International Dairy Journal 136 (2023) 105490

Contents lists available at ScienceDirect

International Dairy Journal

journal homepage: www.elsevier.com/locate/idairyj

Evaluation of the microbial communities in kefir grains and kefir over

time
Faisal A.J. Alraddadi a, b, Tom Ross a, Shane M. Powell a, *
a
University of Tasmania, Private Bag 98, Hobart, TAS, 7001, Australia
b
Taibah University, Janadah Bin Umayyah Road, Medina, Medina, 42353, Saudi Arabia

a r t i c l e i n f o a b s t r a c t

Article history: The microbial communities of kefir grains and kefir were evaluated over time using high-throughput
Received 11 April 2022 amplicon sequencing. It was found that Lactobacillus kefiranofaciens and Lentilactobacillus kefiri consis-
Received in revised form tently dominated kefir grains, whereas Lactococcus lactis dominated kefir. Many other bacteria and yeasts
21 August 2022
were detected that comprised the minor population of kefir grains and kefir. The community compo-
Accepted 28 August 2022
Available online 6 September 2022
sition in the kefir was more variable than in the kefir grains with the relative abundance of both Lb.
kefiranofaciens and Lc. lactis changing over time. The fungal communities of kefir grains were dominated
by Kazachstania turicensis and Torulaspora delbruekii, although the ratio between the two varied signif-
icantly. These findings suggest that the microbial communities in kefir grains change over time, high-
lighting the need for further studies investigating the effect these changes have on the production of
flavour and aroma compounds in kefir.
Crown Copyright © 2022 Published by Elsevier Ltd. All rights reserved.

1. Introduction
Kefir is a traditional fermented dairy product that originated
from the Caucasus, Mongolian mountains, and Eastern Europe
(Rosa et al., 2017). It is an acidic-alcoholic drink with a creamy
consistency (Prado et al., 2015) that is becoming a popular dairy
product in many countries throughout the world including western
countries (Brown, 2017; Leite et al., 2013). Kefir is recognised as a
functional food due to its purported health benefits (Zanirati et al.,
2015).
Kefir is produced by the addition of kefir grains or kefir starter
cultures into milk (Prado et al., 2015). It differs from other fer-
mented dairy products in the way it is produced because kefir
grains can be re-used to make a new batch of kefir increasing in
their biomass over time (Guzel-Seydim, Kok-Tas, Greene, & Seydim,
2011; Simova et al., 2002). Kefir grains have a unique structure
consisting of an undefined consortium of bacteria and yeasts
embedded in an exopolysaccharide matrix (Zanirati et al., 2015).
Kefir grains can remain active for years if maintained and incubated
under appropriate production conditions (Gao & Li, 2016; Simova
et al., 2002). Guzel-Seydim, Wyffels, Seydim, and Greene (2005)
* Corresponding author.
E-mail address: Shane.Powell@utas.edu.au (S.M. Powell).
suggested that kefir grain to milk ratio, fermentation time, tem-
perature, production conditions, washing of kefir grains, and cold
storage can affect the microorganisms of kefir grains and hence the
quality of the final kefir. Kefir can also be produced using starter
cultures of defined microbial communities (Prado et al., 2015;
Vardjan, Lorbeg, Rogelj, & Majheni
c, 2013).
The microbiome of kefir grains has both homofermentative and
heterofermentative lactic acid bacteria (LAB) including Lactoba-
cillus, Lactococcus, Leuconostoc, and Streptococcus (Gao & Li, 2016).
These are also the most commonly reported LAB genera that
dominate kefir grains and kefir beverages (Bourrie, Willing, &
Cotter, 2016). Common species found in kefir grains and bever-
ages include Lactobacillus kefiranofaciens, Lentilactobacillus kefiri
(previously known as Lactobacillus kefiri), Lactococcus lactis, Leu-
conostoc mesenteroides, Lactobacillus acidophilus, Levilactobacillus
brevis (previously known as Lactobacillus brevis), and Lentilactoba-
cillus parakefiri (previously known as Lactobacillus parakefiri) (Gao
& Li, 2016; Prado et al., 2015; Vardjan et al., 2013). Acetic acid
bacteria (AAB) such as Acetobacter spp. are sometimes found in
kefir grains (Prado et al., 2015).
Kefir grains and kefir also contain yeasts including the genera
Kluyveromyces, Candida, Saccharomyces, Kazachstania, and Pichia
(Gao, Gu, Abdella, Ruan, & He, 2012; Plessas et al., 2017). Prado et al.
(2015) listed more than 23 different species of yeasts isolated from
kefir grains and beverages. However, the most common species are

https://doi.org/10.1016/j.idairyj.2022.105490
0958-6946/Crown Copyright © 2022 Published by Elsevier Ltd. All rights reserved.
F.A.J. Alraddadi, T. Ross and S.M. Powell
Saccharomyces cerevisiae, Candida kefyr, Kluyveromyces marxianus,
Torulaspora delbrueckii, and Kazachstania unispora (Diosma,
Romanin, Rey-Burusco, Londero, & Garrote, 2014; Vardjan et al.,
2013; Zanirati et al., 2015).
Kefir is usually produced from starter cultures at the industrial
level due to the consistency and control of the defined microor-
ganisms of the starter cultures (Vardjan et al., 2013). However, the
properties of the final kefir differ from that produced using kefir
grains (Farnworth & Mainville, 2003). For example, Ko €k-Taş,
€
Seydim, Ozer, and Guzel-Seydim (2013) found that exopoly-
saccharides (EPS) or kefiran was higher in kefir produced from kefir
grains compared with that produced from starter cultures.
The symbiotic association of kefir grains microorganisms that
develops over time is unique and it is important that the micro-
biome remain stable to achieve a product with consistent quality at
the industrial level (Vardjan et al., 2013). Farnworth (2006) noted
that producing a consistent kefir product might be hindered due to
the complexity and variations in the microbial composition of kefir
grains.
The dominant bacteria and yeasts of kefir grains are broadly
similar among different geographic regions (Farnworth &
Mainville, 2003). However, the minor microbial communities vary
(Leite et al., 2012). The most frequently reported microbial genera
of LAB and yeasts can be detected using culture-dependent
methods which rely on physiological and biochemical tests (Chen,
Wang, & Chen, 2008). However, culture-based methods such as
plate counting may be subject to a high variability and may not
detect difficult to culture organisms (Leite et al., 2012; Nejati, Junne,
& Neubauer, 2020b). Thus, using culture-independent techniques
such as high-throughput amplicon sequencing is important for a
full description of the microbial communities of kefir grains and
beverages including the minor microbial groups.
The aim of this study was to monitor the microbial communities
of kefir grains and kefir over time to assist in evaluating their ability
to produce kefir with consistent properties.
2. Materials and methods
2.1. Kefir grains
The kefir grains used in this study were kindly provided by Leap
Farm in Copping, Tasmania, Australia who produce goat milk kefir
for their own consumption hence prior to our study the grains had
been used in goat milk. The grains were stored at
20  C when not
in use. The kefir grains were reactivated from storage by fermenting
in pasteurised commercial full cream cow milk at 25  C for 24 h.
Kefir grains were considered active after seven successful kefir
fermentations.
2.2. Kefir production
To produce kefir, 1 g of kefir grains was added into 100 mL of full
cream pasteurised cow milk and fermented at 25  C for 24 h. The
process was repeated every day for 66 days. After each 24 h
fermentation, kefir grains were removed from their associated kefir
by straining with a plastic sieve and they were then used to make a
new batch of kefir. To test the changes of microbial communities in
kefir grains and their corresponding kefir, 0.1 g of kefir grains plus
1 mL of kefir were collected after 24 h of fermentation on days 1, 7,
26, 56, and 66, placed in micro centrifuge tubes and stored
at
20  C until used for microbiological analyses.
2
International Dairy Journal 136 (2023) 105490
2.3. DNA extraction and amplification
From the selected sampling days, DNA was extracted from 0.1 g
of kefir grains and 1 mL of kefir using the PowerSoil® DNA Isolation
Kit (QIAGEN MO BIO Laboratories, Inc.) as per the manufacturer's
instructions with minor modifications. Briefly, to extract DNA from
grains, 7 min bead beating (30 beats
1) using a Tissue Lyser II
(QIAGEN) was performed instead of vortexing. This was essential to
break open the grains. For kefir samples, 1 min of bead beating was
performed for all samples. The extracted genomic DNA was
amplified using the 27F (AGAGTTTGATCMTGGCTCAG) and 519R
(GWATTACCGCGGCKGCTG) primers (Integrated DNA Technologies)
with the following conditions: 3 min at 95  C followed by 29 cycles
of denaturation at 95  C for 20 s, annealing at 55  C for 20 s, and
extension at 72  C for 30 s with a final extension step at 72  C for
5 min. PCR products were then run on 1.5% agarose to check for
successful amplification. The extracted genomic DNA was stored
at
20  C.
2.4. High throughput amplicon sequencing
The samples containing the extracted genomic DNA were sent to
Ramaciotti Centre for Genomics (University of New South Wales,
Sydney, Australia) for sequencing of the bacterial 16S rRNA and
fungal ITS-2 regions on the Illumina MISeq platform using the
MiSeq Reagent kit (ITS: 2  250 base pairs, 16S rRNA 2  300 base
pairs) following the manufacturer's standard protocols. The for-
ward primer 27F (AGAGTTTGATCMTGGCTCAG) and reverse primer
519R (GWATTACCGCGGCKGCTG) were used to amplify the bacterial
16S rRNA region. The fungal ITS2 region was amplified using the
primers fITS7 forward (GTGAATCATCGAATCTTTG) and ITS4 reverse
(TCCTCCGCTTATTGATATGC).
Paired end FastQ files (two files for each sample: R1 for the
forward primer and R2 for the reverse primer) containing the
raw sequences were generated. Raw sequences were processed
using Mothur software v.143.0 following Mothur standard oper-
ating procedure (SOP) to generate an Operational Taxonomic Unit
table (OTU table) that contains the OTUs with the corresponding
taxonomy (Schloss et al., 2009). Sequences were referenced
against the Silva database (Quast et al., 2013) for the 16S rRNA
sequences and the UNITE database (Nilsson et al., 2019) for the
ITS2 sequences at 97% similarity threshold. Representative se-
quences for every OTU were retrieved using Mothur and were
taxonomically assigned by a BLAST search of the NCBI Nucleotide
collection (nr/nt) and rRNA/ITS databases (https://blast.ncbi.nlm.
nih.gov/Blast.cgi).
2.5. Statistical analysis
Sample metadata and the OTU table were imported into Calypso
version 8.84 (Zakrzewski et al., 2017), an online platform used to
explore the microbial community composition and diversity. OTUs
with <0.01% relative abundance were removed prior to analyses.
The remaining data were normalised using total sum normalisation
(TTS) for the microbial profiles of kefir grains and kefir. Square Root
Transformation (sqrt) was performed prior to Non-metric multi-
dimensional scaling (NMDS) using BrayeCurtis distances to
compare the microbial composition across sample types in Primer
7 software (Primer-E). Alpha diversity metrics were calculated us-
ing rarefied data in Calypso (by reducing all samples to the mini-
mum library size to aid comparison).
F.A.J. Alraddadi, T. Ross and S.M. Powell International Dairy Journal 136 (2023) 105490

3. Results representative sequences of the most abundant OTUs at the species

levels (Table 1). Two OTUs belonged to Lb. kefiranofaciens in kefir
3.1. Sequences grains with one accounting for the majority of Lactobacillus asso-
ciated sequences (66.6%) and the other comprising only 0.06%. In
The number of 16S rRNA sequence reads associated with sam- kefir, Lb. kefiranofaciens was represented by one OTU only (36.6%).
ples of kefir grains ranged from 38,335 to 95,789 and the number of Six OTUs associated with Lentilactobacillus in kefir grains were
sequence reads associated with kefir ranged from 27,519 to 71,534. assigned to L. kefiri and accounted for a total of 26.9% of sequences
The number of ITS sequence reads from kefir grains ranged from reads. The five OTUs associated with Lactococcus were assigned to
33,404 to 139,037. Many of the kefir samples produced unusually L. lactis and accounted for a total of 2.1% of sequence reads in the
low numbers of sequence reads and the majority of ITS sequence grains and 48.9% of reads in the kefir.
reads from kefir samples belonged to a Leuconostoc phage. Thus, the One OTU represented L. mesenteroides and accounted for an
fungal sequences from kefir samples were discarded from further average of 0.11% of the total bacterial population in kefir grains and
analysis. an average of 3.7% in all kefir.
Shannon diversity indices calculated at the OTU level for the One-way ANOVA comparisons among the common OTUs
bacterial communities of kefir grains and kefir were 1.8 and 1.9, detected in kefir grains and kefir showed differences in the relative
respectively. For the fungal communities of kefir grains, the Shan- abundance of OTUs between the kefir and kefir grains (Table 1).
non index was 0.7. A number of non-Firmicutes were also found in both kefir grains
and kefir. The sequence reads associated with the Proteobacteria
3.2. Community profiles of kefir grains and kefir phylum represented a minor population accounting for a relative
abundance of 3.3% in kefir grains and 2.9% of all sequence reads in
3.2.1. Bacterial profiles of kefir grains and kefir kefir. Sequence reads associated with Proteobacteria were repre-
The microbiome of kefir grains and kefir are presented at the sented by Pseudomonas spp. (Pseudomonas. putida), Steno-
genus level in Fig. 1. All sequences belonged to the phyla Firmicutes, trophomonas spp., Hafnia spp., and Acinetobacter spp. Sequence
Bacteroidetes, Proteobacteria, Actinobacteria, and Acidobacteria. reads associated with Pseudomonas spp. corresponded to 0.5% and
Sequence reads associated with Firmicutes accounted for approxi-
mately 96% of sequences from both kefir grains and kefir.
The Firmicutes genera differed greatly between kefir grains and Table 1
kefir. Most sequence reads from kefir grains were Lactobacillus spp. Comparisons of the relative abundance (%) of the Firmicutes associated OTUs found
(67%) followed by Lentilactobacillus spp. (26.9%), Lactococcus spp. in kefir grains and kefir.a
(2.1%) and Leuconostoc spp. (0.1%). In kefir, however, Lactococcus OTU No. Kefir grains Kefir
spp. were the predominant genus accounting for an average of
OTU922 Lb. kefiranofaciens 66.6 36.6
48.9% in all kefir samples followed by Lactobacillus spp. (36.6%), OTU2727 L. kefiri 2.3 2.1
Lentilactobacillus spp. (7.3%), Leuconostoc spp. (3.7%), and Anox- OTU2741 L. kefiri 7.8 1.6
ybacillus spp. (0.2%). OTU2759 L. kefiri 6 2.2
OTU55436 Lb. kefiranofaciens 0.06 ND
One-Way ANOVA comparisons of the relative abundance be-
OTU5776 L. kefiri 6.7 1
tween the dominant genera of kefir grains and kefir were per- OTU8962 L. kefiri 2.4 0.4
formed to determine statistical significance. ANOVA indicated that OTU91073 L. kefiri 1.7 ND
the relative abundance of Lactobacillus spp. (P < 0.05), Lentilacto- OTU2705 Lc. lactis 0.6 9.7
bacillus spp. (P < 0.05), and Lactococcus spp. (P > 0.05) were OTU2723 Lc. lactis 1 30.8
OTU2778 Lc. lactis 0.4 6.3
significantly different between kefir grains and kefir. Leuconostoc
OTU13173 Lc. lactis 0.02 1
spp. (P < 0.05) was not significantly different between kefir grains OTU172035 Lc. lactis 0.04 1.1
and kefir. OTU2773 Leuc. mesenteroides 0.11 3.7
Mothur could only assign sequences to the genus level, thus the a
Bold font indicates statistical significance between kefir grains and kefir at
NCBI database was used to determine the closest matches of P < 0.05; ND, not detected.

Fig. 1. Average (n ¼ 2) relative abundance over the sampling time of the bacterial communities of kefir grains (A) and kefir (B) at the genus level.

3
F.A.J. Alraddadi, T. Ross and S.M. Powell International Dairy Journal 136 (2023) 105490

Fig. 2. Relative abundance of the fungal communities of kefir grains at the genus level.

2.7% of the total sequence reads from kefir grains and kefir
(P < 0.05), respectively. Stenotrophomonas spp. and Hafnia spp.
were only found in some samples of kefir accounting for 0.5% and
they were not detected in kefir grains. A group of sequences that
could only be classified to family level (Enter-
obacteriaceae_unclassified) were detected in kefir grains only as
2.4% of the total sequence reads. Few sequence reads were associ-
ated with acetic acid bacteria (AAB) from the phylum Proteobac-
teria. As they comprised <0.01% relative abundance, they were not
included in further analysis.
The remaining phyla, Bacteroidetes, Actinobacteria, and Acid-
obacteria, also comprised a minor component of kefir grains and
kefir. Sequence reads associated with Bacteroidetes were only
associated with the genus Flavobacterium that had a relative
abundance of 0.08% in kefir grains and 0.02% in kefir (P < 0.05). The
phylum Actinobacteria accounted for a relative abundance of 0.2%
and 0.04% of the total sequence reads from kefir grains and kefir
(P < 0.05), respectively. The majority of the sequence reads were
assigned to an unclassified Actinobacteria. Acidobacteria associated
sequence reads accounted for 0.08% in kefir grains and 0.01% in
kefir.
3.2.2. Fungal profiles of kefir grains
The ITS region was sequenced to determine the composition of
the fungal communities in kefir grains (Fig. 2). All sequence reads
belonged to the phyla Ascomycota, Basidiomycota, or Zygomycota.
Ascomycota was the predominant phylum comprising 98% of the
total fungal population from kefir grains. Ascomycota associated
genera were Kazachstania (50.4%), Torulaspora (44%), Kluyveromyces
(2.3), Clavispora (1.1%), Yarrowia (0.2%), and Saccharomyces (0.05%).
The remaining phyla in combination comprised a minor compo-
nent of the fungal composition accounting for only 0.4%. of the total
fungal composition. The remaining 1.6% were unclassified.
Mothur was able to assign the OTUs to species level using the
UNITE database. Three OTUs were associated with Kazachstania
with two OTUs assigned to Kazachstania turicensis (50.3% and

Fig. 3. Non-metric multidimensional scaling (NMDS) based on BrayeCurtis distances for the bacterial communities in kefir grains (circles) and kefir (squares). Colours denote
sampling day (day 1, red; day 7, blue; day 26, green; day 56, light green; day 66, orange).

4
F.A.J. Alraddadi, T. Ross and S.M. Powell
Fig. 4. Non-metric multidimensional scaling (NMDS) of fungal communities in kefir grains based on BrayeCurtis distances. Colours denote sampling day (day 1, red; day 7, blue; day
26, green; day 56, light green; day 66, orange).
0.024%) and one OTU assigned to K. unispora accounting for only
0.04% of the total ITS sequence reads. Torulaspora spp. were rep-
resented by two OTUs assigned to T. delbrueckii (43% and 1%).
Kluyveromyces spp., Yarrowia spp., and Saccharomyces spp. had one
OTU each and they were assigned to Kluy. marxianus, Yarrowia
lipolytica, and Saccharomyces kudriavzevii and accounted for 2.3%,
0.2%, and 0.05% of the total sequence reads, respectively. Clavispora
spp. were represented by two OTUs and assigned to Clavispora.
lusitaniae (1.1% and 0.02%).
The remaining phyla Basidiomycota and Zygomycota represented
a minor component of kefir grains. Basidiomycota associated genera
were Malassezia spp., Rhodotorula spp., Trametes spp., and Gueho-
myces spp. accounting for 0.2%, 0.04, 0.03%, and 0.05% respectively.
Malassezia spp. associated OTUs were assigned to Malassezia. glo-
bosa (0.15%) and Malassezia. restricta (0.05%). Rhodotorula spp. were
only detected in one sample of kefir grains, and it was assigned to
Rhodotorula. mucilaginosa (0.04%). Further, the phylum Zygomycota
was only represented by one genus Mortierella spp. that was
assigned to Mortierella globalpina (0.04%).
Fig. 5. The proportions of the dominant species observed in kefir grains (A, C) and kefir (B) as a percentage of the total bacterial (A, B) and fungal (C) populations at different
sampling times.
5
International Dairy Journal 136 (2023) 105490
3.3. Multivariate analyses
Non-metric multidimensional scaling (NMDS) was performed to
visualise the similarities and dissimilarities in the bacterial com-
positions between kefir grains and kefir over time (Fig. 3). NMDS
also suggested that there was less variation within kefir grains
samples compared with kefir samples that showed higher varia-
tion. Adonis PERMANOVA of BrayeCurtis dissimilarity distances
was performed to test the differences in the bacterial composition
among kefir grains and kefir. Adonis indicated overall significant
differences in the bacterial composition between kefir grains and
kefir (R2 ¼ 0.489, P > 0.05). NMDS was also performed for the fungal
communities of kefir grains samples. It suggested that there was
high variation among kefir grain samples (Fig. 4).
3.4. Changes in the microbial communities over time
The changes in the microbial communities of kefir grains and
kefir over time were examined by plotting the relative abundance
F.A.J. Alraddadi, T. Ross and S.M. Powell
of each species on different days. To do this, the most abundant
OTUs associated with Lactobacillus, Lentilactobacillus, Lactococcus,
Kazachstania, and Torulaspora were combined based on their blast
identification at the species level. Lactobacillus spp. averaged more
than 66% of the total bacterial population in kefir grains. The spe-
cies was identified as Lb. kefiranofaciens. L. kefiri accounted for an
average of 26.9%. The relative abundance of Lb. kefiranofaciens and
L. kefiri in kefir grains remained consistent over time (Fig. 5A).
Lactococcus spp. represented a minor component of kefir grains
ranging from approximately 0e4.5% of the total 16S rRNA sequence
reads which fluctuated over time (Fig. 5A).
Lactobacillus spp. from kefir were composed of only Lb kefir-
anofaciens. The relative abundance of Lb. kefiranofaciens changed
over time ranging from approximately 20%e60% (Fig. 5B). The
relative abundance of L. kefiri slightly fluctuated over time (Fig. 5B)
and the relative abundance of Lc. lactis was not consistent (Fig. 5B).
The changes in the fungal communities of kefir grains over time
were also examined. The genera Kazachstania, and Torulaspora
dominated kefir grains. The dominant species associated with
Kazachstania spp. was K. turicensis which dominated kefir grains in
days 1, 7, and 26. However, the relative abundance of K. turicensis on
days 56 and 66 was much lower. At these times, T. delbrueckii
became more dominant and apparently displaced K. turicensis
(Fig. 5C).
4. Discussion
Kefir is a popular dairy product due to its purported health
benefits associated with the microorganisms used for kefir
fermentation (Dertli & Çon, 2017). Understanding the role of these
microorganisms in kefir fermentation and how the grain micro-
biome changes over time is important for large scale production of
kefir using kefir grains (Purutog _
lu, Ispirli, Yüzer, Serencam, & Dertli,



2020; Vardjan, Mohar Lorbeg, & Can zek Majheni
c, 2018) and for the
development of starter cultures with similar properties as kefir
grains.
4.1. Bacterial composition of kefir grains and kefir
In this study, the predominant bacterial phylum in kefir grains
and kefir was Firmicutes which has been noted in other studies (Liu
et al., 2019; Marsh, O'Sullivan, Hill, Ross, & Cotter, 2013). At the
genus level, Lactobacillus spp. dominated kefir grains which is in
agreement with other studies employing high-throughput ampli-
con sequencing for the identification of the microorganisms in kefir
grains (Dobson, O'Sullivan, Cotter, Ross, & Hill, 2011; Marsh et al.,
2013). The current study did not differentiate between the inte-
rior and exterior parts of grains; however, Dobson et al. (2011)
found that Lactobacillus spp. were slightly more abundant in the
exterior compared with the interior region of the grain (96% and
88% respectively). Two Lactobacillaceae species were identified (Lb.
kefiranofaciens and L. kefiri) both of which have previously been
reported as the predominant species in kefir grains (Garofalo et al.,
2015; Leite et al., 2012). Another study reported that homo-
fermentative lactobacilli such as Lb. kefiranofaciens represented the
majority of the bacterial species in kefir grains (Prado et al., 2015;
Takizawa et al., 1998).
Lb. kefiranofaciens and L. kefiri are important species in kefir
grains because they are involved in kefir grain formation, and they
are considered the major producers of the exopolysaccharide
kefiran (Otles & Cagindi, 2003; Santos, San Mauro, Sanchez, Torres,
& Marquina, 2003; Wang et al., 2012). Kefiran in kefir grains is
important because it connects kefir grain microorganisms, and its
presence is an indication of a good kefir product (Dailin et al., 2016;
Rosa et al., 2017; Wang, Chen, Liu, Lin, & Chen, 2008). The ability of
6
International Dairy Journal 136 (2023) 105490
the grains to maintain a high proportion of Lb. kefiranofaciens as
observed in this study may be important to the quality of the final
kefir product.
The abundance of both Lactobacillus spp. in kefir was low
compared with kefir grains. Walsh et al. (2016) reported that Lb.
kefiranofaciens was more prevalent in the first few hours of kefir
fermentation but then started to decrease due to milk acidification
that favours the Streptococcacea family. Prado et al. (2015) reported
that homofermentative lactobacilli such as Lb. kefiranofaciens that
dominate kefir grains represent only 20% of lactobacilli in the final
kefir with the remaining 80% composed of heterofermentative
L. kefiri. This was not the case in this study as the relative abundance
of Lb. kefiranofaciens was higher than the relative abundance of
L. kefiri in all kefir samples.
The microbial communities of kefir grains are diverse (Nejati
et al., 2020b) and therefore the communities in the final kefir
may also differ. Takizawa et al. (1998) found that kefir grains con-
sisted of 90% homofermentative lactobacilli, mainly Lb. kefir-
anofaciens, which is consistent with the findings of this study while
Vardjan et al. (2013) reported that the ratio between homo-
fermentative Lb. kefiranofaciens and heterofermentative L. kefiri was
1:1.
The only Lactococcus species observed was Lc. lactis, which
accounted for a very small proportion of the total sequence reads in
the kefir grains (an average of 2%). Dobson et al. (2011) and Wang,
Sun, Song, and Guo (2021) reported similar findings where Lacto-
coccus was found as a very small proportion of the kefir grain
community although others have reported that Lc. lactis was the
dominant LAB in kefir grains (Purutoglu et al., 2020; Simova et al.,
2002). Simova et al. (2002) indicated that Lc. lactis is important in
kefir grains regardless of its abundance because it has been found to
produce exopolysaccharide (kefiran) (Purutoglu et al., 2020). These
findings highlight the importance of Lactococcus spp. in kefir grains.
In the current study, Lc. lactis were the dominant bacteria in
kefir (an average of 49%) and the only species of Lactococcus
observed. Several studies showed that Lactococcus spp. were more
prevalent in kefir compared with kefir grains (Dobson et al., 2011;
Kesmen & Kacmaz, 2011) which may be attributed to the weak
attachment of Lactococcus spp. to kefir grains (Garofalo et al., 2015).
Thus, they might be easily detached into milk during fermentation.
In addition, members of the family Streptococcaceae such as Lac-
tococcus are more competitive in milk compared with kefir grains
(Dobson et al., 2011) and produce higher amounts of acid during
fermentation compared with other LAB (Yüksekdag , Beyatli, &
Aslim, 2004).
The abundance of Leuconostoc spp., represented by only Leuc.
mesenteroides, was lower (0.11%) in kefir grains compared with kefir
(3.6%) which has been noted in other studies (Lin, Chen, & Liu, 1999;
Marsh et al., 2013). Walsh et al. (2016) indicated that the pro-
portions of Leuc. mesenteroides in kefir grains ranged from 0.2 to
1.5% of the total sequence reads but it became more prevalent in
milk in the later stages of fermentation accounting for approxi-
mately one-third of the total 16S rRNA sequence reads. Marsh et al.
(2013) reported that Leucosnostoc spp. have a significant impact on
the aroma of kefir.
High-throughput amplicon sequencing proved to be a powerful
tool because it also allowed for the detection of the minor microbial
communities associated with phyla other than the Firmicutes. The
phyla Bacteroidetes, Proteobacteria, Actinobacteria, and Acid-
obacteria comprised a relatively minor component of kefir grains
and kefir. These phyla have been reported by other researchers
(Dobson et al., 2011; Liu et al., 2015) where they make up less than
5% of kefir and kefir grain communities (Dobson et al., 2011).
Further, Pseudomonas spp. represented a minor population in this
study and is consistent with other studies that found Pseudomonas
F.A.J. Alraddadi, T. Ross and S.M. Powell
spp. as part of kefir grains and kefir (Dertli & Çon, 2017; Dobson
et al., 2011). In our study, all representative sequences associated
with Pseudomonas were assigned to P. putida.
4.2. Fungal composition of kefir grains
Yeasts play a significant role in kefir grains, and they have direct
roles in kefir fermentation because they are involved in lactic and
alcohol fermentation (Purutoglu et al., 2020; Simova et al., 2002).
Similar to other studies, the yeasts we found in kefir grains were
98% Ascomycota (Liu et al., 2019; Marsh et al., 2013). Kaz. turicensis
and Torulaspora delbruekii were the dominant species in kefir grains
in this study and both have been reported as part of kefir grains
(Arslan et al., 2015; Kazou et al., 2021; Nejati, Junne, Kurreck, &
Neubauer, 2020a; Simova et al., 2002). Non-lactose fermenting
yeasts such as T. delbruekii are reported to dominate kefir grains
where they can be found in the deep layer of kefir grains (Simova
et al., 2002). Kaz. turicensis was also a dominant yeast in kefir
grains. Kazachstania spp. has previously been reported as both the
most abundant yeast in kefir grains (Walsh et al., 2016) and a minor
component of kefir grains (Garofalo et al., 2015). It has been sug-
gested that Kaz. turicensis is important in kefir grains as the for-
mation of kefir grains may start with the self-aggregation of Kaz.
turicensis and Lb. kefiranofaciens (Wang et al., 2012).
In this study, Kluy. marxianus represented a minor population in
kefir grains which is consistent with other reports (Simova et al.,
2002; Wang, Sun, Song, & Guo, 2021) but in contrast with Korsak
et al. (2015) who found that Kluy. marxianus was the most abun-
dant species in two kefir grains. It is a lactose fermenting yeast and
has a role in kefir fermentation and kefir grain formation
(Purutoglu et al., 2020; Wang et al., 2012).
The remaining Ascomycota species Yarrowia spp., Saccharomyces
spp., and Clavispora spp. found in this study represented a minor
population in the grains as noted by other researchers (Brown,
2017; Dertli & Çon, 2017). C. lusitaniae is associated with clinical
infections but it was found in a home-made kefir and other fer-
mented dairy products, thus Brown (2017) assumed it was a
contaminant. However, it has been suggested that mixed cultures
such as kefir grains are not easily contaminated due to the anti-
microbial metabolites produced by kefir grains microorganisms
(Nout, 1995). Y. lipolytica is a common kefir yeast that has been
identified in both kefir grains and kefir as a minor population
(Dertli & Çon, 2017; Kalamaki & Angelidis, 2017). Y. lipolytica is
important because it produces lipolytic and proteolytic enzymes
that act on milk lipids and peptides (Mansour, Beckerich, &
Bonnarme, 2008).
4.3. Changes in the microbial communities of kefir grains and kefir
over time
A stable kefir grain microbial community is important for
ensuring consistent product quality (Vardjan et al., 2013). Kefir
grains are often replaced by starter cultures for large scale indus-
trial production of kefir because starter cultures comprise less
complex microbial communities and are thus easier to control.
Therefore, this study attempted to assess the consistency in kefir
and kefir grain microbial communities.
It was found that Lactobacillus was the dominant genus at all
sampling times, representing more than 93% of the total 16S rRNA
sequence reads in kefir grains. The relative abundance of Lb. kefir-
anofaciens and L. kefiri were remarkably consistent over the
experimental time. The findings of our study are consistent with
other reports that Lactobacillus spp. are the most consistently
abundant bacteria in kefir grains over several months (Vardjan
et al., 2013; Wang, Xiao, Jia, Pan, & Wang, 2018). This may be
7
International Dairy Journal 136 (2023) 105490
because Lb. kefiranofaciens is resistant to changes in culture con-
ditions and is able to resist levels of heat, cold, bile salt stress, and
acid that are lethal to other bacteria (Chen, Tang, & Chiang, 2017;
Wang et al., 2018).
The relative abundance of Lactobacillus spp. in kefir changed
over time, which contrasts with the observations of Vardjan et al.
(2018) who found that Lactobacillus spp. were consistent over a
period of four months. As previously noted, Lb. kefiranofaciens can
be found in the inner part of kefir grains (Wang et al., 2018) and
thus may have found it hard to detach into the milk resulting in
variable abundance in the kefir. It could also be attributed to the
changes that occurred to the fungal communities over time as it has
been hypothesised that the formation of kefir grains starts with the
self-aggregation of Kaz. turicensis and Lb. kefiranofaciens (Wang
et al., 2012). Yeasts are also involved in lactic fermentation by
providing metabolites to LAB during fermentation (Mainville, 2017;
Purutoglu et al., 2020). Therefore, the changes observed in the
fungal communities (Fig. 5C) might have contributed to the
changes in the relative abundance of Lb. kefiranofaciens over time.
L. kefiri was relatively consistent over time in this study in both
kefir grains and kefir although its numbers were lower in kefir
compared with kefir grains. L. kefiri is a biofilm producer that at-
taches to the surface of kefir grains (Chen et al., 2008). Thus, it may
not be located near Lb. kefiranofaciens in kefir grains. However, the
situation may differ in kefir during fermentation where the growth
of L. kefiri could be affected by Lb. kefiranofaciens. Blasche et al.
(2019) reported that Lb. kefiranofaciens, as a dominant kefir grain
LAB, supressed the growth of L. kefiri while promoting the growth
of other LAB such as Leuc. mesenteroides.
Lc. lactis was only observed in low proportions in the kefir grains
but dominated kefir with evident changes in its relative abundance
over time. Lc. lactis is generally considered to be a strictly homo-
fermentative LAB species and it is reported to attach poorly to kefir
grains (Gao & Li, 2016; Golomb & Marco, 2015) and, thus, it de-
taches easily into milk during fermentation. Other factors,
including the quality of milk and the microbial content of milk, may
also influence the growth of Lactococcus in kefir. The stability of the
microbial community of kefir grains and the influence of the mi-
crobial load in its surrounding environment such as milk is not well
understood (Gethins et al., 2016). Farnworth and Mainville (2003)
suggested that the symbiotic relationships between the micro-
biota of kefir grains allow them to remain stable in kefir grains and
kefir for a long time in spite of milk quality and other inhibiting
substances.
The relative abundance of yeasts in kefir grains was not
consistent over time. Kazachstania spp. were dominant in some of
the batches and Torulaspora spp. became more prevalent in the
later batches. The findings of this study are in contrast with Vardjan
et al. (2013, 2018) who found that yeasts, dominated by Kazach-
stania spp., in kefir grains and kefir were consistent over time
although those studies identified the dominant yeasts using plate
counts. Nejati et al. (2020b) pointed out that culture-dependent
methods such as plate counting can be subject to a high vari-
ability because it depends on medium and incubation conditions.
The use of high-throughput amplicon sequencing in the current
study allowed for the full assessment of the fungal communities
including the minor fungal groups.
The other yeasts detected represented a minor component of
kefir grains. However, their consistent presence might be crucial for
large scale production of kefir. Lu et al. (2014) found that the
presence of S. cerevisiae was consistent in kefir grains over ten
months, while Kluy. marxianus decreased and Y. lipolytica increased
over the same time. The authors speculated that the milk used for
kefir fermentation was the main cause of the observed changes as
the household who provided the kefir grains used only skimmed
F.A.J. Alraddadi, T. Ross and S.M. Powell
milk for kefir fermentation whereas Lu et al. (2014) used pas-
teurised full cream milk. The kefir grains for the current study were
previously used to ferment goats' milk to kefir. In the current study,
however, kefir grains were grown on full cream cows’ milk. Thus, it
is possible that the changes in the microbial communities of kefir
grains found in this study could be caused by the type of milk used
for kefir fermentation.
5. Conclusion
In this study, the microbial composition of kefir grains and kefir
were evaluated over time using high-throughput amplicon
sequencing. The main bacteria found in kefir grains and kefir were
Lb. kefiranofaciens and Lc. lactis, respectively while Kaz. turicensis
and T. delbruekii were the dominant yeast species in kefir grains.
The presence of other bacteria and yeasts was also highlighted. We
observed a greater diversity using high-throughput amplicon
sequencing than studies which only used culture-based methods.
Further, the relative abundance of Lactobacillus spp. was consistent
over time in kefir grains but not in kefir. Neither the yeast nor Lc.
lactis abundance was consistent in either kefir grains or kefir over
time.
The findings of this study suggest that producing kefir with a
consistent quality using kefir grains might be hindered due to the
changes that occur in microbial communities over time. Further
studies need to be undertaken to address the microbial interaction
between bacteria and yeasts in kefir grains along with other pro-
duction parameters such as milk type that may influence the final
kefir.
Declaration of competing interest
None.
Data availability
Data will be made available on request.
Acknowledgements
This study was funded by the College of Science & Engineering,
University of Tasmania. FAJA received a scholarship from the Saudi
Arabian Cultural Mission. The authors also thank Iain Field for
providing kefir grains and Sharee McCammon (Central Science
Laboratory, University of Tasmania) for helping with molecular
analysis.
References
Arslan, S. (2015). A review: Chemical, microbiological and nutritional characteristics
of kefir. CyTA - Journal of Food, 13, 340e345.
Blasche, S., Kim, Y., Mars, R., Kafkia, E., Maansson, M., Machado, D., et al. (2019).
Emergence of stable coexistence in a complex microbial community through
metabolic cooperation and spatio-temporal niche partitioning. bioRxiv, Article
541870. Article.
Bourrie, B. C., Willing, B. P., & Cotter, P. D. (2016). The microbiota and health pro-
moting characteristics of the fermented beverage kefir. Frontiers in Microbiology,
7, 647. Article.
Brown, M. F. W. (2017). Development of a sheep's milk kefir using species isolated
from kefir products (Masters Thesis). Palmerston North, New Zealand: Massey
University.
Chen, M.-J., Tang, H.-Y., & Chiang, M.-L. (2017). Effects of heat, cold, acid and bile salt
adaptations on the stress tolerance and protein expression of kefir-isolated
probiotic Lactobacillus kefiranofaciens M1. Food Microbiology, 66, 20e27.
Chen, H.-C., Wang, S.-Y., & Chen, M.-J. (2008). Microbiological study of lactic acid
bacteria in kefir grains by culture-dependent and culture-independent
methods. Food Microbiology, 25, 492e501.
Dailin, D. J., Elsayed, E. A., Othman, N. Z., Malek, R., Phin, H. S., Aziz, R., et al. (2016).
Bioprocess development for kefiran production by Lactobacillus kefiranofaciens
8
International Dairy Journal 136 (2023) 105490
in semi industrial scale bioreactor. Saudi Journal of Biological Sciences, 23,
495e502.
Dertli, E., & Çon, A. H. (2017). Microbial diversity of traditional kefir grains and their
role on kefir aroma. LWT–Food Science and Technology, 85, 151e157.
Diosma, G., Romanin, D. E., Rey-Burusco, M. F., Londero, A., & Garrote, G. L. (2014).
Yeasts from kefir grains: Isolation, identification, and probiotic characterization.
World Journal of Microbiology and Biotechnology, 30, 43e53.
Dobson, A., O'Sullivan, O., Cotter, P. D., Ross, P., & Hill, C. (2011). High-throughput
sequence-based analysis of the bacterial composition of kefir and an associated
kefir grain. FEMS Microbiology Letters, 320, 56e62.
Farnworth, E. R. (2005). Kefirea complex probiotic. Functional Foods, 2, 1e17.
Farnworth, E. R., & Mainville, I. (2003). Kefir: A fermented milk product. Handbook
of Fermented Functional Foods, 2, 89e127.
Gao, J., Gu, F., Abdella, N. H., Ruan, H., & He, G. (2012). Investigation on culturable
microflora in Tibetan kefir grains from different areas of China. Journal of Food
Science, 77, M425eM433.
Gao, X., & Li, B. (2016). Chemical and microbiological characteristics of kefir grains
and their fermented dairy products: A review. Cogent Food & Agriculture, 2,
Article 1272152.
Garofalo, C., Osimani, A., Milanovi c, V., Aquilanti, L., De Filippis, F., Stellato, G., et al.
(2015). Bacteria and yeast microbiota in milk kefir grains from different Italian
regions. Food Microbiology, 49, 123e133.
Gethins, L., Rea, M. C., Stanton, C., Ross, R. P., Kilcawley, K., O'Sullivan, M., et al.
(2016). Acquisition of the yeast Kluyveromyces marxianus from unpasteurised
milk by a kefir grain enhances kefir quality. FEMS Microbiology Letters, 363,
Article fnw165.
Golomb, B. L., & Marco, M. L. (2015). Lactococcus lactis metabolism and gene
expression during growth on plant tissues. Journal of Bacteriology, 197, 371e381.
Guzel-Seydim, Z. B., Kok-Tas, T., Greene, A. K., & Seydim, A. C. (2011). Functional
properties of kefir. Critical Reviews in Food Science and Nutrition, 51, 261e268.
Guzel-Seydim, Z., Wyffels, J. T., Seydim, A. C., & Greene, A. K. (2005). Turkish kefir
and kefir grains: Microbial enumeration and electron microscopic observation.
International Journal of Dairy Technology, 58, 25e29.
Kalamaki, M. S., & Angelidis, A. S. (2017). Isolation and molecular identification of
yeasts in Greek kefir. International Journal of Dairy Technology, 70, 261e268.
Kazou, M., Grafakou, A., Tsakalidou, E., & Georgalaki, M. (2021). Zooming into the
microbiota of home-made and industrial kefir produced in Greece using clas-
sical microbiological and amplicon-based metagenomics analyses. Frontiers in
Microbiology, 12, Article 64.
Kesmen, Z., & Kacmaz, N. (2011). Determination of lactic microflora of kefir grains
and kefir beverage by using culture-dependent and culture-independent
methods. Journal of Food Science, 76, M276eM283.
Ko €
€ k-Taş, T., Seydim, A. C., Ozer, B., & Guzel-Seydim, Z. B. (2013). Effects of different
fermentation parameters on quality characteristics of kefir. Journal of Dairy
Science, 96, 780e789.
Korsak, N., Taminiau, B., Leclercq, M., Nezer, C., Crevecoeur, S., Ferauche, C., et al.
(2015). Evaluation of the microbiota of kefir samples using metagenetic analysis
targeting the 16S and 26S ribosomal DNA fragments. Journal of Dairy Science, 98,
3684e3689.
Leite, A., Leite, D., Del Aguila, E., Alvares, T., Peixoto, R., Miguel, M., et al. (2013).
Microbiological and chemical characteristics of Brazilian kefir during fermen-
tation and storage processes. Journal of Dairy Science, 96, 4149e4159.
Leite, A. M., Mayo, B., Rachid, C. T., Peixoto, R., Silva, J., Paschoalin, V., et al. (2012).
Assessment of the microbial diversity of Brazilian kefir grains by PCR-DGGE and
pyrosequencing analysis. Food Microbiology, 31, 215e221.
Lin, C.-W., Chen, H.-L., & Liu, J.-R. (1999). Identification and characterisation of lactic
acid bacteria and yeasts isolated from kefir grains in Taiwan. Australian Journal
of Dairy Technology, 54, 14e18.
Liu, W., Zhang, M., Xie, J., Wang, H., Zhao, X., Chen, B., et al. (2019). Comparative
analyses of microbial community diversities of Tibetan kefir grains from three
geographic regions. International Journal of Dairy Technology, 72, 536e544.
Liu, W., Zheng, Y., Kwok, L.-Y., Sun, Z., Zhang, J., Guo, Z., et al. (2015). High-
throughput sequencing for the detection of the bacterial and fungal diversity in
Mongolian naturally fermented cow's milk in Russia. BMC Microbiology, 15,
1e12.
Lu, M., Wang, X., Sun, G., Qin, B., Xiao, J., Yan, S., et al. (2014). Fine structure of Ti-
betan kefir grains and their yeast distribution, diversity, and shift. PLoS One, 9,
Article e101387.
Mainville, I. (2017). Accurate identification of yeasts in kefir by polyphasic analysis.
EC Microbiology, 12, 104e113.
Mansour, S., Beckerich, J., & Bonnarme, P. (2008). Lactate and amino acid catabolism
in the cheese-ripening yeast Yarrowia lipolytica. Applied and Environmental
Microbiology, 74, 6505e6512.
Marsh, A. J., O'Sullivan, O., Hill, C., Ross, R. P., & Cotter, P. D. (2013). Sequencing-
based analysis of the bacterial and fungal composition of kefir grains and milks
from multiple sources. PLoS One, 8, Article e69371.
Nejati, F., Junne, S., Kurreck, J., & Neubauer, P. (2020a). Quantification of major
bacteria and yeast species in kefir consortia by multiplex TaqMan qPCR. Fron-
tiers in Microbiology, 11, Article 1291.
Nejati, F., Junne, S., & Neubauer, P. (2020b). A big world in small grain: A review of
natural milk kefir starters. Microorganisms, 8, Article 192.
Nilsson, R. H., Larsson, K.-H., Taylor, A. F. S., Bengtsson-Palme, J., Jeppesen, T. S.,
Schigel, D., et al. (2019). The UNITE database for molecular identification of
fungi: Handling dark taxa and parallel taxonomic classifications. Nucleic Acids
Research, 47, D259eD264.
F.A.J. Alraddadi, T. Ross and S.M. Powell
Nout, M. (1995). Fungal interactions in food fermentations. Canadian Journal of
Botany, 73, 1291e1300.
Otles, S., & Cagindi, O. (2003). Kefir: A probiotic dairy-composition, nutritional and
therapeutic aspects. Pakistan Journal of Nutrition, 2, 54e59.
Plessas, S., Nouska, C., Mantzourani, I., Kourkoutas, Y., Alexopoulos, A., &
Bezirtzoglou, E. (2017). Microbiological exploration of different types of kefir
grains. Fermentation, 3, Article 1.
Prado, M. R., Blando n, L. M., Vandenberghe, L. P., Rodrigues, C., Castro, G. R., Tho-
maz-Soccol, V., et al. (2015). Milk kefir: Composition, microbial cultures, bio-
logical activities, and related products. Frontiers in Microbiology, 6, Article 1177.
Purutog _
lu, K., Ispirli, H., Yüzer, M. O., Serencam, H., & Dertli, E. (2020). Diversity and
functional characteristics of lactic acid bacteria from traditional kefir grains.
International Journal of Dairy Technology, 73, 57e66.
Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., et al. (2013). The
SILVA ribosomal RNA gene database project: Improved data processing and
web-based tools. Nucleic Acids Research, 41, D590eD596.
Rosa, D. D., Dias, M. M., Grzeskowiak, Ł. M., Reis, S. A., Conceiça ~o, L. L., & Maria do
Carmo, G. P. (2017). Milk kefir: Nutritional, microbiological and health benefits.
Nutrition Research Reviews, 30, 82e96.
Santos, A., San Mauro, M., Sanchez, A., Torres, J., & Marquina, D. (2003). The anti-
microbial properties of different strains of Lactobacillus spp. isolated from kefir.
Systematic & Applied Microbiology, 26, 434e437.
Schloss, P. D., Westcott, S. L., Ryabin, T., Hall, J. R., Hartmann, M., Hollister, E. B., et al.
(2009). Introducing Mothur: Open-source, platform-independent, community-
supported software for describing and comparing microbial communities.
Applied and Environmental Microbiology, 75, 7537e7541.
Simova, E., Beshkova, D., Angelov, A., Hristozova, T., Frengova, G., & Spasov, Z.
(2002). Lactic acid bacteria and yeasts in kefir grains and kefir made from them.
Journal of Industrial Microbiology and Biotechnology, 28, 1e6.
Takizawa, S., Kojima, S., Tamura, S., Fujinaga, S., Benno, Y., & Nakase, T. (1998). The
composition of the Lactobacillus flora in kefir grains. Systematic & Applied
Microbiology, 21, 121e127.
International Dairy Journal 136 (2023) 105490
Vardjan, T., Lorbeg, P. M., Rogelj, I., & Majheni

(2013). Characterization and
c, A.C.
stability of lactobacilli and yeast microbiota in kefir grains. Journal of Dairy
Science, 96, 2729e2736.
Vardjan, T., Mohar Lorbeg, P., & Can

zek Majheni
c, A. (2018). Stability of pre-
vailing lactobacilli and yeasts in kefir grains and kefir beverages during
ten weeks of propagation. International Journal of Dairy Technology, 71,
51e60.
Walsh, A. M., Crispie, F., Kilcawley, K., O'Sullivan, O., O'Sullivan, M. G., Claesson, M. J.,
et al. (2016). Microbial succession and flavor production in the fermented dairy
beverage kefir. mSystems, 1, Article e00052.
Wang, S.-Y., Chen, H.-C., Liu, J.-R., Lin, Y.-C., & Chen, M.-J. (2008). Identification of
yeasts and evaluation of their distribution in Taiwanese kefir and viili starters.
Journal of Dairy Science, 91, 3798e3805.
Wang, S.-Y., Chen, K.-N., Lo, Y.-M., Chiang, M.-L., Chen, H.-C., Liu, J.-R., et al. (2012).
Investigation of microorganisms involved in biosynthesis of the kefir grain.
Food Microbiology, 32, 274e285.
Wang, H., Sun, X., Song, X., & Guo, M. (2021). Effects of kefir grains from different
origins on proteolysis and volatile profile of goat milk kefir. Food Chemistry, 339,
Article 128099.
Wang, X., Xiao, J., Jia, Y., Pan, Y., & Wang, Y. (2018). Lactobacillus kefiranofaciens, the
sole dominant and stable bacterial species, exhibits distinct morphotypes upon
colonization in Tibetan kefir grains. Heliyon, 4, Article e00649.
Yüksekdag , Z., Beyatli, Y., & Aslim, B. (2004). Determination of some characteristics
coccoid forms of lactic acid bacteria isolated from Turkish kefirs with natural
probiotic. LWT–Food Science and Technology, 37, 663e667.
Zakrzewski, M., Proietti, C., Ellis, J. J., Hasan, S., Brion, M.-J., Berger, B., et al. (2017).
Calypso: A user-friendly web-server for mining and visualizing
microbiomeeenvironment interactions. Bioinformatics, 33, 782e783.
Zanirati, D. F., Abatemarco, M., Sandes, S. H. D., Nicoli, J. R., Nunes, A. C., &
Neumann, E. (2015). Selection of lactic acid bacteria from Brazilian kefir
grains for potential use as starter or probiotic cultures. Anaerobe, 32,
70e76.