FEMS Yeast Research 5 (2004) 179–189

www.fems-microbiology.org

Reliable high-throughput screening with Pichia pastoris

by limiting yeast cell death phenomena
Roland Weis a, Ruud Luiten b, Wolfgang Skranc b, Helmut Schwab a,
Marcel Wubbolts b, Anton Glieder a,*
a
Institute of Molecular Biotechnology and Research Centre Applied Biocatalysis, Petersgasse 14, A-8010 Graz, Austria
b
DSM Fine Chemicals, Austria

Received 12 February 2004; received in revised form 7 May 2004; accepted 9 June 2004

First published online 20 August 2004

Abstract

Comparative screening of gene expression libraries employing the potent industrial host Pichia pastoris for improving recomb-
inant eukaryotic enzymes by protein engineering was an unsolved task. We simplified the protocol for protein expression by P. pas-
toris and scaled it down to 0.5-ml cultures. Optimising standard growth conditions and procedures, programmed cell death and
necrosis of P. pastoris in microscale cultures were diminished. Uniform cell growth in 96-deep-well plates now allows for high-
throughput protein expression and screening for improved enzyme variants. Furthermore, the change from one host for protein
engineering to another host for enzyme production becomes dispensable, and this accelerates the protein breeding cycles and makes
predictions for large-scale production more accurate.

2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: High-throughput screening; Pichia pastoris; Programmed cell death; Apoptosis; Protein expression; Protein engineering

1. Introduction This development can be regarded as a committed step

The methylotrophic yeast Pichia pastoris represents a
powerful host for recombinant protein production [1].
However, the enterobacterium Escherichia coli was still
considered as a preferred microorganism for protein
engineering, the generation of mutant libraries of
heterologous proteins and in many cases also for studies
of cell physiology [2]. Applying E. coli as a host, both
expression of proteins as well as screening for desired
or even unknown enzyme activities has been scaled-
down to microscale, making these processes amenable
for automatisation in a high-throughput manner [3–5].
*
Corresponding author. Tel.: +43 316 873 8422/4074;
fax: +43 316 873 8430/9302.
E-mail address: glieder@glieder.com (A. Glieder).
for the successful high-throughput expression of desig-
nated open reading frames derived from genome data
[6], protein engineering by directed evolution [7], and
production of therapeutics [8].
The drawback of prokaryotic protein expression is the
lack of a eukaryotic machinery, which obviates the
heterologous expression of correctly folded and processed
proteins from a variety of eukaryotic genes in E. coli. The
importance of this inadequacy is emphasized by two re-
cent developments, the publication of draft sequences of
eukaryotic genomes (including the human one), and the
emerging market of engineered eukaryotic proteins.
The development of microscale cultivation systems
for eukaryotes, ranging from yeasts as Saccharomyces
cerevisiae [6] to animal cells [9], complies with the
requirements for large-scale expression of genomic

1567-1356/$22.00
2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsyr.2004.06.016
180 R. Weis et al. / FEMS Yeast Research 5 (2004) 179–189
sequences. One article presents a microscale cultivation
procedure for the host organism P. pastoris [10], but
its value for comparative high-throughput screening
for protein engineering has to be doubted due to the lack
of data addressing standard deviations of expression lev-
els across the whole plate.
Protein engineering through rational and/or random
approaches offers a way to optimize enzymes rapidly.
During the last few years, directed evolution techniques
have been developed and used to solve ever more en-
zyme engineering problems [11]. The generation of large
mutant gene libraries which are screened for variants
with improved properties is enabled through a variety
of methods, such as the use of degenerate oligonucleo-
tides, chemical mutagenesis, passage of DNA through
mutagenic strains, error-prone PCR as well as DNA-
shuffling and recombination practices [12]. So it is equi-
table to say that the creation of mutant libraries almost
becomes routine, whereas the outcome of directed evo-
lution experiments critically depends on the means of
expressing and screening the mutant libraries [13]. Actu-
ally, the most essential experimental effort of directed
evolution is to devise, validate and implement a suitable
screen, following the first law of random mutagenesis:
‘‘you get what you screen for’’ [7]. Many industrially
important enzymes have been successfully improved in
E. coli. Still, the need for functional expression of pro-
teins that are not sufficiently well expressed in this host
is a serious bottleneck that has kept several enzymes out
of the evolutionistÕs reach [7,14].
The success of P. pastoris for the production of
heterologous eukaryotic enzymes is mainly due to its
capability of introducing posttranslational modifica-
tions, correct folding of eukaryotic proteins and growth
at high cell densities, respectively [15]. Nevertheless, the
creation of multiple variants through, e.g., directed evo-
lution experiments and expression of the corresponding
mutants can hardly be done in this yeast. Circumstantial
cultivation, high oxygen demand and handling proce-
dures of P. pastoris have limited its applicability for
high-throughput experiments. In addition to simplifying
the handling procedures and downscaling of recombi-
nant protein production in P. pastoris, we optimised cell
viabilities in 96 deep-well plate cultures in order to
achieve high levels of active recombinant protein with
a low deviation in expression levels from well to well.
Only viable cells contribute to high-level protein expres-
sion and provide information about protein properties,
which is predictive for enzyme variants, produced under
controlled conditions on a large scale.
Apoptosis in yeast is one form of programmed cell
death and its regulators and effectors have been inten-
sely studied [16]. Apoptotic cells cannot maintain their
full physiological activity, but are still not necrotic.
Although several inducers have been well characterized,
the effect of varying glucose concentrations in culture
media on yeast apoptosis is still unclear. In this study,
we describe the development of a reliable high-through-
put expression and screening system for recombinant
protein production in P. pastoris by employing apopto-
sis and cell necrosis as markers for mandatory media
optimisations.
2. Materials and methods
2.1. Microbial cloning and reporter strains
Standard molecular-biology procedures were per-
formed according to [17]. E. coli XL-1 blue (Stratagene,
La Jolla, CA, USA) was used for all E. coli cloning
experiments.
P. pastoris strains GS115 (his4) and X-33 (both Invi-
trogen, Carlsbad, CA, USA) were used as hosts for the
yeast experiments. The strain P. pastoris GS115
PamHNL5-a37 [18] expressing the secreted enzyme
hydroxynitrile lyase (HNL) from Prunus amygdalus,
PaHNL5, the strain P. pastoris GS115 PpD1-17 [19]
with the gene for expression of intracellular HbHNL
and P. pastoris GS115 PaHNL5_L1Q [20] which shows
an optimized N-terminal sequence for high level ex-
pression, were used as reporter strains for protein
expression. An additional reporter plasmid pPICZalp-
haB-HRP-WT for the expression of secreted horseradish
peroxidase (HRP) was obtained as a kind gift of Frances
H. Arnold (Caltech, USA). This plasmid was trans-
formed into the strain X-33 (see 2.3), yielding the
new strain P. pastoris X-33 pPICZalphaB-HRP-WT.
2.2. Chemicals and media
Unless otherwise stated, all chemicals were purchased
from Carl Roth GmbH (Karlsruhe, Germany) and Bec-
ton, Dickinson and Company (Franklin Lakes, NJ,
USA), respectively. Sterile water was purchased from
Fresenius Kabi (Graz, Austria).
Unless specifically mentioned, all culture media and
ingredients were prepared according to the protocol
from the Pichia protein expression Kit (Invitrogen, Car-
lsbad, CA, USA). All shake-flask cultivations were car-
ried out in wide-necked, baffled shake flasks covered
with two layers of cotton cloth.
Yeast cultures were either grown in YPD medium
(1% w/v yeast extract, 2% w/v peptone and 2% w/v glu-
cose), minimal dextrose (MD) medium (1.34% Yeast
Nitrogen Base YNB, 4 · 10
5% biotin and 0.2%, 1%,
2% or 3% glucose), minimal methanol (MM) medium
(1.34% YNB, 4 · 10
5% biotin and 0.5% methanol),
buffered MD (BMD) medium (containing 200 mM
potassium phosphate buffer, pH 6.0) or buffered MM
media with doubled (BMM2 containing 1% methanol))
or tenfold (BMM10 containing 5% methanol) concen-
 R. Weis et al. / FEMS Yeast Research 5 (2004) 179–189
tration of methanol compared to MM. An additional
‘‘H’’ indicates the addition of 0.004% histidine to ensure
growth of histidine-auxotrophic strains, as e.g., BMDH
for P. pastoris GS115. Media for plates were solidified
by addition of agar to 1.5% w/v.
Transformed X-33 cells were selected on YPD agar-
plates supplemented with 100 lg ml
1 Zeocin (Cayla,
Toulouse, France).
2.3. Transformation of P. pastoris and selection for
positive clones
P. pastoris was transformed using the standard elec-
troporation protocol according to the ‘‘Pichia Expres-
sion Kit’’ (Invitrogen). Plasmid DNA (10 lg) was
linearized using a restriction enzyme, e.g., BglII or SacI
(both purchased from NEB, Beverly, MA, USA) for
integration of the expression cassette into the genome
of P. pastoris and desalted via dialysis using nitrocellu-
lose filters (0.0025 lm, Millipore, Billerica, MA, USA)
against sterile water for 60 min at room temperature.
After transformation, aliquots of 100 ll were plated
on YPD agarplates supplemented with 100 lg ml
1 Zeo-
cin and incubated for 2 d at 30 C.
The presence of the expression cassette in the genome
of P. pastoris was confirmed by colony PCR. Zeocin-re-
sistant clones were replated on selective media for col-
ony PCR analysis. A single colony was resuspended in
100 ll sterile water, heated to 95 C for 5 min and cen-
trifuged at top speed in a tabletop centrifuge for 1 min
the supernatants, 10 ll served as template for a 50 ll
reaction, containing 0.2 mM dNTPs, 1· reaction buffer
(Qiagen, Hilden, Germany), 1.2 U HotStar Taq polym-
erase (Qiagen), 200 nM each of the primers PP5AOX1
(5 0 GACTGGTTCCAATTGACAAGC 3 0 ) and 3TTA-
OX1rev1 (5 0 GGTGCCTGACTGCGTTAGC 3 0 ). The
following program was used for PCR: 15 min at
95 C, 30 cycles with 30 s at 95 C, 1 min at 55 C
and 2.5 min at 72 C, followed by a final extension step
of 10 min at 72 C. The identity of the resulting PCR
products was verified by DNA sequencing.
2.4. Choice of cultivation conditions in micro-scale deep-
well plates
P. pastoris GS115 and X-33 were grown in shake
flasks in MDH to an OD600 of 2. The wells of the
deep-well plate (Bel-Art Scienceware, Pequannock, NJ,
USA) were then filled with 200, 300, 400, 500, 600,
700 and 800 ll of the cultures, always spaced by wells
with 500 ll of sterile medium, covered and shaken with
340 rpm at 28 C and 80% humidity. After 30 min, 4,
12 h, 1, 2, 3, 4 and 5 d, respectively, the covers and wells
were checked for liquid spillings and volume loss in wells
in the periphery of the plates. Furthermore, the different
181
culture volumes were assessed for pelleted cells semi-
quantitatively by eye.
2.5. Optimization of glucose concentration and protein
expression
Deep-well plates were filled with 250 ll BMD,
BMDH or YPD (glucose concentrations were 0.2%,
1%, 2% and 3%) and inoculated from individual colonies
of GS115 and GS115 PamHNL5-a37. The cultures were
grown under standard conditions (28 C, 340 rpm and
80% humidity) for 60 h. Then 250 ll BMM2 were
added. For further feeding with methanol, 50 ll
BMM10 were admixed 70, 82 and 106 h after inocula-
tion. At 24 h after the last induction (i.e., a total cultiva-
tion time of 130 h) the cells were harvested by
centrifugation at 4000 rpm and 4 C for 10 min in an
Eppendorf 5810R centrifuge, and the supernatant of
each well was assayed for HNL activity in UV-micro-
plates (Greiner Bio-one GmbH, Kremsmünster,
Austria).
2.6. Determination of residual glucose and ammonium in
deep-well plate cultures
Glucose concentration measurements were per-
formed with the ‘‘Glucose UV’’ kit (Dipromed, Weigels-
dorf, Austria) using the hexokinase method. The assay
was adapted to microplates: 190 ll of the provided rea-
gent were combined with 10 ll sample, mixed and incu-
bated at room temperature for 15 min. The absorbance
at 340 nm was measured with a platereader (Spectramax
384plus, Molecular Devices, Sunnyvale, CA, USA) and
offset against a calibration curve that was generated with
known glucose concentrations. Samples represented the
supernatant of briefly centrifuged culture aliquots with-
drawn at given time-points from representative wells
throughout a deep-well plate. If necessary, these samples
were diluted in order to meet the criteria of linearity
within the calibration curve. The determinations of
ammonium in the culture media in deep-well plates were
performed with the Spectroquant Ammonium-test
(Merck, Darmstadt, Germany).
2.7. Determination of necrotic cells
A correlation between the ratio of OD600-value to cell
number was set up as follows: following determination
of OD600 of cultures grown for 60 h, the cell number
was counted under the microscope (Laborlox S, Leitz)
in a Thoma chamber (0.1 mm depth, 0.0025 mm2). This
revealed a cell number of 1.5 · 108 per OD600 = 1. For
this calculation factor, no significant dependence on glu-
cose concentration was observed up to a concentration
of 3%.
182 R. Weis et al. / FEMS Yeast Research 5 (2004) 179–189
0.5 mg Propidium iodide (P-4170, Sigma, St. Louis,
MO, USA) were dissolved in 10 ml sterile PBS (0.1 M
phosphate buffer, pH 7.2, supplemented with 0.12 M
NaCl), stored under protection from light at 4 C
and used within 30 min. The cells were cultured at var-
ious glucose concentrations according to the mentioned
protocol, and after 60 h a theoretical 108 cells were
gently pelleted through centrifugation at room temper-
ature with 1500 rpm for 5 min in a tabletop centrifuge.
After washing 3 times in 0.5 ml PBS, the pellets were
softly resuspended in 200 ll of propidium iodide-
solution, transferred to fluorescence microtiter plates
(FIA plates black TC, F-form, Greiner Bio-one
GmbH, Kremsmünster, Austria), incubated for 10
min at room temperature in the dark and finally meas-
ured for fluorescence intensity in a Spectramax Gemini
XS fluorescence platereader (Molecular Devices, Sun-
nyvale, CA, USA). The excitation wavelength was
536 nm and the emission wavelength 617 nm with a
cutoff filter set to 610 nm. Prior to all measurements,
a calibration curve was created by mixing living cells
(cultivated in deep-well plates in BMD 1% for 20 h)
with dead cells (=living cells, incubated at 75 C for
10 min) in ratios to yield always a calculated total of
108 cells, with a fraction of 0%, 10%, 25%, 30%,
50%, 75% and 100% dead cells.
For the determination of fully-viable cells, an aliquot
of the culture containing a calculated number of 108 cells
was withdrawn after cultivation in media with different
glucose concentrations for 60 h. The cells were diluted
to a theoretical 103 and 102 cells ml
1, and 50 ll as well
as 100 ll of these dilutions were plated on MD and YPD
agarplates, respectively. After 2 d at 30 C, the colonies
were counted and the values were compared to the cal-
culated number of cells.
2.8. Investigation of apoptotic phenomena
For assaying apoptotic phenomena, the TdT-medi-
ated dUTP nick end labelling (TUNEL)-test was em-
ployed [16]. A calculated number of 8 · 107 cells was
taken from representative wells of cultures incubated
in media with different glucose concentrations (0.2%,
1%, 2% and 3%) for 60 h. Cells were treated as described
in [21,22], except for the application of zymolyase 20T
(from Arthrobacter luteus, Seikagaku Corp., Tokyo,
Japan) for spheroplasting.
To obtain positive controls, 4 h prior to further
processing (i.e., after 56 h of incubation) different con-
centrations of H2O2 (10, 100, 300, 600 and 1000 mM)
were added to some culture wells grown as mentioned
above. Suitable concentrations for the individual culti-
vation conditions were applied as positive control for
further tests. As negative controls, a calculated number
of 8 · 107 cells were grown in deep-well plates for 20 h in
BMD 1% glucose. The calculation of apoptotic cells in
relative numbers was determined in three independent
windows of the corresponding slides.
2.9. Additional reporter systems and the corresponding
activity assays
The HNL standard assay employing benzaldehyde
cyanohydrin (mandelonitrile), as a substrate was
adapted to a 96-well microtiter plate format: 130 ll
of 0.1 M citrate-phosphate buffer, pH 5.0, were com-
bined with 20 ll of supernatant. After addition of
50 ll racemic mandelonitrile solution (80 mg racemic
mandelonitrile, dissolved in 0.003 M citrate-phosphate
buffer, pH 3.5, 15 mM final concentration), the
absorbance at 280 nm was tracked over 5 min in
the platereader (Spectramax Plus384, Molecular De-
vices, Sunnyvale, CA, USA). For the comparison of
microtiter plate results with the standard assay in
1-cm cuvettes, an e280 for benzaldehyde of 1.376
l mM
1 cm
1 and a correlation factor was used to cal-
culate the actual specific activity in U (=lmol prod-
uct min
1) ml
1.
For determination of horseradish peroxidase (HRP)-
activity, a protocol from Morawski et al. [23] was
adopted. The absorption was measured at 405 nm in a
Spectramax 384plus platereader (Molecular Devices,
Sunnyvale, CA, USA) after incubation of the culture
supernatants with the substrate ABTS (2,2 0 -azino-bis-
(3-ethylbenzthiazoline-6-sulfonic acid)) and H2O2 for
30 s in the dark.
For the assay of intracellular HNL, P. pastoris
GS115 PpD1-17 cultures were centrifuged, the supern-
atant was discarded and for cell lysis under non-dena-
turing conditions 15 ll of ‘‘Y-PER reagent’’ (Pierce,
Rockford, IL, USA) were added to the cell pellets
in the wells. The plate was incubated with gentle shak-
ing for 30 min at room temperature. After a centrifu-
gation step for 40 min at 4000 rpm, the supernatant
of each well was assayed for HNL-activity in a UV-
microplate as described above for the secreted (R)-
HNL.
2.10. Scale up
P. pastoris fermentations were carried out similar to
the protocols described in [24], with the notable excep-
tion that glucose was used instead of glycerol: at the
end of the glucose feed, a methanol feed was started
aiming at keeping the methanol concentration (off-line
methanol analysis) around 1% by adjusting the feed
rate. The pH-value was set at 5.5 and controlled by sulf-
uric acid and ammonia, respectively. Dissolved oxygen
was kept above 30%, primarily controlled by stirrer
speed, and backed up by aeration rate. The temperature
was set to 30 C. Cell dry weights were determined as de-
scribed in [25].
 R. Weis et al. / FEMS Yeast Research 5 (2004) 179–189
3. Results and discussion
3.1. Microscale cultivation system for P. pastoris
Possible difficulties one inevitably encounters when
using microscale expression and high-throughput
screening facilities include: (a) differential growth and
variations in gene expression by identical clones in sep-
arate wells of microtiter plates; (b) differential growth
and/or gene expression of different clones from gene var-
iant libraries; (c) differential stress exposure across the
plate [3]. The goal is the development of a system in
which every individual culture of a 96-well plate shows
uniform growth and expression.
In previous studies [5,26], deep-well plates with
square-shaped wells and a planar bottom were identified
as optimal system to provide optimal oxygen supply [27]
and to keep cells in suspension. Additionally, the covers
of these plates (Bel-Art Scienceware, Pequannock, NJ,
USA) contained inlets to seal each well against cross-
contamination. In deep-well plates with round wells
and a conical well-bottom the cells pelleted within min-
utes, even when shaken at the rotation limit of 400 per
minute.
As first steps towards microscale cultivation, test runs
under varying conditions were performed using P. pas-
toris strains GS115 and X-33 as reporters for growth
behaviour. Standard cultivation parameters were: 340
rpm at 28 C [24,28] with 80% humidity and a maximum
filling capacity of 600 ll per well, because volumes
above this limit tended to spill onto the cover.
Volume loss under these conditions was negligible
within the cultivation time of three days.
3.2. Optimization of the micro-scale cultivation and
screening
The strong inducible AOX1-promoter was used for
all expression experiments with reporter enzymes. This
promoter is tightly repressed by most carbon sources
like glucose or glycerol and highly induced by methanol
when the C-sources are depleted.
For high-throughput screening the usually employed
media change, from repressing growth medium to induc-
tion medium containing methanol as a sole carbon
source had to be strictly avoided. Such manipulations
cause a high risk of cross contamination and varying
loss of cell material from individual cultures in deep-well
plates, which is a major source of high standard devia-
tions of enzyme activities. Moreover, this procedure is
very laborious. We kept the P. pastoris-cells growing
in 250 ll glucose-containing medium until glucose
was depleted and then induced expression by adding
methanol. In order to avoid stress to the cells by addi-
tion of pure methanol and to provide further nutrients
for the expression phase, the methanol was applied not
183
in a pure form but as a dilution in medium lacking glu-
cose. For the first steps in the development of a micro-
scale cultivation system for comparative screening of
enzyme activities, we used P. pastoris GS115
PamHNL5-a37 [18] expressing a secreted hydroxynitrile
lyase (HNL) as a reporter. Due to the experience with
former shake flask experiments [18], the culture time
for the initial growth phase under repressing conditions
was set to 60 h to allow uniform glucose depletion in all
individual wells of 96-well plates. With these basic set-
tings, the most suitable parameters for both, uniform
cell growth and expression levels, as well as the highest
possible activity levels, were worked out for the reporter
enzyme.
We expected that the specific activities of the repor-
ter enzymes per ml of culture volume would increase
with rising cell densities. For the evaluation of the ideal
glucose concentration at microscale, 0.2%, 1%, 2% and
3% glucose were applied. Growth was performed in
250 ll BMD for 60 h and then 250 ll BMM2 were
added for induction. Further 50 ll BMM10 were
added after additional 10, 22 and 46 h, respectively.
Twenty-four hours after the last induction (i.e., 70 h
after the first one) the cells were pelleted and HNL
activity in the supernatant was determined photometri-
cally. Although the biomass was increased with higher
glucose concentrations as expected (Fig. 1(a)), higher
glucose concentrations in the medium than 1% resulted
in reduced yield of active recombinant protein (Fig.
1(b)). Doubled concentrations of methanol in the
induction media gave even higher specific activities,
but the standard deviation in growth and expression
levels was also significantly higher (data not shown).
1% Glucose in the initial culture media proved to be
the most suitable carbon source concentration by
resulting in the highest activity levels of the expressed
reporter enzyme as well as the most homogenous
expression level.
3.3. The physiological background of low specific activity
at higher cell density
Residual glucose, repressing gene induction, as the
most obvious explanation for this observation could be
excluded. By three independently performed experi-
ments, the time of glucose depletion was determined as
accurately as possible for each of the applied concentra-
tions. Cultures with 0.2% glucose consumed its C-source
within 14 h. 1% Glucose was depleted after 23 h, 2% after
29 h, and for 3% glucose the cells needed 44 h. Therefore,
promoter repression by residual glucose at the time of
induction after 60 h of cultivation was not the reason
for the lower activity levels of cultures grown at higher
glucose concentrations. For all three glucose concentra-
tions, a growth phase of 60 h prior to induction proved
to be optimal, since there was sufficient time even for
184 R. Weis et al. / FEMS Yeast Research 5 (2004) 179–189

Fig. 1. Optical density at 600 nm after cultivation of P. pastoris GS115 PamHNL5-a37 for 60 h in media supplemented with glucose from 0.2% to 3%
w/v (a). HNL activity with the substrate mandelonitrile in the culture supernatant after growth of P. pastoris GS115 PamHNL5-a37 in deep-well
plates with varying glucose concentrations for 60 h and induction with methanol for 70 h (b).

weakly inoculated wells to reach their maximal cell den-
sity by total consumption of the available glucose.
Granot et al. [29] have demonstrated that S. cerevis-
iae and Schizosaccharomyces pombe, when grown in
water in the presence of glucose and in the absence
of additional nutrients, undergo sugar-induced cell
death (SICD) via apoptosis. We found sufficient
amounts of residual nitrogen sources in all individual
culture media after 60 h of cultivation, and moreover
diluted methanol was added for induction of expres-
sion together with fresh nutrients lacking only the
repressing C-source glucose. Thereby we also ruled
out a possible repression of the AOX1-promoter upon
nitrogen limitation [30].
Although SICD was explained by the absence of
other nutrients than glucose [29], we thought that in
our case where all nutrients were present, cell viability
and thereby protein expression were possibly influenced
by varying glucose concentrations.
The determination of the fraction of dead cells in the
particular cultures after the initial growth phase (i.e.,
right before induction) was intended to enlighten the ob-
served mystery. The following scenario would explain
the events: if a considerable fraction of cells died off
when grown on higher glucose concentrations, the over-
all activity of the expressed reporter enzyme would nat-
urally be lower. The fraction of necrotic cells and the
number of living cells (colony-forming units) were deter-
mined by propidium iodide staining and plating on agar
plates, respectively. Therefore a microtiter plate method
for high-throughput determination of necrotic P. pas-
toris-cells was established, based on a flow cytometric
method described previously in the group of Mattanov-
ich [25]. As a control for non-expressing strains, the
wild-type strains X-33 and GS115 were treated in the
same way as the reporter strain.
Experiments were performed in triplicate and by dif-
ferent experimenters. The results from the propidium io-
 R. Weis et al. / FEMS Yeast Research 5 (2004) 179–189
dide staining were somewhat puzzling. Although there
was a clear increase in fluorescence with increasing glu-
cose concentrations (except from 0.2% glucose, where
the value exceeded the one of the 1% glucose cultures),
the comparison with a calibration curve displayed the
fraction of dead cells to be lower than 10% in all cases.
All the more astonishing were the results of the cell plat-
ing experiment. For glucose concentrations other than
1%, lower expression rates were attended with decreased
fractions of recultivable cells. However, the absolute
number showed a large discrepancy between the sum
of viable cells and necrotic cells, and the total number
of analyzed cells (Fig. 2). The non-expressing control
strains X-33 and GS115 showed the same results (data
not shown). Colony counts did not differ significantly
after plating on MD or agar plates, respectively.
Experiments with cells grown in complex YPD media
with different glucose concentrations revealed that for
2% and 3% glucose the discrepancy between cell density
and reporter activity was still present, although less pro-
nounced than with minimal media. However, for screen-
ing of transformants using auxotrophy selection
markers such complex media cannot be used. Further-
more, the use of minimal media for screening purposes
mimics the conditions of the enzyme production on a
large scale, thereby facilitating the transferability of re-
sults between different scales.
The trend of highest reporter protein activity in med-
ia with limited cell density (1% glucose) was observed for
shake-flask cultures as well (data not shown). This indi-
cates that higher oxygen limitation in deep-well plates
than in shake flasks cannot be solely responsible for
the observations. There must be a considerable fraction
of cells which is still not necrotic at higher glucose con-
centrations but on the other hand also physiologically
Fig. 2. Cell viabilities of cultures grown for 60 h in media with varying glucose concentrations. The bottom bars show the percentage of recultivable
cells after plating calculated numbers of cells. The fractions of necrotic cells (stained by propidium iodide) are presented by hanging bars. All
numbers were calculated as an average from three independent experiments.
185
not competent for recombinant protein expression any-
more. We thought about apoptosis as a possible expla-
nation for these observations.
3.4. Suboptimal glucose concentrations in deep-well plate
cultures cause apoptosis in P. pastoris
Apoptosis as a form of programmed cell death in
yeast and its regulators and effectors have been intensely
studied [16]. For the clarification of a possible participa-
tion of apoptotic phenomena in reduced and varying
protein expression in a high-throughput expression sys-
tem, the TUNEL-test was regarded as suitable method
due to its high specificity and significance [21].
No reports about controlled, successful induction of
apoptosis in P. pastoris were available. It was inevitable
for the development of reliable protocols for our exper-
iments to find out about conditions that induce apopto-
sis. One study already had described a possible
occurrence of cell death in P. pastoris related to apopto-
sis [31]. The authors expressed the murine pro-apoptotic
gene bax and showed that its product caused cell death,
even though it was not clearly stated that apoptotic
events took place. However, the TUNEL test results
for Bax-expressing cells as well as negative control cells
displayed unstained or only slightly stained cells, indi-
cating that DNA cleavage was weak or even non-
existing.
Concentrations of 0.6–1 mM H2O2 proved to induce
apoptosis in S. cerevisiae during exponential growth suf-
ficiently, whereas yeast cells in the stationary phase tol-
erated up to 500 mM H2O2. In both cases, the hydrogen
peroxide was applied 3 h (2 generation times) prior to
investigation for apoptosis markers (K.U. Froehlich,
personal communication). Therefore, our P. pastoris
186 R. Weis et al. / FEMS Yeast Research 5 (2004) 179–189

reporter strains were grown for 56 h as described in
media with different glucose concentrations. H2O2 con-
centrations of 10, 100, 300, 600 and 1000 mM were
added to particular wells of all glucose concentrations
and after a total of 60 h the cells were collected and trea-
ted as described in Section 2. At this time, there was yet
no methanol added to the cultures, therefore intracellu-
lar H2O2 production due to metabolization of external
methanol by alcohol oxidase can be excluded. For
0.2% and 1% glucose cultures 100 mM H2O2 and for
2% and 3% glucose 200 mM H2O2 showed the best
induction effect, making them useful positive controls
for apoptosis.
In the following, cultured cells including positive and
negative control cells were examined for apoptosis-in-
duced DNA damage employing the TUNEL-test. As
Fig. 3 shows as a case in point, we found a direct con-
nection between increasing glucose concentrations in
deep-well culture media and increased numbers of
apoptotic cells. The apoptosis tests were repeated twice
to obtain a representative number for the fraction of
apoptotic cells in the different culture samples. For cul-
tures grown for 60 h in 0.2% glucose or 1% glucose,
only 1% or less of the cells showed significant signs of
apoptosis. The fraction of apoptotic cells ascended dra-
matically to 20% in the case of 2% and 25% at 3% ini-
tial glucose. Results from samples derived from shake-
flask cultivation at different glucose concentrations
resembled those from microscale experiments. These
findings were not a result of heterologous protein pro-
duction itself, which might cause stress for the host
cells, because the untransformed P. pastoris strains
X-33 and GS115 without foreign DNA showed the
same behaviour.
Recalling the puzzling gap between the number of
dead cells from the propidium iodide staining and the
number of living cells from plating experiments, its
explanation became obvious: under unfavourable glu-
cose concentrations a large fraction of the cells under-
went apoptosis. It is reasonable to assume that this
fraction of cells is physiologically not competent for rec-
ombinant protein expression. Therefore the yield of ac-
tive reporter enzyme at higher glucose concentrations
decreases and the standard deviation of expression levels
from well to well increases. This phenomenon still re-
mained unexplained. The media ingredients only dif-
fered in their proportion of glucose, and the step from
1% to 2% glucose has generally been regarded as mini-
mal. A concentration of 2% glucose was even regarded
as an optimal standard concentration for protein expres-
sion by P. pastoris in shake flasks (‘‘Pichia Expression
Kit’’, Invitrogen) [1,15]. Limited oxygen supply for
P. pastoris cells at higher densities in deep-well plates
or shake flasks could be one cause for our observations.
With 1% glucose in the growth medium we found
conditions causing a minimum of apoptotic and necrotic
cells, which allows uniform expression of correctly-
folded active enzyme at a high level. Employing apopto-
sis and necrosis as a marker for physiological compe-
tence of P. pastoris cells can be used to optimise
culture conditions when online control is hardly
possible.

Fig. 3. Results of the TUNEL-test which was applied to P. pastoris GS115 PamHNL5-a37 after growth for 60 h in media supplemented with 0.2%
glucose (a), 1% glucose (b), 2% glucose (c) and 3% glucose (d), respectively. P. pastoris GS115 PamHNL5-a37 grown in media supplemented with 1%
glucose for 20 h was used as a negative control (e). P. pastoris GS115 PamHNL5-a37 grown for 60 h in media with 1% glucose was induced for
apoptosis by the addition of 100 mM H2O2 4 h prior to the test procedure and used as a positive control (f). The fraction of apoptotic cells was
determined in three independent, randomly-chosen windows of the corresponding slides.
 R. Weis et al. / FEMS Yeast Research 5 (2004) 179–189 187

3.5. Verification of the screening protocol with further micro-scale process as in a 500-fold higher volume in
reporters shake flasks.

The validation of the usefulness of this screening sys-
tem implies the need for a verification of the results
using additional reporter systems. A second representa-
tive for secreted proteins, horseradish peroxidase
(HRP), was examined for uniform expression levels
across a whole 96-deep-well plate employing the devel-
oped protocol. A sensitive activity assay in microplate
format for this enzyme expressed by S. cerevisiae was
already available [23]. The plasmid harbouring the
HRP-WT (wild-type) gene under the control of the
AOX1-promoter was transformed into P. pastoris X-
33, the transformants were tested for activity by oxida-
tion of ABTS by the expressed HRP and H2O2. In addi-
tion, a single positive clone as well as P. pastoris X-33 as
negative control were cultivated and tested according to
our micro-scale fermentation protocol. The activity lev-
els displayed a uniform expression level with a standard
deviation lower than 15% (data not shown), confirming
the reliability of the protocol.
The HbHNL of the tropical rubber tree Hevea brasil-
iensis, catalysing the same reaction as PaHNL but with
opposite enantioselectivity, was chosen as a representa-
tive for intracellular proteins [19]. The active variant
P. pastoris GS115 PpD1-17 and the untransformed
strain GS115 (in presence of additional histidine in the
medium) were cultivated following the established pro-
tocol. The cells were chemically lysed directly in the
deep-well plate and after harvesting the fraction of solu-
ble intracellular proteins by centrifugation, the same
microtiter plate assay as for PaHNL was applied. Due
to the massive overexpression of this protein, several
dilutions were necessary to meet the criteria of the pho-
tometric test in terms of linearity. The activity levels of
GS115 PpD1-17 showed uniformity with a low standard
deviation across the whole plate, proving the applicabil-
ity of the high-throughput screening for intracellular
proteins as well. We were also pleased to see that the
absolute numbers of activity were comparable to those
obtained by shake-flask cultivation, indicating that the
same amount of active protein was produced in the
3.6. Scale up: from 500 ll to fermentation on large scale
The ultimate goal of a micro-scale high-throughput
screening for engineered proteins lies in a perfect trans-
lation of results to controlled fermenter scale. New en-
zyme variants with improved properties or enhanced
production levels in micro-scale experiments often do
not keep their promises after scale-up to fermentations
under optimal conditions.
The correlation of enzyme activities in micro-scale,
small scale and even large scale was clarified by cultivat-
ing P. pastoris GS115 PamHNL5-a37 and the improved
expression variant P. pastoris GS115 PaHNL5_L1Q [20]
in 2 ml deep-well plates (500 ll working volume), 2-l
shake flasks (250 ml working volume) as well as in a fer-
menter with 10 l working volume. The most striking dif-
ference in operating procedures concerned the
instrumental control of all-important parameters as
pH-value, aeration or methanol concentration, which
were continuously adjustable in the fermenter cultiva-
tions, but much less precise at smaller scale. Of course
this causes differences in the absolute activity values
reached in the fermenter as compared to those in
deep-well plates and shake flasks. However, the ratio
of the relative specific activities between the native
PamHNL5-a37 and the improved secretion variant
PaHNL5_L1Q showed the same trend in improvement
of enzyme production from micro-scale to fermenter
scale (Table 1). Summarizing, the trends we detected
in deep-well plates held true in shake flasks as well as
in 10 l fermentations. The results from 10 l fermenta-
tions can be scaled up to larger volumes without changes
in the results as demonstrated for the expression of
PaHNL by P. pastoris GS115 PamHNL5-a37 in a
4000 l fermenter (data not shown).
The example for enhanced production rate given
above can be translated to improved enzyme properties
(e.g., the conversion of non-natural substrates [18]).
However, we would like to note that the described
procedures allow correct predictions for relative

Table 1
Comparison of activity levels of the strains P. pastoris GS115 PamHNL5-a37 and PaHNL5_L1Q after growth at different scales and normalization
by their biomass
HNL-activity/biomass (U g
1 cdw min
1)a Improvement factor
PaHNL5_L1Q PamHNL5-a37 PaHNL5_L1Q/PamHNL5-a37
Microscale (500 ll) 427.5 104.4 4.1
Shake flask (250 ml) 410.6 99.8 4.1
Fermenter (10 l) 935.5 208.5 4.5
The activity measurement and the biomass determination were performed 70 h after the first induction with methanol. Improvement factors represent
the division of the values of the improved expression construct PaHNL5_L1Q by those of PamHNL5-a37.
a
1 U = 1 lmol benzaldehyde produced after 1 min, cdw = cell dry weight.
188 R. Weis et al. / FEMS Yeast Research 5 (2004) 179–189
improvements of enzyme variants or expression strain
variants. It was not our intention to predict absolute
protein yields or optimal production conditions for
large-scale fermentations, since this is strongly influ-
enced by fermentation techniques. The findings strongly
support the representativity of the new protocol for
high-throughput analysis of enzyme improvements
using P. pastoris on the scale of 96-deep-well plates.
4. Conclusions
The publication of more and more eukaryotic gen-
ome sequences, the availability of efficient production
systems for eukaryotic proteins, as well as the improve-
ment and extension of library production for directed-
evolution experiments, called for high-throughput
methods for eukaryotic hosts. We developed an efficient
protocol for the parallel cultivation, expression and
screening of thousands of protein variants in P. pastoris
with low standard deviation in expression levels. The
careful analysis of culture media composition showed
that minor changes resulted in severe influences on cell
physiology. Under unfavourable conditions, significant
fractions of cells underwent apoptosis, which caused a
bias in screening experiments for expression variants un-
der screening conditions. The outcomes of such a screen-
ing were isolated variants that usually do not keep their
promises after scale-up of enzyme production. Minimiz-
ing programmed cell death and necrosis in micro-scale
culture procedures resulted in the first reliable high-
throughput protocol for comparative screening of en-
zyme variants produced by P. pastoris. The output of
screening new protein variants directly in the production
host P. pastoris are new strains which can be directly
scaled up for enzyme production on a large scale. Thus,
the risk is minimized that important traits such as opti-
mal codon usage for high-level expression get adapted to
the screening host rather than to the production system.
This provides relief to existing bottlenecks of this attrac-
tive host for high-level heterologous protein production
as well as for protein engineering.
The comparison of cell viabilities with the fraction of
apoptotic and necrotic cells can be used as a tool for
optimisation of high-throughput growth and screening
conditions.
The mechanisms for the observed apoptosis, induced
by raising glucose levels in media for P. pastoris cultiva-
tion, remain to be elucidated.
Acknowledgements
We thank TIG, the Province of Styria, SFG and the
City of Graz for financial support. The authors are in-
debted to Laura Leitner and Kai-Uwe Fröhlich for the
apoptosis work. We thank Hannelore Mandl, Beate Psc-
heid and Franz Hartner for excellent technical support.
References
[1] Cregg, J.M., Cereghino, J.L., Shi, J. and Higgins, D.R. (2000)
Recombinant protein expression in Pichia pastoris. Mol. Biotech-
nol. 16, 23–31.
[2] Baneyx, F. (1999) Recombinant protein expression in Escherichia
coli. Curr. Opin. Biotechnol. 10, 411–421.
[3] Pedersen, H., Lamsa, M., Hansen, P.K., Frisner, H., Vind, J.,
Ernst, S., Kongsbak, L., Joergensen, B.R., Beck, T.C., Husum,
T.L. and von Ossowski, I. (2001) Microtiter plate based high-
throughput screening assays for large numbers of cell popula-
tions. WO 2001032844 [Chem. Abstr. 2001, 134, 350243].
[4] Menzel, R. (1989) A microtiter plate-based system for the
semiautomated growth and assay of bacterial cells for beta-
galactosidase activity. Anal. Biochem. 181, 40–50.
[5] Duetz, W.A., Ruedi, L., Hermann, R., OÕConnor, K., Buchs, J.
and Witholt, B. (2000) Methods for intense aeration, growth,
storage, and replication of bacterial strains in microtiter plates.
Appl. Environ. Microbiol. 66, 2641–2646.
[6] Holz, C., Hesse, O., Bolotina, N., Stahl, U. and Lang, C. (2002) A
micro-scale process for high-throughput expression of cDNAs in
the yeast Saccharomyces cerevisiae. Protein Expres. Purif. 25,
372–378.
[7] Arnold, F.H. (1998) Design by directed evolution. Acc. Chem.
Res. 31, 125–131.
[8] Walsh, G. (2003) Biopharmaceutical benchmarks – 2003. Nat.
Biotechnol. 21, 865–878.
[9] Strobel, R., Bowden, D., Bracey, M., Sullivan, G., Hatfield, C.,
Jenkins, N. and Vinci, V. (2001) High-throughput cultivation of
animal cells using shaken microplate techniques. In: Animal Cell
Technology: From Target to Market (Lindner-Olsson, E.,
Chatzissavidou, N. and Luellau, E., Eds.), pp. 307–312. Kluwer
Academic Publishers, Dordrecht, The Netherlands.
[10] Boettner, M., Prinz, B., Holz, C., Stahl, U. and Lang, C. (2002)
High-throughput screening for expression of heterologous pro-
teins in the yeast Pichia pastoris. J. Biotechnol. 99, 51–62.
[11] Petrounia, I.P. and Arnold, F.H. (2000) Designed evolution of
enzymatic properties. Curr. Opin. Biotechnol. 11, 325–330.
[12] Arnold, F.H. and Georgiou, G. (2003) Directed Enzyme Evolu-
tion: Screening and Selection Methods. Humana Press Inc,
Totowa.
[13] Olsen, M., Iverson, B. and Georgiou, G. (2000) High-through-
put screening of enzyme libraries. Curr. Opin. Biotechnol. 11,
331–337.
[14] Farinas, E.T., Bulter, T. and Arnold, F.H. (2001) Directed
enzyme evolution. Curr. Opin. Biotechnol. 12, 545–551.
[15] Lin Cereghino, J. and Cregg, J.M. (2000) Heterologous protein
expression in the methylotrophic yeast Pichia pastoris. FEMS
Microbiol. Rev. 24, 45–66.
[16] Fröhlich, K.U. and Madeo, F. (2003) Genetics of Apoptosis:
Regulators and Applications of Yeast Apoptosis. Oxford Uni-
versity Press, Oxford, GB.
[17] Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D.,
Seidmann, J.G., Smith, J.A. and Struhl, K. (2003) Current
Protocols in Molecular Biology. Wiley, New York.
[18] Weis, R., Poechlauer, P., Bona, R., Skranc, W., Luiten, R.,
Wubbolts, M., Schwab, H. and Glieder, A. (2004) Biocatalytic
conversion of unnatural substrates by recombinant almond R-
HNL isoenzyme 5. J. Mol. Cat. B: Enzymatic 29, 211–218.
[19] Hasslacher, M., Schall, M., Hayn, M., Bona, R., Rumpold, K.,
Lückl, J., Griengl, H., Kohlwein, S.D. and Schwab, H. (1997)
High-level intracellular expression of hydroxynitrile lyase from
 R. Weis et al. / FEMS Yeast Research 5 (2004) 179–189
the tropical rubber tree Hevea brasiliensis in microbial hosts.
Protein Expres. Purif. 11, 61–71.
[20] Glieder, A., Weis, R., Skranc, W., Pöchlauer, P., Dreveny, I.,
Majer, S., Wubbolts, M., Schwab, H. and Gruber, K. (2003)
Comprehensive step-by-step engineering of an (R)-hydroxynitrile
lyase for large-scale asymmetric synthesis. Angew. Chem. Int. Ed.
Engl. 42, 4815–4818.
[21] Madeo, F., Fröhlich, E. and Fröhlich, K.U. (1997) A yeast
mutant showing diagnostic markers of early and late apoptosis. J.
Cell. Biol. 139, 729–734.
[22] Madeo, F., Fröhlich, E., Ligr, M., Grey, M., Sigrist, S.J.,
Wolf, D.H. and Fröhlich, K.U. (1999) Oxygen stress: a
regulator of apoptosis in yeast. J. Cell. Biol. 145, 757–
767.
[23] Morawski, B., Lin, Z., Cirino, P., Joo, H., Bandara, G. and
Arnold, F.H. (2000) Functional expression of horseradish per-
oxidase in Saccharomyces cerevisiae and Pichia pastoris. Protein
Eng. 13, 377–384.
[24] Cino, J. High yield protein production from Pichia pastoris yeast:
a protocol for benchtop fermentation. In: New Brunswick
Scientific (Edison, N.J., Ed.).
189
[25] Hohenblum, H., Borth, N. and Mattanovich, D. (2003) Assessing
viability and cell-associated product of recombinant protein
producing Pichia pastoris with flow cytometry. J. Biotechnol.
102, 281–290.
[26] Duetz, W.A. and Witholt, B. (2001) Effectiveness of orbital
shaking for the aeration of suspended bacterial cultures in square-
deepwell microtiter plates. Biochem. Eng. J. 7, 113–115.
[27] Hermann, R., Lehmann, M. and Buechs, J. (2003) Characteriza-
tion of gas–liquid mass transfer phenomena in microtiter plates.
Biotechnol. Bioeng. 81, 178–186.
[28] Whittaker, M.M. and Whittaker, J.M. (2000) Expression of
recombinant galactose oxidase by Pichia pastoris. Protein Expres.
Purif. 20, 105–111.
[29] Granot, D., Levine, A. and Dor-Hefetz, E. (2003) Sugar-induced
apoptosis in yeast cells. FEMS Yeast Res. 4, 7–13.
[30] Egli, T. (1982) Regulation of protein synthesis in methylotrophic
yeasts: repression of methanol dissimilating enzymes by nitrogen
limitation. Arch. Microbiol. 131, 95–101.
[31] Martinet, W., van der Plas, D., Raes, H., Reekmans, R. and
Contreras, R. (1999) van der Bax-induced cell death in Pichia
pastoris. Biotechnol. Lett. 21, 821–829.