calculation of feed intake.
During the feeding trial, the water temperature was 27 ± 1 °C, and pH
was 7.2 ± 0.2. All tanks were provided with a continuous flow of sand-
(MnSO4), 6.20; Fe (FeSO4), 21.10; I (Ca (IO3)2), 1.63; Se (Na2SeO3), 0.18; Co
(COCl2), 0.24; Mg (MgSO4·H2O).
filtered freshwater (2.0 L min−1) and aeration (dissolved oxygen,
≥6 mg/L). The tanks were maintained under a natural photoperiod.
2.2. Sample collection
Twenty fish were randomly collected prior to the feeding trial and
stored at −80 °C for body composition analysis. During the feeding
trail, the weight of dead fish was recorded for the analysis of feed
utilization. At the end of the feeding trial, fish were anesthetized with
eugenol (1:10000) (Shanghai Reagent, China) after being fasted for
24 h, and the total number and body weight of fish in each tank were
recorded. Then, five fish per tank were randomly collected for body
composition analysis. Another fifteen fish out of thirty were collected to
measure the body weight and body length to analyze condition factor
(CF), and then heparinized syringes (1 mL) was used to obtain the blood
from the caudal vasculature of fish, which were centrifuged at 4000 ×g
for 10 min (4 °C) to obtain the plasma samples. After that, the viscera
and liver weight of four fish per tank were measured to calculate vis-
cerosomatic index (VSI) and hepatosmatic index (HSI), respectively.
Liver of six fish per tank was isolated and kept on ice pack, frozen in
liquid nitrogen immediately and stored at −80 °C for gene expression
analysis. The liver and muscle of another five fish per tank were sam-
pled for biochemical composition analysis. Eventually, the remaining
fish of each tank were fed the respective diet for another one week to
ensure blood samples of a normally metabolizing fish. Then, the blood

2
S. Li, et al. Aquaculture 513 (2019) 734391

Table 2
Growth performance and feed utilization of largemouth bass fed diets with different carbohydrate sources for 11 weeks.⁎
Index Carbohydate sources

α-cassava-starch Potato starch Pea starch Dextrin

Initial body weight (g) 36.31 ± 0.18 36.61 ± 0.56 36.39 ± 0.15 36.05 ± 0.30
Final body weight (g) 160.27 ± 2.64b 152.44 ± 2.10b 172.04 ± 0.04a 158.41 ± 2.94b
SR (%) 98.81 ± 2.06 97.61 ± 4.12 100.00 ± 0.00 94.05 ± 10.31
NFY (g/m3/d) 73.81 ± 1.21b 71.59 ± 2.45b 79.24 ± 0.02a 71.42 ± 2.84b
DWG (g/d) 1.63 ± 0.04b 1.57 ± 0.07b 1.79 ± 0.00a 1.57 ± 0.08b
SGR (%/d) 1.93 ± 0.01b 1.88 ± 0.02b 2.04 ± 0.01a 1.88 ± 0.04b
CF 2.48 ± 0.02 2.38 ± 0.07 2.46 ± 0.09 2.44 ± 0.05
HSI (%) 3.38 ± 0.54 3.35 ± 0.18 3.69 ± 0.58 3.72 ± 0.29
VSI (%) 8.69 ± 0.46ab 7.86 ± 0.25b 8.40 ± 0.38ab 9.27 ± 0.50a
FI (g/d) 39.03 ± 1.13 36.33 ± 1.79 38.63 ± 2.38 39.97 ± 0.64
FCR 0.81 ± 0.01ab 0.79 ± 0.04ab 0.77 ± 0.01b 0.90 ± 0.09a
PER 242.49 ± 2.03a 249.20 ± 1.17a 237.75 ± 1.60ab 222.98 ± 7.97b
PRR (%) 43.63 ± 0.30a 43.73 ± 0.28a 43.41 ± 0.56a 38.67 ± 1.40b
LRR(%) 61.63 ± 2.34ab 64.45 ± 3.88a 52.65 ± 1.32c 53.51 ± 1.33bc

⁎
Values (means ± SEM, n = 3) within a row with a common superscript letter are not significantly different from the other dietary groups (P > .05).

samples were collected at the 0, 1, 3, 6, 12 and 24 h time-points post
feeding, and then plasma was separated according to the above de-
scription for the analysis of postprandial plasma glucose content.
2.3. Chemical analysis
The moisture, ash and crude protein content of fish, feed or feed
ingredients was analyzed following the method described by AOAC
(2003). Moisture was determined by oven-drying samples to constant
weight at 105 °C. Crude protein was measured following the Kjeldahl
method (N × 6.25) (Kjeltec 2200, FOSS, Denmark), and ash was de-
termined by combustion in a muffle furnace to constant weight at
550 °C (AOAC, 2003). Crude lipid was determined following the
chloroform-methanol extraction method (Folch et al., 1957) according
to the description of Peng et al. (2014). Cellulose content was measured
with cellulose analyzer (FT12, Gerhardt, Germany). Hepatic glycogen
content was determined spectrophotometrically using the KOH/an-
throne method (Seifter et al., 1950) following the description of Li et al.
(2018). Plasma glucose content was analyzed spectrophotometrically
using glucose oxidase-peroxide enzyme (GOD-POD) method (Trinder,
1969).
2.4. RNA extraction and real-time quantitative PCR
Total RNA was extracted from isolated liver of largemouth bass
using Trizol Reagent (Takara, Japan) followed by quality measurement
on a 1.2% denaturing agarose gel and yield determination on
NanoDrop® ND-1000 (Wilmington, DE). Thereafter, first strand cDNA
was synthesized with Prime Script™ RT reagent Kit (Takara). Specific
primers used for RT-qPCR were designed using Primer Premier 5.0
(Premier Biosoft) based on the cloned nucleotide sequences (Table 4).
The stability of β-actin was verified and confirmed as the reference
gene. The amplification was conducted in a quantitative thermal cycler
(Mastercycler EP Realplex, Eppendorf, Germany). The program was as
follows: 95 °C for 2 min, followed by 40 cycles of 95 °C for 10 s, 57 °C for
10 s, and 72 °C for 20 s. At the end of each reaction, melting curve
analysis of amplification products was carried out to confirm the single
PCR product in these reactions. The relative expression of the target
genes was calculated according to the 2−ΔΔCt method (Livak and
Schmittgen, 2001).
2.5. Calculations and statistical methods
The following variables were calculated:
Survival rate (SR, %) = final fish number/initial fish
number × 100;
Specific growth rate (SGR, %/d) = (ln final body weight − ln initial
body weight) × 100/days;
Daily weight gain (DWG, g/d) = (final body weight − initial body
weight)/days;
Net fish yield (NFY, g/m3/d) = (final total body weight − initial
total body weight)/tank volume/days;
Feed intake (g/d) = (Feed offered − feed discarded or uneaten
feed)/days;
Feed conversion ratio (FCR) = dry feed consumed/(final body
weight − initial body weight);
Condition factor (CF, %) = final body weight (g)/length
(cm)3 × 100;
Hepatosmatic index (HSI, %) = liver weight/final body
weight × 100;
Viscerosomatic index (VSI, %) = viscera weight/final body
weight × 100;
Protein efficiency ratio (PER) = (final body weight − initial body
weight)/protein intake;
Nutrient retention rate (%) = (final body weight × final nutrient
content − initial body weight × initial nutrient content)/nutrient in-
take × 100;
The results were expressed as the mean ± standard error of the
mean (SEM). All data were subjected to one-way analysis of variance
(ANOVA) using SPSS 19.0 for Windows. Tukey's multiple range test was
chosen as multiple comparison test, and a significance level of 5% was
used.
3. Results
3.1. Growth performance
The SR was not significantly altered by dietary carbohydrate sources
(P > .05) (Table 2). Meanwhile, the final body weight and SGR of fish
fed the diet with pea starch was significantly improved than other
treatments (P < .05) (Table 2). The NFY and DWG followed the similar
pattern with SGR. Although significant differences were not observed in
CF and HSI of fish fed diets with different carbohydrate sources, but
dextrin led to a significant increase of VSI compared to potato starch
(P < .05) (Table 2).
3.2. Feed utilization
Although FI was not significantly altered by dietary carbohydrate
sources (P > .05), fish fed the diet with pea starch possessed a mark-
edly lower FCR than that of dextrin (P < .05) (Table 2). The dextrin
resulted in a significantly lower PER than other treatments (P < .05),

3
S. Li, et al. Aquaculture 513 (2019) 734391

Table 3
Proximate composition of largemouth bass fed diets containing different carbohydrate sources for 11 weeks.⁎
Index Carbohydate sources

α-cassava-starch Potato starch Pea starch Dextrin

Moisture (%) 67.91 ± 0.24 68.01 ± 0.25 67.10 ± 0.22 67.24 ± 0.23
Protein (%) 17.84 ± 0.80ab 17.72 ± 0.11ab 18.23 ± 0.12a 17.66 ± 0.19b
Lipid (%) 6.68 ± 0.09ab 7.12 ± 0.10ab 6.44 ± 0.26b 7.47 ± 0.30a
Ash (%) 13.56 ± 0.10 13.04 ± 0.26 13.62 ± 0.09 13.08 ± 0.26
Hepatic glycogen (mg/g) 107.21 ± 1.54a 103.77 ± 1.17ab 89.95 ± 2.31b 100.36 ± 0.76ab
Muscle glycogen (mg/g) 0.60 ± 0.13 0.60 ± 0.37 0.40 ± 0.05 0.37 ± 0.01

⁎
Values (means ± SEM, n = 3) within a row with a common superscript letter are not significantly different from the other dietary groups (P > .05).

and the PRR followed a similar pattern to the PER (Table 2). Mean- 12

while, the lipid retention rate (LRR) was also significantly affected by

Plasma glucose content (mM)

dietary carbohydrate sources (P < .05) (Table 2). The LRR of fish fed 10
-cassava-starch
the diet with pea starch was significantly lower than that of α-cassava- Potato starch
starch and potato starch (P < .05) (Table 2).
Pea starch
8
Dextrin

3.3. Body approximate composition 6

The moisture content and ash content of fish was not significantly
affected by dietary carbohydrate sources (P > .05) (Table 3). How- 4
0h 1h 3h 6h 12h 24h
ever, the fish fed the diet with pea starch obtained the highest value of
Time post feeding
crude protein content, and the lowest crude lipid content (Table 3). The
crude protein content of fish fed the diet containing pea starch was Time post feeding (h)
significantly higher than that of dextrin group (P < .05), and the crude 0 1 3 6 12 24
lipid followed an opposite pattern with crude protein (Table 3). The α- -cassava-starch B AB aA A aA B
cassava-starch led to a significantly higher hepatic glycogen content Potato starch B B abA A abAB B
than that of pea starch group (P < .05), while dietary carbohydrate Pea starch B B bA A bB B
sources had no significant influence on muscle glycogen content Dextrin B AB abA A bB B
(P > .05) (Table 3).
Fig. 1. Postprandial plasma glucose (0, 1, 3, 6, 12 and 24 h post feeding) of
largemouth bass fed diets containing different carbohydrate sources for
3.4. Postprandial glucose content 11 weeks. The same lower-case letters indicate no significant differences
(P > .05; Tukey's test) at sampling time points among the groups with different
carbohydrate sources, whereas the capital letters indicate no significant dif-
The plasma glucose content increased significantly after feeding,
ferences (P > .05; Tukey's test) at different sampling time within each treat-
and thereafter decreased to the normal level (Fig. 1). The plasma glu-
ment (N = 3).
cose content of fish fed the diet with α-cassava-starch did not return to
the basal level until the 24 h time-point post feeding, while 12 h for the
other treatments (Fig. 1). Meanwhile, the plasma glucose content was 3.5. Relative expression of insulin pathway and glucose metabolism related
not remarkably altered by dietary carbohydrate at the 0, 1 and 24 h genes
time-points post feeding (Fig. 1). However, the α-cassava-starch sig-
nificantly elevated the plasma glucose content compared to the pea The expression of insulin receptor (IR) was slightly elevated by pea
starch group at the 3 h time-point post feeding (P < .05) (Fig. 1). starch (P > .05) (Fig. 2). Meanwhile, pea starch led to a significant
Meanwhile, the plasma glucose content of fish fed the α-cassava-starch increase expression of IRS1 compared to the potato starch and dextrin
remained higher than that of pea starch and dextrin groups (P < .05) groups (P < .05) (Fig. 2). The expression of phosphoinositide 3-kinase
(Fig. 1). regulatory subunit 1 (PI3KR1) was significantly up-regulated by pea
starch compared to other treatments (P < .05) (Fig. 2). Meanwhile, no
significant difference was observed in the expression of AKT1 between

Table 4
Primers used in the present study.
Gene Forward sequence (5′-3′) Reverse sequence (5′-3′) Purpose

IR CATTTTGAGGGAACTGGGTC CTTGATGATGTCTTTAGCGA RT-qPCR

IRS1 TAGTGGTGGTGTCAGCGGT GGAGGTGGAAGTAAAGGAT RT-qPCR
PI3KR1 AAGACCTTCCTCATCACGAC CCTTCCACTACAACACTGCA RT-qPCR
AKT1 CTTAATTTACCGCCGAAAC CCTCCTTGACAATCACCAC RT-qPCR
GK GGGTTTTACCTTCTCCTTTC GGTGGCTACTGTGTCATTCA RT-qPCR
PFKL CTGGCTGAGCTCGTAAAG GTGCCGCAGAAGTCGTTG RT-qPCR
PK CTCTTTCATCCGCAAAGC AATTCCCAGGTCACCACG RT-qPCR
PEPCK GGAAACGGCCAACATTCT GCCAACCAGCAGTTCTCAT RT-qPCR
FBP1 GCGATTGGCGAATTTATC ACTCTGTGACGGCGGGTT RT-qPCR
G6PC AGAAAGCACAGAAGTGGTG CTTGGTCTCGGTGTAGAGG RT-qPCR
β-actin AAAGGGAAATCGTGCGTGAC AAGGAAGGCTGGAAGAGGG RT-qPCR

4
S. Li, et al.
2.5
2.0
Relative gene expression
a
1.5
b ab
b a
b b b
1.0
0.5
0.0
IR
Fig. 2. The expression of insulin pathway related genes in response to starch
sources of largemouth bass fed the diets containing different carbohydrate
sources for 11 weeks. Values (means ± standard error of the mean, SEM) in
bars that have the same letter are not significantly different (P > .05; Tukey's
test) among treatments (N = 3).
the α-cassava-starch and pea starch group (P < .05), but significantly
higher than other two treatments (P > .05) (Fig. 2).
The pea starch significantly up-regulated the expression of gluco-
kinase (GK) compared to the potato starch and dextrin groups
(P < .05) (Fig. 3). Meanwhile, the expression of liver-type 6-phos-
phofructokinase isozyme (PFKL) in the pea starch group was elevated
significantly compared to the dextrin group (P < .05) (Fig. 3). How-
ever, dietary starch had no significant influence on the expression of
pyruvate kinase (PK) (P > .05) (Fig. 3). Although dietary starch source
had no significant influence on the expression of phosphoenolpyruvate
carboxykinase (PEPCK) and fructose-1,6-bisphosphatase-1 (FBP1)
(P > .05), the pea starch significantly enhanced the expression of
glucose-6-phosphatase, catalytic subunit (G6PC) compared to other
treatments (P < .05) (Fig. 4).
4. Discussion
The good binding and expansion properties of starch make it es-
sential in improving feed physical quality (Sørensen et al., 2010).
However, the glucose intolerance of fish species, especially the carni-
vorous fish has been well illustrated (Stone, 2003; NRC, 2011), and the
long-term intake of high dietary starch commonly reduces the growth
performance and further leads to the injury of liver tissue (Amoah et al.,
2008; Goodwin et al., 2002). In fact, some characterizations of starch,
such as molecular complexity, physical state and inclusion content,
would affect both digestibility and efficient utilization of starch in fish
2.0
a omnivorous and herbivorous fish could utilize or tolerate much more
1.6
Relative gene expression
ab
1.2
b potato starch
0.8
b to amylopectin, would contribute to reducing the glucose stress on fish
0.4
0.0
GK
Fig. 3. The expression of glycolysis related genes in response to starch sources
of largemouth bass fed the diets containing different carbohydrate sources for
11 weeks. Values (means ± standard error of the mean, SEM) in bars that have
the same letter are not significantly different (P > .05; Tukey's test) among
treatments (N = 3).
Aquaculture 513 (2019) 734391
2.5
a
a 2.0
Relative gene expression
a
-cassava-starch
1.5
a -cassava-starch potato starch
b
b
potato starch pea starch
b 1.0
b b b pea starch b
b dextrin
dextrin
0.5
0.0
IRS1 PI3KR1 AKT1 G6PC FBP1 PEPCK
Gene Gene
Fig. 4. The expression of gluconeogenesis related genes in response to starch
sources of largemouth bass fed the diets containing different carbohydate
sources for 11 weeks. Values (means ± standard error of the mean, SEM) in
bars that have the same letter are not significantly different (P > .05; Tukey's
test) among treatments (N = 3).
feed (Peres and Oliva-Teles, 2002; Mohapatra et al., 2003; Sørensen
et al., 2010). Previous studies have demonstrated that the growth
performance of some fish, including Rohu, gilthead seabream and blunt
snout bream could be significantly affected by dietary starch sources
(Ren et al., 2015; Kumar et al., 2016; Couto et al., 2016). Similarly, the
pea starch significantly elevated the SGR, NFY and DWG of largemouth
bass than α-cassava starch, potato starch and dextrin in the present
study. However, the growth performance was not significantly affected
by dietary starch sources in African catfish (Leenhouwers et al., 2007)
and cobia (Cui et al., 2010). The above difference maybe related to fish
species, genotype and form of starch, inclusion level, as well as water
temperature and feeding strategies (NRC, 2011).
In the present study, the FI was not significantly altered by dietary
carbohydrate sources, while fish fed the diet with pea starch obtained
the highest FER, which is significantly higher than that of dextrin
group, and this may account for the elevated SGR in the pea starch
group. Starch is mainly composed of amylose and amylopectin (Tester
et al., 2004), and amylopectin is much easier to be digested than
amylose (Gominho-Rosa et al., 2015). Meanwhile, the content of re-
sistant starch is positively associated with amylose (Tester et al., 2004).
Therefore, the high ratio of amylose to amylopectin may lead to slow
digestion of starch, and this may contribute to improving the growth
performance of fish (Rawles and Lochmann, 2003; Liu et al., 2014). The
pea starch possesses higher ratio of amylose to amylopectin than other
starch, cassava starch, potato starch, and dextrin, in the present study,
and this may partly illustrate the growth promotion effect of pea starch.
In contrast, the increase ratio of amylose to amylopectin result in a
reduced growth performance of tilapia (Chen et al., 2013). In general,
ab a
carbohydrate than carnivorous fish species (Legate et al., 2001; Stone,
ab 2003; Polakof et al., 2012). The different glucose tolerance among
-cassava-starch different fish species may partly illustrate the above difference caused
by the ratio of amylose to amylopectin.
b
pea starch Generally, the slow digestion of starch, such as high ratio of amylose
dextrin
caused by postprandial starch load (NRC, 2011; Chen et al., 2013), and
the variation in postprandial glucose content of fish fed diets with
different carbohydrate sources in the present study confirmed the above
theory. The long-term intake of high dietary starch in fish usually lead
PFKL PK
Gene to a prolonged postprandial hyperglycemia and abnormal accumulation
of hepatic glycogen, and the glycogen content was also significantly
affected by dietary carbohydrate sources in some previous studies
(Couto et al., 2016; Liu et al., 2014; Rosenvold et al., 2001). In the
present study, although the muscle glycogen content was not sig-
nificantly affected by dietary carbohydrate sources, the hepatic
5
S. Li, et al.
glycogen of fish fed the diet with pea starch was significantly lower
than that of other treatments. The role of pea starch on reducing the
hepatic glycogen made it to be an appropriate starch source for large-
mouth bass. However, a significant elevated hepatic glycogen was ob-
served in tilapia as the ratio of amylose to amylopectin increased (Chen
et al., 2013), which is contrast to the result in the present study.
The expression of glucose metabolism related genes was conducted
to investigate the glycogen reduction effect of pea starch in the present
study. Numerous studies have shown that the increase of dietary starch
significantly promote the activity and gene expression of GK, which
catalyzes the initial step in utilization of glucose (Moreira et al., 2008;
Bou et al., 2014; Li et al., 2016). Meanwhile, the reduction expression
of HK was observed in golden pompano when dietary starch exceeded
its tolerance (Zhou et al., 2015). In the present study, the pea starch
lead to a significant increased expression of GK compared to dextrin,
indicating 10% dextrin probably near or exceed the tolerance threshold
for metabolic utilization of glucose in accordance with previous study
(Ma et al., 2019). Although the increase ratio of amylose to amylopectin
lead to a significantly reduced activity of GK in obscure puffer (Liu
et al., 2014), the normal maize starch, contains 25–28% amylose, lead
to a significantly elevated activity of GK than waxy maize starch, only
contains 1% amylose, in European starch (Enes et al., 2006). The dif-
ferent glucose tolerance of fish species may partly account for the dif-
ferent result. PFKL catalyzes the phosphorylation of fructose-6-phos-
phate into fructose-1,6-bisphosphate, and PK catalyzes the last step of
glycolysis, the conversion of phosphoenolpyruvate to pyruvate (NRC,
2011). In the present study, the expression of PFKL was marked up-
regulated by pea starch, while dietary carbohydrate sources possessed
no significant influence on the expression of PK. Previous study has
revealed that the inclusion of dietary starch was not significantly al-
tered the expression of PFKL and PK in golden pompano (Zhou et al.,
2015), while 30% galactose significantly decreased the activity of PFK
in common carp (NRC, 2011). The different regulation of glycolysis by
dietary starch source should be further investigated, and the induction
of glycolysis may account for the reduced hepatic content.
The poor inhibition of gluconeogenesis by dietary carbohydrate was
considered as one of the reasons for the glucose intolerance of carni-
vorous fish (Panserat et al., 2000, 2001a, 2001b; Zhou et al., 2016). In
the present study, the expression of PEPCK and FBP1 were not sig-
nificantly changed with dietary carbohydrate sources, while the pea
starch significantly elevated the expression of G6PC. The regulation of
the gluconeogenic pathway by dietary carbohydrate sources is still not
consistent. The activities of FBPase and G6Pase were not affected by
dietary carbohydrate source in European seabass (Enes et al., 2006),
while high ratio of amylose to amylopectin significantly decreased the
FBPase activity in obscure puffer (Liu et al., 2014). Meanwhile, the
maize starch lead to a significantly increased expression of FBP1 than
glucose and maltose in giant grouper (Lu et al., 2018). The different
response of fish to dietary carbohydrate sources should be further
clarified.
In mammals, the insulin pathway plays a vital role in regulating
glucose metabolism to avoid the accumulation of hepatic glycogen
(Titchenell et al., 2017). Meanwhile, dietary carbohydrate sources
could significantly affect the insulin pathway (He et al., 2010). How-
ever, it remains unclear whether this pathway could be affected by the
inclusion of different carbohydrate sources in fish species. In the pre-
sent study, the expression of IR, IRS1 and PI3KR1 was significantly up-
regulated by pea starch, and this indicated the high activity of insulin
pathway compared to other treatments at least at the transcription
level. In general, the activation of insulin pathway commonly leads to
the up-regulation of glycolysis and down-regulation of gluconeogenesis
in mammals (Titchenell et al., 2017). However, the glycolysis was im-
proved while the gluconeogenesis was not inhibited by pea starch in the
present study. This may indicate the activation of insulin pathway
cannot effectively regulate the gluconeogenesis pathway, which needs
further study to investigate.
6
Aquaculture 513 (2019) 734391
5. Conclusion
Pea starch performed better than other starch and was an appro-
priate carbohydrate sources for largemouth bass, which was beneficial
for the growth performance and feed utilization. Meanwhile, pea starch
possessed activated insulin pathway along with improved glycolysis
and poor inhibited gluconeogenesis, which may account for the reduced
hepatic glycogen content.
Acknowledgement
This work was financially supported by National Natural Science
Foundation of China (31802308) and China Agriculture Research
System (CARS-46).
References
Amoah, A., Coyle, S.D., Webster, C.D., Durborow, R.M., Bright, L.A., Tidwell, J.H., 2008.
Effects of graded levels of carbohydrate on growth and survival of largemouth bass,
Micropterus salmoides. J. World. Aquacult. S. 39, 397–405.
AOAC, 2003. Official Methods of Analysis, 17th edn. Assoc.Off. Anal. Chem., Washington,
DC, USA.
Berry, C.S., 1986. Resistant starch: formation and measurement of starch that survives
exhaustive digestion with amylolytic enzymes during the determination of dietary
fibre. J. Cereal Sci. 4 (4), 301–314.
Bou, M., Todorčević, M., Fontanillas, R., Capilla, E., Gutiérrez, J., Navarro, I., 2014.
Adipose tissue and liver metabolic responses to different levels of dietary carbohy-
drates in gilthead sea bream (Sparus aurata). Comp. Biochem. Phys. A 175, 72–81.
Chen, M.Y., Ye, J.D., Yang, W., Wang, K., 2013. Growth, feed utilization and blood me-
tabolic responses to different amylose-amylopectin ratio fed diets in tilapia
(Oreochromis niloticus). Asian Australas. J. Anim. Sci. 26, 1160–1171.
Couto, A., Peres, H., Oliva-Teles, A., Enes, P., 2016. Screening of nutrient digestibility,
glycaemic response and gut morphology alterations in gilthead seabream (Sparus
aurata) fed whole cereal meals. Aquaculture 450, 31–37.
Couto, A., Peres, H., Oliva-Teles, A., Enes, P., 2017. Nutritional value of whole cereal
meals for European sea bass (Dicentrarchus labrax) juveniles. Aquaculture 473,
128–134.
Cui, X.J., Zhou, Q.C., Liang, H.O., Yang, J., Zhao, L.M., 2010. Effects of dietary carbo-
hydrate sources on the growth performance and hepatic carbohydrate metabolic
enzyme activities of juvenile cobia (Rachycentron canadum Linnaeus.). Aquac. Res.
42, 99–107.
Enes, P., Panserat, S., Kaushik, S., Oliva-Teles, A., 2006. Effect of normal and waxy maize
starch on growth, food utilization and hepatic glucose metabolism in European sea
bass (Dicentrarchus labrax) juveniles. Comp. Biochem. Phys. A 143 (1), 89–96.
Folch, J., Lees, M., Sloane-Stanley, G.H., 1957. A simple method for the isolation and
purification of total lipids from animal tissues. J. Biol. Chem. 226, 497–509.
Gatesoupe, F.J., Huelvan, C., Le Bayon, N., Sévère, A., Aasen, I.M., Degnes, K.F.,
Mazurais, D., Panserat, S., Zambonino-Infante, J.L., Kaushik, S.J., 2014. The effects of
dietary carbohydrate sources and forms on metabolic response and intestinal mi-
crobiota in sea bass juveniles, Dicentrarchus labrax. Aquaculture 422, 47–53.
Giuberti, G., Gallo, A., Moschini, M., Masoero, F., 2015. New insight into the role of
resistant starch in pig nutrition. Anim. Feed Sci. Technol. 201, 1–13.
Glencross, B., Blyth, D., Tabrett, S., Bourne, N., Irvin, S., Anderson, M., Fox-Smith, T.,
Smullen, R., 2012. An assessment of cereal grains and other starch sources in diets for
barramundi (Lates calcarifer) implications for nutritional and functional qualities of
extruded feeds. Aquac. Nutr. 18 (4), 388–399.
Gominho-Rosa, M.C., Rodrigues, A.P.O., Mattioni, B., de Francisco, A., Moraes, G.,
Fracalossi, D.M., 2015. Comparison between the omnivorous jundiá catfish (Rhamdia
quelen) and Nile tilapia (Oreochromis niloticus) on the utilization of dietary starch
sources: digestibility, enzyme activity and starch microstructure. Aquaculture 435,
92–99.
Goodwin, A.E., Lochmann, R.T., Tieman, D.M., Mitchell, A.J., 2002. Massive hepatic
necrosis and nodular regeneration in largemouth bass fed diets high in available
carbohydrate. J. World Aquacult. Soc. 33, 466–477.
He, J., Chen, D.W., Yu, B., 2010. Metabolic and transcriptomic responses of weaned pigs
induced by different dietary amylose and amylopectin ratio. PLoS One 5 (11),
e15110.
Hemre, G.I., Mommsen, T.P., Krogdahl, Å., 2002. Carbohydrates in fish nutrition: effects
on growth, glucose metabolism and hepatic enzymes. Aquac. Nutr. 8, 175–194.
Kumar, S., Sahu, N.P., Pal, A.K., Kerepeczki, E., Sinha, A.K., Gal, D., 2016. Metabolic
fitness and growth performance in tropical freshwater fish Labeo rohita are modu-
lated in response to dietary starch type (gelatinized versus non-gelatinized) and water
temperature. Aquac. Nutr. 22, 966–975.
Leenhouwers, J.I., ter Veld, M., Verreth, J.A.J., Schrama, J.W., 2007. Digesta character-
istics and performance of African catfish (Clarias gariepinus) fed cereal grains that
differ in viscosity. Aquaculture 264, 330–341.
Legate, N.J., Bonen, A., Moon, T.W., 2001. Glucose tolerance and peripheral glucose
utilization in rainbow trout (Oncorhynchus mykiss), American eel (Anguilla rostrata),
and black bullhead catfish (Ameiurus melas). Gen. Comp. Endocrinol. 122 (1), 48–59.
Li, X.F., Xu, C., Zhang, D.D., Jiang, G.Z., Liu, W.B., 2016. Molecular characterization and
S. Li, et al.
expression analysis of glucokinase from herbivorous fish Megalobrama amblycephala
subjected to a glucose load after the adaption to dietary carbohydrate levels.
Aquaculture 459, 89–98.
Li, S., Li, Z., Sang, C., Zhang, J., Chen, N., 2018. The variation of serum glucose, hepatic
glycogen content and expression of glucose metabolism related genes in hybrid
grouper (female Epinephelus fuscoguttatus × male E. lanceolatus) in response to in-
traperitoneal insulin infusion. Fish. Sci. 84 (4), 641–647.
Liu, X.H., Ye, C.X., Ye, J.D., Shen, B.D., Wang, C.Y., Wang, A.L., 2014. Effects of dietary
amylose/amylopectin ratio on growth performance, feed utilization, digestive en-
zymes, and postprandial metabolic responses in juvenile obscure puffer Takifugu
obscures. Fish Physiol. Biochem. 40, 1423–1436.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408.
Lu, S., Wu, X., Gao, Y., Gatlin, D.M., Wu, M., Yao, W., Jin, Z., Li, X., Dong, Y., 2018.
Effects of dietary carbohydrate sources on growth, digestive enzyme activity, gene
expression of hepatic gluts and key enzymes involved in glycolysis-gluconeogenesis
of giant grouper Epinephelus lanceolatus larvae. Aquaculture 484, 343–350.
Ma, H., Mou, M., Pu, D., Lin, S., Chen, Y., Luo, L., 2019. Effect of dietary starch level on
growth, metabolism enzyme and oxidative status of juvenile largemouth bass,
Micropterus salmoides. Aquaculture 498, 482–487.
Mohapatra, M., Sahu, N.P., Chaudhari, A., 2003. Utilization of gelatinized carbohydrate
in diets of Labeo rohita fry. Aquac. Nutr. 9, 189–196.
Moreira, I.S., Peres, H., Couto, A., Enes, P., Oliva-Teles, A., 2008. Temperature and
dietary carbohydrate level effects on performance and metabolic utilisation of diets in
European sea bass (Dicentrarchus labrax) juveniles. Aquaculture 274, 153–160.
National Research Council (NRC), 2011. Committee on the Nutrient Requirements of Fish
and Shrimp, Nutrient Requirements of Fish and Shrimp. National Academies Press,
Washington, D.C., USA.
Panserat, S., Médale, F., Breque, J., Plagnes-Juan, E., Kaushik, S., 2000. Lack of significant
long-term effect of dietary carbohydrates on hepatic glucose-6-phosphatase expres-
sion in rainbow trout (Oncorhynchus mykiss). J. Nutr. Biochem. 11 (1), 22–29.
Panserat, S., Plagnes-Juan, E., Kaushik, S., 2001a. Nutritional regulation and tissue spe-
cificity of gene expression for proteins involved in hepatic glucose metabolism in
rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 204 (13), 2351–2360.
Panserat, S., Plagnes-Juan, E., Breque, J., Kaushik, S., 2001b. Hepatic phosphoenolpyr-
uvate carboxykinase gene expression is not repressed by dietary carbohydrates in
rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 204 (2), 359–365.
Peng, M., Xu, W., Mai, K., Zhou, H., Zhang, Y., Liufu, Z., Zhang, K., Ai, Q., 2014. Growth
performance, lipid deposition and hepatic lipid metabolism related gene expression
in juvenile turbot (Scophthalmus maximus L.) fed diets with various fish oil substitu-
tion levels by soybean oil. Aquaculture 433, 442–449.
Aquaculture 513 (2019) 734391
Peres, H., Oliva-Teles, A., 2002. Utilization of raw and gelatinized starch by European sea
bass (Dicentrarchus labrax) juveniles. Aquaculture 205, 287–299.
Polakof, S., Panserat, S., Soengas, J.L., Moon, T.W., 2012. Glucose metabolism in fish: a
review. J. Comp. Physiol. B. 182 (8), 1015–1045.
Rawles, S., Lochmann, R., 2003. Effects of amylopectin/amylase starch ratio on growth,
body composition and glycemic response of sunshine bass Morone chrysops ♀ × M.
saxatilis. J. World Aquacult. Soc. 34, 278–288.
Ren, M., Habtetsion, H.M., Xie, J., Liu, B., Zhou, Q., Ge, X., Pan, L., Chen, R., 2015. Effects
of dietary carbohydrate source on growth performance, diet digestibility and liver
glucose enzyme activity in blunt snout bream, Megalobrama amblycephala.
Aquaculture 438, 75–81.
Rosenvold, K., Petersen, J.S., Lwerke, H.N., Jensen, S.K., Therkildsen, M., Karlsson, A.H.,
Møller, H.S., Andersen, H.J., 2001. Muscle glycogen stores and meat quality as af-
fected by strategic finishing feeding of slaughter pigs. J. Anim. Sci. 79, 382–391.
Seifter, S., Dayton, S., Novic, B., Muntwyler, E., 1950. The estimation of glycogen with the
anthrone reagent. Arch. Biochem. 25 (1), 191–200.
Singh, J., Dartois, A., Kaur, L., 2010. Starch digestibility in food matrix: a review. Trends
Food Sci. Technol. 21 (4), 168–180.
Sørensen, M., Nguyen, G., Storebakken, T., Øverland, M., 2010. Starch source, screw
configuration and injection of steam into the barrel affect the physical quality of
extruded fish feed. Aquac. Res. 41, 419–432.
Stone, D.A., 2003. Dietary carbohydrate utilization by fish. Rev. Fish. Sci. 11, 337–369.
Tester, R.F., Karkalas, J., Qi, X., 2004. Starch-composition, fine structure and archi-
tecture. J. Cereal Sci. 39 (2), 151–165.
Titchenell, P.M., Lazar, M.A., Birnbaum, M.J., 2017. Unraveling the regulation of hepatic
metabolism by insulin. Trends Endocrinol. Metab. 28 (7), 497–505.
Trinder, P., 1969. Determination of blood glucose using an oxidase-peroxidase system
with a non-carcinogenic chromogen. J. Clin. Pathol. 22 (2), 158–161.
Yearbook, C.F.S., 2018. China Fishery Statistics Yearbook. Bureau of Fisheries, Ministry of
Agriculture, China Agriculture Press, Beijing, China, pp. 22.
Yin, F.G., Yin, Y.L., Zhang, Z.Z., Xie, M.Y., Huang, J., Huang, R.L., Li, T.J., 2011. Digestion
rate of dietary starch affects the systemic circulation of lipid profiles and lipid me-
tabolism-related gene expression in weaned pigs. Br. J. Nutr. 106, 369–377.
Zhou, C., Ge, X., Niu, J., Lin, H., Huang, Z., Tan, X., 2015. Effect of dietary carbohydrate
levels on growth performance, body composition, intestinal and hepatic enzyme
activities, and growth hormone gene expression of juvenile golden pompano,
Trachinotus ovatus. Aquaculture 437, 390–397.
Zhou, P., Wang, M., Xie, F., Deng, D.F., Zhou, Q., 2016. Effects of dietary carbohydrate to
lipid ratios on growth performance, digestive enzyme and hepatic carbohydrate
metabolic enzyme activities of large yellow croaker (Larmichthys crocea). Aquaculture
452, 45–51.