Chemico-Biological Interactions 345 (2021) 109550

Contents lists available at ScienceDirect

Chemico-Biological Interactions
journal homepage: www.elsevier.com/locate/chembioint

Research paper

Polystyrene microplastics induce apoptosis via ROS-mediated p53 signaling

pathway in zebrafish
Sathisaran Umamaheswari a, Sheela Priyadarshinee a, Krishna Kadirvelu b, Mathan Ramesh a, *
a
Unit of Toxicology, Department of Zoology, Bharathiar University, Coimbatore, 641 046, India
b
DRDO-BU Centre for Life Sciences, Bharathiar University Campus, Coimbatore, 641 046, India

A R T I C L E I N F O A B S T R A C T

Keywords: Microplastic (MP) pollution is ubiquitous and has become an emerging threat to aquatic biota. Recent scientific
Plastics reports have recorded their toxic impacts at the cellular and organism levels, but the underlying molecular
Enzymes mechanism of their toxicity remains unclear. The present study elucidates an array of molecular events under­
Inflammation
lying apoptosis in the gills of polystyrene microplastics (PS-MPs) exposed zebrafish (Danio rerio). PS-MPs at
Apoptosis
different concentrations (10 and 100 μg L− 1) induced the reactive oxygen species (ROS) generation, in turn
Histology
Genes affecting the oxidative and immune defense mechanism. The expression profile of antioxidant genes cat, sod1,
gpx1a and gstp1 were altered significantly. PS-MPs also significantly inhibited the neurotransmission in zebrafish.
In addition, the PS-MPs exposure upregulated the expression of p53, gadd45ba, and casp3b resulting in apoptosis.
We demonstrate that PS-MPs significantly upregulate the transcriptional pattern of tnfa and ptgs2a which are
essential gene markers in inflammatory mechanism. Further, the oxidative damage induced by PS-MPs exposure
could lead to cytological damage resulting in altered lamellar structures, capillary dilation, and necrosis in gill
histomaps. In conclusion, the findings of this work strongly suggest that PS-MPs induce dose-and time-dependent
ROS mediated apoptotic responses in zebrafish. Furthermore, the physiological responses observed in the gills
correlate with the above observations and helps in unravelling the potential molecular mechanism underpinning
the PS-MPs toxicity in zebrafish.

1. Introduction
The worldwide increase in plastics manufacture and disposal has
caused release of plastic debris in water bodies, thereby posing an
ecological risk to the present and future generations [1,2]. The plastic
trash entering seawaters was determined to be 4–12 million tons every
year [3]. The majority of the plastic trashes that are circulated in the
marine environment in the form of larger plastics as well as debris are
non-biodegradable, and hence they greatly affect the aquatic ecosystem
[4–6]. Furthermore, in the environment plastics are subjected to
degradation which results in the formation of microplastics [7,8]. Klein
et al. [9] reported that degradation of plastics in the environment may
be the key factor for the formation of microplastics. Microplastics (MPs)
have been detected in oceans and rivers in the range of 1 μm–5 mm [7,
10]. In addition, degradation of MPs via photo-oxidation, thermo-ox­
idative reactions and microorganisms [11] may lead to fragmentation of
smaller particles such as nanoplastics [12] which have been recognized
as a serious threat to aquatic organisms [13,14]. Plastics may also act as
carriers for other environmental pollutants and influence their toxicity
[14,15].
The common plastics that are used in day-to-day life comprise high-
density polyethylene (HDPE), low-density polyethylene (LDPE), poly­
propylene (PP), polystyrene (PS), polyamide (PA), polyester (PES),
polyvinylchloride (PVC), and polyethylene terephthalate (PET) [16].
Among these plastics, PS stands third in the category of frequently
identified plastic debris in marine environment [17]. Merchant research
and consulting have reported that approximately 32.7 million tons of PS
were produced worldwide [18]. PS is an aromatic hydrocarbon pro­
duced from polymerization of styrene monomers. Due to its versatility
and inert nature, PS is employed in the manufacture of styrofoam and
other plastic wares such as household appliances, toys, automobile
parts, food packaging, medical devices, and consumer electronics [19,
20]. Besides its application as a general plastic, PS has been widely used
in bioanalytical and biomedical platforms [21,22]. Studies have also
reported the migration of styrene monomers into food items from PS
containers posing a threat to humanity [23–25]. Meanwhile, the PS

* Corresponding author. Unit of Toxicology, Department of Zoology, School of Life Sciences, Bharathiar University, Coimbatore, 641 046, Tamil Nadu, India.
E-mail address: mathanramesh@buc.edu.in (M. Ramesh).

https://doi.org/10.1016/j.cbi.2021.109550
Received 15 March 2021; Received in revised form 19 May 2021; Accepted 8 June 2021
Available online 11 June 2021
0009-2797/© 2021 Elsevier B.V. All rights reserved.
S. Umamaheswari et al.
microbeads, pellets or fragments from cosmetics, detergents, and textiles
also leach into the aquatic environment [26].
Polystyrene microplastics (PS-MPs) are one of the most abundant
MPs found in the marine environment [27,28]. These persisting PS-MPs
in the aquatic environment produce a detrimental consequence on ma­
rine life, and human health. This is attributable to their conformation,
toxicants adsorbing potency, biotransforming and biomagnifying ability
in the food chain [29,30]. Unfortunately, the majority of MPs and NPs
consumed by humans are from food packed in polystyrene containers,
seafood and water with undetectable PS-MPs/PS-NPs [31,32]. The
major source of seafood includes fishes and shell fishes that were rich in
protein content. Approximately twenty percent of individual shellfish
and fish were loaded with microplastic litters in their gastrointestinal
tracts [33,34]. The ingestion and toxicity of PS-MPs in fishes have been
enumerated from various studies such as oxidative damage [35],
neurotoxicity [36], gene expression [37], alteration in glucose meta­
bolism in zebrafish embryos [38], behavioral responses of zebrafish
larvae [39], mortality of juvenile Daphnia magna [40], decrease of
growth rate and gross energy of fish [41] and intestinal immune cell
dysfunction [42]. The existing studies on PS-MPs toxicity provide data at
the physiological level, it remains hypothetical if PS-MPs induced toxic
effects were ROS dependent and affects the molecular pathways pro­
ducing detrimental impacts.
Under normal physiological conditions, there is a balance between
ROS generation and antioxidants activity. Exposure to MPs induces ROS
production causing oxidative stress and increased lipid peroxidation
[37]. As a compensatory response to oxidative stress, antioxidants are
produced by living cells [8]. Previous studies suggested that the activity
of antioxidants is influenced by the tempo of ROS induction and cyto­
protective genes transcription [15,43,44]. The induction of ROS gen­
eration and the activation of tnfa, a pro-inflammatory cytokine, are
interdependent as the production of one trigger the activation of other.
The ROS acts as a key initiator in various signaling pathways
involving cell cycle and energy metabolism [45]. Qiang and Cheng [46]
have reported on the ROS mediated p53 apoptotic cascade activation on
exposure to microplastics. The p53 signaling pathway regulates various
cellular responses associated with cell cycle, senescence, cell survival
and apoptosis [47,48]. The p53 gene transduce signals to stimulate
apoptosis via cas3b and gadd45ba activation [49,50] along with the
expression of ptgs2a, an inflammatory biomarker in zebrafish. The gene
gadd45ba has been associated with stress response to any chemical or
environmental stressors, causing growth arrest, DNA damage or
apoptosis [51]. A limited number of toxicity studies indicated that
oxidative and subsequent DNA damage was linked to the physiological
responses induced by PS-MPs [5,52].
However, the underlying mechanism of PS-MPs induced toxicity are
not yet clearly understood. The present study was conducted to further
discern these mechanisms, induced oxidative responses and associated
apoptotic pathway in zebrafish. Zebrafish (Danio rerio) has been widely
used as a vertebrate model for studying toxicity of any chemical in the
aquatic environment [53]. Besides a vertebrate model, it is a successful
model in MPs toxicity studies for its transparent nature to localise
fluorescent MPs/NPs [54]. We hypothesize that ROS mediates the p53
apoptotic pathway via casp3b activation and subsequently modulates
the physiology in PS-MPs exposed zebrafish. In the present study, we
have evaluated the potential of PS-MPs to induce oxidative stress,
biochemical, and histological responses in zebrafish (Danio rerio). In
addition, we explored the effects of PS-MPs on transcriptional pattern of
genes involved in apoptotic pathway and inflammatory responses of the
gills in zebrafish.
2. Materials and methods
2.1. Polystyrene MPs
PS-MP beads (Product no: LB1) of 0.10–0.12 μm in size were
2
Chemico-Biological Interactions 345 (2021) 109550
purchased as aqueous suspensions from Sigma Aldrich. The morphology
of the beads was characterized using a scanning electron microscope
(SEM – FEI QUANTA 200), where a drop of sonicated MPs suspension
was placed on the double-sided adhesive carbon tape fixed to an
aluminum stub. The stub was air-dried in a sterile environment, coated
with Au/Pd and examined at low vacuum mode (voltage- 15 kV;
working distance- 10 mm). The functional properties of PS-MP beads
were analysed using Fourier Transform Infrared (FTIR) spectroscopy
(FTIR - 4100 type A). For measuring PS-MP bead size, 20 μL of the
aqueous suspension was taken and analysed using Zetasizer Nano,
Malvern, UK at a scattering angle 90◦ and wavelength 633 nm.
2.2. Chemicals
Alkaline phosphatase (AKP) and Lactate dehydrogenase (LDH) assay
kits were purchased from Coral Clinical systems, Goa, India. High-
capacity cDNA Reverse Transcription Kits and SYBR Premix Ex Taq
TM II were purchased from Thermofisher Scientific and Takara respec­
tively. The primers used for the study was purchased from Euroflims
Genomics. TRI Reagent was purchased from Sigma Aldrich. All the other
chemicals were purchased from HiMedia Laboratories Pvt. Ltd., India.
2.3. Zebrafish and exposure
In the present study all the experiments were carried out as per the
regulations of Organization of Economic Co-operation and Development
[55] and Committee for Control and Supervision of Experiments on
Animals (CPCSEA). Adult male zebrafish (AB strain) were acquired from
the New golden aquarium, Coimbatore and maintained in aerated
freshwater. The physicochemical parameters of water i.e., temperature
26.4 ± 1.2 ◦ C, pH 6.6 ± 0.53, total hardness 159 ± 2.7 mg L− 1 CaCO3,
alkalinity 194 ± 2.04 mg L− 1, and dissolved oxygen 6.8 ± 0.3 mg L− 1
were measured daily as per APHA guidelines [56]. During acclimatiza­
tion, the fishes were fed with commercial pellets and the water was
renewed once a day.
Two different concentrations of PS-MPs namely 10 μg L− 1 and 100
μg L− 1 were selected for testing the chronic toxicity [57]. Healthy fish
with 0.28 ± 0.07 g body weight and 2.43 ± 0.06 cm body length (35
Nos) were selected from the stock and introduced in each glass aquaria
filled with 35 L of water. Fish were exposed to two concentrations of
PS-MPs (10 μg L− 1 as Treatment I and 100 μg L− 1 as Treatment II) along
with the control in three replicates for each concentration. The glass
aquaria were replenished with test solution (freshwater for control)
every 24 h to sustain the PS-MPs concentration. Every day the physi­
cochemical properties of water were measured for the renewed aquar­
ium water. Experiments were conducted for a period of 35 days with 7
days sampling frequency. After exposure, 4 fishes from control and
treated groups were sampled, cleansed with methanol to get rid of
particles from the skin, weighed (0.28 ± 0.09 g body weight and 2.55 ±
0.08 cm body length), anesthetized and gill tissues were harvested and
used for biochemical assays. Similarly, gills of 4 fishes from each aquaria
were sampled separately at the end of 7 and 35 d and used for histo­
logical analysis (n = 1) and expression analysis (n = 3).
2.4. Preparation of sample homogenate
The pooled tissue samples were homogenized with ice-cold phos­
phate buffer saline (50 mM, pH 7.4). A part of this homogenate was used
for lipid peroxidation (LPO), catalase (CAT), superoxide dismutase
(SOD), and glutathione peroxidase (GPx) assays. The leftover homoge­
nate was centrifuged at 12000 g for 30 min at 4 ◦ C and the supernatant
was used to measure reactive oxygen species (ROS), glutathione S-
transferase (GST), acetylcholinesterase (AChE), and biochemical en­
zymes (AKP, and LDH).
S. Umamaheswari et al. Chemico-Biological Interactions 345 (2021) 109550

2.5. Oxidative stress indices 2.8. Acetylcholinesterase (AChE) activity

2.5.1. Reactive oxygen species (ROS) AChE level was measured using the method adapted by Ellman et al.
The ROS level was measured by the modified dichlorofluorescein- [63] with slight modifications. Shortly, 250 μL of the reaction solution
diacetate (DCF-DA) method [58]. To 20 mL of the supernatant, 200 (30 mL of 0.1 M phosphate buffer, 1 mL of 10 mM 5, 5-dithiobis-2-nitro­
mL of PBS and 8.3 mL of DCF-DA was added and incubated in the dark benzoic acid solution with sodium bicarbonate, and 0.2 mL of 0.075 M
for 30 min at 37 ◦ C. The fluorescence intensity was measured with 485 acetylcholine solution) were added to 50 μL of the supernatant and the
nm excitation and 520 nm emission in a fluorescence spectrometer optical density was measured at 414 nm in a microplate photometer.
(HORIVA) and expressed as relative fluorescence intensity.
2.9. Real-time reverse transcription-polymerase chain reaction (RT-PCR)
2.5.2. Lipid peroxidation (LPO)
The LPO level was estimated following thiobarbituric acid reactive To study the expression pattern, the total RNA was extracted from
substances (TBARS) assay [59]. Shortly, 100 mL of 5% trichloroacetic the pooled gill tissue samples using TRI Reagent following the manu­
acid (TCA) was added to the tissue homogenate and incubated at 4 ◦ C for facturer’s protocol. The purity and quantity of the obtained RNA were
10 min. Then 100 mL of 0.67% thiobarbituric acid was added to the determined using a NanoDrop plate reader (NanoDrop Technologies,
mixture and centrifuged at 2200 g for 10 min. The clear upper phase was Synergy). Total RNA (1 μg/μL) of each sample was reverse transcribed
incubated in a hot water bath for 10 min, cooled and the optical density using High-capacity cDNA Reverse Transcription Kit. Quantitative real-
was measured at 535 nm in a microplate photometer (Synergy H1, time PCR was performed with synthesized cDNAs, SYBR Premix Ex Taq
BioTek). TM II, and gene-specific primers in Light Cycler 480 (Roche). The re­
action involves denaturation (at 95 ◦ C for 10 min), amplification (40
2.6. Antioxidant enzymes cycles at 95 ◦ C for 15 s and at 60 ◦ C for 1 min), followed by quantifi­
cation, with a melting curve program (60–99 ◦ C). The sources and se­
2.6.1. Catalase (CAT) activity quences of used primers are given in Table 1. All PCR reactions were
The CAT activity was measured following the procedure of Sinha performed in triplicates and the β-actin was employed to normalize the
[60] with slight modifications. Briefly, 25 μL of ice-cold Tris-HCl buffer expression curve of the test gene. Relative fold changes of genes were
(100 mM, pH 7.4) was added to the tissue homogenate and cold determined using the 2− ΔΔCT method [64].
centrifuged at 12000 g for 15 min. The clear upper phase was collected,
3 mL of the reaction mixture (acetic acid and 5% potassium dichromate
2.10. Histological analysis
in 3:1 ratio and 10 mM phosphate buffer, pH 7.0) was added and the
mixture was incubated in a hot water bath for 15 min. The optical
Histological analysis of zebrafish gills was carried out using the
density of the solution was measured at 570 nm in a microplate
protocol of Teng et al. [65]. The gill tissues were fixed in 10% formalin
photometer.
for 48 h and subjected to dehydration in an increasing string of ethanol.
Then the tissues were xylene cleared, embedded in blocks of paraffin
2.6.2. Superoxide dismutase (SOD) activity
wax, and sectioned at 3–5 μm thickness. The sectioned tissues were
The activity of SOD was determined by following the method of
hematoxylin and eosin (H&E) stained for microscopic analysis. The
Marklund and Marklund [61] with slight modifications. 25 μL of 100
slides were observed and photographed using a light microscope (DME
mM Tris-HCl buffer (pH 7.4) was added to the tissue homogenate and
light Microscope, Leica).
cold centrifuged at 12000 g for 15 min. The clear upper phase collected
was added to the reaction solution (50 mM Tris-HCl buffer, with 1 mM
EDTA and 2.64 mM Pyrogallol) and the optical density was read at 420 2.11. Statistical analysis
nm in a microplate photometer.
Graph Pad Prism software (version 8) was used for the statistical
2.6.3. Glutathione peroxidase (GPx) activity analysis. The significant differences in all the experimental groups were
Glutathione peroxidase activity was determined by adapting the
method of Adeyemi et al. [59] with slight modifications. Around 25 μL Table 1
of Tris-HCl buffer (100 mM, pH 7.4) was added to the tissue homogenate Primers and the nucleotide sequences.
and cold centrifuged at 12000 g for 15 min. The clear upper phase was S.No Name Primer sequences Accession number
obtained after centrifugation. Then, 880 μL of the reaction mixture (1
1 β actin GCCAACAGAGAGAAGATGAC AF057040.1
mM GSH, 150 mM of NADPH, 100 mM sodium azide in potassium CACCAGAGTCCATCACAATAC
phosphate buffer, pH 7.0) was added, and the optical density was 2 cat GGAGCTCAACTCTTCATCCA AF170069.1
measured photometrically at 340 nm for 1 min. CCCTTCAGCGTTGTGTTTATC
3 sod1 AGTGAAGGTGACTGGTGAAA BC055516.1
ATGCAGCCGTTTGTGTTG
2.6.4. Glutathione S-transferase (GST) activity 4 gstp1 GGCAACGGCAAACAGTAAA NM_131734.3
GST level was measured using the method adapted by Domingues CATTGAGCACCAGTTAAGGC
et al. [62] with slight modifications. In brief, 100 μL of the reaction 5 gpx1a GGCTTCTACGTGTTGTGTTC NM_001007281.2
solution (10 mM GSH and 60 mM 1-chloro2, 4-dinitrobenzene) was ACTGCACAGTCGGTCTATATC
6 ache CACAACAGGGAGATCACAGTA BC076071.1
added to 50 μL of the clear supernatant and the optical density was
GAAGAGGAACGTGAGTAGCA
measured at 340 nm in a microplate photometer for 5 min. 7 p53 CTTGGTGCTGAATGGACAAC NM_001328588.1
CCAGAGTGATGATTGTGAGGA
2.7. Biochemical analysis 8 casp3b GTGTAGGTGACGAGGAAACA NM_001048066.2
AGGAGCCATTAGCGACATT
9 gadd45ba CAATGCCAGCCTCTCAAATG NM_213031.3
The activity of AKP and LDH enzymes was measured using Reagent CGTTCTTGCAGGGACAGATA
Kits following the manufacturer’s protocol. 10 tnfa GACCTTAGACTGGAGAGATGAC NM_212859.2
ACACCTGGCTGTAGACAAA
11 ptgs2a TGAGGAGATGACAGGAGACA NM_153657.1
CACAAGAAGGCCAGGATACA

3
S. Umamaheswari et al.
determined using two-way ANOVA followed by Duncan’s multiple
comparisons test. The significance level was set at P < 0.05.
3. Results
3.1. PS-MPs – characterization
In the present study, the SEM image of PS-MP beads were spherical
with a size range of 103–113 nm (0.103–0.113 μm) (Fig. 1a). The FTIR
spectrum of the PS-MPs beads show the presence of polystyrene group
(Fig. 1b), verifying the manufacturers’ data. From Fig. S1, the size dis­
tribution graph of PS-MPs shows the average size distribution of PS-MPs
is 116.5 nm (0.116 μm) in the sample.
3.2. Oxidative stress indices
Compared to the control, PS-MPs (10 μg L− 1 and 100 μg L− 1) have
significantly induced (P < 0.001) the ROS production time-and dose-
dependently in this study (Fig. 2a). Similarly, the depicted results from
Fig. 2b shows the significant (P < 0.001) induction of LPO levels in a
time-and dose-dependent manner in PS-MPs groups (10 μg L− 1 and 100
μg L− 1) compared to the control.
3.3. Antioxidant biomarkers
Compared to the control, PS-MPs (10 μg L− 1 and 100 μg L− 1) have
significantly (P < 0.05) inhibited the CAT activity in this study (Fig. 2c)
with an exception in the 7th and 14th day in lower dose group (10 μg
L− 1). Similarly, the SOD activity was significantly (P < 0.05) inhibited
in the PS-MPs groups (10 μg L− 1 and 100 μg L− 1) compared to the
control (Fig. 2d). However, the SOD activity in the lower dose group (10
μg L− 1) showed no significant (P > 0.05) variation at the end of the 7th
day. From Fig. 2e, GPx activity in the PS-MPs groups (10 μg L− 1 and 100
μg L− 1) show significant (P < 0.05) decrease in relation to control
group. However, on 7th day in the lower and higher dose group (10 μg
L− 1 and 100 μg L− 1) and 14th day in higher dose group (100 μg L− 1), no
significant (P > 0.05) change in GPx activity was observed. The
observed decrease in antioxidants is inversely proportional to the dosage
and duration of PS-MPs exposure. The result Fig. 2f, depicts the signif­
icant (P < 0.05) increase in GST activity which depends on time and
dose of PS-MPs exposure with an exception in the 7th day in lower dose
group (10 μg L− 1) compared to the control group.
Fig. 1. SEM image (a) and FT-IR spectrum (b) of PS-MPs (0.1 μm) used in this study.
4
Chemico-Biological Interactions 345 (2021) 109550
3.4. Biochemical enzymes
Throughout the study period, AKP activity shows a significant (P <
0.05) decline in PS-MPs groups (10 μg L− 1 and 100 μg L− 1) compared to
the control as shown in Fig. 2g. The decline was more pronounced with
an increase in dosage and duration of PS-MPs exposure. Compared to the
control, PS-MPs (10 μg L− 1 and 100 μg L− 1) have significantly induced
(P < 0.001) the LDH activity time-and dose-dependently in this study
(Fig. 2h).
3.5. Neurotransmitter – acetylcholinesterase (AChE) activity
Compared to the control, PS-MPs (10 μg L− 1 and 100 μg L− 1) have
significantly (P < 0.001) inhibited the AChE activity in this study
(Fig. 2i). The observed inhibition in the AChE activity showed a time-
and dose-dependent gradual increase.
3.6. Gene regulation pattern
PS-MPs have significantly altered the transcriptional profile of anti­
oxidants, acetylcholinesterase and apoptosis-related genes (Fig. 3). The
expression pattern of cat, sod1, gpx1a (Fig. 3a–c), and ache (Fig. 3e) tend
to decrease significantly (P < 0.05) with increasing dose and duration of
PS-MPs exposure. However, the observed cat decrease was not statisti­
cally significant (P > 0.05) in the 7th day of lower dose group (10 μg
L− 1). Similarly, the decreased expression of sod1 and ache was also noted
to be insignificant (P > 0.05) in 7th and 35th day of lower dose group
(10 μg L− 1). The gene gstp1 was significantly (P < 0.05) upregulated in
the higher dose group (100 μg L− 1) whereas it showed no significant
change (P > 0.05) in the lower dose group (10 μg L− 1) relative to the
control (Fig. 3d). On the other hand, the genes tnfa, p53, casp3b,
gadd45ba, and ptgs2a (Fig. 3f–j) were significantly (P < 0.05) upregu­
lated in the PS-MPs group when compared to control group (except at
the end of 7th day in Treatment 1).
3.7. Histological analysis
To study the PS-MPs induced histological responses, we analysed the
gill histomaps of zebrafish after 7and 35 d of PS-MPs exposure. As
observed in Fig. 4a and b, gill from the control exhibit normal histo­
morphology, such as regular lamellar structure lined with squamous
epithelial cells, conventional orchestrate of pillar cells, and normal fil­
amental structures. However, after 7 d of PS-MPs exposure, the gills
from the lower dose group (10 μg L− 1) possessed aneurysms, capillary
dilation and necrotic cells (Fig. 4c). The occurrence of histological
S. Umamaheswari et al. Chemico-Biological Interactions 345 (2021) 109550

Fig. 2. Effects of PS-MPs exposure on reactive oxygen species (a); lipid peroxidation (b); catalase (c); superoxide dismutase (d); glutathione peroxidise (e); gluta­
thione s-transferase (f); alkaline phosphatase (g); lactate dehydrogenase (h); acetylcholinesterase (i) level in the gills of Danio rerio over 35 d exposure. Values are
expressed as ± SEM. P < 0.05 - statistically significant (*P < 0.05, **P < 0.01, and ***P < 0.001) and P > 0.05 - not significant (#).

lesions increased with increase in time causing lamellar fusion after 35
d of PS-MPs exposure in the lower dose group (Fig. 4d). Similarly, fish
exposed to higher dose (100 μg L− 1) exhibited abnormal gill histo­
morphology such as disrupted lamellar structures, aneurysms, epithelial
lifting of cells and also exhibited increased necrotic zones after 7d and
35d of PS-MPs exposure in a dosage and duration dependent manner
(Fig. 4e and f).
4. Discussion
The presence of plastics in the marine and freshwater ecosystem is a
serious environmental concern throughout the world [1,45,66]. Inges­
tion of MPs by aquatic organisms may accumulate and cause adverse
effects such as oxidative stress, inhibition of growth and development,
neurotransmission malfunction, endocrine disruption, immunological
disorders etc., [26,35,67]. However, data on the MPs-induced physio­
logical responses via apoptosis signaling pathway in freshwater fish is
very limited. Therefore, the present study illustrates the mechanistic
pathway of ROS induced toxicity on the modulation of transcriptional
pattern of cytoprotective and apoptosis-related genes in PS-MPs exposed
zebrafish.
In general, three different processes in the cell generate ROS when

5
S. Umamaheswari et al.
Fig. 3. Effects of PS-MPs exposure on the transcription of cat (a); sod1 (b); gpx1a (c); gstp1 (d); ache (e); tnfa (f); p53 (g); casp3b (h); gadd45ba (i); ptgs2a (j) genes in
the gills of Danio rerio over 35 d exposure. Values are expressed as ± SEM. P < 0.05 - statistically significant (*P < 0.05, **P < 0.01, and ***P < 0.001) and P > 0.05
- not significant (#).
exposed to any stress/or under normal conditions. The former one is the
production of ROS from mitochondrial respiratory chain whereas the
second involves the NADPH oxidases (NOX)-mediated ROS release. The
latter one is the production of ROS from several enzymatic (cytochrome
P450, cyclooxygenases, heme oxygenase, lipoxygenases, myeloperox­
idases, monoamine oxidases, and xanthine oxidizes) reactions [68].
Besides the production of ROS from aforementioned sources, cytokines
and growth promoters hitch to different classes of receptors leading to
the generation of ROS that acts as second messengers in various
signaling pathways [42,69].
Among different classes of receptors, TNFRSF (tumor necrosis factor
super family) is a super family of cytokine receptors that bind to tumor
necrosis factor (TNF) regulating various cellular processes such as cell
survival, growth, multiplication, differentiation, ageing, and death [70,
71]. The fish exposed to PS-MPs exhibited increased tnfa expression and
ROS levels indicating the occurrence of tnfa induced ROS generation. Gu
et al. [72] and Qiang and Cheng [46] recently reported the elevated ROS
levels in the larvae and gonads of PS-MPs treated Danio rerio. However,
very few studies have reported on the tnfa mediated ROS activity in
PS-MPs induced toxicity.
The increased ROS levels and the upregulation of tnfa gene in PS-MPs
groups in our study manifest the correlation between the ROS and tnfa
levels. This corroborates with the findings of Choi et al. [5] on MPs
treated Cyprinodon variegatus. The generated ROS oxidizes the lipids,
proteins, and DNA affecting the metabolic pathways [73]. Li et al. [15]
recorded an interdependent response of ROS and LPO levels in the
PS-NPs exposed Macrobrachium nipponense, lending support to our study.
In this line, Huang et al. [66] recorded an increase of ROS and LPO level
in micro-PS exposed marine mussels. Dimitriadi et al. [26] observed a
significant increase of lipid peroxidation in heart of zebrafish upon
exposure to PS-MPs. Similarly, changes in the expression of genes
6
Chemico-Biological Interactions 345 (2021) 109550
related to ROS production has been reported [51]. The increased LPO
levels in our study might attribute to the formation of DNA adducts
(MDA (Malondialdehyde) and HNE (4-Hydroxynonenal)) inducing
epigenetic modifications and cell death [74].
Exposure to PS-MPs has influenced the antioxidant defense mecha­
nism in zebrafish. The antioxidant defense system is an array of anti­
oxidants such as SOD, CAT, GPx, GSH, and GST involved in the
neutralization of free radicals [75]. In our study, the activities of CAT
and SOD showed depletion in the PS-MPs group compared to the con­
trol. Akin to the enzyme activity, the cat and sod1 gene likely to
downregulate in the PS-MPs group in a time- and dose-independent
manner. Similar results were observed in Eriocheir sinensis and Macro­
brachium nipponense [15,47]. In addition, GPx activity was significantly
reduced in PS-MPs treated groups which corroborates with the
decreased mRNA levels of gpx1a observed in PS-MPs exposed zebrafish.
Meanwhile GST, the phase II antioxidant enzyme showed an elevated
response in PS-MPs groups indicating the increased catalytic process of
GST in phase II detoxification process. The gstp1 gene also exhibited a
time-and dose-dependent upregulation in PS-MPs groups substantiating
the observed enzyme response. Similar results were observed in PS-NPs
exposed Daphnia pulex and PS-MPs exposed Poecilia reticulate [76,77].
Up-regulation of the expression of antioxidant has also been docu­
mented in response to the ROS induced by microplastics [50,54].
Oxidative stress is closely associated with the inflammation process
and the stimulation of any of this process might induce the other [78].
Several inflammatory responses like disrupted lamellar structures,
epithelial lifting, lamellar fusion, capillary dilation, and necrosis were
observed in the gill histomaps of PS-MPs exposed fishes. The
up-regulated transcription pattern of inflammation marker genes tnfa,
and ptgs2a, suggest the stimulation of immune defense mechanism
against PS-MPs induced oxidative stress, producing inflammatory
S. Umamaheswari et al. Chemico-Biological Interactions 345 (2021) 109550

Fig. 4. Histomaps of gill tissue. a) Normal histology of gill tissue - control group (7th day). b) Normal histology of gill tissue - control group (35th day). c) PS-MPs
group - 10 μg L− 1 (7th day). d) PS-MPs group - 10 μg L− 1 (35th day). e) PS-MPs group - 100 μg L− 1 (7th day). f) PS-MPs group - 100 μg L− 1 (35th day). CD -
cytoplasmic degeneration, AM - aneurysm, NC - necrotic cells, LF - Lamellar fusion, EL - epithelial lifting; Scale bar - 400 μm. Insets (scale bar – 100 μm).

responses in the fish. Similarly, study of Wang et al. [79] and Karbalaei
et al. [80] depicted the PS-MPs induced inflammations in the gill his­
toarchitectures of Oryzias melastigma and Oncorhynchus mykiss. The po­
tential toxicity of PS-MPs depends on particle size, species, time, and
exposure systems [64]. Among these factors, the particle size determines
the toxicity of PS-MPs in an organism. The smaller the size of particle,
the greater surface area enabling easy adhesion of PS-MPs particles to
cells (blood cells, hepatic cells/epithelial cells) inducing cellular rup­
tures [37]. This leads to cell death thereby producing damaged histo­
architectures in tissues.
In the present study, the decreased AKP activity in PS-MPs groups
indicates the inhibited release of the enzyme from lysosomes of cells
[81]. In general, AKP dephosphorylates the toxic moiety of proin­
flammatory molecules that are being produced by the cells during stress
conditions. The diminished AKP activity inhibits the dephosphorylation
process causing the deposition of proinflammatory molecules in the
blood stream [82]. Further, this stimulates the immune response and the
release of proinflammatory cytokine [83]. In our study, we observed an
inhibited AKP activity with an elevated tnfa expression pattern in
PS-MPs groups providing additional evidence for the PS-MPs induced
inflammatory responses in Danio rerio. Similarly, Zhang et al. [84] re­
ported the interdependent response of tnfa and AKP activity in delta­
methrin treated Gobiocypris rarus.
Besides the observed inflammatory responses, the occurrence of
increased expression of growth arrest and DNA damage inducible gene
beta a, gadd45ba in PS-MPs treated groups reveals the genotoxic po­
tential of PS-MPs. The gene gadd45ba is associated with the regulation of
several cell cycle events such as cell survival, DNA damage repair, cell
cycle arrest, and apoptosis [85] and the increased expression of this gene
indicate the activation of apoptotic cascade in PS-MPs groups. Apoptosis
plays a crucial role in growth, regulation of tissue homeostasis, and in­
flammatory responses in all organisms [86]. The observed gadd45ba and
p53 genes upregulation might have caused apoptosis, which is evident
from the observed tissue damage in the gill histomaps of PS-MPs exposed

7
S. Umamaheswari et al. Chemico-Biological Interactions 345 (2021) 109550

zebrafish. Similarly, Cheng et al. [87] observed significant loss in DNA
integrity and upregulated transcriptional pattern of p53 in cadmium
exposed Scylla paramamosain. The gene p53 triggers the
caspase-signaling pathway through apoptosis-related molecules such as
Bcl-2/Bax, noxa or cytochrome c activation [53]. In our study, the
transcriptional pattern of casp3b in PS-MPs group shows increased ac­
tivity revealing the occurrence of apoptosis. The results of the present
study are in good agreement with Karami et al. [88] and Choi et al. [5]
showing MPs provoked DNA damage and apoptosis in Danio rerio and
Cyprinodon variegates.
LDH, a cytosolic enzyme converts pyruvic acid to lactic acid in the
anaerobic energy production process. An altered LDH response is the
indication of the xenobiotic intervention in the energy metabolism
causing cell death/injury [89]. The increased LDH levels in PS-MPs
groups indicate impaired energy production resulting in lethargic
swimming activity. Decrease in swimming speed has also been reported
in zebrafish exposed to PS microspheres [53] and in goldfish Carassius
auratus upon exposure to MPs [90]. Penetration of MPs across the
blood–brain barrier in fish may be the possible reason for the behavioral
changes [35]. The lethargic swimming pattern might also be resulted
from the inhibition of AChE activity in PS-MPs treated zebrafish. This
inhibition causes dysfunction of neurotransmitters resulting in acetyl­
choline (ACh) build up at synapses causing a jam in the cholinergic
neurotransmission [91].
Many researchers have documented the apoptotic effects of MPs in
fish [11,53,59]. However, the molecular mechanism involved in the
induction and execution of apoptosis in the tissues of PS-MPs exposed
fish has not been well characterized. Present findings shows that PS-MP
induces oxidative stress in cells by generating surplus ROS and
decreasing antioxidants production. Subsequently, disparity between
ROS generation and antioxidant defenses, causes oxidative damage in
zebrafish, and alter apoptosis-related genes expression resulting in
dysregulated physiology. Fig. 5 summarizes the molecular events trig­
gered by PS-MPs in zebrafish. We hypothesize that PS-MPs induce ROS
that affects the oxidative defense system, and neurotransmission in
zebrafish. Furthermore, ROS induction has stimulated p53 apoptotic
cascade activation producing DNA damage and inflammatory responses
that were evident from the gill histomaps of zebrafish.
5. Conclusion
Taken together, it is evident that p53 apoptotic pathway induction
and enzymes dysregulation are responsible for the various physiological
responses in PS-MPs treated zebrafish. In addition, several genes
involved in cytoprotection and inflammatory responses were also found
to be dysregulated. The current study provides us with insights into the
toxic mechanism of PS-MPs to induce apoptosis in zebrafish and further
research on PS-MPs intervention in metabolic pathways could be
studied.
CRediT authorship contribution statement
Sathisaran Umamaheswari: Conceptual framework, Resources,
Experiments, Investigation, Data curation, Original manuscript writing.

Fig. 5. Mechanism of PS-MPs induced apoptosis in zebrafish: In general, PS-MPs or the unbound styrene (which forms SO (styrene oxide) later) enter the cell and
are detoxified by the action of cytp450, GSH and GST enzymes. This mitochondrial detoxification results in ROS generation, which stimulates LPO with the release of
MDA and HNE. This leads to the formation of DNA adducts causing cell death. Furthermore, the produced ROS upregulates the transcription of p53 gene which in
turn switches on the casp3b activation. The activated casp3b promotes the transcription of gadd45ba resulting in DNA damage and apoptosis. This results in tissue
damage causing increased expression of ptgs2a and tnfa with the release of LDH enzymes. On the other hand, the produced ROS downregulates the expression of
cytoprotective genes such as cat, sod1, gpx1a and upregulates the expression of detoxification gene gstp1, thereby influencing the translation of antioxidants.

8
S. Umamaheswari et al. Chemico-Biological Interactions 345 (2021) 109550

Sheela Priyadarshinee: Experiments, Investigation, Formal analysis. the Scientific Aspects of Marine Environmental Protection, 2016. London, https://e
c.europa.eu/environment/marine/good-environmental-status/descriptor-10/pdf/
Krishna Kadirvelu: Resources, Visualization, Investigation. Mathan
GESAMP_microplastics%20full%20study.pdf. (Accessed February 2021).
Ramesh: Conceptual framework, Supervision, Resources, Writing – re­ [18] T.A. Farrelly, I.C. Shaw, Polystyrene as Hazardous Household Waste, Household
view & editing. hazardous waste management, 2017.
[19] J.O. Choi, F. Jitsunari, F. Asakawa, D. Sun Lee, Migration of styrene monomer,
dimers and trimers from polystyrene to food simulants, Food Addit. Contam. 22
Declaration of competing interest (2005) 693–699.
[20] S.T. Rabie, A.M. Mahran, E.M. Kamel, N.H. Abdel Hamid, Photodegradation of
polystyrene stabilized with uracil derivative, J. Appl. Sci. Res. 4 (2008)
The authors declare that they have no known competing financial
2015–2026.
interests or personal relationships that could have appeared to influence [21] A.E. Hagan, C.A. Farrington, G.C. Wall, M.M. Belz, Sodium polystyrene sulfonate
the work reported in this paper. for the treatment of acute hyperkalemia: a retrospective study, Clin. Nephrol. 85
(2016) 38–43.
[22] B. Díez-Buitrago, F.J. Fernández-SanArgimiro, J. Lorenzo, N. Briz, V. Pavlov,
Acknowledgment Modification of chlorosulfonated polystyrene substrates for bioanalytical
applications, Mater. Sci. Eng. C 112 (2020), 110912.
We thank the Director, DRDO-BU Center for Life Sciences, Bharathiar [23] International Agency for Research on Cancer, IARC) - IARC Monographs on the
Evaluation of Carcinogenic Risks to Humans: Overall Evaluations of
University Campus Coimbatore, India for providing laboratory and Carcinogenicity: an Updating of IARC Monographs Volumes 1-42, Supplement 7,
instrumentation facilities. vol. 440, IARC, Lyon, 1987, ISBN 92 832 14110.
[24] D.E. Till, D.J. Ehntholt, R.C. Reid, P.S. Schwartz, A.D. Schwopc, R.R. Sidman, R.
H. Whelan, Migration of styrene monomer from crystal polystyrene to food and
Appendix A. Supplementary data food simulating liquid, Ind. Eng. Chem. Prod. Res. Dev. 21 (1982) 161–185.
[25] Z. Pilevar, A. Bahrami, S. Beikzadeh, H. Hosseini, S.M. Jafari, Migration of styrene
Supplementary data to this article can be found online at https://doi. monomer from polystyrene packaging materials into foods: characterization and
safety evaluation, Trends Food Sci. Technol. 91 (2019) 248–261.
org/10.1016/j.cbi.2021.109550. [26] A. Dimitriadi, C. Papaefthimiou, E. Genizegkini, I. Sampsonidis, S. Kalogiannis,
K. Feidantsis, D.C. Bobori, G. Kastrinaki, G. Koumoundouros, D.A. Lambropoulou,
References G.Z. Kyzas, Adverse effects polystyrene microplastics exert on zebrafish heart-
molecular to individual level, J. Hazard Mater. (2021), 125969.
[27] L.C. deSá, M. Oliveira, F. Ribeiro, T.L. Rocha, M.N. Futter, Studies of the effects of
[1] A. Jahnke, H.P.H. Arp, B.I. Escher, B. Gewert, E. Gorokhova, D. Kühnel,
microplastics on aquatic organisms: what do we know and where should we focus
M. Ogonowski, A. Potthoff, C. Rummel, M. Schmitt-Jansen, E. Toorman,
our efforts in the future? Sci. Total Environ. 645 (2018) 1029–1039.
M. MacLeod, Reducing uncertainty and confronting ignorance about the possible
[28] K. Enders, R. Lenz, C.A. Stedmon, T.G. Nielsen, Abundance, size and polymer
impacts of weathering plastic in the marine environment, Environ. Sci. Technol.
composition of marine microplastics ≥ 10μm in the Atlantic Ocean and their
Lett. 4 (2017) 85–90.
modelled vertical distribution, Mar. Pollut. Bull. 100 (2015) 70–81.
[2] T. Kögel, Ø. Bjorøy, B. Toto, A.M. Bienfait, M. Sanden, Micro- and nanoplastic
[29] M. Carbery, W. O’Connor, T. Palanisami, Trophic transfer of microplastics and
toxicity on aquatic life: determining factors, Sci. Total Environ. 709 (2020),
mixed contaminants in the marine food web and implications for human health,
136050.
Environ. Int. 115 (2018) 400–409.
[3] J.R. Jambeck, R. Geyer, C. Wilcox, T.R. Siegler, M. Perryman, A. Andrady,
[30] A. Elizalde-Velázquez, A.M. Carcano, J. Crago, M.J. Green, S.A. Shah, J.E. Cañas-
R. Narayan, K.L. Law, Marine pollution: plastic waste inputs from land into the
Carrell, Translocation, trophic transfer, accumulation and depuration of
ocean, Science 347 (2015) 768–771.
polystyrene microplastics in Daphnia magna and Pimephales promelas, Environ.
[4] L. Lei, S. Wu, S. Lu, M. Liu, Y. Song, Z.H. Fu, Shi, K.M. Raley-Susman, D. He,
Pollut. 259 (2020), 113937.
Microplastic particles cause intestinal damage and other adverse effects in
[31] F. Du, H. Cai, Q. Zhang, Q. Chen, H. Shi, Microplastics in take-out food containers,
zebrafish Danio rerio and nematode Caenorhabditis elegans, Sci. Total Environ.
J. Hazard Mater. 399 (2020), 122969.
619–620 (2018) 1–8.
[32] M. Revel, A. Chatel, C. Mouneyrac, Micro (nano) plastics: a threat to human
[5] J.S. Choi, Y.J. Jung, N.H. Hong, S.H. Hong, J.W. Park, Toxicological effects of
health? Curr Opin Environ Sci Health 1 (2018) 17–23.
irregularly shaped and spherical microplastics in a marine teleost, the sheepshead
[33] C.M. Rochman, A. Tahir, S.L. Williams, D.V. Baxa, R. Lam, J.T. Miller, F.C. Teh,
minnow (Cyprinodon variegatus), Mar. Pollut. Bull. 129 (2018) 231–240.
S. Werorilangi, S.J. Teh, Anthropogenic debris in seafood: plastic debris and fibers
[6] M. Cole, C. Liddle, G. Consolandi, C. Drago, C. Hird, P.K. Lindeque, TS.
from textiles in fish and bivalves sold for human consumption, Sci. Rep. 5 (2015),
Galloway Microplastics, Microfibres and nanoplastics cause variable sub-lethal
14340.
responses in mussels (Mytilus spp.), Mar. Pollut. Bull. 160 (2020), 111552.
[34] J. Hwang, D. Choi, S. Han, S.Y. Jung, J. Choi, J. Hong, Potential toxicity of
[7] M. Karamanlioglu, R. Preziosi, G.D. Robson, Abiotic and biotic environmental
polystyrene microplastic particles, Sci. Rep. 10 (2020) 7391.
degradation of the bioplastic polymer poly (lactic acid): a review, Polym. Degrad.
[35] Y. Lu, Y. Zhang, Y. Deng, W. Jiang, Y. Zhao, J. Geng, L. Ding, H. Ren, Uptake and
Stabil. 137 (2017) 122–130.
accumulation of polystyrene microplastics in zebrafish (Danio rerio) and toxic
[8] X. Zhang, X. Wang, B. Yan, Single and combined effects of phenanthrene and
effects in liver, Environ. Sci. Technol. 50 (2016) 4054–4060.
polystyrene microplastics on oxidative stress of the clam (Mactra veneriformis), Sci.
[36] L. Yin, H. Liu, H. Cui, B. Chen, L. Li, F. Wu, Impacts of polystyrene microplastics on
Total Environ. 771 (2021), 144728.
the behavior and metabolism in a marine demersal teleost, black rockfish (Sebastes
[9] S. Klein, I.K. Dimzon, J. Eubeler, T.P. Knepper, Analysis, occurrence, and
schlegelii), J. Hazard Mater. 380 (2019), 120861.
degradation of microplastics in the aqueous environment, in: M. Wagner,
[37] J.H. Kim, Y.B. Yu, J.H. Choi, Toxic effects on bioaccumulation, hematological
S. Lambert (Eds.), Freshwater Microplastics. The Handbook of Environmental
parameters, oxidative stress, immune responses and neurotoxicity in fish exposed
Chemistry, 2018.
to microplastics, A Rev. J. Hazard Mater (2021), 125423.
[10] J.M. Pereira, Y. Rodríguez, S. Blasco-Monleon, A. Porter, C.K. Pham, C.
[38] N.R. Brun, P. van Hage, E.R. Hunting, A.G. Haramis, S.C. Vink, M.G. Vijver,
K. Microplastic, In the stomachs of open-ocean and deep-sea fishes of the North-
M. Schaaf, C. Tudorache, Polystyrene nanoplastics disrupt glucose metabolism and
East Atlantic, Environ. Pollut. 265 (2020), 115060.
cortisol levels with a possible link to behavioural changes in larval zebrafish,
[11] M.A. Browne, S.J. Niven, T.S. Galloway, S.J. Rowland, R.C. Thompson,
Commun Biol 2 (2019) 382.
Microplastic moves pollutants and additives to worms, reducing functions linked to
[39] Q. Chen, M. Gundlach, S. Yang, J. Jiang, M. Velki, D. Yin, H. Hollert, Quantitative
health and biodiversity, Curr. Biol. 23 (2013) 2388–2392.
investigation of the mechanisms of microplastics and nanoplastics toward zebrafish
[12] S. Lambert, C.J. Sinclair, E.L. Bradley, A.B.A. Boxall, Effects of environmental
larvae locomotor activity, Sci. Total Environ. 584–585 (2017) 1022–1031.
conditions on latex dergadation in aquatic systems, Sci. Total Environ. 447 (2013)
[40] Y.S. Eltemsah, T. Bøhn, Acute and chronic effects of polystyrene microplastics on
225–234.
juvenile and adult Daphnia magna, Environ. Pollut. 254 (2019), 112919.
[13] N.P. Ivleva, A.C. Wiesheu, R. Niessner, Microplastic in aquatic ecosystems, Angew.
[41] W. Wang, J. Ge, X. Yu, Bioavailability and toxicity of microplastics to fish species: a
Chem. Int. Ed. 56 (2017) 1720–1739.
review, Ecotoxicol. Environ. Saf. 189 (2020), 109913.
[14] K. Zhang, A.H. Hamidian, A. Tubi, Y. Zhang, J.K.H. Fang, C. Wu, P.K.S. Lam,
[42] W. Gu, S. Liu, L. Chen, Y. Liu, C. Gu, H.Q. Ren, B. Wu, Single-cell RNA sequencing
Understanding plastic degradation and microplastic formation in the environment:
reveals size-dependent effects of polystyrene microplastics on immune and
a review, Environ. Pollut. 274 (2021), 116554.
secretory cell populations from zebrafish intestines, Environ. Sci. Technol. 54 (6)
[15] Y. Li, Z. Liu, M. Li, Q. Jiang, D. Wu, Y. Huang, Y. Jiao, M. Zhang, Y. Zhao, Effects of
(2020) 3417–3427.
nanoplastics on antioxidant and immune enzyme activities and related gene
[43] C.B. Jeong, H.M. Kang, M.C. Lee, D.H. Kim, J. Han, D.S. Hwang, S. Souissi, S.J. Lee,
expression in juvenile Macrobrachium nipponense, J. Hazard Mater. 398 (2020),
K.H. Shin, H.G. Park, J.S. Lee, Adverse effects of microplastics and oxidative stress-
122990.
induced MAPK/Nrf2 pathway-mediated defense mechanisms in the marine
[16] C.G. Alimba, C. Faggio, Microplastics in the marine environment: current trends in
copepod Paracyclopina nana, Sci. Rep. 7 (2017), 41323.
environmental pollution and mechanisms of toxicological profile, Environ. Toxicol.
[44] K. Yin, Y. Wang, H. Zhao, D. Wang, M. Guo, M. Mu, Y. Liu, X. Nie, B. Li, J. Li,
Pharmacol. 68 (2019) 61–74.
M. Xing, A comparative review of microplastics and nanoplastics: toxicity hazards
[17] Sources, fate and effects of microplastics in the marine environment: part two of a
on digestive, reproductive and nervous system, Sci. Total Environ. (2021), 145758.
global assessment 93, IMO/FAO/UNESCO-IOC/UNIDO/WMO/IAEA/UN/UNEP/
UNDP, in: GESAMP, P.J. Kershaw, C.M. Rochman (Eds.), Joint Group of Experts on

9
S. Umamaheswari et al.
[45] G.Y. Liou, P. Storz, Reactive oxygen species in cancer, Free Radic. Res. 44 (5)
(2010) 479–496.
[46] L. Qiang, J. Cheng, Exposure to polystyrene microplastics impairs gonads of
zebrafish (Danio rerio), Chemosphere 263 (2021), 12816.
[47] P. Yu, Z. Liu, D. Wu, V. Chen, W. Lv, Y. Zhao, Accumulation of polystyrene
microplastics in juvenile Eriocheir sinensis and oxidative stress effects in the liver,
Aquat. Toxicol. 200 (2018) 28–36.
[48] J. Li, H. Liu, J. Paul Chen, Microplastics in freshwater systems: a review on
occurrence, environmental effects, and methods for microplastics detection, Water
Res. 137 (2018) 362–374.
[49] X. Zhai, L. Wang, C. Xu, Q. Hou, L. Zhang, Z. Li, W. Qin, Z. Liu, Z. Chen, Triptolide
preserves glomerular barrier function via the inhibition of p53-mediated increase
of GADD45B, Arch. Biochem. Biophys. 671 (2019) 210–217.
[50] S. Park, J.Y. Lee, H. Park, G. Song, W. Lim, Bifenthrin induces developmental
immunotoxicity and vascular malformation during zebrafish embryogenesis,
Comp. Biochem. Physiol. C Toxicol. Pharmacol. 228 (2020), 108671.
[51] J.M. Salvador, J.D. Brown-Clay, A.J. Fornace Jr., Gadd45 in stress signaling, cell
cycle control, and apoptosis, Adv. Exp. Med. Biol. 793 (2013) 1–19.
[52] I. Paul-Pont, C. Lacroix, C. González Fernández, H. Hégaret, C. Lambert, N. Le Goïc,
L. Frère, A.L. Cassone, R. Sussarellu, C. Fabioux, J. Guyomarch, M. Albentosa,
A. Huvet, P. Soudant, Exposure of marine mussels Mytilus spp. to polystyrene
microplastics: toxicity and influence on fluoranthene bioaccumulation, Environ.
Pollut. 216 (2016) 724–737.
[53] S. Sarmah, J.A. Marrs, Zebrafish as a vertebrate model system to evaluate effects of
environmental toxicants on cardiac development and function, Int. J. Mol. Sci. 17
(2016) 2123.
[54] J. Bhagat, L. Zang, N. Nishimura, Y. Shimada Zebrafish, An emerging model to
study microplastic and nanoplastic toxicity, Sci. Total Environ. 728 (2020) 138707.
[55] OECD, Organisation for Economic Co-operation and Development, Guidelines for
Testing of Chemicals No 305: Bioconcentration: Flow-Through Fish Test, 1996.
Paris.
[56] APHA, Standard methods for the examination of water and wastewater, Stand.
Methods (2005) 541.
[57] J. Ding, S. Zhang, R.M. Razanajatovo, H. Zou, W. Zhu, Accumulation, tissue
distribution, and biochemical effects of polystyrene microplastics in the freshwater
fish red tilapia (Oreochromis niloticus), Environ. Pollut. 238 (2018) 1–9.
[58] X. Zhao, S. Wang, Y. Wu, H. You, L. Lv, Acute ZnO nanoparticles exposure induces
developmental toxicity, oxidative stress and DNA damage in embryo-larval
zebrafish, Aquat. Toxicol. 136–137 (2013) 49–59.
[59] J.A. Adeyemi, A.da Cunha Martins, F. Barbosa, Teratogenicity, genotoxicity and
oxidative stress in zebrafish embryos (Danio rerio) co-exposed to arsenic and
atrazine, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 172–173 (2015) 7–12.
[60] A.K. Sinha, Colorimetric assay of catalase, Anal. Biochem. 47 (2) (1972) 389–394.
[61] S. Marklund, G. Marklund, Involvement of the superoxide anion radical in the
autoxidation of pyrogallol and a convenient assay for superoxide dismutase, Eur. J.
Biochem. 47 (3) (1974) 469–474.
[62] I. Domingues, R. Oliveira, J. Lourenço, C.K. Grisolia, S. Mendo, A.M. Soares,
Biomarkers as a tool to assess effects of chromium (VI): comparison of responses in
zebrafish early life stages and adults, Comp. Biochem. Physiol. C Toxicol.
Pharmacol. 152 (3) (2010) 338–345.
[63] G.L. Ellman, K.D. Courtney, V. Andres Jr., R.M. Feather-stone, A new and rapid
colorimetric determination of acetylcholinesterase activity, Biochem. Pharmacol. 7
(1961) 88–95.
[64] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25 (4) (2001)
402–408.
[65] M. Teng, S. Qi, W. Zhu, Y. Wang, D. Wang, K. Dong, C. Wang, Effects of the
bioconcentration and parental transfer of environmentally relevant concentrations
of difenoconazole on endocrine disruption in zebrafish (Danio rerio), Environ.
Pollut. 233 (2018) 208–217.
[66] W. Huang, X. Wang, D. Chen, E.G. Xu, X. Luo, J. Zeng, T. Huan, L. Li, Y. Wang,
Toxicity mechanisms of polystyrene microplastics in marine mussels revealed by
high-coverage quantitative metabolomics using chemical isotope labeling liquid
chromatography mass spectrometry, J. Hazard Mater. 417 (2021), 126003.
[67] M. Sharifinia, Z.A. Bahmanbeigloo, M. Keshavarzifard, M.H. Khanjani, B.P. Lyons,
Microplastic pollution as a grand challenge in marine research: a closer look at
their adverse impacts on the immune and reproductive systems, Ecotoxicol.
Environ. Saf. 204 (2020), 111109.
[68] M.J. Morgan, Y.S. Kim, Z.G. Liu, TNF alpha and reactive oxygen species in necrotic
cell death, Cell Res. 18 (3) (2008) 343–349.
[69] H. Sauer, M. Wartenberg, J. Hescheler, Reactive oxygen species as intracellular
messengers during cell growth and differentiation, Cell. Physiol. Biochem. 11
(2001) 173–186.
10
Chemico-Biological Interactions 345 (2021) 109550
[70] D.W. Banner, A. D’Arcy, W. Janes, R. Gentz, H.J. Schoenfeld, C. Broger,
H. Loetscher, W. Lesslauer, Crystal structure of the soluble human 55 kd TNF
receptor-human TNF beta complex: implications for TNF receptor activation, Cell
73 (1993) 431–445.
[71] R.M. Locksley, N. Killeen, M.J. Lenardo, The TNF and TNF receptor superfamilies:
integrating mammalian biology, Cell 104 (2001) 487–501.
[72] L. Gu, L. Tian, G. Gao, S. Peng, J. Zhang, D. Wu, J. Huang, Q. Hua, T. Lu, L. Zhong,
Z. Fu, X. Pan, H. Qian, L. Sun, Inhibitory effects of polystyrene microplastics on
caudal fin regeneration in zebrafish larvae, Environ. Pollut. 266 (2020), 114664.
[73] W. Czarnocka, S. Karpiński, Friend or foe? Reactive oxygen species production,
scavenging and signaling in plant response to environmental stresses, Free Radic.
Biol. Med. 122 (2018) 4–20.
[74] K. Linhart, H. Bartsch, H.K. Seitz, The role of reactive oxygen species (ROS) and
cytochrome P-450 2E1 in the generation of carcinogenic etheno-DNA adducts,
Redox Biol 3 (2014) 56–62.
[75] S. Abarghouei, A. Hedayati, M. Raeisi, B.S. Hadavand, H. Rezaei, A. Abed-
Elmdoust, Size-dependent effects of microplastic on uptake, immune system,
related gene expression and histopathology of goldfish (Carassius auratus),
Chemosphere 276 (2021), 129977.
[76] Z. Liu, P. Yu, M. Cai, D. Wu, M. Zhang, Y. Huang, Y. Zhao, Polystyrene nanoplastic
exposure induces immobilization, reproduction, and stress defense in the
freshwater cladoceran Daphnia pulex, Chemosphere 215 (2019) 74–81.
[77] J.N. Huang, B. Wen, J.G. Zhu, Y.S. Zhang, J.Z. Gao, Z.Z. Chen, Exposure to
microplastics impairs digestive performance, stimulates immune response and
induces microbiota dysbiosis in the gut of juvenile guppy (Poecilia reticulata), Sci.
Total Environ. 733 (2020), 138929.
[78] K. Lu, R. Qiao, H. An, Y. Zhang, Influence of microplastics on the accumulation and
727 chronic toxic effects of cadmium in zebrafish (Danio rerio), Chemosphere 728
202 (2018) 514–520.
[79] J. Wang, Y. Li, L. Lu, M. Zheng, X. Zhang, H. Tian, W. Wang, S. Ru, Polystyrene
microplastics cause tissue damages, sex-specific reproductive disruption and
transgenerational effects in marine medaka (Oryzias melastigma), Environ. Pollut.
254 (2019), 113024.
[80] S. Karbalaei, P. Hanachi, G. Rafiee, P. Seifori, T.R. Walker, Toxicity of polystyrene
microplastics on juvenile Oncorhynchus mykiss (rainbow trout) after individual and
combined exposure with chlorpyrifos, J. Hazard Mater. 403 (2021), 123980.
[81] M. Qiu, Y. Wang, X. Wang, L. Sun, R. Ye, D. Xu, Z. Dai, Y. Liu, S. Bi, Y. Yao,
R. Gooneratne, Effects of T-2 toxin on growth, immune function and
hepatopancreas microstructure of shrimp (Litopenaeus vannamei), Aquaculture 462
(2016) 35, 39.
[82] J. Bilski, A. Mazur-Bialy, D. Wojcik, J. Zahradnik-Bilska, B. Brzozowski,
M. Magierowski, T. Mach, K. Magierowska, T. Brzozowski, The role of intestinal
alkaline phosphatase in inflammatory disorders of gastrointestinal tract, Mediat.
Inflamm. 2017 (2017), 9074601.
[83] M.L. Rodgers, R. Takeshita, R.J. Griffitt, Deepwater Horizon oil alone and in
conjunction with Vibrio anguillarum exposure modulates immune response and
growth in red snapper (Lutjanus campechanus), Aquat. Toxicol. 204 (2018) 91–99.
[84] L. Zhang, X. Hong, X. Zhao, S. Yan, X. Ma, J. Zha, Exposure to environmentally
relevant concentrations of deltamethrin renders the Chinese rare minnow
(Gobiocypris rarus) vulnerable to Pseudomonas fluorescens infection, Sci. Total
Environ. 715 (2020), 136943.
[85] B. Hoffman, D.A. Liebermann, Gadd45 modulation of intrinsic and extrinsic stress
responses in myeloid cells, J. Cell. Physiol. 218 (1) (2009) 26–31.
[86] P.M. Eimon, A. Ashkenazi, The zebrafish as a model organism for the study of
apoptosis, Apoptosis 15 (3) (2010) 331–349.
[87] C.H. Cheng, H.L. Ma, Y.Q. Deng, J. Feng, Y.K. Jie, Z.X. Guo, Oxidative stress, cell
cycle arrest, DNA damage and apoptosis in the mud crab (Scylla paramamosain)
induced by cadmium exposure, Chemosphere 263 (2021), 128277.
[88] A. Karami, D.B. Groman, S.P. Wilson, P. Ismail, V.K. Neela, Biomarker responses in
zebrafish (Danio rerio) larvae exposed to pristine low-density polyethylene
fragments, Environ. Pollut. 223 (2017) 466–475.
[89] V.V. Husak, N.M. Mosiichuk, I.V. Maksymiv, I.Y. Sluchyk, J.M. Storey, K.B. Storey,
V.I. Lushchak, Histopathological and biochemical changes in goldfish kidney due
to exposure to the herbicide Sencor may be related to induction of oxidative stress,
768, Aquat Toxicol 155 (2014) 181–189.
[90] H. Yang, H. Xiong, K. Mi, W. Xue, W. Wei, Y. Zhang, Toxicity comparison of nano-
sized and micron-sized microplastics to goldfish Carassius auratus Larvae, J. Hazard
Mater. 388 (2020), 122058.
[91] M.B. Colović, Z. Krstić, T.D. Lazarević-Pašti, A.M. Bondžić, V.M. Vasić,
Acetylcholinesterase inhibitors: pharmacology and toxicology, Curr.
Neuropharmacol. 11 (3) (2013) 315–335.