European Journal of Pharmaceutical Sciences 145 (2020) 105235

Contents lists available at ScienceDirect

European Journal of Pharmaceutical Sciences

journal homepage: www.elsevier.com/locate/ejps

Gold nanoparticles promote a multimodal synergistic cancer therapy T

strategy by co-delivery of thermo-chemo-radio therapy
Zahra Alamzadeha,b, Jaber Beika,b, Mehraban Mirrahimic, Ali Shakeri-Zadeha,b,
⁎
Fatemeh Ebrahimid, Ali Komeilie, Behafarid Ghalandarie, Habib Ghaznavif, ,
⁎⁎
S. Kamran Kamravae, , Christos Moustakisg
a
Finetech in Medicine Research Center, Iran University of Medical Sciences (IUMS), Tehran, Iran
b
Medical Physics Department, School of Medicine, Iran University of Medical Sciences (IUMS), Tehran, Iran
c
Biology Department, School of Science, Tehran University of Medical Sciences (TUMS), Tehran, Iran
d
Department of Radiotherapy, University Hospital Cologne, Cologne, Germany
e
Applied Biophotonics Research Center, Science and Research Branch, Islamic Azad University, Tehran, Iran
f
Zahedan University of Medical Sciences (ZaUMS), Zahedan, Iran
g
Department of Radiation Oncology, University Hospital of Muenster, Muenster, Germany

A R T I C LE I N FO A B S T R A C T

Keywords: Multimodal cancer therapy has become a new trend in clinical oncology due to potential generation of sy-
Multimodal therapy nergistic therapeutic effects. Herein, we propose a multifunctional nanoplatform comprising alginate hydrogel
Photothermal therapy co-loaded with cisplatin and gold nanoparticles (abbreviated as ACA) for triple combination of photothermal
Chemotherapy therapy, chemotherapy and radiotherapy (thermo-chemo-radio therapy). The therapeutic potential of ACA was
Radiotherapy
assessed in combination with 532 nm laser and 6 MV X-ray against KB human mouth epidermal carcinoma cells.
Gold nanoparticles
The results demonstrated that tri-modal thermo-chemo-radio therapy using ACA induced a superior anticancer
efficacy than mono- or bi-modality treatments. The intracellular reactive oxygen species (ROS) level in KB cells
treated with tri-modal therapy was increased by 4.4-fold compared to untreated cells. The gene expression
analysis demonstrated the up-regulation of Bax pro-apoptotic factor (by 4.5-fold) and the down-regulation of
Bcl-2 anti-apoptotic factor (by 0.3-fold). The massive cell injury and the appearance of morphological char-
acteristics of apoptosis were also evident in the micrograph of KB cells caused by thermo-chemo-radio therapy.
Therefore, ACA nanocomplex can be offered as a promising platform to combine photothermal therapy, che-
motherapy and radiotherapy, thereby affording an opportunity for combating chemo- and radio-resistant tu-
mors.

1. Introduction (Gottesman et al., 2002; Moeller et al., 2007).

Chemotherapy and radiotherapy are the two major cancer therapy
modalities that have shown profound impact on improving the five-year
survival rate of cancer patients. Despite the ever-increasing progress in
design and application of novel anticancer agents and remarkable
technical advances in radiation delivery equipment, chemotherapy and
radiotherapy are not able to ensure complete cure and often fail due to
the occurrence of tumor relapse or metastasis. The severe systemic
toxicity to the patients and chemoresistance of tumor cells are the
major problems of chemotherapy. On the other hand, radioresistance
nature of hypoxic tumors limits the effectiveness of radiotherapy
Thermal therapy has been proposed as a promising adjuvant
therapy to potentiate the cytotoxic effect of chemotherapy and radio-
therapy (Chicheł et al., 2007; Wang et al., 2017). In this regard, many
clinical experiments have employed thermal therapy in combination
with chemotherapy and radiotherapy for cancer management and de-
monstrated beneficiary therapeutic outcomes such as improved local
tumor control and overall survival (Wust et al., 2002). Considering the
synergy of heat, drug and radiation, a tri-modal combination therapy,
termed as thermo-chemo-radio therapy, can be established with the
potential to provide an opportunity for combating chemo- and radio-
resistant tumors. However, thermo-chemo-radio therapy in traditional

⁎
Corresponding author.
⁎⁎
Co-corresponding author.
E-mail addresses: dr.ghaznavi@zaums.ac.ir (H. Ghaznavi), skkamrava@gmail.com (S.K. Kamrava).

https://doi.org/10.1016/j.ejps.2020.105235
Received 27 November 2019; Received in revised form 16 January 2020; Accepted 22 January 2020
Available online 25 January 2020
0928-0987/ © 2020 Elsevier B.V. All rights reserved.
Z. Alamzadeh, et al.
administration form imparts additional toxicity to the patients, thus
making the combination of these modalities challenging in clinic
(Beik et al., 2019b).
Gold nanoparticles (AuNPs) have emerged as a promising platform
in nanomedicine capable of integrating multiple therapeutic and diag-
nostic functions (Beik et al., 2018; Fan et al., 2017; Mieszawska et al.,
2013; Yang et al., 2015). The bioinert and nontoxic properties, facile
and tunable preparation and easy surface modification make AuNPs a
potentially ideal drug delivery scaffold (Ghosh et al., 2008). Moreover,
like other nanocarriers, AuNPs could benefit from immature structure
of tumor vasculature and selectively locate at the tumor site via the
enhanced permeability and retention (EPR) effect (Maeda et al., 2000;
Peer et al., 2007). Perhaps the most well-known application of AuNPs
has been in photothermal therapy, where AuNPs absorb photon energy
and convert it into heat upon laser irradiation which is exploited for
tumor-specific thermal therapy (Abed et al., 2019; Beik et al., 2019a;
Mirrahimi et al., 2019a; Qin and Bischof, 2012). In addition, AuNPs
have been widely employed as a radiosensitizer due to their high
atomic number (Z = 79) that provides a large X-ray absorption cross-
section (Her et al., 2015). Therefore, AuNPs can improve the effec-
tiveness of radiotherapy by increasing the radiation sensitivity of the
tumor and granting the possibility of reducing the administered dose of
radiation. Taken together, the potential benefits of AuNPs in drug de-
livery, photothermal therapy and radiotherapy can realize a tri-modal
thermo-chemo-radio therapy strategy. Despite the improvement of each
individual therapy by AuNPs, one exceptional feature of this multi-
modal strategy is due to concurrent application of these modalities that
can afford an opportunity for the synergistic interactions between heat,
drug and radiation. In the current study, we prepared a nanocomplex
comprising alginate hydrogel co-loaded with cisplatin and AuNPs
(named as ACA nanocomplex) and assessed its therapeutic potential in
the presence of 532 nm laser and 6 MV X-ray against KB human mouth
epidermal carcinoma cells.
2. Materials and methods
2.1. Materials
Roswell Park Memorial Institute (RPMI) 1640 cell culture medium,
penicillin-streptomycin, trypsin-ethylene diamine tetra acetic acid
(EDTA) and fetal bovine serum (FBS) were purchased from the Sigma-
Aldrich Company (USA) and used for cell culture experiments.
Hydrogen tetrachloroaurate (III) trihydrate, ACS, 99.99% and Alginic
acid sodium salt (viscosity ≥ 2,000 cP, 2% (25 °C) (lit.)) were also
purchased from Sigma-Aldrich for nanoparticle synthesis.
2.2. Preparation and characterization of ACA
The synthesis process of ACA nanocomplex has been reported in
detail in our recent study (Alamzadeh et al., 2019). The nanocomplex
was also characterized for its morphology, size, zeta potential and
UV–visible absorption. According to characterization tests, nanocom-
plex was spherical in shape with hydrodynamic size of 44 nm and zeta
potential of −35.1 mV, and has a light absorption peak at 530 nm. The
further characterization data of the nanocomplex can be found in our
recent studies (Keshavarz et al., 2018; Mirrahimi et al., 2019a).
Table 1
Sequences of primer sets used for gene expression analysis.
Primer name Forward Oligo sequences
Bax CAAACTGGTGCTCAAGGCCC
Bcl-2 CAGGATAACGGAGGCTGGGATG
HSP70 GTGCATTGCAGTGTGCCATC
β-actin ACAGAGCCTCGCCTTTGCC
2
European Journal of Pharmaceutical Sciences 145 (2020) 105235
2.3. Cell culture
KB human mouth epidermal carcinoma cell line was obtained from
Pasteur Institute of Iran. Cells were grown as monolayers in RPMI 1640
medium with 10% FBS, 100 units/ml penicillin, and 100 µg/ml strep-
tomycin and incubated at 37 °C in 5% CO2. To harvest cells, they were
trypsinized with 1 mM EDTA/0.25% Trypsin (w/v) diluted in PBS.
2.4. In vitro cytotoxicity assay
To assess the viability of KB cells after various treatments,
8 × 103 KB cells were seeded on a 96-well plate and kept in an in-
cubator at 37 °C overnight. KB cells were treated with cisplatin (5 µg/
ml), alginate coated AuNPs (Au@Alg, concentration per Au: 20 µg/ml)
and ACA nanocomplex (concentration per cisplatin: 5 µg/ml, con-
centration per Au: 20 µg/ml) for 4 h. Then, KB cells were exposed to a
continuous-wave 532 nm laser source (Changchun New Industries
Optoelectronics Tech, China) with power density of 2.8 W/cm2 for
5 min. Within minutes after laser irradiation, KB cells were irradiated
by a 6-MV Siemens linear accelerator at a dose of 4 Gy and a dose rate
of 2 Gy/min. After 48 h following the treatment, the viability of cells
was measured using MTT assay as suggested by the manufacturer's
manual (Sigma-Aldrich, St. Louis, MO, USA). Briefly, 20 µl of MTT re-
agent was added to the cells for 4 h. Then, the medium was removed
and replaced with formazan crystals dissolved in 10 µl of DMSO and the
plates were kept in the dark at room temperature for 15 min. The ab-
sorbance of the dissolved formazan was measured at a wavelength of
570 nm by an ELISA reader (DYNEX MRX, USA) using a reference
wavelength of 630 nm.
2.5. Real-time quantitative PCR (RT-qPCR)
RT-qPCR was performed to determine the change in the mRNA
expression levels of genes including Bax, Bcl-2 and heat shock protein
70 (HSP70) after various treatments. Firstly, total RNA extraction from
the treated KB cells was performed using AccuZol (BioNeer
Corporation, South Korea) according to the user's manual. One micro-
gram of total RNA extracted from each sample was reverse transcribed
into cDNA using RevertAid First Strand cDNA Synthesis Kit (Thermo
Scientific, Carlsbad, CA, USA). Then, RT-qPCR was performed on a
Corbett 65H0 machine (Corbett Research, Sidney, Australia) using
SYBR® Premix Ex Taq II (Takara, Otsu, Japan). Table 1 represents the
primer sequences of the mentioned genes as well as β-actin gene which
was used as the internal control.
2.6. Determination of ROS level by flow cytometry
Cell-permeable fluorogenic probe 2′, 7′-Dichlorodihydrofluorescin
diacetate (DCFH-DA) was used to detect the intracellular level of re-
active oxygen species (ROS). Subsequent to entry of DCFH-DA into the
cells, it is oxidized to 2′, 7′-Dichlorodihydrofluorescin (DCF) due to
interaction with intracellular ROS. DCF binds to DNA and emits a green
fluorescence which can be detected by a flow cytometer. Firstly, KB
cells were subjected to various treatments including cisplatin, radio-
therapy, ACA, ACA + laser, ACA + radiotherapy and
ACA + laser + radiotherapy with the same conditions as used for
Reverse Oligo sequences
GAGACAGGGACATCAGTCGC
GACTTCACTTGTGGCCCAGAT
GGGCAAATCCTGAGGAGAGC
GATATCATCATCCATGGTGAGCTGG
Z. Alamzadeh, et al.
cytotoxicity assay. After 24 h, cells were trypsinized, harvested and
washed three times with PBS, and then incubated with 10 μM DCFH-DA
at 37 °C for 20 min according to manufacturer's manual. Green fluor-
escent intensity was measured by a flow cytometer (BD FACSCanto II,
USA) at excitation wavelength of 500 nm and emission wavelength of
530 nm
2.7. Ultrastructural study of KB cells by TEM
Transmission electron microscopy (TEM) was used to analyze the
cellular uptake of ACA and the ultrastructural alternations of KB cells.
To this end, KB cells treated with ACA and ACA + laser + radiotherapy
(with the same treatment conditions as mentioned above) underwent
TEM examination (LEO 906; Zeiss). The method for preparation of cells
for TEM study has been reported in our previous study (Movahedi et al.,
2018).
2.8. Statistical analysis
All the experiments were performed in triplicate. Statistical analysis
was performed by one-way ANOVA test by using SPSS software (ver-
sion11). The Tukey test at 95% confidence level was then used as a post
hoc test for pairwise comparison of means of the treatment groups.
Measurement data are mean ± standard deviation (SD). A value of P <
0.05 was considered statistically significant.
3. Results
3.1. Combinatorial therapeutic efficacy of ACA
To assess the anticancer effect of various combination treatments,
the cell viability of a total of 16 groups was measured by MTT assay
(Fig. 1). KB cells treated with ACA showed the higher cytotoxicity
(viability of 57%) than free cisplatin (viability of 73%) at the same
cisplatin concentration (5 µg/ml), indicating that an improved drug
Fig. 1. The in vitro cytotoxicity by MTT assay. The viability of KB cells receiving various treatments. [Laser: 2.8 W/cm2, 5 min; Radiotherapy (RT): 6 MV, 4 Gy;
concentration per cisplatin: 5 µg/ml; concentration per Au: 20 µg/ml]. Error bars indicate standard deviations. (* P value < 0.05, ** P value < 0.001).
3
European Journal of Pharmaceutical Sciences 145 (2020) 105235
delivery efficiency could be obtained by the nanocomplex. Moreover,
the negligible cytotoxicity of Au@Alg (viability of 89%) proved that the
nanocomplex without cisplatin did not induce cytotoxicity by itself. The
cells treated with Au@Alg + laser and ACA + laser exhibited the lower
cell viability of 69% and 40%, respectively, compared to cis-
platin + laser (72%), which is due to the photothermal ablation effect
of AuNPs. While cisplatin + radiotherapy as the conventional che-
moradiation group showed the cell viability of 69%, the combination of
ACA and radiotherapy significantly enhanced the effect of chemor-
adiation and reduced the cell viability to 34%. Additionally, the higher
cytotoxicity of ACA + radiotherapy group than the separate application
of ACA and radiotherapy proved the radiosensitizing effect of this na-
nocomplex. KB cells receiving triple combination therapy using the
nanocomplex (ACA + laser + radiotherapy) revealed a markedly lower
cell viability (17%) than the other groups, manifesting that ACA is able
to combine chemotherapy, radiotherapy and photothermal therapy ef-
fectively, thus yielding a potent anticancer efficacy.
3.2. Gene expression alterations
To determine whether the treatment of KB cells with various regi-
mens can activate the signaling pathway of apoptosis, the mRNA ex-
pression levels of Bax as a pro-apoptotic factor and Bcl-2 as an anti-
apoptotic factor were analyzed by RT-qPCR technique. Bax mRNA ex-
pression was up-regulated by a factor of 2.11 in ACA treated cells,
whereas KB cells treated with ACA + radiotherapy, ACA + laser and
ACA + laser + radiotherapy showed 2.77, 3.20 and 4.50 fold increase
in Bax expression, respectively, relative to untreated cells (Fig. 2a). On
the other hand, Bcl-2 mRNA expression was down-regulated in KB cells
treated with ACA and other combination groups (Fig. 2b). KB cells
treated with thermo-chemo-radio therapy showed the lowest level of
Bcl-2 expression. Fig. 2c shows the ratio of Bax to Bcl-2 mRNA ex-
pression levels as a determinant of propensity to intrinsic apoptosis. The
treatment of KB cells with ACA alone and in combination with RT or
laser yielded the Bax to Bcl-2 ratios of 3.57, 4.85 and 8, respectively.
Z. Alamzadeh, et al. European Journal of Pharmaceutical Sciences 145 (2020) 105235

Fig. 2. The gene expression by RT-qPCR analysis. The mRNA expression for (a) Bax, (b) Bcl-2, (c) ratio of Bax to Bcl-2 and (d) HSP70 in KB cells after various
treatments relative to untreated cells. RT stands for radiotherapy. (ns means P value> 0.05, * P value < 0.05, ** P value < 0.01).

Interestingly, KB cells treated with tri-modal therapy regulation of Bcl-2 anti-apoptotic gene might be a critical mechanism
(ACA + laser + radiotherapy) exhibited a remarkably higher Bax to by which ACA in combination with laser and/or radiotherapy could
Bcl-2 ratio (15) than other combination formulations. Consequently, trigger apoptosis in cancer cells. Additionally, the expression level of
the up-regulation of Bax pro-apoptotic gene along with the down- HSP70 gene which elevates in case of cell stress was also examined. As

4
Z. Alamzadeh, et al. European Journal of Pharmaceutical Sciences 145 (2020) 105235

Fig. 3. Intracellular ROS detection using DCFH-DA. (a) Flow cytometric histogram displays a right shift for KB cells under various treatments compared to untreated
cells, indicating the generation of intracellular ROS. (b) Mean intensity of DCF-DA fluorescence in KB cells after various treatments. RT stands for radiotherapy. (* P
value < 0.05, ** P value < 0.01).

shown in Fig. 2d, various treatments resulted in elevated expression
level of HSP70, and KB cells receiving thermo-chemo-radio therapy
exhibited the highest level of HSP70 expression, evidencing that this
combination therapy produces the highest amount of stress in cells.
3.3. Intracellular ROS generation
fluorescence intensity of treated KB cells compared to the control, in-
dicating the enhanced level of intracellular ROS generation. The mean
fluorescence intensity of DCF-DA probe in Fig. 3b shows that the in-
tracellular ROS generation was increased by 1.78-fold in ACA group,
1.86-fold in ACA + laser group, 2.1-fold in ACA + radiotherapy group
and 4.14-fold in ACA + laser + radiotherapy group compared to un-
treated cells.

Flow cytometry analysis using DCFH-DA fluorescent probe was

performed to quantify the intracellular ROS levels in KB cells after
various treatments. Fig. 3a displays a clear right shift in the

5
Z. Alamzadeh, et al.
Fig. 4. Ultrastructure study of KB cells. (a) KB cells treated with ACA show that the nanoparticles were mostly trafficked to the mitochondria. (b) KB cells treated
with tri-modal thermo-chemo-radio therapy show massive cell injury. Black arrows indicate the presence of ACA in KB cell. White arrows indicate the swelling of
nucleus membrane. {RER, aV, M, N, CC, b, and ner} stand for {rough endoplasmic reticulum, autophagic vacuoles, mitochondria, nucleus, chromatin condensation,
plasma membrane blebbing, and
nuclear envelope rupture}, respectively.
3.4. Ultrastructural damages of KB cells
TEM study was performed to determine the cellular uptake of ACA
nanocomplex and the ultrastructural damages of KB cells after treat-
ment with ACA + laser + radiotherapy. The micrograph of KB cells
treated with ACA (Fig. 4a) shows the intracellular uptake of this na-
nocomplex (indicated by black arrow) and their preferential accumu-
lation inside the mitochondria. Although cells completely maintain
their integrity, the evidence of autophagic vacuoles (aV) formation can
be detected after treatment with ACA. In contrast, the treatment of KB
cells with tri-modal therapy led to massive cell damage as evident by
severe ultrastructural changes of cells. As shown in Fig. 4(b), chromatin
condensation (CC) and membrane blebbing (b) as the typical morpho-
logical features of apoptosis can be visualized. Furthermore, swelling of
nucleus membrane (indicated by white arrow), nuclear envelope rup-
ture (ner) and autophagic vacuoles formation are observable in the
micrograph of cells treated with thermo-chemo-radio therapy.
4. Discussion
The extensive use of hyperthermia as an adjuvant therapy during
the past decades has witnessed its positive effect on improving the
outcome of chemotherapy and radiotherapy (Huang et al., 2011;
Lu et al., 2017). Vascular membrane permeability at elevated tem-
perature that causes enhanced drug uptake, suppressing multi drug
resistance mechanism by heat-induced denaturation of efflux proteins,
6
European Journal of Pharmaceutical Sciences 145 (2020) 105235
and inhibiting the repair of drug-induced DNA damage are the ex-
amples of underlying mechanisms through which hyperthermia could
act synergistically with chemotherapy (Montazerabadi et al., 2019;
Schaaf et al., 2016; Wang et al., 2014). Hyperthermia can also con-
tribute as a potent radiosensitizer to enhance the level of radiation-
induced damages via various mechanisms such as increased tumor
oxygenation and overcoming hypoxia, inhibiting DNA damage repair
pathways following radiotherapy and regulating cell cycle distribution
in favor of radiotherapy by arresting cells in radiosensitive cell cycle
phases (G2/M) (Datta et al., 2015; Horsman and Overgaard, 2007;
Kampinga et al., 2004). Additionally, the concurrent application of
chemotherapy and radiotherapy (chemoradiation) has become a stan-
dard combination regimen and exhibited beneficiary therapeutic out-
come in terms of improved local tumor control and survival rate com-
pared to the separate administration of these modalities
(Mirrahimi et al., 2019b). Some anticancer drugs could play the role of
radiosensitizer in addition to their chemotherapeutic function. Cisplatin
as the model drug used herein comprises a heavy metal atom (pla-
tinum) which can enhance the radiation dose deposition due to in-
creased production of secondary radiation emissions (Candelaria et al.,
2006). Cisplatin also functions as a radiosensitizer through increasing
the susceptibility of radioresistant hypoxic cells, disrupting the repair of
radiation-induced sub-lethal damages and arresting cells in radio-
sensitive G2/M cell cycle phases (Toulany et al., 2014).
It has been demonstrated that the best synergy of chemotherapy,
radiotherapy and hyperthermia is achieved when heat, drug and
Z. Alamzadeh, et al.
radiation are applied simultaneously, but due to the lack of suitable
facilities this is not currently feasible in practice (Hildebrandt et al.,
2002). Therefore, these modalities are inevitably administered se-
quentially which is associated with decreased synergistic therapeutic
effects. Another challenge facing the clinical utility of this multimodal
therapy is the increased level of toxicity caused by individual treat-
ments that may exclude many patients with poor health condition from
participating in treatment procedure. The potential use of AuNPs as a
drug carrier along with their radiosensitive and photo-responsive
properties make AuNPs a unique platform to simultaneously combine
chemotherapy, radiotherapy and photothermal therapy for supra-sy-
nergistic interaction. As a consequence, the administered dosage of
individual therapies could be modified to reduce the adverse side ef-
fects and maintain patient tolerance. Accordingly, the objective of this
study was to enhance the effectiveness of standard cancer therapy
modalities including chemotherapy, radiotherapy and hyperthermia on
one hand, and apply them simultaneously to exploit their synergistic
interactions on the other hand.
The cytotoxicity results demonstrated that ACA nanocomplex was
able to induce greater cell death than free cisplatin under the same drug
concentration. This improved chemotherapy efficiency could be at-
tributed to alginate hydrogel that can enhance the intracellular accu-
mulation and retention of drug payloads by facilitating the cell entry of
nanocarriers, as demonstrated in previous studies (Chavanpatil et al.,
2007; Keshavarz et al., 2018). Like other high atomic number materials,
AuNPs can physically enhance the radiation dose absorption through
enhanced production of secondary electrons (Auger/photo electrons)
(Bergs et al., 2015; Song et al., 2017). AuNPs can also have a catalytic
role for the formation of ROS and this way they induce oxidative stress
to cells (Misawa and Takahashi, 2011). The inhibition of DNA repair
and disruption of cell cycle are another biological implications through
which AuNPs intensify the effect of radiation (Helleday et al., 2008;
Roa et al., 2009). According to cytotoxicity results, the combination of
ACA and radiotherapy led to a significantly lower cell viability (34%)
than the separate use of radiotherapy (cell viability: 87%) and ACA (cell
viability: 57%), supporting the radiosensitizing effect of ACA nano-
complex.
The ROS detection assay proved that ACA + laser + radiotherapy
led to increased intracellular ROS generation, thereby inducing oxida-
tive stress. Moreover, RT-qPCR analysis indicated that ACA in combi-
nation with laser and radiotherapy can activate the genes involved in
the intrinsic pathways of apoptosis, thus enhancing the level of apop-
tosis induction. This was further proved by the ultrastructural analysis
of KB cells by TEM. As shown in micrograph of KB cells, nanoparticles
were mostly trafficked to the mitochondria where they resided in an
aggregated state. Mitochondria are determined as the main source of
ROS such as superoxide and peroxide anions (Wang et al., 2010). When
ACA nanocomplex located in mitochondria is exposed with laser and X-
ray, it can impair mitochondrial structures and increase mitochondrial
outer membrane permeability. This, in turn, increases the cytoplasmic
oxidative stress as well as releasing the apoptotic mediators from the
mitochondria into the cytoplasm, ultimately resulting in apoptosis.
Beside the gene expression analysis and ROS detection assay, the ul-
trastructural analysis of KB cells treated with ACA + laser + radio-
therapy corroborated this mechanism where plasma membrane bleb-
bing and chromatin condensation as the typical morphological
characteristics of apoptosis can be detected. Therefore, the induction of
apoptosis and oxidative stress due to ACA treatment in combination
with laser and radiotherapy could be the result of mitochondrial loca-
lization of ACA and its detrimental effects on mitochondria. Conse-
quently, the findings of this study support that ACA nanocomplex is
able to successfully combine chemotherapy, radiotherapy and photo-
thermal therapy, thereby affording synergistic therapeutic outcome.
In summary, we herein developed four combination treatment re-
gimens using ACA to achieve synergistic therapeutic effects. Bimodal
therapies were found to be in the following order in terms of cell killing
7
European Journal of Pharmaceutical Sciences 145 (2020) 105235
efficiency: thermo-radiotherapy (Au@Alg + laser + RT) ≅ chemor-
adiation therapy (ACA + RT) > thermo-chemotherapy (ACA + laser).
Noteworthy, the tri-modal thermo-chemo-radio therapy was shown to
induce remarkably higher cytotoxicity to cancer cells than mono- or bi-
modality treatments. While the projected percentage of cell viability
due to additive interaction of ACA (57% cell viability), laser (88% cell
viability) and radiotherapy (87% cell viability) was calculated to be
44%, the observed cell viability following this trimodal therapy was
remarkably lower (17%), indicating the synergistic anticancer effect.
Accordingly, in this trimodal therapy, the therapeutic contributions of
each individual therapy including chemotherapy, photothermal
therapy and radiotherapy are estimated to be 51, 21 and 28%, re-
spectively.
5. Conclusion
The present study was designed to employ a multifunctional nano-
platform comprising alginate hydrogel co-loaded with cisplatin and
AuNPs for triple combination of photothermal therapy, chemotherapy
and radiotherapy. The co-localization of anticancer drug, ionizing ra-
diation, laser photon and AuNPs inside the cancer cells and their pos-
sible synergistic interactions with each other led to a potent therapeutic
outcome wherein the enhanced level of apoptotic induction and oxi-
dative stress were observed. This synergistic anticancer efficacy can
afford an additional benefit by providing the potential to reduce the
administered dosage of individual therapies such as drug concentration,
radiation dose and laser power in order to keep the patient's safety.
Therefore, the nanocomplex developed here can be suggested as a
promising platform for multimodal synergistic cancer therapy.
Declaration of Competing Interest
The authors declare that they have no conflict of interest.
Acknowledgments
All supports received from Applied Biophotonics Research Center,
Science and Research Branch, Islamic Azad University, Tehran, Iran,
and Zahedan University of Medical Sciences (ZaUMS), Zahedan, Iran,
are acknowledged.
References
Abed, Z., Beik, J., Laurent, S., Eslahi, N., Khani, T., Davani, E.S., Ghaznavi, H., Shakeri-
Zadeh, A., 2019. Iron oxide–gold core–shell nano-theranostic for magnetically tar-
geted photothermal therapy under magnetic resonance imaging guidance. J. Cancer
Res. Clin. Oncol. 145 (5), 1213–1219.
Alamzadeh, Z., Beik, J., Mahabadi, V.P., Ardekani, A.A., Ghader, A., Kamrava, S.K.,
Dezfuli, A.S., Ghaznavi, H., Shakeri-Zadeh, A., 2019. Ultrastructural and optical
characteristics of cancer cells treated by a nanotechnology based chemo-photo-
thermal therapy method. J. Photochem. Photobiol. B 192, 19–25.
Beik, J., Asadi, M., Khoei, S., Laurent, S., Abed, Z., Mirrahimi, M., Farashahi, A.,
Hashemian, R., Ghaznavi, H., Shakeri-Zadeh, A., 2019a. Simulation-guided photo-
thermal therapy using MRI-traceable iron oxide-gold nanoparticle. J. Photochem.
Photobiol. B, 111599.
Beik, J., Khateri, M., Khosravi, Z., Kamrava, S.K., Kooranifar, S., Ghaznavi, H., Shakeri-
Zadeh, A., 2019b. Gold nanoparticles in combinatorial cancer therapy strategies.
Coord. Chem. Rev. 387, 299–324.
Beik, J., Shiran, M.B., Abed, Z., Shiri, I., Ghadimi‐Daresajini, A., Farkhondeh, F.,
Ghaznavi, H., Shakeri‐Zadeh, A., 2018. Gold nanoparticle‐induced sonosensitization
enhances the antitumor activity of ultrasound in colon tumor‐bearing mice. Med.
Phys. 45 (9), 4306–4314.
Bergs, J.W., Wacker, M.G., Hehlgans, S., Piiper, A., Multhoff, G., Rödel, C., Rödel, F.,
2015. The role of recent nanotechnology in enhancing the efficacy of radiation
therapy. Biochimica et Biophysica Acta (BBA)-Rev. Cancer 1856 (1), 130–143.
Candelaria, M., Garcia-Arias, A., Cetina, L., Dueñas-Gonzalez, A., 2006. Radiosensitizers
in cervical cancer. Cisplatin and beyond. Rad. Oncol. 1 (1), 15.
Chavanpatil, M.D., Khdair, A., Panyam, J., 2007. Surfactant-polymer nanoparticles: a
novel platform for sustained and enhanced cellular delivery of water-soluble mole-
cules. Pharm. Res. 24 (4), 803–810.
Chicheł, A., Skowronek, J., Kubaszewska, M., Kanikowski, M., 2007.
Hyperthermia–description of a method and a review of clinical applications. Rep.
Z. Alamzadeh, et al.
Pract. Oncol. Radiother. 12 (5), 267–275.
Datta, N., Ordóñez, S.G., Gaipl, U., Paulides, M., Crezee, H., Gellermann, J., Marder, D.,
Puric, E., Bodis, S., 2015. Local hyperthermia combined with radiotherapy and-/or
chemotherapy: recent advances and promises for the future. Cancer Treat. Rev. 41
(9), 742–753.
Fan, W., Yung, B., Huang, P., Chen, X., 2017. Nanotechnology for multimodal synergistic
cancer therapy. Chem. Rev. 117 (22), 13566–13638.
Ghosh, P., Han, G., De, M., Kim, C.K., Rotello, V.M., 2008. Gold nanoparticles in delivery
applications. Adv. Drug Deliv. Rev. 60 (11), 1307–1315.
Gottesman, M.M., Fojo, T., Bates, S.E., 2002. Multidrug resistance in cancer: role of
ATP–dependent transporters. Nat. Rev. Cancer 2 (1), 48–58.
Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R.A., 2008. DNA repair
pathways as targets for cancer therapy. Nat. Rev. Cancer 8 (3), 193.
Her, S., Jaffray, D.A., Allen, C., 2015. Gold nanoparticles for applications in cancer
radiotherapy: mechanisms and recent advancements. Adv. Drug Deliv. Rev.
Hildebrandt, B., Wust, P., Ahlers, O., Dieing, A., Sreenivasa, G., Kerner, T., Felix, R., Riess,
H., 2002. The cellular and molecular basis of hyperthermia. Crit. Rev. Oncol.
Hematol. 43 (1), 33–56.
Horsman, M.R., Overgaard, J., 2007. Hyperthermia: a potent enhancer of radiotherapy.
Clin. Oncol. 19 (6), 418–426.
Huang, P., Bao, L., Zhang, C., Lin, J., Luo, T., Yang, D., He, M., Li, Z., Gao, G., Gao, B.,
2011. Folic acid-conjugated silica-modified gold nanorods for X-ray/CT imaging-
guided dual-mode radiation and photo-thermal therapy. Biomaterials 32 (36),
9796–9809.
Kampinga, H., Dynlacht, J., Dikomey, E., 2004. Mechanism of radiosensitization by hy-
perthermia (43 C) as derived from studies with DNA repair defective mutant cell
lines. Int. J. Hyperthermia 20 (2), 131–139.
Keshavarz, M., Moloudi, K., Paydar, R., Abed, Z., Beik, J., Ghaznavi, H., Shakeri-Zadeh,
A., 2018. Alginate hydrogel co-loaded with cisplatin and gold nanoparticles for
computed tomography image-guided chemotherapy. J. Biomater. Appl. 33 (2),
161–169.
Lu, N., Huang, P., Fan, W., Wang, Z., Liu, Y., Wang, S., Zhang, G., Hu, J., Liu, W., Niu, G.,
2017. Tri-stimuli-responsive biodegradable theranostics for mild hyperthermia en-
hanced chemotherapy. Biomaterials 126, 39–48.
Maeda, H., Wu, J., Sawa, T., Matsumura, Y., Hori, K., 2000. Tumor vascular permeability
and the EPR effect in macromolecular therapeutics: a review. J. Control. Release 65
(1), 271–284.
Mieszawska, A.J., Mulder, W.J., Fayad, Z.A., Cormode, D.P., 2013. Multifunctional gold
nanoparticles for diagnosis and therapy of disease. Mol. Pharm. 10 (3), 831–847.
Mirrahimi, M., Abed, Z., Beik, J., Shiri, I., Dezfuli, A.S., Mahabadi, V.P., Kamrava, S.K.,
Ghaznavi, H., Shakeri-Zadeh, A., 2019a. A thermo-responsive alginate nanogel
platform co-loaded with gold nanoparticles and cisplatin for combined cancer chemo-
photothermal therapy. Pharmacol. Res. 143, 178–185.
Mirrahimi, M., Khateri, M., Beik, J., Ghoreishi, F.S., Dezfuli, A.S., Ghaznavi, H.,
Shakeri‐Zadeh, A., 2019b. Enhancement of chemoradiation by co‐incorporation of
gold nanoparticles and cisplatin into alginate hydrogel. J. Biomed. Mater. Res. Part B
Appl. Biomater.
European Journal of Pharmaceutical Sciences 145 (2020) 105235
Misawa, M., Takahashi, J., 2011. Generation of reactive oxygen species induced by gold
nanoparticles under X-ray and UV irradiations. Nanomed. Nanotechnol. Biol. Med. 7
(5), 604–614.
Moeller, B.J., Richardson, R.A., Dewhirst, M.W., 2007. Hypoxia and radiotherapy: op-
portunities for improved outcomes in cancer treatment. Cancer Metastasis Rev. 26
(2), 241–248.
Montazerabadi, A., Beik, J., Irajirad, R., Attaran, N., Khaledi, S., Ghaznavi, H., Shakeri-
Zadeh, A., 2019. Folate-modified and curcumin-loaded dendritic magnetite nano-
carriers for the targeted thermo-chemotherapy of cancer cells. Artif. Cells Nanomed.
Biotechnol. 47 (1), 330–340.
Movahedi, M.M., Mehdizadeh, A., Koosha, F., Eslahi, N., Mahabadi, V.P., Ghaznavi, H.,
Shakeri-Zadeh, A., 2018. Investigating the photo-thermo-radiosensitization effects of
folate-conjugated gold nanorods on KB nasopharyngeal carcinoma cells. Photodiagn.
Photodyn. Ther. 24, 324–331.
Peer, D., Karp, J.M., Hong, S., Farokhzad, O.C., Margalit, R., Langer, R., 2007.
Nanocarriers as an emerging platform for cancer therapy. Nat. Nanotechnol. 2 (12),
751–760.
Qin, Z., Bischof, J.C., 2012. Thermophysical and biological responses of gold nanoparticle
laser heating. Chem. Soc. Rev. 41 (3), 1191–1217.
Roa, W., Zhang, X., Guo, L., Shaw, A., Hu, X., Xiong, Y., Gulavita, S., Patel, S., Sun, X.,
Chen, J., 2009. Gold nanoparticle sensitize radiotherapy of prostate cancer cells by
regulation of the cell cycle. Nanotechnology 20 (37), 375101.
Schaaf, L., Schwab, M., Ulmer, C., Heine, S., Mürdter, T.E., Schmid, J.O., Sauer, G.,
Aulitzky, W.E., van der Kuip, H., 2016. Hyperthermia synergizes with chemotherapy
by inhibiting PARP1-dependent DNA replication arrest. Cancer Res. 76 (10),
2868–2875.
Song, G., Cheng, L., Chao, Y., Yang, K., Liu, Z., 2017. Emerging nanotechnology and
advanced materials for cancer radiation therapy. Adv. Mater. 29 (32), 1700996.
Toulany, M., Mihatsch, J., Holler, M., Chaachouay, H., Rodemann, H.P., 2014. Cisplatin-
mediated radiosensitization of non-small cell lung cancer cells is stimulated by ATM
inhibition. Radiother. Oncol. 111 (2), 228–236.
Wang, L., Lin, X., Wang, J., Hu, Z., Ji, Y., Hou, S., Zhao, Y., Wu, X., Chen, C., 2014. Novel
insights into combating cancer chemotherapy resistance using a plasmonic nano-
carrier: enhancing drug sensitiveness and accumulation simultaneously with loca-
lized mild photothermal stimulus of femtosecond pulsed laser. Adv. Funct. Mater. 24
(27), 4229–4239.
Wang, L., Liu, Y., Li, W., Jiang, X., Ji, Y., Wu, X., Xu, L., Qiu, Y., Zhao, K., Wei, T., 2010.
Selective targeting of gold nanorods at the mitochondria of cancer cells: implications
for cancer therapy. Nano Lett. 11 (2), 772–780.
Wang, S., Weng, J., Fu, X., Lin, J., Fan, W., Lu, N., Qu, J., Chen, S., Wang, T., Huang, P.,
2017. Black phosphorus nanosheets for mild hyperthermia-enhanced chemotherapy
and chemo-photothermal combination therapy. Nanotheranostics 1 (2), 208.
Wust, P., Hildebrandt, B., Sreenivasa, G., Rau, B., Gellermann, J., Riess, H., Felix, R.,
Schlag, P., 2002. Hyperthermia in combined treatment of cancer. Lancet Oncol. 3 (8),
487–497.
Yang, X., Yang, M., Pang, B., Vara, M., Xia, Y., 2015. Gold nanomaterials at work in
biomedicine. Chem. Rev. 115 (19), 10410–10488.