Professional Documents
Culture Documents
Science - 11 November 2022
Science - 11 November 2022
I
ran’s fundamentalist government has long feared academic community in North America condemned a
students and academics, because independent brutal attack on students and faculty at Sharif Univer-
thinking and inquiry are at odds with the extreme sity of Technology in Tehran.
rhetoric of a repressive religious regime that dis- As an Iranian female scientist in the United States,
courages questioning or testing—especially when I believe that all scientists have a distinct duty to
those asking questions are women. But when the recognize these attacks as an assault on education,
Iranian “morality police” beat 22-year-old Mahsa knowledge, and human rights; to speak out against in-
Navid Madani Amini to death in September for wearing “un-Islamic justices in the name of religion; and to give a voice to
clothing,” they unintentionally restored the long-silent students, scientists, and health care professionals liv-
is the founding
voices of Iranian students, scholars, and scientists. ing in oppressive societies. After finishing my doctoral
director of the
In the 1980s, Ruhollah Khomeini, founder of the dissertation in 1999, I returned to Iran to give a scien-
Science Health
Islamic Republic of Iran, described the great danger tific talk at an all-women’s university north of Tehran.
Education Center that university-educated people posed to the regime. Most attendees were young women pursuing scientific
at the Dana-Farber This philosophy was incongruous with Iran’s centu- training. Their eagerness and enthusiasm about scien-
Cancer Institute ries-long history as a beacon of science, philosophy, tific study convinced me that Iran was returning to its
(DFCI), Boston, and medicine. In the 11th century, roots as a nation that valued inquiry.
MA, USA. She is for example, the Iranian physician- But dismayingly, Iran’s students and
a lead scientist in philosopher Ibn Sina wrote about scholars are again willing to risk jail,
the Department of
Cancer Immunology
cancer metastasis for the first time in
human history. Subsequent advances
“How can torture, and death to pursue knowl-
edge. As I watch this uprising, I won-
and Virology at
DFCI and an affiliate
in medicine and science flourished
in the Iranian academic landscape.
scientists der if any of the young women I met
in 1999 are part of this revolution in
faculty member in
the Departments of
Khomeini’s words were a direct at-
tack on intellectuals, leading me
across the free some way, supporting the next gener-
ation of brave women who are fight-
Microbiology and
Global Health and
and other young scientists to leave
Iran and pursue professional careers
world…turn ing for change.
How can scientists across the free
Social Medicine
at Harvard
elsewhere.
Since the 1979 revolution, Iran’s
outrage world show solidarity and turn out-
rage into action? There is power in
Medical School,
Boston, MA, USA.
leadership has increasingly attacked
science and critical thinking, mak- into action?” numbers. The global scientific com-
munity can spread the word of this
ing the country’s brain drain among inhumanity by amplifying the voices
navid_madani@dfci.
the highest in the world. Pressure of the people in Iran through tradi-
harvard.edu
to conform to rigid, strictly enforced behavioral con- tional and social media and in scientific gatherings; by
straints falls heaviest on young people, especially signing the Amnesty International petition calling for
women. Those who speak against this are jailed, the United Nations Human Rights Council to hold Iran
abused, and murdered—just as Mahsa Amini was. accountable for the violence; and by supporting the
Despite these injustices, over 60% of Iranian women work of the Abdorrahman Boroumand Center for Hu-
are college graduates. Iran gave the world mathemati- man Rights in Iran, a nongovernmental and nonprofit
cian Maryam Mirzakhani—the first woman to win the organization that promotes democracy. Above all, sci-
Fields Medal—and Nobel Peace Prize–winning activist entists can help students in Iran continue to learn by
Shirin Ebadi. Iran has thousands more students and providing them online resources if their universities
young professionals eager to further their explorations cannot. As an example, my colleagues and I are cre-
of science and medicine. ating a Persian scientific curricula for university stu-
PHOTO: SAM OGDEN/DANA FARBER CANCER INSTITUTE
The ongoing public outrage sparked by Amini’s dents in subjects such as biochemistry and math so
senseless murder reflects people tired of watching au- that they can study while classes are shut down be-
thorities end their dreams with arbitrary violence. Re- cause of protests.
cently, a surgeon was shot and killed by security forces Scientists largely have stood by in silence for dec-
as her physician colleagues protested in front of the ades as Iran’s unique scientific heritage was deni-
Islamic Republic Medical Council. Indeed, infuriated grated. It’s time to speak up.
Iranians around the world are protesting Iran’s op-
pression of women. Last month, members of the global –Navid Madani
10.1126/science.adf6588
U
niversities are one of the oldest human institu- education by promoting more courses online and at sat-
tions, enduring with essentially the same blue- ellite community-college campuses. Science education,
print for a thousand years. Before the current with its need for collaboration, fieldwork, and hands-on
COVID-19 pandemic, there was much talk about exploration, presents special challenges. Nevertheless,
the promise of massive open online courses, dis- solutions are at hand. At Colorado College, students
tance learning, and other innovations to scale complete a lab science course in only 4 weeks, attend-
and expand the reach of universities, but with ing lectures in the morning and labs in the afternoon.
only limited success. Given the experience gained from This success suggests that US universities could offer Marcia McNutt
educating during the pandemic, it is time for educators 2-week short courses that include concentrated, hands-
is president of
to ask which innovations can be introduced and, impor- on learning and teamwork in the lab and the field for
the United States
tantly, sustained, to expand the accessibility of higher students who already mastered the basics through on-
National Academy
education to meet the needs of the 21st century. line lectures. Such an approach is more common in
Currently, 75% of new jobs require a college degree. European institutions of higher education and would of Sciences,
Yet in the US and Europe, only 40% of young adults at- allow even those with full-time employment elsewhere Washington, DC,
tend a 2-year or 4-year college—a percentage that has ei- to advance their skills during vacations or employer- USA. mmcnutt@
ther not budged or only modestly supported sabbaticals for the nas.edu
risen in more than two decades— purpose of improving the skills
despite a college education being of the workforce. Opportunities
one of the proven ways to lift the
socioeconomic status of under-
“…expansion… abound for partnerships with in-
dustry for life-long learning. The
privileged populations and boost
the wealth of nations. Worse, only
requires many young availability of science training in
this format could also be a boon
18% of that 40% receive degrees
in a STEM (science, technology,
adults to pull for teachers seeking to fill gaps in
their science understanding.
engineering, and mathematics)
discipline, although the fraction
up roots…while also State universities are leading
in experimentation in new for-
has been slowly rising over the
past decade. Depending on for-
working to mats. Arizona State University
has increased its engineering
eign STEM students from Asia to
fill the gap is not a viable solu- support a family.” majors by a factor of 5 to more
than 30,000 students in the past
tion. In the near future, workers 10 years, including 8500 online
in low-skill jobs without college learners. Lab skills are taught
degrees are at risk of being replaced by automation. during 2-week summer sessions. The degree conferred
In fact, improved access to additional training will be to online students is indistinguishable from that earned
a life-long need as the pace of innovation exceeds the by students completing a 4-year residential program.
duration of an individual career. And the complex chal- Ohio State University is providing more opportuni-
lenges that we face as a global society, including climate ties for education in sought-after technology fields by
change and unsustainable use of resources, demand a working with colleges across multiple states to reach
higher level of educational attainment for all, regard- students where they live.
less of job description. A university education may not be for everyone, but
A college education in the US is expensive, even at pub- at least we must make it more easily available to those
lic institutions, and it can take many years, if ever, to re- who would benefit without the traditional obstacles to
coup the cost through future earnings. Tuition, however, completing a 4-year residential program. By commit-
is not the main impediment. Enrollment of young adults ting to educating citizens throughout their lifetimes in
is stagnant even in nations where tuition is free. The big- a manner that respects the realities of income, work,
ger barrier to expansion appears to be the traditional col- family, culture, and community, universities will reach
lege residential program that requires many young adults their true potential as generators of the most precious
to pull up roots and move to a new location to pursue a of all resources: human capital, concentrated not just in
degree while also working to support a family. university towns but throughout the country.
Universities, without building additional facilities,
PHOTO: CHRIS MICHEL
10.1126/science.adf6263
CLIMATE SCIENCE
A
n orbiting fridge-size sensor that uses lasers GEDI measures the height of trees and the quality of
to map forest structure—key to understand- habitat they provide, information that its supporters
ing how much carbon trees sequester—is set say imaging satellites such as Landsat cannot provide.
to plummet to a fiery destruction in the atmo- In operation since April 2019, GEDI has identified the
sphere in 2023 unless NASA extends its tenure. parts of the Amazon rainforest that hold the most car-
Researchers and some U.S. Congress members bon, which could guide conservation efforts intended
are lobbying the agency to reconsider to minimize deforestation and the release of
its plan to jettison the Global Ecosystem A space-based laser carbon to the atmosphere. GEDI’s value has
helps create 3D images
Dynamics Investigation (GEDI) instrument of forests, improving
been constrained by a lack of ground data
from the International Space Station to make estimates of how much from locations such as China and Indonesia,
way for a Department of Defense sensor. carbon they store. which are necessary to calibrate its readings.
including those resistant to the fluoroqui- 2 weeks and recommended that all resi-
New antibiotic passes key hurdle nolones, the current front-line antibiotics. dents wear KN-95 masks. This year, NSF
D R U G D E V E L O P M E N T | A new antibiotic Gepotidacin is also being investigated as a relaxed its strict policies that had required
that represents an entirely novel chemi- treatment for gonorrhea. Bacteria would researchers to isolate before traveling
cal class has passed it first clinical test. likely need mutations in both targeted to Antarctica, but the agency’s vaccine
The drug, gepotidacin, cured urinary tract enzymes to dodge the drug, raising hopes mandate, which now requires a bivalent
infections (UTIs) so well in two large trials that resistance won’t develop easily. booster, remains in force. The outbreak
that researchers stopped them early. Its will likely upset summer fieldwork, much
IMAGE: NASA GODDARD SPACE FLIGHT CENTER
wards the past few weeks. On 1 November, Among the office’s 10 national laboratories, the cause of death would involve “mul-
Pfizer announced trial results showing its Oak Ridge is the biggest winner, receiving tiple teams” and could take months. That
maternal RSV vaccine—which generates 32% of the $1.55 billion. The office’s total has led many scientists to believe Horgan
antibodies that are passed on to newborns— budget is $7.45 billion. had indeed received a planned infusion
had nearly 82% efficacy against severe of viruses carrying DNA that coded for a
infection in the first 3 months of the component of the gene editor CRISPR. The
baby’s life and almost 70% over the first CRISPR therapy subject dies component was an enzyme called Cas9 that
6 months. The company will now seek C L I N I CA L R E S E A R C H | A 27-year-old man normally slices DNA but had been modified
regulatory approval. Three days later, the has died “while participating” in a novel to switch on Horgan’s gene for dystrophin,
European Commission greenlighted an gene-editing trial for his Duchenne muscular a muscle protein. High doses of the same
RSV-targeting antibody called nirsevimab, dystrophy, according to a foundation his type of modified virus have previously been
developed by Sanofi and AstraZeneca, family created to support the experimen- linked to severe immune reactions and
that can be directly injected into newborns. tal treatment. The foundation, Cure Rare one death in trials of a different therapy
A similar antibody is already approved for Disease, noted the death on 14 October but for Duchenne, in which the virus is used
infants at high risk of severe disease from did not explicitly confirm that the patient, to carry a replacement gene. Horgan died
RSV because of other conditions, but a phase Terry Horgan, received the treatment. In a about 6 weeks after the trial began at the
3 trial published this year suggests nirse- 1 November statement first reported by The University of Massachusetts Chan Medical
vimab might help all babies. (See a Science Associated Press, it said its investigation of School, according to ClinicalTrials.gov.
interview about the discoveries at https://
scim.ag/RSVvax.)
Most species of
harlequin frogs
NASA postpones Venus mission remain critically
P L A N E TA RY S C I E N C E | NASA said last week endangered.
it will delay the launch of its Veritas mission
to Venus by 3 years, to 2031, to allow the
agency to improve project management
after its Psyche spacecraft failed to meet its
launch window this summer. Psyche, which
will now launch in October 2023 to explore
an unusual metallic asteroid, suffered from
delays in the development and testing of
its flight software at the Jet Propulsion
Laboratory (JPL), NASA’s lead center for
robotic exploration of the Solar System. An
independent review commissioned by NASA
found JPL has broader problems, such as
technicians stretched across too many proj-
ects. Postponing Veritas, an orbiter that will
map Venus’s surface in fine detail, will free
up the staff needed to complete Psyche and CONSERVATION BIOLOGY
two multibillion-dollar projects, the Europa
Clipper and Mars sample return missions.
Frogs deemed extinct due to fungus live on
A
new analysis reveals that over the past 2 decades, scientists have rediscovered
one-third of the 87 species of harlequin frogs thought to have disappeared from
Energy agency divides windfall South and Central America since the 1950s because of a lethal fungus. The
F U N D I N G | ITER, the international
work supports hopes that extinctions of the tiny, colorful frogs in the Atelopus
fusion test reactor under construction in genus, which comprises 105 known species, were not as widespread as feared.
southern France, is the biggest winner But some of the rediscoveries are based on a single sighting, and collectively the
from an infusion of extra cash for the various species may be far from fully recovered, the researchers report this week in
U.S. Department of Energy’s research, the Biological Conservation. During the past 50 years, the chytrid fungus Batrachochytrium
agency’s Office of Science announced last dendrobatidis has caused population declines in hundreds of amphibian species,
researchers estimate, and harlequin frogs have been among the most severely affected.
PHOTO: MORLEY READ
GLOBAL HEALTH
By Gretchen Vogel that it is adding to the burden of malaria, Anopheles stephensi, a native of South Asia and the
which already kills half a million people in Arabian Peninsula, is spreading rapidly in Africa.
N
early a decade ago, the Republic of Africa each year, most of them children un-
Djibouti seemed on the cusp of elimi- der age 5. To better gauge the threat, WHO Researchers are still trying to gauge
nating malaria. The small country in launched a new initiative in September to the threat An. stephensi poses in Africa. A
the Horn of Africa saw only 27 cases step up surveillance for the species and 2020 study estimated that if the mosquito
in 2012. But between February and study its habits. spreads unchecked, 126 million people
May 2013, the disease surged, with A 2014 paper in Acta Tropica about the could be at increased risk of malaria. How-
1228 cases, followed in November 2013 Djibouti outbreak first reported that An. ever, “We don’t know very much about
by another wave of more than 2100 cases. stephensi, native to South Asia and the Ara- where it is and what the real contribution
Strangely, many people fell ill in the capital, bian Peninsula, had made the short jump to transmission is,” says Jan Kolaczinski, a
Djibouti City. In Africa, malaria is mostly a to Africa. The paper also raised the alarm medical entomologist at WHO. Epidemio-
rural problem. about what this might portend: Unlike logist Anne Wilson, who has been tracking
Far from being an anomaly, the outbreak most of the African mosquitoes that trans- the spread of An. stephensi in Sudan and
marked the arrival of a new threat: an inva- mit the malaria parasites, An. stephensi is a Ethiopia with her colleagues at the Liver-
sive mosquito, Anopheles stephensi, that ap- city dweller, which could explain the urban pool School of Tropical Medicine (LSTM),
pears to have reached Africa from Asia not cases—and made the mosquito’s arrival a notes that in some areas where An. ste-
long before the outbreak. Djibouti saw more “significant future health threat” for Africa, phensi has been found, malaria cases have
than 73,000 malaria cases last year, due at the researchers warned. not increased.
least partly to the mosquito. Last week, a An. stephensi is well-known across its To better understand the mosquito’s
study presented at the annual meeting of original habitat as an efficient malaria vec- role, molecular biologist Fitsum Tadesse
the American Society of Tropical Medicine tor, especially in cities. It can transmit both of the Armauer Hansen Research Institute
and Hygiene (ASTMH) in Seattle linked an parasites that cause most human malaria in Addis Ababa, Ethiopia, and colleagues
PHOTO: SINCLAIR STAMMERS/SCIENCE SOURCE
unusual malaria outbreak earlier this year cases, Plasmodium vivax and the deadlier tracked cases of malaria in Dire Dawa, a
in an Ethiopian city to the same culprit. An. P. falciparum. It thrives in artificial water city in the eastern part of the country that
stephensi has also been spotted in Sudan, sources such as cisterns and even deep had an unusual outbreak of more than
Somalia, and Nigeria, and it may lurk in wells, enabling it to stay active during dry 2400 cases during the first half of this year,
other countries as well. seasons. Its African cousins, such as An. in the dry season. (The city only had 205
“This is one of the biggest movements gambiae and An. funestus, tend to prefer cases in all of 2019.) They tested household
of a malaria vector that has taken place in rural environments and lay their eggs in members of 80 malaria patients and com-
the past 50 years,” says Seth Irish, a medi- puddles that in many countries only occur pared them with households of 210 people
cal entomologist at the World Health Orga- in the rainy season, resulting in a respite who did not have the disease. People living
nization (WHO). The evidence is growing from the disease during the rest of the year. with malaria patients were 5.6 times more
M
tomologist Hmooda Kafy of the University ark McCaughrean has been mov- a major public good, says Michael Bang
of Khartoum showed that An. stephensi oc- ing his online home in steps. Petersen, a political scientist at Aarhus Uni-
curred in 39 of 61 sites surveyed across the McCaughrean, who is an astrono- versity (@M_B_Petersen, 33,000 followers).
country. In some areas, 88% of households mer at the European Space Agency, “I believe it has played important roles in
had the mosquito in or near their homes. has had a profile on Twitter for many the dissemination of knowledge globally
Kenya, which has stepped up surveillance, years. In the spring, when Elon and between scientists and the public dur-
has not picked up the species yet but re- Musk first suggested buying the social media ing, for example, the pandemic.”
searchers are checking archived samples, platform used by nearly 240 million world- Still, with uncertainty about how Twit-
Solomon Karoki of the Kenyan Ministry wide, many were concerned. Musk calls him- ter will change under Musk, many of the
of Health said. Tadesse suspects the mos- self a “free speech absolutist” and promised thousands of medical and scientific experts
quito has spread farther than researchers to stop censoring accounts, raising fears that on the platform have started to look for al-
realize, possibly hitching rides in shipping Twitter would grow nastier and misinforma- ternatives or are considering giving up on
containers: “It’s likely you could find it in tion would drown out reasonable discourse. social media altogether. For a while the
all corners of the continent,” he says. But for McCaughrean, it was beyond that. “At hashtags #GoodbyeTwitter and #Twitter-
Although An. stephensi is well-adapted some level, I made a choice that I don’t want Migration were trending, and many re-
to city life, it also breeds in rural cisterns to support, personally, his ecosystem.” searchers have been posting their new
or wells, notes Sarah Zohdy, an entomo- Mastodon handles, encour-
logist at the U.S. Centers for Disease Control aging others to follow them
and Prevention and the U.S. President’s Ma- to the site, which has gained
laria Initiative. “We call it an urban vector, more than 500,000 new us-
but it’s really an everywhere vector,” she says. ers within days of Musk
The An. stephensi strains found in Af- completing his purchase.
rica are largely resistant to the most widely For the moment, most re-
used insecticides, and they seem to prefer searchers are waiting to see
to rest in barns or sheds rather than hu- what happens with Twit-
man homes, biting people when they are ter. “I’m hedging my bets
ILLUSTRATION: DRUG NARODA/SHUTTERSTOCK AND ANYAPL/SHUTTERSTOCK, ADAPTED BY BY C. SMITH/SCIENCE
M
tomologist Hmooda Kafy of the University ark McCaughrean has been mov- a major public good, says Michael Bang
of Khartoum showed that An. stephensi oc- ing his online home in steps. Petersen, a political scientist at Aarhus Uni-
curred in 39 of 61 sites surveyed across the McCaughrean, who is an astrono- versity (@M_B_Petersen, 33,000 followers).
country. In some areas, 88% of households mer at the European Space Agency, “I believe it has played important roles in
had the mosquito in or near their homes. has had a profile on Twitter for many the dissemination of knowledge globally
Kenya, which has stepped up surveillance, years. In the spring, when Elon and between scientists and the public dur-
has not picked up the species yet but re- Musk first suggested buying the social media ing, for example, the pandemic.”
searchers are checking archived samples, platform used by nearly 240 million world- Still, with uncertainty about how Twit-
Solomon Karoki of the Kenyan Ministry wide, many were concerned. Musk calls him- ter will change under Musk, many of the
of Health said. Tadesse suspects the mos- self a “free speech absolutist” and promised thousands of medical and scientific experts
quito has spread farther than researchers to stop censoring accounts, raising fears that on the platform have started to look for al-
realize, possibly hitching rides in shipping Twitter would grow nastier and misinforma- ternatives or are considering giving up on
containers: “It’s likely you could find it in tion would drown out reasonable discourse. social media altogether. For a while the
all corners of the continent,” he says. But for McCaughrean, it was beyond that. “At hashtags #GoodbyeTwitter and #Twitter-
Although An. stephensi is well-adapted some level, I made a choice that I don’t want Migration were trending, and many re-
to city life, it also breeds in rural cisterns to support, personally, his ecosystem.” searchers have been posting their new
or wells, notes Sarah Zohdy, an entomo- Mastodon handles, encour-
logist at the U.S. Centers for Disease Control aging others to follow them
and Prevention and the U.S. President’s Ma- to the site, which has gained
laria Initiative. “We call it an urban vector, more than 500,000 new us-
but it’s really an everywhere vector,” she says. ers within days of Musk
The An. stephensi strains found in Af- completing his purchase.
rica are largely resistant to the most widely For the moment, most re-
used insecticides, and they seem to prefer searchers are waiting to see
to rest in barns or sheds rather than hu- what happens with Twit-
man homes, biting people when they are ter. “I’m hedging my bets
ILLUSTRATION: DRUG NARODA/SHUTTERSTOCK AND ANYAPL/SHUTTERSTOCK, ADAPTED BY BY C. SMITH/SCIENCE
a virologist at Emory University with more accessing them should not come at a finan- WORKFORCE
than 22,000 Twitter followers. cial cost to users.”
Others worry the idea of “free speech”
will go too far. “While I agree with the im-
portance of free speech on social media, I
Some of these challenges may become
moot if Twitter simply fails as people leave
the platform. And although Twitter may
Scientists
also worry whether some of Musk’s rheto-
ric on the issue is taken by some users as a
relaxation of the norms governing Twitter
be a public good, it has never been a good
business: The company has had revenues
between $1 billion and $5 billion in recent
on trial after
interactions,” Petersen says. “We know from
research that the norms governing a social
media group do have an effect on the level
years, mostly from advertising, but it only
ever turned a profit in 2018 and 2019. Musk’s
attempts to make the business profitable
speaking out
of hostility in the group.”
Indeed, the use of racial slurs on the
again may well end up dooming the plat-
form, Bergstrom says. “I do think it’s a very
on harassment
platform spiked after Musk took over the real possibility that the whole thing collapses
platform, even though he has said the rules in a matter of months to a few years.”
Astrophysicist Christian Ott
have not changed. “If it becomes too toxic But there is a cost to leaving Twitter, too, filed a criminal complaint
and abusive, I will leave to preserve my says Casey Fiesler (@cfiesler, 24,000 fol-
well-being and consider other platforms,” lowers), an information researcher at the
after job offer withdrawn
Titanji says. University of Colorado, Boulder, who has
The problem of toxicity on the platform studied the migration of online communi- By Jeffrey Mervis
only adds to long-standing worries about ties. Perhaps the biggest practical consid-
A
Twitter’s leaders insufficiently protecting eration for the many researchers who have high-profile sexual harassment case
some groups of people, especially women built a large following on Twitter is that 7 years ago in California is now rever-
and people of color, from ha- the decision to move else- berating in Europe, with implications
rassment and abuse, says Devi
Sridhar, a global health expert
“Right now, I where means starting from
the ground up. “Some people
for those who speak out against the
unsavory academic practice of “pass-
at the University of Edin-
burgh. “They rarely acted on
still find it a have put a huge amount of
effort into building a follow-
ing the harasser.”
In February 2018, two astrophysicists at
reported tweets and there’s al- useful platform ing on Twitter,” Fiesler says. the University of Helsinki, Syksy Räsänen and
ways been abuse and threats “If I do leave, I’m not sure I’d Till Sawala, spearheaded an open letter from
on the platform.” Sridhar to follow move to Mastodon immedi- more than 70 Finnish astronomers and astro-
(@devisridhar, 323,000 fol-
lowers) says she will see how
colleagues and ately or just use this as a rea-
son to do less social media,”
physicists broadly condemning harassment
and discrimination. An accompanying press
things develop before decid- learn as well as Rasmussen says. release also expressed the group’s dismay
ing to jump ship. Even so, online migrations that Christian Ott, a U.S. astrophysicist who
Angela Rasmussen, a viro- to share.” tend to be gradual, Fiesler was suspended by and subsequently resigned
logist at the University of Sas- Angela Rasmussen, says. In one of her research from the California Institute of Technology
katchewan (@angie_rasmussen, University of projects, a participant de- (Caltech) after it found he had committed
411,000 followers), has been on Saskatchewan scribed it as akin to “watch- gender-based harassment, was about to start
the receiving end of such abuse. ing a shopping mall go slowly a job at Finland’s University of Turku.
But she notes that Twitter helped her find out of business.” But the speed at which Combined with similar protests by other
her current job and start some scientific col- academics are flocking to Mastodon has scientists, their actions had the desired ef-
laborations. “Right now, I still find it a use- surprised her. “Things are changing faster fect: Within days Turku rescinded its offer
ful platform to follow colleagues and learn than I thought even a week ago,” Fiesler and Ott never went to work at its Tuorla
as well as to share,” she says, adding that says. McCaughrean agrees. “I’m seeing in- Observatory. But next week, a district
she won’t leave Twitter as long as the good stitutions now joining [Mastodon], obser- court in Finland will decide whether the
outweighs the bad. “If the people who like vatories, institutes,” he says. For now, many two researchers went too far.
to tell me I’m a stupid/fat/ugly/old/unfuck- people will keep a dual presence, Fiesler Spurred by a complaint Ott filed with the
able/unloveable/compromised/corrupt/con- says; there are already programs that can police 8 months after losing the Turku job,
flicted/incompetent bitch get a free pass to automatically post on both platforms. For the Finnish government last year charged
say whatever without constraint or modera- a mass exodus to happen, “there has to Räsänen and Sawala with defaming Ott and
tion, the cost-benefit analysis would change be both a compelling reason to leave, and spreading information that violated his pri-
for me,” she adds. an immediate viable alternative option,” vacy. The two scientists face a substantial
Many researchers, whose tweets add she says. fine and a suspended prison sentence if
value to the platform for other users, also Even if academic Twitter ends up largely found guilty. The case is one of several legal
bristle at the idea of paying a subscription moving to Mastodon, the big question battles Ott has waged to clear his name, join-
fee to one of the world’s richest individu- is whether the general public will move ing other scientists who have turned to the
als. Twitter is also rolling out an optional there, too, allowing scientists to commu- courts after losing jobs or status because of
paid service that includes the blue check nicate with a broader audience. “When I harassment findings.
mark that signals a verified account and tweet, I’m talking to my neighbor and the In December 2017, days before Ott’s res-
fewer ads. “That will definitely push me person in the grocery store and the teen- ignation from Caltech took effect, the Uni-
out the door,” Titanji says. “As a matter of ager who is thinking about studying sci- versity of Stockholm’s Nordic Institute for
principle, I feel social media users are free ence in college,” Fiesler says. “That’s the Theoretical Physics offered him a short-term
content creators for these platforms and beauty of scientists on social media.” j appointment. But pushback from faculty
a virologist at Emory University with more accessing them should not come at a finan- WORKFORCE
than 22,000 Twitter followers. cial cost to users.”
Others worry the idea of “free speech”
will go too far. “While I agree with the im-
portance of free speech on social media, I
Some of these challenges may become
moot if Twitter simply fails as people leave
the platform. And although Twitter may
Scientists
also worry whether some of Musk’s rheto-
ric on the issue is taken by some users as a
relaxation of the norms governing Twitter
be a public good, it has never been a good
business: The company has had revenues
between $1 billion and $5 billion in recent
on trial after
interactions,” Petersen says. “We know from
research that the norms governing a social
media group do have an effect on the level
years, mostly from advertising, but it only
ever turned a profit in 2018 and 2019. Musk’s
attempts to make the business profitable
speaking out
of hostility in the group.”
Indeed, the use of racial slurs on the
again may well end up dooming the plat-
form, Bergstrom says. “I do think it’s a very
on harassment
platform spiked after Musk took over the real possibility that the whole thing collapses
platform, even though he has said the rules in a matter of months to a few years.”
Astrophysicist Christian Ott
have not changed. “If it becomes too toxic But there is a cost to leaving Twitter, too, filed a criminal complaint
and abusive, I will leave to preserve my says Casey Fiesler (@cfiesler, 24,000 fol-
well-being and consider other platforms,” lowers), an information researcher at the
after job offer withdrawn
Titanji says. University of Colorado, Boulder, who has
The problem of toxicity on the platform studied the migration of online communi- By Jeffrey Mervis
only adds to long-standing worries about ties. Perhaps the biggest practical consid-
A
Twitter’s leaders insufficiently protecting eration for the many researchers who have high-profile harassment case 7 years
some groups of people, especially women built a large following on Twitter is that ago in California is now reverberat-
and people of color, from ha- the decision to move else- ing in Europe, with implications for
rassment and abuse, says Devi
Sridhar, a global health expert
“Right now, I where means starting from
the ground up. “Some people
those who speak out against the un-
savory academic practice of “passing
at the University of Edin-
burgh. “They rarely acted on
still find it a have put a huge amount of
effort into building a follow-
the harasser.”
In February 2018, two astrophysicists at
reported tweets and there’s al- useful platform ing on Twitter,” Fiesler says. the University of Helsinki, Syksy Räsänen and
ways been abuse and threats “If I do leave, I’m not sure I’d Till Sawala, spearheaded an open letter from
on the platform.” Sridhar to follow move to Mastodon immedi- more than 70 Finnish astronomers and astro-
(@devisridhar, 323,000 fol-
lowers) says she will see how
colleagues and ately or just use this as a rea-
son to do less social media,”
physicists broadly condemning harassment
and discrimination. An accompanying press
things develop before decid- learn as well as Rasmussen says. release also expressed the group’s dismay
ing to jump ship. Even so, online migrations that Christian Ott, a U.S. astrophysicist who
Angela Rasmussen, a viro- to share.” tend to be gradual, Fiesler was suspended by and subsequently resigned
logist at the University of Sas- Angela Rasmussen, says. In one of her research from the California Institute of Technology
katchewan (@angie_rasmussen, University of projects, a participant de- (Caltech) after it found he had committed
411,000 followers), has been on Saskatchewan scribed it as akin to “watch- gender-based harassment, was about to start
the receiving end of such abuse. ing a shopping mall go slowly a job at Finland’s University of Turku.
But she notes that Twitter helped her find out of business.” But the speed at which Combined with similar protests by other
her current job and start some scientific col- academics are flocking to Mastodon has scientists, their actions had the desired ef-
laborations. “Right now, I still find it a use- surprised her. “Things are changing faster fect: Within days Turku rescinded its offer
ful platform to follow colleagues and learn than I thought even a week ago,” Fiesler and Ott never went to work at its Tuorla
as well as to share,” she says, adding that says. McCaughrean agrees. “I’m seeing in- Observatory. But next week, a district
she won’t leave Twitter as long as the good stitutions now joining [Mastodon], obser- court in Finland will decide whether the
outweighs the bad. “If the people who like vatories, institutes,” he says. For now, many two researchers went too far.
to tell me I’m a stupid/fat/ugly/old/unfuck- people will keep a dual presence, Fiesler Spurred by a complaint Ott filed with the
able/unloveable/compromised/corrupt/con- says; there are already programs that can police 8 months after losing the Turku job,
flicted/incompetent bitch get a free pass to automatically post on both platforms. For the Finnish government last year charged
say whatever without constraint or modera- a mass exodus to happen, “there has to Räsänen and Sawala with defaming Ott and
tion, the cost-benefit analysis would change be both a compelling reason to leave, and spreading information that violated his pri-
for me,” she adds. an immediate viable alternative option,” vacy. The two scientists face a substantial
Many researchers, whose tweets add she says. fine and a suspended prison sentence if
value to the platform for other users, also Even if academic Twitter ends up largely found guilty. The case is one of several legal
bristle at the idea of paying a subscription moving to Mastodon, the big question battles Ott has waged to clear his name, join-
fee to one of the world’s richest individu- is whether the general public will move ing other scientists who have turned to the
als. Twitter is also rolling out an optional there, too, allowing scientists to commu- courts after losing jobs or status because of
paid service that includes the blue check nicate with a broader audience. “When I harassment findings.
mark that signals a verified account and tweet, I’m talking to my neighbor and the In December 2017, days before Ott’s res-
fewer ads. “That will definitely push me person in the grocery store and the teen- ignation from Caltech took effect, the Uni-
out the door,” Titanji says. “As a matter of ager who is thinking about studying sci- versity of Stockholm’s Nordic Institute for
principle, I feel social media users are free ence in college,” Fiesler says. “That’s the Theoretical Physics offered him a short-term
content creators for these platforms and beauty of scientists on social media.” j appointment. But pushback from faculty
pending the judge’s decision. But in their tion, according to a letter provided by Ott. [Ott] because he was a man and the com-
testimony, they said they were simply speak- Ott would regain regular faculty status at the plainants are women.”
ing out on an important issue facing their start of the 2017–18 academic year, Harrison That complaint never moved forward, Ott
profession. “It is the duty of every member wrote on 27 April to the National Science told Science last week, although he says OCR
of the scientific community to prevent ha- Foundation, which was funding some of his officials suggested he contact another federal
rassment,” Räsänen told the judge. “When a research. Ott would “work on his research agency that handles allegations of employ-
harasser can simply move to another institu- projects, including interacting with students ment discrimination. (OCR doesn’t comment
tion,” Sawala wrote in the 2018 press release, and postdocs,” Harrison wrote. Caltech de- on the status of complaints.) “But I decided
“it is a slap in the face of individuals who suf- clined to comment on her letters. against it at the time,” Ott says, “because
fer harassment.” But that wasn’t the final chapter. On 1 Au- Caltech had promised to reinstate me.” j
AGRICULTURE
By Erik Stokstad commercially available to Chinese farmers. tal area planted in 2020 quadrupled to
But how many times PR23 could be har- 15,333 hectares last year. (That’s still a tiny
G
rains that grow year after year with- vested before its yield dropped was unclear, fraction of China’s 27 million hectares of rice.)
out having to be replanted could save as was the size of any economic and envi- The government also helped promote the
money, help the environment, and ronmental benefits. So Fengyi Hu, a geneti- crop, Hu says. This year, PR23 is on a list of
reduce the need for back-breaking cist and agronomist at Yunnan University, 29 varieties recommended to farmers by Chi-
labor. Now, the largest real-world and others organized longer experiments. na’s Ministry of Agriculture and Rural Affairs.
test of such a crop—a perennial rice They arranged with farmers in three loca- The largest beneficiary of the labor sav-
grown in China—is showing promise. Pe- tions to plant the rice and harvest it twice a ings will likely be women and children, who
rennial rice can yield harvests as plentiful year for 5 years. do most of the transplanting of rice seed-
as the conventional, annually planted crop Over 4 years PR23 averaged 6.8 tons of rice lings in many rice-growing countries, says
while benefiting the soil and saving small- per hectare, slightly more than annual rice, Len Wade, an agricultural ecologist at the
holder farmers considerable labor and ex- they report this week in Nature Sustainabil- University of Queensland, St. Lucia, who
pense, researchers have found. ity. As hoped, the perennial crop grew back helped test the rice variety. Mothers will
“This is the first robust case study” of pe- again and again without sacrificing the size have more time to “look after the family
rennial rice, says Sieglinde Snapp, a soil and of the harvest. In the fifth year, however, the and get the children to school with break-
crop scientist at the International Maize and yields of PR23 declined, suggesting it needed fast and not exhausted,” he says. Farmers
Wheat Improvement Center who was not to be replanted. could also plant abandoned fields and grow
involved with the work. The results show Compared with annual rice, the crop left more rice, or they might earn more income
the crop is “a potential game changer,” adds more nutrients in the soil, which also held in side jobs like construction.
Clemens Grünbühel, an ecological anthropo- water better, an important trait for rice Still, researchers note potential risks. Be-
logist at the Australian Centre for Interna- grown in regions that depend on rainfall. By cause PR23 enables farmers to till less, fungi
tional Agricultural Research who studies next year, Hu says, the researchers hope to and other pathogens can build up in the
agriculture and rural development. But know how much greenhouse gas perennial fields. Insects can persist in the stubble after
whether it will catch on is hard to predict, rice farming emits. Existing paddy-grown harvest, then transmit viruses to the regen-
says Susan McCouch, a rice geneticist at Cor- rice is a major source of methane, for ex- erating sprouts in the spring. And without
nell University, because seasonal replanting ample, which contributes to global warming. tilling, weeds can flourish. Researchers also
still has some advantages over the new crop. But is the new rice good for farmers? To note that it’s more work to resow the peren-
All rice is to some extent perennial, find out, the researchers compared the ef- nial rice when its yield falters, because its
sprouting new stems after harvest. The fort involved in cultivating PR23 and the larger and deeper roots need to be killed.
trouble is that this second growth doesn’t annual varieties. Fuel for plowing, the seed- The potential benefits—and downsides—
PHOTO: WANG ZHENG VCG/GETTY IMAGES
yield much grain, which is why farmers lings themselves, and other costs were basi- of the crop will soon come into sharper
plow up the paddies and plant new seed- cally the same the first year, typically $2600 focus. The perennial rice is being tried in
lings. The improved perennial rice, in con- per hectare. But for each following year the 17 countries in Asia and Africa. A major tar-
trast, grows back vigorously for a second perennial rice cost half as much to man- get is uplands in Asia, where plowing for
harvest. Researchers developed it by cross- age. Each hectare also took between 68 and conventional rice in small, terraced fields
ing an Asian variety of rice with a wild, pe- 77 fewer days of labor. hastens soil erosion.
rennial relative from Nigeria. Improving the The rice is catching on in southern China. The creators of PR23 “have a proof of
offspring took decades, and in 2018 a vari- Yunnan University has provided seed and concept,” Snapp says. “I hope that there’s
ety called Perennial Rice 23 (PR23) became training to outreach workers, and the to- some momentum building.” j
ARCHAEOLOGY
By Andrew Curry Spindler credited the shallow stone gully ments. Radiocarbon dates from grass, dung,
where hikers found the iceman with shield- moss, and other organic material from the
I
n 1991, hikers in the Alps came across a ing him from the relentless flow of glacial bottom of the gully are younger than Ötzi’s
sensational find: a human body, partly ice just a few meters above. The ice must body, an indication that the site was open
encased in ice, at the top of a moun- have remained intact until a warm sum- to the air. “This idea he was frozen in a time
tain pass between Italy and Austria. mer in 1991 melted it away, exposing the capsule isn’t right,” Pilø says.
Police initially assumed the man had mummy. “The general understanding was That undercuts the idea that a climate
died in a mountaineering accident, but that Ötzi marked this beginning of a cooler shift or cold period set in 5100 years ago,
within weeks archaeologists were arguing period,” Huss says, “as people were sure that enclosing the body in ice that stayed intact
he was actually the victim of a 5100-year- [he] must have been within the ice without for millennia. “I’ve myself made this case in
old murder. interruption since his death.” courses with students—which I will need to
They were right: Later dubbed Ötzi af- But with the retreat of glaciers and revise,” Huss says.
ter the Ötztal Valley nearby, the man’s ice patches around the world over the Periodic exposure could also explain why
body is the oldest known “ice mummy” past few decades, other ancient remains the upper parts of Ötzi’s body—particularly
on record. His physical condition, equip- have emerged, including bodies, hunting the back of his head and his fur cape—are
ment, and violent death— partially decomposed, whereas
confirmed when scans revealed the lower parts are intact. “If he
an arrowhead embedded in his had been immediately buried in
shoulder—have opened a win- ice he would have been better
dow into life in prehistoric Eu- preserved,” Pilø says.
rope. But Ötzi’s preservation may Nor was Ötzi quickly buried
not be as unusual as it seemed, where he died, the authors sug-
archaeologists argued this week. gest. “There’s no way he could
And that could mean more bodies have died in the gully,” Pilø says.
from the distant past are waiting Instead, his missing and scat-
to emerge as the climate warms tered belongings, some found
and ice melts. 6 meters away, suggest he died
Ötzi “was such a huge sur- on the spring snow above the
prise when he was found people gully and was later washed into
thought he was a freak event,” it by meltwater.
says Lars Pilø, an archaeologist That scenario—and not a fight
working for the Oppland County before the mortally wounded vic-
Glacier Archaeological Program in tim fled to higher ground—may
Norway. But many of the original explain the damaged equipment.
assumptions about how weather, The iceman was found in a gully, still partly embedded in ice. Ancient skis, arrowheads, and
climate, and glacial ice conspired hunting equipment discovered in
to preserve him were wrong, Pilø and other equipment, horse manure, and skis. “No Norway, Canada, and elsewhere also show
researchers write in the journal The Holocene. one expected similar sites,” says Thomas breakage and wear. The similarities suggest
“This paper sheds new light on the inter- Reitmaier, an archaeologist at the Archaeo- shifting ice, or the tumbling of Ötzi’s body
pretation of this exceptional archaeological logical Service of the Canton of Grisons in and equipment by meltwater, splintered or
find,” says Matthias Huss, a glaciologist at Switzerland and a co-author of the new snapped the artifacts.
ETH Zürich who was not part of the team. study. “Now, we have lots, and we find this The new analysis suggests the iceman’s
The first archaeologist on the scene one fits quite well with the picture of glacial dramatic death, shot in the back with an
30 years ago was a researcher at the nearby archaeology we’ve developed.” arrow, remains the most unusual aspect of
University of Innsbruck named Konrad Many of the lucky accidents thought to the find. “What is unique—so far—is there
PHOTO: LEOPOLD NEKULA SYGMA/GETTY IMAGES
Spindler. Stunned by the body’s remarkable have preserved Ötzi never happened, the was a person shot up there and preserved,”
preservation, he came up with a plausible researchers concluded after re-evaluating Pilø says.
explanation. Damage to Ötzi’s backpack and some 30 years of research on the site and Even that could change. Evidence from
other equipment led Spindler, who died in its famous occupant. For example, recent other sites in the Alps now suggests moun-
2005, to suggest he was fleeing a conflict analyses by other researchers of seeds and tain passes were often border lines and
and had taken refuge in the mountains late leaves on and around the body point to a conflict zones between prehistoric groups.
in the year. After dying on a high mountain death in spring rather than fall, perhaps “There’s a chance similar sites have pre-
pass, he was quickly covered by winter snow. leaving Ötzi’s body partially exposed in served parts of human corpses,” Reitmaier
A climate shift soon sent temperatures snow over an Alpine summer. says. “We have to stay keen in the next
plunging for centuries or longer, preserving In the centuries that followed, the authors years, because ice patches are melting very
the body in an icy glacial “time capsule.” argue, he was repeatedly bared to the ele- rapidly everywhere.” j
FEATURES
SOLAR ENERGY
GETS FLEXIBLE
As ultrathin organic solar cells hit new efficiency records,
researchers see green energy potential in surprising places
I
n November 2021, while the munici- By Robert F. Service space for exploration,” says Stephen Forrest,
pal utility in Marburg, Germany, was an OPV chemist at the University of Michi-
performing scheduled maintenance on into building facades, windows, and even in- gan, Ann Arbor.
a hot water storage facility, engineers door spaces. “We want to change every build- Even when labmade OPVs look promis-
glued 18 solar panels to the outside of ing into an electricity-generating building,” ing, scaling them to create full-size panels
the main 10-meter-high cylindrical tank. Birnstock says. remains a challenge, but the potential is
It’s not the typical home for solar panels, Heliatek’s panels are among the few OPVs enormous. “Right now is a really exciting
most of which are flat, rigid silicon and in practical use, and they convert about 9% of time in OPVs because the field has made
glass rectangles arrayed on rooftops or the energy in sunlight to electricity. But in re- huge leaps in performance, stability, and
in solar parks. The Marburg facility’s panels, cent years, researchers around the globe have cost,” says Bryon Larson, an OPV expert at
by contrast, are ultrathin organic films made come up with new materials and designs that, the National Renewable Energy Laboratory.
by Heliatek, a German solar company. In the in small, labmade prototypes, have reached
past few years, Heliatek has mounted its flex- efficiencies of nearly 20%, approaching sili- CONVENTIONAL SOLAR POWER—mostly
ible panels on the sides of office towers, the con and alternative inorganic thin-film solar based on silicon—is already a green energy
curved roofs of bus stops, and even the cy- cells, such as those made from a mix of cop- success, supplying roughly 3% of all elec-
lindrical shaft of an 80-meter-tall windmill. per, indium, gallium, and selenium (CIGS). tricity on the planet. It’s the biggest new
The goal: expanding solar power’s reach be- Unlike silicon crystals and CIGS, where re- source of power being added to the grid,
yond flat land. “There is a huge market where searchers are mostly limited to the few chem- with more than 200 gigawatts coming on-
classical photovoltaics do not work,” says Jan ical options nature gives them, OPVs allow line annually, enough to power 150 million
Birnstock, Heliatek’s chief technical officer. them to tweak bonds, rearrange atoms, and homes. Backed by decades of engineering
Organic photovoltaics (OPVs) such as He- mix in elements from across the periodic ta- improvements and a global supply chain,
liatek’s are more than 10 times lighter than ble. Those changes represent knobs chemists its price continues to drop.
PHOTO: HELIATEK
silicon panels and in some cases cost just half can adjust to improve their materials’ ability But solar and other green energy sources
as much to produce. Some are even transpar- to absorb sunlight, conduct charges, and re- aren’t growing nearly fast enough to meet
ent, which has architects envisioning solar sist degradation. OPVs still fall short on those growing demand and forestall catastrophic
panels not just on rooftops, but incorporated measures. But, “There is an enormous white climate change. Between the march of
global economic development, population on roll-to-roll machines such as newspaper By contrast, the molecules in organic semi-
growth, and the expected shift of much of presses would make devices cheap enough conductors tend to hold onto their charges
the world’s cars and trucks from petroleum to be useful despite their shortcomings. But more tightly. When OPVs absorb sunlight,
to electricity, the world’s electricity demand poor efficiency and degradation under relent- there’s enough energy to kick an electron
is expected to double by 2050. According to less sunlight doomed the early models. “The out of its atomic orbit, but not enough for
the latest estimates from the International excitement was there but it was a little too the positive and negative charges to split up
Energy Agency, to achieve global net zero early,” Larson says. and move their separate ways. Rather, these
carbon emissions by 2050, countries must Part of the difficulty in raising OPV opposite charges stick to each other, creat-
install renewables at four times the current efficiencies—then as now—is that they work ing what is known as an exciton. To gener-
pace, a challenge the agency calls “formida- differently from cells made from inorganic ate electricity, the excitons must be separated
ble.” The world needs new sources of renew- materials, such as silicon. All solar cells are into positive and negative charges that can
able power, and fast. sandwichlike devices, with semiconductors travel to their respective electrodes.
OPV advocates don’t see the technology in the middle that absorb photons and con- The moment of separation comes when
replacing conventional silicon panels for vert that energy to electrical charges, which excitons move and encounter an interface
most uses. Rather, they see it helping usher then migrate to metallic electrodes layered between two semiconducting components,
in a wave of new applications and ultimately above and below. When sunlight strikes sili- called donor and acceptor materials. The ac-
putting solar in places silicon panels won’t con cells, the added energy kicks electrons ceptor attracts electrons, and the donor at-
work. The field got its start in 1986 when out of their orbits around individual silicon tracts the positive holes, pulling the exciton
plastic film experts at the Eastman Kodak atoms, freeing them to flow through the ma- apart. It needs to happen quickly: If the ex-
Company produced the first OPV, which was terial. Each excited electron leaves behind cited electron and hole happen to combine
only 1% efficient at converting the energy in an electron vacancy, also known as a “hole,” with each other before they can reach that
sunlight to electricity. But by the early 2000s, which carries a positive charge. The positive interface, they often release their original jolt
fiddling with the chemical knobs had pushed charges flow to a negatively charged elec- of excitation as heat, wasting it.
OPV efficiencies up to about 5%, enough for trode (the cathode), whereas the electrons Over the decades, OPV researchers have
several companies to try to commercialize flow to a positively charged electrode (the sought to improve the performance of
them. Their hope was that printing panels anode), creating an electric current. their devices by coming up with improved
Holee
Hol – Ac
c
Acceptor
e– e– + e–
Sunlight kicks + Each ejected
E Organic
anic Interleaved
electrons out of electron compounds
pou
pounds hold
hold “donor” and
their atomic
the e– e– leaves behind tightlyy onto e– – “acceptor”
orbits. The
orb + a positively electrons,
ctrons
ons, soo + – materials pull
electrons travel
ele charged “hole,” sunlight
light onlyy Exciton e– the excitons apart,,
too the anode, – +
e– which travels provides enough ugh e– allowing the
+ +
then through an
the to the cathode, energy to crea
create
atee charges to travel
external
exx wire to where it excitons—bound
bound to their respective
the cathode. e– recombines with pairs of electrons
ctrons
ons e– electrodes.
Electron
an electron. and holes.
Donor
CATHODE CATHODE
donors and acceptors. Work through the enes were good at grabbing and transport- pushed its efficiency up to 18.4%. And in
mid-2000s pushed the efficiency above 5%, ing electrons, they were lousy at absorbing August, Zhan Lingling at Hangzhou Nor-
mainly by incorporating soccer ball–shaped sunlight. On a molecular level, Zhan’s new mal University and her colleagues reported
carbon compounds called fullerenes into compound, dubbed ITIC, looked like an in Advanced Energy Materials that an OPV
the materials. The fullerenes’ hunger for extended Olympic symbol with extra rings, based on a similar multicomponent strategy
electrons makes them powerful acceptors. and it did both jobs well, first absorbing red achieved 19.3% efficiency. “The progress has
For the next decade, the action shifted to and infrared light and then transporting been really impressive,” says Jean-Luc Brédas,
the donors. By 2012, a series of novel semi- electrons once excitons split. an OPV expert at the University of Arizona.
conducting polymers used as donors pro- Zhan’s first NFA device was only about “Twenty percent will be reached soon.”
pelled efficiencies to 12%. 7% efficient. But chemists around the globe
Then the field suffered a double blow. quickly began to tweak ITIC’s structure, pro- THAT WOULD BRING OPV cells within a few
First, progress plateaued as researchers ducing improved versions. By 2016, new NFAs percentage points of their CIGS and silicon
struggled to find the next breakthrough pushed OPV efficiency to 11.5%. By 2018, they rivals. Still, few market watchers believe
material. Then a rival thin-film solar hit 16%. And the records keep coming. Last OPVs will compete head-to-head with silicon
technology, called perovskites, burst on the year, Larson and his colleagues reported in anytime soon. Silicon solar cells already com-
scene. Perovskites are blends of organic Nature Communications that by combining mand an $85-billion-a-year market, with a
and inorganic compounds that are cheap to multiple donors, an NFA, and a fullerene in 30-year track record and proven durability.
make, easy to process, and great at captur- a single layer, they created a material that In contrast, OPVs remain niche products.
ing sunlight and turning it into electricity. enabled excitons to live longer, and whisked Cheaper OPVs, such as the Heliatek devices,
While OPV progress stalled, the efficiency holes more quickly to their electrode, which are hampered by low efficiencies, and more
of perovskites skyrocketed from about 6.5% efficient ones are still experimental and
in 2012 to about 24% in 2020. “Perovskites costly. So, for now, Forrest says, it’s best for
were a stick of dynamite dropped into the OPV manufacturers to target new markets
OPV world,” Larson says. Funding agencies where silicon isn’t suitable. “If you’re compet- CREDITS: (GRAPHIC) V. ALTOUNIAN/SCIENCE; (PHOTO) UBIQUIT
bailed on OPVs and researchers flocked to ing against silicon, go home, you’ve already
the hot upstart. “Perovskites were a band- lost,” he says.
wagon you simply had to be on,” says Karl One fast-growing use is plastering the
Leo, an OPV researcher at the Technical energy-generating films on the sides of
University of Dresden. buildings. CIGS and other inorganic thin
Today, perovskites remain hot. But chal- films can be used the same way. But demand
lenges with long-term stability and their re- for Heliatek’s panels is brisk enough that
liance on toxic elements have sapped some even though the company only began to sell
enthusiasm. Meanwhile, OPVs soon got a them last year, it is already building a fac-
burst of innovation of their own. tory capable of producing 2 million square
In 2015, researchers led by Xiaowei Zhan, meters (m2) annually, enough to provide
a materials scientist at Peking University, Transparent organic photovoltaics are incorporated roughly 200 megawatts of power. Mean-
reported the first of a new class of non- into the glass facade of the Biomedical and Physical while, a Swedish company called Epishine
fullerene acceptors (NFAs). Although fuller- Sciences Building at Michigan State University. sells OPVs that work indoors and can replace
interface between the donor and acceptor the morphology changes over time and the emitted in making, operating, and eventu-
regions to separate the charges. The con- performance doesn’t hold up,” Armistead ally disposing of them. That’s compared with
tinuous networks also allow the opposite says. NFAs are especially susceptible, because 49 kg of CO2/kWh for silicon panels, and a
charges to flow along their own paths to the the best ones consist of small molecules that whopping 1008 kg of CO2/kWh for mining
electrodes, with electrons cruising through can easily shift through the material. and burning coal. Even with their low effi-
the network of acceptors and holes moving Replacing the NFAs with acceptors woven ciencies, Heliatek’s panels will generate more
through the donors. into long polymers to help keep them in place than 100 times the energy it takes to make
The intertwining ribbons of donors and could help. “They have the chance to be very and deal with them over their life span.
acceptors must be extremely thin, because robust,” Armistead says. Progress is on the OPVs’ carbon footprint is sure to lighten
excitons created when photons strike the ma- march here as well. In the 18 August issue of further as their efficiency continues to set
terial can only migrate about 20 nanometers Advanced Materials, researchers led by Alex new records, lifetimes climb, and produc-
before the charges recombine and the op- Jen, a materials scientist at the University of tion methods advance. Those trends are
portunity to generate electricity is lost, says Hong Kong, reported all-polymer solar cells buoying hopes of a world where solar power
Zhenan Bao, a chemist at Stanford Univer- that had an efficiency of 17% and retained spreads not only across rooftops and des-
sity. “You have to get the morphology right,” 90% of their efficiency under accelerated ag- ert scrubland, but also along the curved
Armistead says. Doing so reliably, on a large ing tests. “That is quite notable,” says Bao, facades of skyscrapers, the windows of the
scale, remains a challenge. whose team also works on all-polymer cells. world, and just about anywhere else people
He and others are encouraged by a study Yet, stability and high efficiency still won’t are looking for a bit of juice. That could
published on 27 October in Nature Energy be enough. To make it in the market, solar make prospects for addressing climate
by Jie Min, an OPV expert at Wuhan Univer- cells also need to prove reliable for decades. change just a little bit brighter. j
Merging supermassive
black hole binaries, as
shown in the artist depiction,
should contribute to a
PERSPECTIVES gravitational wave background.
ASTRONOMY
By Chiara M. F. Mingarelli1,2 and the Parkes Pulsar Timing Array (PPTA) (3), in each pulsar—hence, the more pulsar pairs
J. Andrew Casey-Clyde1 and the International Pulsar Timing Array that can be observed, the lower the noise
(IPTA) (4) have all detected a low-frequency and the larger the signal. The smoking gun
G
ravitational waves are ripples in the noise in their pulsar data, which may be the of the GWB is the Hellings and Downs curve
fabric of spacetime that are caused by first hint of the GWB (see the figure). (5), for which we expect the recently detected
events such as the merging of black The common, low-frequency noise (also red noise to eventually conform to a specific
holes. In principle, many types of called red noise) that the PTAs have mea- functional form (see the figure).
events occur that could create gravi- sured could be due to the cosmic population Although strong evidence exists for a com-
tational waves with frequencies rang- of slowly evolving SMBHBs. These SMBHBs mon red-noise process (or low-frequency sig-
ing from as high as a few kilohertz to as low create gravitational waves with periods of nal) in all the NANOGrav, PPTA, EPTA, and
as a few nanohertz. Sources of gravitational years to decades in their inspiral phase, the IPTA pulsars, little evidence has been found
waves in the nanohertz frequency range in- time in the binary’s evolution leading to so far for the Hellings and Downs curve.
clude cosmic strings, quantum fluctuations the final merger. This inspiral time scale is Whereas Goncharov et al. (6) concluded after
from the early Universe, and, notably, super- very long: A typical equal-mass (1 × 109 so- a series of simulations that some common, or
massive black hole binaries (SMBHBs). Some lar mass) SMBHB observed with a frequency similar, red noise originating in pulsars could
gravitational wave sources are so numerous of 1 nHz is 25 million years from merging. mimic the common red noise generated by
that they are all expected to contribute to a Indeed, these mergers take so long that they a GWB, Romano et al. (7) showed that the
gravitational wave background (GWB). This should create a stochastic (or random) GWB detection of a common red-noise process
GWB has been the target of pulsar timing ar- as a result of the incoherent superposition should be expected before the Hellings and
rays (PTAs) for decades. of potentially tens of thousands of gravita- Downs spatial correlations. If the correlated
IMAGE: OLENA SHMAHALO FOR NANOGRAV
PTAs use the correlations between dozens tional wave signals. The GWB signal induces red noise that is seen in all PTAs truly is a
of pulsar pairs to observe the GWB. Recently, delays and advances in the time that it takes GWB, then detection should be expected
the North American Nanohertz Observatory for pulses from millisecond pulsars to reach with 2 to 5 more years of data (8).
for Gravitational Waves (NANOGrav) (1), the Earth. This signal can be extracted by cross- Notably, a nanohertz GWB sourced by
European Pulsar Timing Array (EPTA) (2), correlating the residuals—the difference be- SMBHBs would indicate that the long-
tween the expected and the actual arrival standing final parsec problem—where the
1
Department of Physics, University of Connecticut, time—of pulsar pairs in the PTA. The noise in SMBHs stall at 1 pc of separation before
Storrs, CT 06269-3046, USA. 2Center for Computational
Astrophysics, Flatiron Institute, New York, NY 10010, USA. each pulsar should be independent, whereas they efficiently emit gravitational waves—is
Email: chiara.mingarelli@uconn.edu the GWB signal should be a common signal solved. Having the system stall at a ~1-pc gap
Correlation function
0.4
times larger than that in the one predicted by 0.3
for finding possible electromagnetic counter-
Mingarelli et al. (11). This either signifies that parts to the SMBHB mergers, and facilities
0.2
Mingarelli et al. (11) were too conservative in such as the next-generation Very Large Array
their mass and merger rate estimates or that 0.1 (ngVLA) will be critical for imaging nearby
perhaps the merger models need an addi- 0.0 gravitational wave host galaxies.
tional level of sophistication, for example, gas –0.1 The detection of the GWB may be immi-
and binary eccentricity, which could in turn –0.2 nent, and as such, a new low-frequency era
increase the number of expected SMBHBs. 0 20 40 60 80 100 120 140 160 180 of GW astronomy is at hand. Assuming that
Although the focus is on SMBHBs because Angular separation of pulsar pairs (°) the GWB is astrophysical, its detection will
of their expected presence in the PTA fre- The expected correlation pattern induced by a GWB is
likely cast aside any remaining doubt that
quency range, other sources are possible. A called the Hellings and Downs curve, which has SMBHs do eventually merge. Moreover, it
network of cosmic strings, the existence of this specific functional form. Each pulsar pair will appear will yield insights into the expected number
which has never been directly demonstrated, as a single point on this correlation curve; hence, a density of SMBHBs as a function of redshift,
credible detection requires a vast number of pulsar
is another potential source of a GWB. A third the volume enclosing the GWB, and the min-
pairs. At present, very little evidence of this curve exists
source, a GWB of primordial origin, would in any published pulsar timing array (PTA) dataset. imum mass of a SMBHB that contributes to
provide evidence of an ekpyrotic Universe, the background (10). All these values are fun-
where the Big Bang is eventually followed by Common process damental properties of SMBHBs on which
a Big Crunch. It is not known for sure how Hints of this background show up as low-frequency there are extremely limited observational
long it will take to distinguish between dif- noise, found in PTAs. Evidence for a common process constraints (which also come from PTAs). At
ferent sources, but Pol et al. (8) showed that (CP) red-noise signal in PTA data is highlighted by data present, PTA datasets span about 15 years,
release (DR) 2 from the International PTA (IPTA), which
at the time of an initial detection of spatial incorporates only 9 years of North American Nanohertz
and with 5 more years of data, it should be
correlations in pulsar pairs with a signal- Observatory for Gravitational Waves (NANOGrav) possible to measure a low-frequency turn-
to-noise ratio of three, current PTAs should data. Combining European PTA (EPTA) and Parkes PTA over in the GWB strain spectrum due to the
have the capability to distinguish a SMBHB (PPTA) data is equivalent to getting three additional presence of, for example, gas and stars sur-
years of NANOGrav (NG) data.
from at least some such exotic sources. rounding the cosmic population of SMBHBs
Once the GWB is detected, the next task Data at lower frequencies (8). Underlying all of this exciting astrophys-
show a CP signal rising
is to make maps of it, akin to the cosmic mi- –5.0 from the baseline ics will be IPTA datasets formed by combin-
crowave background. For instance, individ- –5.5 ing data from all the major PTAs, substan-
No CP signal
log10 [CP delay (s)]
ual nearby SMBHB systems and potentially –6.0 at higher tially increasing detection prospects for all
large-scale structures could contribute to or frequencies nanohertz gravitational wave sources. j
–6.5
trace the anisotropy in the GWB (12). Indeed, –7.0 REF ERENCES AND NOTES
GWB anisotropy may enable us to constrain
–7.5 1. Z. Arzoumanian et al., Astrophys. J. Lett. 905, L34 (2020).
the cosmic population of SMBHBs. Moreover, 2. S. Chen et al., Mon. Not. R. Astron. Soc. 508, 4970 (2021).
–8.0
it will be interesting to see where the aniso- 3. B. Goncharov et al., Astrophys. J. Lett. 917, L19 (2021).
tropic (excess) power on the sky originates –8.5 4. J. Antoniadis et al., Mon. Not. R. Astron. Soc. 510, 4873
–9.0 (2022).
and whether this can be associated with 5. R. W. Hellings, G. S. Downs, Astrophys. J. 265, L39 (1983).
10–9 10–8
SMBHB activity. However, obtaining upper- Frequency (Hz) 6. B. Goncharov et al., Astrophys. J. Lett. 932, L22 (2022).
limit maps of GWB anisotropy may be chal- 7. J. D. Romano, J. S. Hazboun, X. Siemens, A. M. Archibald,
IPTA DR2 (2019) NG 12.5yr (2020) Phys. Rev. D 103, 063027 (2021).
lenging because the distribution of pulsars in 8. N. S. Pol et al., Astrophys. J. Lett. 911, L34 (2021).
the sky is itself anisotropic, thwarting the use EPTA 6PSR (2021) PPTA DR2 (2022) 9. T. Ryu, R. Perna, Z. Haiman, J. P. Ostriker, N. C. Stone, Mon.
of the usual spherical harmonics (13). Not. R. Astron. Soc. 473, 3410 (2018).
–13.5 Spectral index of a 10. J. A. Casey-Clyde et al., Astrophys. J. 924, 93 (2022).
Counterintuitively, detecting continuous supermassive black hole 11. C. M. F. Mingarelli et al., Nat. Astron. 1, 886 (2017).
gravitational waves from individual inspiral- –14.0 binary merger 12. C. M. F. Mingarelli, T. Sidery, I. Mandel, A. Vecchio, Phys.
ing SMBHB systems by PTAs is possible but Rev. D Part. Fields Gravit. Cosmol. 88, 062005 (2013).
–14.5 13. Y. Ali-Haïmoud, T. L. Smith, C. M. F. Mingarelli, Phys. Rev. D
more challenging than detecting the GWB.
log1 ACP
FLEXIBLE ELECTRONICS
By Ruirui Qiao1 and Shi-Yang Tang2 intrinsically stretchable (3). The fluidic na- nearly perfect electrical contacts—without
ture of GaLMs makes them an ideal candi- merging with the microdroplets or with each
G
allium (Ga) is a silver-blue metal date for the second strategy, because they other, and without removing the oxide skins.
that melts at 29.8°C and is useful can be used to build a conductive circuit When the composite is stretched, the micro-
for creating alloys with a wide range inside stretchable polymers. droplet-nanodroplet chain remains intact as
of properties. For example, an alloy GaLMs react with oxygen to form an ox- the microdroplets change their shape to ac-
of Ga and indium (In) with roughly ide skin (1 to 5 nm thick) (4, 5), which occurs commodate the stretch.
a 3-to-1 ratio has a melting point of even at extremely low oxygen concentra- Previous creations of GaLM-polymer
just 15.7°C, although In has a melting point tions (6). This oxide skin is rigid, providing composites also face leakage issues under
of ~157°C. Ga alloys that are liquid at room the double benefit of structural stability and mechanical stress. The leaked GaLMs are
temperature, called Ga-based liquid metals the ability for GaLMs to adhere to surfaces difficult to clean and may diffuse into other
(GaLMs), generally have low toxicity and through electrostatic interactions (5). Be- metallic components inside the device, criti-
high electrical and thermal conductivities cause of these properties, a flexible circuit cally damaging its circuits. To address this
(1). Because of these properties, GaLM- can be patterned onto a stretchable polymer problem, Lee et al. used smaller GaLM mi-
polymer composite materials have been substrate simply by printing GaLMs through crodroplets (~2 µm), which decreases the
considered for creating electronic compo- a nozzle, spray painting over a stencil, or even chance of breaking and spilling the embed-
nents in stretchable devices, such as those stamping with a mold (1, 7). However, the ox- ded droplets. The toughness of the composite
used in biomedical and biosensing applica- ide skins also pose a set of practical problems is enhanced by the GaLM chains, which help
tions. However, an approach to reliably fab- for the use of GaLMs. When printing with absorb mechanical stress. Lee et al. demon-
ricate stretchable conductive circuits using GaLM droplets suspended in a carrier fluid strate the versatility of their method for form-
GaLM-polymer composites has remained (7, 8), the droplets often do not merge back ing conductors using different polymer ma-
elusive. On page 637 of this issue, Lee et together, owing to the presence of the oxide trices and other types of liquid metals.
al. (2) report using acoustic waves to ma- skin. As a result, structures formed by these Despite the many special properties of
nipulate and create a conductive network of droplets with the oxide skin tend to have GaLMs and the attention they have received
GaLM microdroplets embedded in polymer. poor conductivity and require breaking the in recent years within the soft electronics
There are two main strategies for mak- oxide skin and recombining the droplets to- field (9, 10), GaLMs have yet to be widely
ing stretchable conductors in flexible elec- gether to form conductive pathways (8). implemented by the electronics industry.
tronics—by designing structural patterns to To eliminate the need to recombine the GaLMs remain a relatively expensive mate-
make a nonstretchable material stretchable droplets, Lee et al. used an acoustic field to rial, with a price tag of ~$0.50/g in 2022. This
(akin to cutting holes in a piece of non- help connect individual GaLM microdroplets is ~200 times the price of aluminum and ~66
stretchable paper to turn it into a stretch- embedded in polymer (see the figure). With times the price of copper, which are common
able web), and by using materials that are the application of acoustic waves at an ultra- conductors in soft electronics. In addition,
sound frequency of 20 kHz, the microdroplets the electrical conductivity of GaLMs is only
1
Australian Institute for Bioengineering and Nanotechnol- reflect the acoustic energy and shed off nano- ~1/10 that of aluminum and ~1/17 that of cop-
ogy, The University of Queensland, Brisbane, QLD, Aus- sized droplets that bridge the microdroplets per. Thus, using GaLMs for making simple
tralia. 2Department of Electronic, Electrical and Systems
Engineering, University of Birmingham, Birmingham, UK. together. It was surprising that the chain of electronic components is not cost-effective.
Email: r.qiao@uq.edu.au; s.tang@bham.ac.uk GaLM microdroplets and nanodroplets form There may be ways to improve interactions
I
core and the oxide skin, and between the n 2021, 40% of India’s global greenhouse plants. Power plants in the coal-producing
GaLM and the polymer, is essential to further gas emissions came from electricity gen- eastern states are, on average, less efficient
the technology. The method presented by Lee eration, mainly powered by coal plants (i.e., they have higher emissions per unit of
et al. helps to overcome a major challenge (1). Air pollution from these power plants, energy generation) but more cost-effective
in creating conductive circuits with GaLM- composed of predominantly sulfur diox- than those in the rest of the country because
polymer composites, but the composites still ide and particulate matter, is one of the of their proximity to coal mines. According to
face a number of manufacturing challenges. leading causes of respiratory and heart dis- Sengupta et al., expanding the balancing re-
For example, processes such as sonication eases in India, which result in ~80,000 pre- gions of the electric grid to neighboring states
and stir-mixing in a carrier fluid for creat- mature deaths annually (2). Understanding will enable the cheaper coal power plants in
ing GaLM microdroplets tend to lack precise the impacts of electricity sector policies the eastern states to sell more of their elec-
control over the size of the produced drop- aimed at mitigating carbon emissions and tricity, resulting in a decrease in total costs
lets. This is a problem because the size of the air pollution is critical for addressing these but also a modest increase in carbon and
droplets directly affects the electrical and me- climate and public health crises. On page 618 sulfur emissions. Although this strategy may
chanical performance of the composites. of this issue, Sengupta et al. (3) examine how result in extra emissions in the near term,
The biocompatibility and electrical carbon taxes, balancing electricity generation balancing the supply and demand over larger
properties of these composites make them and consumption across larger regions, and regions will help manage the variability of
particularly attractive for biomedical ap- sulfur-control regulations affect near-term weather-dependent solar and wind energy
plications. However, in the daily use of costs and emissions of India’s electricity sec- generation and increase their adoption (6).
stretchable electronics such as wearable tor. They find that these policies can cause With the rising energy demand in India,
sensors, a scenario that demands the ex- inequalities in air pollution exposure across the low-cost coal plants in the poorer coal-
treme strain parameters offered by GaLM- different regions. producing regions are likely to continue oper-
polymer composites is rare. For reference, A tax levied against power plants based ating—even as the rest of India transitions to
the human skin begins to fracture when on their carbon emissions—i.e., a carbon greener energy sources. This will perpetuate
stretched to ~2.5 times its length (14). Other tax—may be an effective policy instrument the social inequality that stems from commu-
applications such as triboelectric energy for controlling carbon emissions in high- nities in these regions being already poorer
harvesters that can generate electricity from income countries (4). However, this strategy and disproportionately exposed to air pollu-
being stretched and released may be possi- may not have the same effect on low- and tion from coal generation compared with the
ble by tuning the electromechanical proper- middle-income countries, such as India. In rest of India. Several strategies could limit
ties of GaLM composites. Such applications theory, imposing a carbon tax on the electric- sulfur and particulate matter emissions from
and other yet-to-be-explored avenues may ity sector would make both coal power plants coal power plants and improve public health
more effectively utilize the full range of the more expensive to operate and alternative in these regions. For instance, installing
stretchability of the composites. j lower-carbon energy sources more competi- pollution-control equipment called flue gas
tive. However, India has limited natural gas desulfurizers (FGDs) can capture sulfur diox-
REFERENCES AND NOTES
resources or energy storage capacity tied ide and particulate matter from coal power
1. S.-Y. Tang et al., Annu. Rev. Mater. Res. 51, 381 (2021).
2. W. Lee et al., Science 378, 637 (2022). with renewable energy that can adequately plants. However, although the Indian gov-
3. N. Matsuhisa et al., Chem. Soc. Rev. 48, 2946 (2019). substitute for coal electricity generation (5). ernment adopted a mandate requiring coal
4. T. Daeneke et al., Chem. Soc. Rev. 47, 4073 (2018).
5. M. D. Dickey, ACS Appl. Mater. Interfaces 6, 18369 (2014). According to Sengupta et al., a carbon tax in power plants to install FGDs in 2015, only 5%
6. T. Liu et al., J. Microelectromech. Syst. 21, 443 (2011). India is unlikely to meaningfully reduce coal of facilities had done so by 2021. To better tri-
7. S. Chen, J. Liu, iScience 24, 102026 (2021). electricity generation without resulting in age this problem, coal power plants causing
8. N. Kazem et al., Adv. Mater. 29, 1605985 (2017).
9. Z. Ma et al., Nat. Mater. 20, 859 (2021). blackouts, at least in the near term. the greatest public exposure to air pollution
10. P. Won et al., iScience 24, 102698 (2021). Although India has a well-connected elec- should be prioritized for FGD installation.
11. S.-Y. Tang, R. Qiao, Accounts Mater. Res. 2, 966 (2021).
12. M. J. Ford, et al., Adv. Mater. 32, 2002929 (2020). tricity grid, most electricity supply and de- The potential electricity rate increases result-
13. J. E. Park et al., Adv. Mater. 32, 2002178 (2020). mand is balanced separately by each state. ing from FGDs could be spread across all tax-
14. H. Joodaki, M. B. Panzer, Proc. Inst. Mech. Eng. H 232, 323 payers or electricity buyers, which will help
(2018).
1
Environmental Studies Program and the Bren School provide economic relief, especially for the
ACKNOWLEDGMENTS of Environmental Science and Management, University of poorer coal-producing states (7). This may
R.Q. receives funding support from the National Health and California, Santa Barbara, CA, USA. 2Central also help stabilize the revenue stream for coal
Medical Research Council (grant no. APP1196850). Electricity Regulatory Commission, New Delhi, India.
Email: rdeshmukh@ucsb.edu; power plant operators and help them adapt
10.1126/science.ade1813 chatterjee.sushanta@gmail.com technologies, such as FGDs. Another strategy
I
core and the oxide skin, and between the n 2021, 40% of India’s global greenhouse plants. Power plants in the coal-producing
GaLM and the polymer, is essential to further gas emissions came from electricity gen- eastern states are, on average, less efficient
the technology. The method presented by Lee eration, mainly powered by coal plants (i.e., they have higher emissions per unit of
et al. helps to overcome a major challenge (1). Air pollution from these power plants, energy generation) but more cost-effective
in creating conductive circuits with GaLM- composed of predominantly sulfur diox- than those in the rest of the country because
polymer composites, but the composites still ide and particulate matter, is one of the of their proximity to coal mines. According to
face a number of manufacturing challenges. leading causes of respiratory and heart dis- Sengupta et al., expanding the balancing re-
For example, processes such as sonication eases in India, which result in ~80,000 pre- gions of the electric grid to neighboring states
and stir-mixing in a carrier fluid for creat- mature deaths annually (2). Understanding will enable the cheaper coal power plants in
ing GaLM microdroplets tend to lack precise the impacts of electricity sector policies the eastern states to sell more of their elec-
control over the size of the produced drop- aimed at mitigating carbon emissions and tricity, resulting in a decrease in total costs
lets. This is a problem because the size of the air pollution is critical for addressing these but also a modest increase in carbon and
droplets directly affects the electrical and me- climate and public health crises. On page 618 sulfur emissions. Although this strategy may
chanical performance of the composites. of this issue, Sengupta et al. (3) examine how result in extra emissions in the near term,
The biocompatibility and electrical carbon taxes, balancing electricity generation balancing the supply and demand over larger
properties of these composites make them and consumption across larger regions, and regions will help manage the variability of
particularly attractive for biomedical ap- sulfur-control regulations affect near-term weather-dependent solar and wind energy
plications. However, in the daily use of costs and emissions of India’s electricity sec- generation and increase their adoption (6).
stretchable electronics such as wearable tor. They find that these policies can cause With the rising energy demand in India,
sensors, a scenario that demands the ex- inequalities in air pollution exposure across the low-cost coal plants in the poorer coal-
treme strain parameters offered by GaLM- different regions. producing regions are likely to continue oper-
polymer composites is rare. For reference, A tax levied against power plants based ating—even as the rest of India transitions to
the human skin begins to fracture when on their carbon emissions—i.e., a carbon greener energy sources. This will perpetuate
stretched to ~2.5 times its length (14). Other tax—may be an effective policy instrument the social inequality that stems from commu-
applications such as triboelectric energy for controlling carbon emissions in high- nities in these regions being already poorer
harvesters that can generate electricity from income countries (4). However, this strategy and disproportionately exposed to air pollu-
being stretched and released may be possi- may not have the same effect on low- and tion from coal generation compared with the
ble by tuning the electromechanical proper- middle-income countries, such as India. In rest of India. Several strategies could limit
ties of GaLM composites. Such applications theory, imposing a carbon tax on the electric- sulfur and particulate matter emissions from
and other yet-to-be-explored avenues may ity sector would make both coal power plants coal power plants and improve public health
more effectively utilize the full range of the more expensive to operate and alternative in these regions. For instance, installing
stretchability of the composites. j lower-carbon energy sources more competi- pollution-control equipment called flue gas
tive. However, India has limited natural gas desulfurizers (FGDs) can capture sulfur diox-
REFERENCES AND NOTES
resources or energy storage capacity tied ide and particulate matter from coal power
1. S.-Y. Tang et al., Annu. Rev. Mater. Res. 51, 381 (2021).
2. W. Lee et al., Science 378, 637 (2022). with renewable energy that can adequately plants. However, although the Indian gov-
3. N. Matsuhisa et al., Chem. Soc. Rev. 48, 2946 (2019). substitute for coal electricity generation (5). ernment adopted a mandate requiring coal
4. T. Daeneke et al., Chem. Soc. Rev. 47, 4073 (2018).
5. M. D. Dickey, ACS Appl. Mater. Interfaces 6, 18369 (2014). According to Sengupta et al., a carbon tax in power plants to install FGDs in 2015, only 5%
6. T. Liu et al., J. Microelectromech. Syst. 21, 443 (2011). India is unlikely to meaningfully reduce coal of facilities had done so by 2021. To better tri-
7. S. Chen, J. Liu, iScience 24, 102026 (2021). electricity generation without resulting in age this problem, coal power plants causing
8. N. Kazem et al., Adv. Mater. 29, 1605985 (2017).
9. Z. Ma et al., Nat. Mater. 20, 859 (2021). blackouts, at least in the near term. the greatest public exposure to air pollution
10. P. Won et al., iScience 24, 102698 (2021). Although India has a well-connected elec- should be prioritized for FGD installation.
11. S.-Y. Tang, R. Qiao, Accounts Mater. Res. 2, 966 (2021).
12. M. J. Ford, et al., Adv. Mater. 32, 2002929 (2020). tricity grid, most electricity supply and de- The potential electricity rate increases result-
13. J. E. Park et al., Adv. Mater. 32, 2002178 (2020). mand is balanced separately by each state. ing from FGDs could be spread across all tax-
14. H. Joodaki, M. B. Panzer, Proc. Inst. Mech. Eng. H 232, 323 payers or electricity buyers, which will help
(2018).
1
Environmental Studies Program and the Bren School provide economic relief, especially for the
ACKNOWLEDGMENTS of Environmental Science and Management, University of poorer coal-producing states (7). This may
R.Q. receives funding support from the National Health and California, Santa Barbara, CA, USA. 2Central also help stabilize the revenue stream for coal
Medical Research Council (grant no. APP1196850). Electricity Regulatory Commission, New Delhi, India.
Email: rdeshmukh@ucsb.edu; power plant operators and help them adapt
10.1126/science.ade1813 chatterjee.sushanta@gmail.com technologies, such as FGDs. Another strategy
A
is to encourage investment in solar and wind of climate and renewable energy targets is s human population and economies
power plants in the coal-producing regions. important, as is public health, employment, have grown rapidly over the past
These energy infrastructure investments will and energy affordability across regions and 100 years, ecosystems worldwide
also provide local job opportunities as the re- communities to ensure equitable growth. have faced increasing pressure from
gions transition away from fossil fuel–based As India continues to develop its economy, overexploitation, habitat destruc-
power generation in the long term (8). balancing the near-term and long-term ef- tion, and other threats (1). In the
India faces the twin challenges of mitigat- fects of its electricity sector policies, as well oceans, roughly half of all commercially
ing carbon emissions and meeting an in- as their impact on social inequalities, will harvested fish and invertebrate stocks be-
creasing energy demand. Several policies and be critical to ensure a low-carbon transition came overfished during the 20th century
regulations have been introduced to reduce that is green as well as just. j (2), and larger predators, such as billfishes
overall energy demand and increase the sup- and sharks, also dwindled (3). The 21st
REF ERENCES AND NOTES
ply for zero-carbon electricity. For instance, century has seen some marine fish and in-
1. R. R. Mohan et al., “Greenhouse Gas Emission Estimates
the government has undertaken large-scale from the Energy Sector in India at the Sub-national Level vertebrate stocks begin recovering owing
procurement of energy-efficient home and (version 2.0)” (GHG Platform India, 2019). to management efforts (4), whereas poorly
office appliances to decrease their prices. It 2. M. Cropper et al., Proc. Natl. Acad. Sci. U.S.A. 118, managed stocks continued to decline (2).
e2017936118 (2021).
has also created a market for energy-saving 3. S. Sengupta et al., Science 378, eabh1484 (2022). On page 617 of this issue, Juan-Jordá et
certificates, where businesses saving more 4. J. E. Stiglitz, N. Stern, “Report of the High-Level al. (5) illustrate a similar contrast among
energy than their targets can sell the left- Commission on Carbon Pricing” (Carbon Pricing ocean predators and introduce an ap-
Leadership Coalition, 2017); https://bit.ly/3TkiiLP.
over credit to another company, creating a 5. R. Deshmukh, A. Phadke, D. S. Callaway, Proc. Natl. Acad.
proach for continuously monitoring their
monetary incentive for businesses to meet Sci. U.S.A. 118, e2008128118 (2021). conservation statuses. The authors found
energy efficiency targets (9). In addition, it 6. E. Ela et al., Electr. J. 29, 51 (2016). that the situations for tunas and billfishes
7. “Analysis of Factors Impacting Retail Tariff and
has introduced competition through bidding Measures to Address Them” (Forum of Regulators,
have improved over the past decade, but
by renewable energy companies, targets for 2021); https://bit.ly/3EYieNy. not those for sharks. This contrast owes
each state to purchase renewable energy, ex- 8. S. Pai, H. Zerriffi, J. Jewell, J. Pathak, Environ. Res. Lett. partly to management, but biological and
emptions for renewable energy from trans- 15, 034065 (2020). socioeconomic factors also cause fisheries
9. “Roadmap of Sustainable and Holistic Approach
mission charges (10), and transmission in- to National Energy Efficiency” (Bureau of Energy to affect these species differently.
frastructure for renewable energy (11). These Efficiency, 2019); https://beeindia.gov.in/sites/default/ The International Union for Conservation
policies have since led to some of the world’s files/Roshanee_print%20version%282%29.pdf. of Nature (IUCN) (6) labels a species as
10. “Tariff Policy” (Ministry of Power, 2016); https://bit.
lowest solar and wind energy prices ($30 to ly/3eJHX1q. critically endangered, endangered, or vul-
$40 USD per megawatt-hour) (12). By 2021, 11. “Report on Green Energy Corridors – II: Part-A” (Power nerable on the basis of how much its pop-
India had become the world’s fifth-largest so- Grid Corporation of India Ltd., 2022); www.powergrid. ulation has declined over the past three
in/sites/default/files/footer/smartgrid/Green%20
lar power producer, with a capacity of 50 GW, Energy%20Corridor%202-Part%20A.pdf. generations or 10 years, whichever period
and the fourth-largest wind power producer, 12. “Renewable Power Generation Costs in 2020” is longer. If threats to a species are consid-
with a capacity of 40 GW (13). (International Renewable Energy Agency, 2021); ered to be poorly understood or managed,
https://bit.ly/3Teskhw.
Although the carbon emissions and gross 13. “Renewable Capacity Statistics 2022”
then the IUCN applies these endangerment
PHOTO: SANJIT DAS/PANOS FOR FT MAGAZINE
domestic product per capita of India are (International Renewable Energy Agency, labels when there is a smaller population
still less than half the global average, the 2022); www.irena.org/publications/2022/Apr/ decline as a precaution. Juan-Jordá et al.
Renewable-Capacity-Statistics-2022.
country has ambitious plans for mitigating 14. Prime Minister’s Office, “National Statement by Prime
built upon this classification system, known
its carbon emissions. At the 26th United Minister Shri Narendra Modi at COP26 Summit in
Nations Climate Change Conference held Glasgow” (Press Information Bureau of India, 2021); 1
https://bit.ly/3goRWcS. Department of Environmental Studies, University of
in 2021 in Glasgow, UK, the Indian govern- Colorado Boulder, Boulder, CO, USA. 2Center for Social and
ment pledged a net-zero emissions target ACKNOWL EDGMENTS Environmental Futures, Cooperative Institute for Research
by 2070 and a near-term target of produc- in Environmental Sciences, University of Colorado Boulder,
The views of the authors are personal and do not represent Boulder, CO, USA. 3Department of Economics, University
ing 50% of its electricity from renewable the views of the Central Electricity Regulatory Commission. of Colorado Boulder, Boulder, CO, USA.
energy by 2030 (14). For India, the pursuit 10.1126/science.ade6040 Email: matthew.g.burgess@colorado.edu
A
is to encourage investment in solar and wind of climate and renewable energy targets is s human population and economies
power plants in the coal-producing regions. important, as is public health, employment, have grown rapidly over the past
These energy infrastructure investments will and energy affordability across regions and 100 years, ecosystems worldwide
also provide local job opportunities as the re- communities to ensure equitable growth. have faced increasing pressure from
gions transition away from fossil fuel–based As India continues to develop its economy, overexploitation, habitat destruc-
power generation in the long term (8). balancing the near-term and long-term ef- tion, and other threats (1). In the
India faces the twin challenges of mitigat- fects of its electricity sector policies, as well oceans, roughly half of all commercially
ing carbon emissions and meeting an in- as their impact on social inequalities, will harvested fish and invertebrate stocks be-
creasing energy demand. Several policies and be critical to ensure a low-carbon transition came overfished during the 20th century
regulations have been introduced to reduce that is green as well as just. j (2), and larger predators, such as billfishes
overall energy demand and increase the sup- and sharks, also dwindled (3). The 21st
REF ERENCES AND NOTES
ply for zero-carbon electricity. For instance, century has seen some marine fish and in-
1. R. R. Mohan et al., “Greenhouse Gas Emission Estimates
the government has undertaken large-scale from the Energy Sector in India at the Sub-national Level vertebrate stocks begin recovering owing
procurement of energy-efficient home and (version 2.0)” (GHG Platform India, 2019). to management efforts (4), whereas poorly
office appliances to decrease their prices. It 2. M. Cropper et al., Proc. Natl. Acad. Sci. U.S.A. 118, managed stocks continued to decline (2).
e2017936118 (2021).
has also created a market for energy-saving 3. S. Sengupta et al., Science 378, eabh1484 (2022). On page 617 of this issue, Juan-Jordá et
certificates, where businesses saving more 4. J. E. Stiglitz, N. Stern, “Report of the High-Level al. (5) illustrate a similar contrast among
energy than their targets can sell the left- Commission on Carbon Pricing” (Carbon Pricing ocean predators and introduce an ap-
Leadership Coalition, 2017); https://bit.ly/3TkiiLP.
over credit to another company, creating a 5. R. Deshmukh, A. Phadke, D. S. Callaway, Proc. Natl. Acad.
proach for continuously monitoring their
monetary incentive for businesses to meet Sci. U.S.A. 118, e2008128118 (2021). conservation statuses. The authors found
energy efficiency targets (9). In addition, it 6. E. Ela et al., Electr. J. 29, 51 (2016). that the situations for tunas and billfishes
7. “Analysis of Factors Impacting Retail Tariff and
has introduced competition through bidding Measures to Address Them” (Forum of Regulators,
have improved over the past decade, but
by renewable energy companies, targets for 2021); https://bit.ly/3EYieNy. not those for sharks. This contrast owes
each state to purchase renewable energy, ex- 8. S. Pai, H. Zerriffi, J. Jewell, J. Pathak, Environ. Res. Lett. partly to management, but biological and
emptions for renewable energy from trans- 15, 034065 (2020). socioeconomic factors also cause fisheries
9. “Roadmap of Sustainable and Holistic Approach
mission charges (10), and transmission in- to National Energy Efficiency” (Bureau of Energy to affect these species differently.
frastructure for renewable energy (11). These Efficiency, 2019); https://beeindia.gov.in/sites/default/ The International Union for Conservation
policies have since led to some of the world’s files/Roshanee_print%20version%282%29.pdf. of Nature (IUCN) (6) labels a species as
10. “Tariff Policy” (Ministry of Power, 2016); https://bit.
lowest solar and wind energy prices ($30 to ly/3eJHX1q. critically endangered, endangered, or vul-
$40 USD per megawatt-hour) (12). By 2021, 11. “Report on Green Energy Corridors – II: Part-A” (Power nerable on the basis of how much its pop-
India had become the world’s fifth-largest so- Grid Corporation of India Ltd., 2022); www.powergrid. ulation has declined over the past three
in/sites/default/files/footer/smartgrid/Green%20
lar power producer, with a capacity of 50 GW, Energy%20Corridor%202-Part%20A.pdf. generations or 10 years, whichever period
and the fourth-largest wind power producer, 12. “Renewable Power Generation Costs in 2020” is longer. If threats to a species are consid-
with a capacity of 40 GW (13). (International Renewable Energy Agency, 2021); ered to be poorly understood or managed,
https://bit.ly/3Teskhw.
Although the carbon emissions and gross 13. “Renewable Capacity Statistics 2022”
then the IUCN applies these endangerment
PHOTO: SANJIT DAS/PANOS FOR FT MAGAZINE
domestic product per capita of India are (International Renewable Energy Agency, labels when there is a smaller population
still less than half the global average, the 2022); www.irena.org/publications/2022/Apr/ decline as a precaution. Juan-Jordá et al.
Renewable-Capacity-Statistics-2022.
country has ambitious plans for mitigating 14. Prime Minister’s Office, “National Statement by Prime
built upon this classification system, known
its carbon emissions. At the 26th United Minister Shri Narendra Modi at COP26 Summit in
Nations Climate Change Conference held Glasgow” (Press Information Bureau of India, 2021); 1
https://bit.ly/3goRWcS. Department of Environmental Studies, University of
in 2021 in Glasgow, UK, the Indian govern- Colorado Boulder, Boulder, CO, USA. 2Center for Social and
ment pledged a net-zero emissions target ACKNOWL EDGMENTS Environmental Futures, Cooperative Institute for Research
by 2070 and a near-term target of produc- in Environmental Sciences, University of Colorado Boulder,
The views of the authors are personal and do not represent Boulder, CO, USA. 3Department of Economics, University
ing 50% of its electricity from renewable the views of the Central Electricity Regulatory Commission. of Colorado Boulder, Boulder, CO, USA.
energy by 2030 (14). For India, the pursuit 10.1126/science.ade6040 Email: matthew.g.burgess@colorado.edu
as “Criterion A,” and developed indices for their target species. Commercially valuable economic characteristics, such as short
assessing the endangerment levels of seven species can support profitable fishing even generation time and low price (which limit
tuna species, six billfish species, and five at extremely low population sizes—if the overfishing), than with the quality of their
shark species. Their indices can be used to species have high prices, large body sizes, management (8).
assess endangerment continuously in time, low harvest costs, and/or small geographic Juan-Jordá et al. highlight the stark chal-
instead of being limited to fixed IUCN as- ranges, which reduce the costs of catch lenges facing oceanic predators—especially
sessment intervals. (11). Nontarget species can also be affected sharks. Successful shark conservation
The indices define a species as being ad- by fishing activities, such as those that are needs to address their specific biological
equately managed if its mortality rate is caught unintentionally (“bycatch”) (12) or and economic vulnerabilities, in addition
less than the mortality rate that can sus- opportunistically (for example, a fishing to deploying fisheries management tools
tain the maximum yield for fisheries. By crew spotting and deciding to catch a dif- used for tunas and billfishes, such as sci-
this measure, the statuses of the tunas and ferent species than their original target) ence-based catch limits. Moreover, mac-
billfishes have improved, on average, during (13). Bycatch species can become threat- roscopic ecosystem considerations may
the 2010s, and the mortality rates of several ened if they are frequently caught along- pose further challenges, even with well-
populations have returned to the levels that side overfished target species (14). They managed predator fisheries. For example,
can support a maximum sustainable yield. can also become threatened even if the maintaining sharks’ ecosystem services as
By contrast, the statuses of sharks have target species are being sustainably caught top predators might require higher shark
continued to deteriorate on average during when the bycatch species has a higher vul- abundances than is ideal for fishery catch.
this period, and their mortality rates have nerability—having a lower reproductive The conservation statuses of threatened
remained well above the maximum sustain- rate compared with its catch rate (15). target species can be improved by manag-
able rate. Juan-Jordá et al. attribute some Some of the differences Juan-Jordá et ing the fishing industry, which can benefit
of this contrast to the improved manage- al. found among sharks, tunas, and bill- the industry economically in the long run
ment of commercial fishing for tunas and fishes likely result from their different while allowing the threatened species to
billfishes, but not for sharks. For example, vulnerabilities to fishing activities. The recover (2, 14). Generating sufficient sci-
the International Commission for the five shark species studied by the authors entific and governance capacity to imple-
Conservation of Atlantic Tunas has been all have slow population growth, have high ment successful management is often the
setting and monitoring catch limits for tu- vulnerability as bycatch, and are com- primary challenge (4, 10). However, the
nas (7). However, the authors also highlight monly caught by fisheries targeting tunas protection of high-vulnerability bycatch
that other biological and fishery factors are and billfishes. Sharks are also sometimes and nontarget species is expected to be
needed to explain this difference between the target themselves. Although there has more difficult because they will require
shark and tuna and billfish status, which is been some progress in managing fisheries fisheries to invest in better fishing gear
consistent with previous findings (8, 9). For that target sharks, these efforts face chal- and targeting practices, or reduce fishing
example, the differences in economic value lenges posed by the lucrative fin trade and efforts, without directly benefiting from
and population growth rate and how each related illegal and unreported fishing (9). these changes (14). The trade-offs between
species is affected by fisheries directly and Marlins also stood out among the studied fishery benefits and ecosystem impacts will
indirectly are important considerations. billfish species as being more endangered, demand difficult negotiations and compro-
To understand why sharks are faring likely because they are highly vulnerable as mises between stakeholders. j
worse on average than tunas and billfishes, bycatch in tuna fisheries (15). By contrast,
REF ERENCES AND NOTES
the mechanisms driving unsustainable fish- tuna species and relatively nonthreatened
1. P. M. Vitousek, H. A. Mooney, J. Lubchenco, J. M. Melillo,
ing practices must be considered (see the billfish species, such as swordfish, are Science 277, 494 (1997).
figure). Without management (4), collective mostly caught as targets (7). Among tuna 2. C. Costello et al., Proc. Natl. Acad. Sci. U.S.A. 113, 5125
action, or community norms that promote species, their conservation statuses are (2016).
3. D. J. McCauley et al., Science 347, 1255641 (2015).
cooperation (10), fisheries tend to overfish more correlated with their biological and 4. R. Hilborn et al., Proc. Natl. Acad. Sci. U.S.A. 117, 2218
(2020).
5. M. J. Juan-Jordá et al., Science 378, eabj0211 (2022).
6. IUCN, IUCN Red List Categories and Criteria: Version 3.1
How fisheries threaten sharks (IUCN, ed. 2, 2012).
Slow growth rates and high catch prices have made sharks Shark Tuna 7. M. J. Juan-Jordá, H. Murua, H. Arrizabalaga, N. K. Dulvy,
vulnerable to fisheries, both as a target and as bycatch. V. Restrepo, Fish Fish. 19, 321 (2018).
8. M. Pons, M. C. Melnychuk, R. Hilborn, Fish Fish. 19, 260
(2018).
Sharks are being caught as a target Sharks are also caught as Even for fisheries that are fishing 9. N. K. Dulvy et al., Curr. Biol. 27, R565 (2017).
by fisheries that set out to catch bycatch by fisheries that are their target species sustainably, 10. N. L. Gutiérrez, R. Hilborn, O. Defeo, Nature 470, 386
sharks for their high prices, even aggressively fishing other they may still catch enough sharks (2011).
when it may be illegal. species as targets. as bycatch to threaten their survival. 11. M. G. Burgess et al., Proc. Natl. Acad. Sci. U.S.A. 114,
3945 (2017).
12. R. Lewison, L. Crowder, A. Read, S. Freeman, Trends Ecol.
Evol. 19, 598 (2004).
13. T. A. Branch, A. S. Lobo, S. W. Purcell, Trends Ecol. Evol.
28, 409 (2013).
14. M. G. Burgess et al., Science 359, 1255 (2018).
15. M. G. Burgess, S. Polasky, D. Tilman, Proc. Natl. Acad. Sci.
GRAPHIC: A. MASTIN/SCIENCE
ACKNOWL EDGMENTS
M.G.B. and S.L.B. thank C. Brooks, R. Langendorf,
M. Hegwood, and N. O’Reilly for feedback.
10.1126/science.add0342
T
cell–based immunotherapy strate- of developmental potential, which can limit CAR T cell–mediated antitumor response.
gies to treat cancer rely on the pool of the ability of the cells to undergo expansion Given that the CDK module of Mediator can
tumor-specific T cells (engineered or after infusion into the patient. This quantity- control the G0-to-G1 transition, promoting
endogenous) to retain a developmental versus-quality dilemma may be partially re- entry into the cell division cycle, the findings
potential that enables them to clonally solved by a better understanding of the rela- by Freitas et al. suggest a relationship be-
expand and serially kill antigen-posi- tionship between cell cycle control and T cell tween cell cycle control and epigenetic pro-
tive cells to achieve an efficacious immune terminal differentiation. Broadly, CDKs regu- gramming and provide an indirect approach
response. Therefore, identifying T cell dif- late cell division and RNA polymerase II–de- for reprogramming the epigenetic status of T
ferentiation regulators in both clinical and pendent transcription. CDK inhibitors have cells used for immunotherapy.
preclinical settings is important to improve been shown to improve the effectiveness of Harnessing the robust killing potential of
on current successes (1–3). Persistence of immunotherapy for certain types of cancers T cells through engineering efforts that refo-
effector T cells has been identified as one (7, 8). Freitas et al. found that disruption of cus the effector response toward pathogenic
of the critical barriers that limits responses the Mediator CDK module in human CAR T cells (tumor cells and/or virally infected cells)
to immunotherapies and is now the focus cells preserved the ability of T cells to mount has been revolutionary. Building on the suc-
of current research efforts to sustain anti- cess observed in cancer settings, the concept
tumor immunity (4, 5). On page 616 of this
issue, Freitas et al. (6) describe an unbi-
“…specific epigenetic programs of CAR T cell therapy is now being applied
to treat a range of diseases, such as cardiac
ased genome-wide CRISPR-Cas9 screen to
determine targets that enhance engineered
reinforce the developmental fibrosis, as well as aging. CAR T cells target-
ing fibroblast activation protein (FAP) have
chimeric antigen receptor (CAR) T cell ef- transition of the T cell to a successfully removed cardiac fibrosis in
fector function. mouse models and improved cardiac func-
CAR T cells are a form of immunotherapy terminally differentiated state…” tion (10). Similarly, senolytic CAR T cells have
that are generated by ex vivo engineering been designed to target a protein expressed
a pool of T cells to express a specific recep- a robust antitumor response after substantial in most senescent cells (which lack the abil-
tor that recognizes cancer antigens; when ex vivo and in vivo expansion. ity to proliferate). Infusing senolytic CAR T
infused into a patient, they elicit antitumor In addition to improving the performance cells into mice with experimentally induced
immune responses. Using a CRISPR screen of engineered CAR and TCR T cells, these liver disease removed the senescent cells and
with freshly isolated human T cells to iden- findings reveal an important aspect of T cell reversed the disease phenotype (11). These
tify genes that enhance CAR T cell effector biology. Deletion of MED12 resulted in en- studies highlight the potential for CAR T cell
function, Freitas et al. identified the genes richment of a T cell population with an effec- therapy to have a major effect on many as-
mediator complex subunit 12 (MED12) and tor-like phenotype that had reduced terminal pects of human health and highlight the need
cyclin C (CCNC), which encode proteins in differentiation. Mechanistically, disruption for deeper understanding of the mechanisms
the cyclin-dependent kinase (CDK) module of MED12 altered the epigenetic landscape currently limiting T cell proliferation and ef-
of the Mediator complex. The Mediator com- of T cells, resulting in increased chromatin fector potential. j
plex plays an integral role in transcription accessibility at genomic regions enriched for
REF ERENCES AND NOTES
by acting as a bridge between transcription binding motifs for the transcription factor
1. B. Prinzing et al., Sci. Transl. Med. 13, eabh0272 (2021).
factors and the RNA polymerase machinery. families signal transducer and activator of 2. E. W. Weber et al., Science 372, eaba1786 (2021).
The authors showed that genetic disruption transcription (STAT) and activating protein 3. M. Sadelain, I. Rivière, S. Riddell, Nature 545, 423 (2017).
4. C. C. Zebley et al., Cell Rep. 37, 110079 (2021).
of the CDK module of Mediator in human 1 (AP-1). Consequently, Mediator was able to 5. S. L. Maude et al., N. Engl. J. Med. 371, 1507 (2014).
T cells resulted in enhanced effector func- bind to these epigenetically permissive re- 6. K. A. Freitas et al., Science 378, eabn5647 (2022).
tion, metabolic fitness, and increased antitu- gions and facilitate transcription of effector 7. R. V. Uzhachenko et al., Cell Rep. 35, 108944 (2021).
8. P. K. Parua, R. P. Fisher, Nat. Chem. Biol. 16, 716 (2020).
mor activity in several mouse tumor models genes. The resulting epigenetically enhanced 9. Y. Wang et al., Nat. Commun. 12, 409 (2021).
treated with engineered CAR and T cell re- CAR T cells exhibit superior antitumor func- 10. H. Aghajanian et al., Nature 573, 430 (2019).
11. C. Amor et al., Nature 583, 127 (2020).
ceptor (TCR) T cell immunotherapy. tion. These data suggest that interruption
To generate a quantity of CAR T cells large of the CDK module through disruption of ACKNOWL EDGMENTS
enough to provide therapeutic benefit for a MED12 or CCNC results in both epigenetic The authors are supported by the National Institutes of Health
patient, current production protocols often and transcriptional alterations that enhance (R01CA237311 to B.Y.), a National Comprehensive Cancer
Network Young Investigator Award (to C.C.Z.), an Alex’s
expand the cells ex vivo over the course of CAR T cell effector potential. Lemonade Stand Young Investigator Grant (to C.C.Z.), Stand
Direct alteration of chromatin accessibility Up To Cancer (SU2C) (B.Y.), and the American Lebanese
Syrian Associated Charities (B.Y. and C.C.Z.). C.C.Z. and B.Y.
1
Department of Bone Marrow Transplantation and Cellular regulators has previously been used to im- hold patents related to epigenetic biomarkers and methods
Therapy, St. Jude Children’s Research Hospital, prove CAR T cell function. Epigenetic-based for enhancing CAR T cell function.
Memphis, TN, USA. 2Department of Immunology, St. Jude
Children’s Research Hospital, Memphis, TN, USA. strategies, such as the chemotherapeutic drug
Email: benjamin.youngblood@stjude.org decitabine (which induces hypomethylation), 10.1126/science.adf0546
By Jos M. Raaijmakers1,2 and E. Toby Kiers3 plant genetic diversity because only desired In theory, rewilding can be achieved by
alleles were spread, while genomic regions following a simple roadmap that identifies
O
ver the past decade, research has next to the target genes suffered selective beneficial microbiota from wild progenitors
shown that microorganisms living sweeps (6). This so-called “domestication in their sites of origin, experimentally quan-
on and inside eukaryotes—the micro- syndrome” decreased the ability of crops to tifies their beneficial effects on modern
biota—are drivers of host health. For withstand pests and diseases. crops over multiple generations, and dis-
plants, microbiota can greatly expand Domestication was also accompanied by entangles the plant genetic basis of micro-
their genomic capabilities by enhanc- considerable habitat expansion and man- bial colonization (see the figure). However,
ing immunity, nutrient acquisition, and toler- agement practices, with increased reliance it is unknown whether domestication and
ance to environmental stresses (1). More than on external inputs (pesticides, fertilizers, industrialization have affected microbiome
ever, plant microbiota are being considered fresh water) to obtain higher yields and to assembly in consistent and convergent ways
as a lever to increase the sustainability of food protect domesticated crops from abiotic across diverse crop lineages. This is impor-
production under a changing climate. Emerg- and biotic stresses. This transition of plants tant because if there is predictability in as-
ing from this global interest to harness the from their native habitats to physicochemi- sembly processes, rewilding approaches are
largely unexplored functional potential of mi- cally diverse agricultural soils also led to likely to be more successful.
crobiota, the microbiome rewilding hypoth- substantial changes in microbiome compo- Microbiome assembly encompasses three
esis posits that plant and animal health can sition (7). For example, the domestication of types of interactions—host-to-microbe,
be improved by reinstating key members of
the diverse (ancestral) microbiota that were
lost through domestication and industrial- A research roadmap to microbiome-assisted crops
ization processes, including changes in diet, Rewilding involves reinstating key ancestral microbes in agricultural soils or planting materials, and/or breeding
plant and animal breeding, and the (over)use modern crops with specific traits that support ancestral microbiota colonization. By comparing wild and
of antibiotics, pesticides, and fertilizers (2–4). domesticated plants, beneficial ancestral microbiomes can be characterized to make rewilding a possibility.
A central question is whether the micro-
biomes of crop ancestors can be used to “re-
wild” microbiomes of current crops. Similar Grow wild relatives Identify plant genetic loci involved
and domesticated Wild Domesticated in recruitment and functioning
to reversing industrialization-associated crops in native of beneficial ancestral microbiota.
changes in human gut microbiota (5), plant and agricultural soils
microbiome rewilding builds on the premise to identify ancestral
microbiota
that wild ancestors harbor microbial genera and store in local Native Agricultural
with specific traits that are not found (or are biobanks. soil soil
strongly depleted) in the microbiome of mod-
ern crops. To date, however, it is unknown for
most plant species whether (and which) mi- Transplant ancestral Identify
crobial genera and functions were lost during microbiota into agricultural molecules
plant domestication, and to what extent re- soil and identify beneficial pheno- that recruit
typic effects through successive and/or activate
wilding can enhance the health and sustain- cultivation and exposure beneficial ancestral
ability of modern crops. In animal systems, to different stress conditions. microbiota.
the effectiveness of rewilding approaches is
intensely debated (3), and similar discussions legumes, combined with long-term nitrogen microbe-to-host, and microbe-to-microbe—
are needed for crop rewilding approaches. fertilization, has been linked to the evolu- each with its own evolutionary features (10).
Plant domestication is one of the most tion of less mutualistic rhizobia (nitrogen- Most well-studied are the selective pressures
important accomplishments in human his- fixing soil bacteria that form nodules in by which hosts select for beneficial interac-
tory, helping drive the transition from a the roots of legumes), and legume varieties tions with their microbiome. This means
nomadic to a sedentary lifestyle. Through that are less able to discriminate between hosts can modulate physical and chemical
stepwise processes, crop plants acquired a rhizobia that provide nitrogen to the plant conditions to control an ever-evolving mi-
suite of new traits, including larger seeds, versus those that do not (4, 8). Disruption crobial community (10). For example, plants
determinate growth, photoperiod sensitiv- of the symbiotic interaction between plants actively release exudates, such as sugars,
ity, and reduced levels of bitter substances. and mutualistic root fungi, known as my- amino acids, and volatile and secondary me-
GRAPHIC: K. HOLOSKI/SCIENCE
Although this led to a more continuous food corrhizae, has also been documented, with tabolites, that attract and selectively enrich
supply, domestication caused a reduction in domesticated crops showing lower colo- for specific microbial species (1). These regu-
nization and a decreased growth response lators impose selection pressures on micro-
1
Netherlands Institute of Ecology, Wageningen, to fungal symbionts, especially in fertilized biome assembly that can persist over multi-
Netherlands. 2Institute of Biology, Leiden University, soils (9). Alterations in the genetic makeup ple plant generations, leading to differential
Leiden, Netherlands. 3Amsterdam Institute for Life and
Environment, Vrije Universiteit Amsterdam, Amsterdam, of crops could at least partially explain this effects on host performance (11). Although
Netherlands. Email: j.raaijmakers@nioo.knaw.nl altered assembly of microbial symbionts. host-mediated recruitment and selection of
microbes have only been shown for relatively However, validation of candidate plant and then be selected for those particular control
few exudate compounds (e.g., strigolactones, microbiome genes is still challenging because mechanisms and used as hosts compatible
flavonoids, coumarins, benzoxazinoids, and it requires incorporating environmental ef- with the ancestral consortia.
organic acids), there is likely a large reper- fects on gene expression. Another approach involves identifying cor-
toire of unknown signals used by wild crop To understand, and ultimately implement, responding loci from wild crop ancestors and
ancestors to control the composition and ac- microbiome rewilding in future crop produc- reintroducing these in domesticated crops,
tivity of their microbiomes. tion, biogeographical analyses of native soils which is conceptually similar to the transfer
The host and microbiota, however, are in a crop’s center of origin are needed. This of disease resistance genes lost during do-
not a single evolutionary unit acting with can be combined with profiling the microbi- mestication. However, the success of this ap-
a common interest (10). Instead, microbes omes of wild relatives, landraces (domesti- proach is questionable considering that the
evolve strategies to maximize their own suc- cated, locally adapted variety of a plant spe- host traits involved in microbiome assembly
cess, driven by strong selection pressures cies), and improved crop varieties growing can be complex and multifactorial, which
to compete and persist on or within a host in native and agricultural soils. These data may not work in a predictable way. Instead of
plant, even if there are costs to the host (12). will help to interpret shifts in plant micro- transferring complex traits from wild ances-
In response, plants have evolved mechanisms biome composition along the domestication tors to domesticated crops, one may consider
to monitor and control the reproductive suc- path, and to disentangle the importance of de novo domestication—the concept that
cess of microbial partners. Because plant plant-soil feedback in driving these shifts. domestication genes are introduced into the
domestication is a process of artificial selec- Considering that the effects of plant geno- wild crop relatives, rather than vice versa (6).
tion and not intentionally directed toward type on microbiome composition may be Rewilding approaches can offer a new
maximizing positive microbe-to-host effects, relatively small, exposure of crops to a suite avenue to harness the benefits of ancestral
these host control mechanisms may have di- of different stresses can help amplify the dif- microbiota, and do not preclude the use of
minished. Indeed, studies with wheat, maize, ferential recruitment of specific ancestral domesticated crop cultivars or agricultural
and soybean show a reduction in positive mi- microbiota. Preservation and genomic char- management practices, such as fertilizer.
crobe-to-host effects following domestication acterization of microbiomes (i.e., biobanking) Integrating field biology experiments with
(4). If selection to control microbes decreases, of wild crop progenitors from their centers of reductionist approaches in controlled con-
rewilding strategies may become even more origin should also be prioritized. ditions will be instrumental in defining the
challenging because host plants will have dif- Additionally, microbiome transplants genetic and chemical basis of the diverse
ficulty establishing mutualistic interactions. should be integrated in experiments to pin- services that microbes can offer crops. Of
Identifying differences in the microbi- point the key beneficial ancestral microbiota. the steps needed to accomplish tangible
omes between crop plants and their wild Analogous to fecal microbiota transplanta- results, rigorous profiling and biobanking
progenitors—and the mechanisms mediat- tion to redirect the dysbiotic composition of microbiomes in their centers of origin
ing these differences—is straightforward in of human microbiomes, transferring com- and designing compatible combinations of
theory, but difficult in practice. Tools such plex microbial communities from root or host plant and beneficial ancestral micro-
as high-throughput plant phenotyping and shoot tissue of wild crop relatives onto seeds biota are probably the most challenging.
genotyping, next-generation sequencing, or planting material of their domesticated As rewilding research moves between the
and advanced metabolomics can provide counterparts can initially be used to identify field and the lab, its value and integration
insights into the genetic and chemical ba- specific microbiome-associated plant pheno- in breeding programs for a new generation
sis of the domestication syndrome. To date, types. If beneficial effects of wild microbiome of “microbiome-assisted” crops await criti-
however, relatively few plant traits have been transplants on crop cultivars are confirmed, cal assessment in different agroecologies. j
attributed to single genes or pathways. On approaches to minimize microbiome com-
REF ERENCES AND NOTES
the microbiome side, it is likewise challeng- plexity through dilution to extinction or the
1. P. Trivedi, J. E. Leach, S. G. Tringe, T. Sa, B. K. Singh, Nat.
ing to identify specific genes involved in host design of synthetic microbial communities Rev. Microbiol. 18, 607 (2020).
selection. Large-scale comparative (meta)ge- may help identify the key microbial genera 2. M. G. Dominguez-Bello et al., Science 362, 6410 (2018).
3. A. T. Reese et al., eLife 10, e60197 (2021).
nomics analyses are starting to reveal genes associated with particular plant phenotypes. 4. S. S. Porter, J. L. Sachs, Trends Ecol. Evol. 35, 426 (2020).
involved in microbial adaptation to the plant The performance of modern crop varieties 5. R. N. Carmody, A. Sarkar, A. T. Reese, Science 372, 462
environment (13). These approaches can help may also be improved through artificial selec- (2021).
6. A. R. Fernie, J. Yan, Mol. Plant 12, 615 (2019).
drive microbiome rewilding by identifying tion on the native microbiome. In this experi- 7. J. E. Pérez-Jaramillo, V. J. Carrión, M. de Hollander, J. M.
key genes underlying beneficial interactions mental evolution approach, the microbiome Raaijmakers, Microbiome 6, 143 (2018).
8. J. Liu, X. Yu, Q. Qin, R. D. Dinkins, H. Zhu, Front. Genet. 11,
across crop species. as a whole is propagated by experimental 00973 (2020).
To unravel plant-specific mechanisms in- passage to the next generation of hosts, while 9. N. Martín-Robles et al., New Phytol. 218, 322 (2018).
volved in microbiome assembly, creating the host is kept genetically invariant (15). 10. K. R. Foster, J. Schluter, K. Z. Coyte, S. Rakoff-Nahoum,
Nature 548, 43 (2017).
segregating populations by crossing the crop Microbiome functions that have been artifi- 11. P. A. H. M. Bakker, C. M. J. Pieterse, R. de Jonge, R. L.
cultivar and its wild progenitor is one of the cially selected can then be identified by com- Berendsen, Cell 172, 1178 (2018).
12. M. Klein et al., Evol. Appl. (2021).
most comprehensive approaches to date. parative taxonomic and functional profiling 13. A. Levy et al., Nat. Genet. 50, 138 (2017).
Recombinant inbred lines have already been of the communities that evolved under dif- 14. J. Bergelson, B. Brachi, F. Roux, F. Vailleau, Curr. Opin.
instrumental in identifying genetic loci that ferent selection regimes. Exposing plants to Biotechnol. 70, 167 (2021).
15. U. G. Mueller, J. L. Sachs, Trends Microbiol. 23, 606
control various agronomically relevant traits, specific stresses, such as drought or nutrient (2015).
such as pathogen resistance and drought tol- deprivation, can expedite the search for spe-
ACKNOWL EDGMENTS
erance, and are now also being adopted to cific subsets of ancestral beneficial consortia.
Thanks to D. Ramirez-Villacis for help with the figure. Support
map the microbiome as a plant phenotype This can be followed with the identification was provided by the Dutch Research Council (NWO)–
(14). Through genome-wide association map- of specific plant root exudates (or other con- Gravitation program Microp 024.004.014 (J.M.R., E.T.K.),
ping, quantitative trait analyses, and fine trol mechanisms) in wild relatives that are re- NWO-Vici (E.T.K.), and Human Frontier Science Program RGP
mapping, domestication loci associated with sponsible for the recruitment of these consor- 0029 (E.T.K.).
microbiome assembly could be identified. tia. Existing domesticated crop varieties can 10.1126/science.abn6350
By Benjamin K. Sovacool1,2,3, Frank W. Geels4, see promise and lessons in recent advance- cluster approach is that the construction of
Marfuga Iskandarova3 ments in the coevolution of net-zero cluster cluster-wide CCS infrastructures can enable
planning, policy implementation, and tech- the transport of CO2 from multiple plants
P
erhaps no sector of the global econ- nical development in the UK, where world- and storage in offshore saline aquifers or
omy is in greater need of concerted leading plans and designs have progressed empty gas fields as well as the creation and
efforts toward deep decarboniza- close to the implementation stage. use of low-carbon sources such as hydro-
tion than industry, which includes Despite considerable growth in produc- gen, mainly “blue” hydrogen produced from
energy-intensive sectors such as tion and energy use, the industrial sector’s natural gas.
chemicals, iron and steel, cement, energy mix has remained virtually un-
and aluminum (1). Yet industry has long changed, remaining heavily connected to NET-ZERO INDUSTRY POLICY IN THE UK
been perceived as hard to decarbonize and fossil fuels, especially coal. Whatever metric UK policy-makers started exploring the in-
has been mostly sheltered from strong en- is used, industrial emissions have grown dustrial decarbonization challenge with a
ergy and climate policies over concerns faster than any other sector, driven by both series of roadmaps, action plans, and strat-
about potential job losses, national com- increased materials and mineral extrac- egies developed with industry from 2015
petitiveness, and carbon leakage. Industrial tion, as well as higher rates of manufactur- to 2017. These highlighted the need to go
decarbonization scenarios often identify ing and production (3). Recently, however, beyond energy and material efficiency in-
carbon capture and storage (CCS) and fuel net-zero commitments have been leading novations toward fuel switching and CCS.
switching to hydrogen as potential net-zero to increased policy interest in industrial The government’s 2018 CCS Action Plan
options (2), but these technologies are ex- decarbonization. Policy-makers must find emphasized an industrial cluster approach
pensive for individual companies and spe- leverage points for reaching net-zero emis- and articulated targets such as the devel-
cific industries. These options can become sions while also allowing industries to con- opment of the first carbon capture, utili-
more feasible when implemented in indus- tinue to grow and prices for products to re- zation, and sequestration (CCUS) facility
trial clusters, where plants from different main affordable (4). by the mid-2020s and deployment at scale
PHOTO: DAN KITWOOD/GETTY IMAGES
industries operate in close proximity. We Despite the potential of technologies such during the 2030s. In 2018, policy-makers
as CCS, many obstacles remain. For exam- created the Industrial Strategy Challenge
1
ple, their scale is small; industry as a whole Fund, which allocated £170 million to
Department of Earth and Environment, Boston University,
Boston, MA, USA. 2Center for Energy Technologies, captures only 40 million metric tons of car- clean growth and transforming construc-
Department of Business Development and Technology, bon dioxide (CO2) emissions per year, and tion and was in turn matched by £250 mil-
Aarhus University, Aarhus, Denmark. 3Science Policy adding all planned carbon capture units to lion of private sector investment. This fund
Research Unit (SPRU), University of Sussex, Falmer, UK.
4
Manchester Institute of Innovation Research, University of the tally increases that number only to 140 enabled industrial firms to engage in more
Manchester, Manchester, UK. Email: b.sovacool@sussex.ac.uk million metric tons (5). The motivation of a detailed pre–front-end engineering and de-
sign (FEED) studies of low-carbon Decarbonization in UK industrial clusters CCS Infrastructure Fund. In October
technologies (6). The map shows the location of the six largest clusters in terms of annual 2021, the government selected the
Policy momentum increased in greenhouse gas (GHG) emissions (million metric tons (Mt) of CO2-eq) HyNet project (in Merseyside) and
2019, when the UK government (top). The graph shows emissions from different industrial sectors the East Coast Cluster (which in-
enshrined a net-zero emission (excluding power generation) in six UK clusters (bottom), dominated cludes both Teesside and the Humber
target in law by amending the mostly by chemicals, refining, and iron and steel. Each of these clusters clusters) as potential first locations
2008 Climate Change Act, and in has aggressive plans in place for deployment of net-zero infrastructure. for CO2 transport and storage net-
2020, when the Ten Point Plan works in the mid-2020s. In August
for a Green Industrial Revolution 2022, the government shortlisted 20
aimed for the production and use power CCUS, hydrogen, and indus-
of 5 GW of low-carbon hydrogen trial carbon capture projects in these
by 2030 (mostly from natural gas SCOTLAND two clusters to proceed to the due
and CCS) and the deployment of diligence stage of the phase 2 cluster-
CCS in two industrial clusters by sequencing process.
NORTHERN Grangemouth
2025 and four clusters by 2030. 5.01 Mt CO -eq These UK efforts at industrial
IRELAND 2
UK ambition has recently been decarbonization did not arise in a
doubled to up to 10 GW of low- Teesside vacuum but rather emerged in a re-
carbon hydrogen production ca- 3.82 Mt CO2-eq gional context where Dutch, Danish,
pacity by 2030, with at least half of and Norwegian efforts have shaped
WALES
this being from electrolytic hydro- Humberside the UK approach. In Denmark, the
gen that is intended to be sourced 10.03 Mt CO2-eq Kalundborg Eco-Industrial Park has
from future renewable energy and been operating since the late 1960s
nuclear power capacity (7). Merseyside and has sought to achieve industrial
ENGLAND 5.04 Mt CO2-eq
To support the deployment of symbiosis by integrating electricity
these technologies in the coming South Wales supply, heat production and distribu-
years, policy-makers created a £240 8.98 Mt CO2-eq tion, steam generation for oil refin-
Southampton
million Net Zero Hydrogen Fund 3.23 Mt CO2-eq ing, and the use of surplus heat in
and a £1 billion CCS Infrastructure homes and commercial enterprises.
Fund, which are being implemented Cement Chemicals Food and drink Iron and steel In Norway, Shell, Total, and Equinor
through a cluster-sequencing strat- Paper and pulp Refining Other minerals or metals Other industry launched the Northern Lights proj-
egy in which cluster-based part- ect in 2020, with completion due to
Southampton
nerships first apply for funding for occur in 2024, seeking to establish
transport and storage infrastruc- Teesside the first cross-border carbon trans-
tures and then, in a second phase, port and storage network in the
for funding for CO2 capture instal- Grangemouth world. The Port of Rotterdam in the
lations, hydrogen production, and Netherlands launched its Porthos
fuel switching. To bypass previously Merseyside (Port of Rotterdam CO2 Transport
documented difficulties with pilot- Hub and Offshore Storage) initiative
ing and deploying carbon capture South Wales in 2022 to store ~2.5 million metric
technologies, such as those that oc- tons of CO2 per year offshore in the
curred with the $7.5 billion Kemper Humberside North Sea, ~20 km off the coast.
project in the United States, the UK 0 2 4 6 8 10 None of these efforts, however, will
is entirely avoiding the use of coal, Greenhouse gas emissions (Mt CO2-eq) operate at the larger scale of activi-
is avoiding troublesome technical ties in the UK, with the Kalundborg
features such as integrated gasification com- FROM INDIVIDUAL PROJECTS TO project representing an integration of indus-
bined-cycle turbines, and is not seeking pre- INTEGRATED CLUSTERS trial activities but not decarbonization, the
combustion capture at large power plants, UK industrial decarbonization policy has Northern Lights project representing only
related in part to earlier failures in govern- moved relatively quickly from problem explo- a transport and storage network, and the
ment support and policy for CCS. ration to general vision to implementation Porthos initiative erecting only a storage site.
The UK’s net-zero cluster plans have sev- and is increasingly focused on industrial clus- UK plans seek to integrate multiple technolo- CREDIT (GRAPHIC) K. FRANKLIN/SCIENCE; (DATA) SEE SUPPLEM
eral challenging characteristics of “mega- ters: large-scale facilities for colocated energy gies over industrial clusters that are much
projects” (8) such as high technological production, industrial manufacturing, distri- larger in terms of volume of manufacturing
novelty (because many of the technological bution, and transportation (9). Six specific and production and greater in terms of the
components are new to the UK or have not clusters, which account for more than 50% of carbon emissions to be captured than those
yet been applied at the scale involved here), direct carbon emissions from industry (10), of its European neighbors.
high structural complexity (because mul- are spread across Scotland (Grangemouth),
tiple components need to be integrated into Wales (South Wales), and England (the Technological challenges
a working system), and high pace (to meet Humber, Merseyside, Southampton, and The net-zero cluster plans are technologically
government targets for 2025 and 2030). Teesside) (see the figure). complex megaprojects because they involve
These net-zero megaprojects offer a rare Although these clusters have different many innovative technologies that need to
opportunity to identify salient real-world emission profiles, the three most important be integrated into wider systems. They are
implementation challenges with exceptional industries are oil refining, chemicals, and also encountering some emergent innova-
potential to inform global efforts at decar- iron and steel (see the figure). Five clusters tion barriers such as solvents for CCS, tech-
bonization elsewhere. submitted proposals to the first round of the nical standards and specifications for hydro-
public acceptance. Local concerns include affect other companies and the viability of divide; consistent core climate policy and
employment opportunities, rights of way net-zero projects. binding carbon targets that do not change
for new infrastructure, and the long-term Despite these tensions and risks, the UK unexpectedly over time; the importance of
environmental sustainability of using natu- experience points the way toward an ap- financing and stimulating decarbonization
ral gas for blue hydrogen owing to fugitive proach that enables collective action be- with public procurement and public reve-
emissions. Frequent public consultations tween companies in a cluster to build new nue; and reliance on harbors, seaports, and
have occurred across all six of the clusters systems together, with a particular empha- pipelines to distribute hydrogen and trans-
and have been especially visible in places sis on overcoming technological, organiza- port CO2 to remote areas and vital indus-
like the Humber. There, the city of Hull tional, policy, and even social implemen- trial clusters.
has run a campaign with regional partners tation challenges. UK policy-makers have Ultimately, there are still uncertainties
(called “Oh Yes! Net Zero”) to increase pub- pioneered new policy mechanisms that about financial support, standards, and sys-
lic knowledge about net-zero projects and could offer a template for global indus- tem integration of innovative technologies.
inform and educate the public about skills trial decarbonization, such as a cluster-se- Much could still go wrong, the UK strategy
and educational opportunities. quencing strategy that enables a modular remains centered on gas (and a near-term
approach to megaproject development and commitment to blue hydrogen, rather than
TENSIONS AND LESSONS differentiated business models to accom- green hydrogen, which implies environmen-
This industrial net-zero pathway involves modate industry specificities and differ- tal risks), and both hydrogen and CCS have
the co-construction of new technologies, ent system components. Interactions with suffered from media-hype cycles and a fail-
social networks, and institutions, and it firms also enable policy-makers to learn ure to deliver emissions reductions before
enables learning processes that aim to ad- and adjust policy designs over time while (15). But the rapid development of technical
dress technological novelty and system- also increasing stakeholder confidence in designs, projects, coalitions, and policies has
integration challenges. This sociotechnical the government’s willingness to drive and generated substantial momentum in the UK,
transition process is coevolutionary and support industrial decarbonization. with companies hoping to make final invest-
full of uncertainties, negotiations, and im- Salient domestic and international pol- ment decisions in 2023 with the goal of deliv-
plementation struggles (14). icy implications arise as well. In the UK, ering the first low-carbon industrial clusters
Although the UK’s net-zero cluster plans most policy attention has focused on tech- by 2025 to 2027. Hopefully this momentum
have progressed well, they also exhibit dis- nologies and finance, which are essential can encourage other industrial firms to fol-
tinct tensions. One tension exists between prerequisites for many industrial organi- low the UK’s lead, showing how such firms
the desire for high-speed delivery to meet zations. Less attention has been given to that bear considerable historical responsibil-
targets and allowing for flexibility and wider sociotechnical system issues such as ity for climate change can harness the capa-
learning, which is needed because there are skills (including welders, machinists, and bilities necessary for solving it. j
many new components that have never be- civil engineers) or standards and regula-
REF ERENCES AND NOTES
fore been integrated at the ambitious scale tions (e.g., CO2 specifications, health and
1. International Energy Agency (IEA),“Industry” (IEA, 2022);
that is required in the UK. Another tension safety regulations, planning requirements), https://www.iea.org/reports/industry.
exists around the modular approach that which could lead to delays. Skills develop- 2. Committee on Climate Change,“Net zero technical
report” (Committee on Climate Change, 2019).
the UK cluster-sequencing strategy has ment can be addressed by further invest- 3. Intergovernmental Panel on Climate Change,“Climate
used by separately advancing and funding ments in infrastructure, such as the HyNet change 2022: Mitigation of climate change. Contribution
infrastructures and plant-specific carbon Academy, across all clusters, and standards of Working Group III to the sixth assessment report of the
Intergovernmental Panel on Climate Change,” P. R. Shukla
capture and hydrogen projects. This has and regulations can be tackled by proactive et al., Eds. (Cambridge Univ. Press, 2022).
enabled progress but may not yet pay suffi- efforts within government. Internationally, 4. P. Fennell, J. Driver, C. Bataille, S. J. Davis, Nature 603, 574
(2022).
cient attention to system integration issues. the UK is trialing new forms of policy inter- 5. R. F. Service, Science 371, 1300 (2021).
Megaprojects with many innovative compo- vention such as regulated asset base models, 6. UK Research and Innovation,
nents usually go through several rounds of differentiated strike prices for carbon, and “Industrial Strategy Challenge Fund” (2022);
https://www.ukri.org/what-we-offer/our-main-funds/
learning and design adjustments, which has cross-border tariffs, which all seek to stimu- industrial-strategy-challenge-fund/.
not happened in the UK, where the hope is late a market for local decarbonization and 7. Department for Business, Energy, and Industrial Strategy,
“British energy security strategy (updated 7 April 2022)”
that everything will fall into place. attempt to minimize carbon leakage. (UK government policy paper, 2022).
Other risks exist not only in isolation Nevertheless, not every aspect of the UK 8. B. Flyvbjerg, Proj. Manage. J. 45, 6 (2014).
but also in relation to each other. One approach will be generalizable to other 9. P. Devine-Wright, Energy Res. Soc. Sci. 91, 102725 (2022).
10. HM Government,“Industrial decarbonisation strategy”
of these is skills development, which in- countries. Some elements will be difficult (UK government policy paper CP 399, 2021).
cludes the possible lack of skills or con- to emulate, such as the smaller nature of 11. Equinor,“H2H Saltend: The first step to a zero carbon
Humber” (2020); https://www.equinor.com/energy/
struction labor that the UK may have if it the UK economy compared with the more h2h-saltend.
embarks on decarbonization across mul- spatially and industrially diverse economies 12. M. Ringel, N. Bruch, M. Knodt, Energy Res. Soc. Sci. 77,
tiple clusters simultaneously. The HyNet of China and the United States; the bind- 102083 (2021).
13. J. Meckling, Glob. Environ. Polit. 21, 134 (2021).
Consortium based at the University of ing and stringently enforceable nature of 14. B. K. Sovacool, F. W. Geels, Environ. Innov. Soc. Transit. 41,
Chester’s Thornton Science Park is being the Climate Change Act, which is (so far) 89 (2021).
15. A. Martínez Arranz, Glob. Environ. Change 41, 124 (2016).
funded by the government to “pioneer the distinctive to the UK; the availability of
new skills required to meet the country’s adequate carbon storage capacity in both ACKNOWL EDGMENTS
Net Zero targets,” but it will support only depleted oil and gas reservoirs and salt cav- We acknowledge support by the UK Research and Innovation
one cluster, at Merseyside. Another risk erns; and a readily available supply of natu- (UKRI) Industrial Strategy Challenge Fund (ISCF) Industrial
Challenge as part of UK Industrial Decarbonisation Research
is associated with increasing interdepen- ral gas to produce blue hydrogen. Policy- and Innovation Centre (IDRIC) award number EP/V027050/1.
dence between industries. The closure or makers around the world, however, can
withdrawal of a major firm, such as the replicate other aspects of the UK approach, SUPPL EMENTARY MATE RIALS
Essar Refinery in Merseyside or Equinor such as strong political commitment for in- science.org/doi/10.1126/science.add0402
or Drax in the Humber, could negatively dustrial decarbonization across the political 10.1126/science.add0402
I
n his new book, The Entangled Brain: brain organization. Disciplines, we learn, are mer is bovine.
How Perception, Cognition, and Emotion entangled too. The book says little about the bodies,
Are Woven Together, Brazilian neu- So, what is the remedy for reductionism? minds, and reciprocal interactions between
roscientist Luiz Pessoa offers a way to Pessoa goes for large-scale distributed circuits organisms and their environments. Certainly,
construe the brain as a fully integrated within a network perspective—a complex sys- “a brain can be thought of as an entire cir-
organ, a framework that “while not rare, tems approach where “many relatively sim- cuit ‘in between’ sensory and motor cells.”
is also not mainstream among neuroscien- ple interacting parts” exhibit “emergent” be- Perception, nevertheless, is virtual action.
tists.” A “divide-and-conquer strategy” has haviors. Emergence can be invoked as a free The Entangled Brain often reads more
produced ever more refined brain maps, he miracle, and the misuse of networks lends like a manifesto than an argument. Indeed,
argues, and subsequent leaps from structure itself to hairball graphs. However, Pessoa’s mantras such as “circuit X produces behavior
to function. However, not only are anatomi- amalgamation of systems theory, cybernetics, Y” betray a can of misconceptions. However,
cal brain areas far from simply located units and network science is a necessary step. there is room for both separation and con-
of cognition but, as the subtitle of the book Pessoa claims that “biology does not work nection, as the synapse metaphorically sym-
makes explicit, perception, cognition, and like physics, and even less so like engineer- bolizes and literally enables. The disputes be-
emotion are also interweaved. ing.” He challenges linchpin assumptions in tween lumpers and splitters are half-truths.
To stress the networked nature of the the life and mind sciences—the reducibility Given Pessoa’s wink at a processual view
brain, Pessoa has chosen a timely adjective: of organisms and their brains, ceteris pari- of life, one wonders whether his post-
“entangled.” He seeks a portrait of the brain bus, and the belief that truth is to be found in reductionism also calls for a postmaterialist
beyond the high-resolution caricature of cog- simplicity. The obviously nontrivial neuroscience. Paraphrasing Erwin
nitive functions placed inside cerebral boxes. requires restating: We cannot ex- Schrödinger, if verschränkung
The first chapters of the book build the plain “all biology in terms of physics (entanglement) is the defining
PHOTO: SIMON RITZMANN/GETTY IMAGES
case for the problem to be solved: “Our un- and chemistry.” characteristic of brains and minds,
derstanding of the role of a specific region Pessoa devotes many pages to it enforces an entire departure
needs to be gradually bootstrapped.” Pessoa his own research on emotion. The from classical lines of thought. In
initially dives into brain anatomy because, no reader is then introduced to the role this sense, The Entangled Brain
matter how dry, it is a must. In turn, proper of the hypothalamus, the amygdala, instantiates yet another con-
the insula, and other brain areas servative revolution in current
The reviewer is at the Instituto de Neurociencias, The Entangled Brain
such as the cingulate and prefrontal Luiz Pessoa
neuroscience. j
Consejo Superior de Investigaciones Científicas–
Universidad Miguel Hernández de Elche, Alicante, Spain. cortex. Wondering about neural mo- MIT Press, 2022.
Email: agomezmarin@gmail.com dularity, Pessoa discusses the logic 280 pp. 10.1126/science.ade8689
GENETICS
By Luis A. Campos smelled like a mixture of a McDonald’s and quences of their work, the results are often
a firing range”), as well as Barbra Streisand’s unedifying,” Cobb complains. His moral el-
I
n the fall of 1972, heralded by a flurry of genetically identical dogs and Greenpeace’s bows are sharp, and he is quick to point out
new research, “the age of genetic engi- foiled efforts to kidnap Dolly, the cloned errors and hypocrisies, whether from biotech
neering had begun, and no one seemed sheep. capitalists’ unholy mixtures of “overexcite-
to care,” observes Matthew Cobb in As As a drosophilist with a journalist’s gimlet ment and ill-considered hyperbole,” journal-
Gods: A Moral History of the Genetic Age, eye for uncovering both technical subtleties ists who have “little grasp of either ethics or
as he describes the advent and rise of re- and situational irony, Cobb interweaves tales genetics,” or pious musings from lab workers
combinant DNA technologies, the presumed of practicalities and moralities, with as care- and ethicists alike. It is through careful atten-
fulfillment of the dreams of decades past. But ful attention to scientific achievements as to tion to the details of complex circumstances
everyone began to care, soon enough. regulatory and social contexts. He is keenly that the book achieves clarity from what
The 1975 Asilomar meeting on potential aware of the happenstance role of money and would otherwise be a muddled morass of
biohazards serves as a recurring touchstone politics, and he also has a knack for telling detailed technical issues, ethical jargon, and
competing interests.
Cobb also calls for respect and engage-
ment with voices, views, and concerns com-
ing from beyond laboratory walls or bureau-
cratic beltways. He notes that some fears, for
instance those of genetically modified crops,
“are apparently rooted deeper than facts can
reach,” even as he concludes that “neither
utopia nor catastrophe has materialised.”
While Cobb constantly grapples with the
shifting boundaries of the technical and the
ethical and is not always consistent in his
conclusions—it is less a moral history than
one that engagingly moralizes—his render-
ings of the relations, entanglements, and
historical ironies are told with a keen eye
to scientific details, finances, and contexts
that matter. He shows time and again how
Maxine Singer, Norton Zinder, Sydney Brenner, and Paul Berg converse at the 1975 Asilomar conference. complicated social dynamics of science can-
not always be easily solved, even if matters
for Cobb’s remarkable jaunt through the descriptions: Genentech in its earliest days often look clearer in retrospect: “Real-world
twists and turns of the genetic engineering is described as “barely more than a rented problems, most of them social and not ame-
revolution. “Organising an international con- office and some headed notepaper,” while nable to simple technofixes, have repeatedly
ference is a pain in the backside at the best of Monsanto’s many and repeated blunders brought a sharp dose of reality to the dreams
times,” he notes. “Organising an international connect to its “reputation for unthinking of the genetic engineers,” he notes midway
conference with the world’s press clamouring ambition.” through the book, before concluding again
to attend must be hell.” The book is clearly Cobb astutely captures sudden transfor- near the end: “We need to temper the visions
not your father’s foray through a fog of subtle mations, as with the advent of gene patent- of utopia, as well the fears of future dystopia.”
distinctions and philosophical jargon. ing, when “what had long been seen as either Deftly navigating between the Scylla of
Driven by three “areas of concern”—heri- immoral or unconstitutional became widely inscrutable pronouncements from policy-
table human gene editing, gene drives, and accepted. Life itself could be owned, and ev- makers on task forces and the Charybdis of
pathogen manipulation—As Gods ranges eryone thought it was normal.” And banal sureties from interested prac-
from recombinant DNA to synthetic biology he observes how even well-meaning titioners, Cobb’s integration and
and from “Frankenfood” and biological weap- attempts at biosecurity related to synthesis of the work of many other
ons to gene therapy and #CRISPRbabies. bioweapons research may lead in- scholars in a variety of fields who
PHOTO: ALBUM/ALAMY STOCK PHOTO
But local color is also abundant. We learn, advertently to the opposite. Through have explored these issues within
for example, about the development of a its various case studies, As Gods science, within journalism, and
“steampunk-sounding gene gun” at Stanford shows that the ethical minefield is within the worlds of scholarship
University in 1987 (“the laboratory soon not some rhetorical flourish—it is make As Gods a valuable new go-to
the very world of everyday genetic source that avoids common pieties
The reviewer is Baker College Chair for the History of As Gods
engineering research. Matthew Cobb
and ritual invocations. j
Science, Technology, and Innovation in the Department of
History, Rice University, Houston, TX 77005, USA. “When scientists muse about Basic Books, 2022.
Email: lc@rice.edu the political and sociological conse- 464 pp. 10.1126/science.ade5848
10.1126/science.adf1013
government should leverage this event to to China’s onshore wind and photovol- REF ERENCES AND NOTES
forge new collaborations between govern- taic market. The richest wind and solar 1. J. I. Lewis et al., Science 350, 1034 (2015).
ments, research institutions, NGOs, and resources are located in the northern and 2. C. Wang, F. Wang, Science 357, 764 (2017).
local communities. Together, this coali- western regions of China, far from the 3. BP, Statistical Review of World Energy (2022);
https://www.bp.com/en/global/corporate/
tion can advance a shared commitment to high-demand, population-dense areas (5). energy-economics/statistical-review-of-world-
conserve one of the few coral reef refuges Provinces in the coastal region consume energy.html.
from climate change. approximately 80% of total national elec- 4. National Energy Administration, “National renew-
Karine Kleinhaus1*, John J. Bohorquez1,2, Yasser M. tricity (6), which is problematic given that able energy power development monitoring and
evaluation report” (2021); www.nea.gov.cn/2022-
Awadallah3, David Meyers2, Ellen Pikitch1 the vast majority of the installed capacity
1 09/16/c_1310663387.htm [in Chinese].
Stony Brook University, School of Marine and is separated by a distance of more than
Atmospheric Sciences, Stony Brook, NY 11790, 5. C. Wang et al., Renew. Sust. Energ. Rev 134, 110337
USA. 2Conservation Finance Alliance, Bronx, NY
1000 miles. Long-distance transmis- (2020).
10460, USA. 3Egyptian Environmental Affairs sion is highly inefficient; an ultrahigh- 6. P. Sherman et al., Sci. Adv. 6, eaax9571 (2020).
Agency, Sharm El Sheikh, South Sinai Governorate voltage line loses 3.5% of power or more 7. S. Zhang, Nature 514, 168 (2014).
46, Egypt. 8. J. Liu et al., Engineering 7, 1611 (2021).
as it travels (6, 7). As planned, China is
*Corresponding author. 9. Polaris Solar PV, “120 stock wind and photovoltaic
Email: karine.kleinhaus@stonybrook.edu building massive wind and solar power projects (6.5GW) in three provinces were abolished
bases in the Gobi and other desert areas. (List Attached)” (2022); https://guangfu.bjx.com.cn/
REFERENCES AND NOTES
Unfortunately, energy storage facilities news/20220913/1254435.shtml [in Chinese].
1. IPCC, in Global Warming of 1.5°C: An IPCC Special and transmission channels are difficult to 10. S. O’Meara, Y. Ye, Nature 603, S41 (2022).
Report on the Impacts of Global Warming of 1.5°C above 11. X. Zheng, “Pumped storage hydropower to bloom
Pre-Industrial Levels and Related Global Greenhouse achieve in these areas, and without them, in China,” China Daily (2021); www.chinadaily.com.
Gas Emission Pathways, in the Context of Strengthening even more renewable energy is likely to be cn/a/202109/29/WS6153f4d8a310cdd39bc6c5b9.
the Global Response to the Threat of Climate Change, wasted (8). html.
Sustainable Development, and Efforts to Eradicate 12. A. Alirezazadeh et al., Energy 191, 116438 (2020).
Poverty, V. Masson-Delmotte et al., Eds. (Cambridge
The central government encourages
University Press, 2018), pp. 3–24. local governments to build renewables
10.1126/science.adf3720
2. M. Fine, H. Gildor, A. Genin, Glob. Change Biol. 19, 3640 but sets penetration targets for each
(2013). province to avoid unchecked construc-
3. E. O. Osman et al., Glob. Change Biol. 24, e474 (2018).
4. M. Khaled, Int. J. Engin. Educ. 4, 17 (2019). tion. As a result, some provinces have
TECHNICAL COMMENT ABSTRACTS
5. A. D. Shepherd, A. S. M. Khalil, M. A. Amer, “State of the suspended wind power and photovoltaic
marine environment report for the Red Sea and Gulf projects, especially projects that can- Comment on “Models predict planned
of Aden (SOMERSGA II)” (The Regional Organization phosphorus load reduction will make Lake
for the Conservation of the Environment of the Red
not be completed because of land use or
COVID-19 policies. By 13 September, 120 Erie more toxic”
Sea and Gulf of Aden, 2020); http://persga.org/
Documents/Publications/QR_Downloads/English/ projects with a total scale of 6492 MW Jef Huisman, Elke Dittmann, Jutta Fastner, J.
SOMERSGA_2020.pdf. had been abolished in Hebei Province, Merijn Schuurmans, J. Thad Scott, Dedmer B.
6. M. Spalding et al., Mar. Pol. 82, 104 (2017). Van de Waal, Petra M. Visser, Martin Welker,
7. Marine Protection Atlas, Marine Protection by Country/ Shanxi Province, and Shaanxi Province,
Egypt (2022); https://mpatlas.org/countries/EGY. representing 2267.5 MW and 4224.5 MW Ingrid Chorus
8. M. Samy-Kamal, Rev. Fish Biol. Fish. 25, 631 (2015). of wind and photovoltaic projects, respec- Hellweger et al. (Reports, 27 May 2022,
9. J. J. Silver, L. M. Campbell, Int. Soc. Sci. J. 68, 241 (2018). pp. 1001) predict that phosphorus
tively (9).
10. R. Victurine et al., “Conservation finance for coral limitation will increase concentrations of
reefs: A vibrant oceans initiative whitepaper” (Wildlife To fundamentally improve renewable
Conservation Society, Bronx, NY, 2022); http://wcs.org/ energy penetration, China must priori- cyanobacterial toxins in lakes. However,
coral-finance-whitepaper. tize energy storage technologies such as several molecular, physiological, and
pumped storage hydropower and virtual ecological mechanisms assumed in their
COMPETING INTERESTS
synchronous machine technology (10, 11), models are poorly supported or contra-
K.K. is president of the Red Sea Reef Foundation. J.J.B. and
dicted by other studies. We conclude that
D.M. are paid consultants for the Global Fund for Coral Reefs. which will allow the infrastructure cur-
their take-home message that phospho-
rently in development to provide power
10.1126/science.adf3377 rus load reduction will make Lake Erie
to distant regions. The country also needs
more toxic is seriously flawed.
to build transregional high-capacity trans-
Full text: dx.doi.org/10.1126/science.add9959
mission channels and flexible grids (12).
China must balance Meanwhile, the government should seek
new market solutions and break down the
Response to Comment on “Models predict
planned phosphorus load reduction will make
renewable energy sites barriers of China’s special regional power
market by establishing an interprovincial
Lake Erie more toxic”
Ferdi L. Hellweger, Charlotte Schampera, Robbie
China leads global renewables instal- power trading market mechanism (8). M. Martin, Falk Eigemann, Derek J. Smith,
lation (1, 2). In 2021, China’s solar and Finally, it is necessary to strengthen the Gregory J. Dick, Steven W. Wilhelm
wind installed capacity was 306.4 GW development of distributed renewables Huisman et al. claim that our model is
and 329 GW, respectively, accounting for and offshore wind power in the east (6) to poorly supported or contradicted by other
36.3% and 39.9% of the global market (3). alleviate the mismatch between renewable studies and the predictions are “seriously
However, enthusiasm for installed capac- energy construction and market demand. flawed.” We show their criticism is based
ity obscures insufficient penetration into Yu Yang1,2,3* and Siyou Xia1,2 on an incomplete selection of evidence,
1
some areas of the country, which hinders Institute of Geographic Science and Natural misinterpretation of data, or does not
the potential benefits of wind and solar Resources Research, Chinese Academy of
Sciences, Beijing, China. 2College of Resources actually refute the model. Like all ecosys-
energy. In 2021, the average waste rates and Environment, University of Chinese tem models, our model has simplifications
of China’s wind and solar were 3.1% and Academy of Sciences, Beijing, China. 3Institute and uncertainties, but it is better than
2.0%, respectively, and more than 10% in of Strategy Research of Guangdong-Hong
existing approaches that ignore biology
Kong-Macao Greater Bay Area, Guangzhou, China.
Qinghai Province (4). *Corresponding author. and do not predict toxin concentration.
Geographic imbalance is a challenge Email: yangyu@igsnrr.ac.cn Full text: dx.doi.org/10.1126/science.ade2277
PLANT MORPHOLOGY
Drought shapes
plant architecture
S
ince plants colonized
land, they have developed
increasingly complex vessel
architectures to carry water
from their roots to their high-
est leaves. Vascular plants now
display a diversity of xylem strand
shapes in cross section, from
elliptical to linear to many lobed.
Bouda et al. investigated whether
selection from drought, which causes
vessel cavitation and embolism, drove
the complexity of xylem strand shape
as plants inhabited drier climates. By
simulating embolism spread between vessels
across varying shape and complexity, including
those seen in extant lycophytes and ferns and extinct
plant fossils, the authors found that evolutionary changes
in xylem strand shape have reduced embolism spread and False-color image of a
made plants less vulnerable to drought. —BEL fossilized tree fern showing
Science, add2910, this issue p. 642 the inner xylem network (blue)
DRUG DEVELOPMENT arthritis to a similar extent as Australia, over 20 years and length so that cells can
injection of the US Food & Drug found that they are increasing continue dividing. Cancer
An oral route to Admistration–approved TNF- much faster than those over cells often have high telom-
TNF inhibition targeting biologic etanercept. longer periods. Better under- erase activity, and noncoding
Excessive production of the —AMV standing of such extremes mutations in the TERT gene
proinflammatory cytokine Sci. Signal. 15, eabi8713 (2022). is vital for effective climate (which encodes telomerase)
tumor necrosis factor (TNF) adaptation and to reduce the are frequently found in tumors. PHOTO: LUDWIG LUTHARDT, MUSEUM FÜR NATURKUNDE, BERLIN
C
loudiness is a fundamental determinant of Earth’s energy
in a within the local region ture. The resulting alloy has
balance. Shortcomings in our ability to faithfully represent
of the Milky Way, filling a gap high creep resistance even
cloud coverage on a global scale are therefore a major
between laboratory measure- under high stresses, a impor-
source of uncertainty in climate models. Datseris et al.
ments and constraints from tant property in structural
developed a conceptual model of global cloudiness that
the distant Universe. —KTS alloys. —BG
uses only a few basic state variables such as surface tempera-
Science, abi9232, this issue p. 634 Science, abq7739, this issue p. 659
ture and pressure velocity to calculate the spatiotemporal
distribution of clouds over the whole planet. In addition to
helping to develop a better theoretical understanding of clouds,
CORONAVIRUS STRUCTURAL BIOLOGY
their work should provide insight into how cloudiness will
Defending against A group II intron change in a changing climate. —HJS
Geophys. Res. Lett. 10.1029/2022GL099678 (2022).
Omicron ready to attack
The Omicron BA.1 lineage By forming ribonucleoprotein Global cloudiness can be approximated from a small array of basic
of severe acute respiratory (RNP) complexes with special- atmospheric parameters.
syndrome coronavirus 2 ized reverse transcriptases,
(SARS-CoV-2) emerged in group II introns can splice out
late 2021 and quickly became of RNA and insert themselves ELECTRON MICROSCOPY cross-sectional pattern of a
dominant, in part because of a into new DNA sites. Chung et al. laser beam, which crosses paths
large number of mutations that used cryo–electron microscopy
Focusing an electron with an electron beam to shape
allowed escape from exist- to investigate how an ancient beam with light its electron distribution. The
ing antibodies. New infection class of group II intron retroele- Like everyday photography, it is modulator provides a means to
waves have come from other ments recognize the shape and possible to increase the bright- program and pattern electron
Omicron sublineages. Park et sequence of a highly structured ness of an electron beam or beams with submillimeter reso-
al. found that either a vaccina- DNA target, thereby revealing prolong the exposure time, thus lution, which can help to lower
tion booster or a breakthrough new molecular recognition improving the picture quality in the electron exposure needed to
infection elicits neutralization strategies between RNPs and electron microscopy. However, image a living biological sample.
activity against the Omicron DNA. Structural comparison of for living biological tissues, too —YY
variants, but only a break- the isolated RNP with that of intense a beam could harm Phys. Rev. X 12, 031043 (2022).
through infection induces the DNA-bound holoenzyme the sample, and for experi-
an antibody response in the reveals that the group II intron ments in which high temporal
nasal mucosa, which might RNP is primed to attack its DNA resolution is needed, a longer THERAPEUTICS
give better protection against target without major confor- exposure time would mean a
transmission. Testing a panel mational rearrangements. The lower frame rate. Mihaila et al.
Opening the gates for
of antibodies, the authors study sheds light on retroele- used a laser beam to shape an antibodies
PHOTO: NASA
showed that the antibody ment structure, function, and electron beam to improve its Delivery of therapeutics into
S2X324 potently neutral- proliferation. —DJ focus. Their setup uses a spatial the central nervous system is
izes all SARS-CoV-2 variants Science, abq2844, this issue p. 627 light modulator to control the notoriously difficult because of
CANCER IMMUNOTHERAPY
Dynamic bispecific duo
Bispecific antibodies are being
used for cancer immuno-
therapy because they target
two different antigens, thus
facilitating T cell targeting to
tumors. Odronextamab is a
CD20xCD3-bispecific antibody
that shows promising activity
in patients with diffuse large
B-cell lymphoma (DLBCL),
but not all patients achieve
complete responses and there
remains a high unmet need
in the setting of relapsed or
refractory disease. Wei et al.
demonstrate that REGN5837, a
CD22xCD28-bispecific antibody,
C
loudiness is a fundamental determinant of Earth’s energy
in a within the local region ture. The resulting alloy has
balance. Shortcomings in our ability to faithfully represent
of the Milky Way, filling a gap high creep resistance even
cloud coverage on a global scale are therefore a major
between laboratory measure- under high stresses, a impor-
source of uncertainty in climate models. Datseris et al.
ments and constraints from tant property in structural
developed a conceptual model of global cloudiness that
the distant Universe. —KTS alloys. —BG
uses only a few basic state variables such as surface tempera-
Science, abi9232, this issue p. 634 Science, abq7739, this issue p. 659
ture and pressure velocity to calculate the spatiotemporal
distribution of clouds over the whole planet. In addition to
helping to develop a better theoretical understanding of clouds,
CORONAVIRUS STRUCTURAL BIOLOGY
their work should provide insight into how cloudiness will
Defending against A group II intron change in a changing climate. —HJS
Geophys. Res. Lett. 10.1029/2022GL099678 (2022).
Omicron ready to attack
The Omicron BA.1 lineage By forming ribonucleoprotein Global cloudiness can be approximated from a small array of basic
of severe acute respiratory (RNP) complexes with special- atmospheric parameters.
syndrome coronavirus 2 ized reverse transcriptases,
(SARS-CoV-2) emerged in group II introns can splice out
late 2021 and quickly became of RNA and insert themselves ELECTRON MICROSCOPY cross-sectional pattern of a
dominant, in part because of a into new DNA sites. Chung et al. laser beam, which crosses paths
large number of mutations that used cryo–electron microscopy
Focusing an electron with an electron beam to shape
allowed escape from exist- to investigate how an ancient beam with light its electron distribution. The
ing antibodies. New infection class of group II intron retroele- Like everyday photography, it is modulator provides a means to
waves have come from other ments recognize the shape and possible to increase the bright- program and pattern electron
Omicron sublineages. Park et sequence of a highly structured ness of an electron beam or beams with submillimeter reso-
al. found that either a vaccina- DNA target, thereby revealing prolong the exposure time, thus lution, which can help to lower
tion booster or a breakthrough new molecular recognition improving the picture quality in the electron exposure needed to
infection elicits neutralization strategies between RNPs and electron microscopy. However, image a living biological sample.
activity against the Omicron DNA. Structural comparison of for living biological tissues, too —YY
variants, but only a break- the isolated RNP with that of intense a beam could harm Phys. Rev. X 12, 031043 (2022).
through infection induces the DNA-bound holoenzyme the sample, and for experi-
an antibody response in the reveals that the group II intron ments in which high temporal
nasal mucosa, which might RNP is primed to attack its DNA resolution is needed, a longer THERAPEUTICS
give better protection against target without major confor- exposure time would mean a
transmission. Testing a panel mational rearrangements. The lower frame rate. Mihaila et al.
Opening the gates for
of antibodies, the authors study sheds light on retroele- used a laser beam to shape an antibodies
PHOTO: NASA
showed that the antibody ment structure, function, and electron beam to improve its Delivery of therapeutics into
S2X324 potently neutral- proliferation. —DJ focus. Their setup uses a spatial the central nervous system is
izes all SARS-CoV-2 variants Science, abq2844, this issue p. 627 light modulator to control the notoriously difficult because of
RACIAL DISPARITIES
Assisted reproductive
CELL BIOLOGY disparities
In the United States, fetal and
Nuclear mechanosensing and cell division neonatal deaths are dispropor-
tionately higher among some
C
ell division depends on the biochemical activation and nuclear translocation of cyclin
B1–CDK1 complexes. Dantas et al. used micromanipulation and high-resolution imaging to racial and ethnic groups, particu-
study the role of biomechanical forces as cultured mammalian cells approached mito- larly non-Hispanic Black women.
sis. They found that during the transition from G2 to mitosis, actomyosin contractility is Although the underlying causes
transmitted to the nucleus through the Linker of Nucleoskeleton and Cytoskeleton (LINC) of the disparities are not fully
complex. This process triggers nuclear envelope unfolding and increased nuclear tension, which understood, it is assumed that
activates calcium-dependent phospholipase cPLA2 and results in faster translocation of cyclin B1 differences in socioeconomic
into the nucleus. This mechanical signal fine-tunes cyclin B1 transport across the nuclear pores, status contribute to it. However,
ensuring timely mitotic entry. Thus, the nucleus acts as a force sensor, regulating cell division little is known about racial and
according to the cellular tension state. —SMH J. Cell Biol. 221, e202205051 (2022). ethnic disparities among women
who opt for medically assisted
Mechanical cues from nuclear deformation trigger the biochemical events involved in the timing of cell division, reproduction, which includes
shown in this light micrograph. assisted reproduction technol-
ogy such as in vitro fertilization.
These procedures are largely
used by economically privileged
the blood–brain barrier, which PARTICLE PHYSICS of the off- and on-shell Higgs women because US health
blocks most molecules from boson production to determine insurance companies rarely
getting across. For antibody-
How wide is the Higgs? the boson’s width and found cover the costs. Lisonkova et al.
The discovery of the Higgs
based therapies, the challenges that it agreed with the Standard examined this knowledge gap
boson 10 years ago provided
are even greater because they Model prediction. —JS in a study of US singleton births
a measurement of its mass.
carry a high risk of triggering Nat. Phys. 10.1038/s41567-022- between 2016 and 2017, when
Measuring its lifetime, a property
neuroinflammation after cross- 01682-0 (2022). more than 90,000 infants were
connected to the uncertainty in
ing the blood–brain barrier. conceived by medically assisted
its mass through the Heisenberg
Edavettal et al. addressed this reproduction. Analysis of births
issue by combining antibody- principle, would enable a check INVASION ECOLOGY conceived by assisted reproduc-
based therapeutics with against the Standard Model tion technology revealed that,
transcytosis-enabling modules of particle physics. However, Megaherbivores compared with infants of non-
engineered to facilitate recep- making a direct measurement suppress invasion Hispanic White women, neonatal
tor-mediated transport into the is tricky because the uncer- Herbivores can play an important death was four times higher in
IMAGE: DR. GOPAL MURTI/SCIENCE SOURCE
brain. The authors tested their tainty in the Higgs boson mass role in plant invasions by pref- infants of non-Hispanic Black
approach in multiple animal (its particle width) is predicted erentially feeding on either the women and nearly two times
models and disease conditions, to be much smaller than the introduced or native species or higher among Asian/Pacific
ranging from neurodegenerative experimental resolution of the by aiding in seed dispersal. Wells Islander and Hispanic infants.
disease to cancer metastasis, detectors at the Large Hadron et al. investigated whether mega- This suggests that other unmea-
with promising results in each Collider (LHC). Instead, the herbivores such as elephants sured factors, including racism
setting. —YN Compact Muon Solenoid col- facilitate or hinder the establish- and institutional bias, may drive
Med (N Y). 10.1016/ laboration at the LHC used ment of Opuntia stricta, a cactus these disparities. —EEU
j.medj.2022.09.007 (2022). comparative measurements that has spread prolifically across Pediatrics 150, e2021055855 (2022).
Shayak Sengupta, Peter J. Adams, Thomas A. Deetjen, Puneet Kamboj, Swati D’Souza, RESULTS: We find that average nationwide CO2
Rahul Tongia, Inês M. L. Azevedo* and SO2 emissions intensities for electricity in
India fail to capture the considerable heteroge-
neity between states. Electricity production and
INTRODUCTION: India is the world’s third-largest est coal plants are located near coal mines in a consumption and associated emissions be-
economy and power producer, with growing handful of poorer, eastern states. Electric- tween Indian states show orders-of-magnitude
electricity demand from low–per capita elec- ity generation mixes vary by state, and both differences tied to population, akin to the dif-
tricity consumption. Despite the growth of the central and state governments share juris- ferences between different countries around
renewable energy, coal-heavy electricity gen- diction over the power sector. the world. A carbon tax results in little short-
eration means that greenhouse gas and air term emissions reductions because there is
pollutant emissions from the power sector are, RATIONALE: A clear understanding of the emis- not enough dispatchable lower emission spare
and will remain, an important focus of public sions of greenhouse gases and air pollutants capacity to substitute coal. Moreover, it would
policies in India. from the Indian grid at a subnational scale has disproportionately increase costs to poorer,
Each state in India largely schedules and not existed before now. No study has yet quan- coal-heavy eastern states. The implementa-
dispatches its own power. Renewable elec- tified the expected spatial heterogeneity arising tion of sulfur controls will likely result in large
tricity capacity is concentrated mostly in from the current federal Indian power sector— reductions of SO2 emissions, with the impor-
wealthier states in southern and western i.e., which states are responsible for emissions tant outcome of reducing the current pre-
India. Meanwhile, hydroelectric power is based on the electricity that they generate or mature mortality associated with air pollution
located predominantly in Himalayan north- consume. We develop and present a reduced- in India. Our simulations suggest that dispatch-
ern and northeastern India. Coal capacity is order dispatch model of Indian power gener- ing plants at the regional level rather than at
found throughout the country, but the cheap- ation to assess CO2 and SO2 emission effects the state level would lead to a small increase
in both SO2 and CO2 emissions, with hetero-
geneous cost effects on states. Regionally co-
ordinated dispatch would also impose changes
Flow of CO2 emissions from electricity
in the spatial patterns of SO2 and CO2 emis-
sions by shifting generation and emissions
Maharashtra Maharashtra from distant plants to cheaper plants closer to
eastern coal-mining regions.
I
production-based, and consumption-based
ndia is the world’s third-largest economy India has planned sulfur emissions–control average annual emission factors for India aris-
and power producer (1, 2). Electricity de- regulations (31–33), the increased penetra- ing from power sector operations. Although
mand may double or triple by 2030 be- tion of renewable energy (34), and market previous work has used dispatch or capacity
cause India still has fairly low per capita reforms to coordinate and economically dis- expansion modeling to simulate Indian power
electricity consumption (3, 4). Such growth, patch electricity-generating units on a limited generation (35, 42–47, 49–52, 56), this work
although providing incredibly important en- basis at the national level as opposed to the uses a flexible, computationally simplified
ergy services and improving quality of life, state level (35). Currently, each state in India method. It reflects the real institutional and
will exacerbate climate change effects result- schedules and dispatches its own power, largely market organization of the Indian grid, where
ing from the emissions of greenhouse gases through long-term power purchase agreements each state self-schedules its electricity to meet
(GHGs) and premature mortality because of between generators and distribution compa- its demand from a respective portfolio of long-
air pollutant emissions. India’s total GHG emis- nies (which govern 90% of power transactions) term contracts with generators. We first eval-
sions already rank third in the world (5, 6), but (36). Eighty-two percent of renewable capacity uate the model’s simulations against reported
per capita GHG emissions remain low. Nearly is concentrated in 8 of 32 states and territories. generation data (figs. S6 to S13). We then use
all of India is breathing polluted air, and about Most of this renewable capacity is found in the model to simulate national policy inter-
a million people die prematurely every year as southern and western India, where wealthier vention scenarios: carbon taxes, stricter sulfur-
a result of outdoor air pollution (7–18), with states are located. Conventional hydro capac- control regulations, and regional scheduling
premature deaths projected to triple by 2050 if ity is located predominantly in Himalayan and dispatch among groups of states.
no action is taken to reduce air pollution (12). northern and northeastern India. Coal capacity
The power sector in India contributes to exists throughout the country, but the cheap- Estimating the emissions of GHGs and criteria
both air pollution and climate change because est coal plants are located near coal mines in a air pollutants from the Indian power sector
coal-fired power stations without air pollution– handful of poorer, eastern states (37, 38). This Currently, dispatch practices in India are a use
control technologies contribute to the bulk leads to electricity generation mixes varying of both economic dispatch based on variable
(>70%) of electricity generation (19–21). Indian widely by state (36). States are responsible for costs of generation and heuristics based on
coal electricity generation contributes to ~40% delivering power to consumers (36) and own a historical practices. Heuristic practices vary by
of India’s total GHG emissions (22). These coal plurality of monitored conventional capacity state, with some regional and national coordi-
plants also contribute to 50% of total sulfur (37). Likewise, both the central and state gov- nation (36, 52).
dioxide (SO2) emissions and 40% of total ni- ernments have overlapping jurisdictions over We model the Indian system as follows.
trogen oxide (NOX) emissions. These pollu- the power sector. This institutional framework First, we identify and characterize the elec-
tants lead to the formation of secondary PM2.5 leads to heterogeneous consequences from tricity generation fleet in India. We construct a
(particulate air pollution, specifically partic- centralized nationwide policies. database of all nonvariable renewable gener-
ulate matter <2.5 mm in diameter), resulting Previous efforts have used detailed techno- ators in India using publicly available data on
in premature mortality. Planned expansions economic modeling to evaluate emissions re- capacity greater than 25 MW and unit-specific
of coal generation capacity will exacerbate ductions from power plant air pollution control heat rates (37, 57, 58) for various years between
these effects (23–30). (39–41), greater renewable energy (42–50), 2014 and 2018. We choose the most recently
1
emissions-minimizing power sector operations reported or modeled heat rate. We fill in miss-
Department of Engineering and Public Policy, Carnegie Mellon
(51), and market reforms (35, 52–56). Some ing heat rates with a log-fit of existing heat rates
University, Pittsburgh, PA, USA. 2Center for Electromechanics,
University of Texas at Austin, Austin, TX, USA. 3Centre for of these previous efforts have explored state- for units as a function of capacity differing by
Social and Economic Progress (formerly Brookings India), level, spatial differences in policy outcomes, with coal and gas units (fig. S18).
New Delhi, India. 4Department of Energy Resources Engineering, some emphasis on current Indian wholesale We then combine this dataset with estimates
Woods Institute for the Environment, and Precourt Energy
Institute, Stanford University, Stanford, CA, USA. power market structure (42, 43, 45, 49, 50). of operating and maintenance (O&M) and
*Corresponding author. Email: iazevedo@stanford.edu However, most efforts have largely focused on fuel costs of fossil fuel generation as follows:
(i) For coal generators, we calculate production- only provide power to meet one state’s de- daily hydro capacity from reported daily hydro
weighted variable cost of power with the Gov- mand) or interstate plants (which are required generation (37). Then, we disaggregate that
ernment of India’s coal dispatch database to provide specific fractions of their electricity generation to the hourly level according to di-
(59), which reports grade-wise coal amounts generation to multiple states). urnal profiles for hydro generation (19). Finally,
sold to individual power stations. We combine Intrastate generating plants have 100% of we compare the capacity available to produce
these amounts with grade-wise fixed prices their generation serving the state in which that amount of electricity for the hour, and we
of coal from Coal India (the state-owned coal they are located. Interstate plants have por- scale the available hydro capacity for the hour
monopoly) and state-wise coal transport costs tions of their generation in each hour needed accordingly to represent the effective hydro
(38, 60). For plants without any reported sold to serve out-of-state demand. We identify these capacity available to run at 100% capacity for
coal amounts, we fill in using state-wise and capacity allocations for a plant to each state the hour.
ownership-wise (central, state, or private) me- from the MERIT India database and capacity Finally, we estimate SO2 and CO2 emission
dian calculated variable cost of power. Cal- allocations from the Government of India’s factors by multiplying unit heat rate for fossil
culated variable costs of power for coal units Central Electricity Authority. Our model cap- plants by fuel composition. We estimate SO2
largely match 1:1 to reported variable costs tures 75 to 85% of installed capacity based off because sulfur control has been the focus of
(fig. S19) of power from the MERIT India data- reported capacity allocations (61, 67) (fig. S2). Indian air pollution policy discussions since
base (61), which reports variable cost of gen- In fig. S3, we show how much of each state 2015 (32, 33). We assume domestic Indian
eration according to long-term power purchase electricity demand is provided by interstate production–weighted average coal composition
agreements between generators and states. plants versus intrastate plants. A table with (69) for all plants and use the mass-balance
(ii) For natural gas plants, we use a region-based intrastate and interstate capacity allocations approach presented by Srinivasan et al. (39).
approach with domestic and imported gas is also shown in table S1. We do not represent variation in coal quality
prices and applicable state taxes (62, 63). For We then develop a merit order dispatch curve between plants owing to data quality issues
nuclear and hydropower plants, we assume (68), where plants are ranked by increasing from the Government of India’s coal quality
the reported variable cost of generation in the marginal costs and where the capacity that data. Because of discrepancies between the
MERIT India database (61). can be provided by each plant is multiplied coal quality delivered to plants versus what
For nondispatchable energy sources (i.e., by the capacity allocation factor, which will Coal India charges plants, coal quality data bet-
wind and solar), we use average monthly di- be one for intrastate plants and a factor be- ter represent the prices that plants pay rather
urnal renewable generation profiles. We do so tween zero and one for interstate plants. This than what they actually use. (70). We assume
by first disaggregating nationwide renewable process is repeated for each hour of the year domestic Indian coal only with no imported
generation data for 2018 to 2019 (19) to obtain and for each Indian state, adjusting available coal, which disproportionately is used in a
diurnal profiles of renewable generation and generators with outage information from daily handful of coastal locations. For gas plants,
then applying these profiles to actual month- generation reports. We ignore transmission we assume natural gas for CO2 emissions (71)
ly renewable generation for each state from constraints, ramping, and minimum capac- and zero SO2 emissions.
September 2017 to August 2018 (64) (fig. S1). ity factor capabilities of generators, and we do Using the procedure mentioned in these pre-
The total demand for power in each state is not explicitly model interstate electricity trans- vious paragraphs, we estimate CO2 and SO2
estimated by decomposing total daily demand fers to meet any shortfalls in generation to emissions under current operations (i.e., our
reported at the state level from POSOCO (65) meet demand. We discuss the limited effect of baseline emissions) by dispatching generators
by state-level diurnal load profiles of demand ignoring ramping and minimum capacity fac- from low to high marginal cost to meet net de-
disaggregated at the monthly level from En- tor constraints in the supplementary mate- mand while considering all the Indian-specific
ergy Analytics Lab (66). The daily demand re- rials. These factors are examined ex post facto operations for inter- and intrastate plants. We
ported by state represents the power consumed for compliance instead of as constraints. Like- run the model for each of the 32 Indian states
within the state at the state boundary. We as- wise, we discuss the sensitivity of our results to and union territories individually. Once we
sume nondispatchable energy sources are shortfalls in generation to meet demand in the establish the baseline emissions, we also test
“must-take,” as is the case in current markets. supplementary materials. and model seven scenarios and estimate their
Thus, we estimate net demand for each hour The treatment of hydropower production effects on SO2 and CO2 emissions as follows.
of the year for each state by subtracting av- also warrants further details. Indian power
erage monthly diurnal renewable genera- operators currently use hydro capacity dur- Carbon tax policy at $10, $35, $50,
tion from estimated total hourly demand ing nonmonsoon months (generally January and $100 per ton
for a given hour. through May and November through Decem- We test the effects of a tax of $10, $35, $50, or
The next step is to identify which plants are ber) as marginal generators, placing gas gen- $100 per metric ton of CO2 on grid operations.
used to meet demand. If each state were op- erators less expensive than coal generators Currently, India has a modest carbon tax on
erating independently, this step would be well after this hydro capacity and dispatching coal coal of ~$3 per ton of CO2 charged as a fee per
approximated by developing a merit order and remaining gas generators by merit order ton of coal that is implicitly incorporated into
dispatch curve of the India power system—i.e., (36). Moreover, hydro reservoirs in India serve the variable cost of power from plants (72). The
computing net demand in an hour as total other purposes besides power generation (e.g., taxes we test are in addition to variable costs
demand minus nondispatchable generation as drinking water, irrigation, and flood con- of power. We translate the tax to an additional
(e.g., wind and solar) and then ranking dis- trol). On a diurnal basis, hydro generation high- cost to the plant operator using the carbon in-
patchable, nonrenewable generators (i.e., nu- ly correlates with net demand, which reflects tensity of each plant. For the carbon tax sce-
clear, hydro, coal, and gas) from low to high hydro’s load-following nature (fig. S4). Conse- narios, we assume $1 USD = ₹71 INR, which
marginal cost and dispatching plants up to the quently, we structure the model to dispatch adds ~300% to the average variable cost of
point where supply meets the hourly demand. power according to increasing O&M costs but coal generation with a $100/ton tax.
However, the Indian grid also has interstate considering hydro before coal and gas plants.
plants provide power to multiple states. We However, to incorporate hydro generation’s Air pollution–control technology adoption
thus categorize each plant and unit in the load-following behavior and to reflect the avail- The air pollution policy represents the minimal
system as either intrastate plants (which can ability of water in reservoirs, we first constrain control and costs needed to meet unimplemented
SO2 emissions regulations in India (table S2) (39). ($99 per ton). These costs only include reagent would rise from merging state markets into
As of December 2019, only 13.75 GW of capacity costs and increase capacity-weighted variable regional ones. We rerun the dispatch model
(~5% of monitored capacity) in India have any cost of power by 1 to 2%. All other associated under these new regional boundaries. For
operational sulfur control (31), and we cannot control costs fall in fixed costs according to each scenario, we operate the model at hourly
verify whether installed control runs regularly Indian regulations; they do not influence dis- resolution for September 2017 to August 2018.
because of a lack of publicly available contin- patch by variable cost of generation (39). We
uous emissions monitoring data. Moreover, in also run a scenario where we impose a $35 per What are the CO2 and SO2 emissions from
March 2021, the Government of India extended ton carbon tax along with sulfur control. electricity generation for each state?
implementation deadlines to 2025 (33), with We find that overall emissions of CO2 from the
current policy discussions highlighting whether Moving Indian power grid operations toward power sector are 820 megatons of CO2, or an
certain regions or plants need priority because regional markets average emission intensity of 711 kg of CO2 per
of high capital costs of sulfur-control equipment. We also test Indian states participating in the megawatt-hour (MWh). SO2 emissions amount
Therefore, for simplicity, we assume no sulfur same electricity markets by region, instead of to 6100 kilotons of SO2, with an average emis-
control at any plants in the base case scenario. state by state. Current policy discussions in sion intensity of 5.3 kg of SO2/MWh (figs. S6 to
Assumptions on control technologies and their India aim to shift power dispatch to more S8). Estimated emissions and generation match
variable costs come from Srinivasan et al. (39). coordination between states to share capacity the reported data for most fuels and regions
For this scenario, we first calculate the percent- and lower costs (35, 53, 55, 73). Moreover, work within 30% (figs. S3 and S6 to S13). However,
age reduction required for each unit to meet modeling future Indian grids assumes more considerable heterogeneity exists between states
Indian sulfur-control regulations. Then we as- renewable generation incumbent upon re- (figs. S9 to S13 and S27 to S31). Our estimated
sume the minimal, least-cost control technology gional or national dispatch to move electricity annual wholesale O&M costs for electricity are
required to meet that reduction from those around the country (45, 47–49). We consider $58.5 billion (₹4.2 lakh crore) (fig. S20), which
presented in Srinivasan et al. (39). For 368 units each Indian region (see fig. S5 for a map of is ~14% less than reported annual wholesale
totaling 72 GW of capacity, we assume dry lime- the regions)—i.e., north, south, east, west, and costs that state distribution utilities incurred to
stone rejection to reduce sulfur emissions ~60% northeast—as separate single markets where procure power in 2017 to 2018 (74).
at annualized cost of ₹6000 per ton of SO2 re- demand needs to be met. We still maintain the We compute both production- and consumption-
moved ($85 per ton). For the remaining 279 same modeling assumptions regarding renew- based emissions and their average emissions
units totaling 129 GW of capacity requiring re- ables as described before. We ignore transmis- intensity for each state (Fig. 1, Fig. 2, and tables
ductions >60%, we assume wet flue gas desul- sion constraints, so this assessment provides S3 and S4). Production-based emissions are
furization at annual cost of ₹7000 per ton of SO2 an upper bound of the economic benefits that the emissions associated with generation within
A C
B D
Fig. 1. Differences in electricity CO2 emissions between states in India. (A) Production (blue) and consumption (yellow) carbon intensities of each state versus production
(blue) and consumption (yellow) (y axis) versus electricity generation or consumption (x axis), split by states that are either net exporters or net importers of electricity. Inset
shows low-demand states. TWh, terawatt-hours. State abbreviations are provided in table S3. (B) Population of each state versus the annual electricity production (blue) or
consumption (yellow) in a state. (C) Map of consumption-based CO2 emissions intensity for each state. (D) Map of production-based CO2 emissions intensity for each state.
A B
Fig. 2. Differences in electricity SO2 emissions between states in India. (A) Production (blue) and consumption (yellow) sulfur intensities of each state (y axis)
versus production (blue) and consumption (yellow) generation (x axis), split by states that are either net exporters or net importers of electricity. (Top) High-demand states.
(Bottom) Low-demand states. (B) Map of consumption-based SO2 emissions intensity for each state. (C) Map of production-based SO2 emissions intensity for each state.
a state’s borders only. Consumption-based emis- ing from 0 to 8.8 kg/MWh (Fig. 2A). We as- reports the lowest at 0.1 kg of SO2/MWh, and
sions are based on carbon intensity of the sume that natural gas–based capacity emits Uttarakhand reports the highest at 2.2 kg of
electricity accounting for imports and exports. no SO2. States with the highest SO2 emis- SO2/MWh. Within this cluster of low-demand
We separate states by net exporters (where sions have the largest coal capacity, includ- states, those with higher CO2 emission factors
electricity generation is higher than electric- ing those with lignite-burning stations [Tamil tend to depend on a combination of coal and
ity consumption) and net importers (where Nadu, Gujarat (GJ), and Rajasthan (RJ)], which gas paired with hydro. Those with higher SO2
electricity generation is lower than electric- have a higher sulfur content than average In- emission factors depend on coal more than
ity consumption). See table S3 for a list of dian coal. gas. The second cluster of states are the re-
state abbreviations and full names. We calculate consumption-based emissions maining 21 states simulated, forming 96% of
Annual production-based CO2 emissions by summing the emissions from interstate and total annual demand. Among this group, aver-
range from nearly zero [in Arunachal Pradesh intrastate generation associated with meeting age consumption annual emission factors vary
(ARP), Chandigarh (CH), Goa (GA), Himachal demand for a state. The highest consumption- considerably, with Assam (AS) and Karnataka
Pradesh (HP), Manipur (MN), Meghalaya (ML), based emissions occur in Maharashtra (120 mega- (KA) at the lower end of this group (521 kg of
Mizoram (MZ), Nagaland (NL), and Sikkim tons of CO2), and the lowest occur in Mizoram CO2/MWh and 2.2 kg of SO2/MWh; 530 kg of
(SK)] to 103 megatons of CO2 [in Maharashtra (0.10 megatons of CO2). The carbon intensity CO2/MWh and 4 kg of SO2/MWh) and with
(MH)], and emissions intensity ranges from 0 for consumption-based emissions ranges from the highest emission factor among all states
to 960 kg of CO2/MWh [with the high end of 87 kg of CO2/MWh (in Himachal Pradesh) coming from Jharkhand (879 kg of CO2/MWh).
this range occurring in Bihar (BR)] (Fig. 1, A to 879 kg of CO2/MWh [in Jharkhand (JH)] The highest SO2 emission factor is in Rajasthan
and D). Several states report zero production- (Fig. 1, A and C). (8 kg/MWh), which depends in part on lig-
based emissions because of zero-carbon capac- There are two distinct clusters in the spread nite plants. Although Karnataka, Madhya
ity or because they import all of their electricity of consumption emission factors. At the lower Pradesh (MP), Tamil Nadu, Maharashtra, Gujarat,
(37, 61) range of state-level emission factors are 11 low– Rajasthan, Andhra Pradesh (AP), and Telangana
Production-based SO2 emissions range from annual demand states (~4% of total nationwide (TG) have the highest amounts of renewable
0 kilotons [in Arunachal Pradesh, Chandigarh, demand), primarily Himalayan and northeast- capacity, they also use considerable amounts
Delhi (DL), Goa, Himachal Pradesh, Jammu ern states, where considerable hydro capacity of coal capacity, putting them in the highest
and Kashmir (JK), Kerala (KL), Manipur, exists (Fig. 1A, inset, and Fig. 2A, bottom panel). cluster of states.
Meghalaya, Mizoram, Nagaland, Puducherry At the minimum within this group, Himachal
(PY), Sikkim, Tripura (TR), and Uttarakhand Pradesh reports an average emission factor of What are the effects of a carbon tax?
(UK)] to 760 kilotons [in Tamil Nadu (TN)], 87 kg of CO2/MWh with Uttarakhand at the Relying on a carbon tax to reduce CO2 emis-
corresponding to emissions intensities rang- greatest at 372 kg of CO2/MWh. For SO2, Tripura sions in the Indian power system will prove
ill-founded in the short term. Even under a higher sulfur emissions. Although these plants of plants showing no change. These 19 plants
$100 per ton of CO2 tax (see Fig. 3A and fig. S16 are typically next to lignite mines, there is a are located throughout the country.
for remaining tax levels), under the current paucity of lignite transport costs. We assume Our base case sulfur emissions estimate and
electricity generation fleet, only 12 states similar relationships for transport costs—i.e., results from sulfur controls are consistent with
would see reductions in their production emis- plants further away from eastern coal-mining previous analyses of sulfur control at Indian
sions intensity larger than 5%: Assam (6% regions have higher transport costs. Conse- power stations. Srinivasan et al. (39) have re-
decrease), Gujarat (9%), Kerala (9%), Punjab quently, the carbon tax penalizes these lignite ported 95% reductions to 650 kilotons, with SO2
(10%), Arunachal Pradesh (11%), Meghalaya plants for both lower efficiency and location emission factors decreasing from 7.9 to 0.4 kg/
(11%), Jammu and Kashmir (12%), Manipur (15%), away from coal mines. The benefits to reduc- MWh with more stringent control under a wider
Chandigarh (16%), Nagaland (18%), Mizoram ing premature mortality from air pollution range of control technologies. Likewise, previous
(23%), and Uttarakhand (27%). These states associated with SO2 emissions will depend on analyses estimating total SO2 emissions from
account for ~20% of annual nationwide de- how these emissions would relate to changes the Indian power sector have ranged from
mand and 15% of electricity production. We in PM2.5 concentration and the resulting chang- 3500 to 10,100 kilotons (24, 57, 75–77).
find that the annual average nationwide CO2 ing in exposure. In any case, if we assume a
(production) emission factor decreases from very simplified order-of-magnitude effect and Should India consider regional markets
711 to 686 kg/MWh, a decrease of 4%. We show assume that this decrease in SO2 results in an as a means to reduce emissions?
the effect of carbon taxes on annual plant ca- average nationwide decrease in PM2.5 concen- Figure 5 shows the changes between the re-
pacity factor (how often a plant runs) in the tration of ~1 mg/m3 and an average population gional dispatch scenario emissions and current
supplementary materials (figs. S23 to S26). density, this would translate to ~10,000 avoided emissions. Figure 6 shows the absolute produc-
Total annual wholesale marginal costs increase premature deaths per year (27). tion CO2 and SO2 emission factors currently
15 to 150% with progressively increasing car- (business-as-usual scenario) and in the regional
bon taxes, and increases in average marginal What are the effects of the proposed dispatch scenario. We show the correspond-
costs disproportionately affect eastern coal- air pollution–control policies? ing consumption emission factors in fig. S17.
mining states in all but the highest carbon For sulfur control, we assume the implementa- Regional dispatch means that each region
taxes of $100 per ton (fig. S21). There may still tion of two control technology options—dry lime- would dispatch its plants to meet demand in
be very valid reasons to implement a carbon price stone injection or wet flue gas desulfurization— the region, rather than having each state doing
even if the short-term benefits are negligible. from Srinivasan et al. (39), which analyzed an so separately. A regional dispatch approach
Doing so may signal to the market the needs entire suite of possible control technologies. would increase, rather than decrease, the av-
for low carbon generation in the long term. Overall, we see a 79% decrease in annual na- erage nationwide CO2 emission factor from 711
There is an important co-benefit from a car- tionwide sulfur emissions from 6100 kilotons to 720 kg/MWh. Total costs decrease by ~6%,
bon tax because it induces reductions of SO2. in the base case to 1300 kilotons in the sulfur- consistent with previous estimates (35, 55). How-
Under a $100 per ton of CO2 carbon tax (Fig. control scenario (Fig. 4A). Annual costs increase ever, the state-level effects that this regional
3B), total SO2 emissions decrease 11% from by ~1% (fig. S21). These decreases represent pooling produces are disparate in terms of emis-
6100 to 5400 kilotons in this scenario, with the minimal control needed to meet upcoming sion factors (Fig. 5A) and costs (fig. S22). In
47 plants increasing their SO2 emissions, 20 Indian SO2 emissions standards for coal gen- Fig. 6A, 14 of 32 states see a decrease in av-
seeing no change, and 95 incurring a decrease erators (table S2). Likewise, minimal nation- erage production emission factors (ranging
in SO2 emissions. Several plants that see de- wide control yields little change (<5%) in plant from 1 to 38% reduction depending on the
creases in SO2 emissions are lignite-burning load factor (PLF)—i.e., the capacity factor of state), and 9 states see an increase in carbon
plants in Tamil Nadu, Rajasthan, and Gujarat, plants (Fig. 4B). Only 19 of 162 coal plants dis- intensity, with the highest increases for states
with higher heat rates (lower efficiency) and patched see appreciable changes in PLF, with 88% with the lowest emission factors in the base
A B
Fig. 3. Impacts of high carbon taxes on the Indian power sector. (A) Changes in average annual production CO2 emission factors by state for a $100 per ton of
CO2 tax. (B) Changes in SO2 emissions induced from a $100 per ton of CO2 tax. kt, kiloton.
A B
Fig. 4. Impacts of sulfur-control policies on the Indian power sector. (A) Decrease in SO2 emissions from implementing minimal sulfur control to meet Indian
emissions norms when compared with baseline emissions. (B) Changes in coal PLFs under the SO2 emissions policy versus the baseline.
A B
Fig. 5. Impacts of regional coordination between states to dispatch power in India. (A) Changes in average annual production emission factors by state for
regional dispatch. Labels show percentage changes, where applicable. (B) Changes in SO2 emissions induced from regional dispatch.
case (e.g., Jammu and Kashmir, Himachal Key findings and policy considerations pact of future loads (such as increased demand
Pradesh, and Sikkim). The SO2 effects of this Indian power sector policies, operations, capac- for air conditioning) that use production-based
simulation show, once again, SO2 emissions ity mix, and generation vary by Indian state. The emission factors derived from generators lo-
concentrated in different spatial patterns (Fig. increased penetration of renewable energy, the cated within geographic boundaries of states
5B). Nationwide SO2 emissions increase to need to control air pollution, and planned market will yield inaccurate results. Although for
6200 kilotons in this scenario compared with reforms warrant analysis beyond national ag- some states with the largest demands, such
the base case scenario, an increase of 2%. The gregate metrics of CO2 and SO2 emissions from as Maharashtra, Tamil Nadu, or Gujarat, the
number of plants seeing increases or decreases Indian power generation. Our nationwide aver- difference between consumption-based and
compared with the base case differs. Of 162 age emission factors agree with the previous production-based emission factors is less than
plants, 97 see increases in SO2 emissions, 31 see national estimates (45, 49, 50, 78, 79). ±10%, for other states with large demands,
decreases, and 34 see no change. However, clear Our results suggest that designing climate such as Karnataka or Uttar Pradesh, the dif-
clusters emerge. Plants that are the furthest mitigation strategies and emissions reductions ference can be in excess of ±10 to 20%. The
away from coal-mining areas (e.g., Haryana, programs and goals on the basis of states’ geo- difference is most pronounced in states with
Gujarat, and Tamil Nadu) see decreases in SO2 graphical boundaries may miss these com- smaller demand, which are more likely to im-
emissions, whereas plants closer to mines see plex interactions between where electricity is port electricity from neighboring states. This
increases as a result of closer plants having lower produced and where it is used. For example, increases their consumption-based emission
variable costs with total fuel costs heavily de- the effect of demand-side emissions reduction factors over their production-based emission
pendent on coal transportation costs. policies (such as energy efficiency) or the im- factors (i.e., Himalayan or northeastern states).
Fig. 6. State-by-state impacts of regional coordination between states to dispatch power in India. (A) Average annual CO2 production emission factors by
state for region and baseline (state) dispatch scenarios. (B) Average annual SO2 production emission factors by state for region and state dispatch scenarios.
State-level, consumption-based emission fac- Chhattisgarh). Transmission networks are sit- and (iii) regionally coordinated dispatch in-
tors provide more detailed and accurate in- uated to deliver this power from these states stead of dispatching plants at the state level,
formation for policy analyses compared with to net importer states. When coal plants in consistent with the Government of India’s plans
both national-level emission factors and regional- these states retire, their accessibility to trans- to coordinate interstate dispatch (35, 53, 56).
level factors because, to meet demand, indi- mission make them well situated for renew- We recognize limitations with our estimates,
vidual states enter contracts with generators able generation as a replacement. Pai et al. which will reflect short-term conditions that
from multiple owners located inside and out- (80) have found that nearly all areas depen- derive from the current electricity-generation
side a state. dent on coal mining in India have high solar capacity mix in India. By focusing on the short
Pricing or incentive mechanisms based energy potential. term, as opposed to the longer term, our results
on production or consumption will result in Electricity decarbonization and emissions highlight current spatial differences that are
markedly different costs to a state. When mech- reduction efforts in India must show an appre- the result of current institutional and market
anisms are tied to production, net exporter ciation for the scale of the challenge. Electricity constraints. Regardless of specific policy instru-
states that generate higher-emissions electric- production and consumption and associated ments, such as a carbon tax, over time there
ity (i.e., coal-mining eastern areas) will face emissions between Indian states show orders- will be a rise of cleaner technologies, and, in
higher costs compared with net exporter states of-magnitude differences tied to population, fact, there are indications that greenfield coal
that generate lower-emissions electricity (i.e., akin to the differences observed between dif- power plant deployments will be few if not
hydro-rich Himalayan areas). Likewise, mech- ferent countries around the world. This will nil. This is because of sufficient overcapacity in
anisms tied to consumption will likely increase be increasingly relevant because future in- the very short term as well as under-construction
costs to net importer states that consume higher- ternational climate policy, to facilitate decar- plants that should suffice through the end of
emissions electricity (i.e., large-demand states bonization in India, must account for this the decade. This highlights the importance of
with high populations and large cities) com- subnational variability instead of treating all existing coal capacity by 2030 (50, 81).
pared with net importer states that consume of India uniformly. Of the policy interventions we evaluate, the
lower-emissions electricity (i.e., small-demand In addition to the business-as-usual scenario, carbon tax is most sensitive to our assumption
states with low populations). this analysis quantifies and defines the spatial of a fixed set of available generation capacity.
Moreover, on the supply side, production- CO2 and SO2 effects that would result from A carbon tax, even at a fairly high level of $100
based emission factors with states as net power different policy interventions in the current per ton of CO2, fails to yield substantial CO2
importers and exporters means that efforts Indian power sector. These policy interven- emissions reductions in the current Indian
to increase shares of zero-emission genera- tions include (i) a carbon tax in addition to the grid in the short term. This is in addition to
tion in general would provide wider reach if current implicit carbon tax charged to mined the implicit carbon tax of ~$6 per ton of do-
put into high-emission, net exporter states coal; (ii) minimum sulfur control to meet cur- mestic and imported coal that India currently
(e.g., Odisha, West Bengal, Jharkhand, and rent, but unimplemented, Indian regulations; charges for coal, which translates to a little
more than $3 per ton of CO2 (72). We find that to ₹200 per megawatt-hour penalties proposed consistently remain net power exporters dur-
the tax required on a coal generator to achieve by the Government of India for noncompli- ing representative times of day, especially at
parity in variable cost with a gas generator ant plants, which suggests that plants are bet- night when there is no solar output. Likewise,
would be ~$66 per ton of CO2, but there is ter off adopting control technology to avoid Rose et al. (49) modeled least-cost electricity
simply not enough natural gas that could be penalties in the dispatch order. PLF changes capacity expansion with transmission con-
used to displace large volumes of coal. In the can guide capital investment decisions because straints in India to 2017 and 2047. They have
long term, a carbon tax would likely spur fu- capital costs contribute to most sulfur-control found that elevated emissions in 2017 and
ture investment in lower carbon generation costs. Specifically, for plants that see decreases nearly all emissions in 2047 concentrated to
capacity in India, lowering both electricity in power load or capacity factors, capital costs eastern coal-mining states because coal power
GHG and sulfur emissions over time. However, may exceed the power load factors needed to remains cost competitive in these areas. Lastly,
unless policies and programs geared toward recoup these costs during plant operation. It Abhyankar et al. (50) modeled least-cost path-
renewables coupled with storage and nuclear remains to be seen whether Indian regula- ways to meet 2030 renewable energy targets
or natural gas occur in parallel, the effect of tors allow a pass-through of such costs even in in India with current state-wise dispatch.
the tax in the first few years would be just to lowered–power load factors cases. This may They have found that eastern coal-mining
increase electricity costs to producers and affect which plants ultimately do or do not areas export most coal generation. Consequent-
thus electricity bills to consumers. These in- undergo sulfur-control installation (31). No ly, a regionally or nationally coordinated
creased costs would disproportionately affect clear patterns about plant age, size, or location Indian grid will allow greater shares of renew-
poorer, coal-heavy eastern states. Public plan- emerge for the plants that do see appreciable ables to move about the country to lower total
ning documents that inform Government of changes in PLF in our sulfur-control scenario. emissions. However, coal-mining regions with
India policy project ~50% generation from As has occurred in many regions around cheaper coal plants will remain generation and
coal by 2030 despite renewable capacity growth the world, India could consider the creation emissions hotspots if the interstate disparity
(81, 82), and detailed dispatch modeling using of regional electricity markets to improve the in the location of renewable and coal capaci-
this planned future capacity finds similar lev- efficiency of the system and decrease costs. ties remains. One way to make coal power less
els of coal generation in the future (45). When However, that would not necessarily align cost competitive in the future in eastern areas
modeling least-cost capacity planning to 2030 with a decrease in emissions. Our simulations would be through a carbon tax, as we explored
and 2047, in an absence of an additional car- suggest that dispatching plants at the regional here, but policy-makers would need to care-
bon tax, previous analyses have found coal level rather than at the state level would lead fully design such a policy to ensure that poorer
generation standing at ~48 and ~41%, respec- to a small increase in both SO2 and CO2 emis- consumers in these states would not see in-
tively (49, 50). sions. Regionally coordinated dispatch would creased electricity costs. The regressive nature
The implementation of sulfur controls will also impose changes in the spatial patterns of of any such tax could be overcome through re-
likely result in large reductions of SO2 emis- SO2 and CO2 emissions by shifting emissions distribution mechanisms, but historical poor
sions, with the important outcome of reducing from distant plants even more to plants closer achievements highlight the challenge for a de-
the current premature mortality associated to eastern coal-mining regions in Chhattisgarh, veloping country with a high fiscal deficit. The
with air pollution in India. Our results show Odisha, Jharkhand, Bihar, and West Bengal. ₹400 per ton “coal cess” began life as a “clean
that most plants see minimal changes in power Because of intensive coal mining and power energy and environment cess” but, since 2017,
load factors (capacity factor) and how often a generation, these areas already face a dispro- has been used purely for budgetary support by
plant runs from the implementation of sul- portionate burden of pollution from coal (23). the Government of India (83).
fur control. Sulfur control imposes minimal Likewise, SO2 emissions become more spatially In addition to the limitations discussed with
variable-cost increases, which minimally in- dispersed, with the number of plants seeing each scenario, we identify several other limi-
fluence the order in which plants dispatch to SO2 emissions increases greater than those tations in our modeling and analysis. First, our
produce electricity. Moreover, we assume that seeing decreases. This behavior is consistent model does not capture 100% of generating
all plants implement sulfur control. If policy- with findings from Kamboj and Tongia (38), capacity, instead reflecting 75 to 85% of ca-
makers target specific plants in a regional man- who have found coal transport costs to pre- pacity tied to long-term power purchase agree-
ner, as currently proposed (33), the potential dominantly determine the variable cost of elec- ments (fig. S2), which govern 90% of power
for shifting emissions away from target areas tricity for Indian power stations. A regional transactions in India (73). Our results conse-
to other areas is possible because of the state- market would penalize plants in states with the quently predict 11% lower total CO2 emissions
wise power dispatch in India and the additional highest transport costs—e.g., Gujarat, Haryana, in our base case than the Government of India
marginal cost of sulfur control, penalizing and Tamil Nadu. estimates (79) and an uncertainty range of 693
plants in the dispatch order. Expected future Notably, our model ignores any explicit trans- to 721 kg/MWh in the national CO2 emission
life span and output would further skew the mission constraints that would limit inter- factor that we derive. We explain in detail the
capital costs, which could ultimately lead to state electricity trade in regional dispatch. uncertainty in our results associated with this
nonuniform deployment, with the extreme Our estimates likely give an upper bound on assumption in the supplementary materials. A
example of some plants simply shutting down. the shifting of emissions and generation to second limitation we recognize is that we only
Policy measures to date do not factor in geo- coal-mining eastern states because transmis- consider CO2 and SO2 emissions, despite the
graphic effects of pollution, but the Govern- sion constraints would limit how much gen- Indian power sector being a large source of
ment of India has proposed such a graded eration from these areas would substitute NOX and primary (directly emitted) PM2.5 emis-
plan for emissions-control equipment based generation in further-away areas. However, sions. Although emissions of NOX are depen-
on location. This approach acknowledges the previous modeling suggests that the spatial dent on combustion conditions, we use a mass
spatial differences in pollution burden from patterns in these results would qualitatively balance approach to derive plant-specific emis-
each plant but fails to account for the sec- apply to a future Indian grid. Spencer et al. (45), sion factors (39) because of the lack of con-
ondary formation of air pollution from pre- who modeled a nationwide integrated 2030 tinuous emissions monitoring data for India.
cursor gases emitted by plants (33). We should Indian grid with expanded renewables (with Adopting the same approach to derive NOX
note that our variable costs of control (₹20 to ~50% coal generation) and transmission con- and PM2.5 emissions would qualitatively yield
₹100 per megawatt-hour) are less than the ₹50 straints, have found that coal-heavy states results similar to those for SO2 in this analysis.
Our analysis shows that policies that have 18. K. Vohra et al., Global mortality from outdoor fine particle 41. M. L. Cropper et al., Applying Benefit-Cost Analysis to Air
modest or negligible emissions impacts at the pollution generated by fossil fuel combustion: Results from Pollution Control in the Indian Power Sector. J. Benefit Cost Anal.
GEOS-Chem. Environ. Res. 195, 110754 (2021). doi: 10.1016/ 10, 185–205 (2019). doi: 10.1017/bca.2018.27; pmid: 32968618
aggregate, national level nonetheless have dis- j.envres.2021.110754; pmid: 33577774 42. D. Palchak et al., “Greening the Grid: Pathways to Integrate 175
parate, state-level, spatial emissions and cost 19. Centre for Social and Economic Progress, CSEP Electricity and Gigawatts of Renewable Energy Into India’s Electric Grid,
effects. Consequently, the differences that we Carbon Tracker (2019); https://carbontracker.in/. Vol. I—National Study” (Greening the Grid Program, 2017).
20. Central Electricity Authority, “Executive Summary on Power 43. D. Palchak et al., “Greening the Grid: Pathways to Integrate 175
quantify have implications for India’s decar- Sector May 2020” (Government of India, Ministry of Power, Gigawatts of Renewable Energy Into India’s Electric Grid, Vol. II
bonization efforts as it aims to increase re- 2020). —Regional Study” (Greening the Grid Program, 2017).
newable energy by 2030 and meet net-zero 21. Central Electricity Authority, “Annual Generation Programme 44. D. Palchak, I. Chernyakhovskiy, T. Bowen, V. Narwade, “India
2019-20” (Government of India, Ministry of Power, 2019). 2030 Wind and Solar Integration Study: Interim Report”
emissions by 2070 while ensuring a just energy 22. R. R. Mohan, N. Dharmala, M. R. Ananthakumar, P. Kumar, (National Renewable Energy Laboratory, NREL/TP-6A20-
transition for coal-dependent states in eastern A. Bose, “Greenhouse Gas Emission Estimates from the Energy 73854, 2019); https://www.nrel.gov/docs/fy19osti/73854.pdf.
India (80, 84). Sector in India at the Subnational Level (Version/edition 2.0)” 45. T. Spencer, N. Rodrigues, R. Pachouri, S. Thakre, G. Renjith,
(GHG Platform India Report, 2019); https://cstep.in/drupal/ “Renewable Power Pathways: Modelling the Integration of Wind
sites/default/files/2020-05/GHGPI-PhaseIII-Methodology% and Solar in India by 2030” (The Energy and Resources
20Note-Energy-Sep%202019.pdf. Institute, 2020).
RE FE RENCES AND N OT ES
23. S. K. Guttikunda, P. Jawahar, Atmospheric emissions and 46. A. Phadke, N. Abhyankar, R. Deshmukh, “Techno-Economic
1. World Bank, GDP, PPP (current international $) (2018); pollution from the coal-fired thermal power plants in India. Assessment of Integrating 175GW of Renewable Energy into the
https://data.worldbank.org/indicator/ny.gdp.mktp.pp.cd. Atmos. Environ. 92, 449–460 (2014). doi: 10.1016/ Indian Grid by 2022” (Lawrence Berkeley National Laboratory,
2. BP, “Statistical Review of World Energy” (2020); j.atmosenv.2014.04.057 2016).
https://www.bp.com/content/dam/bp/business-sites/en/ 24. S. K. Guttikunda, P. Jawahar, Evaluation of Particulate Pollution 47. R. Deshmukh, A. Phadke, D. S. Callaway, Least-cost targets
global/corporate/pdfs/energy-economics/statistical-review/ and Health Impacts from Planned Expansion of Coal-Fired and avoided fossil fuel capacity in India’s pursuit of
bp-stats-review-2020-full-report.pdf. Thermal Power Plants in India Using WRF-CAMx Modeling renewable energy. Proc. Natl. Acad. Sci. U.S.A. 118,
3. S. Ali, “The future of Indian electricity demand: How much, by System. Aerosol Air Qual. Res. 18, 3187–3202 (2018). e2008128118 (2021). doi: 10.1073/pnas.2008128118;
whom and under what conditions?” (Brookings India, 2018); doi: 10.4209/aaqr.2018.04.0134 pmid: 33753476
https://www.brookings.edu/research/the-future-of-indian- 25. A. Sehgal, R. Tongia, “Coal Requirement in 2020: A Bottom-up 48. T. Lu et al., India’s potential for integrating solar and on-
electricity-demand-how-much-by-whom-and-under-what- Analysis” (Brookings India, research paper no. 072016-2, and offshore wind power into its energy system. Nat. Commun.
conditions/. 2016); https://www.brookings.edu/wp-content/uploads/ 11, 4750 (2020). doi: 10.1038/s41467-020-18318-7
4. T. Spencer, A. Awasthy, “Analysing and Projecting Indian 2016/09/2016_08_16_coal_future_2020_asrt.pdf. 49. A. Rose, I. Chernyakhovskiy, D. Palchak, S. Koebrich, M. Joshi,
Electricity Demand to 2030” (TERI, 2019); https://www.teriin. 26. S. K. Sahu, T. Ohara, G. Beig, The role of coal technology “Least-Cost Pathways for India’s Electric Power Sector”
org/sites/default/files/2019-02/Analysing%20and%20Projecting in redefining India’s climate change agents and other (National Renewable Energy Laboratory, NREL/TP-6A20-
%20Indian%20Electricity%20Demand%20to%202030.pdf. pollutants. Environ. Res. Lett. 12, 105006 (2017). 76153, 2020); https://www.nrel.gov/docs/fy20osti/76153.pdf.
5. World Resources Institute, CAIT Climate Data Explorer (2019); doi: 10.1088/1748-9326/aa814a 50. N. Abhyankar, S. Deorah, A. Phadke, “Least-Cost Pathway for
https://www.wri.org/data/cait-climate-data-explorer. 27. M. Cropper et al., The mortality impacts of current and planned India’s Power System Investments through 2030: A Study
6. J. Timperley, “The Carbon Brief Profile: India” (Carbon Brief coal-fired power plants in India. Proc. Natl. Acad. Sci. U.S.A. Under the Flexible Resources Initiative of the U.S.-India Clean
Ltd., 2019); https://www.carbonbrief.org/the-carbon-brief- 118, e2017936118 (2021). doi: 10.1073/pnas.2017936118; Energy Finance Task Force” (Lawrence Berkeley National
profile-india. pmid: 33495332 Laboratory, 2021); https://eta-publications.lbl.gov/sites/
7. S. D. Ghude et al., Premature mortality in India due to PM2.5 28. W. Peng et al., The Critical Role of Policy Enforcement in default/files/fri_india_report_v28_wcover.pdf.
and ozone exposure. Geophys. Res. Lett. 43, 4650–4658 Achieving Health, Air Quality, and Climate Benefits from India’s 51. P. Kumar, R. Banerjee, T. Mishra, A framework for analyzing
(2016). doi: 10.1002/2016GL068949 Clean Electricity Transition. Environ. Sci. Technol. 54, trade-offs in cost and emissions in power sector. Energy 195,
8. L. Conibear, E. W. Butt, C. Knote, S. R. Arnold, D. V. Spracklen, 11720–11731 (2020). doi: 10.1021/acs.est.0c01622; pmid: 116949 (2020). doi: 10.1016/j.energy.2020.116949
Stringent Emission Control Policies Can Provide Large 32856906 52. Central Electricity Regulatory Commission, “Discussion Paper
Improvements in Air Quality and Public Health in India. Geohealth 29. M. Gao et al., The impact of power generation emissions on Re-designing Real Time Electricity Markets in India” (2018).
2, 196–211 (2018). doi: 10.1029/2018GH000139; pmid: 32395679 on ambient PM2.5 pollution and human health in China and 53. Central Electricity Regulatory Commission, “Consultation
9. J. S. Apte, J. D. Marshall, A. J. Cohen, M. Brauer, Addressing India. Environ. Int. 121, 250–259 (2018). doi: 10.1016/ Paper On Security Constrained Economic Despatch of Inter
Global Mortality from Ambient PM2.5. Environ. Sci. Technol. j.envint.2018.09.015; pmid: 30223201 State Generating Stations Pan India” (2018).
49, 8057–8066 (2015). doi: 10.1021/acs.est.5b01236; 30. J. Kopas et al., Environmental Justice in India: Incidence of 54. Central Electricity Regulatory Commission, “Mechanism for
pmid: 26077815 Air Pollution from Coal-Fired Power Plants. Ecol. Econ. 176, Compensation for Competitively Bid Thermal Generating
10. S. Chowdhury, S. Dey, Cause-specific premature death from 106711 (2020). doi: 10.1016/j.ecolecon.2020.106711 Stations for Change in Law on Account of Compliance of the
ambient PM2.5 exposure in India: Estimate adjusted for 31. S. Ramanathan, S. Arora, V. Trivedi, “Coal-Based Power Revised Emission Standards of the Ministry of Environment,
baseline mortality. Environ. Int. 91, 283–290 (2016). Norms: Where do we stand today?” (Centre for Science and Forest and Climate Change, Government of India (MoEF&CC)”
doi: 10.1016/j.envint.2016.03.004; pmid: 27063285 Environment, 2020); https://www.cseindia.org/coal-based- (2020).
11. H. Guo et al., Source contributions and potential reductions to power-norms-coal-based-10125. 55. “Development of Power Market in India. Phase I: Implementation
health effects of particulate matter in India. Atmos. Chem. 32. Ministry of Environment Forest and Climate Change, Government of Market Based Economic Dispatch (MBED)” (2021); https://
Phys. 18, 15219–15229 (2018). doi: 10.5194/acp-18-15219-2018 of India, Gazette of India, 2015, REGD. NO. D. L.-33004/99. powermin.gov.in/sites/default/files/webform/notices/
12. GBD MAPS Working Group, “Burden of Disease Attributable 33. Ministry of Environment Forest and Climate Change, Government Seeking_comments_on_Discussion_Paper_on_Market_Based_
to Major Air Pollution Sources in India. Special Report 21” of India, Gazette of India, 2021, CG-DL-E-01042021-226335. Economic_Dispatch_MBED.pdf.
(Health Effects Institute, 2018); https://www.healtheffects.org/ 34. Government of India, “India’s Intended Nationally Determined 56. Central Electricity Regulatory Commission, “Discussion Paper
publication/gbd-air-pollution-india. Contribution: Working Towards Climate Justice” (2015); on Market Based Economic Dispatch of Electricity : Re-designing
13. E. E. McDuffie et al., Source sector and fuel contributions to https://www4.unfccc.int/sites/submissions/INDC/Published% of Day-ahead Market (DAM) in India” (2018).
ambient PM2.5 and attributable mortality across multiple 20Documents/India/1/INDIA%20INDC%20TO%20UNFCCC.pdf. 57. C. Oberschelp, S. Pfister, C. E. Raptis, S. Hellweg, Global
spatial scales. Nat. Commun. 12, 3594 (2021). doi: 10.1038/ 35. Power System Operation Corporation Limited, “Security emission hotspots of coal power generation. Nat. Sustain. 2,
s41467-021-23853-y; pmid: 34127654 Constrained Economic Dispatch of Inter-state Generating 113–121 (2019). doi: 10.1038/s41893-019-0221-6
14. J. Lelieveld, J. S. Evans, M. Fnais, D. Giannadaki, A. Pozzer, Stations Pan-India: Detailed Feedback Report on Pilot” (2020). 58. Central Electricity Authority, “Annual Performance of Review of
The contribution of outdoor air pollution sources to premature 36. H. Safiullah, G. Hug, R. Tongia, Design of load balancing Thermal Power Stations 2014-15” (2015).
mortality on a global scale. Nature 525, 367–371 (2015). mechanism for Indian electricity markets. Energy Syst. 8, 59. CMPDI – Coal India Limited, Koyla Grahak Seva (2019);
doi: 10.1038/nature15371; pmid: 26381985 309–350 (2017). doi: 10.1007/s12667-016-0199-3 https://elib.cmpdi.co.in/SEVA/index.php.
15. A. J. Cohen et al., Estimates and 25-year trends of the global 37. Ministry of Power, National Power Portal, (2020); https://npp. 60. Coal India Limited, “Price Notification” (2018); https://www.
burden of disease attributable to ambient air pollution: gov.in/publishedReports. coalindia.in/media/documents/Price_Notification_
An analysis of data from the Global Burden of Diseases Study 38. P. Kamboj, R. Tongia, “Indian Railways and Coal: An dated_08.01.2018_effective_from_0000_Hrs_of_09.01.2018_
2015. Lancet 389, 1907–1918 (2017). doi: 10.1016/S0140-6736 Unsustainable Interdependency” (Brookings India, 2018); 09012018.pdf.
(17)30505-6; pmid: 28408086 https://www.brookings.edu/wp-content/uploads/2018/07/ 61. Government of India, Ministry of Power, Merit Order Despatch
16. India State-Level Disease Burden Initiative Air Pollution Railways-and-coal.pdf. of Electricity for Rejuvenation of Income and Transparency
Collaborators, The impact of air pollution on deaths, disease 39. S. Srinivasan, N. Roshna, S. Guttikunda, A. Kanudia, S. Saif, (MERIT) (2020); https://meritindia.in/.
burden, and life expectancy across the states of India: J. Asundi, “Benefit Cost Analysis of Emissions Standards 62. National Thermal Power Corporation, “Delivered Cost of Gas”
The Global Burden of Disease Study 2017. Lancet Planet. for Coal-Based Thermal Power Plants in India” (Center for (2017).
Health 3, e26–e39 (2019). doi: 10.1016/S2542-5196(18)30261-4; Study of Science, Technology and Policy, CSTEP report 63. Ministry of Petroleum and Natural Gas, “State/UT-wise Sales Tax
pmid: 30528905 2018-06, 2018). Rates Applicable on Crude Oil, Natural Gas and Select Major
17. India State-Level Disease Burden Initiative Air Pollution 40. M. L. Cropper, S. Guttikunda, P. Jawahar, K. Malik, I. Partridge, Petroleum Products As on 1 April, 2018” (Government of India,
Collaborators, Health and economic impact of air pollution in Disease Control Priorities, Third Edition (Volume 7): 2019); https://data.gov.in/resources/stateut-wise-sales-tax-rates-
in the states of India: The Global Burden of Disease Study Injury Prevention and Environmental Health, C. N. Mock, applicable-crude-oil-natural-gas-and-select-major-petroleum.
2019. Lancet Planet. Health 5, e25–e38 (2021). doi: 10.1016/ R. Nugent, O. Kobusingye, K. R. Smith, Eds. (World Bank, 64. Central Electricity Authority, “Renewable Energy Generation
S2542-5196(20)30298-9; pmid: 33357500 2017), pp. 239–248. Data” (2018).
65. Power System Operation Corporation Limited, Daily Power 2005–2012. Environ. Sci. Technol. 47, 13993–14000 (2013). the views of the National Science Foundation. This publication
Supply Position Reports (2018); https://posoco.in/reports/ doi: 10.1021/es4039648 was developed as part of the Center for Air, Climate, and Energy
daily-reports/. 77. C. Li et al., India Is Overtaking China as the World’s Largest Solutions (CACES), which was supported under assistance
66. Energy Analytics Lab, “Average System Load Profile” (Indian Emitter of Anthropogenic Sulfur Dioxide. Sci. Rep. 7, agreement no. R835873 awarded by the US Environmental
Institute of Technology, 2019). 14304 (2017). doi: 10.1038/s41598-017-14639-8; pmid: 29123116 Protection Agency (EPA). It has not been formally reviewed by the
67. Central Electricity Authority, “Power Allocation from Central 78. A. Soman, K. Ganesan, H. Kaur, “India’s Electric Vehicle EPA. The views expressed in this document are solely those of
Sector” (2020). Transition: Impact on Auto Industry and Building the authors and do not necessarily reflect those of the EPA. The EPA
68. T. A. Deetjen, I. L. Azevedo, Reduced-Order Dispatch Model for EV Ecosystem” (Council on Energy, Environment and Water, does not endorse any products or commercial services mentioned
Simulating Marginal Emissions Factors for the United States 2019); https://shaktifoundation.in/wp-content/uploads/2019/ in this publication. This work was supported by the Center for
Power Sector. Environ. Sci. Technol. 53, 10506–10513 (2019). 10/Indias-Electric-Vehicle-Transition-Report-PDF.pdf. Climate and Energy Decision Making (SES-1463492) through a
doi: 10.1021/acs.est.9b02500; pmid: 31436968 79. Central Electricity Authority, “CO2 Baseline Database for the cooperative agreement between the National Science Foundation
69. Ministry of Coal, “Provisional Coal Statistics 2017–2018” Indian Power Sector” (2018). and Carnegie Mellon University. Funding for this research was
(2018). 80. S. Pai, H. Zerriffi, J. Jewell, J. Pathak, Solar has greater supported by the National Security Education Program’s Boren
70. D. Singh, R. Tongia, “Need for an Integrated Approach for Coal techno-economic resource suitability than wind for replacing Fellowship. Author contributions: S.S. contributed to the
Power Plants” (CSEP, 2021). coal mining jobs. Environ. Res. Lett. 15, 034065 (2020). conceptualization, gathered data, created the model, analyzed
71. U.S. Energy Information Administration, “How much carbon doi: 10.1088/1748-9326/ab6c6d results, and wrote the paper. P.J.A. contributed to the
dioxide is produced when different fuels are burned?” 81. Central Electricity Authority, “Draft Report on Optimal conceptualization, analyzed results, and wrote the paper. T.A.D.
(EIA, 2020); https://www.eia.gov/tools/faqs/faq.php?id=73&t=11. Generation Capacity Mix for 2029-30” (2019). contributed to the conceptualization. S.D. gathered data. P.K.
72. International Institute for Sustainable Development, “The 82. Central Electricity Authority, “National Electricity Plan - Volume gathered data. R.T. contributed to conceptualization, analyzed
Evolution of the Clean Energy Cess on Coal Production in I: Generation” (2018). results, and wrote the paper. I.M.L.A. contributed to the
India” (2020); https://www.iisd.org/system/files/ 83. “The Goods and Services Tax (Compensation to States) conceptualization, analyzed results, and wrote the paper.
publications/stories-g20-india-en.pdf. Bill, 2017” (PRS Legislative Research, 2017); https://prsindia. Competing interests: The authors declare no competing interests.
73. A. K. Singh, T. B. Kumar, G. Yadav, R. Karna, “Security org/billtrack/the-goods-and-services-tax-compensation-to- Data and materials availability: Model source code, input data,
Constrained Economic Despatch – India: A Rolling Block states-bill-2017. and modeling results are available online (85). License
Implementation Framework,” 2019 8th International Conference 84. S. Pai, H. Zerriffi, A novel dataset for analysing sub-national information: Copyright © 2022 the authors, some rights reserved;
on Power Systems, 1–6 (2019). socioeconomic developments in the Indian coal industry. IOP exclusive licensee American Association for the Advancement of
74. Power Finance Corporation, “Report on Performance of SciNotes 2, 014001 (2021). doi: 10.1088/2633-1357/abdbbb Science. No claim to original US government works. https://www.
State Power Utilities 2017-18” (2020); https://www.pfcindia. 85. S. Sengupta et al., Reduced-Form Dispatch Model of Indian science.org/about/science-licenses-journal-article-reuse
com/DocumentRepository/ckfinder/files/Operations/ Power Generation, dataset, Carnegie Mellon University (2021);
Performance_Reports_of_State_Power_Utilities/ https://doi.org/10.1184/R1/14842224.v1.
SUPPLEMENTARY MATERIALS
Report_on_Performance_of_State_Power_Utilities_%
ACKN OWLED GMEN TS science.org/doi/10.1126/science.abh1484
202017_18.pdf.
Supplementary Text
75. D. Tong et al., Targeted emission reductions from global super- The authors thank J. S. Apte for helpful comments in preparing this
Figs. S1 to S31
polluting power plant units. Nat. Sustain. 1, 59–68 (2018). manuscript. Funding: This material is based on work supported
Tables S1 to S4
doi: 10.1038/s41893-017-0003-y by the National Science Foundation Graduate Research Fellowship
References (86, 87)
76. Z. Lu, D. G. Streets, B. de Foy, N. A. Krotkov, Ozone Monitoring Program grant no. DGE-1252522 and grant no. DGE-1745016. Any
Instrument Observations of Interannual Increases in SO2 opinions, findings, and conclusions or recommendations expressed Submitted 1 June 2021; accepted 23 September 2022
Emissions from Indian Coal-Fired Power Plants during in this work are those of the authors and do not necessarily reflect 10.1126/science.abh1484
Maria José Juan-Jordá*, Hilario Murua, Haritz Arrizabalaga, Gorka Merino, RESULTS: We find that since 1950, the global
Nathan Pacoureau, Nicholas K. Dulvy extinction risk of oceanic predatory fishes has
continuously worsened as a result of rising
and excessive fishing pressure, up until the late
INTRODUCTION: Recent biodiversity assessments RATIONALE: Highly monitored oceanic fisheries 2000s when management actions reduced fish-
show unprecedented loss of species, ecosystems, comprising iconic predatory tunas, billfishes, ing mortality, allowing for recovery of tunas
and genetic diversity on land but it remains and sharks yield an opportunity to support the and billfishes. However, sharks remain under-
unclear how widespread such patterns may be development of linked sets of pressure and eco- managed and their extinction risk continues
in the oceans. There is an urgent need to de- logical state indicators capable of measuring to rise. Our findings reveal a core problem and
velop surveillance indicators to track the health progress toward global biodiversity and sus- ongoing challenge in the management of
of ecosystems in the marine realm, including tainability targets. We derived a continuous oceanic multigear and multispecies fish-
changing extinction risk of marine species. Red List Index (RLI) based on International eries. Whereas target species are increasingly
These will allow evaluation of progress toward Union for Conservation of Nature (IUCN) Red sustainably managed to ensure maximum
achieving global goals and commitments es- List categories and criteria for tracking yearly yields, the functionally important shark spe-
tablished by the Convention of Biological Di- changes in extinction risk of oceanic tunas, cies being captured incidentally by the same
versity (CBD) and Sustainable Development billfishes, and sharks over the past 70 years fisheries continue to decline as a result of
Goals (SDGs) to halt and reverse marine bio- to assess the health of oceanic biodiversity. insufficient management actions. Further-
diversity loss. Furthermore, by assessing the sensitivity and more, our study also connects annual changes
in global extinction risk with changes in fish-
ing mortality over the last 70 years, demon-
strating how the global RLI trajectory of
oceanic predatory fishes is highly sensitive
and responsive to fishing mortality.
R
from the most recent fish stock assessment
ecent global biodiversity assessments cies to ecologically important incidental catch (Fig. 2A, fig. S5, and table S3). Second, we cal-
show unprecedented human-driven de- (8, 9). Third, they are routinely monitored and culated the total percent change in population
clines in abundance of wild species, com- assessed by the five tuna regional fisheries biomass over three GL by estimating the aver-
promising the integrity and functioning management organizations (tuna RFMOs) with age annual rate of population change over the
of ecosystems on Earth (1, 2). However, the mandate to conserve and manage trans-
the scale of damage upon oceanic ecosystems boundary large migratory fish species (table S2
remains unclear. Fishing activity is increas- and fig. S2). Time series of biomass and fish- A
ingly monitored by satellites (3) and fishery ing mortality rates derived from fish stock as- Atlantic Pacific
statistics (4), but its effects on ocean biodiver- sessments are available for 52 populations of
sity are not similarly tracked. The Convention 18 species, encompassing 60% of oceanic pred-
0
of Biological Diversity (CBD) and the Sustain- atory fish diversity (Fig. 1 and figs. S3 to S6).
5 2
able Development Goals (SDGs) of the 2030 This data richness enables the development
Agenda for Sustainable Development together of linked sets of pressure and ecological state
18
established a framework of agreed-upon targets indicators capable of tracking global targets. Species globally
and actions for governments to reduce the cur- The International Union for the Conserva- 0 distributed 4
rent rate of biodiversity loss at the global, re- tion of Nature (IUCN) Red List Index (RLI) is
gional, and national scale. This requires linked a well-established ecological state indicator
1
sets of pressure and ecological state indicators adopted as one of the official UN SDG and
capable of measuring progress toward achiev- CBD indicators (5). The RLI is based on the
ing global marine biodiversity and sustain- IUCN Red List categories and criteria, which Indian
ability targets (5, 6). uses one of five quantitative criteria (A to E) to
Several major oceanic predatory fishes— classify species into one of eight categories of
B
tunas, billfishes, and sharks—exhibit three fea- extinction risk: extinct (EX), extinct in the wild
TUNAS
tures that make them strong candidates for (EW), critically endangered (CR), endangered
7 species
assessment of the trajectory of oceanic bio- (EN), vulnerable (VU), near threatened (NT), 100% assessed
diversity (Fig. 1, fig. S1, and table S1). First, they least concern (LC), and data deficient (DD)
are among the largest (100 to 500 cm) mega- (10, 11). The RLI shows trends in the overall
BILLFISHES
faunal predators and most functionally unique extinction risk for a group of species by mea-
10 species
species in pelagic ecosystems, and they play a suring how the number of species in each Red 60%
assessed
critical role in regulating the structure, func- List category changes over time scaled from
tion, and stability of oceanic ecosystems (7). 1 (all species LC) to 0 (all species EX). The RLI
SHARKS
Second, they exhibit differential resilience to has already been estimated from the episodic 13 species
overfishing and span a range of fisheries cat- application of the IUCN Red List categories 38%
assessed
egories from economically valuable target spe- and criteria to the world’s birds, mammals,
amphibians, corals, cycads, and oceanic sharks
1 and rays (2, 9) by Red List Authorities and Fig. 1. Oceanic predatory fishes of the world.
AZTI, Marine Research, Basque Research and Technology
Alliance (BRTA). Herrera Kaia, Portualdea z/g, 20110 Pasaia, Specialist Groups of the IUCN Species Sur- (A) Total number of oceanic tunas, billfishes, and
Gipuzkoa, Spain. 2International Seafood Sustainability vival Commission. These episodic Red List as- sharks distributed globally and by ocean (table S1).
Foundation, Pittsburgh, PA, USA. 3Earth to Ocean Research sessments occur every 4 to 10 years, thus far (B) Proportion of species with at least one population
Group, Department of Biological Sciences, Simon Fraser
University, Burnaby, British Columbia, Canada. yielding time series of 2 to 4 data points span- assessed with fish stock assessment models by
*Corresponding author. Email: mjuan@azti.es ning up to four decades. major taxa (table S2).
A B
(1000 tonnes) 1000 median over
0.75 3GL= -2.9 (-3.7,-2.1)
Density
Biomass
750
0.50
500
3GLs 0.25
250
36 years
0.00
1950 1955 1960 1965 1970 1975 1980 1985 1990 1995 2000 2005 2010 2015 -5 -4 -3 -2 -1 -0
Annual Rate of Change (%)
C Focal assessement year
D over 3GL prior to 1985
3 1GL
Fishing mortality
Density
F/FMSY= 1.27 0.04 P
CR=0%
P
EN=98.8%
1 0.02 P
VU=1.2%
P
NT=0%
P
LC=0%
0 0.00
E 1950 1955 1960 1965 1970 1975 1980 1985 1990 1995 2000 2005 2010 2015 -100 -75 -50 -25 0
Focal assessement year Percentage reduction
100 over 3GL prior to 1985
of being classified in
Red List Categories
Critically Endangered
50 Endangered
Vulnerable
25 Near Threatened
Least Concern
0 Not Evaluated
1950 1955 1960 1965 1970 1975 1980 1985 1990 1995 2000 2005 2010 2015
Years
Fig. 2. Illustrative example of a continuous Red List assessment using FMSY. The shaded rectangle shows the average fishing mortality over a one GL
Criterion A for Southern Bluefin Tuna from 1985 to 2016. (A) Time series window before 1985, showing that the species is not being sustainably managed—
of biomass from the latest fish stock assessment (table S2). The shaded hence application of the A2 thresholds. (D) Posterior median (vertical black
rectangle shows the three GL window used to estimate the Red List category for line) and probability distribution of the estimated total reduction over three GL in
1985. (B) Posterior probability distribution and median (vertical black line) of 1985. The posterior probability is overlaid on the Red List category A2 thresholds.
the estimated average annual rate of change (percent) in population size over the (E) The probability of being classified in the Red List categories in 1985 and at each
previous three GL in 1985. (C) Time series of fishing mortality rate relative to subsequent year between 1985 and 2016.
three GL window using an intercept-only hier- CR ≥ 80%) are applied. In our illustrative ex- they are combined to the species level is avail-
archical Bayesian model (14). These models ample, the Southern Bluefin Tuna was not able in the supplementary materials (fig. S10
allow for nonlinearity in population trends being sustainably managed (F/FMSY = 1.27) in and table S4). Last, we aggregated the Red List
and account for the hierarchical structure of 1985 based on the average fishing mortality status hierarchically across populations (fig. S8)
the data as some species trends are based on over the one GL window before 1985, hence ap- and then species (fig. S9) to derive the global
multiple population estimates from multiple plication of the A2 threshold (Fig. 2C). Fourth, RLI of oceanic predatory fishes (14).
fish stock assessment models (fig. S5). We es- we assigned Red List category probabilities Since 1950, the global RLI trajectory of oce-
timated that by 1985, Southern Bluefin Tuna because the Bayesian estimation framework anic predatory fishes worsened by ~27% (95%
had a median population reduction of 65.6% allows us to propagate the uncertainty in pop- CI 24.4, 31.1) reflecting the increasing extinc-
[95% credible interval (CI) 52.8, 74.5], equiv- ulation reductions into probabilistic classifica- tion risk of the whole assemblage until recov-
alent to an annual rate of change of −2.9% tions for each of the Red List categories (12). ery became apparent in 2008 (Fig. 3A). In that
(CI −3.7, −2.1) (Fig. 2B). Third, we classified Based on a population reduction value of 65.6%, year, 10 species were classified as threatened,
status using either A1 thresholds, when the Southern Bluefin Tuna was classified as EN with Southern Bluefin Tuna and Oceanic White-
species is sustainably managed worldwide (probability PEN=98.7% and PVU=1.3%) in tip Shark (Carcharhinus longimanus) classified
(i.e., the causes of decline are reversible, and 1985 (Fig. 2D). The fifth step consisted of a year- as CR; Blue Marlin (Makaira nigricans), Silky
understood, and have ceased) in at least 90% on-year estimation of Red List status for the Shark (Carcharhinus falciformis), Porbeagle
of its range, or A2 thresholds otherwise. Spe- entire time series, which reveals how Southern Shark (Lamna nasus), and Swordfish (Xiphias
cifically, A1 thresholds for population reduc- Bluefin Tuna became increasingly threatened gladius) as EN; and Bigeye Tuna (Thunnus
tion (VU = 50 to 69%, EN = 70 to 89%, and over time to the point where in 2005 it was clas- obesus), Yellowfin Tuna (Thunnus albacares),
CR ≥ 90%) are applied to sustainably managed sified as CR (PCR=76% and PEN=24%; Fig. 2E). Pacific Bluefin Tuna (Thunnus orientalis), and
species. In operational terms, a fish species As fishing mortality was reduced from 2006 Striped Marlin (Kajikia audax) as VU (fig. S9).
is considered sustainably managed when the onward, the biomass of Southern Bluefin Tuna The most recent recovery of the RLI since
average fishing mortality (F) on the species stabilized at low levels and has recently started 2008 reflects improvement (from CR to VU)
is below the fishing mortality correspond- to increase—this is closely tracked by a reduc- of Southern Bluefin Tuna, and improvement
ing to the maximum sustainable yield (MSY) tion in extinction risk in the most recent years of five species into NT and LC [Yellowfin Tuna,
(F/FMSY ≤ 1) for the previous one GL in at least (PCR=0%, PEN=66%, PVU=29%, PNT=4%, and Swordfish, Blue Marlin, Striped Marlin, and
90% of its range in accordance with IUCN P LC=1% in 2016; Fig. 2E). This is a case for Black Marlin (Makaira indica); fig. S9]. How-
guidelines (15). Otherwise, for unsustainably which we have one population representing ever, the RLI trajectory varies among major
managed species (F/FMSY > 1), the A2 thresh- the whole species. An example of a species taxa (Fig. 3, B and C). For tunas, the RLI started
olds (VU = 30 to 49%, EN = 50 to 79%, and composed of multiple populations and how to improve in the 1990s and end of the 2000s
whereas the RLI for billfishes deteriorated tainably managed throughout its entire range tory fishes closely tracks the historical trend
until the early 2000s, improving only during (figs. S11 to S13) (14). of fisheries development and implementa-
the past decade. However, the RLI of sharks To understand how changes in population- tion of fisheries management in these species.
has worsened continuously. Our continuous level fishing mortality underlie the RLI, we Since the 1950s, global average fishing mor-
RLI is robust to the choice of different time derived a global population-level RLI for the tality has been increasing, exceeding sustain-
windows for calculating fishing mortality 52 assessed populations (Fig. 4 and fig. S14). able levels in 1993 and then peaking in 2006
metrics and population range–based scenarios The 58-year decline and recent recovery in (Fig. 4A). Over this same period, the average
to determine whether a species is being sus- the population-level RLI of oceanic preda- biomass of oceanic predatory fishes declined
6 Atlantic
Tunas
Fishing mortality
Indian
Billfishes
Eastern Pacific
Sharks
4 Western Pacific
0
D E F
8
6
Biomass
0
G 1.0 H I
Red List Index
0.8
0.6
0.4
1950 1970 1990 2010 1950 1970 1990 2010 1950 1970 1990 2010
Fig. 4. Trends in overall fishing mortality and their impact on population biomass and population-level RLI trajectory of oceanic predatory fishes. (A) Global
average fishing mortality rates relative to FMSY and is disaggregated by major ocean regions (B) and taxon (C). (D) Global average biomass relative to BMSY and is
disaggregated by major ocean regions (E) and taxon (F). (G) Global population-level RLI and is disaggregated by major ocean regions (H) and taxon (I). The solid line
denotes the median and the shaded polygons the 95% CIs. The horizontal gray lines denote the FMSY and BMSY. Interpretation of RLI values can be found in Fig. 3.
and then approached the MSY (BMSY; Fig. 4D). for removing the autocorrelation and trends in assessment (a “miss” of 12.8%; Fig. 5B), as they
Consequently, the population-level RLI of oce- the time series. We show that the RLI closely may not be considered threatened when their
anic fishes worsened steadily since the 1950s, tracks changes in fishing mortality and find a abundance declines have been stabilized at low
reaching its lowest value in 2008, 2 years after significant negative cross-correlation between levels and the causes of decline are understood
the maximum value of fishing mortality (Fig. fishing mortality and the RLI (Fig. 5A), sug- and have ceased. Furthermore, there were few
4G). When fishing mortality started to de- gesting that the RLI is sensitive (sensitivity = “false alarms” (10.6%) in which the Red List
crease after 2006, the population-level RLI −0.34) and responsive to fishing mortality (with criteria classified a population as threatened
reversed shortly after, reflecting the reclassi- a significant time lag of only 2 years) (14) (figs. although it was not being estimated as over-
fication of many populations into less threat- S15 to S17). The pressure-state relationship is fished, offering an early warning for those
ened categories (fig. S8). reversible and symmetric, with the RLI recov- populations with relatively large biomass de-
The extent and timing of management ering as fishing mortality decreases, tracking clining rapidly toward target levels (fig. S5).
measures implemented by tuna RFMOs differ back (green points) along the same path as the These false alarms are transient and disappear
markedly among ocean regions and taxa, in- decline trajectory (red points, Fig. 5A). Second, if populations are stabilized at target levels.
fluencing overall fishing mortality, biomass, we assessed alignment by comparing the fish- Altogether, this harmony in criteria sets is
and population-level RLI trajectories (Fig. 4). ery exploitation status [whether populations highly consistent with all other modeling and
Regionally, the RLI trajectories track the his- are considered overfished (B < BMSY) or not meta analyses comparing the Red List status
torical increase in fishing mortality following (B ≥ BMSY), derived from the latest fish stock with fishery exploitation status over a wide
the development of industrial tuna fisheries, assessments and the corresponding population- range of marine fishes (16–18) and provides
which began first in the Atlantic and eastern scale Red List status (14) (table S5). We find that further evidence of alignment among both
Pacific before expanding to the Indian and the fishery exploitation status and Red List classification systems when applied at the same
western Pacific oceans during the 1980s (Fig. status are aligned in 76.6% of the assessments scale. Although we do not propose that the RLI
4B). The lowest RLI values observed in the (true positives and negatives; Fig. 5B and table be used to manage populations, there should
Indian and western Pacific around the 2010s S6). Therefore, a sustainable fishery will have be no concerns that a threatened listing is in-
(Fig. 4H) were due to the steep decline in bio- low extinction risk, and conversely in an un- consistent with fishery management advice
mass (Fig. 4E) resulting from the rapid in- sustainable fishery, an overfished population will as these mismatches can often be understood
crease in fishing mortality. We also find that likely have a higher extinction risk. However, and explained. Hence, our findings of strong
the different timing in the stabilization pattern some overfished populations were categorized alignment demonstrate that both criteria sets
of overall biomass levels around the manage- in the low-risk category of LC by the Red List are complementary and eliminate any technical
ment target of MSY in the four ocean regions
has resulted in the observed region-level re-
ductions in extinction risk. The RLI has been Fig. 5. Effects of fishing mortal- A
reversed in all oceans through reductions in ity on the state of oceanic 1.00
Population-level Red List Index
fishing mortality (Fig. 4H). When examining predatory fishes. (A) Prewhitened Prior to 2008
population-level RLI trajectories by major cross-correlation between global 0.95 After 2008
taxon, we confirm that the declining RLI tra- average annual fishing mortality
jectory has not only been halted but also and population-level RLI for the 0.90
reversed for tunas and billfishes (Fig. 4I). assessment of sensitivity and
We attribute these recoveries to a reduction responsiveness of the RLI to 0.85
in overall fishing mortality (Fig. 4C) and hence fishing. (B) Alignment between the
the recovery of biomass toward sustainable population-level Red List status 0.80 Strength of the
levels (Fig. 4F) following effective manage- in relation to fishery exploitation pressure-state relationship:
ment measures. However, we caution that the status. Current fishery exploitation 0.75 Sensitivity (-0.34)
threatened status of some tunas and billfishes status, whether the population is Responsiveness (2 years lag)
(e.g., Indian Ocean Yellowfin and Atlantic considered overfished (Bcurrent < 0.70
Bigeye Tuna) require strengthened manage- BMSY) or not (Bcurrent > BMSY), 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4
ment measures (fig. S8). Historically, sharks derived from the most current Global fishing mortality
have been the incidental catch of these tuna fishery assessments (y axis)
and billfish fisheries and have declined steeply and the Red List status for the B
(Fig. 4, F and I) as fishing mortality is twice same assessment year (x axis).
Undetermined
that of the sustainable level (Fig. 4C). Despite Circle size is proportional to
increasing scientific evidence and public con- the number of populations
cern, undermanaged populations of oceanic classified in each category. 1 1 3
sharks continue to worsen along a path of in-
creasing extinction risk (Fig. 4I). 10.6% Not aligned 48.9% Aligned
Not overfished
barrier for use of the RLI by policy-makers for trade, and conservation actions to categorize to halt and reverse broad oceanic biodiver-
tracking CBD and SDG targets. species in addition to the population reduction sity loss remains the next management chal-
Our continuous RLI of oceanic predatory analysis used here. Finally, our continuous RLI lenge to achieve progress for both people and
fishes advances and complements episodic could be applied to other marine fishes and oceanic biodiversity.
RLI as calculated for other animal and plant any other taxa with time series of population
groups (Fig. 6) as it allows for tracking of data, which would increase the temporal and Materials and Methods
status and trends in extinction risk on much spatial resolution of both global and regional Compilation of population data from fish
finer time scales. In a half a century, industrial Red List and RLI assessments. We reaffirm the stock assessments
fisheries have reduced oceanic pelagic bio- need to expand the representation of marine We compiled the most recent (as of June 2020)
diversity to levels similar to those brought species on the Red List to monitor marine fish stock assessments for 52 populations
about for other terrestrial taxa over the course biodiversity because most marine taxa remain (18 species) of tunas, billfishes, and sharks from
of centuries (19). The initial warnings now unassessed (21). the five tuna RFMOs (fig. S2 and table S2) (14).
seem timely and appropriate given how rap- Our study connects annual changes in fish- For each fish stock assessment, we extracted
idly the RLI of oceanic tunas, billfishes, and ing mortality and extinction risk globally over the following: (a) the estimated time series
some sharks have recovered to levels more the past 70 years for oceanic tunas, billfishes, of biomass or time series of biomass relative to
typical of terrestrial vertebrates. This pro- and sharks and reveals how effective manage- the biomass that produces the MSY [B/BMSY]
vides evidence that decisive action by fish- ment for highly valuable commercial species (fig. S5), (b) the estimated time series of fish-
eries agencies can recover exploited fishes, of tunas and billfishes has reversed the bio- ing mortality relative to the fishing mortality
but we have yet to take similarly decisive ac- diversity loss curve while the extinction risk of that produces the MSY [F/FMSY] (fig. S6),
tion for sharks. Furthermore, our continuous undermanaged sharks continues to increase. and (c) the standard biological reference points
RLI trajectories for tunas (Fig. 3B) and sharks Our vignette of oceanic predator fisheries re- used to determine population status, gener-
(Fig. 3D) are highly consistent with the re- veals the biggest challenge of global multigear ally the current adult biomass relative to the
cently published episodic IUCN Red List and multispecies fisheries management, as adult biomass producing MSY (Bcurrent/BMSY)
assessments for oceanic tunas and sharks target species are increasingly being brought and current fishing mortality rate relative to
(8, 9, 20), showing that the RLI for oceanic to sustainable levels to ensure maximum yield. the fishing mortality that maintains MSY
tunas has recovered between 2011 and 2021 However, the shark species incidentally cap- (Fcurrent/FMSY) (table S2). This data was ex-
and that the global extinction risk for sharks tured by the same fisheries continue to decline tracted from the assessment models (and
continues to worsen. For data-rich taxa, both to the point where there is increasing risk of model runs) used to determine population
the episodic and continuous RLI are highly biodiversity loss due to insufficient manage- status and provide management advice by the
aligned because both Red List assessments ment actions (22, 23). Driven by policy com- Scientific Committees of each of the tuna
are driven by the same data, though we note plexity, insufficient data and monitoring, RFMOs (14).
that the episodic formal IUCN Red List assess- socioeconomic concerns, and lack of political
ments process has scope to diverge as it con- action, oceanic sharks remain undermanaged Compilation and estimation
siders other criteria (B to E), threats, use and and a lower priority in tuna RFMOs despite of generation lengths
repeated and increasingly intense warnings We also collated the GL for each species (and
based on their high intrinsic sensitivity to populations) of tunas, billfishes, and sharks
1.0 Corals overfishing, increasing catches, and the high from the published literature or as approved
Oceanic international trade value of their meat and for use by the IUCN Tuna and Billfish Specialist
0.9
sharks and rays Birds fins (9, 24). To date, conservation and man- Group or the IUCN Shark Specialist Group
Oceanic tunas,
billfishes
agement measures in tuna RFMOs for sharks (table S3). In some cases we also estimated
remain largely focused on mitigating the effects GL for populations using age-structured life
Red List Index
(F) on the species or population is below the fishing pressure (here expressed as fishing 17. P. G. Fernandes et al., Coherent assessments of Europe’s
fishing mortality corresponding to the maxi- mortalities), which is monitored at the level of marine fishes show regional divergence and megafauna
loss. Nat. Ecol. Evol. 1, 0170 (2017). doi: 10.1038/
mum sustainable yield (MSY; F/FMSY≤1) for population, on the population-level RLI trajec- s41559-017-0170
the previous one GL in at least 90% of its tories. We calculated the global population- 18. S. Millar, M. Dickey-Collas, Report on IUCN assessments and
range according to IUCN guidelines (15). When level RLI using the Red List status of the fisheries management approaches. ICES CM 2018/ACOM:60
(2018).
estimating the total percent change for species 52 populations of tunas, billfishes, and sharks
19. D. J. McCauley et al., Marine defaunation: Animal loss in the
with multiple populations, we weighted the as the basic unit of assessment (instead of global ocean. Science 347, 1255641 (2015). doi: 10.1126/
estimated total percent change in biomass of using species as the unit of assessment) as- science.1255641
each population by their MSY to account for signing equal weighting to all populations (fig. 20. The IUCN Red List of Threatened Species, (IUCN, 2015);
www.iucnredlist.org.
the contribution of different population sizes S7 and S14) (14). 21. T. J. Webb, B. L. Mindel, Global patterns of extinction
to the global species (table S2). We calculated risk in marine and non-marine systems. Curr. Biol. 25,
the total percent change in population bio- Estimation of the overall trajectories of biomass 506–511 (2015). doi: 10.1016/j.cub.2014.12.023;
mass over the past three GL by estimating the and fishing mortalities pmid: 25639240
22. R. Hilborn et al., Effective fisheries management instrumental
average annual rate of population change over We calculated the global overall trajectory of in improving fish stock status. Proc. Natl. Acad. Sci. U.S.A. 117,
the three-GL window using an intercept-only biomass and fishing mortality across the 52 2218–2224 (2020). doi: 10.1073/pnas.1909726116;
hierarchical Bayesian model (14). At the end, populations of oceanic predatory fishes from pmid: 31932439
23. M. G. Burgess et al., Protecting marine mammals, turtles, and
we were able to assign Red List categories to 1950 to 2019 by fitting a Bayesian generalized birds by rebuilding global fisheries. Science 359, 1255–1258
the taxonomic unit of population (fig. S8) and linear model where the fishing mortality or (2018). (2018). doi: 10.1126/science.aao4248
the taxonomic unit of species (fig. S9) annually biomass values were treated as the response 24. M. J. Juan-Jordá, H. Murua, H. Arrizabalaga, N. K. Dulvy,
V. Restrepo, Report card on ecosystem-based fisheries
between 1950 to 2019 (fig. S10 shows two il- variable with a Gamma likelihood and an iden- management in tuna regional fisheries management
lustrative examples of Red List status calcu- tity link function, and the years were the fixed organizations. Fish Fish. 19, 321–339 (2017).
lations). Because of the Bayesian estimation predictors (treated as factors) (14). In this way, doi: 10.1111/faf.12256
framework, we assigned Red List category the estimated average biomass or fishing mor- 25. H. Booth, D. Squires, E. J. Milner-Gulland, The mitigation
hierarchy for sharks: A risk-based framework for reconciling
probabilities allowing us to propagate the tality had balanced data as each year had the trade-offs between shark conservation and fisheries objectives.
uncertainty in population reductions into same number of populations and each popula- Fish Fish. 21, 269–289 (2019). doi: 10.1111/faf.12429
probabilistic classifications for each of the tion weighted equally. 26. M.-J. Juan-Jordá, N. Pacoureau, mjuanjorda/
RLI_tunas_billfishes_sharks, Github (2022); https://github.
Red List categories. The application of A1 or com/mjuanjorda/RLI_tunas_billfishes_sharks.
A2 thresholds for assigning the most likely
Red List category requires to determine on an RE FERENCES AND NOTES AC KNOWLED GME NTS
annual basis whether a population and spe- 1. “Secretariat of the Convention on Biological Diversity (2020) We thank all the authors of the fishery stock assessments used
Global Biodiversity Outlook 5 – Summary for Policy Makers” in our analysis, which were performed by the five tuna regional
cies is being sustainably managed. We con- (UN Convention on Biological Diversity, 2020). fisheries management organizations independent of this paper. We
ducted two different sensitivity analyses for 2. “Summary for policymakers of the global assessment report on also thank A. B. Cooper, and the Earth to Ocean Research
evaluating the impact of calculating in differ- biodiversity and ecosystem services of the Intergovernmental Group from Simon Fraser University, Canada for their highly
Science-Policy Platform on Biodiversity and Ecosystem constructive comments and feedback at the early stages of this
ent ways whether a population and species Services” S. Díaz et al., Eds. (IPBES secretariat, 2019). study. Funding: M. J. J-J. received funding from the People
is being sustainably managed on the deter- 3. D. A. Kroodsma et al., Tracking the global footprint of fisheries. Programme (Marie Curie Actions) of the European Union’s Seventh
mination of extinction risk (figs. S11, S12, and Science 359, 904–908 (2018). doi: 10.1126/science.aao5646 Framework Programme (FP7/2007-2013) under REA grant
4. FAO, The State of World Fisheries and Aquaculture 2020. agreement [628116], and a fellowship from “la Caixa” Foundation
S13) (14). (FAO, 2020); www.fao.org/documents/card/en/c/ca9229en. (ID 100010434). The “la Caixa” fellowship code is (LCF/BQ/PR20/
5. G. M. Mace et al., Aiming higher to bend the curve of 11770005). N.K.D. was supported by the Natural Sciences and
Estimation of RLI biodiversity loss. Nat. Sustain. 1, 448–451 (2018). Engineering Research Council of Canada and the Canada Research
doi: 10.1038/s41893-018-0130-0 Chairs Program. This paper is contribution 1130 from AZTI, Marine
We calculated a continuous RLI for oceanic 6. T. H. Sparks et al., Linked indicator sets for addressing Research, Basque Research and Technology Alliance (BRTA).
predatory fishes between 1950 and 2019 using biodiversity loss. Oryx 45, 411–419 (2011). Author contributions: M. J. J-J. and N.K.D. conceptualized the
the estimated extinction risk of the 18 species doi: 10.1017/S003060531100024X analysis. M. J. J-J., H. M., H.A., and G. M. compiled and curated
7. E. L. Hazen et al., Marine top predators as climate and the time series data. M. J. J-J. and N.K.D. visualized the data and
of tunas, billfishes, and sharks (figs. S7 and
ecosystem sentinels. Front. Ecol. Environ. 17, 565–574 (2019). wrote the first draft. M. J. J-J. and N.P. conducted the statistical
S14) (14). We also disaggregated the global doi: 10.1002/fee.2125 analysis with input from all authors. M. J. J-J. created figures
species-level RLI by major taxon (tunas, bill- 8. B. B. Collette et al., High value and long life - Double jeopardy with input from all authors. M. J. J-J., H. M., H.A., and N.K.D.
fishes, sharks). Traditionally, the RLI is cal- for tunas and billfishes. Science 333, 291–292 (2011). acquired the funding. All authors discussed the time series data,
doi: 10.1126/science.1208730 developed the methodology, discussed analysis and results,
culated from the episodic application of the 9. N. Pacoureau et al., Half a century of global decline in oceanic contributed to writing the manuscript and oversaw the project.
IUCN Red List categories and criteria to spe- sharks and rays. Nature 589, 567–571 (2021). doi: 10.1038/ Competing interests: The authors declare no competing interests.
cies groups, and this usually occurs episodi- s41586-020-03173-9; pmid: 33505035 Data and materials availability: Data and code used in our
10. S. H. M. Butchart et al., Improvements to the Red List Index. analysis will be available on GitHub. All other data needed to
cally involving Red List Authorities and PLOS ONE 2, e140 (2007). doi: 10.1371/journal.pone.0000140; evaluate conclusions in the paper are present in the paper or the
Specialist Groups of the IUCN Species Survival pmid: 17206275 supplementary materials. License information: Copyright © 2022
Commission. Instead, here, we calculated a 11. IUCN Red List Categories and Criteria: Version 3.1 (IUCN the authors, some rights reserved; exclusive licensee American
Species Survival Commission, 2012); https://portals.iucn.org/ Association for the Advancement of Science. No claim to original
continuous RLI using a Bayesian framework library/sites/library/files/documents/RL-2001-001-2nd.pdf. US government works. https://www.sciencemag.org/about/
by classifying species into the extinction risk 12. R. B. Sherley et al., Estimating IUCN Red List population reduction: science-licenses-journal-article-reuse
probabilistic categories using time series ana- JARA—A decision-support tool applied to pelagic sharks. Conserv.
Lett. 13, e12688 (2020). doi: 10.1111/conl.12688
lyses of population data derived from fish 13. N. K. Dulvy, S. Jennings, S. I. Rogers, D. L. Maxwell, Threat and SUPPLEMENTARY MATERIALS
stock assessments (14). The Bayesian estima- decline in fishes: An indicator of marine biodiversity. Can. J.
science.org/doi/10.1126/science.abj0211
tion framework improved the characterization Fish. Aquat. Sci. 63, 1267–1275 (2006). doi: 10.1139/f06-035
Materials and Methods
14. Materials and methods are available as supplementary
of uncertainty in the RLI, which facilitates the Figs. S1 to S17
materials.
communication of uncertainty and proba- Tables S1 to S6
15. Guidelines for Using the IUCN Red List Categories and Criteria,
References (27–47)
bilistic statements to conservation practi- Version 14 (IUCN Standards and Petitions Committee, 2019);
MDAR Reproducibility Checklist
tioners (12). https://www.iucnredlist.org/resources/redlistguidelines.
16. N. K. Dulvy, H. K. Kindsvater, in Conservation for the Submitted 27 April 2021; resubmitted 10 December 2021
We also calculated a global population-level Anthropocene Ocean, L. P. S, M. R. Poe, Eds. (Academic Press, Accepted 27 September 2022
RLI in order to examine the effects of global 2017), pp. 339–340. 10.1126/science.abj0211
T
CAR that induces functional, transcriptomic,
cell–based immunotherapies, including of nuclear receptor subfamily 4A (NR4A) (14), and epigenetic hallmarks of T cell exhaustion
immune checkpoint inhibitors and adop- and transient induction of T cell rest (15, 16). (13, 16). Using a previously published single
tive cell therapies, have demonstrated However, it remains unclear whether exhaus- guide RNA (sgRNA) library (24), editing was
impressive antitumor effects in many tion resistance will be sufficient to overcome achieved by adapting the SLICE (sgRNA lenti-
cancers (1–8), but durable responses are the multitude of immunosuppressive factors viral infection with Cas9 protein electroporation)
not achieved in most patients. A central bar- in the tumor microenvironment. platform (18) to incorporate CAR transduction
rier to progress is limited T cell potency, re- Gene editing technologies are providing un- (Fig. 1A and fig. S1A). We detected 98% of the
sulting from a myriad of factors, including paralleled opportunities to engineer more sgRNA library in transduced CAR T cells, with
T cell exhaustion, senescence, anergy, and potent human T cells. Ex vivo CRISPR has 19,885 genes targeted by at least four sgRNAs
local and systemic immunosuppression (9–12). been used safely to deliver gene-edited tumor- (fig. S1, B and C). Successful editing was con-
Advances in understanding the biology of specific T cells to humans with cancer (17), and firmed by drop out of sgRNAs targeting a “gold
T cell exhaustion are providing novel ap- the CRISPR platform has been optimized to standard” set of essential genes but not control
proaches to prevent these phenomena, in- conduct forward genetic screens in primary guides after 23 days in culture (fig. S1D and
cluding overexpression of c-JUN (13), deletion human T cells to identify novel targets to aug- tables S1 and S2).
ment T cell function. These approaches have For the expansion screen, we cultured the
1 identified genes that regulate programmed transduced cells in vitro for 15 days, then co-
Immunology Graduate Program, Stanford University School of
Medicine, Stanford, CA, USA. 2Center for Cancer Cell Therapy, cell death protein 1 (PD-1) expression, T cell cultured with GD2+ tumor cells until day 23
Stanford Cancer Institute, Stanford University School of proliferation and persistence, and resistance and compared sgRNA abundance between day 0
Medicine, Stanford, CA, USA. 3Department of Computer to adenosine-mediated immunosuppression and day 23 (fig. S1E). Per the MAGeCK algo-
Science, Stanford University, Stanford, CA, USA. 4Center for
Personal Dynamic Regulomes, Stanford University, Stanford, CA, (18–20), but work is ongoing to define genes rithm (25), both donors showed enrichment
USA. 5Department of Pathology, Stanford University School of for which editing will most potently augment of sgRNAs targeting genes known to inhibit
Medicine, Stanford, CA, USA. 6Institute for Stem Cell Biology antitumor responses in humans. In this study, T cell survival, such as FAS and CASP3 (26)
and Regenerative Medicine, Stanford University School of
Medicine, Stanford, CA, USA. 7Department of Bioengineering, we used CRISPR screening to identify genes (Fig. 1B), whereas sgRNAs targeting genes
Stanford University School of Medicine, Stanford, CA, USA. that regulate effector function in primary human known to promote T cell proliferation, such as
8
Department of Pharmacology, University of Colorado Anschutz T cells expressing chimeric antigen receptors IL2RG, MYC, and ZAP70, were depleted. The
Medical Campus, Aurora, CO, USA. 9Parker Institute for Cancer
Immunotherapy, San Francisco, CA, USA. 10Howard Hughes
(CARs) and discovered that MED12 (Mediator top hits in the expansion screen were CCNC
Medical Institute, Stanford University, Stanford, CA, USA. complex subunit 12) and CCNC (cyclin C), genes (cyclin C) and MED12 (Mediator complex sub-
11
Division of Pediatric Hematology/Oncology and Division of encoding proteins in the kinase module of the unit 12), members of the kinase module of Me-
Stem Cell Transplantation and Regenerative Medicine,
Department of Pediatrics, Stanford University School of
Mediator complex, negatively regulate T cell diator, with seven of seven guides targeting
Medicine, Stanford, CA, USA. 12Linda Crnic Institute for Down effector activity. Mediator, an evolutionarily CCNC and eight of eight guides targeting MED12
Syndrome, University of Colorado Anschutz Medical Campus, conserved multisubunit protein complex that positively enriched (fig. S2, A to C). The expan-
Aurora, CO, USA. 13Division of Blood and Marrow
acts as a bridge between enhancer-bound tran- sion screen also showed depletion of sgRNAs
Transplantation and Cell Therapy, Department of Medicine,
Stanford University School of Medicine, Stanford, CA, USA. scription factors and the general transcription targeting BATF and JUNB, suggesting a sur-
*Corresponding author. Email: cmackall@stanford.edu machinery, is required for gene transcription vival role for activator protein 1 (AP-1) family
‡Present address: Department of Pediatrics, University of and plays a central role in establishing cellular members in the setting of chronic stimulation.
Pennsylvania, Philadelphia, PA, USA.
†These authors contributed equally to this work. identity by coordinating transcriptional net- In the cytokine production screen, we cultured
§These authors contributed equally to this work. works (21–23). Across multiple CAR T cell mod- HA-28z CAR T cell knockout libraries in vitro
Donor 2
Donor 2
2
effect that depletion of cyclin C
(“CCNC deficient”) or MED12
Expansion screen
E 8
ED 1
M 22
E 7
E 0
ED 4
M 31
M 21
E 6
E 9
E 0
ED 9
E 7
E 5
E 6
E 4
E 5
E 3
ED 8
30
M ED 9
C NC
E 8
E 6
ED 7
M D4
M D9
ED 1
M K8
M 13
ED 1
M 2
ED 1
M D1
M D1
M D1
M D2
M D1
M D1
M D1
M D2
M 2
M D1
M D1
M D2
M D2
M D2
M D2
M K1
M ED
M ED
M ED
M ED
D
E
E
C
D
for 15 days, added GD2+ tumor cells to the Mediator consists of a 26-subunit core or- Mediator kinase module in T cell expansion
culture for 6 hours, used fluorescence-activated ganized into head, middle, backbone, and tail and cytokine production.
cell sorting (FACS) to sort cells, and compared domains, and a four-subunit dissociable kinase
sgRNA abundance in CAR T cells expressing module (28, 29) (Fig. 1D). CCNC and MED12 Mediator kinase module–deficient CAR T cells
interleukin-2 (IL-2) and tumor necrosis factor–a are both centrally located in the kinase mod- demonstrate increased in vitro and in vivo
(TNFa) protein against the total population ule (30), suggesting that loss of either gene expansion independent of costimulation domain
(fig. S1E). MED12 was enriched in the cytokine disrupts a common function. Consistent with or tonic CAR signaling
screen, with six of seven guides demonstrating this, sgRNAs targeting all members of the To validate the expansion screen findings,
enrichment, while several genes, including kinase module were positively enriched in the sgRNAs targeting CCNC, MED12, or AAVS1 as
nine of nine guides targeting ZAP70 were de- expansion screen except for MED12L, which is a control were delivered as ribonucleoprotein
pleted, consistent with the known role for not expressed in T cells (Fig. 1E and fig. S2D). 3 days after T cell activation followed by ret-
ZAP70 in CAR signaling (27) (Fig. 1C and fig. In contrast, sgRNAs targeting subunits of the roviral transduction of the HA-28z CAR (fig.
S2, B and C). Six of nine guides targeting head, backbone, and middle domains of core S3A). CCNC and MED12 deletion were con-
TNF and five of eight guides targeting IL2 Mediator were associated with poor expansion firmed by immunoblotting and Sanger sequenc-
were also significantly depleted, demonstrat- (Fig. 1E). Together, these data demonstrate a ing using Inference of CRISPR Edits (ICE) (31)
ing an expected loss of cytokine-negative cells requirement for the core Mediator complex in (fig. S3, B and C). Because CAR transduction
in the sorted population (fig. S2B). T cell survival and a regulatory role for the efficiency, as well as the ratio of CD4+ to CD8+
cells, could affect CAR T cell function, we con- stimulated MED12- and CCNC-deficient HA-28z, (Fig. 2, G and H, and fig. S6, E and F). Sim-
firmed that loss of MED12 or CCNC did not CD19-28z, and HER2-4-1BBz CAR T cells pro- ilarly, we observed enhanced tumor control
change CAR expression or the ratio of CD4+ to duced higher levels of cytokines and showed and prolonged survival in mice engrafted with
CD8+ cells, nor did it affect retroviral integra- increased frequencies of IL-2 and TNFa– 143B osteosarcoma cells and treated with
tion of green fluorescent protein (GFP) (fig. S3, expressing cells (Fig. 2C and fig. S5, A and B). MED12- and CCNC-deficient CAR T cells ex-
D to H). MED12- and CCNC-deficient HA-28z Additionally, we found elevated IL2, IFNG, pressing the HER2-4-1BBz receptor (Fig. 2I
CAR T cells showed greater expansion than and TNF mRNA levels in MED12-deficient cells and fig. S6G). Collectively, these results dem-
did control cells over 23 days in culture (Fig. compared with control cells, indicating that onstrate that MED12- and CCNC-deficient
2A). We previously reported that HA-28z CAR these changes are transcriptionally mediated T cells manifest enhanced hallmark features
T cells develop hallmark features of exhaus- (fig. S5C). To assess the impact of Mediator of effector cells, spanning antigen-induced ex-
tion attributable to tonic signaling (13, 16, 32). kinase module disruption more broadly on pansion, cytokine production, metabolic fit-
To determine whether MED12 and/or CCNC antigen-induced cytokine secretion, we per- ness, and killing capacity.
would limit functionality of CAR T cells that formed bead-based multiplex immunoassay
do not develop exhaustion in vitro, we deleted profiling of 38 cytokines in supernatants col- MED12-deficient T cells demonstrate
MED12 and CCNC in T cells expressing the lected from CD19-28z CAR T cells stimulated sustained effector function under
CD19-28z CAR (13, 16, 32). CCNC- and MED12- with CD19+ Nalm6 leukemia cells for 24 hours. chronic stimulation
deficient CD19-28z CAR T cells demonstrated Hierarchical clustering showed that the cyto- To further investigate the impact of kinase
increased expansion compared with control kine profile of MED12- and CCNC-deficient module disruption on longer-term T cell fitness
cells over 23 days in culture and after serial CD19-28z CAR T cells was distinct from that of and following repetitive antigen stimulation,
stimulation with tumor cells (Fig. 2A and fig. controls (Fig. 2D), with increased proinflam- we focused on MED12 because this gene was
S4A). Furthermore, adoptively transferred matory cytokines including interferon-g (IFNg), a top hit in both CRISPR screens. MED12-
MED12- and CCNC-deficient HA-28z and TNFa, IL-17, and IL-6; increased inflammatory deficient HA-28z CAR T cells demonstrated
CD19-28z CAR T cells showed increased in chemokines CXCL10 and CCL3; and increased increased expansion and cytotoxicity after re-
vivo expansion in tumor-bearing NSG mice common gamma chain family cytokines IL-2 peated stimulation with Nalm6-GD2 tumor
compared with control CAR T cells (fig. S4B). and IL-9, which promote T cell survival and cells (Fig. 3, A and B, and fig. S7, A and B).
We also observed enhanced expansion of MED12- differentiation (fig. S5D). Together, these re- Similarly, MED12-deficient HA-28z CAR T cells
and CCNC-deficient HER2-4-1BBz CAR T cells sults demonstrate that MED12 and CCNC con- cultured in vitro until day 54 continued to
(fig. S4B), confirming that the findings are not strain antigen-induced T cell expansion and demonstrate enhanced T cell expansion and
restricted to CAR T cells incorporating a CD28 inflammatory cytokine production and raise cytokine production (Fig. 3, C and D). To fur-
costimulatory domain. Together, these results the prospect that MED12- or CCNC-deficient ther characterize the MED12-deficient phe-
demonstrate that MED12- and CCNC-deficient T cells may demonstrate enhanced antitumor notype at late time points, we performed
human CAR T cells manifest enhanced antigen- immune responses. single-cell proteomic analysis of 34 proteins
driven expansion regardless of whether the using mass cytometry to measure lineage-
CAR incorporates a CD28 or 4-1BB costimu- Mediator kinase module–deficient CAR T cells defining transcription factors and cell surface
latory domain or whether the CAR T cells demonstrate increased metabolic fitness and markers associated with activation, exhaus-
manifest hallmark features of exhaustion. antitumor activity tion, and T cell differentiation (table S3). Both
To determine whether these effects are To assess whether MED12- or CCNC-deficient control and MED12-deficient HA-28z CAR
dependent on catalytic activity of the kinase T cells manifest metabolic features of enhanced T cells displayed an activated effector pheno-
module, we cultured healthy human T cells effector functionality (35), we measured glyco- type after 50 days in culture, with high ex-
following anti-CD3/CD28 activation with com- lytic and oxygen consumption rates. We ob- pression of Ki67, CD69, Tbet, TOX, CD25, and
pounds that are dual inhibitors of CDK8 and served increased basal and maximal oxygen CD122 and low expression of IL7R, CD45RA,
CDK19 and observed significant increases in consumption in MED12- and CCNC-deficient CD27, CD28, CCR7, and TCF7 relative to non-
T cell expansion (Fig. 2B). Additionally, over- cells, despite no change in mitochondrial mass, activated T cells isolated from peripheral blood
expression of MED12 suppressed T cell pro- and increased basal and maximal rates of (fig. S7, C and D). Relative to control HA-28z
liferation, confirming that the kinase module glycolysis (Fig. 2, E and F, and fig. S6, A and B). cells, loss of MED12 substantially reduced ex-
restrains T cell expansion (fig. S4, C and D). Stimulation of CD19-28z CAR T cells via the pression of CD39, a marker associated with
MED12 and CCNC behave as tumor suppres- CAR resulted in higher levels of pS6 in MED12- terminal exhaustion and diminished stemness
sors in some settings (33, 34), however, when deficient cells, demonstrating enhanced antigen- (Fig. 3, E and F) (37, 38), while PD-1 and TIM3
we removed IL-2 from the culture medium, we dependent activation of the mammalian target were unchanged and LAG3 was elevated (fig.
observed a complete loss of viable cells within of rapamycin complex 1(MTORC1) pathway S7E). Additionally, MED12-deficient cells main-
3 weeks (fig. S4E), indicating that expansion which may contribute to the increased meta- tained an elevated CD8+/CD4+ ratio during
is not associated with transformation, as the bolic activity observed (fig. S6, C and D). The long-term culturing (fig. S7F).
cells remain IL-2 dependent. Together, these simultaneous increases in rates of oxidative To determine whether cells lacking MED12
results demonstrate that the kinase module is a phosphorylation and glycolysis observed in would manifest sustained antitumor activity
potent modulator of human T cell expansion. MED12-deficient cells is similar to the meta- in vivo, we engrafted mice with Nalm6-GD2
bolic state described in early activated T cells, leukemia, treated them with MED12-deficient
Mediator kinase module–deficient CAR T cells which have not yet differentiated into short- or control HA-28z CAR T cells, and rechallenged
produce higher levels of inflammatory lived effector cells or memory cells (36). them with additional tumor cells 26 days after
cytokines after antigen stimulation CCNC- and MED12-deficient CAR T cells CAR T cells were administered. MED12-deficient
Next, we sought to confirm the effects of MED12 demonstrated enhanced antitumor function CAR T cells protected from rechallenge with
and CCNC deletion on antigen-induced cyto- in vivo, in a model wherein NSG mice were in- GD2+ but not GD2− tumor cells, demonstrat-
kine production using bulk assays and by as- oculated with Nalm6 or Nalm6-GD2 leukemic ing prolonged antigen-specific antitumor ac-
sessing single-cell production of IL-2 and TNFa cells and treated 3 days later with gene-edited tivity (Fig. 3, G to I). Together, these results
by flow cytometry. Bulk cultures of antigen- CD19-28z or HA-28z CAR T cells, respectively show that loss of MED12 results in long-term
IL-2 (pg/mL)
15 **
clearance. (A) In vitro T cell expansion 100
6000 10000 30000
of CCNC- and MED12-deficient HA-28z 10
(left) and CD19-28z (right) CAR T cells. 10 3000 5000 15000
5
Fold change in total cell count after
23 days in culture relative to control 0 1 0 0 0
18000 18000
CAR T cells edited at the safe harbor 60000
IFN (pg/mL)
CCNC sg40 MED12 sg48 Control sg1
AAVS1 locus. Two different sgRNAs were CCNC sg46 MED12 sg49 12000 40000 12000
used to validate each candidate gene.
Data are mean ± SD of n = 3 donors. B 6000 20000 6000
Ratio paired t test. *P < 0.05, **P < CDK8/19 inhibition
6000
Fold expansion
TNF (pg/mL)
AS2863619 ns
4000
CDK8 and CDK19 over 15 days in culture. SEL120
800 400 1600
Inhibitors were supplemented to the CCT251545
media every 48 hours. Data are mean ± 2000 DMSO
400 200 800
SD of n = 2 replicate wells. Representa-
tive of three independent experiments. 0
-11 -10 -9 -8 -7 -6 -5
0 0 0
10 10 10 10 10 10 10
(C) IL-2 (top), IFNg (middle), and TNFa concentration (M)
CCNC sg40 MED12 sg49 Control sg1 NT
(bottom) cytokine release after 24-hour
coculture with tumor cells from non- D -1.5 0 1.5 E MED12 sg48 Control sg1
transduced (NT) and CAR T cells edited z-score 400
MED12 sg49
OCR (pmol/min)
with sgRNAs targeting MED12, CCNC, R/A
Control-1 300
or safe-harbor control. HA-28z, CD19-
CCNC-40
28z, and HER2-4-1BBz CAR T cells CCNC-46 200 oligo FCCP
were stimulated 1:1 with Nalm6-GD2, MED12-48
Nalm6, or 143B cells, respectively. MED12-49 100
sFAS
LIF
IL−9
CXCL8
IL−6
IL−2
IL−1Ra
IL−17F
TNFb
IL−27
CCL2
CXCL10
IL−21
CXCL9
CCL5
CCL3
CCL4
CCL22
IL−17E
IFNy
IL−22
TNFa
IL−17A
IL−7
GM−CSF
CCL7
IL−4
IL−16
M−CSF
CCL1
CXCL13
IL−10
IL−3
IL−1a
CXCL5
sFASL
sCD40L
IL−5
400 100
Maximum ECAR (mpH/min)
D0 300
Seahorse analysis of oxygen consump- HER2-BB Control sg1
tion rate (OCR) and extracellular HER2-BB CCNC sg40
D14 200
acidification rate (ECAR) of control HER2-BB MED12 sg49
or MED12-deficient CD19-28z CAR 100
D21
T cells under resting and challenge (p/sec/cm2/sr)
8
conditions. Data are mean of n = 12 1 x 10
D27 0
replicate wells. Representative results 2 x 105
5 10 15 20
Days post treatment
from two independent experiments.
(G) Analysis of tumor clearance. NSG
mice were injected intravenously with 1.0 × 106 Nalm6-GD2 leukemia cells and treated with 2.0 × 105 nontransduced or CCNC- or MED12-deficient HA-28z CAR T cells
9 days after tumor infusion (n = 5 mice). (H) Analysis of tumor clearance. NSG mice were injected intravenously with 1.0 × 106 Nalm6 leukemia and treated
with 2.5 × 105 nontransduced or CCNC- or MED12-deficient CD19-28z CAR T cells 3 days after tumor infusion (n = 5 mice). (I) Analysis of tumor clearance.
Tumor area of NSG mice injected intramuscularly with 1 × 106 143B osteosarcoma cells and treated 4 days later with 5 × 106 nontransduced or CCNC- or MED12-
deficient HER2-4-1BBz CAR T cells. Data are mean ± SD of n = 5 mice (nontransduced, MED12-deficient, and CCNC-deficient) or n = 4 mice (control). Two-way
analysis of variance (ANOVA) test with Dunnett’s multiple comparison test. *P < 0.01. [(G) to (I)] Representative experiment from two independent experiments
(n = 2 donors). [(B), (C), and (F)] Two-tailed unpaired Student’s t test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
A B non-transduced
C
HA-28 MED12 sg49 HA-28 Control sg1
fluorescence (normalized)
HA-28 Control sg1 HA-28 MED12 sg49 Control sg1
30 1.5 100
MED12 sg48
tumor rechallenge
tumor rechallenge MED12 sg49
Fold expansion
Fold expansion
tumor GFP
20 1.0
10
10 0.5
0.0 1
0
0 100 200 40 45 50 55
8 10 12 14 16 18
Days post T cell activation Hours Days post T cell activation
D E F
HA-28 Control sg1
Day 45 post T cell activation
HA-28 MED12 sg49 Day 23 HA-28
900 6000 1.5
non-transduced
G H I
Non-transduced Non-transduced
HA-28
HA-28 Control sg1 HA-28 Control sg1
Control sg1 MED12 sg49 MED12 sg49 non-transduced
HA-28 MED12 sg49 GD2- HA-28 MED12 sg49 GD2-
rechallenge
109 D47
2 x 105
108 50
D57
107
106
D104
105 0
0 20 40 60 0 50 100
Days post treatment Days post treatment
Fig. 3. Loss of MED12 sustains effector function during chronic stimula- were stimulated 1:1 with Nalm6-GD2. Data are mean ± SD from n = 3 replicate
tion. (A) Antigen-driven in vitro expansion of control and MED12-deficient HA-28z cultures. (E and F) Flow cytometric analysis of CD39 expression in non-
CAR T cells. CAR T cells were serially stimulated with GD2+ tumor cells in the transduced or HA-28z CAR T cells. Mean fluorescence intensity is normalized
absence of IL-2 at 48-hour intervals at a 1:1 effector to target cell ratio. Data are to the control at each time point. Data are mean ± SD of n = 3 replicate wells.
mean ± SD of n = 3 donors. (B) Cytotoxicity of control and MED12-deficient Statistical comparison is between control and MED12-deficient CAR T cells.
HA-28z CAR T cells against GFP+ Nalm6-GD2 leukemia after serial stimulation (G and I) Analysis of tumor clearance. Bioluminescent imaging (BLI) of NSG
beginning 10 days after T cell activation. Cells were counted and replated at mice injected intravenously with 1 × 106 Nalm6-GD2 leukemia and treated with
a 1:1 ratio of T cells to tumor cells at 48- to 72-hour intervals in media without 4 × 105 nontransduced or HA-28z CAR T cells 7 days after tumor infusion
IL-2. Data are mean ± SD of n = 3 replicate cultures. Representative of three and rechallenged 26 days later with Nalm6 or Nalm6-GD2 cells (n = 5 mice).
independent experiments. (C) In vitro expansion of control and MED12-deficient (H) Survival of CAR-treated mice shown in (G). Survival curves were compared
HA-28z CAR T cells cultured with IL-2. Two different sgRNAs were used to with the Log-rank Mantel-Cox test. *P < 0.01. [(A) to (D)] Two-tailed unpaired
validate each candidate gene. Data are mean ± SD of n = 2 replicate cultures. Student’s t test. *P < 0.05, **P < 0.01. [(E) and (G)] Two-way ANOVA test
(D) IL-2 (left) and IFNg (right) release after 24-hour coculture with tumor cells with Dunnett’s multiple comparison test. *P < 0.01. [(C) to (H)] Representative
45 days after T cell activation. Control and MED12-deficient HA-28z CAR T cells of two independent experiments.
enhancement of T cell fitness, both in the pleted in the NK-like T cell signature, consis- tion, including AP-1 family transcription fac-
setting of chronic stimulation due to the tonic tent with our previous observations. We also tors (FOS, JUNB, BATF, BATF3), IFNG, TNF,
signaling HA-28z CAR and after repeated en- found modest enrichment of the GZMK+ early CD38, IL2RA, and CD69. They also expressed
counters with tumor cells. T effector memory signature, which supports lower levels of genes associated with T cell
the model that loss of MED12 sustains a tran- stemness, including LEF1, TCF7, CD27, and
Loss of MED12 increases effector function in sitory effector memory phenotype that pre- IL7R, and decreased expression of genes asso-
T cells using a TCR for tumor recognition cedes terminal effector differentiation (fig. S8, ciated with T cell quiescence, including KLF2
To determine whether the effects observed in G and H). Together, the data demonstrate and FOXO1. Consistent with MED12-deficient
MED12-deficient CAR T cells were generaliz- phenotypic differences and functional enhance- cells manifesting enhanced cytokine secretion
able to T cells that use a TCR for target recog- ments observed in MED12-deficient CAR T cells and metabolic fitness, gene set enrichment
nition, we deleted MED12 and transduced cells are generalizable to T cells expressing an en- analysis (GSEA) of differentially expressed
with the a and b chains of a TCR that recog- gineered TCR and indicate that disruption of genes revealed enrichment of metabolic and
nizes New York esophageal squamous cell car- the kinase module could have broad utility in cytokine-related gene sets (Fig. 5, F and G).
cinoma (NY-ESO-1), a tumor antigen found in T cell–directed immunotherapies. Transcriptional changes induced by loss of
numerous human cancers, including melanoma MED12 were largely shared between CD4+ and
and synovial sarcoma (39). Compared with MED12-deficient CAR T cells have an CD8+ T cell subsets (fig. S9, D to F). Together,
controls, MED12-deficient NY-ESO-1 T cells effector-like phenotype and display an these results indicate that loss of MED12 pro-
demonstrated an increased proportion of activated transcriptional program motes a transcriptional program consistent with
cells bearing an effector memory phenotype, MED12-deficient CD19-28z CAR T cells displayed an activated effector memory phenotype with
and a lower proportion bearing a stem cell effector phenotypes on the basis of an absence enhanced metabolic fitness and cytokine sec-
memory phenotype (Fig. 4, A and B, and fig. of CCR7; however, MED12-deficient CAR T cells retion capacity.
S8A). MED12-deficient NY-ESO-1 T cells showed expressed high levels of CD45RO, whereas con-
reduced expression of CD45RA and IL7R and trol cells were largely negative for this marker Loss of MED12 increases core Mediator
elevated expression of Ki67, IL2RA, ICOS, at this time point (42–44) (Fig. 5, A and B). chromatin occupancy at transcriptionally
and Tbet, consistent with an activated, pro- Both MED12-deficient and control CD19-28z active enhancers
liferating effector phenotype with diminished CAR T cells expressed high levels of Blimp-1 The Mediator complex lacks a DNA binding
quiescence compared with control cells (Fig. 4, and low levels of Eomes and CD28, consistent domain but interacts with chromatin through
C to E, and fig. S8, B and C). with an effector phenotype (45); however, un- protein-protein interactions with DNA-bound
Loss of MED12 resulted in increased T cell biased clustering demonstrated significant transcription factors and RNA polymerase II
expansion in culture and increased cytokine distinctions between MED12-deficient and con- (RNAPII) (47). To identify the genomic loca-
release upon coculture with NY-ESO-1+ mela- trol phenotypes (Fig. 5C and fig. S9A). MED12- tions of chromatin–Mediator interactions, we
noma cells (Fig. 4, F and G). To determine deficient cells expressed higher levels of T-bet, performed chromatin immunoprecipitation se-
whether loss of MED12 increased antitumor ICOS, TOX, and CD45RO and lower levels of quencing (ChIP-seq) using antibodies against
activity in vivo, we engrafted mice with A375 CD45RA and IL7R, a phenotype previously MED12 and MED1 to profile chromatin bind-
melanoma and treated them with control or associated with short-lived effector cells (SLECs) ing of the kinase module and core Mediator,
MED12-deficient NY-ESO-1 T cells. Complete that have not undergone terminal differentia- respectively, in the presence or absence of
tumor clearance was observed 28 days after tion (46) (Fig. 5D and fig. S9, B and C). Para- MED12. Comparison of MED1- and MED12-
treatment in seven of nine mice in the MED12- doxically, MED12-deficient cells also expressed bound genomic regions in control CD19-28z
deficient group, while zero of nine mice were high levels of CD62L, which is usually asso- CAR T cells showed MED1 and MED12 colo-
tumor-free in the control group (Fig. 4, H and ciated with stem cell and central memory sub- calization in 86.1% of sites, whereas MED1 was
I, and fig. S8D). Single-cell transcriptomic pro- sets and not typically expressed by SLECs. found exclusively at 13.1% of sites and MED12
filing of tumor-infiltrating NY-ESO-1 T cells MED12-deficient CD19-28z CAR T cells also was found exclusively at only 0.7% of sites
showed that MED12-deficient cells expressed expressed high levels of LAG-3, whereas other (Fig. 6A). These results demonstrate that, in
higher levels of genes encoding cytotoxic mol- exhaustion markers such as PD-1, TIM3, TIGIT, human T cells, the kinase module rarely con-
ecules including perforin, granzyme B, and and CD39 were lowly expressed and unchanged tacts chromatin in the absence of core Me-
IFNg and lower levels of natural killer (NK) from control cells (Fig. 5D and fig. S9C). To- diator and the kinase module is present at the
cell receptors KLRD1 and KLRB1, which have gether, these results demonstrate that MED12- majority of sites occupied by core Mediator.
been associated with T cell dysfunction during deficient CAR T cells manifest expansion of a Given the degree of colocalization observed, we
chronic antigen exposure (Fig. 4, J and K, and distinctive CCR7–IL7R–Tbet+ICOS+CD62L+ ef- predicted that MED12 deletion could have
fig. S8E) (40), and cell cycle analysis showed fector cell subset that displays enhanced cyto- widespread effects on transcription and func-
that a higher fraction of MED12-deficient tumor- kine production, effector cell potency, metabolic tion of the core Mediator.
infiltrating lymphocytes were in S phase, con- fitness, and antitumor activity. To assess the effect of MED12 deletion on
sistent with increased proliferation in tumors To assess genome-wide transcriptional dif- core Mediator chromatin occupancy, we com-
(fig. S8F). ferences between MED12-deficient and control pared genomic regions bound by MED1 in con-
To assess similarities between MED12- cells, bulk RNA-seq was performed on day 15 trol and MED12-deficient CAR T cells. Principal
deficient T cells and naturally occurring T cell CD19-28z CAR T cells after a 3-hour stimula- components analysis showed global differences
populations found in tumors from human tion via the CAR in vitro. MED12-deficient in MED1 occupancy between genotypes, includ-
donors, we compared the single-cell RNA se- cells were transcriptionally distinct from con- ing 842 sites with increased MED1 occupancy
quencing (scRNA-seq) profiles of control and trol cells, with differential expression of 3501 and 270 sites with decreased MED1 occupancy
MED12-deficient NY-ESO-1 T cells isolated from genes between genotypes in at least one con- (Fig. 6B and fig. S10A), demonstrating a gen-
xenograft tumors to a set of 17 previously de- dition (Fig. 5E). Consistent with the functional eral pattern of increased MED1 binding in the
scribed T cell gene expression signatures (41). and phenotypic data, MED12-deficient cells dem- absence of MED12. Consistent with a model
MED12-deficient T cells were enriched for the onstrated increased expression of numerous wherein the kinase module limits access of
interferon stimulation gene signature and de- genes associated with effector cell differentia- core Mediator to chromatin, MED12-deficient
% EM of NY-ESO-1 TCR+
using a TCR for tumor recogni- SCM
100 80 Control sg1 Donor 1
% of NY-ESO-1 TCR+
100 NY-ESO-1 TCR+ Donor 2
tion enhances antitumor activity CM 80 MED12 sg49
60
and effector function. (A and B) EM
60
Frequency of T effector memory
UMAP2
TE
UMAP2
50 40
cells (CD45RO+, CCR7−) and stem 40
Control sg1
terminal effector; EM, effector NY-ESO-1
memory. (C to E) UMAP analysis of 10 MED12 sg48
control and MED12-deficient
min
NY-ESO-1
NY-ESO-1 TCR+ cells. Expression of LAG3 CD25 CD28 ICOS MED12 sg49
IFN (pg/mL)
IL-2 (pg/mL)
are combined and colored by geno- 300 1800
type (C), by donor (D), or by marker
TOX Tbet BLIMP-1 Eomes 200 1200
intensity (E). Each dot represents a
single cell (n = 8319 cells). Data are
UMAP2
100 600
pooled from two donors. (F) In vitro
expansion of control and MED12- 0 0
deficient NY-ESO-1 T cells cultured Non- NY-ESO-1 NY-ESO-1
UMAP1 transduced Control sg1 MED12 sg49
with IL-2. Data are mean ± SD of
H A375 melanoma I Day 28 post treatment
n = 3 donors. (G) IL-2 (left) and
300 400
IFNg (right) release after 24-hour 300 300 Non-transduced Non-transduced
coculture of NY-ESO-1 T cells with NY-ESO-1 Control sg1 NY-ESO-1 Control sg1
300
200 200 200 NY-ESO-1 MED12 sg49
A375 melanoma cells. Data are NY-ESO-1 MED12 sg49
mean ± SD from n = 3 cultures. 200
100 100 100
Representative of three independent
100
experiments. (H and I) Analysis of
0 0 0
tumor clearance. Tumor area of NSG 0 10 20 30 0 10 20 30 0 10 20 30 0
mice injected subcutaneously with Days post treatment
6
3 × 10 A375 melanoma cells J K PRF1 GZMB IFNG
-34 -29
Gene Expr. P adj. = 1.8 x 10 P adj. = 9.0 x 10 P adj. = 1.2 x 10-5
6
and treated 7 days later with 3 × 10 min max
6 6
Expression Level
cells showed approximately a twofold increase MED12-deficient cells had more abundant MED1 To determine whether sites with increased
in MED1 ChIP-seq signal intensity at sites where in the chromatin-bound fraction and in total MED1 chromatin occupancy after MED12 dele-
increased MED1 binding was observed (Fig. 6C). cell lysates, but MED1 transcript was not dif- tion represent transcriptionally active regions,
Increased MED1 chromatin binding was con- ferentially expressed, indicating that this effect we performed ChIP-seq with antibodies tar-
firmed by immunoblotting studies, which dem- was posttranscriptionally regulated (Fig. 6, D geting H3K27ac and RNAPII pS2 (the elongat-
onstrated that, compared with control cells, and E, and fig. S10, B to D). ing form of RNAPII). Consistent with a model
UMAP1
60 60
cytometry analysis of T cell
40 40
subsets as assessed by CD45RO
TE EM
CCR7
and CCR7 expression in control 0 20 20
78.2 18.1 15.6 76.9
or MED12-deficient CD8+ CD19- 0 0
28z CAR T cells 23 days after 0 105 0 105 UMAP2
T cell activation. Representative CD45RO
result of n = 3 donors. Gating D E rest CAR stim
and subtyping strategy is shown. LAG3 TOX T-bet CD62L
sgRNA: sg1 sg49 sg1 sg49
(B) Frequency of T effector LEF1
memory cells (CD45RO+, CCR7−) FLI1
in CD8+ and CD4+ CAR T cells. CD27
n = 3 donors. Two-tailed paired CCR7
Student’s t test. **P < 0.01, 1128 FOXP3
***P < 0.001. (C and D) UMAP ETS1
ICOS CD45RO CD45RA IL7R
FAS
analysis of control and MED12-
FOXO1
deficient CD19-28z CAR T cells KLF2
15 days after T cell activation.
Expression of 34 markers was SOCS1
analyzed by CyTOF. Control and 649 TCF7
IL7R
MED12-deficient samples are
Blimp-1 Eomes CD28 CD27 NR4A3
combined and colored by geno-
type (C) or by marker intensity
UMAP1
TOX
(D). Representative donor of TOX2
n = 3 donors. Each dot repre- CD38
sents a single cell (n = 30,000 1136 HLA-E
cells). (E) Heatmap of differen- CD28
UMAP2 low high CD247
tially expressed genes in control Protein level
or MED12-deficient CD19-28z F IFNG
CAR T cells detected by bulk RNA- down in MED12 sg49 up in MED12 sg49 TNF
seq 15 days after T cell activation. JUNB
Cholesterol homeostasis FOS
Cells were collected on day 15, 588 IL2RA
IFN response
and CAR stimulated for 3 hours CD69
IFN response size IRF8
with plate-bound anti-idiotype 100
Protein secretion BATF
antibody. Adjusted P < 0.01. 150 CCL3
Hypoxia
n = 3 donors. (F and G) GSEA of -2 z-score 2
Apoptosis 200
unstimulated MED12-deficient CAR
Complement
T cells compared with control G
Glycolysis -log10(FDR)
cells using the hallmark
Adipogenesis 3.5
gene collection. Normalized Glycolysis MTORC1 signaling
TNF signaling via NFKB 3.0
enrichment scores (NES) and 0.4 0.35
MTORC1 signaling
FDR q values are shown. A 2.5
Androgen response
positive NES indicates that the 2.0
Fatty acid metabolism NES = 1.73
gene set was enriched in MED12- NES = 1.57
Inflammatory response 1.5 0 FDR = 0.003 0 FDR = 0.011
deficient cells.
E2F targets
MYC targets
−2 −1 0 1 2
Normalized enrichment score
wherein MED12 deletion modulates transcrip- genes located near sites with increased MED1 chromatin occupancy at select sites in human
tion at MED1-bound sites, we observed that occupancy showed enrichment of genes relat- T cells responsible for regulating T cell differ-
sites with changes in MED1 ChIP-seq signal ed to T cell differentiation, cytokine receptor entiation, leading to transcriptional reprogram-
were highly concordant with sites demonstrat- signaling, and immune response genes (Fig. 6G ming of CAR T cells and enhanced potency.
ing differences in H3K27ac ChIP-seq, RNAPII and table S6) and included many genes with
ChIP-seq, and ATAC-seq (assay for transposase- significantly increased transcript levels, includ- Loss of MED12 increases STAT5 activity in
accessible chromatin with sequencing), indi- ing IFNG, IL17F, IL2RA, and TOX (Fig. 6H and CD19-28z CAR T cells
cating changed transcriptional activity (Fig. 6F fig. S10G). Together, the data are consistent with To define the most differentially regulated tran-
and fig. S10, E and F). Pathway analysis of the a model wherein loss of MED12 increases MED1 scriptional programs in MED12-deficient cells,
A B C D
Control sg1 MED12 sg49
MED1 ChIP-seq
Norm. coverage
MED1 MED12 1000 842 Increased Decreased
40 40
sites sites increased MED1
500 30 30
ME l sg1
ME
ME l sg1
ME
Co
Co
Kb Kb
ntr
ntr
D1
D1
D1
D1
-1000
o
2s
2s
2s
2s
1
E F
g4
g4
g4
g4
8
9
1.5 H3K27ac MED12 MED1 RNAPII
MED1 normalized
MED12 sg48 Control MED12 Control MED12 Control Control MED12 Control MED12
sg1 sg49 sg1 sg49 sg1 sg1 sg49 sg1 sg49 Decreased
MED12 sg49
Coverage
1.0 40 Increased
Norm.
20
Nearest Norm.
0.5 0
Gene Coverage
decreased MED1
KLF2
TCF7
270 sites
0.0 KLRG1 30
G CCR7
GATA3
SOCS3
Positive regulation -log(FDR)
of T cell differentiation 4.0
IFNG
3.5 IL2RA
Alternatively activated APC 3.0 PRDM1
Th17 cell differentiation 2.5 CCR2 20
2.0 CCR5
TGF- receptor signaling pathway 1.5
CXCL11
Th1 and Th2 cell differentiation
CCL1
842 sites increased MED1
H 77 kb
-3kb 3kb
40 kb 365 kb
[0 - 599] [0 - 220] [0 - 45]
MED1 Control sg1
[0 - 599] [0 - 220] [0 - 45]
MED1 MED12 sg49
[0 - 603] [0 - 180] [0 - 37]
MED12 Control sg1
[0 - 200] [0 - 72] [0 - 54]
H3K27ac Control sg1
[0 - 200] [0 - 72] [0 - 54]
H3K27ac MED12 sg49
[0 - 260] [0 - 100] [0 - 76]
ATAC Control sg1
[0 - 260] [0 - 100] [0 - 76]
ATAC MED12 sg49
[0 - 795] [0 - 111] [0 - 26]
RNAPII Control sg1
[0 - 795] [0 - 111] [0 - 26]
RNAPII MED12 sg49
we used HOMER motif enrichment analysis to of STAT and AP-1 motifs (Fig. 7C), confirming factor signatures in both CD4+ and CD8+ T cells
identify differentially accessible transcription that core Mediator is recruited to these sites. (fig. S12, A to D).
factor–binding motifs in MED12-deficient ver- Some motifs demonstrated decreased accessi- To assess the functional significance of these
sus control cells. The top enriched motifs were bility in MED12-deficient cells, including FLI1 findings, we compared STAT5 phosphory-
STAT5 and STAT1, transcription factors that and FOXO1, which are implicated in maintain- lation in MED12-deficient versus control cells
drive cytokine-mediated gene expression (Fig. ing T cell quiescence (48, 49) (fig. S11D), pro- during in vitro culture with IL-2 and observed
7, A and B, and fig. S11, A to C). AP-1 family viding evidence that MED12 deficiency also that MED12-deficient cells manifest signifi-
motifs including JunB, BATF, and FOS were diminishes transcription of some genes. ATAC- cantly higher levels of phosphorylated STAT5
also significantly enriched, as were motifs from seq profiling of sorted CD4+ and CD8+ CD19-28z (Fig. 7D). STAT5 activation was dependent on
interferon response family (IRF) members such CAR T cells showed that chromatin accessibil- IL-2, given that removal of IL-2 for 24 hours
as IRF8 and IRF4. Motif enrichment analysis ity changes in MED12-deficient cells were reversed the effect, whereas brief reexposure
on sites with increased MED1 occupancy in largely shared between subsets and indicated of MED12-deficient CAR T cells to IL-2 led to
MED12-deficient cells also showed enrichment increased AP-1 and STAT family transcription higher maximum levels of phosphorylated STAT5
STAT
60 STAT1
T
A
family
G
C
STAT
T
C
A
−log(P value)
G G
ATAC-seq in resting MED12- GG A A
T T
CC A A CC 1 x 10 AA -30
IRF8 100 BATF
AA G AP−1
GG
AP−1 A A
AG
JunB
C
TC T C
G
TG
C TT GC TACT T CG T
C T
5000
n = 6035 sites with log2 fold STAT4 Zf STAT3 bHLH
STAT3 AP−1
change > 1 and adjusted P < 0.05. 4000
Bach2 Fos ATF3
50 Bcl6
(C) Transcription factor binding 3000 JunB BATF
STAT6 IRF:BATF 20
motif enrichment at sites with STAT6
2000 IRF8 IRF3 Jun
increased MED1 occupancy
IRF4 Tcf21
by ChIP-seq in resting MED12- 1000
PRDM1
Bach2 RUNX
deficient CD19-28z CAR T cells. 0 0 0
4
0 10 0 10 20 30 40 50 0 10 20 30 40 50
n = 842 sites with adjusted P <
STAT5 pY694 rank rank
0.05. (D) Flow cytometry analysis
of STAT5 phosphorylation in E CD19-28 F natural T cells
control and MED12-deficient CD19- 5000
15000 Control sg1
28z CAR T cells 15 days after
IL2RA MFI
4000 MED12 sg48
IL2RA MFI
10000 DMSO
IL2RA expression in nontrans-
10
compared with control cells (fig. S13, A and B). quisite role for core Mediator in human T cell ICOS, Tbet, and CD25, along with simultaneous
MED12-deficient CAR T cells also manifested function. increases in glycolysis and oxidative phosphory-
increased expression of the high-affinity IL-2 To explain these findings, we demonstrated lation (36). Paradoxically, however, MED12-
receptor, IL2RA, a downstream target of STAT5- that the kinase module and core Mediator are deficient cells showed elevated CD62L and CD28,
mediated transcription, whereas expression of largely colocalized in wild-type CAR T cells, molecules not typically expressed on effector
IL2RG was unchanged (Fig. 7E and fig. S13C) consistent with the known role for the kinase cells. This raises the possibility that MED12
(50). Furthermore, activated heathy, nontrans- module in regulating the interaction between loss induces a synthetic effector state not rep-
duced T cells also showed elevated IL2RA expres- core Mediator and RNAPII (58, 59), and leading resented by T cell phenotypes found in nature.
sion in the absence of MED12, indicating that to the hypothesis that loss of MED12 or CCNC Current models hold that upon antigen en-
this effect was not dependent on CAR signaling in T cells reduces steric hindrance between core counter, naïve T cells differentiate into CCR7–
(Fig. 7F), and T cells cultured with CDK8/19 Mediator and RNAPII, and thereby increases IL7R–Tbet+CD62L– SLECs, with most effectors
inhibitors also showed elevated expression transcription and modulates T cell function. progressing toward a state of terminal differ-
of IL2RA, demonstrating that inhibition of Consistent with this model, deletion of MED12 entiation associated with diminished activ-
CDK8 and CDK19 kinase activity is sufficient shared some phenotypic similarities with de- ity, while a fraction express CCR7 and IL7R
to elicit increased sensitivity to IL-2 in human letion of CCNC, although more profound effects and differentiate into long-lived memory cells
T cells (Fig. 7G). were observed after MED12 deletion, poten- (44, 46, 64, 65). The functionally enhanced
We observed increased MED1 occupancy at tially owing to the structural relationships that MED12-deficient effector CAR T cells observed
the IL2RA locus in MED12-deficient cells (Fig. predict full ablation of the Mediator kinase here displayed a distinctive CCR7–IL7R–ICOS+
6H), and in comparing sites with increased module in the absence of MED12, and partial Tbet+CD62L+ phenotype, with diminished ex-
chromatin accessibility in MED12-deficient cells ablation upon CCNC deletion (30, 58, 60, 61). pression of CD45RA (42). Of interest, CD4+
to previously published STAT5 ChIP-seq data Our data demonstrate selective changes in ICOS+Tbet+LAG3+ cells similar to those de-
from CD4+ T cells (51), we found extensive co- the chromatin landscape and enhancement scribed here have been implicated in mediat-
localization of MED1 and STAT5 (Fig. 7, H and of MED1 binding to chromatin in MED12- ing tumor regression in patients treated with
I). Together these results are consistent with a deficient T cells, with the most profound ef- anti-CTLA4 therapy (66). Although MED12-
model wherein enhanced MED1 occupancy in- fects seen in the regulatory regions associated deficient cells showed increases in LAG3 and
creases IL2RA expression in MED12-deficient with transcription factors that regulate T cell TOX, which have been associated with T cell
T cells, thereby initiating a feed-forward differentiation. This selective but widespread exhaustion, we observed down-regulation of
loop in which heightened sensitivity to IL-2 pattern of modulation may explain why the CD39 and augmentation of numerous func-
promotes STAT5 activation and prolonged up- Mediator kinase module, rather than any tional attributes spanning improved proliferation,
regulation of IL2RA. These findings demonstrate single transcription factor, was the top hit in cytokine secretion, and, ultimately, sustained
that MED12 deletion regulates T cell effector our CRISPR screens. improvements in functionality even at late
differentiation and function by transcriptional MED12 deletion selectively enhanced ex- time points, improved tumor control in vivo, and
reprogramming through modulation of MED1 pression of numerous transcription factors long-term protection from antigen rechallenge.
chromatin occupancy. These effects are as- involved in T cell effector differentiation, includ- Together, these data are not consistent with
sociated with enhanced activity of multiple ing TOX, T-bet, and BATF3, and orchestrated exacerbation of T cell exhaustion in MED12-
transcription factors that control T cell fate coordinated changes in chromatin accessi- deficient T cells.
during effector differentiation, including STAT5, bility and increased MED1 occupancy at mo- This work identifies the Mediator kinase mod-
as well as others such as AP-1, IRF, and other tifs for several transcription factor families ule as a critical negative regulator of T cell
STATs (52–54). involved in T cell differentiation, including effector differentiation and function. Deletion
STAT5, cJUN, BATF, and IRF8. We hypothesize of either MED12 or CCNC induces broad func-
Discussion that the effects of MED12 and CCNC deletion tional enhancements in effector T cells, includ-
Immune checkpoint inhibitors and adoptive are highly context dependent, because we ob- ing increased expansion, cytokine secretion,
T cell therapies induce profound antitumor served increased glycolytic rates in MED12- metabolic fitness, and sustained effector func-
effects in some patients for whom all other and CCNC-deficient effector T cells, consistent tion during chronic stimulation, all properties
therapies have failed, but most patients treated with enhanced effector activity, whereas pre- that would be predicted to enhance antitumor
with cancer immunotherapies do not experi- vious studies in cancer have demonstrated effects. Pharmacological inhibition of Mediator
ence long-term benefits (1–5). Enhancing the diminished glycolytic activity in several can- kinase activity phenocopied genetic ablation of
efficacy of cancer immunotherapies requires cers following small-molecule mediated inhibi- MED12 with regard to increased expansion and
new approaches to augment the potency of tion of CDK8 (62). The selectivity of the effects elevated expression of IL2RA, raising the pos-
tumor-specific T cell responses. In the con- is not fully understood, but may be explained sibility of synergistic antitumor effects of such
text of adoptive cell therapy, considerable in part by the newly reported finding that en- agents in the context of immunotherapy, be-
efforts have focused on enhancing stem-like hancers have varying degrees of dependence cause hyperactive CDK8/19 kinase activity ac-
pools of memory T cells and thereby increas- on Mediator for transcriptional activation, de- tivates oncogenes in some cancer types (67).
ing the supply of effector cells (55–57) and on termined by the presence of sequence-specific The work further implicates interactions be-
preventing or reversing T cell exhaustion to transcription factors and other chromatin char- tween the kinase module and core Mediator as a
enhance T cell function (13, 14, 16). In this acteristics (63). major axis of regulation of T cell differentiation.
study, we used systematic, unbiased genome- Functional studies revealed elevated STAT5 Technologies to inactivate genes in the context
wide CRISPR-Cas9 screens to identify tar- activity in MED12-deficient T cells, manifested of ex vivo cell manufacturing and even in vivo
gets capable of enhancing CAR T cell effector as increased IL2RA expression and increased gene editing (68), using a variety of approaches,
function. Our results converged on MED12 sensitivity of T cells to IL-2. We also observed including CRISPR-Cas9, Zinc finger nucle-
and CCNC, core components of the Mediator substantial alterations in effector T cell dif- ases, TALENs, or base editing, are increasingly
kinase module, which have not previously ferentiation, with MED12-deficient CD4+ and available for emerging applications in human
been implicated in regulating T cell potency. CD8+ cells demonstrating an early activated medicine (69), highlighting the potential for
Our screen also confirmed an expected re- phenotype, comprising elevated expression of clinical translation of these findings.
Materials and methods natant was harvested 48 and 72 hours after Illumina sequencing adapters were added using
T cell isolation transfection. On days 3 and 4, tissue culture custom primers and sequencing was per-
Whole blood buffy coats were obtained from plates were coated with RetroNectin (Takara), formed on the llumina NovaSeq 6000 PE150
the Stanford Blood Center from healthy vol- blocked with 2% bovine serum albumin (BSA) platform at a depth of 5 × 107 reads per sam-
unteers under 41 years. T cells were isolated for 5 min, and incubated with retroviral super- ple. Sequencing was performed by Novogene
using the RosetteSep Human T Cell Enrich- natant for 2 hours at 32°C, 3200 rpm. T cells (Sacramento, CA).
ment Cocktail (Stemcell Technologies). T cells were added to virus-coated plates at a density
were stored in CryoStor cell cryopreservation of 1 × 106 per milliliter. On day 5, CD28/CD3 CRISPR screen data analysis
media CS10 (Sigma-Aldrich) in liquid nitrogen. Dynabeads (Invitrogen) were removed using Guide sequences were extracted from FASTQ
magnetic separation. Cells were cultured with files and matched to the Bassik library index
CRISPR screen puromycin at 2.5 mg/ml from days 7 to 10 to using a custom R script. Raw counts for each
T cell activation and culturing eliminate cells that did not express a guide. guide were provided as input to the MAGeCK
Two hundred million T cells each from two algorithm (25). For the expansion screen, two
donors were thawed on day 0 and activated Expansion screen replicates from plasmid DNA library were com-
with CD3/CD28 Dynabeads (Invitrogen) at a The CAR T cells transduced with the sgRNA pared with four samples collected on day 23
ratio of three beads per T cell. Cells were cul- library were cultured in T175 flasks and were (two from each donor). For the cytokine pro-
tured in AIM-V medium (Gibco) supplemented passaged every other day. On day 15, 100 mil- duction screen, four samples collected on
with 5% fetal bovine serum (FBS), 10 mM lion Nalm6-GD2 cells were added to 100 mil- day 15 (two from each donor) were compared
HEPES, 1X penicillin-streptomycin-glutamine lion T cells and cocultured to day 23. Fifty with two samples (one from each donor) that
supplement (Gibco), and 10 ng/ml recombi- percent of the culture volume was discarded were sorted for high cytokine expression. The
nant IL-2 (21.8 IU/ml) (Peprotech). Cells were at each passage. On day 23, duplicate samples MAGeCK algorithm was used to perform nor-
maintained at a density between 0.5 and 2 mil- of 30 million cells were collected for genomic malization, calculate log fold changes for guides
lion per milliliter in T175 flasks. DNA extraction. The plasmid DNA encoding and genes, and calculate adjusted P values.
the lentiviral sgRNA library was used to ap-
Lentiviral transduction proximate the relative abundance of sgRNAs Targeted CRISPR gene editing
The complete Bassik Human CRISPR Knock- at the start of the experiment. Ribonucleoprotein (RNP) was prepared using
out Library was obtained from Addgene and synthetic sgRNA with 2'-O-methyl phosphoro-
amplified with Endura ElectroCompetent Cytokine production screen thioate modification (Synthego) diluted in TE
Cells (Lucigen). LentiX cells (Takara) were On day 15, duplicate samples of 30 million buffer at 100 mM. Five microliters sgRNA were
plated on 150-mm plates coated with poly-D- cells from each of two donors were harvested incubated with 2.5 ml duplex buffer (IDT) and
lysine (Corning) and transfected with 18 mg from the total population for genomic DNA 2.5 mg Alt-R S.p. Cas9 Nuclease V3 (IDT) for
REV, 18 mg GAG/POL, 7 mg VSVg, 15 mg library extraction. One hundred million CAR T cells 30 min at room temperature. One hundred–
vector, 3.38 ml Opti-MEM (Gibco), and 135 ml were cocultured for 6 hours with 100 million microliter reactions were assembled with 10 mil-
Lipofectamine 2000 (Invitrogen) per plate. Nalm6-GD2 tumor cells with eBioscience lion T cells, 90 ml P3 buffer (Lonza), and 10 ml
Media was changed 24 hours after transfec- Monensin Solution (Invitrogen) in 200 ml me- RNP. Cells were pulsed with protocol EO115
tion, and supernatant was harvested 48 hours dium without IL-2. Intracellular cytokine stain- using the P3 Primary Cell 4D-Nucleofector Kit
after transfection. Lentiviral supernatant was ing was performed using the Cytofix/Cytoperm and 4D-Nucleofector System (Lonza). Cells were
concentrated with Lenti-X Concentrator (Takara) Kit (BD). Cells were stained with antibodies recovered immediately with warm media for
and added to the T cell culture medium 2 days specific for CD4, CD8, TNF-a, and IL-2 (table 6 hours before transduction with CAR. Guides
after activation. On day 3, cells were assessed S4) and fixable viability dye eFluor506 (eBio- sequences: AAVS1-sg1 5′ GGGGC-CACUAGGGAC-
for mCherry expression by flow cytometry to science). Cell sorting was performed at the AGGAU 3′, CCNC-sg40 5′ GAUGCCAAAAACA-
confirm that the percentage of transduced Stanford Shared FACS Facility on a FACSAria CACAUGU 3′, CCNC-sg46 5′ GGAUUUAAAGU-
cells was between 8 and 12%. II equipped with a 70-mm nozzle. The top 10% UUCUCUCAG 3′, MED12-sg48 5′ CCUGCCU-
of TNFa+ and IL-2+ were sorted using indi- CAGGAUGAACUGA 3′, and MED12-sg49 5′
CAS9 electroporation vidual gates for CD4+ and CD8+ cells. CD4+ UAACCAGCCUGCUGUCUCUG 3′.
On day 3, 100 ml reactions were assembled and CD8+ cytokine high cells were pooled. A
with 10 million T cells, 30 mg Alt-R S.p. Cas9 single sorted sample of ~5 million TNFa+ IL-2+ Assessment of targeted CRISPR gene editing
Nuclease V3 (IDT), 90 ml P3 buffer (Lonza), cells were collected from each donor for geno- Four to seven days after editing, genomic DNA
and 7 ml duplex buffer (IDT). Cells were pulsed mic DNA extraction. was extracted with QuickExtract DNA Extrac-
with protocol EO115 using the P3 Primary Cell tion Solution (Lucigen) and ~500–base pair
4D-Nucleofector Kit and 4D-Nucleofector Sys- Genomic DNA extraction and sequencing (bp) regions flanking the cut site were am-
tem (Lonza). Cells were recovered immedi- library preparation plified with Phusion Hot Start Flex 2X Master
ately with warm media for 6 hours before Technical duplicates were performed for ge- Mix (New England Biolabs) according to man-
transduction with CAR. The electroporation nomic DNA extraction, library preparation, ufacturer’s instructions. Sanger sequencing
protocol was repeated on day 5. and sequencing. Genomic DNA was extracted traces were analyzed by Inference of CRISPR
from cell pellets using overnight lysis in SDS Edits (ICE) (31).
Retroviral transduction with proteinase K at 37°C as previously de-
Retroviral supernatant was produced as pre- scribed (70). Briefly, protein was precipitated Cell lines
viously described (13). Briefly, 293GP cells with ammonium acetate, and genomic DNA Nalm6 leukemia, 143B osteosarcoma and A375
were plated on poly-D-lysine (Corning) coated was precipitated with isopropanol. All the re- melanoma cells were obtained from American
plates and transfected with RD114 envelope covered genomic DNA was used as a template Type Culture Collection. Cell lines were stably
and HA-28z CAR encoding plasmids using for polymerase chain reaction (PCR) to gen- transduced with GFP and firefly luciferase.
Lipofectamine 2000 (Invitrogen). Media was erate the sequencing libraries. The libraries Nalm6-GD2 cells were engineered to stably
changed 24 hours after transfection, and super- were prepared as previously described (24). express GD2 synthase and GD3 synthase to
obtain surface expression of GD2 disialogan- duced T cells, which were CD3/28 activated antibodies specific for cell surface markers for
glioside. Single-cell clones were selected for but not retrovirally transduced or gene-edited, 20 min. Antibodies used are listed in table S4.
high expression of GFP, luciferase, and GD2. were included as a negative control. For pSTAT5 staining, cells were prepared with
Cell lines were maintained in RPMI (Gibco) the Fix and Perm Cell Permeabilization kit
supplemented with 10 mM HEPES, 10% FBS, Incucyte cytotoxicity assay (ThermoFisher) according to manufacturer’s
and 1X penicillin-streptomycin-glutamine sup- Tumor cells (5 × 104) were cocultured with instructions. For pS6 staining, T cells were
plement (Gibco). variable numbers of CAR T cells in 250 ml me- cultured 24 hours in complete AIM-V media
dia without IL-2 in flat bottom 96-well plates without IL-2 prior anti-idiotype stimulation
T cell expansion and viability assays for 80 hours. Time lapse microscopy images (1 mg/ml of mouse immunoglobulin G anti-
T cells were activated for 4 days at a 1:3 ratio were obtained with the Incucyte Live Cell human CD19 idiotype cross-linked with 10 mg/
of T cells to anti-CD3/28 Dynabeads (Invitro- Analysis system (Essen Bioscience) at 10× mag- ml of anti-mouse Fab in phosphate-buffered
gen). T cell expansion assays were performed nification. Total green object integrated in- saline (PBS). Cells were incubated with anti-
with IL-2 in the culture medium at 10 ng/ml tensity (green calibrated units times square idiotype—or left unstimulated—for 1 hour at
(21.8 IU/ml) unless indicated otherwise. Cell micrometers per image) was used to assess 37°C and kept on ice immediately afterwards.
counts and viability measurements were ob- tumor killing. Effector to target cell ratios Cells were fixed (BD Phosphoflow Fix Buffer I)
tained using the Cellaca Mx Automated Cell are indicated in the figures or figure legends. and then permeabilized (BD Perm Buffer III)
Counter (Nexcelom). Cells were stained with according to manufacturer’s instructions. For
acridine orange and propidium iodide to as- RT-qPCR mitochondrial mass staining, cells were stained
sess viability. A portion of the culture volume RNA was extracted with RNeasy kit (Qiagen), with MitoTracker Green (Cell Signaling Tech-
was discarded at each passage, and the frac- and cDNA was synthesized with High-Capacity nology) at 200 nM, 37°C for 30 min. Before
tion of cells maintained in culture was used to cDNA Reverse Transcription kit (ThermoFisher). acquisition, cells were resuspended in FACS
calculate total cell counts. Reverse transcription–quantitative polymerase buffer and analyzed on a LSRFortessa (BD)
chain reaction (RT-qPCR) was performed with with BD FACSDiva software.
CDK8 kinase inhibitor assays PowerUp SYBR Green Master Mix (Thermo-
SEL120 (SEL120-34A) hydrochloride, AS2863619, Fisher) using the Bio-Rad CFX thermocycler Western blotting
and CCT251545 (Selleckchem) were reconstituted and CFX Manager software. Target gene ex- Total cell lysates were extracted in nondena-
at 5 mM in dimethyl sulfoxide and stored at pression was normalized to the 18S housekeep- turing lysis buffer (150 mM NaCl, 50 mM Tris
−80°C. Human primary T cells were plated ing gene using the 2DDCt method. Primer pH 8, 1% NP-40, 0.25% sodium deoxycholate
in 96-well plates with 50,000 T cells per well. sequences for RT-PCR: IFNG-F 5′ TGACCA- with Halt Protease Inhibitor Cocktail) (Thermo-
Inhibitors were added 24 hours after CD3/ GAGCATCCAAAAGA 3′, IFNG-R 5′ CTCTTCG- Fisher Scientific). Chromatin-bound and soluble
CD28 bead activation and were freshly supple- ACCTCGAAACAGC 3′, IL2-F 5′ TGCATTGC- cellular fractions were prepared with cytoske-
mented every 48 hours. CD3/28 beads were ACTAAGTCTTGCAC 3′, IL2-R 5′ AGTTCTG- letal lysis buffer [10 mM PIPES-KOH (pH 6.8),
removed on day 4 after activation. The re- TGGCCTTCTTGGG 3′, TNF-F 5′ CACAGTGA- 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2],
ported half maximal inhibitory concentration AGTGCTGGCAAC 3′, TNF-R 5′ AGGAAGGC- and Halt Protease Inhibitor Cocktail. Briefly, cells
(IC50) for CDK8 is 4.4 nM, 0.6 nM, and 5 nM CTAAGGTCCACT 3′, 18S-F 5′ GCAGAATCC- were washed in PBS, resuspended in lysis buf-
for SEL120, AS286319, and CCT251545, re- ACGCCAGTACAAG 3′, 18S-R 5′ GCTTGTTG- fer, and incubated on ice for 20 min. Cells were
spectively. The IC50 for CDK19 is 10.4 nM, TCCAGACCATTGG 3′. centrifuged at 5000 rpm to separate the solu-
4.3 nM, and 6.3 nM for SEL120, AS286319, ble and chromatin-bound fractions. The sol-
and CCT251545, respectively. Seahorse assay uble fraction was cleared by centrifugation
Metabolic analysis was carried out using Sea- at 13,000 rpm. The chromatin-bound fraction
Serial stimulation assay horse Bioscience Analyzer XFe96. Briefly, 2 × was resuspended in Sample Reducing Buffer
Starting from 10 days after activation, CAR T 106 cells were resuspended in extracellular flux (Pierce) and incubated at 100°C for 5 min.
cells were plated at a 1:1 ratio with GFP+ tumor (XF) assay media supplemented with 25 mM Protein concentration was assessed with the
cells without IL-2. At 48- to 72-hour intervals, glucose, 2 mM glutamine, and 1 mM sodium DC Protein Assay kit (Bio-Rad), and 20 mg total
cell counts were recorded, and flow cytometry pyruvate and plated on a Cell-Tak (Corning)– protein was loaded per sample. Equal volumes
was performed to assess the ratio of T cells to coated microplate allowing the adhesion of of soluble and chromatin fractions were loaded
tumor cells. Cocultures were then collected CAR T cells. Mitochondrial stress and glyco- for each sample. SDS–polyacrylamide gel elec-
and replated in fresh media and additional lytic parameters were measured by the oxygen trophoresis was performed, and proteins were
tumor cells were added to maintain a 1:1 ef- consumption rate (OCR) (pmol/min) and ex- transferred to polyvinylidene difluoride mem-
fector to target ratio. tracellular acidification rate (ECAR) (mpH/min), branes for immunoblotting. Antibodies used
respectively, with use of real-time injections are listed in table S4. Immunofluorescence was
Cytokine production assays of oligomycin (1.5 mM), carbonyl cyanide p- detected with the Odyssey Imaging System
T cells and tumor cells (5 × 104 of each) were trifluoromethoxyphenylhydrazone (FCCP; 1 mM), (Licor), or chemiluminescence was detected
cocultured in 250 ml media without IL-2 in and rotenone and antimycin (both 1 mM). Res- with autoradiography film.
round bottom 96-well plates for 24 hours. piratory parameters were calculated according
Culture supernatants were collected and anal- to manufacturer’s instructions (Seahorse Bio- Western blot quantification
yzed by enzyme-linked immunosorbent assay science). All chemicals were purchased from Images captured with autoradiography film
(ELISA). IL-2 and IFNg were detected with the Agilent unless stated otherwise. were scanned at 600 dpi in 16-bit gray scale,
ELISA MAX kit (Biolegend), and TNFa was and images captured with the Odyssey Imag-
detected with the Quantikine kit (R&D Sys- Flow cytometry ing System were exported as JPEGs. Quantifi-
tems). Bead-based multiplex cytokine detec- T cells were washed in FACS buffer [Dulbecco’s cation was performed with ImageJ software.
tion assays were performed at the Human phosphate-buffered saline (DPBS) no calcium, A region of interest (ROI) of equal size was
Immune Monitoring Center (Stanford Univer- no magnesium (Gibco) with 2% FBS]. Cells used to measure the specific band and back-
sity) using the Luminex platform. Nontrans- were incubated on ice in FACS buffer with ground signal in each lane. Pixel densities
were subtracted from 255 to invert the image, paraformaldehyde for 10 min at room temper- pH 8.0, and 0.1% NaDOC), once in IP wash
and the background values were subtracted ature. Cells were washed twice in PBS, flash buffer III (0.25 M LiCl, 0.5% NP-40, 1 mM
from band values to adjust for background frozen on dry ice, and stored at −80°C. Cells EDTA, 20 mM Tris, pH 8.0, 0.5% NaDOC), and
signal. For each sample, the background ad- were thawed, washed in CSM, and barcoded once in TE buffer (10 mM EDTA and 200 mM
justed MED1 pixel density was divided by the with the Cell-ID 20-plex kit (Fluidigm) as prev- Tris, pH 8.0). DNA was eluted from the beads
same value from the HIST3 loading control to iously described (71). Samples were pooled and by vigorous shaking for 20 min in elution buf-
calculate a ratio of MED1 to HIST3. Ratios stained for cell surface markers for 30 min at fer (100 mM NaHCO3, 1% SDS). DNA was de-
from donor 1 and donor 2 were normalized to room temperature. Panel of antibodies can be cross-linked overnight at 65°C and purified
the largest ratio collected in each independent found in table S3. CARs were detected with with MinElute PCR purification kit (Qiagen).
experiment. anti-idiotype antibodies conjugated to metals. DNA was quantified by Qubit, and 10 ng DNA
The NY-ESO-1 TCR was detected with PE la- was used for sequencing library construction
Mice beled tetramers, followed by 30 min of sec- with the Ovation Ultralow Library System V2
Immunocompromised NOD scid IL2Rgammanull ondary staining with anti-PE-156Gd (Fluidigm). (Tecan) using 12 PCR cycles. Libraries were
(NSG, Strain #005557) mice were purchased Intracellular staining was performed using per- sequenced on the Illumina NovaSeq 6000
from JAX and bred in-house under sterile con- meabilization buffer (eBioscience) for 45 min PE150 platform at a depth of 3 × 107 reads
ditions. Mice were monitored daily by the Vet- on ice followed by two CSM washes. Cells were per sample.
erinary Service Center staff. Care and treatments resuspended with Cell-ID Intercalator-ID
were in compliance with Stanford University (Fluidigm), washed twice in deionized water, ATAC-seq
APLAC protocols. Leukemia cells and CAR resuspended in 1X EQ beads, and acquired on a Approximately 100,000 CAR T cells were used
T cells were administered via intravenous Helios mass cytometer (Fluidigm). After acqui- per sample. Nuclei were isolated with ATAC-LB
injection. 143B osteosarcoma cells were ad- sition, data were normalized using MATLAB- (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM
ministered by intramuscular injection. For based software (72) and debarcoded using MgCl2, 0.1% IGEPAL) and used for tagmenta-
some experiments, tumor burden was asses- MATLAB-debarcoder. Fsc files were uploaded tion using Nextera DNA Library Preparation
sed before treatment and mice were random- to the OMIQ platform for analysis (OMIQ.ai). Kit (Illumina) from three donors. After tag-
ized to groups to ensure equal tumor burden mentation DNA was purified with MinElute
between treatment groups. Time of treatment Bulk RNA-seq PCR Purification Kit (Qiagen). Tagmented DNA
and dosing is indicated in figure legends. Re- CAR T cells were collected on day 15 and pro- was then amplified with Phusion high-fidelity
searchers were blinded during administration cessed without freezing. RNA was extracted PCR master mix (NEB) using 14 PCR cycles.
of T cells. Leukemia progression was moni- using the RNeasy mini kit (Qiagen). RNA qual- Amplified libraries were purified again with
tored using the Lago SII (Spectral Instruments ity was assessed by BioAnalyzer (Agilent). Se- MinElute PCR Purification Kit. Fragment dis-
Imaging). Quantification of bioluminescence quencing libraries were prepared by Novogene tribution of libraries was assessed with Agilent
was performed with Aura software (Spectral (Sacramento, CA), and 150 bp paired-end se- Bioanalyzer and libraries were sequenced on
Instruments Imaging). Solid tumor progres- quencing at a depth of 3 × 107 reads per sample the Illumina NovaSeq 6000 PE150 platform at
sion was followed using caliper measurements was obtained using the Illumina NovaSeq6000 a depth of 3 × 107 reads per sample. Sequencing
of the injected leg area. Researchers were platform. FASTQ files were generated by Novo- was performed by Novogene (Sacramento, CA).
blinded to the treatment groups during solid gene. Transcripts were quantified with Salmon,
tumor measurements. Mice were euthanized and DESeq2 was used to identify differentially ATAC-seq and ChIP-seq data processing
upon manifestation of paralysis, impaired mo- expressed genes. Gene set enrichment analysis Quality control, aligning, and signal tracks
bility, poor body condition (score of BC2−), or was performed using GSEA software (Broad Paired end FASTQ files were trimmed to re-
when tumor diameter exceed 17 mm. Sample Institute). move adapters and low-quality sequences using
sizes of five mice per group were selected on “fastp” and then were aligned to the hg38
the basis of previous experience with these ChIP-seq reference genome using “hisat2” with the
models. All experiments were repeated twice ChIP-seq was performed as previously described “–no-spliced-alignment” and “–very-sensitive”
with different donors, and donors used for with minor modifications (73). CAR T cells (3 × options. Duplicates were marked and removed
in vivo experiments were different than those 106) were double cross-linked by 50 mM disuc- with “picard MarkDuplicates.” Reads with high-
in the screening experiments. cinimidyl glutarate (DSG, #C1104 - Proteo- quality concordant alignments to human chro-
Chem) for 30 min followed by 10 min of 1% mosomes chr1-chr22 and chrX (e.g., excluding
Blood analysis formaldehyde. Formaldehyde was quenched chrY and chrM) were converted to BED files
Blood was collected from the retro-orbital by the addition of glycine. Nuclei were iso- for downstream processing. Bigwig files were
sinus into Microvette blood collection tubes lated with ChIP lysis buffer (1% Triton x-100, normalized by using the number of fragments
with EDTA (Fisher Scientific). Whole blood 0.1% SDS, 150 mM NaCl, 1mM EDTA, and overlapping peaks genome wide, which con-
was labeled with anti-CD45 (HI30, Thermo- 20 mM Tris, pH 8.0). Nuclei were sheared trols for differences in sequencing depth and
Fisher), and red blood cells were lysed with with Covaris sonicator using the following set- also library quality between samples, were ex-
FACS Lysing Solution (BD) according to man- up: Fill level – 10, Duty Cycle – 5, PIP – 140, ported from R using “rtracklayer::export” and
ufacturer’s instructions. Samples were mixed Cycles/Burst – 200, Time – 4 min. Sheared visualized using the Integrative Genomics
with CountBright Absolute Counting beads chromatin was immunoprecipitated overnight Viewer (IGV). Plots were generated in R using
(ThermoFisher) before flow cytometry analysis. with the antibodies shown in table S4. Anti- ChIPpeakAnno (3.13) (74).
body chromatin complexes were pulled down
CyTOF sample preparation and data analysis with Protein A magnetic beads and washed Obtaining a union peak set and
6
CAR T cells (2 × 10 ) were washed in PBS and once in IP wash buffer I [1% Triton, 0.1% SDS, counts matrix
resuspended in 250 nM cisplatin (Fluidigm) 150 mM NaCl, 1 mM EDTA, 20 mM Tris, pH Peaks were called for each replicate using
for 3 min. Cells were washed twice in cell stain- 8.0, and 0.1% sodium deoxycholate (NaDOC)], MACS2. Reproducible peaks for each sample
ing medium (CSM; PBS with 0.05% BSA and twice in IP wash buffer II (1% Triton, 0.1% were determined as peaks present in at least
0.02% sodium azide) followed by fixing in 1.6% SDS, 500 mM NaCl, 1 mM EDTA, 20 mM Tris, two of three replicates and merged to create a
disjoint peak set for each sample. Reproduc- the beta chain of the NY-ESO-1 TCR (table S4), 6. S. A. Rosenberg et al., Treatment of patients with metastatic
ible peaks for each sample were then merged and tetramers loaded with the SLLMWITQC melanoma with autologous tumor-infiltrating lymphocytes and
interleukin 2. J. Natl. Cancer Inst. 86, 1159–1166 (1994).
into a disjoint union peak set encompassing peptide. Cell sorting of live, tetramer+, Vb13.1+ doi: 10.1093/jnci/86.15.1159; pmid: 8028037
all samples using our previously described it- cells was performed at the Stanford Shared 7. P. F. Robbins et al., Tumor regression in patients with metastatic
erative procedure which merges the peak sets FACS Facility on a FACSAria II equipped with synovial cell sarcoma and melanoma using genetically engineered
lymphocytes reactive with NY-ESO-1. J. Clin. Oncol. 29, 917–924
by repeatedly removing less significant over- a 70-mm nozzle. (2011). doi: 10.1200/JCO.2010.32.2537; pmid: 21282551
lapping peaks until no overlaps remain. The 8. S. P. D’Angelo et al., Antitumor activity associated with
peak by sample counts matrix was obtained scRNA-seq library preparation prolonged persistence of adoptively transferred
and sequencing NY-ESO-1c259 T cells in synovial sarcoma. Cancer Discov.
by counting reads overlapping with each peak. 8, 944–957 (2018). doi: 10.1158/2159-8290.CD-17-1417;
The counts matrix was loaded into DESeq2 for Cells harvested from four tumors from each pmid: 29891538
differential analysis. Selected peak sets were experimental condition were pooled and cap- 9. J. A. Fraietta et al., Determinants of response and resistance
to CD19 chimeric antigen receptor (CAR) T cell therapy of
also visualized across samples by using the big- ture was performed at the Stanford Function chronic lymphocytic leukemia. Nat. Med. 24, 563–571
wig track files described above with “plotHeat- Genomics Facility using the 10X Genomics (2018). doi: 10.1038/s41591-018-0010-1; pmid: 29713085
map” from the “deepTools” analysis suite. platform. Sequencing libraries were prepared 10. M. Philip et al., Chromatin states define tumour-specific T cell
dysfunction and reprogramming. Nature 545, 452–456 (2017).
with the 10X Chromium Next GEM Single Cell doi: 10.1038/nature22367; pmid: 28514453
Details of peak sets 3′ v 3.1 kit (10X Genomics) according to man- 11. S. Srivastava et al., Immunogenic chemotherapy enhances
Differential “up” and “down” peak sets were ufacturer’s instructions. Deep sequencing of recruitment of CAR-T cells to lung tumors and improves
antitumor efficacy when combined with checkpoint blockade.
obtained from DESeq2 pairwise comparisons single-index libraries was performed by Novo- Cancer Cell 39, 193–208.e10 (2021). doi: 10.1016/
using false discovery rate (FDR) ≥ 0.05 and gene (Sacramento, CA) on the Illumina Nova- j.ccell.2020.11.005; pmid: 33357452
sometimes an additional fold change thresh- Seq 6000 PE150 platform with an average depth 12. K. G. Anderson, I. M. Stromnes, P. D. Greenberg, Obstacles
posed by the tumor microenvironment to T cell activity: A case
old, as indicated. “Bound” peak sets: for each of ~38,000 reads per cell. for synergistic therapies. Cancer Cell 31, 311–325 (2017).
sample (where a sample is, for example, “h3k27ac_ doi: 10.1016/j.ccell.2017.02.008; pmid: 28292435
MED12_unstim”), bound peaks were deter- scRNA-seq data processing and analysis 13. R. C. Lynn et al., c-Jun overexpression in CAR T cells induces
exhaustion resistance. Nature 576, 293–300 (2019).
mined on the basis of thresholding the nor- Index demultiplexing and generation of FASTQ doi: 10.1038/s41586-019-1805-z; pmid: 31802004
malized counts matrix. The normalized counts files was performed by Novogene. Alignment 14. J. Chen et al., NR4A transcription factors limit CAR T cell
matrix was obtained by multiplying each to hg38 was performed with Cell Ranger v7.0.0 function in solid tumours. Nature 567, 530–534 (2019).
doi: 10.1038/s41586-019-0985-x; pmid: 30814732
column (replicate) in the counts matrix by (10X Genomics). Filtering was performed to 15. L. Labanieh et al., Enhanced safety and efficacy of protease-
(1 × 106 per total reads in peaks in that repli- remove debris and dead cells using the Seurat regulated CAR-T cell receptors. Cell 185, 1745–1763.e22
cate). The bound peaks for each sample were package v4.1.1 in R. Clustering of scRNA-seq (2022). doi: 10.1016/j.cell.2022.03.041; pmid: 35483375
16. E. W. Weber et al., Transient rest restores functionality in
then determined as peaks that had at least two profiles, dimensionality reduction using uni-
exhausted CAR-T cells through epigenetic remodeling. Science
of three replicates with a normalized value form manifold approximation and projection 372, eaba1786 (2021). doi: 10.1126/science.aba1786;
greater than a threshold. A cutoff of 2 was (UMAP), and differential gene analysis were pmid: 33795428
selected empirically, which yielded between performed with Seurat. For comparison to pub- 17. E. A. Stadtmauer et al., CRISPR-engineered T cells in patients
with refractory cancer. Science 367, eaba7365 (2020).
60,000 and 120,000 peaks per sample. Finally, lished datasets, marker genes for each cluster doi: 10.1126/science.aba7365; pmid: 32029687
bound peak sets for each sample were merged of Zheng et al. were obtained from table S3 18. E. Shifrut et al., Genome-wide CRISPR screens in primary
into bound peak sets for each sample set (e.g., of the Zheng et al. manuscript (41). For each human T cells reveal key regulators of immune function. Cell
175, 1958–1971.e15 (2018). doi: 10.1016/j.cell.2018.10.024;
an overall h3k27ac CAR T peak set) by taking cluster, the top 50 marker genes were ob- pmid: 30449619
the union. tained by using the effect size ranking (column 19. D. Wang et al., CRISPR screening of CAR T cells and cancer
“comb.ES.rank” in Zheng et al. table S3). A stem cells reveals critical dependencies for cell-based
Motif analysis module score for each gene set was added to therapies. Cancer Discov. 11, 1192–1211 (2021). doi: 10.1158/
2159-8290.CD-20-1243; pmid: 33328215
Motifs enriched in particular peak sets were each cell in our TIL scRNA-seq dataset with 20. J. A. Belk et al., Genome-wide CRISPR screens of T cell
analyzed using the HOMER “findMotifsGenome. the Seurat function “AddModuleScore” and exhaustion identify chromatin remodeling factors that limit
T cell persistence. Cancer Cell 40, 768–786.e7 (2022).
pl” utility or chromVAR for ATAC-seq samples. then visualized by genotype (MED12-sg49 ver- doi: 10.1016/j.ccell.2022.06.001; pmid: 35750052
For HOMER analysis, total bound peaks for sus control sg1). Statistical significance was 21. L. El Khattabi et al., A pliable Mediator acts as a functional
each sample set were used as background, assessed via two-sided Wilcoxon test using R rather than an architectural bridge between promoters and
thus, the enrichments represent motif enrich- function “wilcox.test.” enhancers. Cell 178, 1145–1158.e20 (2019). doi: 10.1016/
j.cell.2019.07.011; pmid: 31402173
ments relative to general CAR T–specific peaks 22. W. A. Whyte et al., Master transcription factors and Mediator
rather than enrichments relative to the whole establish super-enhancers at key cell identity genes. Cell
RE FERENCES AND NOTES 153, 307–319 (2013). doi: 10.1016/j.cell.2013.03.035;
genome.
1. S. L. Maude et al., Tisagenlecleucel in children and young pmid: 23582322
adults with B-cell lymphoblastic leukemia. N. Engl. J. Med. 23. M. Quevedo et al., Mediator complex interaction partners
Single-cell RNA-seq 378, 439–448 (2018). doi: 10.1056/NEJMoa1709866; organize the transcriptional network that defines neural stem
Isolation of tumor infiltrating NY-ESO-1+ pmid: 29385370 cells. Nat. Commun. 10, 2669 (2019). doi: 10.1038/s41467-
T cells 2. D. W. Lee et al., T cells expressing CD19 chimeric antigen 019-10502-8; pmid: 31209209
receptors for acute lymphoblastic leukaemia in children and 24. D. W. Morgens et al., Genome-scale measurement of off-target
Tumors were harvested 6 days after adoptive young adults: A phase 1 dose-escalation trial. Lancet 385, activity using Cas9 toxicity in high-throughput screens.
transfer of NY-ESO-1+ T cells. Tissue dissocia- 517–528 (2015). doi: 10.1016/S0140-6736(14)61403-3; Nat. Commun. 8, 15178 (2017). doi: 10.1038/ncomms15178;
pmid: 25319501 pmid: 28474669
tion was performed with the Mouse Tumor 3. A. Ribas, J. D. Wolchok, Cancer immunotherapy using 25. W. Li et al., MAGeCK enables robust identification of essential
Dissociation Kit (Miltenyi) and Gentle MACS checkpoint blockade. Science 359, 1350–1355 (2018). genes from genome-scale CRISPR/Cas9 knockout screens.
C tubes (Miltenyi) according to manufacturer’s doi: 10.1126/science.aar4060; pmid: 29567705 Genome Biol. 15, 554 (2014). doi: 10.1186/s13059-014-0554-4;
4. R. G. Majzner, C. L. Mackall, Clinical lessons learned from the pmid: 25476604
instructions. Red blood cells were lysed (Red 26. L. Sabbagh et al., The selective increase in caspase-3
first leg of the CAR T cell journey. Nat. Med. 25, 1341–1355
Blood Cell Lysis Solution, Miltenyi), and sam- (2019). doi: 10.1038/s41591-019-0564-6; pmid: 31501612 expression in effector but not memory T cells allows
ples were washed and passed through 70-mm 5. F. L. Locke et al., Long-term safety and activity of axicabtagene susceptibility to apoptosis. J. Immunol. 173, 5425–5433
ciloleucel in refractory large B-cell lymphoma (ZUMA-1): (2004). doi: 10.4049/jimmunol.173.9.5425; pmid: 15494489
filters before staining for 30 min at room tem-
A single-arm, multicentre, phase 1-2 trial. Lancet Oncol. 20, 27. R. G. Majzner et al., Tuning the antigen density requirement for
perature with fixable viability dye eFluor506 31–42 (2019). doi: 10.1016/S1470-2045(18)30864-7; CAR T-cell activity. Cancer Discov. 10, 702–723 (2020).
(eBioscience), antibodies specific for Vb13.1, pmid: 30518502 doi: 10.1158/2159-8290.CD-19-0945; pmid: 32193224
28. A. Verger, D. Monté, V. Villeret, Twenty years of Mediator helper T cell lineages. Nat. Immunol. 12, 551–559 (2011). AC KNOWLED GME NTS
complex structural studies. Biochem. Soc. Trans. 47, 399–410 doi: 10.1038/ni.2030; pmid: 21516110 Funding: This work was supported by National Institutes of Health
(2019). doi: 10.1042/BST20180608; pmid: 30733343 52. P. Tripathi et al., STAT5 is critical to maintain effector CD8+ grants U54CA232568-01 (C.L.M.), RM1-HG007735 (H.Y.C.), R35-
29. R. Abdella et al., Structure of the human Mediator-bound T cell responses. J. Immunol. 185, 2116–2124 (2010). CA209919 (H.Y.C.), and U01CA260852 (A.T.S.); a Stand Up 2 Cancer–
transcription preinitiation complex. Science 372, 52–56 (2021). doi: 10.4049/jimmunol.1000842; pmid: 20644163 St. Baldrick’s–National Cancer Institute Pediatric Cancer Dream
doi: 10.1126/science.abg3074; pmid: 33707221 53. T. W. Hand et al., Differential effects of STAT5 and PI3K/AKT Team Translational Research Grant (SU2CAACR-DT1113, C.L.M.);
30. Y. C. Li et al., Structure and noncanonical Cdk8 activation signaling on effector and memory CD8 T-cell survival. Parker Institute for Cancer Immunotherapy (A.T.S., H.Y.C., and C.L.M.);
mechanism within an Argonaute-containing Mediator kinase Proc. Natl. Acad. Sci. U.S.A. 107, 16601–16606 (2010). Virginia and D.K. Ludwig Fund for Cancer Research (C.L.M.); the
module. Sci. Adv. 7, eabd4484 (2021). doi: 10.1126/sciadv. doi: 10.1073/pnas.1003457107; pmid: 20823247 Burroughs Welcome Fund Career Award for Medical Scientists (A.T.S.);
abd4484; pmid: 33523904 54. G. Verdeil, D. Puthier, C. Nguyen, A.-M. Schmitt-Verhulst, a Pew-Stewart Scholars for Cancer Research Award (A.T.S.); and
31. D. Conant et al., Inference of CRISPR Edits from Sanger Trace N. Auphan-Anezin, STAT5-mediated signals sustain a TCR- the Cancer Research Institute Lloyd J. Old STAR Award (A.T.S.). Stand
Data. CRISPR J. 5, 123–130 (2022). doi: 10.1089/ initiated gene expression program toward differentiation of Up 2 Cancer is a program of the Entertainment Industry Foundation
crispr.2021.0113; pmid: 35119294 CD8 T cell effectors. J. Immunol. 176, 4834–4842 (2006). administered by the American Association for Cancer Research. C.L.M.,
32. A. H. Long et al., 4-1BB costimulation ameliorates T cell doi: 10.4049/jimmunol.176.8.4834; pmid: 16585578 H.Y.C., and A.T.S. are members of the Parker Institute for Cancer
exhaustion induced by tonic signaling of chimeric antigen 55. C. S. Jansen et al., An intra-tumoral niche maintains and Immunotherapy, which supports the Stanford University Cancer
receptors. Nat. Med. 21, 581–590 (2015). doi: 10.1038/ differentiates stem-like CD8 T cells. Nature 576, 465–470 Immunotherapy Program. H.Y.C. is an investigator of the Howard
nm.3838; pmid: 25939063 (2019). doi: 10.1038/s41586-019-1836-5; pmid: 31827286 Hughes Medical Institute. E.W.W. is a member of the Parker Institute for
33. N. Li et al., Cyclin C is a haploinsufficient tumour suppressor. 56. L. Gattinoni et al., A human memory T cell subset with stem Cancer Immunotherapy and was funded by a Parker Institute Bridge
Nat. Cell Biol. 16, 1080–1091 (2014). doi: 10.1038/ncb3046; cell-like properties. Nat. Med. 17, 1290–1297 (2011). Scholar Award. R.G.M. is the Taube Distinguished Scholar for Pediatric
pmid: 25344755 doi: 10.1038/nm.2446; pmid: 21926977 Immunotherapy at Stanford University School of Medicine. J.A.B.
34. M. B. Moyo, J. B. Parker, D. Chakravarti, Altered chromatin 57. S. K. Vodnala et al., T cell stemness and dysfunction in tumors are was supported by a Stanford Graduate Fellowship and a National
landscape and enhancer engagement underlie transcriptional triggered by a common mechanism. Science 363, eaau0135 Science Foundation Graduate Research Fellowship under grant DGE-
dysregulation in MED12 mutant uterine leiomyomas. (2019). doi: 10.1126/science.aau0135; pmid: 30923193 1656518. K.A.F. was supported by the National Science Foundation
Nat. Commun. 11, 1019 (2020). doi: 10.1038/s41467-020- 58. K. L. Tsai et al., A conserved Mediator-CDK8 kinase module Graduate Research Fellowship under grant DGE-1656518. Sorting was
14701-6; pmid: 32094355 association regulates Mediator-RNA polymerase II interaction. performed on an instrument in the Stanford Shared FACS Facility
35. R. I. Klein Geltink, R. L. Kyle, E. L. Pearce, Unraveling the Nat. Struct. Mol. Biol. 20, 611–619 (2013). doi: 10.1038/ obtained using NIH S10 Shared Instrument Grant S10RR025518-01.
complex interplay between T cell metabolism and function. nsmb.2549; pmid: 23563140 Tetramers were obtained from the NIH Tetramer Facility, which is
Annu. Rev. Immunol. 36, 461–488 (2018). doi: 10.1146/ 59. M. T. Knuesel, K. D. Meyer, C. Bernecky, D. J. Taatjes, The supported by contract 75N93020D00005. Illustrations were created
annurev-immunol-042617-053019; pmid: 29677474 human CDK8 subcomplex is a molecular switch that controls with BioRender.com. Author contributions: Conceptualization: K.A.F.,
36. L. S. Levine et al., Single-cell analysis by mass cytometry Mediator coactivator function. Genes Dev. 23, 439–451 (2009). C.L.M., E.S., A.T.S., R.G.M., and E.W.W. Methodology: K.A.F., J.A.B.,
reveals metabolic states of early-activated CD8+ T cells during doi: 10.1101/gad.1767009; pmid: 19240132 B.D., K.S., D.K., P.X., E.W.W., R.G.M., M.M., and A.T.S. Investigation:
the primary immune response. Immunity 54, 829–844.e5 60. X. Wang et al., Structural flexibility and functional interaction of K.A.F., J.A.B., B.D., K.S., D.K., P.X., M.M., V.T.D., E.S., K.A.B., M.G.D.,
(2021). doi: 10.1016/j.immuni.2021.02.018; pmid: 33705706 Mediator Cdk8 module. Protein Cell 4, 911–920 (2013). M.C.R., J.B., P.J.Q., K.A.B., and M.D. Visualization: K.A.F., J.A.B., V.T.D.,
37. S. Krishna et al., Stem-like CD8 T cells mediate response of doi: 10.1007/s13238-013-3069-y; pmid: 24043446 and V.T. Writing – original draft: K.A.F., E.S., and C.L.M. Writing –
adoptive cell immunotherapy against human cancer. Science 61. B. Aranda-Orgilles et al., MED12 regulates HSC-specific review & editing: K.A.F., E.S., C.L.M., E.W.W., H.Y.C., R.G.M., A.T.S.,
370, 1328–1334 (2020). doi: 10.1126/science.abb9847; enhancers independently of Mediator kinase activity to control J.A.B., and J.M.E. Competing interests: K.A.F., E.S., and C.L.M. are
pmid: 33303615 hematopoiesis. Cell Stem Cell 19, 784–799 (2016). coinventors on patent application number PCT/US2021/058047
38. P. K. Gupta et al., CD39 expression identifies terminally doi: 10.1016/j.stem.2016.08.004; pmid: 27570068 submitted by the board of trustees of the Leland Stanford Junior
exhausted CD8+ T cells. PLOS Pathog. 11, e1005177 (2015). 62. M. D. Galbraith et al., CDK8 kinase activity promotes glycolysis. University that covers the use of T cells deficient in MED12 or CCNC
doi: 10.1371/journal.ppat.1005177; pmid: 26485519 Cell Rep. 21, 1495–1506 (2017). doi: 10.1016/ for cancer immunotherapy. C.L.M. holds multiple patents in the
39. R. Thomas et al., NY-ESO-1 based immunotherapy of cancer: j.celrep.2017.10.058; pmid: 29117556 arena of CAR T cell therapeutics. C.L.M. is a cofounder and holds
Current perspectives. Front. Immunol. 9, 947 (2018). 63. C. Neumayr et al., Differential cofactor dependencies define equity in Lyell Immunopharma, Syncopation Life Sciences, and Link
doi: 10.3389/fimmu.2018.00947; pmid: 29770138 distinct types of human enhancers. Nature 606, 406–413 Cell Therapies, which are developing CAR-based therapies, and
40. C. R. Good et al., An NK-like CAR T cell transition in CAR T cell (2022). doi: 10.1038/s41586-022-04779-x; pmid: 35650434 consults for Lyell, Syncopation, Link, NeoImmuneTech, Apricity,
dysfunction. Cell 184, 6081–6100.e26 (2021). doi: 10.1016/ 64. S. M. Kaech et al., Selective expression of the interleukin 7 Nektar, Immatics, Mammoth, and Ensoma. A.T.S. is a cofounder of
j.cell.2021.11.016; pmid: 34861191 receptor identifies effector CD8 T cells that give rise to Immunai and Cartography Biosciences. A.T.S. receives research
41. L. Zheng et al., Pan-cancer single-cell landscape of tumor- long-lived memory cells. Nat. Immunol. 4, 1191–1198 (2003). funding from Allogene Therapeutics and Merck Research
infiltrating T cells. Science 374, eabe6474 (2021). doi: 10.1126/ doi: 10.1038/ni1009; pmid: 14625547 Laboratories. H.Y.C. is an inventor on patents for the use of ATAC-seq,
science.abe6474; pmid: 34914499 65. E. J. Wherry et al., Lineage relationship and protective a cofounder of Accent Therapeutics and Boundless Bio, and an
42. D. Hamann et al., Phenotypic and functional separation of immunity of memory CD8 T cell subsets. Nat. Immunol. 4, adviser for 10x Genomics, Arsenal Biosciences, Cartography
memory and effector human CD8+ T cells. J. Exp. Med. 186, 225–234 (2003). doi: 10.1038/ni889; pmid: 12563257 Biosciences, and Spring Discovery. E.W.W. consults for and holds
1407–1418 (1997). doi: 10.1084/jem.186.9.1407; 66. S. C. Wei et al., Distinct cellular mechanisms underlie anti- equity in Lyell Immunopharma and VISTAN Health and consults for
pmid: 9348298 CTLA-4 and anti-PD-1 checkpoint blockade. Cell 170, Umoja Biopharma. E.S. consults for and holds equity in Lyell
43. P. Romero et al., Four functionally distinct populations of 1120–1133.e17 (2017). doi: 10.1016/j.cell.2017.07.024; Immunopharma and consults for Lepton Pharmaceuticals and Galaria.
human effector-memory CD8+ T lymphocytes. J. Immunol. 178, pmid: 28803728 R.G.M. is a cofounder of and holds equity in Syncopation Life Sciences
4112–4119 (2007). doi: 10.4049/jimmunol.178.7.4112; 67. R. Firestein et al., CDK8 is a colorectal cancer oncogene that and Link Cell Therapies. R.G.M. has served as a consultant for
pmid: 17371966 regulates b-catenin activity. Nature 455, 547–551 (2008). Lyell Immunopharma, Zai Lab, NKarta, Arovella Pharmaceuticals,
44. F. Sallusto, D. Lenig, R. Förster, M. Lipp, A. Lanzavecchia, Two doi: 10.1038/nature07179; pmid: 18794900 Innervate Radiopharmaceuticals, GammaDelta Therapeutics,
subsets of memory T lymphocytes with distinct homing 68. J. D. Gillmore et al., CRISPR-Cas9 in vivo gene editing for Immunai, and Aptorum Group. J.A.B. is a consultant to Immunai.
potentials and effector functions. Nature 401, 708–712 (1999). transthyretin amyloidosis. N. Engl. J. Med. 385, 493–502 Data and materials availability: ATAC-seq, ChIP-seq, and RNA-seq
doi: 10.1038/44385; pmid: 10537110 (2021). doi: 10.1056/NEJMoa2107454; pmid: 34215024 data have been deposited into the Gene Expression Omnibus
45. Y. Muroyama, E. J. Wherry, Memory T-cell heterogeneity and 69. C. Ashmore-Harris, G. O. Fruhwirth, The clinical potential of (GEO) repository under accession number GSE174282. ATAC-seq and
terminology. Cold Spring Harb. Perspect. Biol. 13, a037929 (2021). gene editing as a tool to engineer cell-based therapeutics. ChIP-seq data can be viewed through the UCSC Genome Browser
doi: 10.1101/cshperspect.a037929; pmid: 33782027 Clin. Transl. Med. 9, 15 (2020). doi: 10.1186/s40169-020-0268-z; at the following link: https://genome.ucsc.edu/s/kfreitas/med12%
46. N. S. Joshi et al., Inflammation directs memory precursor pmid: 32034584 2Dcart%2Dv3. License information: Copyright © 2022 the authors,
and short-lived effector CD8+ T cell fates via the graded 70. E. H. Yau, T. M. Rana, Next-generation sequencing of genome- some rights reserved; exclusive licensee American Association for
expression of T-bet transcription factor. Immunity 27, 281–295 wide CRISPR screens. Methods Mol. Biol. 1712, 203–216 the Advancement of Science. No claim to original US government
(2007). doi: 10.1016/j.immuni.2007.07.010; pmid: 17723218 (2018). doi: 10.1007/978-1-4939-7514-3_13; pmid: 29224076 works. https://www.science.org/about/science-licenses-journal-
47. J. Soutourina, Transcription regulation by the Mediator 71. E. R. Zunder et al., Palladium-based mass tag cell barcoding article-reuse
complex. Nat. Rev. Mol. Cell Biol. 19, 262–274 (2018). with a doublet-filtering scheme and single-cell deconvolution
doi: 10.1038/nrm.2017.115; pmid: 29209056 algorithm. Nat. Protoc. 10, 316–333 (2015). doi: 10.1038/
48. Z. Chen et al., In vivo CD8+ T cell CRISPR screening reveals nprot.2015.020; pmid: 25612231
SUPPLEMENTARY MATERIALS
control by Fli1 in infection and cancer. Cell 184, 1262–1280.e22 72. R. Finck et al., Normalization of mass cytometry data with bead
(2021). doi: 10.1016/j.cell.2021.02.019; pmid: 33636129 standards. Cytometry A 83, 483–494 (2013). doi: 10.1002/ science.org/doi/10.1126/science.abn5647
49. A. Delpoux et al., FOXO1 constrains activation and regulates cyto.a.22271; pmid: 23512433 Figs. S1 to S13
senescence in CD8 T cells. Cell Rep. 34, 108674 (2021). 73. B. Daniel, B. L. Balint, Z. S. Nagy, L. Nagy, Mapping the genomic Tables S1 to S6
doi: 10.1016/j.celrep.2020.108674; pmid: 33503413 binding sites of the activated retinoid X receptor in murine bone MDAR Reproducibility Checklist
50. H. P. Kim, J. Imbert, W. J. Leonard, Both integrated and marrow-derived macrophages using chromatin immunoprecipitation
differential regulation of components of the IL-2/IL-2 receptor sequencing. Methods Mol. Biol. 1204, 15–24 (2014). doi: 10.1007/978- View/request a protocol for this paper from Bio-protocol.
system. Cytokine Growth Factor Rev. 17, 349–366 (2006). 1-4939-1346-6_2; pmid: 25182757
doi: 10.1016/j.cytogfr.2006.07.003; pmid: 16911870 74. L. J. Zhu et al., ChIPpeakAnno: A Bioconductor package to Submitted 7 December 2021; resubmitted 2 August 2022
51. W. Liao, J.-X. Lin, L. Wang, P. Li, W. J. Leonard, Modulation of annotate ChIP-seq and ChIP-chip data. BMC Bioinformatics 11, Accepted 22 September 2022
cytokine receptors by IL-2 broadly regulates differentiation into 237 (2010). doi: 10.1186/1471-2105-11-237; pmid: 20459804 10.1126/science.abn5647
T
from neutralizing antibody responses of this
he emergence of the severe acute respi- glycoprotein NTD and RBD, which are the main previously dominant variant of concern (Fig.
ratory syndrome coronavirus 2 (SARS- targets of neutralizing antibodies (3, 8, 13–18), 1A; fig. S1, A to G; table S1; and data S1). The
CoV-2) Omicron variant at the end of 2021 explain the markedly reduced plasma-neutralizing highest levels of neutralizing GMTs against
caused a worldwide surge in COVID-19 activity of previously infected or vaccinated sub- SARS-CoV-2 variants were observed for BA.1
cases. The Omicron BA.1 and BA.1.1 lineages jects (especially those who have not received breakthrough cases, which was possibly due
swept the world first, followed by the BA.2 lineage booster doses) and the escape from most mono-
1
(1). Although BA.1 and BA.2 share a large num- clonal antibodies (mAbs) used in the clinic. As Department of Biochemistry, University of Washington,
Seattle, WA, USA. 2Howard Hughes Medical Institute,
ber of spike (S) mutations, they are each charac- a result, an increasing number of reinfec- University of Washington, Seattle, WA, USA. 3Humabs
terized by unique sets of amino acid changes tions or breakthrough infections are occurring Biomed SA, Subsidiary of Vir Biotechnology, Bellinzona,
that are associated with different antigenic prop- (19–22), even though these cases tend to be Switzerland. 4Department of Molecular Microbiology,
Washington University School of Medicine, St. Louis, MO,
erties (2–4). The BA.2.12.1 sublineage emerged in milder than infections of immunologically
USA. 5Division of Allergy and Infectious Diseases, University
the United States, peaking at the beginning of naive individuals. of Washington, Seattle, WA, USA. 6Vir Biotechnology,
June 2022, and is characterized by the presence San Francisco, CA, USA. 7KU Leuven Department of
of the L452Q receptor-binding domain (RBD) Characterization of plasma and mucosal Microbiology, Immunology and Transplantation, Rega Institute
humoral responses to Omicron infection for Medical Research, Laboratory of Virology and
and S704L fusion machinery mutations in addi- Chemotherapy, B-3000 Leuven, Belgium. 8Laboratory of
tion to the BA.2-defining mutations (4). The Understanding the relationships between prior Clinical and Epidemiological Virology, Rega Institute,
BA.2.75 sublineage is spreading in multiple antigen exposure through vaccination or in- Department of Microbiology, Immunology and Transplantation,
KU Leuven, Leuven, Belgium. 9Faculty of Biomedical Sciences,
countries and carries unique mutations (added fection with one SARS-CoV-2 strain and the Università della Svizzera italiana, Lugano, Switzerland.
to the BA.2 background) in the N-terminal do- immune response to subsequent infections 10
Division of Nephrology, Ente Ospedaliero Cantonale, Lugano,
main (NTD), along with D339H, G446S, and with a different strain is paramount to guiding Switzerland. 11Clinical School, University of New South Wales,
Sydney, New South Wales, Australia. 12Clinical Trial Unit, Ente
N460K mutations and an R493Q reversion in strategies to end the COVID-19 pandemic. To Ospedaliero Cantonale, Lugano, Switzerland. 13Division of
the RBD (5). The BA.3 S glycoprotein comprises investigate this, we first evaluated the magni- Clinical Pharmacology and Toxicology, Institute of
a combination of mutations found in BA.1 S and tude of immune evasion associated with the Pharmacological Sciences of Southern Switzerland, Ente
Ospedaliero Cantonale, Lugano, Switzerland. 14Department of
BA.2 S (6), whereas BA.4 S and BA.5 S are iden- Omicron sublineages by assessing the neutral- Clinical Pharmacology and Toxicology, University Hospital
tical to each other and comprise a deletion of izing activity of human plasma using a non- Zurich, Zurich, Switzerland. 15Department of Medicine, Ente
residues 69 to 70, L452R and F486V substitu- replicative vesicular stomatitis virus (VSV) Ospedaliero Cantonale, Bellinzona, Switzerland. 16Institut
Pasteur, Université Paris Cité, Lyssavirus Epidemiology and
tions, and an R493Q reversion compared with pseudotyped with Wuhan-Hu-1 S harboring
Neuropathology Unit, F-75015 Paris, France. 17Department of
BA.2 S (7). We characterized the emergence G614 (Wu-G614), Delta, BA.1, BA.2, BA.2.12.1, or Pathology and Immunology, Washington University School of
of Omicron (BA.1) as a major antigenic shift BA.4/5 mutations or with SARS-CoV S (Fig. 1A; Medicine, St. Louis, MO, USA. 18Department of Internal
because of the unprecedented magnitude of fig. S1, A to G; table S1; and data S1). We com- Medicine, UT Southwestern Medical Center, Dallas, TX, USA.
*Corresponding author. Email: dveesler@uw.edu (D.V.);
immune evasion associated with this variant pared plasma from six cohorts of individu- dcorti@vir.bio (D.C.)
of concern (3, 8–12). Mutations in the BA.1 S als: those previously infected in 2020 (with a †These authors contributed equally to this work.
4
61
61
61
61
61
61
G
G
u-
u-
u-
u-
u-
u-
W
W
B
W
Infected-vaccinated Omicron primary infection Omicron primary infection Omicron breakthrough Omicron breakthrough
(2-3 doses) 1-3 months 6-7 months (2-3 doses) 1-3 months (2-3 doses) 4-6 months
0%(0%) 62%(ACE2inh:56%) 62%(50%) 32%(ACE2inh:50%) 64%(0%) 34%(ACE2inh:100%) 0%(0%) 92%(ACE2inh:95%) 0%(0%) 87%(ACE2inh:91%)
Omicron BA.1 RBD IgG
3 3 3 3 3
2 2 2 2 2
1 1 1 1 1
0
38%(44%)
0 6%(0%) 0 2%(0%) 0 8%(5%)
0 13%(9%)
0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3
1%(0%) 47%(ACE2inh:40%) 7%(0%) 28%(ACE2inh:0%) 4%(50%) 42%(ACE2inh:20%) 0.2%(0%) 64%(ACE2inh:68%) 0%(0%) 54%(ACE2inh:54%)
SARS-CoV RBD IgG
3 3 3 3 3
2 2 2 2 2
1 1 1 1 1
0
52%(60%)
0 65%(100%) 0 54%(80%) 0 35%(32%)
0 46%(46%)
0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3
Wuhan RBD IgG Wuhan RBD IgG Wuhan RBD IgG Wuhan RBD IgG Wuhan RBD IgG
D E
Fig. 1. Evaluation of plasma, memory, and mucosal antibody responses ELISA. Red dots indicate inhibition of the interaction with ACE2 (using Wuhan-
upon Omicron breakthrough infections in humans. (A) Pairwise neutralizing Hu-1 target antigen) as determined in a separate assay. The percentages
activity [half-maximum inhibitory dilution (ID50)] against Wu-G614, Delta, BA.1, are expressed relative to the total positive hits against any of the antigens
BA.2, BA.2.12.1, BA.4/5, and SARS-CoV S VSV pseudoviruses using plasma from tested. Numbers of positive hits relative to individual donors are shown in fig. S3.
subjects who were infected and vaccinated, vaccinated and experienced (C) Frequency analysis of site-specific IgG antibodies derived from memory
breakthrough infection, or received vaccination only. VeroE6-TMPRSS2 cells B cells. RBD sites targeted by IgG derived from memory B cells were defined
were used as target cells (93). Data are the geometric mean of an n = 2 technical by a blockade-of-binding assay using mAbs specific for sites Ia (S2E12), Ib
replicates and have been performed in at least two biologically independent (S2X324), IIa (S2X259), IV (S309; parent of sotrovimab), and V (S2H97). Hybrid
experiments. GMTs are shown with a color-matched bar (and reported in table S1) sites Ia/Ib, Ia/IIa, Ib/IIa, Ib/IV, IIa/V, and IV/V were defined by competition
with the fold change compared with Wu-G614 indicated above. Demographics of with the two corresponding mAbs. Hybrid sites exhibiting competition with more
enrolled donors are provided in data S1. (B) Cross-reactivity of IgGs secreted than two mAbs are indicated as “multiple.” Lack of competition is indicated
from memory B cells obtained from infected-vaccinated individuals (n = 11), as “other.” Pie charts show cumulative frequencies of IgGs specific for the
primary SARS-CoV-2 infected individuals (n = 3 samples collected at 1 to different sites among total RBD-directed IgG antibodies (left) and those
3 months and n = 2 samples collected at 6 to 7 months), or breakthrough cases inhibiting binding of RBD to human ACE2 (right) in n = 11 infected-vaccinated
(n = 7 samples collected at 1 to 3 months and n = 4 samples collected at 4 to individuals or n = 7 breakthrough cases. (D) Neutralizing activity against
6 months) occurring in January–March 2022, when the prevalence of Omicron Wu-G614 and BA.1 S VSV pseudoviruses determined from nasal swabs obtained
BA.1/BA.2 exceeded 90% in the region where samples were obtained (fig. S2). longitudinally upon BA.1 breakthrough infection up to approximately 180 days
Each dot represents a well containing oligoclonal B cell supernatant screened after a positive PCR test [post (+) PCR]. (E) Neutralizing activity against Wu-G614
for the presence of IgGs binding to the SARS-CoV-2 Wuhan-Hu-1 and BA.1 RBDs and BA.1 S VSV pseudoviruses from nasal swabs obtained longitudinally after a
(top) or to the SARS-CoV-2 Wuhan-Hu-1 and SARS-CoV RBDs (bottom) using negative PCR test [post (–) PCR)] in vaccinated-only individuals.
to exposure to BA.1 S because no correlation RBD-directed memory B cells. Notably, a frac- through cases did not compete with any of
was found between time intervals and GMTs tion of RBD-directed antibodies (7 to 9%) cross- these five mAbs, indicating that they recog-
(data S1). Neutralizing GMTs against the SARS- reacted with the Wuhan-Hu-1 and BA.2 RBDs nize other undefined RBD antigenic sites (Fig.
CoV S pseudovirus was reduced for all cohorts but not with the BA.1 RBD, and a smaller frac- 1C and fig. S7). Antibodies recognizing most
by 8.6- to 25-fold relative to Wu-G614 S VSV, un- tion (1 to 3%) also cross-reacted with the Wuhan- antigenic sites overlapping with the receptor-
derscoring the marked genetic and antigenic Hu-1 and BA.4/5 RBDs but not with the BA.1 binding motif (RBM), such as mAb S2E12 (33),
divergence of this sarbecovirus clade (19, 27, 28). RBD, consistent with the antigenic distance of were found at lower frequency upon Omicron
Given the recall of Wuhan-Hu-1 plasma- BA.1 from the other Omicron sublineages (Fig. breakthrough infections relative to infected-
neutralizing antibodies in Omicron break- 1B, figs. S3 to S6, and table S2). Furthermore, vaccinated subjects, consistent with the pres-
through cases, we investigated the cross-reactivity the proportion of BA.4/5-reacting antibodies ence of several immune escape mutations in
of RBD-directed antibodies produced by in vitro– cross-reacting with Wuhan-Hu-1, BA.1, and the Omicron RBM (Fig. 1C and fig. S7) (3, 18). A
stimulated memory B cells obtained up to BA.2 decreased over time when comparing similar relative reduction was observed for
200 days after infection or vaccination, as well as 1 to 3 months versus 4 to 6 months after antibodies targeting RBD antigenic site IIa
in circulating plasma cells collected in the days breakthrough infections (fig. S4, D to F). This [recognized by the S2X259 mAb (34)] (Fig. 1C
after infection (29). These analyses used blood suggests that the maturation of antibodies and fig. S7), in agreement with previous find-
samples from individuals who were infected driven by BA.1 or BA.2 breakthrough infections ings describing Omicron immune escape from
before the emergence of Omicron and subse- may also result in a narrowing of their spe- several site IIa mAbs (3, 8, 18). Collectively, these
quently vaccinated (“infected-vaccinated 2/3 cificity over time, thereby decreasing cross- findings demonstrate that Omicron breakthrough
doses”), as well as subjects who experienced reactivity with the BA.4/5 RBD. These findings infections preferentially expand existing B cell
either an Omicron primary infection or an illustrate how immunological imprinting from pools primed by vaccination and elicit cross-
Omicron breakthrough infection. Primary and prior exposure, also referred to as “original reactive antibodies, supporting the concept of
breakthrough Omicron infections occurred be- antigenic sin,” can strongly affect the response immunological imprinting.
tween January and March 2022, during which to distantly related antigens. By contrast, mem- To evaluate mucosal antibody responses in
time the prevalence of Omicron BA.1/BA.2 sub- ory B cell–derived RBD-directed IgG antibodies subjects who experienced a BA.1 breakthrough
lineages exceeded 90% in the region from which obtained from Omicron primary infections up to infection or in vaccinated-only subjects, we
the samples were obtained (fig. S2). Plasma- 6 to 7 months after infection were present at low assessed IgG- and IgA-binding titers in nasal
neutralizing activity of Omicron-infected (pri- frequency and were mostly specific for the BA.1 swabs obtained longitudinally after polymer-
mary and breakthrough) cases was reduced and BA.2 RBDs, (Fig. 1B, figs. S3 to S6, and data ase chain reaction (PCR) testing. Although we
an average of 6.1-fold against BA.4/BA.5 S VSV S1). The frequency of IgG antibodies cross- detected S-specific IgG, and to a lesser extent
relative to BA.1 S VSV (table S2), likely as a reacting with the SARS-CoV RBD was similar IgA, in swabs from several breakthrough cases,
result of both RBD and NTD mutations in the across all three cohorts, concurring with the vaccinated-only individuals had no detectable
former lineage, concurring with the above data overall weak plasma-neutralizing activity (Fig. binding antibody titers (fig. S8, A to D, and fig.
and recent studies (30, 31). More than 80% of 1, A and B, and table S2). S9, A and B). Accordingly, we observed mucosal
SARS-CoV-2 RBD-directed IgGs secreted by We determined the site specificity of RBD- neutralizing activity against Wu-G614 and BA.1 S
memory B cells and plasma cells obtained directed antibodies secreted by stimulated VSV pseudoviruses for nasal swabs obtained from
from breakthrough cases cross-reacted with memory B cells by competition with structur- breakthrough cases throughout the month after
the Wuhan-Hu-1, BA.1, BA.2, BA.4/5 and Delta ally characterized mAbs targeting four distinct symptom onset, corresponding to up to 19 days
RBDs, and >90% of these antibodies blocked antigenic sites (13, 27). Most of the memory B after positive PCR testing (Fig. 1, D to E; fig.
binding to ACE2 [a correlate of neutralization cell–derived antibodies from (pre-Omicron) S9C; and data S1). Furthermore, analysis of
(13, 32)] (Fig. 1B, figs. S3 to S6, and table S2). infected-vaccinated individuals competed with nasal swabs obtained from four breakthrough
Moreover, Omicron breakthrough infections the five reference mAbs used, whereas a large cases ~6 months after symptom onset dem-
failed to elicit BA.1-, BA.2-, or BA.4/5-specific fraction of antibodies from Omicron break- onstrated a retention of neutralizing activity.
Assessing plasma-neutralizing antibody titers neutralization potency ranging between two and S375F triple mutant (as found in BA.1) did
of these BA.1 breakthrough cases yielded sim- and four orders of magnitude against all Omi- not alter sotrovimab activity (fig. S11F and
ilar magnitude and GMT reductions compared cron sublineage S VSV pseudoviruses compared table S3), lending further support to the role
with the rest of the BA.1 breakthrough cohort with Wu-D614 S VSV because of mutations in of F371 in reducing the sotrovimab potency
(Fig. 1A, fig. S1F, and data S1). The magnitude the RBM (Fig. 2A and fig. S10, A and B) (18). against BA.2, BA.3, BA.4, BA.5, BA.2.12.1, and
of the neutralizing antibody responses in nasal CT-P59, however, retained neutralizing activ- BA.2.75.
swabs cannot be directly compared with plas- ity against the BA.2.75 sublineage (29.2-fold S2X259, a site IIa mAb that broadly reacts
ma samples because of the self-administration reduction relative to Wu-D614 S VSV). The re- with the RBD of multiple sarbecoviruses (34),
procedure and resulting sample nonunifor- cently described ACE2-mimicking S2K146 retained activity against BA.1 (3). However, the
mity. Overall, we observed heterogeneous mu- mAb (40), which retained unaltered activity neutralization potency of S2X259 was decreased
cosal neutralizing antibody responses among against BA.1 compared with Wu-D614 (3), had by one to two orders of magnitude against BA.2,
BA.1 breakthrough cases but not in vaccinated- a mildly reduced neutralizing activity against BA.3, BA.4, BA.5, BA.2.12.1, and BA.2.75 S VSV
only individuals (Fig. 1, D and E; fig. S9, C BA.2, BA.3, BA.2.12.1, and BA.2.75 S VSV pseudo- pseudoviruses (Fig. 2A and fig. S10, A and B),
and D; and data S1). Collectively, these data viruses (3.3-, 3.1-, 1.9-, and 4.3-fold, respectively) likely because of the detrimental effect of the
underscore the lack of or very weak induction (Fig. 2A and fig. S10, A and B). However, S2K146 aforementioned S371F/S373P/S375F–induced
of mucosal antibody responses upon intramus- had a marked reduction in neutralizing activity remodeling and of the R408S mutation (34).
cular delivery of mRNA vaccines or adenovirus- against BA.4 and BA.5 (with 472- and 285-fold S2H97 is a site V mAb that had a 4.7- to 10-fold
vectored vaccines (35, 36) and are consistent IC50 reductions compared with Wu-D614 S decrease in neutralization potency against Omi-
with concurrent findings that Omicron break- VSV), likely caused by the F486V mutation. cron sublineages compared with Wu-D614 S
through infection, but not vaccination alone, Sotrovimab, a site IV mAb with broad sarbeco- VSV (Fig. 2A and fig. S10, A and B) despite the
induces neutralizing antibody responses and virus (clade Ia and Ib) cross-neutralizing ac- absence of mutations present in the epitope or
tissue-resident T cells in the nasal mucosa tivity (41), had a 16-, 7.3-, 21.3-, 22.6-, 16.6-, and otherwise found to affect binding by DMS,
(37, 38). 8.3-fold reduction in potency relative to Wu- perhaps reflecting differential accessibility
D614 against VSV pseudoviruses expressing to its cryptic epitope in the context of these S
Omicron sublineages escape neutralization BA.2, BA.3, BA.4, BA.5, BA.2.12.1, and BA.2.75 S trimers (27).
mediated by most clinical mAbs proteins, respectively (Fig. 2A). Similar reduc-
We next evaluated the impact of BA.1, BA.2, tions in neutralizing activity were also ob- Identification of the pan-variant and
BA.3, BA.4, BA.5, BA.2.12.1, and BA.2.75 S served against authentic Omicron sub-lineage ultrapotent neutralizing mAb S2X324
mutations on neutralization mediated by a virus isolates (Fig. 2C and fig. S11), and are The S2X324 mAb stood out in our panel be-
panel of RBD-directed mAbs using VSV pseudo- greater than that observed against BA.1 pseudo- cause its neutralization potency was largely
viruses and VeroE6 target cells. The site Ib virus (2.7-fold), although no additional residue unaffected by the BA.1, BA.2, BA.3, BA.4, BA.5,
COV2-2130 mAb weakly neutralized BA.1 (3), mutations map to the sotrovimab epitope ex- BA.2.12.1, and BA.2.75 S mutations (Fig. 2A and
whereas it neutralized BA.2, BA.3, BA.4, BA.5, cept the G339H substitution present in BA.2.75 fig. S10, A and B). S2X324 cross-reacted with and
BA.2.12.1, and BA.2.75 S VSV pseudoviruses instead of G339D found in BA.1 (41–43). We re- neutralized all SARS-CoV-2 (VSV pseudovirus
with 1.6-, 4.2-, 14.5-, 8.8-, 2.0-, and 7.9-fold de- cently showed that sotrovimab retained in vitro and authentic virus) variants tested, with IC50
creases, respectively, in half-maximal inhibition effector functions against BA.2 and conferred values <10 ng/ml except BA.2.75, for which the
concentration (IC50) compared with Wu-D614 Fc-dependent protection in the lungs of mice IC50 was 18 ng/ml (Fig. 2, B and C; figs. S10, A to
S VSV (Fig. 2A and fig. S10, A and B). More- infected with BA.2 (44). The additional loss of C, S12, and S13; and table S4). S2X324 cross-
over, the COV2-2196 + COV2-2130 mAb cock- neutralization of these Omicron sublineage reacted with the sarbecovirus clade 1b Pangolin-
tail had 106.4-, 7.6-, 35-, 92.8-, 46.5-, 9.3-, and VSV pseudoviruses beyond BA.1 likely results GD RBD but did not recognize more divergent
9.1-fold decreases in potency against BA.1, BA.2, from the S371F substitution, which is found in sarbecovirus RBDs (Fig. 2D), in contrast to the
BA.3, BA.4, BA.5, BA.2.12.1, and BA.2.75, respec- BA.2, BA.3, BA.4/5, BA.2.12.1, and BA.2.75, previously described broadly neutralizing mAb
tively (Fig. 2A and fig. S10, A and B). Because and introduces a bulky phenylalanine near the S2X259 (34). Furthermore, S2X324 inhibited
COV2-2196 weakly inhibited Omicron sub- N343 glycan, which is part of the sotrovimab binding of the SARS-CoV-2 RBD to human
lineages (except for BA.2.75, for which the re- epitope (41). A recently determined BA.2 S ACE2 in a concentration-dependent manner,
duction in IC50 was 17.3-fold), the neutralizing structure shows that the RBD helix compris- as measured by competition enzyme-linked
activity of the cocktail was largely mediated ing residues 364 to 372 is indeed remodeled immunosorbent assay (ELISA) (Fig. 2E), and
by COV2-2130. Within the COV2-2130 epitope, (45) and adopts a distinct conformation from induced slow, premature shedding (47) of the
position 446 is a glycine residue for Wuhan- the ones observed for Wuhan-Hu-1 S or BA.1 S S1 subunit from cell surface–expressed S (Fig.
Hu-1, BA.2, BA.4, BA.5, and BA.2.12.1 S or a structures (18, 46). This structural rearrange- 2F). However, S2X324 did not promote the
serine residue in BA.1, BA.3, and BA.2.75 S, ment is sterically incompatible with the glycan fusogenic conformational changes of a wild-
the latter residue disrupting the binding in- N343 conformation observed in S309-bound type–like purified recombinant S ectodomain
terface of COV2-2130 (18). The importance spike structures (18, 41), as supported by mo- trimer (fig. S14), likely because of the slow ki-
of this site was also identified through deep lecular dynamics simulations, and likely ex- netics of S1 shedding. This suggests that block-
mutational scanning (39), and this point plains the reductions in neutralization potency age of ACE2 binding is the main mechanism of
mutation was shown to reduce neutralizing (fig. S11, A to D). Although we could not test the S2X324-mediated inhibition of SARS-CoV-2.
activity by ~4-fold for COV2-2130 (8). The effect of the S371F substitution alone in the To evaluate the ability of S2X324 to promote
greater reduction in potency against BA.4 and Wu-D614 S background (because of poor VSV antibody dependent-phagocytosis or cytotox-
BA.5 relative to BA.2 is likely driven by the pseudovirus infectivity), the S371F, S373P, icity, we tested whether the mAb could activate
L452R mutation, as reported (https://www. S375F, and D614G mutant (as found in BA.2, Fcγ receptors expressed at the surface of Jurkat
fda.gov/media/154701/download) (39). The BA.3, BA.4, BA.5, BA.2.12.1, and BA.2.75) re- cells. Although S2X324 only activated FcγRIIIa,
REGN10987 + REGN10933 and LY-CoV16 + duced sotrovimab-mediated neutralization but not FcγRIIa, in vitro (fig. S15, A and B), it
LY-CoV555 mAb cocktails and the CT-P59 by 3.4-fold relative to Wu-D614 S VSV (fig. triggered both antibody-dependent phago-
and ADI-58125 mAbs had reductions of in vitro S11E and table S3). Moreover, the S371L, S373P, cytosis and cytotoxicity after incubation of
A 104
Neutr. IC50 (ng/ml) Wu-Hu-1
103 BA.1
BA.2
BA.3
102 BA.4
BA.5
BA.2.12.1
101
BA.2.75
104
Fold change (IC50 BA/WT)
BA.1
103 BA.2
BA.3
102 BA.4
BA.5
BA.2.12.1
101 BA.2.75
100
97
59
24
59
46
25
ab
oV 55
6
-2 30
6
04
10 7
3
01
19
13
19
N 098
93
H
P
X3
X2
K1
81
m
-C V5
V2 1
14
T-
-2
-2
O -2
S2
vi
I-5
S2
S2
S2
oV
EG 1
LY Co
V2
V2
C V2
tro
R N
AD
-C
EG
-
so
LY
LY
C
C
R
(IC50Omicron/WT)
103 102 BA.5
IC50 (ng/ml)
IC50 (ng/ml)
Fold change
BA.4(N658S) Mu
103 BA.4(V3G) B.1.619 BA.2.12.1
BA.5 A.23.1 BA.4(V3G)
102 BA.2.12.1 B.1.258 102 101
BA.2.75 B.1.519
101 Alpha R.1
Beta R.2
Gamma
101 100
100 A.27.1
Delta B.1.298
Epsilon
10-1 Eta 100 10-1
97
59
ab
ab
24
ab
46
24
24
H
X2
X3
m
K1
X3
X3
S2
vi
vi
vi
S2
S2
S2
S2
tro
S2
tro
tro
so
so
so
IC50
D E 100 S2E12 22.12 100
SARS-CoV-2 Wu-Hu-1
4 S2X324 26.69 S2E12
binding to the RBD (%)
PG-GX
S2M11
Binding (OD 405 nm)
75
mAb binding (%)
Inhibition of ACE2
PG-GD
75 S2X324
3 RaTG13
S2X259
SARS-CoV 50 S309
WIV1
2 50
25
1 0 25
0 -25
10-1 100 101 102 103 104 10-1 100 101 102 103 104 5 30 60 120 180
S2X324 (ng/ml) mAb (ng/ml) Time (min)
Fig. 2. Identification and characterization of S2X324 as a pan-variant RBD- Omicron BA.1, BA.2, BA.4, BA.5, and BA.2.12.1 authentic viruses using VeroE6-
directed mAb. (A) mAb-mediated neutralization of BA.1, BA.2, BA.3, BA.4, BA.5, TMPRSS2 target cells. Data are representative of at least two biological
BA.2.12.1, and BA.2.75 S VSV pseudoviruses. Two haplotypes of BA.4 S were tested: independent experiments. Neutralization of Omicron BA.1 by sotrovimab refers to
BA.4-V3G (orange dots) and BA.4-N658S (white dots), and the IC50 values reported previously published data (3). (D) Cross-reactivity of S2X324 with sarbecovirus
in the text are the averages of both haplotypes. The potency of each mAb or clade 1a and 1b RBDs analyzed by ELISA. PG-GX, Pangolin-Guangxi; PG-GD,
mAb cocktail is represented by their IC50 (top, geometric mean ± SD) or fold Pangolin-Guangdong. (E) Preincubation of serial dilutions of S2X324 or S2E12
change relative to neutralization of the Wuhan-Hu-1 (D614) pseudovirus (bottom, with the SARS-CoV-2 RBD prevents binding to the immobilized human ACE2
average ± SD). (B) Neutralization of SARS-CoV-2 variant S VSV pseudoviruses ectodomain in ELISA. Error bars indicate SD between replicates. (F) S2X324-
mediated by broadly neutralizing mAbs. Each symbol represents the GMT of at least mediated S1 shedding from cell surface–expressed SARS-CoV-2 S as determined
two independent experiments. (C) Neutralizing activity (left) and fold change by flow cytometry. S2E12 and S2X259 were used as positive controls, and S2M11
relative to WA-1/2020 (right) of S2X324 and sotrovimab against SARS-CoV-2 and S309 were used as negative controls.
peripheral blood mononuclear cells with SARS- parent) (41) mAbs (fig. S13B). S2X324 uses all (fig. S13A) might be caused by G446S, because
CoV-2 S-expressing cells (fig. S15, C to F). The six complementary-determining loops to rec- although the mutation is clearly accommo-
slow S1 shedding kinetics likely explain the ognize RBD residues T345, N439, K440, L441, dated, at least one of three favored rotamers
ability of S2X324 to promote Fc-mediated ef- S443, K444, V445, S446, G447, N448, Y449, for S446 would clash with the Fab. The Y501
fector functions. N450, R498, P499, T500, Y501, G502, Q506, backbone forms van der Waals interactions
and R509 (Fig. 3C). Consistent with the com- with the VL N32 side chain that are indepen-
Structural basis for S2X324-mediated petition assay, S2X324 overlaps with the RBM dent of the RBD residue identity at position
neutralization on the RBD and would sterically hinder re- 501 (explaining retention of neutralization
To understand the pan-variant S2X324 inhib- ceptor engagement (Figs. 2E and 3D). of all Y501-containing variants). S2X324 and
itory activity, we determined a cryo–electron The structure explains how this mAb accom- LY-CoV1404 share 87 and 91% amino acid
microscopy structure of the Omicron BA.1 S modates residues that are mutated in Omicron sequence identity in their heavy and light chains,
ectodomain trimer bound to the S2X324 Fab lineages relative to Wuhan-Hu-1: N440K (BA.1/ respectively, likely explaining their similar bind-
fragment at 3.1-Å resolution (Fig. 3A, fig. S16, BA.2/BA.3/BA.4/BA.5/BA.2.12.1/BA.2.75), G446S ing mode (fig. S17) (48), pan-variant neutralizing
and table S5). In our structure, the BA.1 S trimer (BA.1/BA.3//BA.2.75), Q498R (BA.1/BA.2/BA.3/ activity (49), and comparable resilience to Omi-
had three Fabs bound to one closed and two BA.4/BA.5/BA.2.12.1/BA.2.75), and N501Y (BA.1/ cron sublineage mutations thus far (Fig. 2A).
open RBDs. We used focused classification and BA.2/BA.3/BA.4/BA.5/BA.2.12.1/BA.2.75). Specifi-
local refinement of the closed RBD-S2X324 Fab cally, K440 forms a salt bridge with the VL E53 Identification of S2X324 viral escape
complex to obtain a 3.3-Å structure revealing side chain, S446 forms van der Waals inter- mutants in vitro
the molecular details of the binding interface. actions with VH R60 and VL S96/S97, whereas To explore potential mutations that could pro-
S2X324 recognizes an RBD epitope partially R498 forms electrostatic interactions with the mote escape from S2X324-mediated neutrali-
overlapping with antigenic sites Ib and IV VL S96 backbone. Our structure further sug- zation, we passaged a replication-competent
(Fig. 3, A and B), explaining the observed compe- gests that the tighter binding of S2X324 to the VSV chimera harboring either SARS-CoV-2
tition with the S2H14 (13) and S309 (sotrovimab Wuhan-Hu-1 and BA.2 RBDs relative to BA.1 Wu-G614 S (50) or Omicron BA.1 S in the pres-
ence of S2X324. Residue substitutions at three
distinct sites emerged in both S backgrounds
(Fig. 3C; fig. S18, A and B; and tables S6 and S7):
(i) K444N/T (Wu-G614 and BA.1 background)
and K444E/M (BA.1 background), which would
abrogate the salt bridges formed between
the K444 side chain and the heavy chain D56
and D58 side chains; (ii) V445D (Wu-G614
background) and V445A/F (BA.1 background),
which would disrupt Van der Waals contacts
with S2X324; and (iii) P499R (Wu-G614 back-
ground) and P499S/H (BA.1 background), which
might alter the local RBD backbone confor-
mation and/or sterically hinder mAb binding.
Furthermore, three additional mutations were
detected in the BA.1 S background only, S446I,
G447S, and N448K, which are positioned near
the interface between the heavy and light chains
(Fig. 3C; fig. S18, A and B; and tables S6 and
S7). The VSV chimera harboring SARS-CoV-2
Wu-G614 S outcompeted the chimeras harbor-
ing the K444T/N, V445D, or P499R escape mu-
tants after four rounds of passaging, suggesting
reduced fitness in this replicating chimeric
virus model system (fig. S18C). Even though
each of these mutations requires a single nu-
cleotide substitution, they are very rare and
have been detected cumulatively only in 0.087
and 0.080% of Delta and Omicron genome
sequences as of 12 August 2022, respectively
(table S8 and fig. S19), although the frequency
Fig. 3. Structural characterization of the S2X324 pan-variant mAb. (A) Cryo-EM structure viewed along of some of them is increasing. We further
two orthogonal orientations of the prefusion SARS-CoV-2 Omicron BA.1 S ectodomain trimer with three tested VSV pseudoviruses bearing Wu-G614,
S2X324 Fab fragments bound. SARS-CoV-2 S protomers are colored light blue, pink, and gold. S2X324 heavy- BA.1, or BA.2 S carrying K444E, K444D, K444N,
chain and light-chain variable domains are colored purple and magenta, respectively. Glycans are shown K444T, V445D, and P449R/H, and confirmed
as blue spheres. (B) Ribbon diagram of the S2X324-bound SARS-CoV-2 RBD. The N343 glycan is shown that these mutations abrogated or strongly re-
as blue spheres. (C) Magnified view of the contacts formed between S2X324 and the SARS-CoV-2 BA.1 RBD. duced S2X324-neutralizing activity (fig. S19 and
Selected epitope residues are labeled, and electrostatic interactions are indicated with dotted lines. A few table S9). In addition, S2X324-neutralizing ac-
of the escape mutants identified are colored turquoise. (D) Superimposition of the S2X324-bound (purple and tivity was abrogated when V445T/A/F was
magenta) and ACE2-bound [dark gray, PDB 6M0J (94)] SARS-CoV-2 RBD (light blue) structures showing steric introduced in the BA.1 backbone (table S9).
overlap. The N343 glycan is shown as blue spheres. S2X324 retained potent neutralizing activity
against pseudoviruses bearing other muta- lenged with SARS-CoV-2 Delta in a dose- viral RNA loads by 2.5 and 3 orders of mag-
tions in the epitope found in known variants dependent manner (Fig. 4, A to C) despite a nitude compared with the control group, re-
such as N439K, N440K, and N501Y in the 20-fold difference in in vitro potency against spectively (Fig. 4, G and H). Viral replication in
Wu-G614 S background (table S9). Although SARS-CoV-2 Delta S VSV (Fig. 2B). These data the lungs was fully abrogated at 2 and 5 mg/kg
the S2X324 escape mutants identified are rare, support the lack of direct correlation between of S2X324 and reduced by about one order of
these data suggest that a mAb cocktail com- in vitro and in vivo potency that was previous- magnitude for animals treated with 0.1 and
prising S2X324 would increase the barrier for ly reported (51, 52). Moreover, prophylactic 0.5 mg/kg of S2X324 (Fig. 4I). No statistically
the emergence of resistance mutants even fur- administration of S2X324 at 5 mg/kg decreased significant differences were observed for ani-
ther compared with this single mAb. viral loads below detection levels in the lungs mals receiving an Fc-silenced version of S2X324
of hamsters challenged with BA.2 or BA.5 (Fig. (N297A) versus the groups receiving the same
S2X324 protects hamsters against SARS-CoV-2 4, D to F). In this model, S309 retained activity doses of Fc-competent S2X324, indicating that
Delta, BA.2, and BA.5 variants against BA.5 despite a 22.6-fold reduced in vitro limited contribution of Fc-mediated effector
We investigated the in vivo prophylactic and potency relative to Wu-D614 (Fig. 2, A and B). functions in these experimental conditions.
therapeutic efficacy of S2X324 using Syrian Therapeutic administration of hamster IgG2a
hamsters challenged with SARS-CoV-2 var- S2X324 (1 day after challenge with the SARS- Discussion
iants. Prophylactic administration of S2X324 CoV-2 Delta variant) at 2 and 5 mg/kg pre- Immune imprinting, which is also referred to
or S309 comparably protected hamsters chal- vented body weight loss and reduced lung as original antigenic sin, was described based
7
Log10TCID50/mg lung
5 4 mg/kg
6 ** 5 MGH2 Ctr.
4 ** 5 15
3 5 S2X324
** 4
3 5 HuS309
2 3 15
2 ** ** 5 HuS2X324
*** *** 2
1
1 1
0 0 0
G SARS-CoV-2 Delta H SARS-CoV-2 Delta I SARS-CoV-2 Delta
8
Log10RNA copies/mg lung
* 6
Body weight change (%)
mg/kg
Log10TCID50/mg lung
10 7
*
* *** * 5 MGH2 Ctr.
5
6 *** 5
***
4 2 S2X324
0 5
0.5
4 3 0.1
3 5 S2X324
-10 2 2 -N297A
2 ***
1 **** **** ****
1
-20
Fig. 4. S2X324 protects hamsters against SARS-CoV-2 Delta, BA.2, and prior by prophylactic intraperitoneal administration of S2X324 hamster IgG2a at
BA.5 challenge. (A to C) Dose-dependent (expressed in milligrams of mAb per 5 mg/kg of body weight. ***P < 0.001 relative to control. Data were analyzed
kilogram of body weight) prophylactic protection of S2X324 (blue circles) and with Mann-Whitney two-tailed t test. (E and F) Quantification of replicating
S309 (green diamonds) hamster IgG2a (harboring hamster IgG2a constant virus titers (TCID50) (E) and viral RNA load (F) in the lung of Syrian hamsters
regions) administered to animals 1 day before infection with SARS-CoV-2 Delta. 4 days after intranasal infection with SARS-CoV-2 Omicron BA.5, which was
Animals were evaluated 4 days after infection on the basis of the fraction of body preceded 1 day prior by prophylactic intraperitoneal administration of S309 or
weight change (A), replicating viral titers [50% tissue culture infectious dose S2X324 human IgG1 (HuS309 and HuS2X324). (G to I) Dose-dependent
(TCID50)] (B), and viral RNA load (C). n = 6 animals/dose. *P < 0.05, **P < 0.01, protection in animals 4 days after infection with SARS-CoV-2 Delta by
***P < 0.001, and ****P < 0.0001 relative to isotype control (MGH2 mAb against therapeutic intraperitoneal administration of S2X324 hamster IgG2a (blue
circumsporozoite protein of Plasmodium sporozoites). Data were analyzed with symbols) or the S2X324 N297A mutant IgG2a (purple symbols) 1 day later
Kruskal-Wallis test followed by Dunn’s multiple-comparisons test. (D) Quantification at 5, 2, 0.5, or 0.1 mg/kg of body weight. *P < 0.05, **P < 0.01, ***P < 0.001,
of viral RNA loads in the lung and trachea of Syrian hamsters 4 days after and ****P < 0.0001 relative to control, respectively. Data were analyzed with
intranasal infection with SARS-CoV-2 Omicron BA.2, which was preceded 1 day Mann-Whitney two-tailed t test.
on the observation that infections with in- time to enhance their affinity and neutralizing 5. C.-W. Tan et al., Lancet Microbe S2666-5247(22)00220-8
fluenza virus strains distinct from the one potency against Omicron, but also to possibly (2022).
6. P. A. Desingu, K. Nagarajan, K. Dhama, J. Med. Virol. 94,
that caused prior infection preferentially boosted broaden their neutralizing activity against 1808–1810 (2022).
antibody responses against epitopes shared past and future variants. Indeed, multiple studies 7. H. Tegally et al., medRxiv 2022.05.01.22274406 [Preprint]
with the original strain (53). Although this have shown that somatic hypermutations yield (2022); https://doi.org/10.1101/2022.05.01.22274406.
8. L. Liu et al., Nature 602, 676–681 (2022).
phenomenon is often considered detrimen- RBD-specific mAbs with increased affinity for 9. D. Planas et al., Nature 602, 671–675 (2022).
tal, it can also be beneficial, as was the case at the homotypic antigen and augmented resilience 10. M. Hoffmann et al., bioRxiv 472286 [Preprint] (2021);
the time of the 2009 H1N1 pandemic, during to immune evasion of emerging heterotypic https://doi.org/10.1101/2021.12.12.472286.
11. W. F. Garcia-Beltran et al., Cell 185, 457–466.e4 (2022).
which initial antibody responses to infection variants (40, 75–79). The recently introduced 12. H. Gruell et al., bioRxiv 487257 [Preprint] (2022);
with this newly emerged and antigenically bivalent mRNA vaccine boosters encoding the https://doi.org/10.1101/2022.04.06.487257.
shifted virus were dominated by antibodies Wuhan-Hu-1 and either the BA.1 or the BA.4/5 13. L. Piccoli et al., Cell 183, 1024–1042.e21 (2020).
14. J. E. Bowen et al., bioRxiv 473391 [Preprint] (2021);
targeting the conserved hemagglutinin stem S glycoproteins have yielded encouraging re-
https://doi.org/10.1101/2021.12.19.473391.
region (54, 55). Subsequent exposures through sults (80–82). 15. L. Stamatatos et al., Science 372, eabg9175 (2021).
vaccination or infection elicited antibody re- Understanding antibody responses elicited 16. A. J. Greaney et al., Sci. Transl. Med. 13, eabi9915 (2021).
sponses to the shifted variant (i.e., to “non- by and directed toward Omicron sublineages 17. M. McCallum et al., Cell 184, 2332–2347.e16 (2021).
18. M. McCallum et al., Science 375, 864–868 (2022).
conserved” hemagglutinin epitopes) (54, 56). is as the result of key to informing public 19. A. C. Walls et al., Cell 185, 872–880.e3 (2022).
Moreover, several studies reported hemagglu- health policies and the design of SARS-CoV-2 20. A. Y. Collier et al., Sci. Transl. Med. 14, eabn6150 (2022).
tinin stem-directed antibody-mediated protec- and sarbecovirus vaccines (70, 71, 83–85). Our 21. T. A. Bates et al., JAMA 327, 179–181 (2022).
22. P. Mlcochova et al., Research Square [Preprint] (2021);
tion against H5N1 and H7N9 zoonotic influenza data show that Omicron breakthrough infec- https://doi.org/10.21203/rs.3.rs-637724/v1.
strains through imprinting during childhood tions do not elicit high titers of pan-sarbeco- 23. M. McCallum et al., Science 374, 1621–1626 (2021).
resulting from exposure to seasonal H1N1 and virus–neutralizing antibodies (e.g., directed 24. R. Suzuki et al., Nature 603, 700–705 (2022).
25. P. Mlcochova et al., Nature 599, 114–119 (2021).
H3N2, respectively (55, 57). Similarly, we show against SARS-CoV), in agreement with recent 26. S. Crotty, Science 372, 1392–1393 (2021).
that exposure to antigenically shifted Omicron data (86). These findings contrast with the 27. T. N. Starr et al., Nature 597, 97–102 (2021).
strains primarily recalls existing memory B observation that preexisting immunity to SARS- 28. C.-W. Tan et al., N. Engl. J. Med. 385, 1401–1406 (2021).
29. D. Pinna, D. Corti, D. Jarrossay, F. Sallusto, A. Lanzavecchia,
cells specific for epitopes shared by multiple CoV followed by SARS-CoV-2 vaccination is Eur. J. Immunol. 39, 1260–1270 (2009).
SARS-CoV-2 variants rather than priming naïve associated with elicitation of pan-sarbecovirus– 30. K. Khan et al., medRxiv 2022.04.29.22274477 [Preprint] (2022).
B cells recognizing Omicron-specific epitopes neutralizing antibodies (28). These different 31. A. Muik et al., bioRxiv 502461 [Preprint] (2022);
https://doi.org/10.1101/2022.08.02.502461.
(at least up to 180 days after breakthrough in- outcomes might be explained by the low fre-
32. C. W. Tan et al., Nat. Biotechnol. 38, 1073–1078 (2020).
fection), as was also recently reported (58). quency of memory B cells encoding neutraliz- 33. M. A. Tortorici et al., Science 370, 950–957 (2020).
Although immune imprinting may be benefi- ing antibodies targeting antigenic sites shared 34. M. A. Tortorici et al., Nature 597, 103–108 (2021).
cial for stimulating responses to cross-reactive among pre-Omicron variants (Wuhan-Hu-1– 35. L. Azzi et al., EBioMedicine 75, 103788 (2022).
36. J. Tang et al., Sci. Immunol. 7, eadd4853 (2022).
SARS-CoV-2 S epitopes, antibody responses to related strains), Omicron, and SARS-CoV be- 37. D. Planas et al., medRxiv 2022.07.22.22277885 [Preprint]
some Omicron S-specific epitopes were hin- cause of the genetic and antigenic distances (2022); https://doi.org/10.1101/2022.07.22.22277885.
dered by prior antigenic exposure. between these three distinct viruses. For in- 38. J. M. E. Lim et al., J. Exp. Med. 219, e20220780 (2022).
39. J. Dong et al., Nat. Microbiol. 6, 1233–1244 (2021).
Currently, there is uncertainty whether vac- stance, Omicron BA.1 and BA.2 harbor varia- 40. Y.-J. Park et al., Science 375, 449–454 (2022).
cines matching dominant circulating SARS- tions of the RBD antigenic site II, which is the 41. D. Pinto et al., Nature 583, 290–295 (2020).
CoV-2 variants such as those used for seasonal target of pan-sarbecovirus–neutralizing anti- 42. E. Cameroni et al., bioRxiv 472269 [Preprint] (2021);
https://doi.org/10.1101/2021.12.12.472269.
influenza are needed, or if the repeated use of bodies such as S2X259 (34), DH1047 (87), and 43. A. L. Cathcart et al., bioRxiv 434607 [Preprint] (2021);
Wuhan-Hu-1–based vaccines will suffice. Re- ADG2 (88), leading to resistance to the neu- https://doi.org/10.1101/2021.03.09.434607.
cent work showed that boosting previously tralization mediated by some of these mAbs 44. J. B. Case et al., Nat. Commun. 13, 3824 (2022).
45. V. Stalls et al., Cell Rep. 39, 111009 (2022).
immunized macaques with Beta or Omicron (3, 8, 18). This suggests that conservation of 46. A. C. Walls et al., Cell 181, 281–292.e6 (2020).
mRNA S vaccines or with Beta RBD nano- RBD antigenic sites across sarbecoviruses may 47. A. C. Walls et al., Cell 176, 1026–1039.e15 (2019).
particle vaccines elicited comparably high titers have resulted (at least partially) from limited 48. K. Westendorf et al., bioRxiv 442182 [Preprint] (2022);
https://doi.org/10.1101/2021.04.30.442182.
of antibodies broadly neutralizing multiple var- immune pressure rather than from functional
49. K. Westendorf et al., Cell Rep. 39, 110812 (2022).
iants relative to Wuhan-Hu-1–based vaccines or structural constraints (i.e., some mutations 50. J. B. Case et al., Cell Host Microbe 28, 475–485.e5 (2020).
(59–61). Furthermore, administration of Wuhan- at these conserved sites may remain compa- 51. A. Schäfer et al., J. Exp. Med. 218, e20201993 (2021).
Hu-1–based vaccine boosters in humans was tible with viral fitness) (86). 52. J. B. Case et al., bioRxiv 484787 [Preprint] (2022);
https://doi.org/10.1101/2022.03.17.484787.
shown to elicit appreciable titers of neutralizing Recent preclinical assessment of intranasally 53. T. Francis, Proc. Am. Philos. Soc. 104, 572–578 (1960).
antibodies and prevent severe disease associated administered influenza and sarbecovirus vac- 54. D. Corti et al., Science 333, 850–856 (2011).
with Omicron infections (11, 19, 62–65). The cine candidates has demonstrated the induc- 55. J. Wrammert et al., J. Exp. Med. 208, 181–193 (2011).
56. C. S.-F. Cheung et al., Cell Rep. 32, 108088 (2020).
limited cross-variant neutralization elicited tion of lung-resident protective mucosal humoral 57. K. M. Gostic, M. Ambrose, M. Worobey, J. O. Lloyd-Smith,
by Omicron primary infection in humans or and cellular immunity at the site of viral entry Science 354, 722–726 (2016).
Omicron-based vaccination of immunologically (89–92). These observations, along with our find- 58. J. Quandt et al., Sci. Immunol. 7, eabq2427 (2022).
59. M. Gagne et al., Cell 185, 1556–1571.e18 (2022).
naïve animals and the data on the specificity ings that SARS-CoV-2 breakthrough infections, 60. K. S. Corbett et al., Science 374, 1343–1353 (2021).
of memory B cells presented here indicate that but not vaccination alone, elicit neutralizing ac- 61. P. S. Arunachalam et al., Sci. Transl. Med. 14, eabq4130
an Omicron-based vaccine might elicit anti- tivity in the nasal mucosa, support the devel- (2022).
62. E. K. Accorsi et al., JAMA 327, 639–651 (2022).
body responses directed toward the vaccine- opment and evaluation of a next generation of 63. H. F. Tseng et al., Nat. Med. 28, 1063–1071 (2022).
matched and closely related antigens. This vaccines administered intranasally. 64. R. Pajon et al., N. Engl. J. Med. 386, 1088–1091 (2022).
suggests that a heterologous prime boost or 65. J. E. Bowen et al., bioRxiv 484542 [Preprint] (2022);
https://doi.org/10.1101/2022.03.15.484542.
a multivalent approach might be preferable RE FERENCES AND NOTES 66. A. Rössler, L. Knabl, D. von Laer, J. Kimpel, N. Engl. J. Med.
(59, 66–73). Omicron infection and Omicron 1. R. Viana et al., Nature 603, 679–686 (2022). 386, 1764–1766 (2022).
S-based vaccination of previously immune sub- 2. J. Yu et al., medRxiv 2022.02.06.22270533 [Preprint] (2022); 67. I.-J. Lee et al., bioRxiv 478406 [Preprint] (2022);
https://doi.org/10.1101/2022.02.06.22270533. https://doi.org/10.1101/2022.01.31.478406.
jects, however, recalls cross-reactive memory 3. E. Cameroni et al., Nature 602, 664–670 (2022). 68. S. I. Richardson et al., Cell Host Microbe 30, 880–886.e4
B cells (58, 74), which may further mature over 4. J. E. Bowen et al., Science 377, 890–894 (2022). (2022).
69. K. Stiasny et al., Research Square [Preprint] (2022); ACKN OWLED GMEN TS Biotechnology Inc. L.A.P. is a former employee and shareholder in
https://doi.org/10.21203/rs.3.rs-1536794/v1. We thank A. E. Powell and N. Czudnochowski for assistance with Regeneron Pharmaceuticals. Regeneron provided no funding for this
70. A. C. Walls et al., Cell 184, 5432–5447.e16 (2021). protein production. Funding: This study was supported by the work. H.W.V. is a founder and holds shares in PierianDx and Casma
71. A. A. Cohen et al., Science 371, 735–741 (2021). National Institute of Allergy and Infectious Diseases (grants Therapeutics. Neither company provided resources. D.C. is currently
72. S. Chalkias et al., Research Square [Preprint] (2022); DP1AI158186 and HHSN75N93022C00036 to D.V.), a Pew Biomedical listed as an inventor on multiple patent applications, which disclose
https://doi.org/10.21203/rs.3.rs-1555201/v1. Scholars Award (D.V.), an Investigators in the Pathogenesis of the subject matter described in this manuscript. The Veesler
73. S. S. M. Cheng et al., J. Clin. Virol. 156, 105273 (2022). Infectious Disease Award from the Burroughs Wellcome Fund (D.V.), laboratory has received a sponsored research agreement from Vir
74. W. B. Alsoussi et al., bioRxiv 509040 [Preprint] (2022); Fast Grants (D.V.), the University of Washington Arnold and Mabel Biotechnology Inc. S.P.J.W. has licensing agreements with Vir
https://doi.org/10.1101/2022.09.22.509040. Beckman cryoEM center (D.V.), and the National Institutes of Biotechnology and Merck and is a consultant for Thylacine Bio. The
75. C. Gaebler et al., Nature 591, 639–644 (2021). Health (grant S10OD032290 to D.V. and grant AI163019 to S.P.J.W.) remaining authors declare no competing interests. Data and
76. Z. Wang et al., Nature 595, 426–431 (2021). materials availability: The cryoEM map and coordinates have been
D.V. is an Investigator of the Howard Hughes Medical Institute. O.G. is
77. D. Pinto et al., Science 373, 1109–1116 (2021). deposited to the Electron Microscopy Databank (SARS-CoV-2 S/
funded by the Swiss Kidney Foundation. Author contributions:
78. J. S. Low et al., bioRxiv 486377 [Preprint] (2022); S2X324: EMD-28559; SARS-CoV-2 S/S2x324: EMD-28558) and the
A.C.W., A.L., D.P., D.C., M.S.P., and D.V. designed the experiments.
https://doi.org/10.1101/2022.03.30.486377. Protein Data Bank (SARS-CoV-2 S/S2X324: PDB 8ERR; SARS-CoV-2
79. R. Marzi et al., bioRxiv 509852 [Preprint] (2022); A.C.W., A.D.M., D.P., C.S., W.R., K.R.S. F.Z., H.V.D., M.G., G.Sc., and
F.A.L. isolated mAb and performed binding, neutralization assays, S/S2x324: PDB 8ERQ). Materials generated in this study will be
https://doi.org/10.1101/2022.09.30.509852. made available on request, but may require a completed materials
80. S. Chalkias et al., N. Engl. J. Med. 387, 1279–1291 (2022). biolayer interferometry, and surface plasmon resonance binding
measurements. A.R., J.Z., N.F., M.M.R., and J.N. performed transfer agreement signed with Vir Biotechnology Inc. or the
81. S. M. Scheaffer et al., bioRxiv 507614 [Preprint] (2022);
neutralization assays using authentic virus. H.K. confirmed the University of Washington. License information: This article is subject
https://doi.org/10.1101/2022.09.12.507614.
Spike mutations of authentic virus by Sanger sequencing. A.D.M. to Howard Hughes Medical Institute’s (HHMI’s) Open Access to
82. A. Muik et al., bioRxiv 508818 [Preprint] (2022);
and D.P. performed ACE2 binding inhibition and S1 shedding Publications policy. HHMI lab heads have previously granted a
https://doi.org/10.1101/2022.09.21.508818.
assays. B.G. and M.A.S. evaluated effector functions. C.S.F., J.B., nonexclusive CC BY 4.0 license to the public and a sublicensable
83. A. A. Cohen et al., bioRxiv 485875 [Preprint] (2022);
and L.P performed memory B cell repertoire analysis. O.G., A.C., license to HHMI in their research articles. Pursuant to those licenses,
https://doi.org/10.1101/2022.03.25.485875.
84. D. R. Martinez et al., Science 373, 991–998 (2021). and P.F. contributed to the recruitment of donors and the the author-accepted manuscript of this article can be made freely
85. D. Li et al., bioRxiv 477915 (2022); https://doi.org/10.1101/ collection of plasma samples. J.d.I., L.S., and A.T. performed available under a CC BY 4.0 license immediately upon publication.
2022.01.26.477915. bioinformatic and epidemiology analyses. Z.L. and S.P.J.W. performed
86. L.-F. Wang et al., Research Square [Preprint] (2022); mutant selection and fitness assays. R.A., J.J., F.B., P.M., J.N., G.D.d.M., SUPPLEMENTARY MATERIALS
https://doi.org/10.21203/rs.3.rs-1362541/v1. L.K., and H.B. performed hamster model experiments and data science.org/doi/10.1126/science.adc9127
87. D. R. Martinez et al., Sci. Transl. Med. 14, eabj7125 analysis. A.A. performed the EM refolding experiments Y.J.P. prepared Materials and Methods
(2022). cryoEM specimens and collected and processed data collection. Figs. S1 to S18
88. C. G. Rappazzo et al., Science 371, 823–829 (2021). Y.J.P. and D.V. built and refined the atomic models. J.E.B. and C.S. Tables S1 to S9
89. T. Mao et al., bioRxiv 477597 [Preprint] (2022); purified recombinant glycoproteins. A.L., D.P., Y.J.P., A.D.M., Z.L., D.P., References (95–126)
https://doi.org/10.1101/2022.01.24.477597. D.C., M.S.P., and D.V. analyzed the data. A.C.W., D.P., D.C., M.S.P., MDAR Reproducibility Checklist
90. J. E. Oh et al., Sci. Immunol. 6, eabj5129 (2021). and D.V. wrote the manuscript with input from all authors. F.B., G.S., Data S1
91. S. N. Langel et al., Sci. Transl. Med. 14, eabn6868 J.N., S.P.J.W., H.W.V, M.S.P., D.C., and D.V. supervised the project.
(2022). Competing interests: D.P., A.D.M., F.Z., M.G., C.S.F., J.B., C.S., View/request a protocol for this paper from Bio-protocol.
92. A. O. Hassan et al., Cell Rep. Med. 2, 100230 (2021). H.V.D., K.H., W.R., M.A.S., G.Sc., B.G., F.B., J.d.I., A.R., J.Z., N.F., H.K.,
93. F. A. Lempp et al., Nature 598, 342–347 (2021). M.M.R, J.N., F.A.L., G.S., L.P., A.T., H.W.V., A.L., M.S.P., and D.C. are Submitted 9 May 2022; accepted 17 October 2022
94. J. Lan et al., Nature 581, 215–220 (2020). employees of Vir Biotechnology Inc. and may hold shares in Vir 10.1126/science.adc9127
G
obtained a 2.8-Å resolution cryo-EM structure
roup II introns are self-splicing retroele- element for retrotransposition (8). Compared of the E.r. group IIC intron in complex with its
ments that have played a key role in with their more evolved counterparts, group specific maturase and DNA target (Fig. 1, B
shaping eukaryotic genomes as the an- IIC RTs lack an endonuclease domain for gen- and C, and figs. S4 and S5), thereby revealing
cestors of spliceosomal introns and non– erating TPRT primers and instead exploit the the state immediately before the first step of
long terminal repeat (LTR) retroelements lagging strands at DNA replication forks (4). reverse splicing (Fig. 1A). The overall high-
(1). They remain important for gene expres- Recent structural and biochemical studies of resolution 3D reconstruction was of sufficient
sion in plants, fungi, yeasts, and many bacteria IIA and IIB introns have provided important quality to permit the modeling of individual
(2, 3). Group II introns encode a specialized insights into strategies for the maturase recog- nucleotides (movie S1) and metal ions. The
reverse transcriptase (maturase) that binds nition of intron RNA (9–11). However, availa- catalytic core that was formed by D5, the lariat
its parent intron and facilitates self-splicing, ble RNP structures have not revealed a specific branchpoint, EBS-IBS (exon binding site–intron
which releases a well-folded lariat ribonucleo- mechanistic role for the maturase during RNP binding site) sequences, and the protein thumb
protein (RNP) complex (4). The liberated RNP assembly, DNA recognition, or chemical ca- and DNA binding domain (DBD) was resolved
functions as a retrotransposon, targeting DNA talysis. At present, the mechanism by which to <3 Å.
that contains spliced exon junction sequences group IIC introns recognize DNA structures The overall structure reveals a compact as-
and inserting by means of a two-step trans- and not just DNA sequences remains unclear. sembly of intron RNA and maturase protein
esterification reaction known as reverse splicing Furthermore, there are no available structures that is closely associated with the DNA sub-
(Fig. 1A) (5). The resulting DNA-RNA chimera of the free RNP retroelement before it has strate through an extensive network of inter-
is copied into cDNA by the reverse transcriptase bound DNA. These open questions preclude actions (movie S2). The intron core adopts a
(RT) activity of the multifunctional maturase a clear understanding of group II intron similar fold to that of intron structures that
in a process known as target primed reverse retrotransposition and its evolutionary role in are derived from truncated and modified con-
transcription (TPRT) (6). Host repair pathways shaping modern genomes. To address these structs (15, 16). The tertiary interactions that
complete the downstream DNA copy-and-paste problems, we solved cryo–electron microscopy were identified in previous group II introns
steps that are needed to achieve total intron (cryo-EM) structures of a group IIC intron are present, along with several additional in-
integration (4). retroelement that was poised to undergo the teractions that are observed in this full-length
There are three main classes of group II first step of reverse splicing. intron construct that contains all six intron
introns, IIA, IIB, and IIC, which share a con- domains (Fig. 1D). The fold of the maturase
served secondary structure and a similar ter- Results resembles that of previously studied IIC pro-
tiary organization around a ribozyme active Overall architecture of an ancient group II teins (13, 17), although the thumb and DNA
site (7). Group IIC introns are an ancient class intron retroelement binding domains are now clearly resolved
of bacterial introns that recognize both the se- To investigate the mechanism of DNA inser- (Fig. 1C and fig. S5). The bound DNA contains
quence and three-dimensional (3D) structure tion, we captured a group II intron retroele- a short spacer, the intron insertion site, and a
of their DNA insertion sites (8). Unlike their ment before the first step of reverse splicing 5′ stem-loop motif that is exclusive to group
larger IIA and IIB counterparts, group IIC into DNA (Fig. 1A). We first conducted in vitro IIC introns (Fig. 1D) (18, 19).
introns are almost completely dependent on splicing reactions of the IIC Eubacterium
their maturases to facilitate intron excision rectale (E.r.) intron (12) in complex with its Features of the catalytic RNP core
through lariat formation, thereby forming the encoded maturase (MarathonRT) (13, 14) Despite extensive efforts, a complete group II
functional RNP that serves as the minimal and purified the reaction mixture to obtain a intron holoenzyme active site had not yet been
branched lariat-maturase complex (fig. S1, A visualized. In this work, we capture the com-
1
Department of Molecular Biophysics and Biochemistry, Yale to C). The purity and stability of this RNP plete ribozyme core architecture, which includes
University, New Haven, CT 06511, USA. 2Department of
complex were assessed by using biophysical hallmark elements identified in earlier bio-
Molecular, Cellular and Developmental Biology, Yale
University, New Haven, CT 06511, USA. 3Howard Hughes methods: sedimentation velocity analytical chemical and structural studies (8, 20). For
Medical Institute, Chevy Chase, MD 20815, USA. 4Laboratory ultracentrifugation and size exclusion chroma- example, we see that the 2′-5′ lariat linkage,
of Evolutionary Genetics and Genomics, The Rockefeller tography coupled to multiangle light scattering between the first intron nucleotide (G1) and
University, New York, NY 10065, USA.
*Corresponding author. Email: anna.pyle@yale.edu (SEC-MALS) indicated that the sedimentation the branchpoint A (A632), is a crucial struc-
†These authors contributed equally to this work. coefficient and molecular mass of the RNP tural motif for organizing the ribozyme core.
Fig. 3. Mechanism of maturase-facilitated ribozyme catalysis. (A) Protein positioning within the retroelement composite map. (B) Protein-D4a contact points.
(C and D). Interactions that form the RNA-protein anchor points. (E) Protein stabilization of EBS1 and EBS3 loops. (F and G) Amino acids that rigidify the EBS1 and
EBS3 loops. (H) R308 joins EBS1 and EBS3 together.
interactions begins with the nucleotide located intron achieves stable, base-pairing specificity By capping the DNA stem-loop, a set of stack-
immediately downstream of the insertion site with the DNA target. ing interactions clamp the loop terminus into
(dT36), which forms a single–base pair inter- Nucleotides within the DNA spacer partic- position within the holoenzyme. One such
action (EBS3-IBS3) with a nucleotide extend- ipate in binding the RNP, adopting an ordered interaction forms between the DNA and RNA
ing from the D1d coordination loop within the structure that engages in specific interactions loop nucleotides that project from D4, which
intron (A231) (Fig. 4F). Stacked atop this pair with the holoenzyme. Rather than forming a effectively joins the DNA stem and RNA bases
is a short helix formed through base pairings helical stack, the spacer nucleotides (dA28, into one continuous stacking network. This
between the subsequent stretch of DNA nu- dT29, dT30, and dT31) form an unusual motif extended stacking array consists of dA14 and
cleotides (IBS1: dT35, dT34, dT33, and dC32) in which the nucleotides splay in alternating A441 and U443 from D4a (Fig. 4I). This DNA-
and a second substrate-recognition loop that directions on either side of the central phos- RNA tertiary interaction is anchored in place
projects from the terminus of intron D1d (EBS1: phate spine (Pauling-like DNA), thereby expos- by an adjacent stacking network that forms
A184, A185, A186, and G187) (Fig. 4F). Similar ing a large interaction interface to the adjacent between the extrahelical dT13 residue and a
to the short codon-anticodon helix in the ribo- DBD (Fig. 4, F and H). Amino acids from the series of conserved amino acid side chains (fig.
some (34), the EBS-IBS1 duplex is further sta- DBD intercalate between the DNA spacer nu- S8), which form a sequential stack that merges
bilized through the formation of an A-minor cleotides while forming an abundance of inter- with the hydrophobic core of the protein. The
motif between A75 and the dC32-G187 base actions with both the bases and the phosphate aromatic plane of the dT13 nucleobase and
pair (Fig. 4G). The structure reveals that EBS1- backbone (Fig. 4H). For example, N3 of dT31 Trp136 (W136) flank R266 on either side,
IBS1 is not limited to four contiguous base interacts with amide oxygens of N378, whereas which creates an arginine-p stacking sand-
pairs; rather, it is extended by an additional its adjacent phosphate oxygens interact with wich configuration (35), in which each com-
base pair that is formed between the next proximal arginine residues (R381 and R382). ponent is separated by a planar distance of
consecutive nucleotide (A188) in the EBS1 loop Together, these interactions stabilize an un- 3.8 Å (Fig. 4J).
and a discontinuous nucleotide from the DNA usual backbone conformation that enables the
spacer region (dT30). Indeed, the intervening dT30-A188 pair to form atop the EBS-IBS1 helix. Retroelement primed for attack
DNA nucleotide (dT31) is extrahelical and sta- In turn, these interactions with the DBD pull To better understand molecular rearrange-
bilized by interactions with protein residues the DNA into place, which positions the spe- ments that might occur when the intron retro-
(Fig. 4H). Through these sequential stacking cialized barb-like structure formed by the a element binds to DNA substrate, we solved the
networks, which are supported by contacts helical bundle within the DBD at the base of structure of the apo-RNP, visualizing the free
with the protein (i.e., dT36O4 with K361), the the DNA stem (Fig. 4, B and H). intron-maturase complex at a resolution of
Fig. 4. Shape and sequence recognition of a DNA target. (A) Secondary (F) EBS-IBS base-pairing interactions. (G) Stabilizing A-minor tertiary
structure of the DNA target. (B) Interactions of the structured DNA with interaction. (H) Interactions between protein and single-stranded DNA.
holo-RNP. (C) Protein contacts with DNA helical stem. (D) Fit of the DNA (I and J) Intermolecular stacking interactions between DNA and (I) RNA
groove against the protein palm linker. (E) DNA and D1 backbone interactions. nucleotides and (J) protein residues.
3.6 Å (Fig. 5A and fig. S9). We observed that in retrotransposition (Fig. 5A). Upon recog- anistic role of the protein as a stabilizing
the apo-RNP has an architecture that is almost nition of the DNA stem-loop, the RNP (palm, catalytic component (Fig. 5C). Further evi-
identical to that of the complex bound to DNA, fingers, and D4a) appears to become more dence of a preformed catalytic core includes
and that substrate binding induces only mi- rigid, as we observe a concomitant increase in the persistence of the heteronuclear metal
nor changes in the structure. The RNP-active local resolution at these positions (figs. S3B ion cluster, which remains organized around
site remains completely intact (Fig. 5, A and B) and S9B and movies S5 and S6). This is remi- the lariat, although M2 is not visible in this
(9–11). The maturase does not change its orien- niscent of many protein enzymes, whereby case (Fig. 5D).
tation in the absence of DNA and remains docking of ligand into the active site freezes
coordinated at two anchor points along the out local motions and locks the substrate in Discussion
D4a arm, with the thumb and DBD inserted place. In previous ligand-free intron structures, Insights into protein-facilitated
into the active site to participate in catalysis EBS nucleotides were found to be disordered ribozyme catalysis
(Fig. 5A). In this configuration, the binding or rearranged (21, 22, 24). Here, we observe The structures presented here reveal how com-
interface for the target DNA is maintained, that the positions of the EBS nucleotides are ponents of the holoenzyme help promote activ-
which enables the RNP to readily recognize unchanged, likely due to the presence of the ity of the ribozyme core. The protein buttresses
an incoming DNA target and rapidly engage maturase. These findings reinforce the mech- the catalytic residues responsible for specifically
positioning the DNA substrate, providing a stacking moieties that involve both RNA and gages from D2 and swings 90° upward, con-
missing link in understanding how maturases protein (Fig. 4). These interactions highlight tacting D1c and a basic patch on the protein
unlock the full catalytic potential of group II the symbiotic nature of RNA and protein and thumb. Our structures do not preclude D6
intron ribozymes (Fig. 2). Interactions with underscore the multiplicity of strategies avail- helix dynamics, because there is ample space
protein residues stabilize the intron substrate- able to RNPs for achieving selective substrate for a similar movement and the regions that
recognition loops and precisely arrange nu- recognition. D6 contacts are accessible. The open archi-
cleotides for DNA binding. These interactions The DNA stem-loop motif is exclusive to tecture we observe provides a direct route
contribute to the proper orientation of reac- IIC introns, which contain an abbreviated D1 for DNA to approach the RT active site, be-
tion components throughout ribozyme cataly- scaffold and short exon recognition sequences cause it remains unobstructed by other intron
sis. Our findings provide a direct mechanistic (7). In the more highly evolved IIA and IIB domains and can readily accommodate an
role for the protein cofactor, and they help introns, the RNP binding motif that we find entire hybrid duplex for reverse transcription
explain the lowered salt and magnesium re- occupied by the DNA stem in IIC introns is (39). This suggests that initiation of RT ac-
quirements in its presence (36). instead replaced by intron insertion motif tivity, within the current holoenzyme assembly,
Prior studies, owing to resolution limitations D1d2, an RNA subdomain that includes EBS2, may be possible without marked conforma-
or construct design, were unable to identify which is absent in the IIC class (7). Comparison tional rearrangement.
a specific function for the maturase protein, of this region across intron classes suggests
except in transient D6 stabilization (9). By that EBS2 evolved to imitate the target DNA Retroelement poised to attack
contrast, we can now show that not only are stem (fig. S11). Indeed, the DNA stem motif Group II intron retroelements are prolifera-
the protein thumb and DBD proximal to D1 structurally resembles the EBS2-IBS2 inter- tive, invasive agents, and our structures explain
catalytic residues, they have critical roles in actions typical of IIA and IIB introns, and it why. The apo-retroelement is poised to react
stabilizing substrate binding. Given its anal- functionally emulates EBS2 by anchoring and does not require any reorganization of
ogous spatial placement, it is possible that the DNA substrate to the RNP. This mimicry structure upon target DNA binding. The ar-
Prp8 may play a similar role during spliceo- suggests that recognition of a structured DNA rangement of the active site, from substrate-
somal catalysis (fig. S10) (37). motif by the more primitive IIC introns was recognition nucleotides to the heteronuclear
replaced by RNA domains within the intron it- metal ion cluster to the DNA binding interface,
RNP recognition of DNA structure: An expanded self, which resulted in longer target-recognition is preserved despite the absence of DNA sub-
recognition repertoire sequences that provided greater base-pairing strate (Fig. 5). This prearranged organization is
The high-resolution cryo-EM structures we pro- specificity for the retroelement. consistent with the biological role of group II
vide here offer a glimpse into RNP strategies for introns as parasitic genetic elements (40). Use
recognizing DNA (Fig. 1B). The holoenzyme Implications for reverse splicing and of the same catalytic core from splicing to inte-
structure reveals a stem-loop DNA nestled reverse transcription gration eschews the need for major rearrange-
within the retroelement, bound to RNA and Encircled by RNA, the exterior surfaces of the ments or host cofactors and allows complete
protein. Within this cleft, the protein assists protein are enclosed, but the concave interior autonomy, which is highly advantageous for
in positioning the insertion site and aligning of the protein, adjacent to the catalytic core, a genetic parasite.
the DNA stem for steric fit against the com- is conspicuously solvent accessible, which has Total integration of the RNP requires faith-
plementary maturase surface (Fig. 3). Addition- functional implications. During reverse splic- ful and accurate reverse transcription of the
al aspects of the unusual recognition strategy ing, the D6 helix undergoes a conformational intron sequence, including the long open read-
include splayed Pauling-like DNA (38), a stab- change that places the lariat linkage into the ing frame (ORF) that encodes the protein,
ilizing A-minor motif, and intermolecular active site (9). To accomplish this, D6 disen- after insertion. This is accomplished by using
the RT activity of the multifunctional maturase. 5. H. Wank, J. SanFilippo, R. N. Singh, M. Matsuura, 42. C. R. Beck, J. L. Garcia-Perez, R. M. Badge, J. V. Moran, Annu.
MarathonRT, the protein within the holoen- A. M. Lambowitz, Mol. Cell 4, 239–250 (1999). Rev. Genomics Hum. Genet. 12, 187–215 (2011).
6. S. Zimmerly, H. Guo, P. S. Perlman, A. M. Lambowitz, Cell 82, 43. M. A. Kerachian, M. Kerachian, Clin. Chim. Acta 488, 209–214
zyme visualized here, is a well-characterized, 545–554 (1995). (2019).
robust, accurate, and ultraprocessive RT en- 7. A. M. Pyle, Crit. Rev. Biochem. Mol. Biol. 45, 215–232 44. J. Jumper et al., Nature 596, 583–589 (2021).
zyme that is capable of copying through long, (2010). 45. Y. Xiong, T. H. Eickbush, EMBO J. 9, 3353–3362 (1990).
8. A. M. Pyle, Annu. Rev. Biophys. 45, 183–205 (2016).
structurally complex templates (41). The inti- 9. D. B. Haack et al., Cell 178, 612–623.e12 (2019). AC KNOWLED GME NTS
mate association of the parent intron with 10. G. Qu et al., Nat. Struct. Mol. Biol. 23, 549–557 (2016). We thank M. Llaguno, S. Wu, J. Lin, K. Zhou, and K. Gibson (YCRC)
this protein allows access to its exceptional 11. N. Liu et al., Nucleic Acids Res. 48, 11185–11198 (2020). for help with grid preparation, sample screening, and data
12. L. Dai, N. Toor, R. Olson, A. Keeping, S. Zimmerly, Nucleic Acids collection. We thank F. Bleichert for helping with cryoSPARC data
RT properties and ensures that the intron Res. 31, 424–426 (2003). processing and Y. Xiong, K. Zhang, and C. Wang for helpful
sequence, which is pivotal to its tertiary ar- 13. C. Zhao, A. M. Pyle, Nat. Struct. Mol. Biol. 23, 558–565 suggestions. We also thank C. Zhao and O. Federova for insights
chitecture, is preserved, allowing the retro- (2016). and advice throughout this project. Funding: This work was
14. C. Zhao, F. Liu, A. M. Pyle, RNA 24, 183–195 (2018). supported by the Howard Hughes Medical Institute and the Gruber
element to continually propagate.
15. N. Toor, K. S. Keating, S. D. Taylor, A. M. Pyle, Science 320, Foundation (Gruber Science Fellowship to K.C.). Cryo-EM data
77–82 (2008). were collected with microscopes at the Yale CryoEM Resource
Implications for modern retroelements 16. R. T. Chan, A. R. Robart, K. R. Rajashankar, A. M. Pyle, N. Toor, Core that is funded in part by the NIH (S10OD023603). Funding
Study of group II intron complexes provides a Nat. Struct. Mol. Biol. 19, 555–557 (2012). for open access charge was provided by the Howard Hughes
17. A. M. Lentzsch, J. L. Stamos, J. Yao, R. Russell, Medical Institute. A.M.P. is an investigator and L.X. is a research
window into our understanding of non-LTR A. M. Lambowitz, J. Biol. Chem. 297, 100971 (2021). associate with the Howard Hughes Medical Institute. Author
retrotransposons, such as the L1 RNP, an active 18. L. Dai, S. Zimmerly, Nucleic Acids Res. 30, 1091–1102 contributions: K.C. and L.X. designed the protocol to purify
mobile element that continues to disperse in (2002). the retroelement complexes, prepared the samples, made EM
19. N. Toor, A. R. Robart, J. Christianson, S. Zimmerly, Nucleic
human genomes (42, 43). Computationally Acids Res. 34, 6461–6471 (2006).
grids, and performed biochemical assays. S.C.D. conducted
SEC-MALS experiments on purified intron complexes. K.C. and L.X.
predicted structures of ORF2p, the mobility 20. C. Zhao, A. M. Pyle, Trends Biochem. Sci. 42, 470–482 collected EM data. K.C. and L.X., with assistance from P.C. and
factor of L1, show that its RT and thumb domain (2017). S.C.D., processed the EM data. K.C. and L.X., with help from
21. A. R. Robart, R. T. Chan, J. K. Peters, K. R. Rajashankar, J.P. and S.C.D., built the atomic model. K.C., L.X., and A.M.P.
resemble that of the maturase, MarathonRT N. Toor, Nature 514, 193–197 (2014). analyzed the structure. K.C. and L.X. drafted and prepared the
(fig. S12) (44). ORF2p contains an additional 22. M. Costa, H. Walbott, D. Monachello, E. Westhof, F. Michel, manuscript. A.M.P. supervised and coordinated the group II
N-terminal endonuclease and a C-terminal Science 354, aaf9258 (2016). intron project. Competing interests: A patent application on
23. S. M. Fica, M. A. Mefford, J. A. Piccirilli, J. P. Staley, Nat. Struct. MarathonRT has been filed by Yale University. Data and materials
extension, but these domains do not block Mol. Biol. 21, 464–471 (2014). availability: All data are available in the main text and the
the exterior basic surfaces of the RT and thumb. 24. M. Marcia, A. M. Pyle, Cell 151, 497–507 (2012). supplementary materials. Cryo-EM maps are available in the
MarathonRT and ORF2p are evolutionarily 25. S. M. Fica et al., Nature 503, 229–234 (2013). Electron Microscopy Data Bank with codes EMD-26550 (holo-RNP)
26. M. E. Wilkinson, S. M. Fica, W. P. Galej, K. Nagai, Mol. Cell 81, and EMD-26549 (apo-RNP). Structural models are available in
related, and they are implicated in similar
1439–1452.e9 (2021). the Protein Data Bank with PDB accession codes 7UIN (holo-RNP)
mobility mechanisms, so it is possible that 27. O. Fedorova, A. M. Pyle, EMBO J. 24, 3906–3916 (2005). and 7UIM (apo-RNP). License information: Copyright © 2022 the
the same surfaces are used for anchoring and 28. B. Cousineau, S. Lawrence, D. Smith, M. Belfort, Nature 404, authors, some rights reserved; exclusive licensee American
substrate recognition (45). Given the lack of 1018–1021 (2000). Association for the Advancement of Science. No claim to original
29. N. Toor, G. Hausner, S. Zimmerly, RNA 7, 1142–1152 US government works. https://www.science.org/about/science-
structural information on L1 and the strong (2001). licenses-journal-article-reuse
parallels between systems, our work provides 30. R. N. Singh, R. J. Saldanha, L. M. D’Souza, A. M. Lambowitz,
a starting point for imagining how L1 might J. Mol. Biol. 318, 287–303 (2002).
31. C. Zhao, A. M. Pyle, Curr. Opin. Struct. Biol. 47, 30–39 SUPPLEMENTARY MATERIALS
assemble and function. (2017). science.org/doi/10.1126/science.abq2844
This study reveals strategies for RNP in- 32. M. Matsuura, J. W. Noah, A. M. Lambowitz, EMBO J. 20, Materials and Methods
teractions with DNA, having implications 7259–7270 (2001). Figs. S1 to S12
33. F. Michel, K. Umesono, H. Ozeki, Gene 82, 5–30 (1989). Table S1
for mechanistic understanding of the spliceo- 34. A. Lescoute, E. Westhof, Biochimie 88, 993–999 (2006). References (46–65)
some and non-LTR retrotransposons. 35. M. M. Flocco, S. L. Mowbray, J. Mol. Biol. 235, 709–717 (1994). MDAR Reproducibility Checklist
36. M. Matsuura et al., Genes Dev. 11, 2910–2924 (1997). Movies S1 to S6
37. S. M. Fica, C. Oubridge, M. E. Wilkinson, A. J. Newman,
RE FE RENCES AND N OT ES K. Nagai, Science 363, 710–714 (2019).
View/request a protocol for this paper from Bio-protocol.
1. T. H. Eickbush, Curr. Biol. 9, R11–R14 (1999). 38. L. Pauling, R. B. Corey, Proc. Natl. Acad. Sci. USA 39, 84–97 (1953).
2. J. L. Ferat, F. Michel, Nature 364, 358–361 (1993). 39. J. L. Stamos, A. M. Lentzsch, A. M. Lambowitz, Mol. Cell 68,
3. L. Bonen, J. Vogel, Trends Genet. 17, 322–331 (2001). 926–939.e4 (2017). Submitted 29 March 2022; resubmitted 10 June 2022
4. A. M. Lambowitz, S. Zimmerly, Cold Spring Harb. Perspect. Biol. 40. A. M. Lambowitz, S. Zimmerly, Annu. Rev. Genet. 38, 1–35 (2004). Accepted 17 October 2022
3, a003616 (2011). 41. L. T. Guo et al., J. Mol. Biol. 432, 3338–3352 (2020). 10.1126/science.abq2844
BACKGROUND: Fast radio bursts (FRBs) are ADVANCES: The early FRBs were discovered OUTLOOK: The diversity of FRBs continues
broadband, millisecond-duration bursts of using single radio dishes with limited spatial to expand. One FRB had emission extended
radio emission visible at cosmological dis- resolution. These instruments established over several seconds, punctuated by bursts
tances. As FRBs traverse the intergalactic me- that FRBs might be detectable to redshifts with a 217-ms periodicity. Others showed
dium, their radiation is slightly delayed by corresponding to when the Universe was only weaker evidence for faster periodicities, at
the presence of free electrons in a frequency- half its current age. However, they were un- 2.8 and 10.7 ms, which could be linked to the
dependent manner. When these delays are able to localize any FRBs to their host galaxies, rotation period of the neutron stars thought
combined with cosmological models of the dis- so their true distances remained uncertain. to produce them. The initial 12 orders of mag-
tribution of baryons in the Universe, they can In 2016, the first repeating FRB was discov- nitude in luminosity between the early FRBs
infer distances. The first FRB, the Lorimer Burst, ered, which allowed follow-up observations and pulsars in the Milky Way is being closed
was discovered in 2007. Although its radio using radio interferometers with better spa- by observations of fainter FRBs. The nature
brightness was similar to that of radio pulsars tial resolution. These showed that the repeat- of the sources and the emission mechanism
(neutron stars) in the Milky Way, its inferred ing source is situated in a small, low-metallicity remains unclear. It is possible that there are
distance was a million times greater, indicative dwarf galaxy at a distance confirming their multiple ways of producing FRBs, including
of a new class of object. cosmological nature and near a persistent from unusual locations such as millisecond
Instrumental and computational advances source of radio emission. The localization of pulsars in globular clusters.
made FRB discovery routine by the mid-2010s, the repeater thus demonstrated that the lu- New instruments are currently being con-
and there are many thousands of bursts known minosities of FRBs were extremely high. structed and commissioned that will have in-
from more than 600 unique sources. Some Improved instrumentation greatly expanded creased sensitivity. These will also localize many
FRBs arise from sources that produce multiple both the number of observed FRBs and the more FRBs to their host galaxies, increasing
bursts, separated by anything from seconds to
months, and these are known as “repeaters.”
number with identified host galaxies. Local-
izations of repeaters determined numerous
the utility of FRBs in cosmology.
▪
However, the majority of FRB sources have host galaxies and showed that repeating FRBs
never been seen to repeat. are likely to be associated with young, highly
Because most of the baryonic (normal) matter magnetic neutron stars (magnetars). Some The list of author affiliations is available in the full article online.
Email: mbailes@swin.edu.au
in the Universe is ionized, FRBs can constrain repeaters appear to have cyclic activity win-
Cite this article as M. Bailes, Science 378, eabj3043
the total baryonic content of the Universe. The dows, which is consistent with an orbit, or pos- (2022). DOI: 10.1126/science.abj3043
discovery of FRBs raised two scientific ques- sibly a precession, of the source. The degree
tions: (i) what produces them? and (ii) what of linear polarization of repeaters is strong- READ THE FULL ARTICLE AT
can they tell us about the Universe? ly frequency dependent, indicating that they https://doi.org/10.1126/science.abj3043
Repeater shown Eight new FRBs used to measure Periodic Catalog of 217 ms
Cumulative number of FRBs detected
to be in a highly repeaters the baryonic fraction repeaters over 500 FRBs “period”
magnetic environment identified of the Universe identified released seen
2001 2006 2007 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023
Rotating Lorimer Burst Second Lorimer Four new First FRB Polarized FRB First Repeater FRB traced to
radio discovered in Burst-like pulse bursts found, detected using detected, repeating host galaxy a magnetar in
transients archival data identified FRB name a different population FRB identified the Milky Way
discovered adopted telescope increases
Timeline of some important breakthroughs in FRBs. The blue graph indicates the cumulative number of FRBs detected (~800, including some bursts from
repeaters). Source: HeRTA: FRBSTATS online catalog.
F
bright source was illuminating the sidelobes of
ast radio bursts (FRBs) are millisecond The study of radio pulsars has been advanced multiple beams or there was an unusual form
flashes of radio waves from distant as- by discoveries of unusual objects, usually in of radio interference (Fig. 1B).
tronomical sources. The first FRB (1), large-scale surveys (2, 10, 11). A new class of I was observing at the Parkes telescope on
later named the Lorimer Burst, was dis- pulsar-like objects, the rotating radio tran- an unrelated project with Lorimer and be-
covered in 2007, some 40 years after the sients (RRATs) were discovered in 2006 using came involved in diagnosing the putative dis-
discovery of radio pulsars (2). As was the case the Parkes Multibeam Receiver (12), a 13-pixel persed radio source. We extracted the relevant
with pulsars, its discovery was completely ser- radio camera that was used in multiple pulsar burst data and displayed them as waterfall
endipitous. The burst swept across the 288-MHz surveys (6, 7, 13, 14). RRATs (15) were initially plots, which show the pulse energy as a func-
passband of the radio receiver in about a third interpreted as an atypical type of pulsar that tion of both time and frequency (23, 24). We
of a second, consistent with emission from a only rarely emitted pulses, albeit always in found that the source had a dispersion sweep
distant extraterrestrial source, with the ra- phase with a neutron star’s rotation period. similar to those of pulsars, with evidence of
dio waves subsequently dispersed by pas- This was unlike radio pulsars, which usually radio frequency–dependent multipath inter-
sage through an ionized plasma (Fig. 1, D and emitted regular pulsations with each rotation. stellar scattering (which scales as n–4), as is
E). It struck the Parkes 64-m radio telescope In 2007, searches were underway to find more often seen in observations of pulsars (25)
in Australia just after 5:50 a.m. local time on examples of RRATs (16–18). (Fig. 1, D and E). Further investigation showed
25 August 2001, and was automatically ar- Like pulsars, RRATs exhibit a radio frequency– that the burst had saturated the receiver in the
chived onto magnetic tape as part of a radio dependent delay that appears as a sweep on beam closest to the source’s location (beam 6
pulsar survey. It remained undiscovered for the radio receiver. This arises because radio in Fig. 1B), which have limited dynamic range,
>5 years. This Review examines its serendip- waves travel slightly slower in the ionized causing an algorithm designed to remove in-
itous discovery, the subsequent demonstra- interstellar medium than the speed of light terference to replace the burst with synthetic
tion that it was part of a previously unknown in a vacuum (c). The speed is determined by data. If the instrument had not been sensitive
class of astronomical source, and the cosmo- the radio frequency (n) and the density of free to strong signals in multiple beams, then the
logical implications. electrons (Fig. 1A). By the time a broadband burst would never have been found. Dis-
radio pulse arrives at Earth, this frequency- abling the interference rejection algorithm
Discovery of the Lorimer Burst dependent delay leads to a well-defined sweep and reprocessing the archived data showed
The discovery of FRBs became possible because in which the higher radio frequencies arrive that the burst was >100 times the survey’s de-
of the development of high-time-resolution before the lower ones (shown in Fig. 1C for tection threshold, with an estimated flux den-
radio instrumentation and software tools, PSR J1707–4053). A radio pulse’s dispersion sity of 30 jansky (Jy) (Fig. 1, D and E). The
L
which are mainly used for pulsar surveys. measure, DM ≡ ∫0 ne dL, is the integrated col- burst was bright enough to be visible in four of
Radio pulsars are rapidly rotating, highly umn density of free electrons along the line the 13 beams (26, 27).
magnetized neutron stars that emit beams of of sight, where ne is the local free electron The estimated source distance placed it well
emission, which appear to pulse as the neu- density in cubic centimeters, L is the dis- beyond the SMC (the target of the survey); it
tron star rotates (2–5) in a manner similar to tance to the source in parsecs (pc), and DM is appeared to be at cosmological distance (1). In
a lighthouse. By 2007, more than half of the the dispersion measure expressed as parsecs the voids between galaxies, free electron den-
known pulsars had been discovered using per cubic centimeter. The difference in the sities (22) are ~1 m–3. This makes the source
the Parkes 64-m telescope (Fig. 2A) as a re- arrival times (t2 – t1) between two radio waves distance equivalent to ~1 Mpc for each 1 pc cm–3
sult of its low radio interference environment of frequencies n2 and n1 is approximately as of the DM after removing the Milky Way fore-
and access to the Southern Hemisphere sky, follows (19): ground. Thus, the DM of ~375 pc cm–3 indi-
where most pulsars reside (6–9). cated a distance of ~1 Gpc; for comparison,
the Milky Way is ~30 kpc across and the SMC
Centre for Astrophysics and Supercomputing, Swinburne 1 1
University of Technology, Hawthorn, Victoria 3122, Australia. t2 t1 ≈ 4:15 DMms ð1Þ is at a distance of ~60 kpc. To explain the ob-
Email: mbailes@swin.edu.au n2 2 n1 2 served brightness at such a distance, the source
Fig. 1. FRB dispersion and the location of the Lorimer Burst. (A) Conceptual threshold in beams 7 and 13, and was weakly detected in beam 12 (27). The
illustration of how dispersion delays the time of arrival at Earth. As radio waves cross indicates the inferred burst position (1). (C) Observed dispersion sweep of
encounter free electrons, they become delayed in a radio frequency–dependent the pulsar PSR J1707–4053 with DM = 360 pc cm–3 and its de-dispersed pulse
manner. The more energetic (higher-frequency) radio waves (blue) experience profile (inset) (125). (D and E) Dispersion sweep and integrated pulse profile
less delay than the lower energy waves (red). This leads to a characteristic (inset) of the Lorimer burst at DM = 375 pc cm–3 in sidelobe beam 13 (D) and
sweep observed in FRBs and pulsars. (B) Pointing of the Parkes 13-beam receiver beam 6 (E). The dip in flux after the burst in beam 6 is an instrumental artifact
just south of the edge of the SMC at the time of the observation of the caused by saturation. (F to K) Inferred evolution of the Lorimer Burst’s
Lorimer Burst (1). The burst-saturated beam 6, was well above the detection dispersion over cosmic time. T0 is the time of emission.
would have to be about a trillion times more (Fig. 3). The implied radio energy emitted in of 1187 pc cm–3, but that was only identified
luminous than any known pulsar. Alterna- the 5-ms-duration burst was similar to all the years later.]
tively, the source could have been enshrouded power the Sun emits over a month. If the source repeated, then it would pro-
in a highly ionized plasma in its host environ- The burst was well above the survey detec- vide more confidence in its celestial origin,
ment, leading to a spurious distance estimate. tion threshold. In extragalactic surveys, a ho- but 40 hours of follow-up observations at
There is a subclass of high-magnetic-field and/or mogeneous isotropic cosmological population Parkes saw nothing (1). It appeared that the
short-period pulsars that are known to occa- follows the relation d log N/d log S = –3/2, burst was either (i) a one-off hyperluminous
sionally emit highly energetic radio pulses, where N is the number of sources above a flux flash of radio waves from the distant Universe
which might have been linked to the burst. density S. This arises because the volume sur- a trillion times more luminous than known
The Crab Pulsar, a young and highly magne- veyed expands as the distance D3, whereas radio transient bursts and requiring improb-
tized neutron star, occasionally produces these each object’s flux density follows the inverse able survey statistics or (ii) some obscure form
giant pulses, individual radio flashes that can square law D–2. For every Lorimer Burst, there of radio interference. We decided that the
be much brighter than the mean energy of should be many (perhaps dozens) of fainter pulse’s well-defined sweep with frequency was
its average pulse. However, even the brightest bursts present in the survey data. There did sufficient to conclude that it was celestial,
Crab Pulsar giant pulses were about a trillion not appear to be any. [A FRB search (28) found so we submitted a paper summarizing our
times less energetic than the putative burst another FRB in the same dataset, with a DM findings (1). The event soon became known
Fig. 2. Seven radio telescopes and an example FRB detected at each tele- observed using the UTMOST real-time data capture system (77, 126). (D) The
scope. Insets show the intensity of each burst as a function of time (integrated core of the 36-antenna ASKAP telescope. The inset shows the four-component
profiles). FRBs with complex frequency structure [(B′) and (E′)] also have FRB 181112, which has narrow temporal features (78). (E) The cylindrical
waterfall plots beneath their integrated profiles. (A) The Parkes 64-m telescope 4 × 20 m wide × 100 m long CHIME telescope and a 3-s-long FRB 20191221A that
and the Lorimer Burst FRB 010724 (1) (inset). (B) The 305-m Arecibo exhibited a 216.8-ms periodicity (88). (F) The 500-m FAST telescope and the
Observatory and one burst from the repeating FRB 121102 (73). The burst three-component FRB 181123 (127). (G) The STARE2 telescope and the Galactic
exhibits a downward-drifting frequency effect as a function of time. Frequencies FRB 200428, which was emitted by a magnetar during an x-ray flare (86).
run from low to high in the vertical direction. (C) The 1.5-km-long Molonglo [Photo credits: J. Sarkissian (A), F. Camilo (B), C. Flynn (C), K. Steele
telescope and FRB 170827, which has an extremely narrow temporal structure (D), M. Bailes (E), Di Li (F), and S. R. Kulkarni (G).]
as the “Lorimer Burst,” now also designated mological probe. The DM contains informa- wave oven ~100 m from the Parkes dish (34),
FRB 010724. tion on the number of free electrons along its raising further doubts. Was the Lorimer Burst
path. Most of the Universe’s baryonic (normal just a similar form of radio interference?
Implications of the Lorimer Burst atomic) mass is not in galaxies, but between In 2012, another search of the Parkes Multi-
The apparent luminosity of the Lorimer Burst them in the intergalactic medium (IGM). The beam Pulsar Survey found a potential Lorimer
was very high, but there were few clues as to bulk of the IGM mass is in hydrogen and he- Burst–like signal (35) with a DM of 745 pc cm–3,
what may have caused it. There was only an lium, which do not retain their electrons be- although it was uncertain whether it originated
upper limit (≤5 ms) on the intrinsic width of cause they are ionized by ultraviolet light. An outside of the Galaxy (36). The celestial and
the burst due to a combination of instrumen- FRB can therefore act as a free electron (and cosmological nature of these dispersed radio
tal broadening and radio wave scattering. Re- hence baryon) counter between the host gal- signals was therefore uncertain.
quiring the emission region to be causally axy and Earth (Fig. 1, F to K). Localized FRBs
connected (within 5 ms of travel time at the could potentially constrain the total mass of 2013: A cosmological population
speed of light) set an upper limit on its size of IGM, a quantity with controversial measure- In 2008, three pulsar and radio burst surveys
≤1500 km. Such distance scales are consistent ments using other methods (29). commenced at Parkes, called the High Time
with the dimensions of the rotating magnetic Resolution Universe (HTRU) surveys (37).
fields seen in rapidly rotating neutron stars, The hunt for more FRBs These used multibeam anti-coincidence detec-
shocks from explosions emanating from rela- Attempts were made to find more bursts, both tion methods (38) that proved effective at re-
tivistic objects, or collisions between neutron from existing archival data and by initiating moving terrestrial near-field interference. In
stars and other compact objects (neutron stars surveys that specifically targeted FRBs. How- 2013, one of the HTRU surveys found four
or stellar-mass black holes). ever, none of the early efforts was successful. radio bursts (39), the brightest of which had
Radio telescopes observe a small fraction of Many groups searched archival data, finding a DM almost three times that of the Lorimer
the sky, so initial estimates of the FRB event some additional RRATs (18, 30), but no events Burst that followed the same n–2 dispersion
rate were hundreds per day for FRBs as bright similar to the Lorimer Burst were found. Sur- and n–4 scattering power laws with radio fre-
as the Lorimer Burst (1) and 10,000 d–1 for veys specifically designed to find new bursts quency. This demonstrated that fainter and
fainter bursts that were still above the detec- (31, 32) also initially did not detect any. It was higher-dispersion (more distant) bursts ex-
tion limit of large radio dishes. The implied discovered that the Parkes Radio Telescope isted, implying that the Lorimer Burst was
rate in a given cosmological volume was sim- receiver was often struck by quasidispersed part of a cosmological population. The term
ilar to that of supernovae: about once every radio pulses that were present in all 13 beams “fast radio burst” and the acronym FRB were
few decades in a normal galaxy. of the multibeam receiver, some of which had coined at that time. A system of nomenclature
If its origin could be determined, then the dispersion similar to the Lorimer Burst (33). was adopted, designating each burst FRB
Lorimer Burst had potential for use as a cos- These were shown to be caused by a micro- followed by numerals indicating the date it
never repeat, and many of the events are ex- of observation (44, 60). However in 2016, haps the persistent radio source was an ac-
pected to be associated with star-forming gal- FRB 121102, then the only FRB detected using creting intermediate mass black hole or nearby
axies, which have large numbers of massive stars Arecibo, was found to repeat, producing many supernova remnants powered by young neu-
and high supernova rates. Cataclysmic models repeat bursts in a single observing session tron stars produced by recently exploded stars?
invoking decelerating blast waves (52) predicted (61). It was nicknamed the repeater (later Follow-up observations of the repeater de-
unresolved FRBs with radio bandwidths dn/n ~ 1, known as R1). tected 93 further bursts (70, 71) between 4 and
similar to the bandwidths of the receivers used In follow-up observations of FRB 121102, 8 GHz. These observations showed that, in
in many radio telescopes, whereas models 10 additional bursts were discovered, two its rest frame, FRB emission could extend to
invoking the magnetospheres of relativistic ob- on 1 day, then eight on another, with six ap- almost 10 GHz, but often with small fractional
jects could contain finer temporal and band- pearing during a 10-min period. On other bandwidths. The repeater has a rotation mea-
limited spectral features (49), as exhibited in days, no bursts were seen (61). The repeater’s sure of ~105 rad m–2, among the highest known
the giant pulses from energetic pulsars. discovery ruled out the cataclysmic models, for any astronomical source (72). This implied
The second class of model was noncataclys- at least for for repeating FRBs. The bursts from that it was in a highly magnetized environ-
mic, so it could allow FRBs to repeat. Giant FRB 121102 also appeared to come in clumps, ment, similar to the Galactic Center of the
pulses are the very bright (≳100 times the unlike giant pulses from pulsars, which are Milky Way, which contains a supermassive
mean flux density) single pulses emitted by more random (56, 62). black hole.
high-magnetic field young pulsars, including FRBs from the repeater appeared to be Subsequent observations using broadband
the Crab Pulsar (53) and PSR J0540–6919 (54), subtly different than the nonrepeating FRBs receivers (73) demonstrated that the repeater’s
which rotate at ~20 to 30 Hz. Millisecond pul- observed with Parkes and the GBT. Bursts emission is often limited in frequency extent,
sars rotate at up to 700 Hz, and two examples from the repeater often had multiple compo- with emission confined to the same finite ra-
that emit giant pulses are PSR B1937+21 (55) nents and were broader in temporal extent dio bands for extended periods, which must be
and PSR J1823–3021A, which is located in a (~5 versus ~1 ms). These components were instrinsic to the source. Monitoring of the ro-
globular cluster (56). FRBs are >1 billion times often confined to small fractional bandwidths tation measure has shown it varies over years,
the luminosities of the most luminous giant (dn/n ~ 0.2), with emission within each burst dropping to two-thirds of its original value, in-
pulses from the Crab Pulsar, although it has drifting to lower radio frequencies (Fig. 2B′). dicating a rapidly evolving magnetic environ-
been suggested that FRBs could be a related This behavior had been predicted for radio ment (74).
phenomenon producing much rarer super- emission from magnetars (63) before any FRB Questions posed by the discovery of the re-
giant pulses (49) from highly energetic pul- had been discovered. The emission has been peater were: Do all FRBs repeat if observed for
sars. The origin of the giant pulses is unclear, described as being like a sad trombone, with long enough? Are there two classes of FRB, re-
but if a pulsar’s propensity to emit a giant pulse multiple notes each progressively lower in peaters and nonrepeaters? If every FRB source
depends upon its magnetic field and spin pe- tone (64). emits millions of FRBs (or more), then the for-
riod, then there could be extremely magnetic The repeater’s active periods provided an mation rate of the sources could be very low,
and rapidly spinning neutron stars in the Uni- opportunity for follow-up with interferom- so the sources could potentially be highly exotic
verse (called millisecond magnetars) that could eters to determine a precise location suitable objects that are unknown from observations of
emit numerous FRB-like pulses, albeit for a for the identification of host galaxies. During the local Universe.
very short time (less than a year) before they one such active period, the realfast (65) instru-
exhaust their rotational kinetic energy. If this ment on the Very Large Array (VLA) interfer- 2017–2022: The FRB age of discovery
model is correct, then FRBs would not be one- ometer detected an FRB (66) and localized it to Most of the early FRBs were found with stan-
off sources and would preferentially be lo- near a persistent radio source and faint optical dard radio pulsar search instrumentation. Once
cated in the spiral arms of star-forming galaxies companion. Subsequent very long baseline in- the cosmological population was established,
(like young pulsars), possibly inside supernova terferometry further localized it to its host plans were made to accelerate the discovery
remnants. They might also exhibit an under- galaxy (67) and showed that it was situated rate using large field of view instruments. Some
lying quasi-periodicity, like giant pulses, which coincident with the persistent radio source FRBs, such as the Lorimer Burst, were so bright
tend to appear at particular rotation phases. (68). The host was a tiny dwarf galaxy con- that they should have been detectable by small
Magnetars (neutron stars with high magnetic taining 40 million solar masses (M⨀) in stars dishes. Although small telescopes have much
fields) would be expected in star-forming re- and gas, with a high specific star-formation lower sensitivity, they also have wider fields of
gions, but millisecond pulsars are known to rate of ~0.4 M⨀ year–1, with elemental abun- view than large dishes and are less expensive to
occur both within globular clusters and the dances (metallicity) showing that it is still build and operate. Purpose-built FRB facilities,
disks and halos of galaxies (57), because their undergoing its first wave of star formation. both large and small, were constructed.
rotational kinetic energy is sufficient to power The repeater’s host galaxy was very similar to The UTMOST upgrade (Fig. 2C) of the large
them for more than the age of the Universe. those of many long-duration gamma-ray bursts cylindrical Molonglo Observatory Synthesis
Some models did not fit into either category, and superluminous supernovae (69). Both of Telescope (MOST) allowed an interferome-
such as those implying that FRB sources are those types of transient are associated with ter to identify FRBs in a blind survey (75). The
within the Milky Way with spurious DM, such young massive stars of low metallicity. The Australian Square Kilometre Array Pathfinder
as flare stare models (58, 59). Although these redshift (z = 0.193) (67), and hence distance, (ASKAP) array (Fig. 2D) added an incoherent
models greatly reduced the required intrinsic of the repeater’s host galaxy removed all re- fast sampling mode to the 30-square-degree
luminosities, they required an alternative ex- maining doubt that FRBs were at cosmolog- field of view (provided by its phased array
planation for the dispersion of the pulses, ical distances. FRB 121102 was at a distance feeds) and began detecting FRBs routinely,
necessitating a fine-tuned physical model to of 972 Mpc, close to the maximum estimated finding 20 in a fly’s eye survey (76). The phased
produce the observed dispersion sweep. for the Lorimer Burst (1). array feeds removed the degeneracy between
The association with the persistent radio FRB flux and (usually unknown) position in
Discovery of repeating FRBs source raised several questions. Was the persist- the primary beam, enabling measurements of
Searches for repetition of the FRBs detected ent source enabling the FRB emission, caused absolute flux densities for one-off FRBs. The
using Parkes found none after >100 hours by the FRB, or merely coincident with it? Per- nearby high-flux FRBs detected with ASKAP
were shown to be local versions of fainter sists (Fig. 3). The definition of what constitutes was found, and the high repetition rate means
FRBs detected by the more sensitive Parkes an FRB is also becoming blurred. Early obser- that the radio emission mechanism must be
dish in the more distant Universe (76). The vations of FRBs were often temporally smeared very efficient. The DM of the repeater is increas-
expected d log N/d log S = –3/2 flux density by the instrument and had approximately milli- ing, not decreasing, as would be expected if it
distribution was beginning to be consistent second durations; however, as instrumenta- were at the center of an expanding supernova
with a cosmological population. tion improved, both intrinsically narrower and remnant (101, 102).
Many of these purpose-built facilities had the broader FRBs were observed. Periodic emission Another repeater was found with a DM of
ability to buffer and store the raw data when (88) has been reported in an unusually long only 87 pc cm–3, associated with the spiral gal-
an FRB occurred, which was determined auto- ~3-s burst of radio emission, with periodic spikes axy Messier 81 (M81) at a distance of ~3.6 Mpc
matically in real time. This enabled microsecond- at separations of 216.8 ms (Fig. 2E′). Two other (92). Interferometry showed that it is almost
time-resolution studies of FRB profiles, which FRBs have potential periodic emission with certainly associated with a globular cluster in
revealed detailed microstructure down to only periods of 2.8 and 10.7 ms (88). Do these reflect M81. Most of the dispersion for this burst arises
a few tens of microseconds (77, 78) (Figs. 2, C′ the rotation periods of neutron star hosts, or from the foreground Milky Way and within
and D′). These short time scales indicate that are FRBs similar to some radio magnetars that M81, not the intergalactic medium. This FRB
the emission occurs on subkilometer scales, often exhibit spiky emission (89)? is only about 0.4% of the distance to the orig-
consistent with gaps in neutron star magneto- inal repeater, of similar brightness, and thus
spheres (79). Repeaters galore about five orders of magnitude less luminous.
The Canadian Hydrogen Intensity Mapping CHIME detected a second repeater, FRB 20180814A, Globular clusters do not contain young stars,
Experiment (CHIME) telescope in Canada which has a low DM of 189 pc cm–3, indicating a and any magnetars formed in the first wave of
(Fig. 2E) has a very wide field of view (~200 distance of only 350 Mpc (82). The detections star formation are expected to have become
square degrees) and high instantaneous sen- increased so rapidly that there were soon an- inactive long ago. If this repeating FRB is also
sitivity (collecting area of 8000 m2). This is other 17 repeaters (83, 84). In its first year of produced by a magnetar, then it might have
complemented by the ASKAP interferometer’s operation, CHIME detected a total of 18 re- been formed recently, either by the collapse of
sub-arc-second localizing capabilities and the peaters (3.7%) and 474 FRBs that were not an accreting white dwarf or by the merger of
even higher sensitivity provided by the 500-m seen to repeat (96.3%) (90). The repeating FRBs two neutron stars (92). The FRBs might alter-
Five-Hundred Meter Aperture Spherical Tele- have narrower fractional radio bandwidths natively arise from a millisecond pulsar, which
scope (FAST) dish (Fig. 2F). A very different and are wider than one-off FRBs (91). Follow-up are abundant in globular clusters and are known
approach was taken by Survey for Transient interferometric observations (92) demonstrated to emit giant pulses (56, 103). Follow-up ob-
Astronomical Radio Emission 2 (STARE2), that one of these repeaters (FRB 20180916B) servations of this source found burst storms,
which operates three 20-cm coaxial feeds (Fig. was emitted from within a nearby spiral galaxy in which it emits an FRB more than once per
2G), which have less than a millionth of FAST’s at a redshift of z = 0.0337 (~170 Mpc). This FRB minute, but with no associated periodicity (104).
collecting area but view the entire sky. was six times closer than the original repeater Unlike some of the repeaters that show dis-
CHIME (80) is a fixed 4 ×100 m long × 20 m (R1) and less luminous that previously observed persion measure variations, this source has a
wide cylindrical interferometer that forms extragalactic FRBs. stable DM (104), consistent with the expected
1024 coherent beams over the sky. Its FRB sub- Analysis of the repeater FRB 180916B showed environment within a globular cluster.
project CHIME/FRB searches for dispersed the bursts were all received in a 5-day-wide win-
radio pulses almost continuously from 400 to dow that recurred every 16.35 days, with more
800 MHz, scanning the entire northern sky every than half concentrated in a narrower 0.6-day-
day. The CHIME/FRB average detection rate wide window (93). This motivated searches for
(a few per day) has rapidly increased the cat- periodicities in other repeaters. R1’s bursts
alog of known FRBs, which now has >600 unique were then shown to be consistent with a 157 to
sources. CHIME observations have provided in- 161 d periodicity with a broader fractional ac-
sights into FRB emission at low (400 to 800 MHz) tivity cycle (~50%) (94, 95). A consistent pe-
radio frequencies (81) and identified a large riodicity usually indicates either two stars in
number of repeaters (82–84), many of which an orbit or precession, the reorientation of a
were localized with other facilities. spin axis (tracing out a conical shape). This led
In early 2020, CHIME detected two FRB-like to the suggestion that repeating FRBs were
bursts of emission (85) from the Galactic mag- magnetars orbiting other active (massive?)
netar SGR 1935+2154 separated by only 30 ms. stars in such a way so that they are only ob-
Just a second earlier, STARE2 also detected a servable at certain orbital phases (96). This
millisecond-duration radio burst (86) (Fig. 2G′) model received some support when the radio
at 1.4 GHz. The time delays between the two frequency of bursts from repeating FRBs was Fig. 4. Repeating FRB orbital model. In this
instruments were consistent with the delay shown to be (orbital?) phase dependent, with repeating FRB model (99), a massive star’s stellar
caused by pulse dispersion. These radio bursts the lower-frequency FRBs coming later in the wind (blue arrows) causes an orbiting (with a period
were coincident with an x-ray burst from the cycle than the high-frequency ones (97, 98). of weeks to months) magnetar (small black dots)
magnetar (87). Although the radio luminosity Others (99) have suggested that repeating FRBs to emit FRBs. The interaction between the stellar
of the burst was 30 times weaker than the least might be induced by material streaming past wind and the magnetar wind produces cavities (cyan
luminous FRB then known, it demonstrated magnetars. These types of models are illus- shading) separated by a shock front (cyan lines).
that magnetars could emit FRB-like emission. trated in Fig. 4. The cavity preferentially emits high-frequency FRBs
At least some FRBs, and possibly all, are emitted Observations with FAST (Fig. 2F) detected (blue and green wavy arrows) at the leading edge
from magnetars. 1652 FRBs from the original repeater in and lower-frequency FRBs (red wavy arrows) in
The initial trillion-fold luminosity gap be- <60 hours of observation time (100). During its the trailing sections. This model is an attempt to
tween the Lorimer Burst and Galactic pulsars most active observed period, the repeater was explain both the activity windows of some repeaters
has gradually closed, although a gap still per- bursting on average every 30 s. No periodicity and their radio frequency time dependence.
A very high DM = 1205 pc cm–3 repeating possibly resolving the difficulty in locating all Determining the locations of ~100 FRBs should
FRB observed with FAST was subsequently of the baryons using other methods (29). provide sufficient information on their host
localized to a galaxy (105), which is much closer The sheer numbers of FRBs detected by galaxies to constrain the progenitors. My lead-
than the intergalactic DM model suggested, CHIME are providing other insights into the ing contenders for the repeaters are magnet-
implying that the host galaxy must be con- population. Analysis of the catalog of detected ars, with some in orbit around massive stars,
tributing ~75% of the total dispersion. Like the FRBs (90) found that the DM and flux density whereas nonrepeaters seem more likely to
original repeater, this FRB is associated with a distributions are consistent with a cosmological be rare giant pulses from high-magnetic field
persistent radio source that is probably related population and with the large-scale structure of (~109 G?) or recently spun-up millisecond pul-
to the anomalous DM. This source demon- galaxies in the Universe (114). sars. Both magnetars and millisecond pulsars
strates the potential pitfalls of assuming that FRB dispersion measures and host galaxy experience magnetic field reconfigurations
the DM reliably predicts distances. redshifts have been used to independently de- (Fig. 5) leading to changes in radio pulse shape
The linear polarization fraction of repeating rive the value of the Hubble constant (H0), the changes. In magnetars, this can produce high-
FRBs was shown to be strongly radio frequency rate at which the expansion velocity of the Uni- energy outbursts (116)—and in one case, a low-
dependent, as predicted if their radio waves are verse increases with distance. With a limited luminosity FRB (85, 86). Could these magnetic
scattered in a highly variable magnetic environ- sample of nine FRBs with redshifts, a value of reconfigurations be a common trigger for FRB
ment (106). At lower frequencies, radio waves H0 = 62 ± 9 km s–1 Mpc–1 has been deduced production? In millisecond pulsars, these re-
experience more variable Faraday rotation, lead- (115), albeit with some possibly optimistic as- configurations are extremely rare, and of the
ing to the observed systematic depolarization. sumptions about the (contaminating) host few hundred known millisecond pulsars, only
galaxy DM contributions. This is less precise a few have been seen to exhibit them, includ-
Host galaxies and cosmological applications than other methods; improvements will re- ing PSR J1713+0747 (117). If this model is cor-
Advances in instrumentation have enabled in- quire eliminating FRBs with high local DM rect, then eventually all FRBs might repeat,
terferometers to determine the precise loca- contributions, possibly by examining their but we might have to wait decades or more to
tions of one-off FRBs, identifying their host intrinsic widths and scattering or by charac- observe them.
galaxies (107–109), as well as following up re- terizing their host galaxy environments. I expect that progress in the field will be
peaters. A study of six repeating and 10 non- strongly linked to new facilities coming online
repeating FRBs with known host galaxies and Current status and future prospects in the next decade. The MeerTRAP (118) exper-
redshifts (ranging from z = 0.008 to 0.66) So what are FRBs? My personal view is that, iment is predicted to detect and localize FRBs
found that there was no statistically signif- like many new classes of object, FRBs will ul- at higher distances. The CRACO (Commensal
icant difference between their host galaxies timately be shown to be composed of one or Real-time ASKAP Fast Transients Coherent)
(110). However, the same study found that two dominant sources, but there could be other upgrade to the ASKAP interferometer (set to
FRBs are rare in elliptical galaxies, being more rarer classes of source with the right combina- become operational in late 2022) will coher-
common in galaxies that are experiencing at tion of magnetic field, rotation, gravity, and ently add the signals from the inner 30 an-
least some star formation (110). One-off FRBs accelerated charged particles to generate FRBs. tennas to improve the FRB localization rate by
are less common in galaxies with high star for-
mation rates per unit mass, unlike long gamma-
ray bursts, which are often associated with
low-metallicity, low-mass hosts and produced
by exploding massive stars. Nonrepeaters also
appear to have different host galaxy proper-
ties to core-collapse supernovae (110). This is
inconsistent with unification models pro-
posing that all FRBs are from young magnetars
produced in recent supernovae. Could non-
repeaters be produced by neutron stars reac-
tivated long after their formation? One potential
reactivation mechanism is mass transfer from
a companion star. That process is known to
produce millisecond pulsars, some of which
emit giant pulses. Neutron stars in binaries
accrete mass and gain angular momentum
when their companions exhaust their fuel and
swell up during stellar evolution. The length
of the delay between neutron star birth and
this accretion depends upon the mass of the
companion star; it can be between 1 Myr and
>1 Gyr. Millisecond pulsars could explain the
host properties of one-off FRBs but not their
lack of repetition.
Enough FRB host galaxies have been deter-
mined to derive an FRB redshift–DM relation
(111) (also known as the Macquart relation).
The observed relation is consistent with the Fig. 5. Magnetar FRB emission model. Reconfiguration of the intense magnetic fields around a magnetar is
total mass of baryons inferred by studies of associated with high-energy outbursts. In this model for FRB generation, reconfiguration of the magnetic field
the cosmic microwave background (112, 113), releases relativistic particles that generate coherent radio emission in the magnetosphere, possibly producing FRBs.
an order of magnitude, whereas the Deep Syn- 10. R. A. Hulse, J. H. Taylor, Discovery of a pulsar in a binary 35. E. F. Keane, B. W. Stappers, M. Kramer, A. G. Lyne, On the
optic Array (DSA 110) (119) (also coming in late system. Astrophys. J. 195, L51–L53 (1975). doi: 10.1086/181708 origin of a highly dispersed coherent radio burst. Mon. Not. R.
11. D. C. Backer, S. R. Kulkarni, C. Heiles, M. M. Davis, Astron. Soc. 425, L71–L75 (2012). doi: 10.1111/j.1745-
2022) is predicted to localize almost one FRB W. M. Goss, A millisecond pulsar. Nature 300, 615–618 3933.2012.01306.x
per day. The CHIME/FRB outrigger project is (1982). doi: 10.1038/300615a0 36. K. W. Bannister, G. J. Madsen, A Galactic origin for the fast
deploying additional cylinders to enable local- 12. L. Staveley-Smith et al., The Parkes 21 CM multibeam radio burst FRB010621. Mon. Not. R. Astron. Soc. 440,
receiver. Publ. Astron. Soc. Aust. 13, 243–248 (1996). 353–358 (2014). doi: 10.1093/mnras/stu220
ization. The Canadian Hydrogen Observatory doi: 10.1017/S1323358000020919 37. M. J. Keith et al., The High Time Resolution Universe
and Radio-transient Detector (CHORD) (120) 13. R. T. Edwards, M. Bailes, W. van Straten, M. C. Britton, The Pulsar Survey. I. System configuration and initial discoveries.
will be an array of 512 6-m dishes supported by Swinburne intermediate-latitude pulsar survey. Mon. Not. R. Mon. Not. R. Astron. Soc. 409, 619–627 (2010). doi: 10.1111/
Astron. Soc. 326, 358–374 (2001). doi: 10.1046/j.1365- j.1365-2966.2010.17325.x
outrigger stations that will enable rapid lo- 8711.2001.04637.x 38. J. Kocz, M. Bailes, D. Barnes, S. Burke-Spolaor, L. Levin,
calization of FRBs and should be operational 14. R. N. Manchester, G. Fan, A. G. Lyne, V. M. Kaspi, F. Crawford, Enhanced pulsar and single pulse detection via automated
some time in the mid 2020s. Farther in the fu- Discovery of 14 radio pulsars in a survey of the magellanic radio frequency interference detection in multipixel feeds.
clouds. Astrophys. J. 649, 235–242 (2006). doi: 10.1086/ Mon. Not. R. Astron. Soc. 420, 271–278 (2012). doi: 10.1111/
ture, instruments including the DSA 2000 (121)
505461 j.1365-2966.2011.20029.x
(circa 2027) plan to localize hundreds of FRBs 15. M. A. McLaughlin et al., Transient radio bursts from rotating 39. D. Thornton et al., A population of fast radio bursts at
per day and the Square Kilometre Array (122) neutron stars. Nature 439, 817–820 (2006). doi: 10.1038/ cosmological distances. Science 341, 53–56 (2013).
(from 2030) is expected to probe high-redshift nature04440; pmid: 16482150 doi: 10.1126/science.1236789; pmid: 23828936
16. P. Weltevrede, B. W. Stappers, J. M. Rankin, G. A. E. Wright, 40. L. G. Spitler et al., Fast radio burst discovered in the Arecibo
FRBs. The results from these new instruments Is Pulsar B0656+14 a very nearby rotating radio transient? Pulsar ALFA Survey. Astrophys. J. 790, 101 (2014).
will ensure that the golden age of FRB discov- Astrophys. J. 645, L149–L152 (2006). doi: 10.1086/506346 doi: 10.1088/0004-637X/790/2/101
ery extends well into the 2030s. 17. E. F. Keane et al., Further searches for rotating radio 41. S. Burke-Spolaor, K. W. Bannister, The galactic position
transients in the Parkes Multi-beam Pulsar Survey. Mon. Not. dependence of fast radio bursts and the discovery of
Would FRBs have ever been discovered if R. Astron. Soc. 401, 1057–1068 (2010). doi: 10.1111/j.1365- FRB011025. Astrophys. J. 792, 19 (2014). doi: 10.1088/
not for the brightness of the Lorimer Burst? 2966.2009.15693.x 0004-637X/792/1/19
Parallels have been drawn with the first gravi- 18. S. Burke-Spolaor, M. Bailes, The millisecond radio sky: 42. K. Masui et al., Dense magnetized plasma associated with a
Transients from a blind single-pulse search. Mon. Not. R. fast radio burst. Nature 528, 523–525 (2015). doi: 10.1038/
tational wave source, which remains the one Astron. Soc. 402, 855–866 (2010). doi: 10.1111/j.1365- nature15769; pmid: 26633633
with the largest known amplitude (123, 124). 2966.2009.15965.x 43. D. J. Champion et al., Five new fast radio bursts from the
The Lorimer Burst was only detected because 19. S. R. Kulkarni, Dispersion measure: Confusion, constants & HTRU high-latitude survey at Parkes: First evidence for
clarity. arXiv:2007.02886 [astro-ph.HE] (2020). two-component bursts. Mon. Not. R. Astron. Soc. 460,
it appeared in the sidelobes of the telescope, so 20. J. M. Cordes, T. J. W. Lazio, NE2001.I. A new model for the L30–L34 (2016). doi: 10.1093/mnrasl/slw069
in that sense, its high flux density was neces- galactic distribution of free electrons and its fluctuations. 44. V. Ravi, R. M. Shannon, A. Jameson, A fast radio burst
sary for the discovery. However the high fluence arXiv:astro-ph/0207156 [astro-ph] (2002). in the direction of the Carina Dwarf Spheroidal Galaxy.
21. J. M. Yao, R. N. Manchester, N. Wang, A new electron-density Astrophys. J. Lett. 799, L5 (2015). doi: 10.1088/
of the burst also compromised both its detec-
model for estimation of pulsar and FRB distances. Astrophys. J. 2041-8205/799/1/L5
tion and its acceptance. The simple interference 835, 29 (2017). doi: 10.3847/1538-4357/835/1/29 45. V. Ravi et al., The magnetic field and turbulence of the
rejection algorithm in operation tried to erase 22. K. Ioka, The cosmic dispersion measure from gamma-ray cosmic web measured using a brilliant fast radio burst.
the burst, and its brightness led to arguments burst afterglows: Probing the reionization history and Science 354, 1249–1252 (2016). doi: 10.1126/science.aaf6807;
the burst environment. Astrophys. J. 598, L79–L82 (2003). pmid: 27856844
that it was statistically unlikely, and hence doi: 10.1086/380598 46. S. R. Kulkarni, E. O. Ofek, J. D. Neill, Z. Zheng, M. Juric, Giant
probably interference. I am convinced that the 23. A. W. Hotan, W. van Straten, R. N. Manchester, PSRCHIVE sparks at cosmological distances? Astrophys. J. 797, 70
visual recognition of the Lorimer Burst’s dis- and PSRFITS: An open approach to radio pulsar data storage (2014). doi: 10.1088/0004-637X/797/1/70
and analysis. Publ. Astron. Soc. Aust. 21, 302–309 (2004). 47. E. Platts et al., A living theory catalogue for fast radio
persed bright pulse played a role in convincing doi: 10.1071/AS04022 bursts. Phys. Rep. 821, 1–27 (2019). doi: 10.1016/
astronomers that FRBs existed, but I am also 24. W. van Straten, M. Bailes, DSPSR: Digital signal processing j.physrep.2019.06.003
certain that it was the scientific potential of software for pulsar astronomy. Publ. Astron. Soc. Aust. 28, 48. D. B. Melrose, Coherent emission mechanisms in astrophysical
1–14 (2011). doi: 10.1071/AS10021 plasmas. Rev. Mod. Plasma Phys. 1, 5 (2017). doi: 10.1007/
FRBs that motivated the instrumental develop- 25. N. D. R. Bhat, J. M. Cordes, F. Camilo, D. J. Nice, D. R. Lorimer, s41614-017-0007-0
ments and surveys that ultimately produced the Multifrequency observations of radio pulse broadening and 49. J. M. Cordes, I. Wasserman, Supergiant pulses from
scientific discoveries discussed in this Review. constraints on interstellar electron density microstructure. extragalactic neutron stars. Mon. Not. R. Astron. Soc. 457,
Astrophys. J. 605, 759–783 (2004). doi: 10.1086/382680 232–257 (2016). doi: 10.1093/mnras/stv2948
26. E. Petroff et al., FRBCAT: The fast radio burst catalogue. 50. T. Totani, Cosmological fast radio bursts from binary neutron
Publ. Astron. Soc. Aust. 33, e045 (2016). doi: 10.1017/ star mergers. Publ. Astron. Soc. Jpn. 65, L12 (2013).
RE FE RENCES AND N OT ES
pasa.2016.35 doi: 10.1093/pasj/65.5.L12
1. D. R. Lorimer, M. Bailes, M. A. McLaughlin, D. J. Narkevic, 27. V. Ravi, The observed properties of fast radio bursts. 51. H. Falcke, L. Rezzolla, Fast radio bursts: The last sign of
F. Crawford, A bright millisecond radio burst of extragalactic Mon. Not. R. Astron. Soc. 482, 1966–1978 (2019). supramassive neutron stars. Astron. Astrophys. 562, A137
origin. Science 318, 777–780 (2007). doi: 10.1126/ doi: 10.1093/mnras/sty1551 (2014). doi: 10.1051/0004-6361/201321996
science.1147532; pmid: 17901298 28. S. B. Zhang et al., A new fast radio burst in the data sets 52. B. D. Metzger, B. Margalit, L. Sironi, Fast radio bursts as
2. A. Hewish, S. J. Bell, J. D. H. Pilkington, P. F. Scott, R. A. Collins, containing the Lorimer burst. Mon. Not. R. Astron. Soc. 484, synchrotron maser emission from decelerating relativistic
Observation of a Rapidly Pulsating Radio Source. Nature 217, L147–L150 (2019). doi: 10.1093/mnrasl/slz023 blast waves. Mon. Not. R. Astron. Soc. 485, 4091–4106
709–713 (1968). doi: 10.1038/217709a0 29. J. M. Shull, B. D. Smith, C. W. Danforth, The Baryon Census (2019). doi: 10.1093/mnras/stz700
3. P. Goldreich, W. H. Julian, Pulsar Electrodynamics. Astrophys. J. in a multiphase intergalactic medium: 30% of the Baryons 53. T. H. Hankins, J. S. Kern, J. C. Weatherall, J. A. Eilek,
157, 869 (1969). doi: 10.1086/150119 may still be missing. Astrophys. J. 759, 23 (2012). Nanosecond radio bursts from strong plasma turbulence in
4. M. Ruderman, Pulsars: Structure and Dynamics. Annu. Rev. doi: 10.1088/0004-637X/759/1/23 the Crab pulsar. Nature 422, 141–143 (2003). doi: 10.1038/
Astron. Astrophys. 10, 427–476 (1972). doi: 10.1146/annurev. 30. M. Bagchi, A. C. Nieves, M. McLaughlin, A search for nature01477; pmid: 12634779
aa.10.090172.002235 dispersed radio bursts in archival Parkes Multibeam Pulsar 54. M. Geyer et al., The Thousand-Pulsar-Array programme on
5. D. R. Lorimer, M. Kramer, Handbook of Pulsar Astronomy Survey data. Mon. Not. R. Astron. Soc. 425, 2501–2506 MeerKAT - III. Giant pulse characteristics of PSR J0540-6919.
(Cambridge Univ. Press) (2012). (2012). doi: 10.1111/j.1365-2966.2012.21708.x Mon. Not. R. Astron. Soc. 505, 4468–4482 (2021).
6. R. N. Manchester et al., The Parkes multi-beam pulsar 31. A. P. V. Siemion et al., The Allen Telescope Array Fly’s Eye doi: 10.1093/mnras/stab1501
survey - I. Observing and data analysis systems, discovery Survey for Fast Radio Transients. Astrophys. J. 744, 109 55. I. Cognard, J. A. Shrauner, J. H. Taylor, S. E. Thorsett, Giant
and timing of 100 pulsars. Mon. Not. R. Astron. Soc. 328, (2012). doi: 10.1088/0004-637X/744/2/109 radio pulses from a millisecond pulsar. Astrophys. J. 457, L81
17–35 (2001). doi: 10.1046/j.1365-8711.2001.04751.x 32. R. S. Lynch et al., The Green Bank Telescope 350 MHz (1996). doi: 10.1086/309894
7. D. J. Morris et al., The Parkes Multibeam Pulsar Survey - II. Drift-scan Survey II: Data Analysis and the timing of 10 new 56. F. Abbate et al., Giant pulses from J1823-3021A observed
Discovery and timing of 120 pulsars. Mon. Not. R. Astron. pulsars, including a relativistic binary. Astrophys. J. 763, 81 with the MeerKAT telescope. Mon. Not. R. Astron. Soc. 498,
Soc. 335, 275–290 (2002). doi: 10.1046/j.1365- (2013). doi: 10.1088/0004-637X/763/2/81 875–882 (2020). doi: 10.1093/mnras/staa2510
8711.2002.05551.x 33. S. Burke-Spolaor, M. Bailes, R. Ekers, J.-P. Macquart, 57. R. T. Bartels, T. D. P. Edwards, C. Weniger, Bayesian model
8. M. Kramer et al., The Parkes Multibeam Pulsar Survey. III. I. CrawfordIII, Fronefield, Radio bursts with extragalactic comparison and analysis of the Galactic disc population of
Young pulsars and the discovery and timing of 200 pulsars. spectral characteristics show terrestrial origins. Astrophys. J. gamma-ray millisecond pulsars. Mon. Not. R. Astron. Soc.
Mon. Not. R. Astron. Soc. 342, 1299–1324 (2003). 727, 18 (2011). doi: 10.1088/0004-637X/727/1/18 481, 3966–3987 (2018). doi: 10.1093/mnras/sty2529
doi: 10.1046/j.1365-8711.2003.06637.x 34. E. Petroff et al., Identifying the source of perytons at the 58. A. Loeb, Y. Shvartzvald, D. Maoz, Fast radio bursts may
9. F. Crawford et al., Radio pulsars in the Magellanic clouds. Parkes radio telescope. Mon. Not. R. Astron. Soc. 451, originate from nearby flaring stars. Mon. Not. R. Astron.
Astrophys. J. 553, 367–374 (2001). doi: 10.1086/320635 3933–3940 (2015). doi: 10.1093/mnras/stv1242 Soc. Lett. 439, L46–L50 (2014). doi: 10.1093/mnrasl/slt177
59. B. Dennison, Fast radio bursts: Constraints on the dispersing 85. The CHIME/FRB Collaboration, A bright millisecond-duration 111. J. P. Macquart et al., A census of baryons in the Universe
medium. Mon. Not. R. Astron. Soc. Lett. 443, L11–L14 (2014). radio burst from a Galactic magnetar. Nature 587, 54–58 (2020). from localized fast radio bursts. Nature 581, 391–395 (2020).
doi: 10.1093/mnrasl/slu072 doi: 10.1038/s41586-020-2863-y; pmid: 33149292 doi: 10.1038/s41586-020-2300-2; pmid: 32461651
60. E. Petroff et al., A survey of FRB fields: Limits on repeatability. 86. C. D. Bochenek et al., A fast radio burst associated with a 112. R. J. Cooke, M. Pettini, C. C. Steidel, One percent determination
Mon. Not. R. Astron. Soc. 454, 457–462 (2015). doi: 10.1093/ galactic magnetar. Nature 587, 59–62 (2020). doi: 10.1038/ of the primordial deuterium abundance. Astrophys. J. 855, 102
mnras/stv1953 s41586-020-2872-x; pmid: 33149288 (2018). doi: 10.3847/1538-4357/aaab53
61. L. G. Spitler et al., A repeating fast radio burst. Nature 87. D. M. Palmer, B. A. T. Team, A forest of bursts from SGR 113. N. Aghanim et al., Planck 2018 results. VI. Cosmological
531, 202–205 (2016). doi: 10.1038/nature17168; 1935+2154. GRB Coordinates Network 27665, 1 (2020). parameters. Astron. Astrophys. 641, A6 (2020). doi: 10.1051/
pmid: 26934226 88. B. C. Andersen et al., Sub-second periodicity in a fast radio 0004-6361/201833910
62. S. C. Lundgren et al., Giant pulses from the Crab Pulsar: burst. Nature 607, 256–259 (2022). doi: 10.1038/s41586- 114. M. Rafiei-Ravandi et al., CHIME/FRB catalog 1 results: Statistical
A joint radio and gamma-ray study. Astrophys. J. 453, 433 022-04841-8; pmid: 35831603 cross-correlations with large-scale structure. Astrophys. J. 922,
(1995). doi: 10.1086/176404 89. L. Levin et al., Radio emission evolution, polarimetry and 42 (2021). doi: 10.3847/1538-4357/ac1dab
63. M. Lyutikov, Radio emission from magnetars. Astrophys. J. multifrequency single pulse analysis of the radio magnetar 115. S. Hagstotz, R. Reischke, R. Lilow, A new measurement
580, L65–L68 (2002). doi: 10.1086/345493 PSR J1622-4950. Mon. Not. R. Astron. Soc. 422, 2489–2500 of the Hubble constant using fast radio bursts. Mon. Not.
64. F. Rajabi, M. A. Chamma, C. M. Wyenberg, A. Mathews, (2012). doi: 10.1111/j.1365-2966.2012.20807.x R. Astron. Soc. 511, 662–667 (2022). doi: 10.1093/
M. Houde, A simple relationship for the spectro-temporal 90. M. Amiri et al., The first CHIME/FRB fast radio burst catalog. mnras/stac077
structure of bursts from FRB 121102. Mon. Not. R. Astron. Astrophys. J. Suppl. Ser. 257, 59 (2021). doi: 10.3847/1538- 116. F. Coti Zelati, N. Rea, J. A. Pons, S. Campana, P. Esposito,
Soc. 498, 4936–4942 (2020). doi: 10.1093/mnras/staa2723 4365/ac33ab Systematic study of magnetar outbursts. Mon. Not. R. Astron.
65. C. J. Law et al., realfast: Real-time, commensal fast 91. Z. Pleunis et al., Fast radio burst morphology in the first CHIME/ Soc. 474, 961–1017 (2018). doi: 10.1093/mnras/stx2679
transient surveys with the very large array. Astrophys. J. FRB catalog. Astrophys. J. 923, 1 (2021). doi: 10.3847/1538- 117. H. Xu et al., A sustained pulse shape change in PSR J1713
Suppl. Ser. 236, 8 (2018). doi: 10.3847/1538-4365/aab77b 4357/ac33ac +0747 possibly associated with timing and DM events.
66. S. Chatterjee et al., A direct localization of a fast radio burst 92. F. Kirsten et al., A repeating fast radio burst source in a The Astronomer’s Telegram 14642, 1 (2021).
and its host. Nature 541, 58–61 (2017). doi: 10.1038/ globular cluster. Nature 602, 585–589 (2022). doi: 10.1038/ 118. B. Stappers, “MeerTRAP: Real time commensal searching for
nature20797; pmid: 28054614 s41586-021-04354-w; pmid: 35197615 transients and pulsars with MeerKAT,” Paper presented at
67. S. P. Tendulkar et al., The host galaxy and redshift of the 93. The CHIME/FRB Collaboration, Periodic activity from MeerKAT Science: On the Pathway to the SKA, Stellenbosch,
repeating fast radio burst FRB 121102. Astrophys. J. Lett. a fast radio burst source. Nature 582, 351–355 (2020). South Africa, 25–27 May 2016.
834, L7 (2017). doi: 10.3847/2041-8213/834/2/L7 doi: 10.1038/s41586-020-2398-2; pmid: 32555491 119. J. Kocz et al., DSA-10: A prototype array for localizing fast
68. B. Marcote et al., The repeating fast radio burst FRB 121102 94. K. M. Rajwade et al., Possible periodic activity in the radio bursts. Mon. Not. R. Astron. Soc. 489, 919–927 (2019).
as seen on milliarcsecond angular scales. Astrophys. J. Lett. repeating FRB 121102. Mon. Not. R. Astron. Soc. 495, doi: 10.1093/mnras/stz2219
834, L8 (2017). doi: 10.3847/2041-8213/834/2/L8 3551–3558 (2020). doi: 10.1093/mnras/staa1237 120. K. Vanderlinde et al., “The Canadian Hydrogen Observatory
69. Y. Li, B. Zhang, A comparative study of host galaxy properties 95. M. Cruces et al., Repeating behaviour of FRB 121102: Periodicity, and Radio-transient Detector (CHORD),” in Canadian Long
between fast radio bursts and stellar transients. Astrophys. J. waiting times, and energy distribution. Mon. Not. R. Astron. Soc. Range Plan for Astronomy and Astrophysics White Papers,
Lett. 899, L6 (2020). doi: 10.3847/2041-8213/aba907 500, 448–463 (2021). doi: 10.1093/mnras/staa3223 vol. 2020 (Zenodo, 2019); https://zenodo.org/record/
70. V. Gajjar et al., Highest frequency detection of FRB 121102 at 96. M. Lyutikov, M. V. Barkov, D. Giannios, FRB periodicity: Mild 3765414#.Y1GlGnbMKUk.
4-8 GHz using the breakthrough listen digital backend pulsars in tight O/B-star binaries. Astrophys. J. Lett. 893, 121. G. Hallinan et al., The DSA-2000: A radio survey camera.
at the Green Bank Telescope. Astrophys. J. 863, 2 (2018). L39 (2020). doi: 10.3847/2041-8213/ab87a4 arXiv:1907.07648 [astro-ph.IM] (2019).
doi: 10.3847/1538-4357/aad005 97. Z. Pleunis et al., LOFAR detection of 110-188 MHz emission and 122. T. Hashimoto et al., Fast radio bursts to be detected with the
71. Y. G. Zhang et al., Fast Radio Burst 121102 pulse detection frequency-dependent activity from FRB 20180916B. Astrophys. J. square kilometre array. Mon. Not. R. Astron. Soc. 497,
and periodicity: A machine learning approach. Astrophys. J. Lett. 911, L3 (2021). doi: 10.3847/2041-8213/abec72 4107–4116 (2020). doi: 10.1093/mnras/staa2238
866, 149 (2018). doi: 10.3847/1538-4357/aadf31 98. I. Pastor-Marazuela et al., Chromatic periodic activity down to 123. LIGO Scientific Collaboration, Virgo Collaboration,
72. D. Michilli et al., An extreme magneto-ionic environment 120 megahertz in a fast radio burst. Nature 596, 505–508 Observation of gravitational waves from a binary black hole
associated with the fast radio burst source FRB 121102. (2021). doi: 10.1038/s41586-021-03724-8; pmid: 34433943 merger. Phys. Rev. Lett. 116, 061102 (2016). doi: 10.1103/
Nature 553, 182–185 (2018). doi: 10.1038/nature25149; 99. B. Zhang, A “cosmic comb” model of fast radio bursts. PhysRevLett.116.061102; pmid: 26918975
pmid: 29323297 Astrophys. J. Lett. 836, L32 (2017). doi: 10.3847/ 124. LIGO Scientific Collaboration, Virgo Collaboration,
73. K. Gourdji et al., A sample of low-energy bursts from FRB 2041-8213/aa5ded KAGRA Collaboration, GWTC-3: Compact binary
121102. Astrophys. J. Lett. 877, L19 (2019). doi: 10.3847/ 100. D. Li et al., A bimodal burst energy distribution of a repeating coalescences observed by LIGO and Virgo during the
2041-8213/ab1f8a fast radio burst source. Nature 598, 267–271 (2021). second part of the third observing run. arXiv:2111.03606
74. G. H. Hilmarsson et al., Rotation measure evolution of the doi: 10.1038/s41586-021-03878-5; pmid: 34645999 [gr-qc] (2021).
repeating fast radio burst source FRB 121102. Astrophys. J. 101. B. Margalit, B. D. Metzger, A concordance picture of FRB 125. M. Bailes et al., The MeerKAT telescope as a pulsar facility:
Lett. 908, L10 (2021). doi: 10.3847/2041-8213/abdec0 121102 as a flaring magnetar embedded in a magnetized System verification and early science results from MeerTime.
75. M. Caleb et al., The first interferometric detections of fast ion-electron wind nebula. Astrophys. J. Lett. 868, L4 (2018). Publ. Astron. Soc. Aust. 37, e028 (2020). doi: 10.1017/
radio bursts. Mon. Not. R. Astron. Soc. 468, 3746–3756 doi: 10.3847/2041-8213/aaedad pasa.2020.19
(2017). doi: 10.1093/mnras/stx638 102. A. L. Piro, B. M. Gaensler, The dispersion and rotation 126. M. Bailes et al., The UTMOST: A hybrid digital signal processor
76. R. M. Shannon et al., The dispersion-brightness relation for measure of supernova remnants and magnetized stellar transforms the Molonglo Observatory Synthesis Telescope.
fast radio bursts from a wide-field survey. Nature 562, 386–390 winds: Application to fast radio bursts. Astrophys. J. 861, 150 Publ. Astron. Soc. Aust. 34, e045 (2017). doi: 10.1017/
(2018). doi: 10.1038/s41586-018-0588-y; pmid: 30305732 (2018). doi: 10.3847/1538-4357/aac9bc pasa.2017.39
77. W. Farah et al., FRB microstructure revealed by the real-time 103. R. W. Romani, S. Johnston, Giant pulses from the millisecond 127. W. Zhu et al., A fast radio burst discovered in FAST Drift Scan
detection of FRB170827. Mon. Not. R. Astron. Soc. 478, pulsar B1821-24. Astrophys. J. 557, L93–L96 (2001). Survey. Astrophys. J. Lett. 895, L6 (2020). doi: 10.3847/
1209–1217 (2018). doi: 10.1093/mnras/sty1122 doi: 10.1086/323415 2041-8213/ab8e46
78. H. Cho et al., Spectropolarimetric analysis of FRB 181112 104. K. Nimmo et al., Burst timescales and luminosities as links 128. M. Caleb, E. Keane, A decade and a half of fast radio burst
at microsecond resolution: Implications for fast radio burst between young pulsars and fast radio bursts. Nat. Astron. 6, observations. Universe 7, 453 (2021). doi: 10.3390/
emission mechanism. Astrophys. J. Lett. 891, L38 (2020). 393–401 (2022). doi: 10.1038/s41550-021-01569-9 universe7110453
doi: 10.3847/2041-8213/ab7824 105. C. H. Niu et al., A repeating fast radio burst associated with a
79. K. S. Cheng, C. Ho, M. Ruderman, Energetic radiation from persistent radio source. Nature 606, 873–877 (2022). AC KNOWLED GME NTS
rapidly spinning pulsars. I. Outer magnetosphere gaps. doi: 10.1038/s41586-022-04755-5; pmid: 35676486 I thank D. Lorimer for involving me in the pursuit of the
Astrophys. J. 300, 500 (1986). doi: 10.1086/163829 106. Y. Feng et al., Frequency-dependent polarization of Lorimer Burst; my colleagues in the HTRU, SUPERB, UTMOST,
80. M. Amiri et al., The CHIME Fast Radio Burst Project: repeating fast radio bursts-implications for their origin. and CRAFT FRB collaborations; M. Caleb and C. Knox for help with
System overview. Astrophys. J. 863, 48 (2018). doi: 10.3847/ Science 375, 1266–1270 (2022). doi: 10.1126/science. the figures; A. Deller, K. Gourdji, C. Flynn, and R. Shannon for
1538-4357/aad188 abl7759; pmid: 35298266 feedback on the manuscript; and S. Ransom and an anonymous
81. The CHIME/FRB Collaboration, Observations of fast radio 107. K. W. Bannister et al., A single fast radio burst localized referee for providing many important suggestions that greatly
bursts at frequencies down to 400 megahertz. Nature 566, to a massive galaxy at cosmological distance. Science 365, improved the manuscript. Funding: This work was supported by
230–234 (2019). doi: 10.1038/s41586-018-0867-7; 565–570 (2019). doi: 10.1126/science.aaw5903; pmid: 31249136 the Australian Research Council (Laureate Fellowship FL150100148)
pmid: 30653191 108. V. Ravi et al., A fast radio burst localized to a massive and the ARC Centre of Excellence for Gravitational Wave Discovery
82. The CHIME/FRB Collaboration, A second source of repeating galaxy. Nature 572, 352–354 (2019). doi: 10.1038/s41586- (OzGrav grant CE170100004). Competing interests: I declare
fast radio bursts. Nature 566, 235–238 (2019). doi: 10.1038/ 019-1389-7; pmid: 31266051 no competing interests. License information: Copyright © 2022
s41586-018-0864-x; pmid: 30653190 109. C. J. Law et al., A distant fast radio burst associated with its the authors, some rights reserved; exclusive licensee American
83. The CHIME/FRB Collaboration et al., CHIME/FRB discovery host galaxy by the very large array. Astrophys. J. 899, 161 Association for the Advancement of Science. No claim to original
of eight new repeating fast radio burst sources. Astrophys. (2020). doi: 10.3847/1538-4357/aba4ac US government works. https://www.science.org/about/science-
J. Lett. 885, L24 (2019). doi: 10.3847/2041-8213/ab4a80 110. S. Bhandari et al., Characterizing the fast radio burst host licenses-journal-article-reuse
84. E. Fonseca et al., Nine new repeating fast radio burst sources galaxy population and its connection to transients in the local
from CHIME/FRB. Astrophys. J. Lett. 891, L6 (2020). and extragalactic universe. Astron. J. 163, 69 (2022). Submitted 12 April 2022; accepted 5 October 2022
doi: 10.3847/2041-8213/ab7208 doi: 10.3847/1538-3881/ac3aec 10.1126/science.abj3043
T
he Standard Model of particle physics where a0 and aobs are the laboratory and ob- lent to ≈13 Å at 5000 Å) (11–13). We chose
contains parameters known as funda- served values of a, respectively; Dv is the line these values to reduce the systematic effects
mental constants. These include the shift in velocity units; and the sensitivity co- while maintaining sensitivity to variations in
coupling strengths of the known phys- efficient Q describes how much a given line a between stars.
ical forces; the strength of electromag- shifts to the blue (for positive Q) or red. The We applied this solar twins method to ar-
netism is set by the fine-structure constant, approximation is valid for Da=a≪1. In prac- chival solar twin spectra from the High Accu-
a ≡ e2/ħc, where e is the elementary charge, tice, the velocity shifts are measured for multi- racy Radial velocity Planet Searcher (HARPS)
ħ is the reduced Planck constant, and c is ple lines and different atoms and ions, which spectrograph mounted on the European South-
the (vacuum) speed of light. These dimen- is known as the many multiplet method. ern Observatory (ESO) 3.6-m telescope at La
sionless numbers are referred to as funda- Using lines with a wide variety of Q coef- Silla Observatory, Chile. HARPS is highly stable
mental because the Standard Model does not ficients increases the sensitivity to variations over time (14), and its wavelength scale has
predict their values. They are usually as- in a. been precisely characterized by using laser
sumed to be universal constants—they do not Sun-like stars are potentially suitable targets frequency combs (15, 16). This sets an instru-
depend on other (unknown) physics. Their for the many multiplet method: Their spectra mental systematic error limit of ~2 to 3 m s–1
values can only be established experimen- contain thousands of narrow, well-defined, in the velocity separations of line pairs (12). To
tally, and testing their constancy requires mea- strong (but unsaturated) absorption lines reach this level, we restricted our analysis to
surements under a wide range of physical (Fig. 1A). The observed wavelengths of these HARPS exposures corrected for nonuniform
conditions, such as different times, distances, lines could in principle be compared with detector pixel sizes (corrections, ~25 m s–1)
and gravitational potentials. Measurements of their laboratory values while simultaneously (13, 17) and applied a further correction for
laboratory atomic clocks have set an upper accounting for the star’s radial velocity. How- sparsely sampled wavelength calibration (cor-
limit on relative variations in a to ≲1018 year–1 ever, this simple approach is limited by large rections, ~5 m s–1) (13, 16).
over several years (1). On cosmological time systematic errors; several physical mecha- We selected 16 bright (nearby) solar twins
and distance scales, absorption lines of dis- nisms can shift the lines by up to ~700 m s–1 with HARPS spectra, with signal-to-noise ratio
tant gas clouds in the spectra of background from their laboratory wavelengths, and the (SNR) > 200 per 0.8 km s–1 pixel, plus the Sun
quasars limit relative variations in a to ≲1 line profiles are asymmetric because they arise through reflection of its light from the asteroid
parts per million (ppm) (2–4). A study of giant over a range of depths in stellar atmospheres Vesta (with SNR > 150) (table S1) (13). With
stars within the Milky Way has set similar (8, 9). These effects produce velocity shifts (Dv) these SNRs, the statistical uncertainty in the
limits of ≲2 to 6 ppm (5, 6). between lines, typically Dv ~ 250 m s–1 (8), velocity separation of two unresolved absorp-
Any variation in a would alter the energy which is equivalent to Da/a ~ 6 ppm for a tion lines is ~25 m s–1 from a single exposure,
levels of atoms and ions in characteristic ways typical range in Q coefficients of ≈0.07 (10). assuming that they absorb 50% of the stellar
(7). The rest-frame wave number of an ab- Direct comparison of absorption lines in a sin- flux at their cores (18). The median number of
sorption or emission line (wobs) would shift gle giant star to laboratory values has already HARPS exposures available was 10 exposures
from its laboratory value (w0) in proportion reached this systematic error limit (5). per star (range of 1 to 138), so by combining
to the relative change Da/a ≡ (aobs – a0)/a0: We adopted an alternative technique that results from multiple exposures, we expected
Dv w0 wobs Da compares absorption lines between stars that median statistical uncertainties to reduce to
≡ ≈2 Q ð1Þ have intrinsically similar spectra, eliminating ~8 m s–1 per line pair, per star. By averaging
c w0 a
the need to compare with laboratory wave- over the sample of 17 stars, the uncertainty
1
Centre for Astrophysics and Supercomputing, Swinburne lengths. The atmospheric spectrum of an iso- approaches that imposed by the available in-
University of Technology, Hawthorn, Victoria 3122, Australia. lated main-sequence star depends primarily strument calibration (12).
2
ARC Centre of Excellence for Gravitational Wave Discovery, on its mass and heavy-element content, which From 8843 lines listed in a solar atlas (19),
Hawthorn, Victoria 3122, Australia. 3School of Physics,
University of New South Wales, Sydney, NSW 2052, Australia. determine three primary observable parame- we selected 22 that are separated from each
*Corresponding author. Email: mmurphy@swin.edu.au ters: the effective temperature Teff, iron met- other and not blended with other nearby
to-star scatters for all line pairs (si ) and a Combining the results from all 17 stars pro- 13. Materials and methods are available as supplementary
smaller contribution from the uncertainties in vided a weighted mean with 12 ppb ensemble materials.
14. M. Mayor et al., Messenger 114, 20 (2003).
the Q coefficients. Because a line can be shared precision: 15. T. Wilken et al., Mon. Not. R. Astron. Soc. 405, L16–L20
by multiple pairs, its statistical and systematic (2010).
uncertainties cause correlated errors across those hDa=aiw ¼ 7 T 5stat T 11sys ppb ð3Þ 16. D. Milaković, L. Pasquini, J. K. Webb, G. Lo Curto, Mon. Not. R.
Astron. Soc. 493, 3997–4011 (2020).
pairs; we used a Monte Carlo method to compute
where hDa=aiw and its 1s statistical uncer- 17. A. Coffinet, C. Lovis, X. Dumusque, F. Pepe, Astron. Astrophys.
the combined Da/a value and its statistical and 629, A27 (2019).
tainty and systematic error were calculated 18. J. W. Brault, Mikrochim. Acta 93, 215–227 (1987).
systematic uncertainty for each star (13).
from the Monte Carlo simulations to account 19. M. Laverick et al., Astron. Astrophys. 612, A60 (2018).
We found no variations in a between nearby 20. D. A. Berke, DBerke/varconlib: VarConLib initial release.
for the correlations between results for differ-
solar twins (<50 parsec), with a typical (me- Zenodo (2022); doi:10.5281/zenodo.7196771.
ent stars because they share common line pairs
dian) uncertainty in Da/a of ≈50 parts per 21. D. A. Berke, M. T. Murphy, C. Flynn, F. Liu, DBerke/Berke_et_
(13). The weights are the inverse variances from alia_2022_supplemental_data: Initial release of supplementary
billion (ppb) (adding statistical and systematic material. Zenodo (2022); doi:10.5281/zenodo.7196796.
quadrature addition of the statistical and sys-
errors in quadrature). The precision reaches 22. M. T. Murphy, MTMurphy77/alpha_SolarTwins22: Code and data
tematic uncertainties in Da/a for each star.
≈30 ppb for some stars, which is ≳30 times for constraining variations in the fine-structure constant between
The combined result (Eq. 3) acts as an entirely solar twin stars. Zenodo (2022); doi:10.5281/zenodo.7196515.
more precise than individual quasar absorp-
empirical reference for stellar measurements
tion systems (2, 4). The systematic error term AC KNOWLED GME NTS
of a. This and the ability of our automatic
dominates in these cases (Fig. 2), mainly be- We thank D. Dravins for discussions about potential astrophysical
analysis procedure to recover shifts in a be-
cause of the intrinsic star-to-star scatter, si ≈ 0 systematic errors. Funding: M.T.M., F.L., and C.L. acknowledge
tween stars were tested by altering the wave-
to 15 m s–1 per line pair i. The solar twins the support of the Australian Research Council through Future
Fellowship grant FT180100194. V.A.D. and V.V.F. acknowledge
length measurements for half our twins by
method provides ≳100 times more accuracy the Australian Research Council for support through grants
amounts corresponding to an a variation of
than comparison between lines in individual DP190100974 and DP200100150. OzGrav is funded by the
100 ppb (13). Rerunning the full analysis but Australian government through the Australian Research Council
white dwarfs or giant stars with their labora-
removing these stars from the determination Centres of Excellence funding scheme. Author contributions:
tory counterparts (5, 6). The results for the
of Dvimodel , we recovered an 86 ± 19 ppb dif- M.T.M. conceived the stellar twins technique, acquired funding,
supervised the project, calculated the Da/a values, and wrote the draft
17 stars are formally consistent with each
ference between the shifted and unshifted
other, with c2 = 18.2 around their weighted manuscript. D.A.B. wrote the software, performed the velocity shift
twins. The discrepancy arises because some measurements and analysis, and curated all data. F.L., C.F., and C.L.
mean (16 degrees of freedom; 31% probability assisted with the methodology and analysis and validation of results.
measurements of shifted lines are excluded as
of a larger value by chance alone), so there is V.A.D. and V.V.F. calculated the sensitivity coefficients (Q). All authors
outliers; the shifts introduced are much larger commented on and revised the manuscript. Competing interests:
no evidence for additional systematic errors
than the total uncertainties (including si ). The authors declare no competing interests. Data and materials
that are not accounted for by si . availability: This work is based on observations obtained from the
This confirms that our analysis process would
Another study (12) considered a variety of ESO Science Archive Facility and collected at the European Southern
still have detected any large (~100 ppb) dis- Observatory under ESO program(s) listed in table S1. The
astrophysical and instrumental effects that
crepancies between some twins if they were observations are available from the ESO Science Archive facility:
could cause spurious variation of a between http://archive.eso.org/eso/eso_archive_main.html. Our software for
present in the data.
stars and/or account for si. Apart from those measuring the line wavelengths and computing the line pair
already corrected in our analysis (such as wave- separations and models is available on Zenodo (20). Tables of the
RE FERENCES AND NOTES lines used in this study; their laboratory wavelengths; our measured
length calibration distortions), that study ruled and model offsets from those values; and our measured line pair
out systematic error contributions from line 1. R. Lange et al., Phys. Rev. Lett. 126, 011102 (2021).
separations, models, and si values are available on Zenodo (21).
2. S. M. Kotuš, M. T. Murphy, R. F. Carswell, Mon. Not. R.
blending; pair separation; differences in line Our software for computing Da/a in this work is available on Zenodo
Astron. Soc. 464, 3679–3703 (2017).
(22). The stellar parameters and our measured Da/a values and
depth in a pair; transiting exoplanets or mag- 3. M. T. Murphy, K. L. Cooksey, Mon. Not. R. Astron. Soc. 471,
uncertainties are listed in table S2. License information: Copyright ©
netic activity cycles of the target stars; and con- 4930–4945 (2017).
2022 the authors, some rights reserved; exclusive licensee American
4. M. T. Murphy et al., Astron. Astrophys. 658, A123 (2022).
tamination of spectra by scattered moonlight, 5. A. Hees et al., Phys. Rev. Lett. 124, 081101 (2020). Association for the Advancement of Science. No claim to original
US government works. https://www.science.org/about/science-
cosmic ray events, or charge transfer ineffi- 6. J. Hu et al., Mon. Not. R. Astron. Soc. 500, 1466 (2021).
7. V. A. Dzuba, V. V. Flambaum, J. K. Webb, Phys. Rev. Lett. 82, licenses-journal-article-reuse
ciencies in the detector. However, they estimated 888–891 (1999).
that variations in stellar rotation velocities or 8. D. Dravins, Annu. Rev. Astron. Astrophys. 20, 61–89 (1982). SUPPLEMENTARY MATERIALS
elemental and isotopic abundances between 9. J. I. González Hernández et al., Astron. Astrophys. 643, A146 science.org/doi/10.1126/science.abi9232
(2020). Materials and Methods
stars may plausibly explain the size of and var- 10. V. A. Dzuba, V. V. Flambaum, M. T. Murphy, D. A. Berke, Figs. S1 to S4
iations in si (12). Nevertheless, they did not Phys. Rev. A 105, 062809 (2022). Tables S1 to S3
find specific evidence for these effects with sim- 11. D. A. Berke, M. T. Murphy, C. Flynn, F. Liu, Mon. Not. R.
References (23–34)
Astron. Soc. 10.1093/mnras/stac2458 (2022).
ple tests, even among the larger data sample of 12. D. A. Berke, M. T. Murphy, C. Flynn, F. Liu, Mon. Not. R. Submitted 1 April 2022; accepted 14 October 2022
stars used (12). Astron. Soc. 10.1093/mnras/stac2037 (2022). 10.1126/science.abi9232
S
tretchable electronics with high stretch- We report a universal synthetic route for laser sintering (22), have been reported. These
ability and high toughness are essential highly conductive and mechanically tough methods rupture the native oxide of LMPs and
for soft robotics (1, 2), skin electronics LMP-based conductors without the LM leakage cause a substantial amount of LM to leak to
(3, 4), and implantable electronics (5, 6). issue (Fig. 1). Our LM conductor includes a long- other LMPs, thereby forming percolation path-
Substantial progress has been made in range assembled network of LMPs (LMPNet) ways. These methods have limitations in the
intrinsically stretchable conductors. High me- and a tough elastomeric matrix. The percola- reliability, uniformity, and mechanical robust-
tallic conductivity with rubber-like stretchabil- tion structure and deformation mechanisms of ness of circuit lines. During the activation, a
ity has been successfully achieved in conductive the LMPNet led to high conductivity, outstand- large amount of LM emerges from the surface
polymers (7) and nanocomposites (8–12). How- ing toughness, and imperceptible resistance of conductive lines and disrupts other lines
ever, certain critical challenges, including the changes under large deformation (Fig. 1C). (fig. S8).
inevitable change in electrical resistance during The LMPNet is composed of a network of large We devised an alternative method for form-
stretching and difficulty in achieving long-term LMPs (average size of 2 to 3 mm) as the main ing a highly conductive LMP assembled network
cyclic stability and strong interfacial bonding framework and smaller LMPs (average size in the polymer matrix without LM leakage. This
with electronic components, remain. Hence, of 100 nm, denoted as LMPnano) as network method involves acoustic field application to
an elastic printed circuit board (E-PCB) has interconnectors (Fig. 1B and figs. S1 to S3). as-printed LMP lines. For this, we chose water
not been realized without structure engineer- When the LMPNet is stretched, the micrometer- as the medium to avoid unwanted damage
ing (13). sized LMPs deform into ellipsoidal structures, to the printed lines or temperature increase.
Room-temperature liquid metals (LMs) have whereas the LMPnano interconnectors remain When an acoustic field was applied for 30 s,
received considerable attention as elastic con- intact similarly to solid particles (Fig. 1C and we observed the formation of nanosized LMP
ductors because of their metallic conductiv- figs. S1 and S2). Thus, particle–particle contacts (LMPnano) between the original micrometer-
ity and extreme deformability. Gallium-based could be preserved under large strain, result- sized LMPs (Fig. 1B and figs. S1 to S3), re-
LMs have been studied for elastic conductors ing in negligible resistance changes under large sulting in the interconnection of the LMPs
through various approaches, including dis- strain (>4000%). with LMPnano, that is, the formation of the
persing LM particles (LMPs) in an elastomer The LMPNet could be formed with high uni- LMPNet.
(14, 15), coating LM on a porous polymer matrix formity and reliability over a large area (fig. We investigated the electrical characteristics
(16), mixing LMPs with a solid conductive filler S4). This allowed us to predict the electrical of the LMPNet depending on the LM volume
composite (17, 18), doping LMPs in a polymer resistance of the lines and design an E-PCB, in fraction in the composite. The as-printed LMP
matrix (19), and forming a biphasic LM struc- which various electronic components, includ- conductor was insulating, even at a high LM
ture (20). However, LM-based conductors suffer ing integrated circuit (IC) chips, resistors, tran- content, and required an acoustic field to form
from leakage issues under external mechanical sistors, and capacitors are assembled with a conductive LMPNet (Fig. 2A). The conductiv-
stimuli, which limit their reliability, uniformity, tough interfacial adhesion (Fig. 1D). ity of the LMPNet increased with an increase in
and stability. As illustrated in Fig. 1, A and B, and fig. S5, the LM volume fraction in the composite, and
the formation of the LMPNet in a polymer it reached 2.10 106 S/m at 74.4 vol % of the
1
matrix was accomplished in two steps: First, LM (Fig. 2A and fig. S9). Considering the vol-
Department of Materials Science and Engineering, Korea
Advanced Institute of Science and Technology (KAIST),
an LMP–polymer composite was formed, and ume fraction of the polymer in the composite
Daejeon 34141, Republic of Korea. 2School of Electrical then the LMPNet formation was induced. To and the electrical conductivity of the pure LM,
Engineering, Korea Advanced Institute of Science and prepare micrometer-sized LMPs, we applied the resultant conductivity nearly reached the
Technology (KAIST), Daejeon 34141, Republic of Korea.
3 an acoustic field to the room-temperature LM theoretical effective conductivity
P calculated
Center for Nanomaterials and Chemical Reactions, Institute
for Basic Science (IBS), Daejeon 34141, Republic of Korea. alloy (eutectic gallium indium, EGaIn) (1.35 g) by using the relationship σ ¼ fA σA, where
4
Department of Mechanical Engineering, Korea Advanced in acetone (30 ml) at an amplitude of 63.4 mm f is the volume fraction of the conductive ma-
Institute of Science and Technology (KAIST), Daejeon 34141, (44%) for 20 min, using a probe sonicator in terial and σ is the electrical conductivity of
Republic of Korea.
*Corresponding author. Email: jiheongkang@kaist.ac.kr water. The solvent was decanted after centri- the conductive component (Fig. 2A and fig.
†These authors contributed equally to this work. fugation for 30 min at 2200 rpm. The sedi- S10) (23). This result suggests that a nearly
Fig. 1. Formation of a
liquid metal particle
network in a polymer and
its application for elastic
printed circuit boards.
(A) Schematic of the
formation of liquid metal
nanoparticles (LMPnano)
at the surface of
existing micrometer-sized
liquid metal particles
(LMPs) via acoustic field
application. (B) Scanning
electron microscopy
images of the LMPs and
LMP network (LMPNet)
formed in the polymer,
which reveal that LMPnano
species are formed at the
surface of the original
LMPs. Scale bars, 3 μm.
(C) Schematic illustration
of the formation of a
highly conductive LMPNet
and the distinctive
behavior of the elastic
LMPNet derived from the
differences in the sizes of
the original LMP and
LMPnano, resulting in negligible resistance change during stretching. (D) Schematic illustration of the elastic multilayered printed circuit board based on
the LMPNet and the assembly of integrated stretchable electronics.
Fig. 3. LMPNet-based E-PCB. (A) Schematic illustration of the circuit line and an (PPG) sensor before and after stretching by 150%. (E) Optical image of the PPG
LED array assembled using the LMPNet for a stretchable display. (B) Optical sensor attached to human skin (left) and the normalized reading of the PPG
images of the LED array reading “DMDL” at rest (left) and under 100% strain sensor as a function of the strain (0, 50, 100, and 150% strain) applied to the
(right). (C) Schematic illustration of the circuit lines, VIAs, and electronic PPG sensor circuit board (right). (F) Optical image of a stand-alone integrated
components assembled using the LMPNet for a stretchable health monitoring stretchable electronic system (left) and biaxially stretched electronic system
system. (D) Optical image showing the operation of a photoplethysmography (right). This system includes 26 VIAs and 38 electronic components.
defect-free percolation pathway was formed change in the resistance even under biaxial To understand the impact of the LMPNet
by the assembly of the LMPs in the polymer stretching (fig. S17). on the mechanical properties, we performed
matrix. Although the LMP Net is based on a According to Eshelby’s theory, LMPs in an mechanical tests on three samples: pure PU,
zero-dimensional particle structure, its elec- elastomeric matrix deform their structures LMP–PU, and LMPNet–PU. In contrast with
trical conductivity is higher than those of the when a strain is applied. This feature allows rigid conductive fillers, LMP inclusions in PU,
previously reported elastic printable conductors much better electromechanical responses from which have zero Young’s modulus, make the
(fig. S11) (7, 9, 10, 16–18, 20). The LMPNet ex- LMP-based conductors than from conventional LMP–PU composite softer (fig. S20). However,
hibited zero resistance change at 100% strain rigid conductive filler-based conductors (fig. the deformation and crack-bridging effect of
(R/Ro = 1.00) and excellent electromechanical S18). The electromechanical properties of our the LMP substantially toughen the polymer
decoupling at 600, 2000, and 4100% strain LMPNet conductor result from not only the matrix (27). We investigated how the LMPnano
(R/Ro = 1.41, 5.18, and 20.8, respectively) (Fig. deformation of the LMPs but also the struc- affects the mechanical properties of the com-
2B and fig. S12). It has excellent environmental ture of the assembled LMP network. The de- posite. As discussed above, LMPnano behaves
stability (phosphate-buffered saline, 16 weeks), formation of LMPs is size dependent, with like a solid particle in PU and thus has a
thermal stability (fig. S13), and high cyclic sta- nanosized LMPnano mimicking the behavior of stiffening effect on the PU matrix (Fig. 2D and
bility (15,000 cycles at 100% strain, 8000 cycles solid particles (24). We performed theoretical fig. S21). LMPnano also improved the stretch-
at 300% strain, and 1200 cycles at 500% strain) simulations and confirmed this size-dependent ability and toughness of the composite (Fig. 2D)
(Fig. 2C and fig. S14). We investigated the deformation of LMPs in the polymer (fig. S19) because of the additional energy dissipation
effects of the strain rate and LM volume (24–26). When LMPNet was stretched, we ob- mechanism facilitated by the reversible as-
fraction on the electromechanical behavior served that large LMPs deformed to ellipsoidal sembly of the LMPNet (fig. S22).
of the LMPNet conductor. The LMPNet exhib- structures and the LMPnano’s between large The interfacial adhesion problem of LMP
its a stable electrical performance during dy- LMPs were intact (fig. S1). The dissimilar de- conductors with rigid electronic chips is severe
namic stretching, regardless of the strain rate formation of the LMPs of two different sizes in E-PCB. Owing to the low toughness of LMP,
(fig. S15) and the LM volume fraction (fig. enables the realization of a mechanically and electronic chips are easily delaminated from con-
S16). We also confirmed its imperceptible electrically resilient percolation network (Fig. 1C). ductive lines by cohesive failure when stretched.
Fig. 4. LMPNet in various polymers. (A) Young’s modulus of various polymer matrices compositions; the data demonstrate that various types of metals with low melting points
used for LMPNet formation. (B) Stress–strain curves of the LMPNet formed in various can also be used to form the LMPNet (n = 4, where n is the number of samples that
polymers (plastic, elastomer, self-healing polymer, silicon-based polymer, fluoropolymer, are used to generate statistical data). (E) Digital image (top left), optical microscopy
and hydrogel); the data reveal that the mechanical properties can be tuned by choosing image (top right, bottom left), and thickness profile (bottom right) of a photopatterned
an appropriate polymer. (C) Resistance of the LMP–polymer and LMPNet–polymer LMPNet. (F) Schematic illustration of various electrodes (left) and their impedance spectra
composites based on diverse polymer matrices. The LMPNet shows low electrical (right); gold electrode (yellow), dried LMP–hydrogel (gray), dried LMPNet–hydrogel
resistance (<5 ohms), regardless of the host matrix (n = 4, where n is the number of (red), and swollen LMPNet–hydrogel (blue). Swollen LMPNet–hydrogel exhibits the lowest
samples that are used to generate statistical data). (D) Melting point (top) and resistance impedance owing to the penetration of ions into the hydrogel (left). (G) Optical microscopy
(bottom) of the LMPNet formed from four types of liquid metal alloys with different images (top) and digital images (bottom) of a damaged and self-healed LMPNet.
Our LMPNet–PU lines afford high interfacial deformation even without the aid of an en- from our LMPNet conductive lines, and no deg-
adhesion energy (596 J/m2) with various engi- capsulation layer. radation of the electrical properties was noted
neered surfaces. This can be attributed to the One of the major challenges of the reported upon scotch-taping, scratching, or stretching
adhesion properties of PU and efficient energy LMP-based conductors is the leakage of the the conductive lines (Fig. 2F and fig. S25). The
dissipation facilitated by the LMPNet (Fig. 2E LM owing to the continuous rupture of LMPs mechanical robustness of the LMPNet can be
and fig. S23). As demonstrated in fig. S24 and by mechanical stimuli. For example, upon attributed to both the high toughness of the
movie S1, a commercial micro–light-emitting scratching or stretching, several LM droplets LMPNet–PU and the relatively small size of the
diode (mLED) bonded to LMPNet–PU lines ex- emerged from the conductive lines (fig. S8). LMPs. In this study, we used LMPs with an
hibited stable performance under dynamic By contrast, no LM leakage could be observed average size of 2 mm as the main component of
the LMPNet. In previously reported LMP systems outcome can be expected if LMPnano is mixed REFERENCES AND NOTES
(14, 15, 19), large LMPs (more than 10 mm) were with LMPs in the conductive ink. However, 1. S. I. Rich, R. J. Wood, C. Majidi, Nat. Electron. 1, 102–112
used to achieve high conductivity. We exper- we could not observe any evolution of the (2018).
2. D. Rus, M. T. Tolley, Nature 521, 467–475 (2015).
imentally confirmed the LM leakage issue in percolation network, which indicated that 3. D.-H. Kim et al., Science 333, 838–843 (2011).
the case of an LMPNet with LMP sizes of >5 mm LMPnano did not interconnect the LMPs (in- 4. S. Wang et al., Nature 555, 83–88 (2018).
(fig. S8). Notably, we achieved a high conductivity sulating) (fig. S32). 5. D.-H. Kim et al., Nat. Mater. 9, 511–517 (2010).
of the LMPNet even with 2-mm LMPs (Fig. 2A). To realize E-PCB, we confirmed the process- 6. Y. Liu et al., Nat. Biomed. Eng. 3, 58–68 (2019).
7. Y. Wang et al., Sci. Adv. 3, e1602076 (2017).
To understand how LMPnano is generated ability of the LMPNet conductor. Our LMPNet
8. M. Park et al., Nat. Nanotechnol. 7, 803–809 (2012).
by an acoustic field, we studied multiple possi- conductor provides an excellent platform via a 9. N. Matsuhisa et al., Nat. Mater. 16, 834–840 (2017).
ble mechanisms (figs. S26 to S27). The acous- printing process for the fabrication of E-PCB. 10. T. Sekitani et al., Nat. Mater. 8, 494–499 (2009).
tic field can generally be thought to cause a We confirmed excellent printability, stretch- 11. S. Choi et al., Nat. Nanotechnol. 13, 1048–1056 (2018).
12. Y. Kim et al., Nature 500, 59–63 (2013).
temperature increase or the collapse of nano- able vertical interconnect accesses (VIAs), and 13. N. Matsuhisa, X. Chen, Z. Bao, T. Someya, Chem. Soc. Rev. 48,
bubbles on the surface of the printed lines chip-bonding processes (figs. S33 to S35). As a 2946–2966 (2019).
(28). We did not observe any evolution of the proof of concept, we fabricated bi-layer E-PCB 14. E. J. Markvicka, M. D. Bartlett, X. Huang, C. Majidi, Nat. Mater.
17, 618–624 (2018).
percolation network when the LMP lines were and assembled integrated electronics, includ- 15. A. Fassler, C. Majidi, Adv. Mater. 27, 1928–1932 (2015).
annealed at 150°C for 1 day (fig. S28A), indi- ing a mLED array (Fig. 3, A and B; fig. S36; and 16. Z. Ma et al., Nat. Mater. 20, 859–868 (2021).
cating that the LMPnano formation is not due movie S2) and a photoplethysmography (PPG) 17. K. Parida et al., Nat. Commun. 10, 2158 (2019).
18. J. Wang et al., Adv. Mater. 30, e1706157 (2018).
to temperature increase. Further, we could sensing wearable device (Fig. 3C and fig. S37).
19. S. Veerapandian et al., Nat. Mater. 20, 533–540 (2021).
also exclude the effect of nanobubbles formed As shown in Fig. 3, B, D, and E, they can exhibit 20. S. Liu, D. S. Shah, R. Kramer-Bottiglio, Nat. Mater. 20, 851–858
in the medium and their collapse at the water/ stable electrical performance under dynamic (2021).
line interface through two experiments. If the stretching. In addition, we fabricated highly 21. Y. Lin et al., Nanoscale 10, 19871–19878 (2018).
22. S. Liu et al., ACS Appl. Mater. Interfaces 10, 28232–28241
network formation is a surface event, a thick- integrated skin electronics, in which 26 VIAs (2018).
ness dependence of the LMPNet formation is and 38 chips were assembled, and confirmed 23. N. F. Uvarov, Solid State Ion. 136–137, 1267–1272 (2000).
expected. However, the LMPNet could be gen- their robustness under biaxial stretching (Fig. 24. R. W. Style et al., Nat. Phys. 11, 82–87 (2015).
25. X.-Q. Zheng, H. Zhao, Z. Jia, X. Tao, P. X.-L. Feng, Appl. Phys.
erated even in a 60-mm-thick film with the same 3F and fig. S38). Lett. 119, 013505 (2021).
electrical conductivity as that of a 20-mm-thick Our acoustic field–based LMPNet synthesis 26. G. M. Odegard, T. C. Clancy, T. S. Gates, Polymer 46, 553–562
film (fig. S29). We covered the LMP lines with should apply to most polymer matrices. We (2005).
a thick PU film and applied an acoustic field. successfully formed LMPNet in more than 27. N. Kazem, M. D. Bartlett, C. Majidi, Adv. Mater. 30, e1706594
(2018).
We observed the successful formation of the 15 different polymers with various chemical 28. K. S. Suslick, Science 247, 1439–1445 (1990).
LMPNet, suggesting that it was not a surface and mechanical properties (Fig. 4, B and C; 29. J. Kang, J. B.-H. Tok, Z. Bao, Nat. Electron. 2, 144–150
event (fig. S28B). figs. S39 and S40; and table S2). We also con- (2019).
We hypothesize that the LMPNet formation firmed the formation of LMPNet using other 30. J. Kang et al., Adv. Mater. 30, e1706846 (2018).
occurs in three distinct steps (Fig. 1A and fig. LM alloys with different melting temperatures AC KNOWLED GME NTS
S30). First, the acoustic energy is transferred and compositions (Fig. 4D). All the LMPNet Funding: This study was supported by the National R&D
from the probe sonicator to the composite via systems exhibited high conductivity, regard- Program funded by the Ministry of Science and ICT (grant no.
the water medium. Then, the acoustic energy less of the polymer and LM. NRF-2021M3H4A1A03048658), the Basic Science Research
Program (grant no. NRF-2021R1C1C1011116), and the Wearable
accumulates at the LMP/polymer/LMP inter- The LMP Net could also be formed in a Platform Materials Technology Center (WMC, grant no. NRF-
face. As the polymer is acoustically transpar- photoresist (SU-8), which enabled the high- 2022R1A5A6000846). This study was also partially supported by
ent, the acoustic wave energy can freely travel resolution patterning of LMPNet conductive the National R&D Program (NRF-2021R1A4A1052070, NRF-
2021M3H4A3A01050378, and NRF-2022M3E5E9017759) and 2020
and reach the bottom part of the polymer film lines (Fig. 4E and fig. S41). We observed un- Joint Research Project of Institutes of Science and Technology.
(table S1). By contrast, LMPs have a high usual electrochemical features in a LMPNet– Author contributions: W.L., H.K., and J.K. conceived and designed
acoustic impedance and mostly reflect the hydrogel. We obtained the impedance spectrum the experiments. W.L. and H.K. prepared and characterized the
LMP-based stretchable conductors. I.K. and J.-W.J. programmed
wave energy. Owing to the large difference in of the LMPNet–hydrogel in the frequency range the stretchable PPG sensor for signal conditioning circuit board
acoustic impedance between the polymer and 1 to 1 × 106 Hz and observed that our LMPNet– demonstration. I.K. and W.L. fabricated the stretchable PPG
LMP, the wave energy mostly accumulates at hydrogel electrode exhibits one order of mag- sensor. W.L., H.K., H.P., H.L., J.S.P., and J.M.Y. performed scanning
electron microscopy and transmission electron microscopy. J.J.
the LMP/polymer/LMP interfaces. We con- nitude lower impedance than Au electrodes in and S.R. performed the computer simulations. W.L., H.K., and J.K.
firmed this possibility through finite element the low-frequency range (Fig. 4F and figs. S42 wrote the manuscript. All the authors discussed the results and
simulation using a simple model (fig. S31). The to S44). This observation results from the high commented on the manuscript. J.K. supervised this study.
Competing Interests: W.L., H.K., and J.K. are inventors in a
accumulated acoustic energy starts to form dual conductivity (electronic and ionic con-
patent application (Korean Patent application no. 10-2022-
nanobubbles (cavitation) at the LMP/polymer/ duction) and high surface area of the LMPNet 0036393, patent pending) that covers the formation of the
LMP interface. The final step is the genera- in the hydrogel. The initial dry LMPNet–hydrogel LMPNet in various polymers and their applications. Data and
tion of LMPnano from the original LMPs by the was only electronically conductive, whereas materials availability: All data are available in the main text or
supplementary materials. License information: Copyright ©
collapse of the nanobubbles (Fig. 1A). That is, the sample swollen with electrolyte solution 2022 the authors, some rights reserved; exclusive licensee
LMPnano is generated directly from the LMPs exhibited mixed electron and ion conduc- American Association for the Advancement of Science. No claim
without complete rupture of LMPs. This event tion, leading to extremely low impedance (6). to original US government works. https://www.sciencemag.org/
about/science-licenses-journal-article-reuse
occurs inside the LMP–polymer composite, Considering the biocompatibility of EGaIn
wherein the LMPs are immobilized. Therefore, and hydrogel matrix, our LMPNet–hydrogel SUPPLEMENTARY MATERIALS
LMPnano forms efficiently and interconnects can be designed as an implantable electrode. science.org/doi/10.1126/science.abo6631
the LMPs without moving to other free spaces Moreover, we formed an LMPNet in a self-healing Materials and Methods
Figs. S1 to S44
in the polymer matrix (fig. S1). Thus, a highly elastomer (SHE) (Fig. 4C) and investigated Tables S1 and S2
conductive LMPNet was formed through these its mechanical and electrical self-healing prop- References (31–48)
steps, in which large LMPs were compactly erties (29, 30). The LMPNet–SHE could auton- Movies S1 and S2
assembled by LMPnano with an interparticle omously restore its mechanical and electrical Submitted 17 February 2022; accepted 23 September 2022
distance of less than 2 nm (fig. S3B). A similar properties when damaged (Fig. 4G). 10.1126/science.abo6631
W
gauge of its biological importance (fig. S4A). By
ater availability is a critical limiting forms. The extent of xylem strand medullation evaluating the sensitivity of the mortality
factor for land plants (1), whose macro- is commonly underdetermined by branching threshold to stepwise topological changes, we
evolution is marked by a series of or attachment of vascular appendages, and, in effectively reconstruct the proposed dimension
hydraulic milestones that mitigated many cases, there is no direct correspondence of the fitness landscape faced by land plants.
water loss, provided control over (3). The well-known correlation of increased As xylem strand shape diverges from the
transpiration, and increased water transport medullation of the stele with plant size or axis terete haplostele, the mean number of neighbors
efficiency (2, 3). These adaptations mark dis- diameter (3, 12, 13) led Bower (7) and Wardlaw per conduit decreases (Fig. 2). This progressively
tinctions between major land plant lineages (8) to hypothesize that the latter led to the reduces the number of independent paths for
(2), each releasing plants from hydraulic con- former. Nevertheless, a physiologically account- embolism spread through the network. The
straints and thereby enabling them to expand able morphometric relationship has remained remaining paths become concentrated in fewer,
their niche space into drier environments (4). elusive (3, 10, 14). more topologically central conduits. We quantify
The earliest tracheophytes had a simple cylin- Here, we propose the idea that stelar evolu- path concentration as the squared root of the
drical (terete), centrally located vascular strand tion may have increased drought resistance sum of squares of the number of shortest paths
[stele (5)] containing xylem with tracheids as the by altering xylem network topology. To replace passing through each conduit divided by the
water conducting cells (6). This terete haplostele evaporative losses from photosynthesizing sur- total number of such paths (fig. S5). As the
shape occurs repeatedly early in the fossil record, faces, plants extract soil water under increasing logarithm of path concentration (lnPC) in-
but steles soon diversified toward more radially capillary tension as soils dry. Sufficient tension creases, fewer paths traverse the network in
elongated shapes or larger, more elaborate forms places xylem water in a metastable state, making parallel, further restricting embolism spread
(Fig. 1A) (3, 5, 6). Despite a century-long debate it increasingly vulnerable to cavitation, which at centrally located constriction points. The
over the evolutionary drivers of stele complexity blocks water transport locally with a vapor- combined effect of these changes increases
from the Devonian and Carboniferous periods phase embolus (15). Unchecked, the systemic p88 as the xylem strand becomes elongated
onward (3, 7–10), no underlying selective pres- spread of emboli leads to hydraulic network fail- or increasingly medullated (Fig. 2, B and C).
sure has been found to account for the observed ure, tissue death (16), and ultimately plant mor- Each incremental increase in complexity thus
patterns. Presently, the dominant view is that tality (17). Embolism spreads when the liquid theoretically yields a marginal improvement
changes to vascular architecture were a develop- tension in a water-filled conduit overcomes in survivorship under drought. We found up
mental artifact of increasingly branched or the air-seeding pressure (ASP) threshold of to a 2-MPa difference in p88 between the two
complex plant bodies (3, 11, 12). the pit membrane that separates it from an extreme stele shapes, leading to a potential
Coordination of the vasculature with branch- embolized one (15). Thus, conduit adjacency and doubling of the mortality threshold in some
ing or appendages is necessary for efficient connectivity make up a tissue-scale network, species (fig. S4, B and C).
plant body construction, and the ontogenetic the topology of which determines the extent Observed Paleozoic and extant pteridophyte
connection between the two is well established of embolism spread for a given ASP distrib- xylem strands span nearly the full range of
(12). Nevertheless, developmental constraints ution (18, 19). Network topology alone can both network traits, with only the most-
imposed by the requirements of coordination push the vulnerability curve, measured as the resistant ideal end points unoccupied (Fig.
across vascular traces present an insufficient cumulative proportion of xylem conductivity 2D and figs. S6 to S8). The least-drought-
explanation for many of the observed stelar lost versus water tension, toward greater re- resistant trait combinations are found exclu-
sistance to hydraulic failure (Fig. 1, B and C, sively in Paleozoic specimens [one-way analysis
1
Institute of Botany, Czech Academy of Sciences, Průhonice, and fig. S1) and thus shift the value of tension of variance (ANOVA) indicates the difference
Czechia. 2Department of Biology, Bates College, Lewiston,
that constitutes a plant’s drought mortality from extant plants with N = 60, degrees of
ME, USA. 3Yale School of the Environment, New Haven, CT,
USA. 4New York Botanical Garden, Bronx, NY, USA. 5School threshold [p88, defined as the xylem pressure freedom = 59, F > 52, and p < 0.001 on both
of Forest Resources, University of Maine, Orono, ME, USA. leading to 88% loss of conductivity (20)]. metrics and simulated p88], which corresponds
6
Department of Environmental Studies, Haverford College, Because tracheid network topology is deter- with previously established traits that re-
Haverford, PA, USA.
*Corresponding author. Email: martin.bouda@ibot.cas.cz (M.B.); mined by xylem strand shape and conduit duced their drought resistance (21, 22). Extant
craig.brodersen@yale.edu (C.R.B.) packing, we propose that stele shape may pteridophytes range down to fewer than three
A B
Protracheophytes
Initial embolism
Rhyniophyta (red)
Zosterophylls
Drepanophycales
50% spread
Lycopodiales
Protolepidodendrales
Spread repeated
Selaginellales
to completion
Isoetales
Psilophyton
Cladoxylopsids
Ferns
Final embolism extent
Stenokoleales C 1
Cumulative proportion
Embolized
Cumulative proportion
conduits embolized
Archaeopteridales (left)
Spermatophytes Air-seeding
0.5
pressure
Embolized
Silurian Devonian Carboniferous
(right)
Fig. 1. Xylem strand shapes that are associated with increasing drought In both example steles, the scenario represents a worst-case initial embolism
tolerance. (A) Evolutionary relationships between the tracheophytes position and maximum likelihood spread when water tension corresponds
and their stratigraphic ranges. Representative xylem strand shapes of to the median conduit ASP: Embolism spreads from each cell to about
Paleozoic (boxes with dashed borders) and extant (boxes with solid borders) half of its neighbors. Our formal simulations randomized initial position
vascular plants show a trajectory from the simple terete haplostele to and ASP of individual conduit walls over N = 5000 replicates per tension
the more-elongated or deeply medullated xylem strand shapes that are level. (C) Corresponding vulnerability curves show that xylem strand
observable in more recent taxa. (B) Conceptual model of the spread shape alone can increase drought resistance, regardless of initial embolus
of embolism (red) from a single conduit in two different xylem strand shapes. position in the network.
neighbors per conduit and tend to keep below drought-resistant topologies on extant mesic embolism resistance, drought was likely a
a lnPC of 0, with notable exceptions such as species. A simple correlation is likely to be major driver of the changes in stelar morphol-
the long, narrow, corrugated xylem strand further confounded by the fact that drought ogy that have been observed over evolution-
of Dicksonia antarctica or the apparent resistance is a complex plant property that ary history. Because our Paleozoic species are
protostele with deep parenchymal intru- involves many traits operating at multiple thought to have occupied various wetland
sions of Lygodium microphyllum (figs. S3 and spatial and temporal scales, including pit mem- habitats (25), our observations are fully con-
S9). Although the two metrics are partially brane properties, stomatal behavior, leaf struc- sistent with the idea of selection for resistant
correlated, these results suggest that both ture, drought deciduousness, root hydraulic topologies in drier environments at this macro-
local reduction in connectivity and overall architecture, and their physiological coordina- evolutionary scale.
shape change can yield increasingly drought- tion (24). Moreover, available habitat informa- Network trait analysis allows us to restate
resistant xylem. tion fails to account for possible confounding the Bower-Wardlaw hypothesis (7, 8) as quan-
Among extant species, we found vulnerable microclimate effects. Unaccountable microsite titative predictions on how conduit network
topologies only in species limited to ever-moist differences in wetness would further under- topology will diverge from the terete arrange-
environments (Fig. 2D and table S1 for habitat mine a direct correlation. Nevertheless, across ment as xylem strands grow in the number
information). Whereas we did find mesic plant taxa, habits, and habitats and across a of conduits, owing to a selection pressure by
species with both relatively vulnerable (e.g., wide range in drought tolerance, mortality is hydraulic failure. As conduits are added to a
Selaginella selaginoides) and resistant xylem known to occur after stomatal closure only xylem strand that maintains a terete shape,
topologies (Osmunda regalis), we only found once embolism begins to spread in the xylem vulnerability increases. By contrast, straps or
xeric species with resistant ones (e.g., Astrolepis (1). Resistance to embolism spread is thus a lobed shapes yield more-resistant topologies
sinuata, Cheilanthes distans). Because no coun- key trait that provides a marginal increase in as they grow if the independent lobes remain
tervailing selection pressure is known to favor survivorship among vascular plants on the sufficiently narrow (Fig. 3A). Lineages that
less-medullated steles in moister conditions, verge of drought mortality. To the extent increase xylem strand size while maintaining
evolutionary legacies (23) may confer more- that xylem network topology contributes to the same ASP distribution should thus be
0 1 2 3 4 5 6 7 8 3
B C
A Log conduit betweenness centrality
P88 ( ASP)
1
0
2 3 4 5 -1 -0.5 0 0.5 1 1.5
Mean number of neighbors Log path concentration
0.5 D
Increasing drought resistance
-0.5
Extant
-1 Extinct
Selaginella
Lycopodiaceae
Other Lycophytes
Ferns
-1.5 Basal lineages ii
i
Fig. 2. Theoretical drought-resistance effects of xylem strand shape. (A) Increasingly resistant shapes in annular, elliptical, three-lobed, and six-lobed series
used in drought simulations. (B) p88 versus mean number of neighbors per conduit. (C) p88 versus the lnPC. (D) Placement of empirical conduit networks of
60 species in space defined by the number of neighbors and lnPC (see table S1 for full list). The insets indicate stele shapes of selected species; species i to v are
noted in the main text.
Extant
A i
Extinct
4 Linear limit (i)
Simulated P88 ( ASP)
1
v i 1
vi
vii
0
viii
ix vi
0 B ix
3 i ii 6 ix
C D
Log path concentration
Number of neighbors
2 5
vii
1 4
iii
0 3
viii
-1
2 i
iv
-2 ix
1
8 16 32 64 128 256 512 1024 2048 8 16 32 64 128 256 512 1024 2048
Number of conduits in xylem strand v ix Number of conduits in xylem strand
Fig. 3. Xylem strand size, conduit network topology, and drought resistance. (A to D) Trajectories (A) of the mortality threshold with increasing number of
conduits in selected shapes (i to ix). The simulated p88 (B), lnPC (C), and number of neighbors per conduit (D) versus number of conduits in a xylem strand for N =
60 species, overlain on null model distributions of the network traits and their upper and lower bounds.
16. T. Brodribb et al., New Phytol. 232, 68–79 (2021). ACKN OWLED GMEN TS contributions: Conceptualization: M.B., C.R.B., J.W.W.,
17. M. Mantova, S. Herbette, H. Cochard, J. M. Torres-Ruiz, We thank P. Crane for early discussions of this work. We thank J.P.W.; Methodology: M.B., C.R.B., B.A.H.; Software: M.B.;
Trends Plant Sci. 27, 335–345 (2022). B. Ambrose (New York Botanical Garden), C. Jones and Formal analysis: M.B.; Investigation: M.B., C.R.B., K.A.P., B.A.H.,
18. A. Mrad, J.-C. Domec, C.-W. Huang, F. Lens, G. Katul, Plant Cell M. Opel (University of Connecticut), and K. Kim (Yale Marsh J.P.W.; Resources: M.B., C.R.B., J.P.W.; Visualization: M.B.,
Environ. 41, 2718–2730 (2018). Botanical Garden) for access to plant material used in this C.R.B.; Funding acquisition: C.R.B.; Writing – original draft:
19. J. Wason et al., Plant Physiol. 186, 373–387 (2021). study. We further thank J. Galtier, B. Meyer-Berthaud, and M.B., C.R.B.; Writing – review and editing: M.B., C.R.B., J.W.W., K.A.P.,
20. Materials and methods are available as supplementary materials. A.-L. Decombeix for images and discussions of Devonian and B.A.H., J.P.W. Competing interests: The authors declare that they
21. J. P. Wilson, A. H. Knoll, Paleobiology 36, 335–355 Carboniferous vascular plants. A. Gandolfo of the Cornell have no competing interests. Data and materials availability: All raw
(2010). University Plant Anatomy Collection and S. Hu of the Yale images and data used in the analysis, including all data reported in
22. J. P. Wilson, Paleontol. Soc. Papers 19, 175–194 Peabody Paleobotanical collection provided access to images and figures here, as well as all original code required to perform the
(2013). specimens of fossilized plants. We also thank M. Duguid and analysis in this work are available online at OSF (31). License
23. J. Cavender-Bares, D. D. Ackerly, S. E. Hobbie, P. A. Townsend, L. Green of Yale for their assistance in locating several of the information: Copyright © 2022 the authors, some rights reserved;
Annu. Rev. Ecol. Evol. Syst. 47, 433–462 (2016). ferns and lycophytes used in this study at the Yale Myers Forest. exclusive licensee American Association for the Advancement of
24. B. Choat et al., Nature 558, 531–539 (2018). The S. selaginoides accession was collected by S. Lavergne. Science. No claim to original US government works. https://www.
25. S. F. Greb, W. A. DiMichele, R. A. Gastaldo, in Wetlands Through We thank three anonymous reviewers for their insightful science.org/about/science-licenses-journal-article-reuse
Time, vol. 399 (Geological Society of America, 2006). comments that greatly improved previous drafts of this
26. B. Chen et al., Earth Sci. Rev. 222, 103814 (2021). manuscript. Funding: J.W.W. was partially supported by the SUPPLEMENTARY MATERIALS
27. M. Larter et al., New Phytol. 215, 97–112 (2017). US Department of Agriculture, National Institute of Food and
science.org/doi/10.1126/science.add2910
28. H. J. Schenk et al., Proc. Natl. Acad. Sci. U.S.A. 105, Agriculture, McIntire Stennis Project number ME0-42121 through
Materials and Methods
11248–11253 (2008). the Maine Agricultural and Forest Experiment Station. B.A.H.
Figs. S1 to S10
29. A. H. Knoll, K. J. Niklas, B. H. Tiffney, Science 206, 1400–1402 was supported by the Phillips Fellowship, Bates College. M.B. and
Table S1
(1979). C.R.B. were supported by the Newman Family Plant Research
References (32–100)
30. K. J. Niklas, B. H. Tiffney, A. H. Knoll, Nature 303, 614–616 Fund. M.B. was partially supported by long-term research
Movies S1 to S4
(1983). development project no. RVO 67985939 of the Czech Academy
31. M. Bouda et al., Supplementary raw data and code for the of Sciences. Computational resources were supplied by the View/request a protocol for this paper from Bio-protocol.
manuscript “Drought resistance as a primary driver of stelar project “e-Infrastruktura CZ” (e-INFRA CZ LM2018140 and
evolution in early vascular plants”. OSF (2022); https://doi. e-INFRA CZ ID:90140) supported by the Ministry of Submitted 2 June 2022; accepted 13 October 2022
org/10.17605/OSF.IO/9AMBV. Education, Youth and Sports of the Czech Republic. Author 10.1126/science.add2910
I
strongly depends on the physical state of the
solated neutron stars (NSs) with extremely to 100 keV) x-rays, with luminosity L ≈ 1038 to NS external layers. If radiation comes from
strong magnetic fields are referred to as 1047 erg s−1 and duration ≈ 0.1 to 100 s. Mag- the bare, condensed surface, the polarization
magnetars (1). There are ~30 confirmed netars also exhibit persistent x-ray emission at is expected to be ≲10% , but a magnetized
magnetars known (2), many of which are L ≈ 1033 to 1035 erg s−1, which is pulsed at spin atmosphere can produce polarization ≲80%
detectable only during periods of enhanced frequencies f ≈ 0.1 to 10 Hz with spin-down (6–8). The polarization of outgoing photons
rates f ≈ ð1016 to108 ÞHzs1. These proper-
activity. Magnetar emission is powered by the is then modified by RCS, which leads to a
magnetic field, producing bursts of hard (≈10 ties indicate high magnetic fields B ≲ 1015 G, polarization degree≲30% in the X mode for the
1
Department of Physics and Astronomy, University of Padova, I-35131 Padova, Italy. 2Mullard Space Science Laboratory, University College London, Holmbury St Mary Dorking RH5 6NT, UK. 3Istituto di Astrofisica e
Planetologia Spaziali, Istituto Nazionale di Astrofisica (INAF), I-00133 Roma, Italy. 4Department of Physics and Astronomy, University of British Columbia, Vancouver, BC V6T 1Z1, Canada. 5Dipartimento di Fisica
Enrico Fermi, Università di Pisa, I-56127 Pisa, Italy. 6Istituto Nazionale di Fisica Nucleare (INFN) Sezione di Pisa, I-56127 Pisa, Italy. 7Osservatorio Astronomico di Cagliari, INAF, I-09047 Selargius, Italy. 8Theoretical
AstroPhysics Including Relativity and Cosmology, Caltech, Pasadena, CA 91125, USA. 9Deparment of Physics and Kavli Institute for Particle Astrophysics and Cosmology, Stanford University, Stanford, CA 94305,
USA. 10Institut für Astronomie und Astrophysik, Universität Tübingen, 72076 Tübingen, Germany. 11Physics Department and McDonnell Center for the Space Sciences, Washington University, St. Louis, MO 63130,
USA. 12Center for Space Sciences and Technology, University of Maryland, Baltimore, MD 21250, USA. 13NASA Goddard Space Flight Center (GSFC), Greenbelt, MD 20771, USA. 14Center for Research and
Exploration in Space Science and Technology, NASA/GSFC, Greenbelt, MD 20771, USA. 15Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology, Cambridge, MA 02139, USA.
16
RIKEN Cluster for Pioneering Research, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan. 17RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan. 18Department of Physics, Tokyo University of
Science, 1-3 Kagurazaka, Shinjuku, Tokyo 162-8601, Japan. 19NASA Marshall Space Flight Center (MSFC), Huntsville, AL 35812, USA. 20Instituto de Astrofísica de Andalucía, 18008 Granada, Spain. 21Osservatorio
Astronomico di Roma, INAF, 00040 Monte Porzio Catone, Italy. 22Space Science Data Center (SSDC), Agenzia Spaziale Italiana (ASI), 00133 Roma, Italy. 23Dipartimento di Matematica e Fisica, Università degli
Studi Roma Tre, 00146 Roma, Italy. 24INFN Sezione di Torino, 10125 Torino, Italy. 25Dipartimento di Fisica, Università degli Studi di Torino, 10125 Torino, Italy. 26Osservatorio Astrofisico di Arcetri, INAF, 50125
Firenze, Italy. 27Dipartimento di Fisica e Astronomia, Università degli Studi di Firenze, 50019 Sesto Fiorentino, Italy. 28INFN Sezione di Firenze, 50019 Sesto Fiorentino, Italy. 29ASI, 00133 Roma, Italy. 30INFN Sezione
di Roma Tor Vergata, 00133 Roma, Italy. 31Astronomical Institute of the Czech Academy of Sciences, 14100 Praha 4, Czech Republic. 32Cahill Center for Astronomy and Astrophysics, Caltech, Pasadena, CA 91125,
USA. 33Department of Physics, Yamagata University, 1-4-12 Kojirakawa-machi, Yamagata-shi 990-8560, Japan. 34Department of Earth and Space Science, Osaka University, 1-1 Yamadaoka, Suita, Osaka 565-0871,
Japan. 35Department of Physics, Chuo University, 1-13-27 Kasuga, Bunkyo-ku, Tokyo 112-8551, Japan. 36Institute for Astrophysical Research, Boston University, Boston, MA 02215, USA. 37Laboratory of
Observational Astrophysics, St. Petersburg University, St. Petersburg 199034, Russia. 38Finnish Centre for Astronomy with the European Southern Observatory, University of Turku, 20014 Turku, Finland.
39
Observatoire Astronomique de Strasbourg, Université de Strasbourg, 67000 Strasbourg, France. 40Division of Particle and Astrophysical Science, Graduate School of Science, Nagoya University, Furo-cho,
Chikusa-ku, Nagoya, Aichi 464-8602, Japan. 41Hiroshima Astrophysical Science Center, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8526, Japan. 42Department of Physics, The
University of Hong Kong, Pokfulam, Hong Kong. 43Department of Astronomy and Astrophysics, Pennsylvania State University, University Park, PA 16801, USA. 44Department of Physics and Astronomy,
University of Turku, 20014 Turku, Finland. 45Space Research Institute of the Russian Academy of Sciences, Moscow 117997, Russia. 46Center for Astrophysics, Harvard & Smithsonian, Cambridge, MA
02138, USA. 47Osservatorio Astronomico di Brera, INAF, 23807 Merate, Italy. 48Dipartimento di Fisica, Università degli Studi di Roma Tor Vergata, 00133 Roma, Italy. 49Anton Pannekoek Institute for Astronomy,
University of Amsterdam, 1098 XH Amsterdam, Netherlands. 50Guangxi Key Laboratory for Relativistic Astrophysics, School of Physical Science and Technology, Guangxi University, Nanning 530004, China.
*Corresponding author. Email: taverna@pd.infn.it
†Deceased.
PL component, independent of the initial po- detectable polarization at 99% confidence level
larization state of the thermal photons (7–9). 050547, where MJD is the modified Julian (MDP99) for our observation is ~2% over the
Because NSs cannot be spatially resolved by date); uncertainties are 68.3% confidence. 2- to 8-keV range, so the significance of the
observations, the contributions from regions These values are consistent with previous nonzero polarization degree is ~17s.
with different magnetic field orientations (and measurements, within the uncertainties (12). To investigate whether the PD and PA de-
therefore with different emitted polariza- We performed a spectral analysis using the pend on the photon energy, the data were
tion orientations) are blended together, which software package XSPEC (16), version 12.12.1. grouped into five energy bins, which were se-
reduces the observed polarization (10, 11). How- The data are not consistent with a single- lected to contain similar numbers of counts in
ever, if the magnetic field is strong enough component model, so we considered several each bin. Figure 2 shows a polar plot of the
(5), it forces the photon polarization vec- two-component models (15). In all models, we results. We find that the PD is 15.0 ± 1.0% at
tors to follow the magnetic field direction, fixed the value of the foreground interstellar low energies (~2 to 4 keV), ~10s above the
which results in an observed polarization column density to 0.57 × 1022 cm−2 (17); it can- MDP99 of that bin, which is ~4%. At 4 to 5 keV,
almost unchanged from that at the emission not be constrained by the IXPE data because the PD is consistent with zero. In the highest-
(10, 11). of insufficient sensitivity below 2 keV. Our energy bin (5.5 to 8 keV), the PD is 35.2 ± 7.1%,
The magnetar 4U 0142+61 (coordinates right best-fitting parameters for a BB + PL model where the MDP99 is ~21%. The PA is ~50° at
ascension 01h 46m 22s.41, declination 61° 45′ (table S2) are consistent with previous mea- energies below 4 keV and −40° above 5 keV, a
03″.2, J2000 equinox) has a persistent (lightly surements (17, 18). swing of 90°.
variable) x-ray flux of ~6 × 10−11 erg s−1 cm−2 in Polarization was measured by extracting the We also performed a spectropolarimetric
the 2- to 10-keV range, a spin frequency of (calibrated) Stokes parameters I, Q, and U analysis by separately convolving the low-
f = 0.12 Hz, and a frequency derivative of from each photon, which were collected by the and high-energy spectral components with a
f ¼ 2:6 1014 Hzs1 . This implies a spin-
three independent IXPE detector units (DUs). constant polarization model (POLCONST in XSPEC).
down (equatorial) magnetic field of B ~ 1.3 × After subtracting the sky background, the con- This confirms the 90° swing in polarization angle
1014 G (2, 12). It is visible at infrared and tributions of each DU were combined to ac- for all the two-component spectral models we
optical wavelengths (13), but no (pulsed) radio count for the 120° offset between the DUs. considered: BB + BB, BB + PL, and BB + trun-
emission has been detected. Figure 1 shows the phase-averaged, normal- cated PL (15). For the latter model, the derived
We observed 4U 0142+61 with the Imaging ized Stokes parameters (Q/I and U/I) in the PD for the two components is within ~1s of the
X-ray Polarimetry Explorer (IXPE) (14) be- 2- to 8-keV energy range for the individual DUs observed values, with the low-energy BB com-
tween 31 January 2022 and 27 February 2022 and the combined data. The phase-averaged, ponent being less polarized than the high-
for a total on-source time of 840 ks. IXPE energy-integrated values are Q/I = 0.013 ± energy PL (15).
provides imaging polarimetry over a nominal 0.008 and U/I = 0.120 ± 0.008, which ffi implies a
pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi To perform a phase-dependent analysis, we
energy band of 2 to 8 keV. The data were polarization degree PD≡ Q2 þ U 2 =I of 13.5 ± divided the flux into 100 phase bins and used
extracted and processed according to stan- 0.8% and a polarization angle PA≡arctanðU = an unbinned maximum likelihood technique
dard procedures (15). Pulsations were detected QÞ=2 of +48.5° ± 1.6°, with positive values (19) to determine the PD and PA. Figure 3A
(fig. S3) at f = 0.115079336 ± 6 × 10−9 Hz with being east of (local celestial) north; uncertain- shows the resulting pulse profile, which is
ties are 1s. We derived these values using two double peaked, as found in previous obser-
different methods and found consistent re- vations (18). Phase variations are evident in
sults (15). We determined that the minimum both PD and in PA (Fig. 3, B and C), with
amplitudes of ~10% and ~30°, respectively. fraction (~15%) than the phase valley between densed (solid or liquid) surface (6–8, 23). The
At low energies (2 to 4 keV), we find the main them (~9%). By contrast, the phase-resolved IXPE result below 4 keV is not compatible
and secondary peaks have higher polarization PA is single peaked. This is consistent with the with the presence of an atmosphere and only
predictions of pulsar (a different type of NS) marginally compatible with a condensed sur-
models [specifically the rotating-vector model face. The latter would be more consistent with
(20)], although a strong degeneracy prevents the data if the PD could be raised in the model,
us from determining the NS spin and mag- perhaps by thermal radiation being emitted
netic axes orientations from the PA data (15). from only a limited region, not the entire sur-
A phase-resolved spectral analysis of 4U face (as was assumed in previous calculations).
0142+61 shows no statistically significant de- The low pulsed fraction at low energies (18)
pendence of the spectrum on rotational phase indicates an extended emitting area. Using a
(15). The BB component is compatible with numerical code (7), we calculated that radia-
being constant in phase (fig. S5), which is con- tion from a condensed iron surface, emitted
sistent with previous results (21) and previous from an equatorial belt, produces O-mode
observations of a low pulsed fraction (~5%) photons at low energies (2 to 4 keV) with PD
below 3 to 4 keV (18). ~15%. Reprocessing by RCS then produces
We considered the IXPE results within a an excess of X-mode photons at higher en-
twisted-magnetosphere model (4), account- ergies (5.5 to 8 keV) with PD ~35%, whereas
ing for the quantum electrodynamical effect the PA changes by 90°. Our calculation does
of vacuum birefringence (7–9). The ob- not assume that the reference direction in the
served polarization behavior as a function plane of the sky (from which the PA is com-
of energy—with a minimum PD and a 90° puted) coincides with the projection of the NS
swing of PA at 4 to 5 keV—indicates that the spin axis. To match the measured and pre-
2- to 8-keV x-ray emission from 4U 0142+61 dicted (absolute) values, an offset is added to
has two distinct components, polarized in two the simulated PA (15). Figure 2 shows the re-
different normal modes, which correspond to sults of our numerical simulation for a mag-
the two components identified in the spectral netic field strength ~1014 G, as measured for
analysis. In this framework, the low-energy 4U 0142+61 (18), assuming the emissivity of an
component is produced by thermal emission iron condensed surface (23), in the fixed-ion
from the surface of the NS, whereas the high- approximation. A hotter belt close to the mag-
energy component is produced by photons netic equator appears in NS magnetothermal
scattered to higher energies in the magneto- evolution calculations in both two and three
sphere (Fig. 4A). The measured polarization dimensions (24, 25).
fraction at high energies (~35% at 5.5 to 8 keV) We also consider alternative models to ex-
is compatible with the theoretical prediction of plain the IXPE data. Within the RCS para-
the RCS model (7) and indicates that X-mode digm, low-energy O-mode photons could be
Fig. 3. Phase-dependent x-ray flux and polariza- photons dominate at high energies; converse- produced by a gaseous layer with an inverted
tion properties. (A) Energy-integrated (2 to 8 keV) ly, O-mode photons dominate at low energies. temperature profile, with a downward flow
IXPE counts as a function of spin phase. Error bars are Theoretical models for magnetar surface of energy, as might be produced by external
at 1s confidence level. (B) Polarization degree as a emission of soft x-rays predict either (i) a particle bombardment (26). In this case,
function of spin phase. Error bars indicate DlogL = 1, large ð≳50%Þ polarization degree in the X O-mode photons would escape from a deeper
where L is the unbinned likelihood (19). (C) Same as mode if there is a gaseous atmosphere heated (and so hotter) region than in a passively cool-
(B), but for the polarization angle. The orange curve from below (22) or (ii) a small ≲10% polariza- ing atmosphere and would dominate the
shows the best-fitting rotating vector model (15). tion degree in the O mode if there is a con- outgoing flux.
In an alternative scenario, the low-energy cess (30). We are unable to distinguish between AC KNOWLED GME NTS
emission could be interpreted as polarized in these possibilities. We thank three anonymous referees for helpful and constructive
the X mode and the high-energy emission, We have detected (linearly) polarized x-ray comments that improved the paper. This paper is based on
observations made by the IXPE, a joint US and Italian mission.
above 4 to 5 keV, in the O mode. Low-energy, emission from the magnetar 4U 0142+61. The The US contribution to the IXPE mission is supported by
X mode–dominated emission with a low po- polarization properties vary with x-ray energy, NASA and led and managed by the MSFC with industry partner
larization degree (~15%) could originate from including a 90° swing of the polarization Ball Aerospace (contract NNM15AA18C). The Italian contribution
is supported by ASI through contract ASI-OHBI-2017-12-I.0,
an extended region of a condensed iron sur- angle. These observations can be explained agreements ASI-INAF-2017-12-H0 and ASI-INFN-2017.13-H0 and
face seen few degrees away from the magnetic by a model of emission from the bare con- the SSDC with agreements ASI-INAF-2022-14-HH.0 and ASI-
axis. Radiation from a thin atmosphere or densed surface of the NS that is reprocessed by INFN 2021-43-HH.0, and by INAF and INFN. Data products were
provided by the IXPE Team (MSFC, SSDC, INAF, and INFN)
corona in the presence of thermal photons RCS in a twisted magnetosphere. Alternative and distributed with additional software tools by the High-
that are undergoing Compton scattering (8) explanations are also possible. Energy Astrophysics Science Archive Research Center
could produce the observed polarization at (HEASARC) at NASA GSFC. Funding: R.Ta. and R.Tu.
acknowledge financial support from the Italian MUR through
low energies. However, this scenario does not RE FERENCES AND NOTES grant PRIN 2017LJ39LM. J.H., D.G.-C., I.C., and D.K.
explain how O-mode photons would dominate 1. R. C. Duncan, C. Thompson, Astrophys. J. 392, L9 (1992). acknowledge the support of the Natural Sciences and
the emission in the 5- to 8-keV band. Saturated 2. S. A. Olausen, V. M. Kaspi, Astrophys. J. Suppl. Ser. 212, 6 (2014). Engineering Research Council of Canada (NSERC), funding
3. V. M. Kaspi, A. M. Beloborodov, Annu. Rev. Astron. Astrophys. reference number 5007110, and the Canadian Space Agency.
Compton scattering in a thin atmosphere 55, 261–301 (2017). D.G.-C. is a Canadian Institute for Theoretical Astrophysical
or corona (8) or emission from an electron- 4. C. Thompson, M. Lyutikov, S. R. Kulkarni, Astrophys. J. 574, (CITA) National Fellow (grant no. CITA 490888-16). E.G. and
positron plasma (27) could potentially produce 332–355 (2002). H.K. acknowledge NASA support under grants 80NSSC18K0264,
5. A. K. Harding, D. Lai, Rep. Prog. Phys. 69, 2631–2708 (2006). 80NSSC22K1291, 80NSSC21K1817, and NNX16AC24G.
O mode–dominated radiation (Fig. 4B), but
6. D. González Caniulef, S. Zane, R. Taverna, R. Turolla, K. Wu, M.Ne. acknowledges support from NASA under award
these models predict a much higher PD than Mon. Not. R. Astron. Soc. 459, 3585–3595 (2016). 80GSFC21M0002. T.T. was supported by grant JSPS KAKENHI
is observed. Emission from a small region of 7. R. Taverna, R. Turolla, V. Suleimanov, A. Y. Potekhin, S. Zane, JP19H05609. F.Mu., J.R., S.B., E.Co., E.D.M., A.D.M., Y.E., S.F.,
Mon. Not. R. Astron. Soc. 492, 5057–5074 (2020). R.F., F.L.M., G.M., M.Pe., A.R., P.So., and A.T. were supported
the surface that is covered by an externally
8. I. Caiazzo, D. González-Caniulef, J. Heyl, R. Fernández, by ASI and INAF under grants ASI-INAF-2017-12-H0 and ASI-
illuminated gaseous layer but hot enough to Mon. Not. R. Astron. Soc. 514, 5024–5034 (2022). INAF-2022-14-HH.0. L.B., L.L., R.Be., R.Bo., A.B., S.Ca., S.M.,
dominate the high-energy band would also 9. R. Fernández, S. W. Davis, Astrophys. J. 730, 131 (2011). A.Mar., C.O., M.P.-R., C.S., and G.S. were supported by ASI and
produce substantial polarization in the O mode. 10. R. Taverna et al., Mon. Not. R. Astron. Soc. 454, 3254–3266 (2015). INFN under grants ASI-INFN-2017.13-H0 and ASI-INFN-2021-43-
11. J. S. Heyl, N. J. Shaviv, D. Lloyd, Mon. Not. R. Astron. Soc. 342, HH.0. Author contributions: R.Ta., R.Tu., F.Mu., J.H., S.Z.,
No detailed modeling of these scenarios is 134–144 (2003). L.B., J.R., and M.C.W. planned the observing campaign. R.Ta.,
available. 12. R. Dib, V. M. Kaspi, Astrophys. J. 784, 37 (2014). R.Tu., F.Mu., J.H., S.Z., L.B., J.R., D.G.-C., M.B., I.C., N.D.L., E.G.,
Identifying the mode in which the observed 13. F. Hulleman, M. H. van Kerkwijk, S. R. Kulkarni, Nature 408, D.K., H.K., M.Ne., M. Ng, N.O., A.Po., T.T., and K.U. analyzed
689–692 (2000). the data. R.Ta., R.Tu., F.Mu., J.H., S.Z., L.B., J.R., D.G.-C., M.B.,
x-ray photons are predominantly polarized 14. M. C. Weisskopf et al., J. Astron. Telesc. Instrum. Syst. 8, I.C., A.Po., T.T., and K.U. modeled the data. R.Ta., R.Tu., F.Mu.,
would determine the orientation of the mag- 026002 (2022). J.H., S.Z., L.B., J.R., D.G.-C., M.B., and A.Po. wrote the
netar spin axis projected onto the plane of the 15. Materials and methods are available as supplementary manuscript. V.D. and M.E. served as internal reviewers. All the
materials. other authors contributed to the design and science case of
sky. The phase-averaged PA is 0° (or 90°) for 16. K. A. Arnaud, Astronomical Data Analysis Software and Systems the IXPE mission and to the planning of the observations in this
radiation mostly polarized in the O mode (or X V, G. H. Jacoby, J. Barnes, Eds. (Astronomical Society of the paper. All authors provided input and comments on the
mode), taking the reference direction in the Pacific Conference Series, vol. 101, 1996), p. 17. manuscript. Competing interests: The authors declare there
17. P. R. den Hartog et al., Astron. Astrophys. 489, 245–261 (2008). are no competing interests. Data and materials availability: The
plane of the sky to be along the spin axis 18. N. Rea et al., Mon. Not. R. Astron. Soc. 381, 293–300 (2007). IXPE observation of 4U 0142+61 is available in the HEASARC
projection (10). If O-mode photons dominate 19. D. González-Caniulef, I. Caiazzo, J. Heyl, Unbinned likelihood IXPE Data Archive https://heasarc.gsfc.nasa.gov/docs/ixpe/
at low energies at which PA ~ 50°, as in the analysis for x-ray polarization. arXiv:2204.00140 [astro-ph.IM] archive/ under ObsID 01003299. The IXPE software is available
(2022). at https://github.com/lucabaldini/ixpeobssim and documented
RCS model, the projection of the spin axis 20. V. Radhakrishnan, D. J. Cooke, Astrophys. J. Lett. 3, 225 (1969). at https://ixpeobssim.readthedocs.io. Our measured
would be ~50° east of north. Conversely, if 21. S. P. Tendulkar et al., Astrophys. J. 808, 32 (2015). polarizations are listed in table S2, and the results of our model
low-energy photons are polarized in the X 22. A. Y. Potekhin, G. Chabrier, W. C. G. Ho, Astron. Astrophys. fitting are listed in tables S1 and S3. The code used for the
572, A69 (2014). equatorial belt simulation is available at https://github.com/
mode, the spin axis projection would be ~40° 23. A. Y. Potekhin, V. F. Suleimanov, M. van Adelsberg, K. Werner, robertotaverna/magMC and archived on Zenodo (31). License
west of north. In the latter case, the spin pro- Astron. Astrophys. 546, A121 (2012). information: Copyright © 2022 the authors, some rights
jection would be consistent with the direction 24. D. Viganò, “Magnetic fields in neutron stars,” thesis, reserved; exclusive licensee American Association for the
Universidad de Alicante, Alicante, Spain (2013); https://arxiv. Advancement of Science. No claim to original US government
of the magnetar proper motion, 60° ± 12° west
org/abs/1310.1243. works. https://www.science.org/about/science-licenses-
of north (Fig. 2) (28), whereas in the former 25. D. De Grandis et al., Astrophys. J. 914, 118 (2021). journal-article-reuse
case, the two would be almost orthogonal. It is 26. D. González-Caniulef, S. Zane, R. Turolla, K. Wu, Mon. Not. R.
unclear which is more appropriate for mag- Astron. Soc. 483, 599–613 (2019). SUPPLEMENTARY MATERIALS
27. C. Thompson, A. Kostenko, Astrophys. J. 904, 184 (2020).
netars. Observations of pulsars (including the science.org/doi/10.1126/science.add0080
28. S. P. Tendulkar, P. B. Cameron, S. R. Kulkarni, Astrophys. J.
Crab Pulsar and Vela Pulsar) show alignment Materials and Methods
772, 31 (2013).
Figs. S1 to S10
of the spin axis with the proper motion (29). 29. H. T. Janka, A. Wongwathanarat, M. Kramer, Astrophys. J. 926,
Tables S1 to S3
9 (2022).
However, binary star evolution theory predicts References (32–59)
30. M. Colpi, I. Wasserman, Astrophys. J. 581, 1271–1279 (2002).
that NSs should be accelerated perpendicular 31. R. Taverna, robertotaverna/magMC: magMC, version 1.1.1, Submitted 16 May 2022; accepted 18 October 2022
to their spin axis during their formation pro- Zenodo (2022). 10.1126/science.add0080
BLACK HOLES line at ∼6.4 keV, which can constrain the ve-
locity of the accretion disk gas orbiting the
Polarized x-rays constrain the disk-jet geometry in black hole and the time dilation close to the
black hole. This reflection component is also
the black hole x-ray binary Cygnus X-1 expected to be polarized (10, 11).
We performed x-ray polarimetric observa-
Henric Krawczynski1*, Fabio Muleri2*, Michal Dovčiak3*, Alexandra Veledina4,5,6*, tions of Cyg X-1 using the Imaging X-ray
Nicole Rodriguez Cavero1, Jiri Svoboda3, Adam Ingram7, Giorgio Matt8, Javier A. Garcia9, Polarimetry Explorer (IXPE) space telescope
Vladislav Loktev4, Michela Negro10,11,12, Juri Poutanen4,6, Takao Kitaguchi13, Jakub Podgorný3,14,15, (12). Theoretical predictions of the Cyg X-1 po-
John Rankin2, Wenda Zhang16, Andrei Berdyugin4, Svetlana V. Berdyugina17,18,19, Stefano Bianchi8, larization degree (in the 2–8 keV IXPE band)
Dmitry Blinov20,21, Fiamma Capitanio2, Niccolò Di Lalla22, Paul Draghis23, Sergio Fabiani2, were ∼1% or lower, depending on the emis-
Masato Kagitani24, Vadim Kravtsov4, Sebastian Kiehlmann20,21, Luca Latronico25, sion state (6, 7, 9, 13). These predictions used
Alexander A. Lutovinov6, Nikos Mandarakas20,21, Frédéric Marin14, Andrea Marinucci26, an inclination angle (the angle between the
Jon M. Miller23, Tsunefumi Mizuno27, Sergey V. Molkov6, Nicola Omodei22, Pierre-Olivier Petrucci28, black hole spin axis and the line of sight) of
Ajay Ratheesh2, Takeshi Sakanoi24, Andrei N. Semena6, Raphael Skalidis20,21, Paolo Soffitta2, i = 27.°5 ± 0.°8 inferred from optical observa-
Allyn F. Tennant29, Phillipp Thalhammer30, Francesco Tombesi31,32,33, Martin C. Weisskopf29, tions of the binary system (1). Earlier polar-
Joern Wilms30, Sixuan Zhang27, Iván Agudo34, Lucio A. Antonelli35,36, Matteo Bachetti37, ization observations with the Eighth Orbiting
Luca Baldini38,39, Wayne H. Baumgartner29, Ronaldo Bellazzini38, Stephen D. Bongiorno29, Solar Observatory (OSO-8) space telescope
Raffaella Bonino25,40, Alessandro Brez38, Niccolò Bucciantini41,42,43, Simone Castellano38, gave a polarization degree of 2.44 ± 1.07% and
Elisabetta Cavazzuti26, Stefano Ciprini32,36, Enrico Costa2, Alessandra De Rosa2, Ettore Del Monte2, a polarization angle (measured on the plane
Laura Di Gesu26, Alessandro Di Marco2, Immacolata Donnarumma26, Victor Doroshenko44,6, of the sky from north to east) of −18° ± 13° at
Steven R. Ehlert29, Teruaki Enoto13, Yuri Evangelista2, Riccardo Ferrazzoli2, Shuichi Gunji45, 2.6 keV (14, 15) and a nondetection at higher
Kiyoshi Hayashida46†, Jeremy Heyl47, Wataru Iwakiri48, Svetlana G. Jorstad49,50, Vladimir Karas3, energies (16). IXPE observed Cyg X-1 from
Jeffery J. Kolodziejczak29, Fabio La Monaca2, Ioannis Liodakis51, Simone Maldera25, 15 to 21 May 2022 with an exposure time of
Alberto Manfreda38, Alan P. Marscher49, Herman L. Marshall52, Ikuyuki Mitsuishi53, Chi-Yung Ng54, ∼242 kiloseconds (ks). The IXPE 2–8 keV ob-
Stephen L. O’Dell29, Chiara Oppedisano25, Alessandro Papitto35, George G. Pavlov55, servations were coordinated with simultaneous
Abel L. Peirson22, Matteo Perri36,35, Melissa Pesce-Rollins38, Maura Pilia37, Andrea Possenti37, x-ray and gamma-ray observations by other
Simonetta Puccetti36, Brian D. Ramsey29, Roger W. Romani22, Carmelo Sgrò38, Patrick Slane56, space telescopes covering the energy range
Gloria Spandre38, Toru Tamagawa15, Fabrizio Tavecchio57, Roberto Taverna58, Yuzuru Tawara53, 0.2–250 keV, including the Neutron Star Inte-
Nicholas E. Thomas29, Alessio Trois37, Sergey Tsygankov4,6, Roberto Turolla58,59, Jacco Vink60, rior Composition Explorer (NICER, 0.2–12 keV),
Kinwah Wu59, Fei Xie2,61, Silvia Zane59 the Nuclear Spectroscopic Telescope Array
(NuSTAR, 3–79 keV), the Swift X-ray Telescope
A black hole x-ray binary (XRB) system forms when gas is stripped from a normal star and accretes onto a (XRT, 0.2–10 keV), the Astronomical Roentgen
black hole, which heats the gas sufficiently to emit x-rays. We report a polarimetric observation of the XRB Telescope–X-ray Concentrator (ART-XC, 4–30 keV)
Cygnus X-1 using the Imaging X-ray Polarimetry Explorer. The electric field position angle aligns with the of the Spectrum-Röntgen-Gamma observatory
outflowing jet, indicating that the jet is launched from the inner x-ray–emitting region. The polarization degree (SRG), and the INTEGRAL Soft Gamma-Ray
is 4.01 ± 0.20% at 2 to 8 kiloelectronvolts, implying that the accretion disk is viewed closer to edge-on than Imager (ISGRI, 30–80 keV) on the Interna-
the binary orbit. These observations reveal that hot x-ray–emitting plasma is spatially extended in a plane tional Gamma-Ray Astrophysics Laboratory
perpendicular to, not parallel to, the jet axis. (INTEGRAL) (17). Simultaneous optical ob-
servations were performed with the Double
C
Image Polarimeter 2 (DIPol-2) instrument
ygnus X-1 (Cyg X-1, also cataloged as HD Black hole x-ray binaries are observed in mounted on the Tohoku 60-cm telescope
226868) is a bright and persistent x-ray states of x-ray emission thought to correspond at the Haleakala Observatory, Hawaii, and
source. It is a binary system containing to different configurations of the accreting the Robotic Polarimeter (RoboPol) at the
a 21.2 ± 2.2 solar-mass black hole in a matter (4). In the soft state, the x-rays are 1.3-m telescope of the Skinakas Observatory,
þ7:7
5.6-day orbit with a 40:67:1 solar-mass dominated by thermal emission from the ac- Greece (17).
þ0:18
star and is located at a distance of 2:220:17 cretion disk. The thermal emission is expected During the observation campaign, Cyg X-1
kiloparsecs (kpc) (1). Gas is stripped from the to be polarized because x-rays scatter off elec- was highly variable over the entire 0.2–250 keV
companion star; as it falls in the strong grav- trons in the accretion disk (5–7). In the hard energy range (fig. S1). The source was in the
itational field of the black hole, it forms an state, the x-ray emission is produced by (single hard x-ray state with a photon index of 1.6
accretion disk that is heated to millions of or multiple) scattering of photons (emitted by (table S5) and a 0.2–250 keV luminosity of
kelvin. The hot incandescent gas emits x-rays. the accretion disk or electrons in the magnetic 1.1% of the Eddington luminosity (the lumi-
Previous analyses of the thermal x-ray flux, its field) off electrons in hot coronal gas. Observa- nosity at which the radiation pressure on
energy spectrum, and the shape of the x-ray tions constrain the corona to be much hotter electrons equals the gravitational pull on the
emission lines have indicated that the black (kBTe ∼ 100 keV, where kB is the Boltzmann ions of the accreted material). We detected
hole in Cyg X-1 spins rapidly, with a dimen- constant and Te is the electron temperature) linear polarization in the IXPE data with >20s
sionless spin parameter a > 0.92 (close to the than the accretion disk (kBTd ∼ 0.1 keV, where statistical confidence (where s is the stan-
maximum possible value of 1) (2). Cyg X-1 also Td is the disk temperature). The shape of the dard deviation) (Fig. 1 and fig. S3), measur-
produces two pencil-shaped outflows of mag- corona and its location with respect to the ing a 2–8 keV polarization degree of 4.01 ±
netized plasma, called jets, that have been accretion disk are both debated (4, 8) but 0.20% at an electric field position angle of
imaged in the radio band (3). It is therefore could be constrained by x-ray polarimetry (9). −20.° 7 ± 1.° 4. The polarization degree and
classified as a microquasar, being analogous to Reflection of x-rays emitted by the corona off angle are consistent with the previous results
much larger radio-loud quasars (supermassive the accretion disk produces an emission com- of OSO-8 at 2.6 keV (15). Evidence for an in-
black holes with jets). ponent that includes the iron Ka fluorescence crease in the polarization degree with energy
(Fig. 1 and fig. S5) is significant at the 3.4s are likely to be dominated by the coronal accretion disk. In these models, repeated scat-
level (17). We find a 2.4s indication that the emission. terings in the plane of the corona polarize the
polarization degree increases with the source We analyzed the optical data at multiple x-rays perpendicular to that plane. Two mod-
flux (fig. S6). wavelengths (17), finding an intrinsic optical els are consistent with our observations: (i) a
We find no evidence that the polarization polarization degree of ∼1% and polarization hot corona sandwiching the accretion disk
depends on the orbital phase of the binary angle of −24°. The uncertainties on these re- (20), as predicted by numerical accretion disk
system (fig. S7). This excludes the possibility sults are dominated by systematic effects simulations (21); or (ii) a composite accretion
that the observed x-ray polarization originates related to the choice of polarization refer- flow with a truncated cold disk that is geomet-
from the scattering of x-ray photons off the ence stars and are ±0.1% on the polarization rically thin and optically thick and an inner
companion star or its wind and shows that degree and ±13° on the polarization direc- laterally extended region (geometrically thick
these effects do not measurably affect the po- tion (figs. S11 to S13 and table S4). The optical but optically thin) of hot plasma, possibly pro-
larization properties. polarization direction is thought to indicate duced by evaporation of the cold disk (22). If
We calculated a suite of emission models the orientation of the orbital axis projected the jet is launched from the inner, magne-
and compared them with the observations onto the sky (18). We find that it aligns with tized region of the disk, the jet carrying away
(17). We estimate that >90% of the x-rays the x-ray polarization direction and the ra- disk angular momentum could leave behind
come from the inner ∼2000-km-diameter dio jet. a radially extended hot and optically thin
region surrounding the ∼60-km-diameter The alignment of the x-ray polarization with corona (23).
black hole. The x-ray polarization angle aligns the radio jet indicates that the inner x-ray– The polarization data rule out models in
with the billion-kilometer-scale radio jet to emitting region is directly related to the radio which the corona is a narrow plasma column
within ∼5° (Fig. 2). jet. If the x-ray polarization is perpendicular or cone along the jet axis, or consists of two
We decomposed the broadband energy to the inner accretion disk plane, as favored compact regions above and below the black
spectra observed simultaneously with IXPE, in our models (17), this implies that the inner hole. Our modeling of these scenarios accounts
NICER, NuSTAR, and INTEGRAL into a multi- accretion disk is perpendicular to the radio for the effect of the coronal emission reflecting
temperature black-body component (thermal jet, at least on the plane of the sky. This is off the accretion disk (17). These models predict
emission from the accretion disk), a power-law consistent with the hypothesis that jets of polarization degree well below the observed
component (from multiple Compton scatter- microquasars (and, by extension, of quasars) values. Models that produce high polarization
ing events in the corona), emission reflected are launched perpendicular to the inner ac- degree predict polarization directions close
off the accretion disk, and emission from more cretion flow (19). to perpendicular to the jet axis, a decreasing
distant stationary plasma (fig. S8) (17). We find Figure 3 compares our observed polariza- polarization degree with energy, or both, and
that the coronal emission strongly dominates tion with theoretical predictions made using therefore disagree with the observations.
in the IXPE energy band, contributing ∼90% models of the corona (17). We find that the In our favored corona models, the high po-
of the observed flux. The accretion disk and only models that are consistent with the ob- larization degree we observe requires that the
reflected emission components contribute servations are those in which the coronal x-ray bright region is seen at a higher incli-
<1% and ∼10% of the emission, respectively. plasma is extended perpendicular to the jet nation than the ∼27° inclination of the binary
Therefore, our polarization measurements axis, and therefore probably parallel to the orbit. Sandwich corona models involving the
1
Department of Physics and McDonnell Center for the Space Sciences, Washington University in St. Louis, St. Louis, MO 63130, USA. 2Istituto di Astrofisica e Planetologia Spaziali, Istituto
Nazionale di Astrofisica (INAF), 00133 Roma, Italy. 3Astronomical Institute of the Czech Academy of Sciences, 14100 Praha 4, Czech Republic. 4Department of Physics and Astronomy, 20014
University of Turku, Turku, Finland. 5Nordic Institute for Theoretical Physics (Nordita), Kungliga Tekniska Högskolan (KTH) Royal Institute of Technology and Stockholm University, SE-106 91
Stockholm, Sweden. 6Space Research Institute of the Russian Academy of Sciences, Moscow 117997, Russia. 7School of Mathematics, Statistics, and Physics, Newcastle University, Newcastle
upon Tyne NE1 7RU, UK. 8Dipartimento di Matematica e Fisica, Università degli Studi Roma Tre, 00146 Roma, Italy. 9Division of Physics, Mathematics and Astronomy, California Institute of
Technology, Pasadena, CA 91125, USA. 10Center for Space Sciences and Technology, University of Maryland, Baltimore County, Baltimore, MD 21250, USA. 11NASA Goddard Space Flight Center
(GSFC), Greenbelt, MD 20771, USA. 12Center for Research and Exploration in Space Science and Technology, NASA-GSFC, Greenbelt, MD 20771, USA. 13Rikagaku Kenkyūjyo (RIKEN) Cluster for
Pioneering Research, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan. 14Centre national de la recherche scientifique, Observatoire Astronomique de Strasbourg, Université de Strasbourg, Unité
Mixte de Recherche 7550, 67000 Strasbourg, France. 15Astronomical Institute, Charles University, 18000 Prague, Czech Republic. 16National Astronomical Observatories, Chinese Academy of
Sciences, Beijing 100101, China. 17Leibniz-Institut für Sonnenphysik, 79104 Freiburg, Germany. 18Istituto Ricerche Solari (IRSOL) Aldo e Cele Daccò, Faculty of Informatics, Università della
Svizzera italiana, 6605 Locarno, Switzerland. 19Euler Institute, Faculty of Informatics, Università della Svizzera italiana, 6962 Lugano, Switzerland. 20Institute of Astrophysics, Foundation for
Research and Technology–Hellas, 71110 Heraklion, Greece. 21Department of Physics, University of Crete, 70013 Heraklion, Greece. 22Department of Physics and Kavli Institute for Particle
Astrophysics and Cosmology, Stanford University, Stanford, CA 94305, USA. 23Department of Astronomy, University of Michigan, Ann Arbor, MI 48109, USA. 24School of Sciences, Tohoku
University, Aoba-ku, 980-8578 Sendai, Japan. 25Istituto Nazionale di Fisica Nucleare, Sezione di Torino, 10125 Torino, Italy. 26Agenzia Spaziale Italiana (ASI), 00133 Roma, Italy. 27Hiroshima
Astrophysical Science Center, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8526, Japan. 28Institut de Planétologie et d’Astrophysique de Grenoble (IPAG),
Université Grenoble Alpes, Centre national de la recherche scientifique, 38000 Grenoble, France. 29NASA Marshall Space Flight Center, Huntsville, AL 35812, USA. 30Dr. Karl Remeis Observatory,
Erlangen Centre for Astroparticle Physics, Universität Erlangen-Nürnberg, 96049 Bamberg, Germany. 31Dipartimento di Fisica, Università degli Studi di Roma “Tor Vergata,” 00133 Roma, Italy.
32
Istituto Nazionale di Fisica Nucleare, Sezione di Roma “Tor Vergata,” 00133 Roma, Italy. 33Department of Astronomy, University of Maryland, College Park, MD 20742, USA. 34Instituto de
Astrofísica de Andalucía, 18008 Granada, Spain. 35INAF Osservatorio Astronomico di Roma, 00078 Monte Porzio Catone, Roma, Italy. 36Space Science Data Center, ASI, 00133 Roma, Italy.
37
INAF Osservatorio Astronomico di Cagliari, 09047 Selargius, Cagliari, Italy. 38Istituto Nazionale di Fisica Nucleare, Sezione di Pisa, 56127 Pisa, Italy. 39Dipartimento di Fisica, Università di Pisa,
56127 Pisa, Italy. 40Dipartimento di Fisica, Università degli Studi di Torino, 10125 Torino, Italy. 41INAF Osservatorio Astrofisico di Arcetri, 50125 Firenze, Italy. 42Dipartimento di Fisica e
Astronomia, Università degli Studi di Firenze, 50019 Sesto Fiorentino, Firenze, Italy. 43Istituto Nazionale di Fisica Nucleare, Sezione di Firenze, 50019 Sesto Fiorentino, Firenze, Italy. 44Institut für
Astronomie und Astrophysik, Universität Tübingen, 72076 Tübingen, Germany. 45Department of Physics, Yamagata University, 1-4-12 Kojirakawa-machi, Yamagata-shi 990-8560, Japan.
46
Department of Earth and Space Science, Osaka University, 1-1 Yamadaoka, Suita, Osaka 565-0871, Japan. 47Department of Physics and Astronomy, University of British Columbia, Vancouver,
BC V6T 1Z4, Canada. 48Department of Physics, Faculty of Science and Engineering, Chuo University, 1-13-27 Kasuga, Bunkyo-ku, Tokyo 112-8551, Japan. 49Institute for Astrophysical Research,
Boston University, Boston, MA 02215, USA. 50Department of Astrophysics, St. Petersburg State University, Petrodvoretz, 198504 St. Petersburg, Russia. 51Finnish Centre for Astronomy
with the European Southern Observatory (ESO), 20014 University of Turku, Turku, Finland. 52Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology,
Cambridge, MA 02139, USA. 53Division of Particle and Astrophysical Science, Graduate School of Science, Nagoya University, Furo-cho, Chikusa-ku, Nagoya, Aichi 464-8602, Japan.
54
Department of Physics, The University of Hong Kong, Pokfulam, Hong Kong. 55Department of Astronomy and Astrophysics, Pennsylvania State University, University Park, PA 16802, USA.
56
Center for Astrophysics, Harvard & Smithsonian, Cambridge, MA 02138, USA. 57INAF Osservatorio Astronomico di Brera, 23807 Merate, Lecco, Italy. 58Dipartimento di Fisica e Astronomia,
Università degli Studi di Padova, 35131 Padova, Italy. 59Mullard Space Science Laboratory, University College London, Holmbury St Mary, Dorking, Surrey RH5 6NT, UK. 60Anton Pannekoek
Institute for Astronomy, University of Amsterdam, 1098 XH Amsterdam, Netherlands. 61Guangxi Key Laboratory for Relativistic Astrophysics, School of Physical Science and Technology, Guangxi
University, Nanning 530004, China.
*Corresponding author. Email: krawcz@wustl.edu (H.K.); fabio.muleri@inaf.it (F.Mu.); dovciak@astro.cas.cz (M.D.); alexandra.veledina@utu.fi (A.V.)
†Deceased.
emission was the main source of the observed high observed polarization degree either im- 3. A. M. Stirling et al., Mon. Not. R. Astron. Soc. 327, 1273–1278
polarization, we would expect that a rise in the plies a more edge-on viewing geometry than (2001).
4. C. Done, M. Gierliński, A. Kubota, Astron. Astrophys. Rev. 15,
x-ray flux from the inner accretion flow would given by the optical data, or it suggests that 1–66 (2007).
lead to an overall smaller polarization degree— unidentified physical effects are responsible 5. P. A. Connors, T. Piran, R. F. Stark, Astrophys. J. 235, 224
contrary to the observed trend (fig. S6). for production of the x-rays in accreting black (1980).
6. L.-X. Li, R. Narayan, J. E. McClintock, Astrophys. J. 691,
The polarized x-rays from the immediate hole systems. 847–865 (2009).
surroundings of the black hole carry the im- 7. J. D. Schnittman, J. H. Krolik, Astrophys. J. 701, 1175–1187
print of the geometry of the emitting gas. We (2009).
RE FERENCES AND NOTES 8. C. Bambi et al., Space Sci. Rev. 217, 65 (2021).
conclude that the x-ray bright plasma is ex- 1. J. C. A. Miller-Jones et al., Science 371, 1046–1049 (2021). 9. J. D. Schnittman, J. H. Krolik, Astrophys. J. 712, 908–924
tended perpendicular to the radio jet. The 2. L. Gou et al., Astrophys. J. 790, 29 (2014). (2010).
10. G. Matt, Mon. Not. R. Astron. Soc. 260, 663–674 (1993). managed by its Marshall Space Flight Center, with industry partner General Research Fund of the Hong Kong Government under grant
11. J. Poutanen, K. N. Nagendra, R. Svensson, Mon. Not. R. Ball Aerospace (contract NNM15AA18C). The Italian contribution to number HKU 17305419. P.Sl. acknowledges support from NASA
Astron. Soc. 283, 892–904 (1996). the IXPE mission is supported by the Italian Space Agency (ASI) Contract NAS8-03060. Author contributions: H.K., F.Mu., M.D.,
12. M. C. Weisskopf et al., J. Astron. Telesc. Instrum. Syst. 8, through contract ASI-OHBI-2017-12-I.0, agreements ASI-INAF- A.V., N.R.C., J.S., A.I., G.M., J.A.G., V.L., and J.Pou. participated in
026002 (2022). 2017-12-H0 and ASI-INFN-2017.13-H0, and its Space Science Data the planning of the observation campaign and the analysis and
13. H. Krawczynski, B. Beheshtipour, Astrophys. J. 934, 4 (2022). Center (SSDC) with agreements ASI-INAF-2022-14-HH.0 and modeling of the data. M.N., T.K., J.Pod., J.R., and W.Z. contributed
14. M. C. Weisskopf et al., Astrophys. J. 215, L65 (1977). ASI-INFN 2021-43-HH.0; and by INAF and the Istituto Nazionale di to the analysis or modeling of the data. A.V.B., V.Kr., S.V.B.,
15. K. S. Long, G. A. Chanan, R. Novick, Astrophys. J. 238, 710 Fisica Nucleare (INFN) in Italy. This research used data and M.K., T.S., D.B., S.K., N.M., and R.S. contributed to the optical
(1980). software products or online services provided by the IXPE Team polarimetric data. J.M.M. and P.D. contributed the Swift results;
16. M. Chauvin et al., Nat. Astron. 2, 652–655 (2018). (Marshall Space Flight Center, the SSDC of the Italian Space J.W. and P.T. the INTEGRAL results; and A.A.L., S.V.M., and A.N.S.
17. Materials and methods are available as supplementary materials. Agency, the INAF, and INFN), as well as the High-Energy the SRG/ART-XC results. S.B., F.C., N.D.L., L.L., A.Mar., T.M.,
18. J. C. Kemp, M. S. Barbour, T. E. Parker, L. C. Herman, Astrophysics Science Archive Research Center (HEASARC), at N.O., A.R., P.-O.P, P.So., A.F.T., F.To., M.C.W., and S.Zh. contributed
Astrophys. J. 228, L23–L27 (1979). NASA Goddard Space Flight Center. We thank the NICER, NuSTAR, to the discussion of the results. F.Ma. and S.F. served as internal
19. M. C. Begelman, R. D. Blandford, M. J. Rees, Rev. Mod. Phys. INTEGRAL, Swift, and SRG/ART-XC teams and Science Operation referees. All other authors contributed to the design and science
56, 255–351 (1984). Centers for their support of this observation campaign. DIPol-2 is a case of the IXPE mission and to planning the observations used in
20. F. Haardt, L. Maraschi, Astrophys. J. 380, L51 (1991). joint effort between University of Turku (Finland) and Leibniz this paper. All authors provided input and comments on the
21. B. E. Kinch, J. D. Schnittman, S. C. Noble, T. R. Kallman, Institut für Sonnenphysik (Germany). We are grateful to the manuscript. Competing interests: The authors declare no
J. H. Krolik, Astrophys. J. 922, 270 (2021). Institute for Astronomy, University of Hawaii, for allocating competing interests. Data and materials availability: The May
22. F. Meyer, E. Meyer-Hofmeister, Astron. Astrophys. 288, observing time for the DIPol-2 polarimeter, and to the Skinakas and June IXPE observations are available at https://heasarc.gsfc.
175–182 (1994). Observatory for performing the observations with the RoboPol nasa.gov/FTP/ixpe/data/obs/01/01002901/ and https://heasarc.
23. P. O. Petrucci, J. Ferreira, G. Henri, J. Malzac, C. Foellmi, polarimeter at their 1.3-m telescope. Funding: H.K. acknowledges gsfc.nasa.gov/FTP/ixpe/data/obs/01/01250101/, respectively.
Astron. Astrophys. 522, A38 (2010). NASA support under grants 80NSSC18K0264, 80NSSC22K1291, The NICER data are available at https://heasarc.gsfc.nasa.gov/
24. A. Veledina, J. Poutanen, I. Vurm, Mon. Not. R. Astron. Soc. 80NSSC21K1817, and NNX16AC42G. F.Mu., J.R., S.B., S.F., A.R., docs/nicer/nicer_archive.html under ObsIDs 5100320101,
430, 3196–3212 (2013). P.So., E.D.M., E.Co., A.D.M., G.M., Y.E., R.F., F.L.M., M.Pe., and A.T. 5100320102, 5100320103, 5100320104, 5100320105,
25. J. M. Bardeen, J. A. Petterson, Astrophys. J. 195, L65 (1975). were funded through contract ASI-INAF-2017-12-H0. L.B., R.Bo., 5100320106, and 5100320107. The NuSTAR data are available at
26. J. A. Tomsick et al., Astrophys. J. 780, 78 (2014). R.Be., A.Br., L.L., S.Ca., S.M., A.Man., C.O., M.P.-R., C.S., and https://heasarc.gsfc.nasa.gov/db-perl/W3Browse/w3table.pl?
27. M. L. Parker et al., Astrophys. J. 808, 9 (2015). G.S. were funded by the ASI through contracts ASI-INFN-2017.13-H0 tablehead=name%3Dnumaster&Action=More+Options under
28. P. Lachowicz, A. A. Zdziarski, A. Schwarzenberg-Czerny, and ASI-INFN 2021-43-HH.0. M.Pi. was funded through contract ObsIDs 30702017002, 30702017004, and 30702017006. The
G. G. Pooley, S. Kitamoto, Mon. Not. R. Astron. Soc. 368, ASI-INAF-2022-14-HH.0. I.A. acknowledges support from MICINN SWIFT XRT data are available at https://heasarc.gsfc.nasa.gov/
1025–1039 (2006). (Ministerio de Ciencia e Innovación) Severo Ochoa award for the cgi-bin/W3Browse/swift.pl under ObsIDs 00034310009,
29. D. M. Russell, T. Shahbaz, Mon. Not. R. Astron. Soc. 438, IAA-CSIC (SEV-2017-0709) and through grants AYA2016-80889-P 00034310010, 00034310011, 00034310012, 00034310013, and
2083–2096 (2014). and PID2019-107847RB-C44. M.D., J.S., and V.Ka. acknowledge 00034310014. The extracted INTEGRAL ISGRI data are archived at
30. A. A. Zdziarski, P. Pjanka, M. Sikora, Ł. Stawarz, Mon. Not. R. support from GACR (Grantová agentura České republiky) project Zenodo (32). The SRG ART-XC data are available at ftp://hea.iki.
Astron. Soc. 442, 3243–3255 (2014). 21-06825X and institutional support from the Astronomical rssi.ru/public/SRG/ART-XC/data/Cygnus_X-1/. The MAXI light
31. M. Lyutikov, V. I. Pariev, D. C. Gabuzda, Mon. Not. R. Astron. Institute of the Czech Academy of Sciences (RVO:67985815). curves are available at http://maxi.riken.jp/star_data/J1958+352/
Soc. 360, 869–891 (2005). J.A.G. acknowledges support from NASA grant 80NSSC20K0540. J1958+352.html. The raw DIPol-2 and RoboPol data are archived at
32. P. Thalhammer, J. Wilms, N. Rodriguez Cavero, X-ray observations J.Pod. acknowledges support from Charles University project Zenodo (33, 34). The KERRC code (13) is available at https://gitlab.
of black hole binary Cyg X-1 with INTEGRAL, version 1, Zenodo GA UK No. 174121 and from the Barrande Fellowship Programme com/krawcz/kerrc-x-ray-fitting-code.git. The MONK code (35) is
(2022); https://doi.org/10.5281/zenodo.7140274. of the Czech and French governments. A.V., J.Pou., and S.S.T. available at https://projects.asu.cas.cz/zhang/monk. The
33. V. Kravtsov et al., Optical polarimetric observations of black acknowledge support from Russian Science Foundation grant ixpeobssim software is available at https://github.com/
hole binary Cyg X-1 with DIPol-2, version 1, Zenodo (2022); 20-12-00364 and the Academy of Finland grants 333112, 347003, lucabaldini/ixpeobssim and documented at https://ixpeobssim.
https://doi.org/10.5281/zenodo.7108247. 349144, and 349906. M.N. acknowledges support from NASA readthedocs.io. Our derived x-ray polarization measurements are
34. D. Blinov, S. Kiehlmann, N. Mandarakas, R. Skalidis, Optical under award number 80GSFC21M0002. T.K. is supported by JSPS listed in tables S1 and S2, and the optical polarization
polarimetric observations of the black hole binary star KAKENHI Grant Number JP19K03902. P.-O.P. acknowledges measurements are listed in table S4. The numerical results of our
Cyg X-1 with RoboPol, version 1, Zenodo (2022); support from the High Energy National Programme (PNHE) of model fitting are listed in table S5. Our models of polarized
https://doi.org/10.5281/zenodo.7127802. Centre national de la recherche scientifique (CNRS) and from the emission in the truncated disk geometry are archived at Zenodo
35. W. Zhang, M. Dovčiak, M. Bursa, Astrophys. J. 875, 148 French space agency (CNES) as well as from the Barrande (36). License information: Copyright © 2022 the authors, some
(2019). Fellowship Programme of the Czech and French governments. rights reserved; exclusive licensee American Association for the
36. A. Veledina, J. Poutanen, Polarization of Comptonized D.B., S.K., N.M., and R.S. acknowledge support from the European Advancement of Science. No claim to original US government
emission in slab geometry, version 1, Zenodo (2022); Research Council (ERC) under the European Union’s Horizon works. https://www.science.org/about/science-licenses-journal-
https://doi.org/10.5281/zenodo.7116125. 2020 research and innovation program under grant agreement no. article-reuse
771282. V.Kr. thanks Vilho, Yrjö and Kalle Väisälä Foundation.
ACKN OW LEDG MEN TS P.T. and J.W. acknowledge funding from Bundesministerium für SUPPLEMENTARY MATERIALS
We thank J. Miller-Jones, J. Orosz, and A. Zdziarski for very helpful Wirtschaft and Klimaschutz under Deutsches Zentrum für
science.org/doi/10.1126/science.add5399
discussions of the optical constraints on the orbital inclination of Luft- und Raumfahrt grant 50 OR 1909. A.I. acknowledges support
Materials and Methods
Cyg X-1 and optical position angles. We are grateful to three from the Royal Society. J.H. acknowledges the support of the
Figs. S1 to S12
anonymous referees, whose excellent comments contributed to Natural Sciences and Engineering Research Council of Canada
Tables S1 to S5
strengthening the paper. We thank T. Maccarone for emphasizing (NSERC), funding reference number 5007110, and the Canadian
References (37–79)
that stellar wind absorption may modify the jet orientation Space Agency. S.G.J. and A.P.M. are supported in part by National
measurement results. This work is based on observations made Science Foundation grant AST-2108622, by NASA Fermi Guest Submitted 18 June 2022; accepted 17 October 2022
with the IXPE mission, a joint US and Italian mission. The US Investigator grant 80NSSC21K1917, and by NASA Swift Guest Published online 3 November 2022
contribution to the IXPE mission is supported by NASA and led and Investigator grant 80NSSC22K0537. C.-Y.N. is supported by a 10.1126/science.add5399
C
trend analysis challenging (36).
limate change is expected to change the these studies reported positive trends in sub- Here, we follow a new approach to over-
intensity and frequency of heavy rain- daily rainfall extremes at some locations in come these limitations and use weather radars
fall across the world (1–3) by increasing North America (22, 23), Australia (1, 2, 7, 24–30), to gain higher confidence in changes of short-
humidity and changing the large-scale Europe (31–33), Southeast Asia (34), and parts duration rainfall extremes. We used satellite-
atmospheric circulation and convective of China (35), most stations (within a network) calibrated observations from three ground-based
dynamics of storms (4). Despite advances in showed weak or no trends, probably because radars (Wollongong, Terrey Hills, and New-
understanding the effects of a warming climate of their questionable representativeness in castle) covering the greater Sydney, Australia,
on rainfall extremes at daily (or longer) scales, sampling short-duration (subdaily or subhourly) region (45) to study trends in rainfall extremes
according to the sixth report of the Inter- rainfall extremes. These extremes often take down to the 10-min scale over the past two
governmental Panel on Climate Change (IPCC), place over small areas (e.g., subkilometer) decades. Figure 1, A to C, shows the locations
there is very low confidence about changes and time (e.g., subhourly) scales that are rarely of the three radars and their fields of view
in short-duration (subdaily) extreme precip- resolved by gauge networks. The sixth report while observing the same events at a particu-
itation, which is often responsible for destruc- of the IPCC considered this issue to be one of lar time. Using multiple overlapping radars
tive natural hazards like flash floods, landslides, the main limitations in determining reliable enabled us to limit the data inconsistency
and debris flows in both urban and rural areas trends in short-duration rainfall extremes issue in the datasets and increase the signal-
(5–7). Improved knowledge of changes in heavy, (36). For example, Lengfeld et al. (36) showed to-noise ratio.
short-duration rainfall is vital for effective that only 17.3% of hourly heavy precipitation By using an object-based approach, rain
climate adaptation (6–8) and to reduce the events in Germany from 2001 to 2018 were systems in the gridded radar data are considered
vulnerability of cities (6). captured by the gauge network, whereas 81.8% as moving objects (see the highlighted objects
Current studies have shown upward trends in of daily events were observed. in Fig. 1, A to C). This approach enabled us to
extreme rainfall at daily scales in many places Regional climate models (RCMs) can predict locate and observe the peak intensity of storms
around the globe and suggest typical increases subdaily rainfall extremes. A few RCM-based for every time step, which is not possible using
similar to the Clausius-Clapeyron rate of ~7% K–1 studies showed them intensifying over North point-based datasets. The object-based method
(1, 8–11). Super–Clausius-Clapeyron scaling America (37) and Sweden (38). However, sub- used in this study is called method of object-
(>7% K−1) is reported for subdaily rainfall ex- daily rainfall extremes are poorly simulated based diagnostic evaluation (MODE), which has
tremes in some regions like Australia (1, 12, 13), in RCMs, owing to parameterizing convection been previously used over Wollongong radar
Germany (14), Netherlands (15–17), South rather than explicitly simulating it. Convection- in another study to investigate the climatology
Korea (18), and Hong Kong (19). However, it permitting models (CPMs) overcome this limi- of rain systems near Sydney (46). Using this
is uncertain whether these observed scaling tation and have been run in a few regions technique over two radar- and satellite-based
rates can be used as a basis for projecting (39, 40). However, there are large uncertain- precipitation products over the eastern United
future changes to rainfall extremes because ties in the fidelity and evaluation of CPMs be- States showed that the object-based properties
this approach does not explicitly include other cause of the lack of reliable observations, the of the storms are not dependent on the ob-
contributing factors such as changes in atmo- spatiotemporal scale mismatch between simu- servational platform (44, 47). By using this
spheric stability, storm structural dynamics lated and observed data, and the reliance of technique, the spatial maximum intensity
(20), and large-scale circulation (4, 17, 21). these models on parameterization of micro- of the detected objects (hereafter, object max-
A growing number of studies have examined scale processes (41, 42). Similar concerns apply imum intensity) for each time step have been
trends at subdaily and/or subhourly scales using to high-resolution reanalysis datasets (43). extracted and are paired with their year of
gauge stations during the past decades in The limitations mentioned above suggest occurrence. A 95% quantile regression has
various regions across the globe. Although that more spatially and temporally complete been applied over the paired data (for each
observational data are required to investigate radar separately) to target the trend of the
1 hourly or shorter-duration high-impact rainfall spatial maximum rain rate of the extreme
Climate Change Research Centre, University of New South
Wales, Sydney, New South Wales, Australia. 2ARC Centre of events. Satellite-based precipitation products storms.
Excellence for Climate Extremes, University of New South can provide precipitation estimation with global We also repeated the quantile regression
Wales, Sydney, New South Wales, Australia. 3Science and coverage at reasonably high spatiotemporal analysis over the objects captured simultane-
Innovation Group, Australian Bureau of Meteorology,
Melbourne, Victoria, Australia. resolution. However, observations in these ously by both the Terrey Hills and Wollongong
*Corresponding author. Email: h.ayat@unswalumni.com products have large spatiotemporal gaps that radars to identify any effect of different radar
Terrey Hills A B C
Wollongong
Newcastle
Latitude (°N)
200.0 200.0
100.0 100.0
50.0 50.0
30.0 30.0
Rain rate (mm/hr)
15.0 15.0
7.5 7.5
3.0 3.0 C
1.0 1.0
0.0 0.0
B
Rain rate (mm/hr)
Matched
objects
Lo
n git
ud )
e( (°N
°E)
it ude
Lat
Fig. 1. The locations of the selected weather radar and AWS rain gauges using the object-detection technique. The detected objects in the Wollongong
that captured an event on 16 December 2015 at 02:06:00 UTC. (A to (A) and Terrey Hills (B) radars are matched with the total interest value of 1
C) Fields of view of the Wollongong (A), Terrey Hills (B), and Newcastle (C) radars (see supplementary methods for more details). The numbers in the magnified
while observing the event. In (A), the bottom solid circle shows the Wollongong view from (C) represent the AWS rain gauges. An example of the maximum
radar field of view, and the middle and top dashed circles show the relative intensity of an object is shown in the 3D view of the detected object in Terrey Hills
locations of the Terrey Hills and Newcastle radar fields of view, which are shown radar (B) at the bottom left. An example of a matched object is shown at the
in (B) and (C). The highlighted rainfall patterns are objects that were detected bottom right.
Fig. 2. Annual 95% quantile of the object maximum intensity trend in changes using the quantile regression analysis. All the calculated trends are
the radar datasets. (A) The 95% quantile time series of annual rainfall. The significant at the level of 0.05. Blue, Wollongong radar; orange, Newcastle
dashed lines are the 95% quantile regression fitted over the data matched with radar; green, Terrey Hills radar; purple, objects in Terrey Hills that are matched
their years of occurrence. The values on the y axis are normalized based on with their Wollongong counterparts; brown, objects in Wollongong that are
the 95% quantile of the entire dataset of each radar. (B) Calculated slope of matched with their Terrey Hills counterparts.
hardware and location on the calculated trends the matched objects in the Terrey Hills and pixels (at the AWS locations) are showing
in the previous step. For this purpose, we used Wollongong radars. There are positive trends statistically significant positive trends. These
an object-matching technique to isolate the in all radar datasets that are statistically sig- 10-min trend results are in agreement with
objects that are observed in two radars at each nificant at the 0.05 level. The radars thus cor- what we have observed in the trend of object
time step. By using this technique, an object roborate each other and suggest an upward maximum intensity. However, fewer stations
from the Terrey Hills radar dataset is matched trend of at least 2% per year since 1997 (ac- (both in radar and AWS data) show robust
with its counterpart in the Wollongong radar celerating to up to 8% more recently) in the positive trends in hourly accumulations, es-
dataset at each time step if they have similar maximum intensity. The actual trends look pecially in AWS data (Fig. 3B). Note that a
properties (here location and area; see supple- strongest for the most extreme values, and daily trend analysis for the 99.9% quantile is
mentary methods for more details). any approach or instrument that is reaching not possible because the maximum number of
In the next step, all rainfall data from 1999 farther out on the distribution tail encounters available daily data in a year is less than 1000.
to 2017 (including wet and dry data) from nine stronger trends. For example, trends are even The observed trends in the extreme rainfall
high-resolution (1 min) automatic weather stronger, and very similar, in the matched (99%) are weaker in subhourly accumulations
stations (AWSs) are resampled to subhourly objects in both the Wollongong and Terrey (Fig. 3C) but stronger and clearer in hourly
(10 min), hourly, and daily time scales. The 99 Hills datasets. This is related to the matching accumulations (Fig. 3D). However, this signal
and 99.9% quantile regressions are fitted process that often excludes small-scale nonex- becomes less clear in daily accumulations, for
over the data from each year to investigate the treme storms with shallow vertical structures which most of the stations do not show robust
trend of rainfall extremes from a point-based because a pair of matched objects is detected upward trends (Fig. 3E). Note that a possible
perspective. We repeated the same procedure at different distances from the radars and dif- reason for steeper observed trends in radars is
for the same period over Wollongong radar ferent altitudes (fig. S6) and often includes that radars observe higher-level precipitation,
data and sampled at the locations of AWS rain well-developed and more extreme storms. Sim- and when the storms get stronger, they may be
gauges to directly compare the radar to other ilar results have also been found using the 90% lofting precipitation higher, so the fraction
platforms. Note that the 95% quantile is tar- quantile of data (see fig. S1). reaching the ground might decrease a bit,
geting low rainfall intensities in the point-based Figure 3 shows the detected trends of sub- causing the higher trend. Conversely, gauge
approach because wet and dry records were hourly (10 min), hourly, and daily extreme records are sensitive to winds, which are more
included (see supplementary methods). Hence, (99%) and very extreme (99.9%) rainfall from severe during heavy rainfall and cause gauge
we have selected 99 and 99.9% quantiles to a point-based perspective using nine AWS rain undercatch, possibly resulting in an under-
target the extremes. Note that to compare the gauges (orange) and the Wollongong radar estimation of trends in gauge instruments. This
rate of change between the radars and gauge data (blue) at the locations of the AWS rain may explain all or some of the differences in
stations and estimate a rate of change inde- gauges by applying the quantile regression trend magnitudes.
pendent of an observational platform, we nor- technique. The trends that are not statisti- We also investigated the relationships be-
malized the results by dividing them by the cally significant are shown in gray. Figure 3A tween climate indices [i.e., El Niño–Southern
average of the data for each radar and gauge indicates that most AWS rain gauges (six out Oscillation (ENSO), Indian Ocean Dipole (IOD),
station. of nine) show robust upward trends in very and Southern Annular Mode (SAM)] and object
Figure 2 presents the time series and linear extreme rainfall (99.9%) at a subhourly reso- maximum intensity in another study (46) (using
trends of the annual extreme (95% quantile lution (10 min) with a rate of up to 2% per Wollongong radar data and a multivariate ap-
across all objects) maximum rain rate seen in year. These trends are even more clear in the proach), and the results did not show any link
the object for each radar separately and for Wollongong radar data, because all the selected between intensity and any of the modes in this
25. S. M. Herath, R. Sarukkalige, V. T. V. Nguyen, J. Hydrol. 556, 40. E. J. Kendon, S. Blenkinsop, H. J. Fowler, J. Clim. 31, S.C.S.; Data analysis: H.A.; Investigation: H.A., J.P.E., S.C.S., J.S.;
1171–1181 (2018). 2945–2964 (2018). Supervision: J.P.E., S.C.S., J.S.; Writing – original draft: H.A.;
26. D. Jakob, D. J. Karoly, A. Seed, Nat. Hazards Earth Syst. Sci. 11, 41. L. V. Alexander et al., Environ. Res. Lett. 14, 125008 (2019). Writing – review and editing: J.P.E., S.C.S., J.S. Competing
2263–2271 (2011). 42. F. B. Avila et al., Weather Clim. Extrem. 9, 6–16 (2015). interests: The authors declare that they have no competing
27. D. Jakob, D. J. Karoly, A. Seed, Nat. Hazards Earth Syst. Sci. 11, 43. H. Ali, N. Peleg, H. J. Fowler, Geophys. Res. Lett. 48, interests. Data and materials availability: Radar data used in this
2273–2284 (2011). e2021GL093798 (2021). study are available at https://geonetwork.nci.org.au/geonetwork/
28. S. Westra, S. A. Sisson, J. Hydrol. 406, 119–128 (2011). 44. H. Ayat, J. P. Evans, A. Behrangi, Remote Sens. Environ. 259, srv/eng/catalog.search#/metadata/f8188_7912_6774_5057. AWS
29. A. G. Yilmaz, B. J. C. Perera, J. Hydrol. Eng. 19, 1160–1172 112417 (2021). data are also accessible from the following link: http://www.bom.
(2014). 45. J. Soderholm, V. Louf, A. Protat, R. A. Warren, Australian gov.au/climate/data/stations/. The source code of the object-
30. F. Zheng, S. Westra, M. Leonard, Nat. Clim. Chang. 5, 389–390 Operational Weather Radar Level 2 Dataset, NCI Data based method used in this study is available at https://github.
(2015). Catalogue (2022); https://doi.org/10.25914/40KE-NM05. com/H0omaN/MTD-Modified. License information: Copyright ©
31. K. Arnbjerg-Nielsen, Water Sci. Technol. 54, 1–8 (2006). 46. H. Ayat, J. P. Evans, S. C. Sherwood, J. Soderholm, 2022 the authors, some rights reserved; exclusive licensee
32. E. Arnone, D. Pumo, F. Viola, L. V. Noto, G. La Loggia, Hydrol. Research Square [Preprint] (2021); https://doi.org/10.21203/ American Association for the Advancement of Science. No claim to
Earth Syst. Sci. 17, 2449–2458 (2013). rs.3.rs-1134660/v1. original US government works. https://www.science.org/about/
33. H. Madsen, K. Arnbjerg-Nielsen, P. S. Mikkelsen, Atmos. Res. 47. H. Ayat, J. P. Evans, S. Sherwood, A. Behrangi, J. Hydrometeorol. science-licenses-journal-article-reuse
92, 343–349 (2009). 22, 43–62 (2021).
34. A. H. Syafrina, M. D. Zalina, L. Juneng, Theor. Appl. Climatol. SUPPLEMENTARY MATERIALS
120, 259–285 (2015). ACKN OWLED GMEN TS
science.org/doi/10.1126/science.abn8657
35. C. Xiao, P. Wu, L. Zhang, L. Song, Sci. Rep. 6, 38506 This research was undertaken with the assistance of resources and
Materials and Methods
(2016). services from the National Computational Infrastructure (NCI),
Figs. S1 to S10
36. K. Lengfeld et al., Environ. Res. Lett. 15, 085003 (2020). which is supported by the Australian government. Funding: This
Table S1
37. C. Li et al., Geophys. Res. Lett. 46, 6885–6891 (2019). work was supported by the Australian Research Council as
References (48–50)
38. J. Olsson, K. Foster, Nord. Hydrol. 45, 479–489 (2013). part of the Center of Excellence for Climate Extremes (grant
39. S. C. Chan, E. J. Kendon, N. M. Roberts, H. J. Fowler, CE170100023 to J.P.E. and S.C.S.). Author contributions: Submitted 29 December 2021; accepted 12 October 2022
S. Blenkinsop, Environ. Res. Lett. 11, 094024 (2016). Conceptualization: H.A., J.P.E., S.C.S.; Methodology: H.A., J.P.E., 10.1126/science.abn8657
W
mechanism from full dislocation slip to par-
hen a metal is stressed far below its the melting point in kelvin), aggravating the tials (8). We estimated the critical grain size
yield strength at elevated tempera- GB diffusional (Coble) creep (4). GBs facilitate in the alloy, following the classical dislocation
tures, a continuously increasing strain vacancy migration and deformation of grains theory, to be about 37 nm (11). This suggests
is often induced—a process known as in the Nabarro-Herring creep (5, 6). In addi- that plastic straining of the alloy with grains
creep. A great number of failures of tion, the strengthening effect of GBs, although smaller than 37 nm may induce structure re-
materials and components serving at high pronounced in metals at room temperature laxation of GBs into low-energy configurations.
temperatures are attributed to creep or to its (RT), vanishes typically above 0.5 Tm, at which Hence, we processed the alloy bars (with an
combination with other degradation pro- GB processes (migration or sliding) become initial structure as in fig. S1) by using a surface
cesses (1), costing billions of dollars annually prominent (7). Hence, eliminating GBs in ma- mechanical grinding treatment (the processing
for the repair and replacement of parts in ad- terials is another primary approach to mini- parameters in table S1) for refining grains into
vanced devices. The ever-growing demand of mizing atomic diffusion and resisting creep at the desired size regime in the surface layer, a
higher fuel efficiency and reliability of turbines, high temperatures, as practiced in producing process applied previously in many other metals
nuclear reactors, and devices in chemical in- turbo blades of single-crystal or directional and alloys (8).
dustries calls for a constant improvement of solidified superalloys (2). But the creep re- After the treatment, uniformly distributed
high-temperature creep resistance in advanced sistance of the alloys achieved so far are mod- equiaxed nanograins formed the top surface
alloys (1). erate. The creep-stress levels at >0.5 Tm are layer, about 25 mm thick in the treated samples
Creep is a time-dependent deformation pro- lower than 0.8 GPa even for the most heavily (Fig. 1A). The grain sizes ranged from few nano-
cess controlled by atomic diffusion and dislo- alloyed single-crystal superalloy (CMSX-4) (2). meters to about 30 nm (average, 9 ± 3 nm; error
cation glide. To resist creep in materials, one Contradictory to the conventional wisdom is standard deviation) (Fig. 2B) under trans-
may increase their high-temperature strength, of eliminating GBs, we proposed introducing mission electron microscopy (TEM) measure-
minimize atomic diffusion, or both. Alloying abundant GBs to form stable GB networks in ments, which is well below the critical size.
may strengthen materials at high tempera- metals to inhibit creep by means of suppress- The grain size is roughly homogeneous along
tures by solution hardening with heat-resistant ing atomic diffusion and hardening at high depth within this layer. Homogeneous com-
elements tungsten (W), molybdenum (Mo), temperatures, simultaneously. The idea was position distributions were detected for each
and rhenium (Re) in superalloys (2) or by inspired by recent studies on GB relaxation element without any difference across GBs
forming more stable phases for strengthen- in metals—namely, that GBs can adjust their in high-magnification energy-dispersive x-ray
ing or for pinning grain boundary (GB) mo- structures into low-energy states through inter- spectroscopy (EDS) mappings (Fig. 1B). Seg-
tion at high temperatures (3). For example, the actions with partial dislocations as triggered regation of elements or second-phase particles
superalloys that serve at temperatures higher by plastic straining in a number of metals and at GBs is absent.
than 650°C are heavily alloyed, in which the alloys with nano-sized grains (8). The relaxed Under high-resolution TEM (HRTEM), we
strengthening g′/g′′ phases constitute up to GBs become more stable against migration found that nanograins are typically separated
60% in volume. under thermal (8) and mechanical (9) activa- by faceted boundaries, with segments of {111}
GBs in materials are usually regarded to be tion, respectively, implying that atomic dif- atomic planes connected by steps (Fig. 1C).
deleterious to creep. Atomic diffusivity along fusion associated with the relaxed GBs are Statistical measurements along the [110] axis
GBs in metals is several orders of magnitude retarded at elevated temperatures. In addition, showed that the number fraction of nanograins
higher than that in lattices above 0.5 Tm (Tm is the strengthening effect of the stabilized of which the majority of boundaries (>50%)
GBs may remain at higher temperatures. Both are faceted {111} is about 70%. Procession
1
Shenyang National Laboratory for Materials Science, Institute features may resist creep deformation, as long electron diffraction (PED) statistical measure-
of Metal Research, Chinese Academy of Sciences, Shenyang
as the GBs are capable of inhibiting diffusion ments under TEM (Fig. 1, D and E) revealed a
110016, China. 2School of Materials Science and Engineering,
University of Science and Technology of China, Shenyang and remaining strong under a combined stimu- random distribution of grain orientations with
110016, China. 3School of Power and Mechanical Engineering, li with high stress and high temperatures. a considerable fraction of low SCSL (coincidence-
Wuhan University, Wuhan 430072, China. 4Liaoning Academy We performed an experimental study by site lattice) boundaries (<S30) (44%). These
of Materials, Shenyang 110004, China.
*Corresponding author. Email: xyli@imr.ac.cn (X.Y.L.); taking a single-phased nickel-cobalt-chromium are typical structural features of GBs in relaxed
lu@imr.ac.cn (K.L.) (NiCoCr) alloy as an example. We found that states with low excess energies, analogous to
Fig. 1. Structures of the nanograined NiCoCr alloy with stable GBs. faults (SFs). (D) An inverse pole figure (IPF) image with (E) a distribution map
(A) A bright-field TEM image showing extremely fine grains. (B) A high-angle of GB characters from precession electron diffraction analysis. Colored lines
annular dark-field (HAADF) image of several grains, outlined by dotted lines, indicate different boundaries: red, twin boundaries; gray, low-angle GBs (5 to
with corresponding EDS mappings of different elements. (C) An HRTEM image ~15°); black, ordinary high-angle GBs (>15°); and other colors, other special
of an individual grain with faceted GBs, which contains twins and stacking boundaries (S < 30).
that in copper (Cu) and Ni with relaxed GBs pious in-grain twin boundaries and stacking having faceted boundaries. Twins and stack-
(8). They are distinct from the “high-energy non- faults in this nanograined sample (denoted ing faults were rarely seen with a much lower
equilibrium” GBs in metals that have under- as SNG-9). density of twin- and stacking fault–GB triple
gone severe plastic deformation (12). Copious For comparison, we cut out another set of line (~0.02 nm–1) than that of SNG-9. These
S3 twin boundaries and stacking faults were specimens in the subsurface layer from the suggest that GB relaxation was not induced in
detected in the nanograins (Fig. 1C), with a same as-processed bar in which grains were this sample, which has a chemical composi-
number density of twin- and stacking fault– larger than the critical size. A foil of about tion identical to that of the SNG-9 sample.
GB triple line of ~0.13 nm–1, supporting that 25 mm thick consists of roughly equiaxed and We characterized thermal stability of the
partial dislocation activities dominated the randomly oriented grains with an average samples by annealing at elevated temper-
deformation and refinement processes as transverse size of 42 ± 12 nm (aspect ratio of atures. In NG-42, obvious grain coarsening
expected. Hence, we believe that a large pop- ~1.6) (denoted as the NG-42 sample) (fig. S2), to the submicro-scale was detected as an-
ulation of GBs were structurally relaxed into which is similar to the nanograined structures nealed at >700°C (Fig. 2A and fig. S3), which is
more stable states triggered by the mechani- in metals from severe plastic deformation (12). analogous to the recrystallization in the
cal processing, forming dense GB networks Most GBs are ordinary with curved morphol- coarse-grained (CG) MP35N sample. How-
of abundant stable GBs interwoven with co- ogies, with only a very small fraction of grains ever, nanograins in SNG-9 remain stable in
morphology and size after annealing at 700°C. The GB strengthening capability at different modulus), which is in agreement with the
Grain sizes increase slightly to ~30 ± 10 nm temperatures (T) can be evaluated by using values calculated from the dislocation creep
after annealing at 800°C for 12 hours, and the coefficient K in the Hall-Petch relation- mechanism as in the Weertman-Ashby defor-
below 100 nm at 1000°C (Fig. 2A and figs. S3 ship (19), HV = HV0 + (ET/ERT)1/2 · K · d–1/2, where mation map (Fig. 3B). The NG-42 sample ex-
and S4). The higher thermal stability of the HV0 is intragranular hardness that can be ob- hibits creep rates of 5.6 × 10−4 to 3.9 × 10−4 s−1
SNG-9 is contradictory to the normal “smaller, tained from the CG samples; d is the aver- under a stress of 100 to 77 MPa (~0.1% G) at
less-stable” trend (13) but in alignment with age grain size; and ERT and ET are the elastic 700°C, and 4.3 × 10−4 to 1.2 × 10−4 s−1 under
that in nanograined Cu, Ni, and aluminium- modulus at RT and T, respectively (11). For 832 to 720 MPa (~1.1% G) at 600°C, respec-
magnesium (Al–Mg) samples with relaxed GBs the NG-42 sample, K decreases above 500°C, tively. The calculated stress exponent is about
(8, 14). The inherent stability against grain with an equicohesive temperature (when K = 0, 1.3, which is in agreement with the diffusional
coarsening can be reasonably attributed to GB strengthening vanishes) of ~800°C. In creep process. Apparently, the creep resistance
the stable GB networks consisting of abundant SNG-9, K clearly decreases at >810°C, with is lower in NG-42 because of its much higher
relaxed GBs interlocked with copious twin an extrapolated equicohesive temperature of GB density relative to the CG sample. Consid-
boundaries and stacking faults. ~1000°C, which is much higher than that of ering the concurrent grain coarsening induced
We measured Vickers hardness (HV) of the NG-42 and other alloys (15, 20, 21). These ob- by the indentation loading (average grain sizes
samples at various temperatures from RT to servations suggest that the relaxed GBs remain increase from an initial ~59 to ~400 nm at
900°C. Yield strength (sy) was converted with structurally stable and gain strength at high 700°C), we calculated the creep rates of GB
a Tabor factor of 3.0 (Fig. 2C) (1). The strength temperatures of up to ~1000°C. diffusional (Coble) and GB sliding mechanisms
of the NG-42 sample is around 2 GPa at RT We evaluated creep behaviors of the SNG-9 following equations in (11) for sample NG-42
and decreases at higher temperatures and pro- sample in a temperature range of 600° to 750°C under a stress level of ~0.1% G at 700°C. We
nouncedly at >600°C, which is similar to that by using the indentation-creep method (22) found that the two calculated rates are com-
in conventional superalloys (15–18). The SNG-9 on a Nano Test Vantage (Micro Materials, UK) parable; both are close to the measured rates
sample exhibits a yield strength of 2.6 GPa at equipped with a cubic boron nitride Berkevich (for example, Coble creep rates in Fig. 3B). It
RT and increases slightly to 2.8 GPa at 400° indenter. For comparison, we measured sample suggests that both mechanisms may be op-
to 600°C. Strength decreases above 600°C, NG-42 and a deformed CG sample (with grain erative during the creep process, which is
although the values are well above that of NG- sizes of ~50 mm) under the same conditions. consistent with that observed in other nano-
42 and other alloys over the entire temperature The steady-state creep stress and the corre- grained metals and alloys (23). An obvious
range. We plotted the measured RT strength sponding strain rate were derived from the in- decrease in texture intensity was detected in
values of NG-42 and SNG-9 samples and found dentation displacement-time curves (Fig. 3A), the sample after creep tests (fig. S6), verifying
that they fall nicely on the Hall-Petch line ex- with a holding time exceeding 300 s. the GB sliding mechanism that may random-
trapolated from the CG counterparts, which is For the CG sample, creep rates at 700°C ize the grain orientation distributions.
indicative of effective GB strengthening at RT ranged from 5.6 × 10−4 to 3.2 × 10−4 s−1 under Very low creep rates were observed in the
in the SNG-9 sample. a stress of 301 to 239 MPa (~0.4% G; G, shear SNG-9 sample, with a high strength at elevated
confirming that the GB-networks are stable strength, as well as high-temperature creep re- 21. T. Xia et al., Mater. Charact. 145, 362–370 (2018).
against the diffusional creep process under sistance simultaneously. Such a property en- 22. I. C. Choi, B. G. Yoo, Y. J. Kim, J. I. Jang, J. Mater. Res. 27, 3–11
(2012).
gigapascal stress at 700°C. hancement differs fundamentally from that 23. M. A. Meyers, A. Mishra, D. J. Benson, Prog. Mater. Sci. 51,
In a separate experiment, we estimated the of the traditional strategies. We know that 427–556 (2006).
GB diffusivity in the SNG-9 and NG-42 sam- over the past decades, various techniques have 24. J. Weissmüller, J. Markmann, Adv. Eng. Mater. 7, 202–207
(2005).
ples annealed at 700°C for 100 hours ten- been developed for introducing high-density 25. L. Wang et al., Nat. Commun. 5, 4402 (2014).
sioned under a stress of 260 MPa to analyze GBs in nanostructured materials. Stabilization 26. K. C. Chen, W. W. Wu, C. N. Liao, L. J. Chen, K. N. Tu, Science
their creep behaviors comparatively. We deter- of GBs through different physical and chem- 321, 1066–1069 (2008).
27. X. P. Mao et al., Adv. Mat. Res. 328-330, 1143–1148
mined GB diffusion coefficients in terms of ical approaches has been demonstrated in a (2011).
the grain growth kinetic model by using the wide range of metals and alloys (35). There- 28. R. P. Singh, R. D. Doherty, Metall. Trans. A Phys. Metall. Mater.
measured grain size changes. The GB diffu- fore, we anticipate that the use of stable GB Sci. 23, 321–334 (1992).
29. H. De Cicco, M. I. Luppo, L. M. Gribaudo, J. Ovejero-García,
sion coefficient we obtained in SNG-9 is about networks offers a viable paradigm for design-
Mater. Charact. 52, 85–92 (2004).
four orders of magnitude smaller than that in ing advanced stable alloys with high perfor- 30. T. W. Ni, J. X. Dong, Mater. Sci. Eng. A 700, 406–415
NG-42 (11), which suggests that atomic diffu- mance, especially alloys for high-temperature (2017).
sion is substantially suppressed by the stable applications. 31. G. F. Harrison, W. J. Evans, M. R. Winstone, Mater. Sci. Technol.
25, 249–257 (2009).
GB networks. This effect echoes previous ob- 32. M. Whittaker, W. Harrison, C. Deen, C. Rae, S. Williams,
RE FERENCES AND NOTES
servations in Cu that atomic diffusion is clearly Materials 10, 61 (2017).
1. M. A. Meyers, K. K. Chawla, Mechanical Behavior of Materials 33. G. M. Han, J. J. Yu, Z. Q. Hu, X. F. Sun, Mater. Charact. 86,
slowed along the relaxed GBs adjacent to the (Cambridge Univ. Press, 2008). 177–184 (2013).
intersecting twin boundaries (26). 2. R. C. Reed, The Superalloys: Fundamentals and Applications 34. Y. S. Zhao et al., Mater. Sci. Forum 944, 8–12 (2019).
Single-phased superalloys usually have low (Cambridge Univ. Press, 2006). 35. C. A. Schuh, K. Lu, MRS Bull. 46, 225–235 (2021).
3. K. A. Darling et al., Nature 537, 378–381 (2016).
creep stresses—typically below 350 MPa with
4. R. L. Coble, J. Appl. Phys. 34, 1679–1682 (1963). AC KNOWLED GME NTS
creep rates below 10−6 s−1—and they are higher 5. F. R. N. Nabarro, Report of a Conference on Strength of Solids
We thank C. Liang for help with sample preparation. Funding: This
in the g′/g′′–strengthened multiphased super- (The Physical Society, 1948).
work was supported by the Ministry of Science and Technology
alloys at 700°C (400 to ~750 MPa for wrought 6. C. Herring, J. Appl. Phys. 21, 437–445 (1950).
of China (grants 2017YFA0700700 and 2017YFA0204401), the
7. M. Nganbe, A. Fahim, J. Mater. Eng. Perform. 19, 395–400
superalloys and up to ~800 MPa for single- National Natural Science Foundation of China (grant 51901226),
(2010).
and the Chinese Academy of Sciences. Author contributions: X.Y.L.
crystal superalloys) (Fig. 4). The creep resis- 8. X. Zhou, X. Y. Li, K. Lu, Science 360, 526–530 (2018).
and K.L. initiated and supervised the study; Y.G.T. prepared
tances we observed in the NG-42 and deformed 9. X. Zhou, X. Li, K. Lu, Phys. Rev. Lett. 122, 126101 (2019).
the samples; Q.S.M. performed the indentation creep test; B.B.Z.
10. D. Sorensen, B. Q. Li, W. W. Gerberich, K. A. Mkhoyan, Acta
CG samples are obviously lower than those performed structure characterization experiments; and B.B.Z.,
Mater. 63, 63–72 (2014).
X.Y.L., and K.L. analyzed data, discussed the results, and wrote the
of conventional superalloys (2, 17, 27–34). The 11. Materials and methods are available as supplementary
paper. Competing interests: The authors declare no competing
creep resistance of the SNG-9 sample is out- materials.
interests. Data and materials availability: All data are available
standing, with strain rates as low as ~10–7 s–1
12. K. Oh-ishi, Z. Horita, D. J. Smith, T. G. Langdon, J. Mater. Res.
in the manuscript or the supplementary materials. License
16, 583–589 (2001).
information: Copyright © 2022 the authors, some rights reserved;
under a gigapascal stress at 700°C and 959 MPa 13. K. Lu, Nat. Rev. Mater. 1, 16019 (2016).
exclusive licensee American Association for the Advancement of
at 750°C. These properties in our single-phased 14. W. Xu, B. Zhang, X. Y. Li, K. Lu, Science 373, 683–687
Science. No claim to original US government works. https://www.
(2021).
NiCoCr alloy with stable GB networks are su- 15. M. Nganbe, M. Heilmaier, Int. J. Plast. 25, 822–837 (2009).
science.org/about/science-licenses-journal-article-reuse
perior to the existing wrought single-phased 16. Y. Gu et al., Scr. Mater. 55, 815–818 (2006).
and multiphased superalloys. Our alloy even 17. Special Metals Corporation, “Alloy technical bulletins”; SUPPLEMENTARY MATERIALS
https://www.specialmetals.com/documents/technical-
outperforms that of the most heavily alloyed science.org/doi/10.1126/science.abq7739
bulletins.
CMSX-4 (2, 34) and SRR99 (33) single-crystal 18. G. G. D. Armengol, thesis, University of London (1981).
Materials and Methods
Figs. S1 to S6
superalloys. 19. J. P. Hirth, J. Lothe, Theory of Dislocations (McGraw-Hill,
Tables S1 and S2
The present finding indicates that the stable 1968).
References (36–44)
20. J. H. Schneibel, M. Heilmaier, W. Blum, G. Hasemann,
GB networks in the nanograined alloy enable T. Shanmugasundaram, Acta Mater. 59, 1300–1308 Submitted 29 April 2022; accepted 11 October 2022
an elevated thermal stability, high-temperature (2011). 10.1126/science.abq7739
E
region that we identified would not have been
scaping replicative senescence is an essen- We sought to identify new mechanisms of included as a promoter region in earlier studies.
tial step of oncogenesis (1, 2). Telomere telomere maintenance in cancer cells by analyz- We tested whether the proximal 200 bp up-
shortening limits the proliferative poten- ing somatic mutations that occur in telomere- stream of the TPP1 translational start site
tial of cells, and several mechanisms have related genes. We focused our analysis on was enriched for somatic variants by exam-
been identified that permit tumor cells to melanoma because individuals with germline ining whole-genome sequencing data from
extend telomeres and increase their replica- variants in the TERT promoter predominantly 305 patient-derived melanoma samples avail-
tive capacity (3–8). Somatic mutations in the develop this cancer (5). We examined somatic able from the ICGC, and found that the
TERT promoter are the most common identi- variants from telomere-related genes in mela- TPP1 proximal promoter was significantly
fiable mechanism in melanoma and are found noma from the International Cancer Genome enriched relative to 59,727 annotated pro-
in ~75% of cases (5, 9). TERT is the catalytic Consortium (ICGC) (11). Mutations in TPP1 and moters (false discovery rate–corrected P value =
component of telomerase, the enzyme respon- POT1, components of the six-protein shelterin 6.57 × 10–14).
sible for de novo telomere synthesis and main- complex that coats telomeres, have been re- We next sought to determine the functional
tenance of telomeres. TERT promoter mutations ported in familial melanoma (12–14), and consequences of the somatic variants that we
are not sufficient to immortalize some cell we found numerous somatic variants among identified in the promoter of TPP1. The two
types, and telomeres continue to shorten in 749 melanoma samples analyzed (fig. S1). We most common variants were C>T transitions
nevi during the transition to melanoma de- noted a cluster of recurrent somatic variants located 75 and 108 bp upstream of the trans-
spite acquisition of TERT promoter mutations in a conserved region of ACD, the gene encod- lational start site. The –108 variant created
(10). Therefore, although additional mutations ing TPP1 (which we refer to as the TPP1 gene the core binding sequence TTCC for the
are likely required to enable telomere elonga- hereafter for clarity), that co-localized with E-twenty-six (ETS) family of transcription
tion and immortalization, the genomic changes histone marks typically associated with pro- factors. The –75 variant was adjacent to an
that potentially synergize with TERT promoter moters (Fig. 1A). TPP1 has been reported to existing ETS site in the context of a se-
mutations to achieve sustained telomere main- have two isoforms, TPP1-long (L) and TPP1- quence that is enriched for mutations in
tenance remain unknown (10). short (S), which differ by 86 amino acids in the melanoma (21), created a new TFIID binding
N terminus (15, 16). The cluster of variants was site, and co-localized with the annotated
positioned such that they would be coding transcriptional start site for the TPP1 mRNA
1
Dorothy P. and Richard P. Simmons Center for Interstitial variants in TPP1-L and promoter variants in (Fig. 2 and fig. S3). The identification of two
Lung Disease, Division of Pulmonary, Allergy, and Critical TPP1-S. To determine which isoform of TPP1 recurrent promoter variants that created or
Care Medicine, Pittsburgh, PA, USA. 2Environmental and was expressed in melanoma, we examined modified ETS transcription factor binding
Occupational Health Department, School of Public Health,
University of Pittsburgh, Pittsburgh, PA, USA. 3Faculty of
RNA-sequencing (RNA-seq) data from 12 mela- sites bore marked similarity to putative ac-
Medicine and Public Health, Princess Srisavangavadhana noma cell lines and 61 microdissected nevi and tivating mutations in the TERT promoter
College of Medicine, Chulabhorn Royal Academy, Bangkok, melanoma samples (GSE153592 and GSE112509) (5, 6), although the precise sequences created
Thailand. 4UC Santa Cruz Genomics Institute, University of
California, Santa Cruz, CA, USA. 5Department of Molecular,
(17, 18), and found that TPP1-S was the only by the variants were distinct. We found that
Cell and Developmental Biology, University of California, isoform expressed (Fig. 1A and fig. S2). To TPP1 was up-regulated in several large data-
Santa Cruz, CA, USA. 6University of Pittsburgh Medical further validate this finding, we cloned the bases of cancer gene expression, including
Center, Hillman Cancer Institute, Pittsburgh, PA, USA.
7 entire genomic region [3.5 kb, including 895 those with a high frequency of TERT promoter
Department of Molecular Biology and Genetics, Johns
Hopkins University School of Medicine, Baltimore, MD, USA. base pairs (bp) upstream of the TPP1-S trans- mutations (fig. S4); however, there were in-
8
Department of Pediatrics, Division of Pediatric Hematology/ lational start site and 637 bp upstream of sufficient data for the analysis of melanoma
Oncology, University of Pittsburgh School of Medicine, the TPP1-L translation start site and all exons with TPP1 promoter mutations specifically. To
Pittsburgh, PA, USA.
*Corresponding author. Email: jalder@pitt.edu (J.K.A.) and and introns of both isoforms] of TPP1 into a further characterize the TPP1 promoter variant,
cgreider@ucsc.edu (C.W.G.) plasmid without an additional promoter and we generated luciferase reporters of progressively
A
RNA-seq
TPP1S
TPP1L
1
ICGC
-108C>T -75C>T
10
Conservation
H3K27Ac
1kb
gD A
A
> T DN
N
A
5C g
B C
P1 W DN
N
-7 >T
gD
c
8C
TP -L c A
A
T
N
0
P1 DN
P1 87
P1 -1
P1 c D
TP M
TP pro
Flag TRF2 DAPI MERGE
TP ro
o
TP -S
-L
pr
p
P1
kDa
TP
TPP1-L Flag
HEK293
Parental
50 TPP1-S
37 GAPDH
5 µm
TPP1-L Flag
50 TPP1-S
LOX
TPP1-Flag
37 GAPDH
MEL624
TPP1-L Flag
5 µm 50 TPP1-S
37 GAPDH
Fig. 1. Identification of a cluster of somatic promoter variants in TPP1. cell lines stably expressing a C-terminally FLAG-tagged TPP1 were stained for the
(A) Genomic locus of the ACD gene from UCSC Genome Browser data. Dark blue shelterin component TRF2 and the FLAG epitope. Co-localization of TPP1 with
rectangles indicate the exons for TPP1-S and TPP1-L. The red bars below the TRF2 suggests that the C-terminal FLAG-tag does not disrupt localization of
gene track show the locations of the somatic variants identified in the ICGC TPP1 to the telomere. (C) Western blot of HEK293, LOX, and MEL624 cells
database, with taller bars corresponding to the number of melanomas found with transfected with plasmids encoding the cDNAs for TPP1-S and TPP1-L and
a specific variant. RNA-seq data (GSE153592) are shown above the gene track in for TPP1-L-M87A, which is incapable of expressing TPP1-S, together with
purple, along with vertebrate conservation and H3K27 acetylation marks from plasmids expressing the entire genomic locus of TPP1 with and without the most
multiple cell lines, indicating the location of likely regulatory regions. (B) HeLa common promoter variants.
smaller fragments of the TPP1 proximal pro- the activity of the TPP1 promoter only when the ative capacity of cells that express limiting
moter, and found that a 285-bp fragment was promoter variants were present (Fig. 2D). These amounts of telomerase. We expressed TPP1,
sufficient for full basal transcriptional activ- data suggest that the TPP1 promoter variants TERT, or both in primary BJ fibroblasts and
ity (fig. S3E). Introduction of the –75C>T or are activated by ETS transcription factors that monitored their proliferative capacity for
–108C>T promoter variants had little effect on are abundantly expressed in melanomas. 90 days (Fig. 3, B and C). Control untrans-
luciferase expression in HEK293 cells; how- To determine the cellular consequences of duced fibroblasts and fibroblasts transduced
ever, there was a small but significant increase increased TPP1 expression, we generated stable with TPP1 alone entered replicative senescence
in luciferase expression in the two melanoma cell lines that overexpressed TPP1 in telomerase- after ~40 days. By contrast, cells transduced
cells lines, LOX and MEL624 (Fig. 2A), suggest- positive HeLa cells. For completeness, we also with TERT and TERT + TPP1 bypassed senes-
ing that melanoma-specific ETS transcription examined TPP1-L. We investigated whether cence and were immortalized (Fig. 3B). These
factors are required for increased activity. RNA- cells stably expressing C-terminally tagged findings are consistent with previous reports
seq data from 426 melanoma samples (11) TPP1-S and TPP1-L altered telomere length demonstrating that TERT overexpression is
showed that of 27 ETS family members, ETV5, in telomerase-expressing HeLa cells. Consis- sufficient to immortalize primary fibroblasts
ETS1, and ETV4 were the most abundantly tent with previous reports (15, 22), stable over- (23). We next examined telomere length in
expressed (fig. S5). We confirmed this finding expression of TPP1-S led to considerable control and TPP1-transduced fibroblasts, and
using quantitative polymerase chain reaction telomere lengthening, whereas overexpression found that telomeres were very heterogeneous,
(qPCR) and Western blotting on non-melanoma of TPP1-L caused telomere shortening (Fig. 3A). with a median length of ~6 kb after 15 passages.
lines HeLa, BJ fibroblasts, and HEK293 and These data confirm that increased expression Introduction of TERT caused telomere lengthen-
several melanoma cell lines and short-term of TPP1 can lead to telomere lengthening in ing, consistent with previous reports (23), and
primary cultures (Fig. 2, B and C). Finally, we telomerase-expressing cells. the coexpression of TERT and TPP1 together
overexpressed ETV5, ETV4, or ETS1 in HEK293 We next investigated whether the over- caused a synergistic effect resulting in significant
cells and found that all three robustly increased expression of TPP1 could extend the prolifer- telomere elongation (Fig. 3D). These findings
A
-108 -75
0.0 0.5 1.0 1.5 0 1 2 3 4 0.0 0.5 1.0 1.5 2.0 2.5
Luc
EV
CTCCTCC TTCCTCT WT
CTCCTCC TTCCTTT
**** **
-75C>T
**** ***
TTCCTCC TTCCTCT -108C>T
B C D ****
a
15
62 om
60
* ****
M ela
Lo 293
4
50
Relative Expression
M
a
EK
eL
x
* kDa H 10
****
H
****
40
30 52 ETS1
20 5
55 ETV4
10
50 ETV5 0
0
ETV5 ETV4 ETS1 ETV5 ETV4 ETS1
37 GAPDH
Non-melanoma Melanoma TPP1pro WT TPP1pro -108C>T
TPP1pro -75C>T
Fig. 2. ETS transcription factors activate the variant TPP1 promoter. (C) Western blot showing high expression of ETS transcription factors
(A) Luciferase assays were performed with a 285-bp fragment of the TPP1 in LOX melanoma and MEL624 lines. (D) Luciferase assays comparing activity of
proximal promoter in melanoma and non-melanoma cell lines. The TPP1 the TPP1 promoter reporter in the presence of three transfected ETS
promoter variants had little effect on the transcriptional activity in non-melanoma transcription factors in HEK293 cells. Cells were co-transfected with a pGL4
cells lines (HEK293) but increased reporter activity in two melanoma-derived reporter and pCDNA3.1 expression plasmid with one of the three ETS
lines. (B) qPCR examining the levels of three ETS transcription factor family transcription factors. Mean and SD are shown from at least three independent
members in non-melanoma (HeLa, HEK293, and BJ fibroblast; n = 3) and experiments in (A) and (D), and groups were compared with a one-way
melanoma cell lines (MEL624 and LOX) and short-term primary cultures (n = 6 to ANOVA followed by Tukey’s multiple-comparisons test for pairwise comparisons.
7). Medians are shown and groups were compared using the Mann-Whitney test. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.
A TPP1 S L B D replicate # 1 2 3 1 2 3 1 2 3 1 2 3
Clone # P 1 2 1 2 P TPP1-S + + + + + +
80 TERT + + + + + +
BJ Non-treated
Population Doublings
Kb Kb
60
BJ TPP1-S+
Cumulative
6.0
6.0 20
5.0
5.0
0 4.0
0 20 40 60 80 100
Days after recovery from selection
C 3.0
replicate 1 2 3 1 2 3 1 2 3 1 2 3
3.0
TPP1-S + + + + + +
TERT + + + + + + 2.0
100 TERT
1.5
kDa
2.0 50 TPP1-S
1.2
37 GAPDH 1.0
BJ Fibroblasts
Day 90
BJ Fibroblasts
Fig. 3. TPP1-S overexpression causes telomere lengthening and is synergistic fibroblasts expressing TPP1-S or TERT (average of three independent transductions
with TERT overexpression. (A) Southern blot of telomeres in HeLa cell lines for each group). (C) Western blot showing expression of each of the transgenes
that stably expressed TPP1-S or TPP1-L for 90 days. Two independent clones of in cells collected from (B). (D) Southern blot of telomere lengths of BJ fibroblasts in
each are shown. “P” indicates the parental cell line used to establish each of the (B) 15 passages after transduction showing synergistic telomere lengthening in
modified clones. (B) Growth curves of cumulative population doublings of BJ cells exogenously overexpressing TPP1 and TERT.
5c /+
5c /+
5c /+
+
+
5c T
T/
W
T/
from three independent measure-
-7 1 T
-7 2 T
-7 3 T
T/
4
08
5
-7
-1
ments from each clone, and
-7
groups were compared using one- C D
way ANOVA followed by Dunnett’s TTAGGG TTAGGT DAPI OVERLAY
multiple-comparisons test.
(B) Schematic of the experimental 100
Wild-type
hTR-WT
TERT-expressing lentivirus to
increase the rate of variant telo- 60
hTR-TTAGGT
hTERT
canonical and variant telomeres
were quantitated. (C) FISH 0
hTR-TTAGGT
TPP1-75C>T
G T
+T -75 T
T
TA T
T
TA >
G
W
C
G
variant (TTAGGT; green) in
G
parental or genome-edited
+T
MEL624 cells. Images were 5 µm
+hTERT
taken 7 days after transduction
with lentiviruses. (D) Quantitation
E F
of the fraction of telomeres
Wild-type n=22 (15.83%)
with both TTAGGG and TTAGGT 1st hit
Telomere length
signals from a single clone. TERT promoter n=109 (78.42%) TERT promoter
Groups were compared using
ANOVA with Dunnett’s correction TPP1 promoter n=1 (0.72%)
for multiple comparisons. 2nd hit
**P < 0.01 and ****P < 0.0001. TERT and TPP1 promoter TPP1
(E) Proportion of cutaneous mutations n=7 (5.03%) promoter
melanomas that had TERT, TPP1,
Total=139
or TERT + TPP1 variants (25).
Time
(F) Model of telomere length
dynamics in melanoma progression. TERT promoter variants likely occur early and slow telomere attrition but are not sufficient to prevent telomere shortening
(blue dashed lines in model). Telomere shortening continues until cells enter crisis (red dashed line). Additional mutations, such as the TPP1 promoter, are likely
required to fully maintain telomeres and escape crisis (second hit).
indicate that TERT and TPP1 overexpression –108C>T variant significantly increased the We used a telomerase RNA encoding the
is synergistic and lengthens telomeres more expression of TPP1 (Fig. 4A). The greater in- variant telomere repeat TTAGGT, which can
than TERT overexpression alone. crease in expression levels of TPP1 from the be incorporated into telomeres and localized
To determine whether the TPP1 promoter modified endogenous promoter (Fig. 4C) com- with a peptide nucleic acid fluorescent probe.
variants were sufficient to increase telomere pared with the luciferase assay (Fig. 2A) sug- Wild-type or genome-edited MEL624 or LOX
addition, we introduced the two most common gests that additional factors may contribute cell lines with the most common promoter
variants, –75C>T and –108C>T, into MEL624 to TPP1 expression in melanoma. Telomeres variants were co-transduced with lentiviruses
and LOX cells using CRISPR/Cas9 (see the are extremely long in MEL624 and LOX cells that express the variant telomerase RNA and
supplementary materials and methods) (fig. (>20 kb), and it is not possible to detect hTERT. Using FISH to determine the percentage
S6). We obtained and sequence verified six changes in length using Southern blot analysis. of telomeres with variant repeats, we found
clones from MEL624 and LOX cells. We then We therefore used fluorescence in situ hybrid- that cells with a modified TPP1 promoter in-
examined the expression of TPP1 after modi- ization (FISH) to detect a modified telomere corporated significantly more TTAGGT variant
fying the endogenous promoter and found sequence as a surrogate for in vivo telomerase repeat sequences on telomeres (Fig. 4, C and
that introduction of either the –75C>T or activity, as previously described (Fig. 4B) (24). D, and fig. S7). These findings suggest that
TPP1 promoter mutations synergize with hTERT development of possible treatments for patients presentation; and P. Opresko and T. Finkel for thoughtful feedback
to increase telomere repeat addition in mela- with cancer and those with diseases of telomere on this manuscript. Funding: This work was supported by the
National Institutes of Health (grant R35CA209974 to C.W.G. and
noma cells. shortening. Our findings also support the idea J.K.A. and grant R01HL135062 to J.K.A.). P.C. received funding
We next investigated the co-occurrence of that multiple noncoding mutations can coop- from the HRH Princess Chulabhorn College of Medical Science to
somatic TERT and TPP1 promoter mutations erate to enable cellular immortalization and support graduate studies in Environmental and Occupational
Health Science, School of Public Health, University of Pittsburgh.
in cancer. TPP1 promoter variants are found highlight the importance of understanding Author contributions: Conceptualization: C.W.G., J.K.A.; Data
primarily in cancers of the skin, but have also the contribution of noncoding variants to curation: J.K.A., P.C., H.B.; Formal analysis: J.K.A., P.C., H.B.,
been reported in several different cancer types the development of cancer. O.V.; Funding acquisition: C.W.G., J.K.A.; Investigation: P.C., B.S.,
J.M.K., C.W.G., J.K.A., H.C.B., O.M.B.; Methodology: P.C., A.M.H.,
(fig. S8). The reason for the disproportionate A.A.G.S., E.R., C.S., C.J.C., H.C.B., O.M.B.; Visualization: P.C.,
number of variants in melanoma is unknown RE FERENCES AND NOTES A.M.H., H.C.B.; Resources: E.R., C.S., B.S., J.M.K.; Writing – original
but may be related to the high mutation rate draft: P.C., C.W.G., J.K.A.; Writing – review and editing: all authors.
1. N. W. Kim et al., Science 266, 2011–2015 (1994).
Competing interests: J.M.K. reports advisory/consultancy
and reliance on telomerase activation in this 2. D. Hanahan, R. A. Weinberg, Cell 144, 646–674 (2011).
roles with Amgen Inc., Ankyra Therapeutics, Applied Clinical
cancer. In a dataset of deeply sequenced cuta- 3. C. B. Harley, A. B. Futcher, C. W. Greider, Nature 345, 458–460
Intelligence LLC, Axio Research LLC, Becker Pharmaceutical
(1990).
neous melanomas (25), 139 samples were 4. K. J. Wu et al., Nat. Genet. 21, 220–224 (1999).
Consulting, Bristol Myers Squibb, Cancer Network, Checkmate
evaluated for the presence of the TERT and 5. S. Horn et al., Science 339, 959–961 (2013).
Pharmaceuticals, DermTech, Fenix Group International, Harbour
BioMed, Immunocore LLC, iOnctura, Istari Oncology, Magnolia
TPP1 promoter variants. A large fraction (83%) 6. F. W. Huang et al., Oncogenesis 4, e176 (2015).
Innovations LLC, Merck, Natera Inc., Novartis Pharmaceuticals,
carried a somatic variant in the TERT promoter, 7. F. P. Barthel et al., Nat. Genet. 49, 349–357 (2017).
OncoCyte Corporation, OncoSec Medical Inc., PathAI Inc., Pfizer
8. M. Peifer et al., Nature 526, 700–704 (2015).
as previously reported (5, 9), and eight samples 9. F. W. Huang et al., Science 339, 957–959 (2013).
Inc., Replimune, Scopus BioPharma, SR One Capital Management,
Takeda Development Center Americas Inc., and Takeda
carried a TPP1 promoter variant (~6%). In all 10. K. Chiba et al., Science 357, 1416–1420 (2017).
Pharmaceutical Company Limited. J.M.K. also reports research
cases except one, the TERT and TPP1 promoter 11. J. Zhang et al., Nat. Biotechnol. 37, 367–369 (2019).
grants/funding to his institution from Amgen Inc., Bristol Myers
12. C. D. Robles-Espinoza et al., Nat. Genet. 46, 478–481
variants were found together in the same tumor Squibb, Checkmate Pharmaceuticals, Harbour BioMed, Immvira
(2014).
Pharma Co., Immunocore LLC, Iovance Biotherapeutics, Novartis
(Fig. 4E). However, because of limitations in 13. L. G. Aoude et al., J. Natl. Cancer Inst. 107, dju408
Pharmaceuticals, Takeda, and Verastem Inc. The remaining
current whole-genome sequencing datasets, (2014).
authors declare no competing interests. Data and materials
14. J. Shi et al., Nat. Genet. 46, 482–486 (2014).
additional studies using targeted resequenc- availability: All data and materials used in the analysis are
15. S. Grill et al., Cell Rep. 27, 3511–3521.e7 (2019).
available to any researcher for purposes of reproducing or
ing will be required to determine the frequency 16. J. M. Boyle et al., Mol. Biol. Cell 31, 2583–2596 (2020).
extending our analysis and are available in the main text or the
of TPP1 and TERT promoter mutations in can- 17. J. Motwani et al., Epigenomics 13, 577–598 (2021).
supplementary materials. Please contact the corresponding
18. M. Kunz et al., Oncogene 37, 6136–6151 (2018).
cers other than melanoma. We found that TPP1 19. E. Rheinbay et al., Nature 578, 102–111 (2020).
authors to request any materials. License information: Copyright
© 2022 the authors, some rights reserved; exclusive licensee
up-regulation in the absence of telomerase 20. N. Weinhold, A. Jacobsen, N. Schultz, C. Sander, W. Lee, Nat.
American Association for the Advancement of Science. No claim to
expression is unlikely to influence telomere Genet. 46, 1160–1165 (2014).
original US government works. https://www.science.org/about/
21. N. J. Fredriksson et al., PLOS Genet. 13, e1006773
length or cellular immortality. Therefore, selec- (2017).
science-licenses-journal-article-reuse
tion for TPP1 promoter variants is most likely to 22. J. Nandakumar et al., Nature 492, 285–289 (2012).
SUPPLEMENTARY MATERIALS
occur after the activation of telomerase (Fig. 4E). 23. A. G. Bodnar et al., Science 279, 349–352 (1998).
24. M. E. Diolaiti, B. A. Cimini, R. Kageyama, F. A. Charles, science.org/doi/10.1126/science.abq0607
Our data indicate that TPP1 is one of the missing Materials and Methods
B. A. Stohr, Nucleic Acids Res. 41, e176 (2013).
factors that collaborate with TERT promoter 25. N. K. Hayward et al., Nature 545, 175–180 (2017). Figs. S1 to S8
mutations to facilitate cellular immortalization References (26–39)
ACKN OWLED GMEN TS MDAR Reproducibility Checklist
in melanoma. The identification of new path-
We thank all patients who participated in the various studies View/request a protocol for this paper from Bio-protocol.
ways that contribute to telomere lengthening
reported here; the Melanoma Center Biospecimen Repository
and cellular immortalization may have impor- (UPCI 96-99) for providing samples; C. Wongchokprasitti and Submitted 24 March 2022; accepted 11 October 2022
tant prognostic value and may also inform the M. Diekans for assistance in bioinformatic analysis and data 10.1126/science.abq0607
T
binding to RuBisCO probably serves a very differ-
oxic cyanobacterial blooms cause major dictions about toxicity. MC comprises a large ent function. Binding of MC appears to play a
water quality problems across the globe. class of cyanobacterial toxins, consisting of hun- key role in the assembly and cellular localization
Hence, there is a need for models that dreds of MC congeners that vary widely in tox- of RuBisCO, which enables rapid acclimation
can predict cyanotoxin concentrations in icity. Their model considers only the total MC of cells to CO2-limiting conditions (12).
surface waters. Hellweger et al. (1) devel- concentration, but ignores changes in MC com- Fifth, which factors govern the competition
oped an agent-based model that can provide position and therefore cannot make predictions between toxic and non-toxic strains? Laboratory
valuable insights in the molecular and physi- about the toxicity of blooms. This is not merely a selection experiments have shown that the MC-
ological mechanisms affecting the toxicity of semantic issue, because excess N may shift the MC producing wildtype has a strong selective ad-
cyanobacterial blooms. In essence, the pro- composition to the more N-rich variant MC-RR vantage compared to the MC-deletion mutant
posed mechanisms in Hellweger et al. (1) are: (2), which is one of the least toxic MC congeners. under CO2-limited conditions, but not under
(i) High nitrogen (N) but low phosphorus (P) Second, contrary to their Fig. 2, cyanobac- CO2-replete conditions (13). This reinforces the
loads will stimulate the production of the N- teria produce only low amounts of H2O2 by recent idea (12) that MC binding to RuBisCO
rich toxin microcystin (MC). (ii) One of the key photosynthesis. Cyanobacteria lack the Mehler probably plays a role in CO2 fixation. Other se-
functions of MC is protection against oxida- reaction, which is responsible for most H2O2 lection experiments investigated the role of N
tive stress. (iii) Therefore, MC-producing strains production during high light stress in photo- and P limitation. The results showed that the
will be more resistant to natural H2O2 concen- synthetic eukaryotes. Instead, cyanobacteria use MC-producing wildtype won under N limitation,
trations than non-MC-producing strains, espe- a “Mehler-like” reaction with flavodiiron pro- while the non-toxic mutant dominated under
cially under high N but low P conditions. (iv) teins to transfer their excess photosynthetic P-limited conditions (14), which is exactly op-
Thus, reducing P loads without diminishing N electrons to O2, which produces water without posite to the predictions of Hellweger et al.
loads will select for MC-producing strains, that H2O2 formation (4). Sixth, the models of Hellweger et al. consider
will make Lake Erie “more toxic”. Third, Hellweger et al. assume that the nat- only toxic and nontoxic Microcystis strains.
Hellweger et al. suggest that these mech- ural H2O2 concentrations in Lake Erie (0.1 to However, the main aim of nutrient load reduc-
anisms have contributed to the observed re- 0.5 mmol/L) may cause oxidative stress and in- tion programs is not to shift the competitive
surgence of toxic cyanobacteria after P load duce MC binding to proteins. However, the balance between Microcystis strains, but to
reduction in Lake Erie and many other lakes, study (5) cited by Hellweger et al. used a much suppress the entire cyanobacterial bloom and
and they advocate a dual N and P management higher H2O2 concentration of 10 mmol/L to shift the lake to a completely different phyto-
strategy. Although we agree with Hellweger et al. induce MC binding to proteins. Dziallas and plankton community. Shifts from bloom-forming
that high N concentrations can be an impor- Grossart (6) reported significant reduction of the cyanobacteria to (nontoxic) eukaryotic phyto-
tant driver of cyanobacterial growth and cyano- cellular chlorophyll-a content at environmen- plankton are often observed in response to de-
toxin production (2,3), several of their model tally relevant H2O2 concentrations of 0.025 to clines in nutrient availability. Models ignoring
assumptions and predictions are poorly sup- 0.1 mmol/L, but this result appears to deviate this important ecological mechanism are there-
ported or contradicted by existing literature. from other studies. Most controlled laboratory fore unlikely to make reliable predictions of
First, contrary to the claim in their title, the studies show that H2O2 only starts to affect the how nutrient load reductions will affect cyano-
model of Hellweger et al. does not make pre- photosynthetic yield and growth of Microcystis toxin concentrations in surface waters.
strains at H2O2 concentrations that are one or P load reductions have successfully controlled
more orders of magnitude higher [5 to 60 mmol/L,
1
Department of Freshwater and Marine Ecology, Institute for cyanobacterial blooms in a wide variety of lakes
Biodiversity and Ecosystem Dynamics, University of Amsterdam,
P.O. Box 94240, 1090 GE Amsterdam, Netherlands.
depending on the conditions; (e.g., 7,8)]. This (15), but in some lakes achieving sufficiently
2
Department of Microbiology, Institute of Biochemistry and is in agreement with lake treatments that re- low P concentrations proves challenging. In these
Biology, University of Potsdam, Karl-Liebknecht-Str. 24/25, 14476 quire H2O2 concentrations of 60 to 300 mmol/L cases, bloom control by dual N and P reduc-
Potsdam-Golm, Germany. 3Department of Drinking Water and
to effectively suppress cyanobacterial blooms tions seems promising and further experience
Swimming Pool Hygiene, German Environment Agency, Berlin,
Germany. 4Department of Biology, Center for Reservoir and (8,9). We therefore question whether the nat- with such dual approaches is desirable. How-
Aquatic Systems Research, Baylor University, One Bear ural H2O2 concentrations in Lake Erie are high ever, there are major issues with several molec-
Place #97388, Waco, Texas, USA. 5Department of Aquatic enough to induce MC-binding to proteins and ular and physiological mechanisms assumed in
Ecology, Netherlands Institute of Ecology (NIOO-KNAW),
Wageningen, Netherlands. 6Independent Consultant, Berlin. to shift the competitive balance between toxic Hellweger et al. and their models omit common
*Corresponding author. Email: j.huisman@uva.nl and nontoxic Microcystis strains. ecological responses to nutrient load reduction
such as shifts in phytoplankton species com- 6. C. Dziallas, H. P. Grossart, PLOS ONE 6, e25569 (2011). AC KNOWLED GME NTS
position. Hence, there is insufficient support 7. M. Drábková, W. Admiraal, B. Marsálek, Environ. Sci. Technol. Author contributions: Conceptualization: all authors; Writing of
41, 309–314 (2007). original draft: J.H., M.W., and I.C.; Review and editing of
for their provocative claim that P load reduc- 8. E. F. J. Weenink et al., Environ. Microbiol. 23, 2404–2419 manuscript: all authors. Competing interests: The authors declare
tion alone will make Lake Erie and other lakes (2021). that they have no competing interests. License information:
more toxic. 9. H. C. P. Matthijs et al., Water Res. 46, 1460–1472 (2012). Copyright © 2022 the authors, some rights reserved; exclusive
10. A. Holland, S. Kinnear, Mar. Drugs 11, 2239–2258 (2013).
licensee American Association for the Advancement of Science. No
11. J. M. Schuurmans et al., Harmful Algae 78, 47–55 (2018).
RE FE RENCES AND N OT ES claim to original US government works. https://www.sciencemag.
12. T. Barchewitz et al., Environ. Microbiol. 21, 4836–4851
1. F. L. Hellweger et al., Science 376, 1001–1005 (2022). org/about/science-licenses-journal-article-reuse
(2019).
2. D. B. Van de Waal et al., Ecol. Lett. 12, 1326–1335 (2009). 13. D. B. Van de Waal et al., ISME J. 5, 1438–1450 (2011).
3. C. J. Gobler et al., Harmful Algae 54, 87–97 (2016). 14. S. Suominen, V. S. Brauer, A. Rantala-Ylinen, K. Sivonen,
4. Y. Helman et al., Curr. Biol. 13, 230–235 (2003). T. Hiltunen, Aquat. Ecol. 51, 117–130 (2017). Submitted 18 July 2022; accepted 12 October 2022
5. Y. Zilliges et al., PLOS ONE 6, e17615 (2011). 15. J. Fastner et al., Aquat. Ecol. 50, 367–383 (2016). 10.1126/science.add9959
H
but it would require different parameteriza-
uisman et al. provide a point-by-point Third, Huisman et al. question whether oxi- tion of the two strains (beyond presence/absence
criticism of our recent paper (1), to which dative stress occurs at environmental H2O2 of the mcyB gene) to reflect those differences.
we respond in turn. First, the model concentrations and cite two studies. The first Sixth, Huisman et al. criticize that the model
predicts total MC concentration and we study (8) does not support their assertion. The only considers Microcystis and no other phyto-
equate that to toxicity, which is necessi- lowest concentration evaluated was 15 mmol/L plankton, and they suggest that nutrient reduc-
tated by limited availability of congener-specific at which effects were observed, which does not tions will lead to a shift away from Microcystis
knowledge on synthesis, function, potency, and rule out effects at untested lower concentra- toward nontoxic eukaryotic phytoplankton. We
it is common practice, e.g., WHO, EPA, ELISA, tions, which were also observed in another acknowledge that any changes due to manage-
also by Huisman et al. (2). We agree that a study by the same group (9). The second study ment or climate may result in a species shift,
change in N-limitation will likely affect MC (10) found no effect at 22 mmol/L, but the H2O2 which would not be predicted by the model, and
congener composition and toxicity. However, was degraded within a few hours and not re- that adds uncertainty to our results. However,
the underlying mechanisms remain unclear and plenished as it was in a study that did observe understanding and predicting species shifts is
the evidence is not as consistent as Huisman et al. an effect (11) and as it would be in the environ- complicated, and it is not clear that nutrient re-
suggest. In the study they cite (3), the more toxic ment. Our more recent work also shows effects ductions always or in the case of Lake Erie will
MC-YR also increased, and some studies found at natural H2O2 concentrations, though it also lead to a shift toward eukaryotes. In Lake Erie
no change of composition with changing N (4). suggests more complex strain-level diversity of (and many other systems), the present resur-
Second, in the model, H2O2 is produced photo- H2O2 sensitivity (6). Note that the effects in the gence of Microcystis occurred following nutri-
synthetically by Microcystis and other sources, model are sublethal and subtle, corresponding ent reductions (15). With the limited current
including respiration and extracellular. Yes, to ~20% growth rate differences. Huisman et al. understanding, assuming such a shift will not
there is increasing evidence that cyanobacteria also question whether MC binds to proteins at occur may be a good precautionary manage-
do not produce H2O2 via the Mehler reaction, ambient conditions, although their own work ment approach.
but photosynthetic production has been ob- (12) showed this. Huisman et al. end their critique by point-
served (5). In Lake Erie, H2O2 peaks prior to or Fourth, Huisman et al. point to a study (13) ing to the success of P load reductions in con-
coincident with Microcystis blooms (6, 7), con- that showed a toxigenic strain is more sensi- trolling cyanobacteria blooms, which is entirely
sistent with photosynthetic production. How- tive to H2O2 than a non-toxigenic strain and consistent with the model (our Figs. 4B1 and
ever, our more recent work also suggests most suggest that this contradicts the model, but 4C5) and misses the point of our paper, i.e., that
biological H2O2 production in Lake Erie is by the model actually reproduces that experiment it may increase toxin concentrations. The spe-
heterotrophic bacteria (7). It would be useful (our Fig. 3, right side). Huisman et al. also pro- cific criticisms they provide are useful in that
to extend the model to more explicitly resolve pose a different function for MC based on their they point to uncertainties and potential fu-
the various H2O2 sources and sinks. In the more recent research, where MC enables accli- ture developments of the model. However, such
meantime, the simplified representation is a mation to C-limitation. We don’t question this uncertainties are unavoidable and inherent in
reasonable approximation, and if it is Micro- mechanism and it would be useful to update all models of complex ecological systems. The
cystis or associated bacteria is not critical since the model to include it. Development of mech- model we presented is based on a large body of
H2O2 readily diffuses across cell membranes. anistic models is a dynamic/stepwise process, biological evidence, and even with its simpli-
and models will always lag biological under- fications constitutes the most complete and
standing. There are many potential functions of consistent representation of Microcystis growth
1
Water Quality Engineering, Technical University of Berlin, MC and they are not mutually exclusive. What and toxin production available today. The model
Berlin, Germany. 2Department of Microbiology, University of
evidence is there to refute that MC (also) binds predicts that reducing P alone will increase
Tennessee, Knoxville, TN. 3Department of Earth and
Environmental Science, University of Michigan, Ann Arbor, to proteins and protects them against oxidative toxin concentrations, which is in striking contrast
MA. 4Cooperative Institute for Great Lakes Research, damage, as it is implemented in the model? to the present management approach, which
University of Michigan, Ann Arbor, MA. Fifth, Huisman et al. suggest the ecology of assumes P load reductions will reduce toxicity.
*Corresponding author. Email: ferdi.hellweger@tu-berlin.de (F.L.H.);
wilhelm@utk.edu (S.W.W.) toxigenic and non-toxigenic strains may be Management should be based on the best sci-
†These authors contributed equally. affected by competition for C, consistent with ence and models available. We scientists need
to be clear and maybe sometimes “provoca- 9. M. Drábková, W. Admiraal, B. Marsálek, Environ. Sci. Technol. and Atmospheric Administration grant NA17NOS4780186 (G.J.D.);
tive” to make this happen. 41, 309–314 (2007). National Science Foundation grant OCE-1736629 (G.J.D.); German
10. E. F. J. Weenink et al., Environ. Microbiol. 23, 2404–2419 Research Foundation [DFG, Research Training Group “Urban
(2011). Water Interfaces (UWI)” (GRK 2032/1)]. Author contributions:
RE FE RENCES 11. C. Dziallas, H.-P. Grossart, PLOS ONE 6, e25569 (2011). Formal analysis: F.L.H., C.S., and F.E. Funding acquisition: F.L.H.,
1. F. L. Hellweger et al., Science 376, 1001–1005 (2022). 12. S. Meissner, J. Fastner, E. Dittmann, Environ. Microbiol. 15, S.W.W., and G.J.D. Project administration: F.L.H. and S.W.W.
2. G. Sandrini, S. Cunsolo, J. M. Schuurmans, H. C. P. Matthijs, 1810–1820 (2013). Software: F.L.H. Supervision: F.L.H., S.W.W. and G.J.D. Visualization:
J. Huisman, Front. Microbiol. 6, 401 (2015). 13. J. M. Schuurmans et al., Harmful Algae 78, 47–55 (2018). F.L.H. and C.S. Writing - original draft: F.L.H. Writing - review and
3. D. B. Van de Waal et al., Ecol. Lett. 12, 1326–1335 (2009). 14. S. Suominen, V. S. Brauer, A. Rantala-Ylinen, K. Sivonen, editing: F.L.H., C.S., R.M.M., S.W.W., D.J.S., G.J.D., and F.E.
4. K. Kameyama, N. Sugiura, Y. Inamori, T. Maekawa, Environ. T. Hiltunen, Aquat. Ecol. 51, 117–130 (2017). Competing interests: Authors declare that they have no
Toxicol. 19, 20–25 (2004). 15. H. W. Paerl et al., Hydrobiologia 847, 4359–4375 (2020). competing interests. License information: Copyright © 2022 the
5. C. O. P. Patterson, J. Myers, Plant Physiol. 51, 104–109 (1973). authors, some rights reserved; exclusive licensee American
6. D. J. Smith et al., Appl. Environ. Microbiol. 88, e0254421 (2022). ACKN OWLED GMEN TS Association for the Advancement of Science. No claim to original
7. D. Smith, The Impact of Microbial Interactions and Hydrogen Funding: National Oceanographic and Atmospheric Administration US government works. https://www.sciencemag.org/about/
Peroxide on Western Lake Erie Cyanobacterial Blooms, University grant NA18NOS4780175 (F.L.H. and S.W.W.). This is NOAA science-licenses-journal-article-reuse
of Michigan (2021). contribution 1034. National Institute of Environmental Health
8. M. Drábková, H. C. P. Matthijs, W. Admiraal, B. Maršálek, Sciences grant 1P01ES028939-01 (S.W.W.); National Science Submitted 18 July 2022; accepted 12 October 2022
Photosynthetica 45, 363–369 (2007). Foundation grant OCE-1840715 (S.W.W.); National Oceanographic 10.1126/science.ade2277
We are worthy
D
uring the first meeting with my future mentor when I was an undergraduate student, he asked
why I wanted to join his lab. I confidently responded with the first thing that came to mind:
“Because you’re famous.” He let out the loudest laugh I have ever heard and told me students
usually say they want to gain research experience to apply to grad school or they find his re-
search fascinating. I wanted to hide under the table. I was so embarrassed I hadn’t thought of a
savvy answer like the other students. I didn’t even know what grad school was, but it sounded
fancy and therefore out of my league. These were some of my struggles as a first-generation college
student and aspiring professional from an immigrant family.
something else to take the pressure off so I could work up the dare them to expect the best from themselves. As I say to my
courage to offer a thoughtful response. He never doubted I students, how can we expect others to see that we’re worthy
had something worthwhile to contribute. Over time, I began if we can’t see it ourselves? j
to believe it, too.
He held me to the highest standards. Yet no matter what Lan Nguyen Chaplin is a professor at Northwestern University.
mistakes I made, he showed me grace and compassion— Send your career story to SciCareerEditor@aaas.org.
PRIZE ES SAY
GRAND PRIZE WINNER
Bill Thompson
Bill Thompson
received an
undergraduate
degree from
Sheffield Hal-
lam University
and a PhD from
the University of Edinburgh.
After completing a postdoctoral
fellowship at Princeton Univer-
sity, he started his lab in the
Department of Psychology at
the University of California,
Berkeley, in 2022. His research
examines the computational
processes that support human
reasoning, creativity, and
language. www.science.org/
doi/10.1126/science.ade3128
SOCIAL SCIENCES
An ever-evolving mind
Experimental evolution of human cognition helps
us understand ourselves
By Bill Thompson tion pressures that influence how a species
evolves. The accident destroyed one of the
I
n 1887, in an upstairs room in a second- first known studies of experimental evolu-
ary school in Sheffield, England, a fire tion—a high-cost, high-value experimental
broke out. The fire at Wesley College methodology that helps biologists test the
engulfed a custom-built incubator that predictions of evolutionary theory under
had housed thousands of generations of controlled laboratory conditions.
CREDITS: (PHOTO) COURTESY OF BILL THOMPSON; (ILLUSTRATI
a population of unicellular organisms. I was born exactly 100 years later in 1987,
Every evening for 7 years, the incubator’s less than a mile away in the University of
temperature had been carefully increased Sheffield’s Jessop Hospital for Women.
by the diligent amateur scientist and school I did not learn about Dallinger’s experi-
governor, William Henry Dallinger. ments for another 31 years, but when I did,
Dallinger had been studying how or- it changed my life and my career.
ganisms adapt to changing conditions. I am a cognitive scientist, and through my
By gradually manipulating the conditions research, I try to understand what makes
inside the incubator over a long period of human intelligence so open-ended and cre-
time, he had taken control of the selec- ative. To accomplish this goal, I conduct my
own high-cost, high-value experiments de-
Department of Psychology, University of California, signed to grow new cognitive abilities in the
Berkeley, Berkeley, CA, USA. Email: wdt@berkeley.edu laboratory, using experimental evolution.
The goal of my research has been to test their predictions and to communicate and cognitive sciences and to better under-
translate this perspective into computa- their relevance to a broader audience. My stand the mechanisms shaping our minds
tional theories and experiments capable postdoctoral mentor, Tom Griffiths, intro- and our societies. j
of testing them—a truly interdisciplinary duced me to the method of experimen-
REF ERENCES AND NOTES
challenge. When I tried to develop formal tal evolution pioneered by Dallinger (6).
1. B. Thompson, B. van Opheusden, T. Sumers, T. L.
models of cognition as a PhD candidate in Together, we worked to conceptualize an Griffiths, Science 376, 95 (2022).
linguistics, I relied on methods from com- analogous framework applicable to cogni- 2. B. Thompson, S. Kirby, K. Smith, Proc. Natl. Acad. Sci.
puter science, specifically, probabilistic tive science that scaled up experimental U.S.A. 113, 4530 (2016).
machine learning, Bayesian inference, and approaches to cultural evolution. 3. B. Thompson, B. de Boer, J. Lang. Evol. 2, 94 (2017).
4. M. Schouwstra, H. de Swart, B. Thompson, Cogn. Sci. 43,
stochastic optimization algorithms (3–5). Experimental evolution in biology pro- e12732 (2019).
To extend these models to the popula- vided a model but not an implementation. 5. B. Thompson, T. L. Griffiths, Proc. R. Soc. London Ser. B
tion setting, I had to integrate them with Development of the necessary infrastruc- 288, 20202752 (2021).
mathematical models of evolutionary dy- ture to conduct experiments in multigen- 6. W. H. Dallinger, Proc. R. Soc. London 27, 332 (1878).
namics, in particular, replicator dynamics erational populations required years of
(2). These models helped to establish a deep investments of time and resources 10.1126/science.ade3128
SOCIAL SCIENCES
PRIZE ES SAY
FINALIST
Célia Lacaux
A doorway into possibility
Célia Lacaux
The borderland between wakefulness and
received her sleep promotes creativity
undergraduate
degree from
Aix-Marseille By Célia Lacaux dream and can even control their dreams’
University and scenarios)—two factors that have been posi-
E
Imperial Col- ach night, we cross a bridge that con- tively correlated with creativity (1, 2). Could
lege London and her master’s nects the waking and sleeping worlds. narcoleptic individuals’ atypical experience
degrees from Ecole Normale Su- We know very little about this bridge with sleep onset and dreams promote the
périeure and University College that symbolizes the sleep-onset pe- development of increased creativity over
London. She then completed a riod because our passage is brief and time? To address this question, I adminis-
PhD in 2021 at the Paris Brain leaves only a few fragmented memo- tered various questionnaires and creativity
Institute under the supervision ries behind. Moreover, sleep researchers tests (for example, invent different endings
of Delpine Oudiette and Isabelle have largely overlooked this twilight period, to a story) to 185 patients with narcolepsy
Arnulf. She is now moving to likely because of its “in-between” and fleet- and 126 healthy subjects (3). Patients with
the lab of Sophie Schwartz in ing nature. However, upon closer exami- narcolepsy scored higher than did healthy
Switzerland for a postdoctoral nation, the sleep-onset period appears to subjects on all tests. This higher creative
position. Her research focuses be a rich and dynamic time during which potential also correlated positively with
primarily on the relationship
our body and mind undergo substantial indices of sleepiness and with symptoms
between sleep and creativity.
changes. Brain activity slows, muscles relax, of narcolepsy indicative of a hybrid state
www.science.org/doi/10.1126/
and reality gradually distorts as dreamlike between wakefulness and sleep (such as
science.ade3129
images begin to dance before the eyelids. hypnagogic hallucinations, sleep paralysis,
In contrast to sleep researchers, many or lucid dreaming). These findings demon-
artists and inventors, such as Thomas Edi- strate the existence of an increased creative
son and Salvador Dali, have been fascinated potential in narcolepsy. In addition to pro-
by this period and viewed it as a real source viding a silver lining to a disabling disorder,
of creative inspiration. They even devised these results pointed to a possible link be-
methods for capturing this fleeting moment tween hybrid states and creativity.
and its flashes of creativity before they van- I decided to go further and directly test
ished into the limbo of sleep. Their secret? the impact on creativity of a hybrid physio-
Taking naps while holding an object that logical state and focused on the sleep-onset
dropped noisily as they dozed off to awaken period, commonly known as N1. To do so,
them just in time to record some of their I took an approach to empirically test the
discoveries and/or ideas. Is there any truth method used by Thomas Edison to increase
in this alluring story? Is the sleep-onset pe- his creativity. In this second study, 103 par-
riod conducive to creativity? ticipants were asked to solve lengthy and
This question, at the intersection of the tedious mathematical problems without
life and social sciences, was the focus of knowing that a hidden rule could allow
my PhD thesis work. My main hypothesis them to solve the problems almost instantly
was that hybrid states, at the borderland (4). Participants had to compute many of
between wakefulness and sleep, promote these arithmetic problems before and after
creativity. To test this hypothesis, I exam- a 20-minute break. The break was carried
ined a physiological state in which sleep out under the same conditions as those
and wakefulness coexist (the sleep-onset pe- used by Thomas Edison: The subjects sat
riod) alongside a sleep disorder, narcolepsy, in a chair and were instructed to rest while
in which the line between these two states holding an object in one hand. If the ob-
is finer than usual. ject fell, they had to report everything that
Patients with narcolepsy experience ex- came into their heads before the object fell.
cessive daytime sleepiness, which leads to During the break, participants’ brain activ-
recurrent bouts of sleep during the day. ity was monitored to determine their wake-
These individuals are also dream “mae- sleep stages.
PHOTO: COURTESY OF CÉLIA LACAUX
stros”: They remember their dreams more My collaborators and I found that af-
frequently than do the general population ter an average of only one minute in N1,
and are predominantly lucid dreamers most subjects (83%) suddenly discovered
(they are conscious of dreaming while in a the hidden rule—a threefold increase in
the proportion of individuals experiencing
this insight as compared with subjects who
Institut du Cerveau–Paris Brain Institute,
Pitié Salpêtrière University Hospital, Paris, France. had remained awake during the break. This
Email: celia.lacaux@gmail.com beneficial effect disappeared as the sub-
10.1126/science.ade3129
SOCIAL SCIENCES
PRIZE ES SAY
FINALIST
Stephen Kissler
Revealing contagion
Stephen Kissler
Mathematical models help predict and manage
received his the course of pandemics
undergraduate
degree from the
University of By Stephen Kissler our field’s fundamental equations, to con-
Colorado and struct a mathematical model to explain how
I
a PhD from the feel a kinship with the artists and poets these common coronaviruses behave (7). We
University of Cambridge, both of the Middle Ages who tried to make found that they are powerfully driven by
in Applied Mathematics. He is sense of the plague. They left us chill- seasonal shifts in our behavior, they can in-
completing his postdoctoral fel- ing, yet oddly familiar images of danc- duce immunity against one another, and yet
lowship at the Harvard T.H. Chan ing skeletons playing flutes, that sum- our immunity to them rapidly wanes. Based
School of Public Health and will moned contagion up from the graves; upon these insights, we built a series of best
start his lab in the Department images of stars detached from the sky that guesses for how the novel coronavirus’ tra-
of Computer Science at the rained down illness—which captured be- jectory might unfold: a major surge with re-
University of Colorado in 2023. liefs that were half science and half dream curring outbreaks, and years of intermittent
His research examines how (1, 2). These individuals left us words that control measures needed to keep hospitals
immunological and behavioral our modern lexicons have failed to replace: from being overwhelmed (8). The equations
factors influence the spread of influenza, from the influence of the stars; made clear that the pandemic of a lifetime
respiratory viruses. www.science.
cholera, from an excess of the fiery humor; was at our doorstep, and it would take all of
org/doi/10.1126/science.ade3133
syphilis, from the name of an epic poem’s us to shift its course.
unfortunate hero (3). Through their im- Despite these predictions, we were un-
ages and words, these artists and authors prepared for how capriciously the virus
turned an invisible microbe into some- would strike, like a cyclone flattening
thing that could be seen, heard, and some- neighborhoods at random. The only clear
how managed. pattern that emerged was that the new
Mathematics, like art and poetry, lets us virus showed a predilection for the poor
see the unseeable. We can use mathematics and the marginalized (9). Was this simply
to trace the courses of planets, predict dev- due to differences in underlying health,
astating storms, and learn the properties of or did some communities also experience
subatomic particles through the traces they much higher rates of infection? At the time,
leave behind. Likewise, and in the tradi- we had little idea where the virus was as
tion of the plague artists, we can trace the barriers to testing had obscured its move-
global course of an illness, predict when it ments (10). We needed the epidemiological
will surge and recede, and learn the proper- equivalent of weather stations to map and
ties of a virus through the imprint it leaves predict its path (11). Fortunately, a network
on the body. Typically, the mathematics of of hospitals across New York City provided
contagion rest on a sure scientific founda- just this, by routinely administering severe
tion, but sometimes we are thrown into the acute respiratory syndrome coronavirus
turmoil of grappling with something com- 2 (SARS-CoV-2) tests to women who were
pletely new. It was into this turmoil that about to give birth (12). We used a new sta-
my colleagues and I were thrown when we tistical approach to triangulate the level of
heard the first reports of an atypical pneu- disease circulating in these women’s com-
monia in Wuhan, China, on 4 January 2020. munities and found vast differences, which
The early reports from Wuhan and reflected the disparities in severe disease
Lombardy, Italy, made clear that we needed occurrence (13, 14). We then sought to ex-
a swift response—but how? What would plain what drove these disparities. A da-
it take to bend the epidemic’s trajectory? tabase of anonymized cell phone locations
Without a clear frame of reference, we re- over time was used, and we found that the
lied on metaphor: Was this the outbreak of neighborhoods with the most infections
1918, 2003, or 2009 (4–6)? The right com- also had the most commuters (i.e., front-
parison was key, yet despite four other coro- line workers—those who were regularly
naviruses spreading regularly beneath our still commuting from home to work—were
literal noses, we knew little about them. We bearing the brunt of the pandemic). We
dug through historical records and gathered used these results to advocate for greater
PHOTO: KENT DAYTON
what data we could. Then, we built upon protections for essential workers.
Amid the pandemic’s march across the
globe and into our communities, a paral-
Department of Immunology and Infectious Diseases,
Harvard T.H. Chan School of Public Health, Boston, MA, lel drama played out between the virus and
USA. Email: skissler@hsph.harvard.edu our bodies. An infection is its own small