Maria Kala

IDM 2023

Exam III

November 1st, 2022

Due November 8th by 1:30pm

Reminder: Send an electronic copy to Dr. Frank Jenkins (fjenkins@pitt.edu) and place
your name in the title of the file.
 Maria Kala

1) As a second-year graduate student, you are interested in studying the role of gene X in the
recently discovered murine hepatitis Y virus-induced fulminant hepatitis (massive necrosis of the
liver) in mice, as Aim 1 of your thesis. The murine Y virus is closely related to the hepatitis B
virus; thus, understanding the mechanism of disease in a murine model could enabled a better
understanding of Fulminant hepatic failure (FHF) due to acute hepatitis B in humans. Upon
reviewing the literature, you learned that several groups reported that “gene X” knockout (loss of
function) mice are embryonic lethal; and your PI informed you that they also confirmed those
results prior to your arrival.

State the technology that you will employ to mitigate the embryonic lethality effect in mice, and
state your justifications for using said technology? (10pts)

R/ Cre-loxP system: which is a system used for knocking out genes as well as inducing gene
expression.
 Maria Kala

2) As a third-year graduate student, you have recently demonstrated that gene X is essential for
hepatitis Y virus-induced fulminant hepatitis in a mouse model. You also demonstrated that gene
X is essential for virus Y – induced necrosis in mouse hepatocytes in tissue culture. For the
second Aim of your thesis, you are interested in determining the essential genes involved in gene
X-necrotic signaling pathway in hepatitis Y virus-induced necrosis in murine hepatocytes. You
have approximately a year to carry out this experiment.

State the technology that you will employ to determine the other essential genes involve in gene
X-necrotic signaling in hepatitis Y virus infection of murine hepatocytes in tissue culture, and
state your justifications for using said technology as compared to alternative technologies?
(10pts)

R/ Crisper-cas 9 system: which is a system that

 Maria Kala

Questions 3 -5.

While you were working with primary human cells in culture, which usually only replicate for 10-14
passes, you observe a colony of cells that continue to divide and take over the culture as the rest of the
cells die off. Following some extensive work, you suspect that the cells contain a foreign DNA sequence
that may have a transforming gene. Your lab has now isolated a cloned EcoRI -EcoRI DNA fragment in
the EcoRI site of the pBR325 vector that is capable of doing the transforming. You job is to examine this
fragment in more detail. The first thing you do is send it out for DNA sequencing (sequence is below)
There are two large proteins that are “interesting”.

Present a report to your student peers to answer the following questions. In answering the questions show
your work-up in a format that would allow them to follow how you would manipulate the DNA, do the
subcloning, and test the proteins that might be doing the odd behavior. If at any stage you do PCR, show
how you develop the primers all the way to presenting the primers that you would order. Show any in-
frame protein-protein fusion joins that you make. Some marks are given for details on how you would
derive the oligonucleotides and how you develop your approach. Even if your final answer is wrong but
the approach is correct, you may score marks (if I can understand it). ANY STEPS using PCR must
show the primer sequences that you will order, and denoting the 5’ and 3’ ends.

Answers are to be submitted electronically by email, preferably as a word document or pdf format.

The insert sequence is

GAATTCcacgccgaatgagttcgagatcaagcgcagcgtcgacggggagggctacaacgt
ggcccaatgcaacataaccaaggactggttcctcgtccagatgctctcccactacaacat
cggctaccagggcttccacgtgcccgagggctacaaggaccgcatgtactcctttttccg
caacttccagcccatgagcaggcaggtggtggatgagatcaactacaaggactacaaggc
cgtcaccctgcccttccagcacaacaactctggcttcaccggctacctcgcacccaccat
gcgtcaggggcagccttaccccgccaacttcccttacccgctcatcggctccaccgcagt
cccctccgtcacccagaaaaagttcctctgcgacagggtcatgtggcgcatccccttctc
cagcaacttcatgtccatgggtgccctcaccgacctgggtcagaacatgctctatgccaa
ctcggcccacgcgctcgacatgaccttcgaggtggaccccatggatgagcccaccctcct
ctatcttctcttcgaagttttcgacgtggtcagagtgcaccagccgcaccgcggcgtcat
cgaggccgtctacctgcgcacacccttctccgccggcaacgccaccacctaagcatgagc
ggttccagcgaacgagaactcgcggccatcgtgcgcgacctgggctgcgggccctacttt
ttgggcacccacgacaagcgcttcccgggcttcctagccggcgacaagctggcctgcgcc
atcgtcaacacggccggccgcgagaccggaggcgtgcactggctcgccttcggctggaac
ccgcgctcgcgcacctgctacatgttcgacccctttgggttctcggaccgccggctcaag
cagatttacagcttcgagtacgaggccatgctgcgccgaagcgccctggcctcctcgccc
gaccgctgtctcagcctcgaacagtccacccagaccgtgcaggggcccgactccgccgcc
tgcggacttttttgttgcatgttcttgcatgcgttcgtgcactggcccgaccgacccatg
gacggaaaccccaccatgaacttgctgacgggggtgcccaacggcatgctacaatcgcca
caggtgctgcccacccggatcctccggcgcaaccaggaggagctctaccgcttcctcgcg
cgccactccccttacttccgatcccaccgcgccgccatcgaacacgccaccgcttttgac
aaaatgaaacaactgcgtgtatctcaataaacagcacttttattttacatgcactggagt
atatgcaagttatttaaaagtcgaaggggttctcgcgctcgtcgttgtgcgccgcgctgg
ggagggccacgttgcggtactggtacttggaaagccacttgaactcggggatcaccagtt
tgggcactggggtctcggggaaggtctcgctccacatgcgccggctcatctgcagggcgc
ccagcatgtcagggccggagatcttgaaatcacagttggggccggtgctctgcgcgcgcg
agttgcggtacacggggttgcagcactggaacaccatcagactggggtacttcacactgg
caagcacgctcttgtcgctaatggatccctgatccttgtccaggtcctcggcgttgctca
ggccgaacggggtcatcttgcacagctggcggcccaggaagggcacgctctgaggcttgt
 Maria Kala

ggttacactcgcagtgcacgggcatcagcatcatccccgcgccgcgctgcatattcgggt
agagggccttgacgaaggccgcgatctgcttgaaagcttgctgggccttggccccctcgc
tgaagaacagaccgcagctcttcccgctgaactggttattcccgcacccggcatcatgca
cgcagcagcgcgcgtcatggctggtcagttgcaccacgctccgtccccagcggttctggg
tcaccttagccttgctgggctgctccttcagcgcgcgctgtccgttctcgctggtcacat
ccatctccaccacgtggtccttgtgaatcatcaccgttccatgcagacacttgagctgac
cttccacctcggtgcagccgtgatcccacaggacgcagccggtgcactcccaattcttgt
gcgcgatcccgctgtggctgaaaatgtaaccttgcaacaggcgacccataatggtgctaa
atgatttctgggtggtgaatgtcagttgcatcccgcgggcctcctcgttcatccaggtct
ggcacatcttctggaagatctcggtctgctccggcatgagcttgtaagcatcgcgcaagc
cgctgtcgacgcggtagcgttccatcagcacgttcatggtatccatgcccttctcccatg
acgagaccagaggcagactcagggggttgcgcacgttcaggacaccaggggtcgcgggct
cgacgatgcgttttccgtccttgccttccttcaacagaaccggaggctggctgaatccca
ctcccacgatcacggcgtcttcctggggcatctcttcgtcggggtctaccttggtcacat
gcttggtctttctggcttgcttcttttttggagggctgtccacggggaccacgtcctcct
cggaagacccggagcccacccgctgatactttcggcgcttggtgggcagaggaggtggcg
gcggcgaggggctcctctcctgctccggcggatagcgcgccgacccgtggccccggggcg
gagtggcctctcgctccatgaaccggcgcacgtcctgactgccgccggccattgtttcct
aggggaagatggaggagcagccgcgtaagcaggagcaggaggaggacttaaccacccacg
agcaacccaaaatcgagcaggacctgggcttcgaagagccggctcgtctaaaacccccac
aggatgaacaggagcacgagcaagacgcaggccaggaggagaccgacgctgggctcgaac
atggctacctgggaggagaggaggatgtgctgctaaaacacctgcagcgccagtccctca
tcctccgggacgccctggccgaccggagcgaaacccccctcagcgtcgaggagctgtgtc
gggcctacgagctcaacctcttctcgccgcgcgtgccccccaaacgccagcccaacggca
cctgcgagcccaacccgcgtctcaacttctatcccgtctttgcggtccccgaggccctGa
attc

Question 3. 15 points

A Identify the most likely specific source of the DNA. What is the identity of the two proteins
encoded in the sequence and what are they from? Indicate exactly where the start and stop codons are
for each protein over 100 amino acids (5 points)

B. Without using any PCR methods, show me how you would theoretically make two new DNA
clones, cloning into the polylinker region of the routine cloning vector Puc19. Each DNA clone will
contain just one of the two open reading frames (ORFs) intact. The end result will be two clones,
one with a DNA fragment in which the large complete protein coding region is intact but the small
protein coding region disrupted or missing; The second clone will contain a DNA fragment that has
the small protein open reading frame sequence intact, but the large open reading frame sequence will
be disrupted. I want to know what you would digest the existing DNA clone with, and the sites in the
Puc19 vector you would insert the DNA fragment for each ORF into. Hint. 1. It must be in the
polylinker region of puc19 (2) the overhangs of the restriction cut vector and fragment must match.
(3) Each clone must have only one of the protein coding regions complete- the other open reading
frame must be missing or partially disrupted (4) YOU CANNOT USE any PCR methods (10 points)

Question 4. 15 points

A Detail how you would clone the small ORF gene into a suitable vector so it is expressed
as a GST-gene as an in-frame fusion (that is, a “GST-protein X” ) You can now use PCR for
 Maria Kala

this. GST vectors were detailed in part of the lecture and there are additional ones online. You
must detail which GST vector you use (7 points).

B Describe how you would clone the biggest protein coding region so that it is in frame as a
fusion to the GFP protein (so that it is protein Y-GFP fusion). You may use the vector pEGFP
N1 shown in class. Again, you may (and probably need to) Use PCR. What elements might
want to add or delete to the inserted DNA sequence? Show me the primers (8 points)

Question 5; 20 points

A. You now suspect that the effects on cells that were initially seen are mediated by a portion of the
big protein. Detail how you would express a part of the big protein from amino acids 36 to 117 in
cells of insect origin. You will need to research the web to find a commercially available vector
and system. In your answer, show me the vector polylinker that you are going to clone the
fragment into; Provide the vector name/system; the company that supplies it; and a web link.
Show what sites in the vector polylinker you would aim to clone the piece of the gene, and how
to generate the DNA fragment to go into the vector. You will have to use PCR- show me the
primers you would order (12 points)

B. The smaller protein has one methionine. Design a mutating primer that you would order that can
be used to mutate the first methionine of the small protein coding sequence in the puc 19 vector
to an alanine (or any other amino acid if you want to) instead of a methionine. (4 points)

C. (4 points) Present a short paragraph on the reasoning you would put forward to your boss for
using an expression system you think would be best to;
i. Express the small protein in mammalian epithelial cells in order to determine
which part of the cell the protein localizes to.
ii. How to easily purify significant amounts of the small protein in order to purify it
so you can make a lot, so you can then use the protein as an immunogen to make
antibodies to it.
 Maria Kala

Question 6 – Microfluidics (15pts)

You are studying the role of microglia on modulating neuron growth, and you want to dissect how
juxtracrine vs. paracrine signaling affects this process. Design an experiment using the three channel Aim
Biotech 3D chip (see figure below for an example coculture between endothelial cells and cancer cells –
and details in https://www.aimbiotech.com). You can mix cells with collagen type I hydrogel and
introduce the cells in the Collagen I region.

How would you design an experiment using microglia and axons to assess the role of paracrine
interactions?
a. In which channel would you introduce each cell type and why?
R/Media channel:….; Vessel channel: ….; Stromal cell channel:
b. How would you decide how many cells to seed in each channel?
R/
c. What technique would you use to assess if proliferation of neurons changes by coculture
with microglia cells?
R/
d. Now a collaborator asks you if you can detect the concentration of cytokines secreted by
microglia (TNF-α) in the microfluidic device: what technique could you use to measure
cytokines in the device?
R/
e. How could you design an experiment to address the question by the collaborator asks of
whether TNF-α secretion is affected by the presence of neurons?
R/
 Maria Kala

Question #7 – Computational modeling: Statistical and Mathematical Modeling (15 pts)

Statistical Modeling

In the following paper (https://pubmed.ncbi.nlm.nih.gov/32601199/) the relative protein expression in 4

breast cancer cell lines (labelled as 192, 202, 474 and 1954) was measured using reverse phase protein
arrays after treatment with lapatinib and is shown in the heatmap below. Conditions of breast cancer cell
monoculture (labeled as mono) and fibroblast coculture (labeled as occult).

a) What technique would you use to validate the measured changes of these proteins?
R/
b) You want to use a statistical approach to address if one of the proteins plotted in the heatmap
above associates with lapatinib resistance (e.g. the cancer cell growth-rate at the same dose used
to measure protein expression). You propose to use linear regression: what variables would you
use in your regression analysis? How would you assess if the regression is statistically
significant?
R/

c) Your labmate asks you to develop a predictive signature that includes multiple proteins as
predictors (a multivariate predictor). Why would a predictor with multiple proteins as
independent variables perform better than a predictor with a single protein? How would you
validate the result?
R/
 Maria Kala

Mechanistic Modeling

Now you have measurements of cancer cell and fibroblast numbers with time and you want to develop an
agent-based based model of tumor-fibroblast modeling that is shown in the figure below (Tumor cells:
green; Fibroblast: blue)

d) How could you use the agent-based model to help you design the next set of your experiments?

e) What are two assumptions of agent-based models that can affect how well your simulations
match the experimental results?