Biochimie 121 (2016) 112e122

Contents lists available at ScienceDirect

Biochimie
journal homepage: www.elsevier.com/locate/biochi

Research paper

Preventive effects of butyric acid, nicotinamide, calcium glucarate

alone or in combination during the 7, 12-dimethylbenz (a) anthracene
induced mouse skin tumorigenesis via modulation of K-Ras-PI3K-
AKTpathway and associated micro RNAs*
Prakash Tiwari a, c, Satya Sahay a, c, Manuraj Pandey a, Syed S.Y.H. Qadri b,
Krishna P. Gupta a, *
a
Environmental Carcinogenesis Division, CSIR-Indian Institute of Toxicology Research, Mahatma Gandhi Marg, Lucknow, 226001, India
b
Pathology Division, National Institute of Nutrition, Hyderabad, India
c
PhD Programme, Academy of Scientific and Innovative Research (AcSIR), India

a r t i c l e i n f o a b s t r a c t

Article history: Skin cancer is among the most common cancers worldwide and identifiable molecular changes for early
Received 4 February 2015 and late stage of skin tumorigenesis can suggest the better targets for its control. In this study, we
Accepted 27 November 2015 investigated the status of K-Ras-PI3K-AKTpathway followed by NF-kB, cyclin D1, MMP-9 and regulatory
Available online 30 November 2015
micro RNA during 7, 12-dimethylbenz[a]anthracene (DMBA) induced mouse skin tumorigenesis and its
prevention by butyric acid (BA), nicotinamide (NA) and calcium glucarate (CAG), individually or in
Keywords:
combination with respect to time. DMBA upregulated the K-Ras, PI3K, Akt, NF-kB, cyclin D1 and MMP-9,
Chemoprevention
but downregulated the PTEN in a time dependent manner. DMBA also reduced the levels of micoRNA let-
Natural agents
Combination
7a but induced the levels of miR-21 and miR-20a as a function of time. BA, NA and CAG were found to
Skin tumors prevent DMBA induced changes, but they were most effective when used together in a combination.
PI3K/AKT Reduced let-7a and miR-211 were correlated with the overexpression of K-Ras and MMP-9. Over-
miRNA expression of miR-21 and miR-20a was correlated with the down regulation of PTEN and overexpression
of Cyclin D1. Collectively, the enhanced chemopreventive potential of natural compound in combination
via regulation of K-Ras-PI3K-AKTpathway along with regulatory micro RNAs provide a newer and
effective mean for cancer management.
© 2015 Published by Elsevier B.V.

1. Introduction [4]. Phosphatidylinositol-3-kinase (PI3K) plays a major role in cell

Humans get exposed directly to environmental pollutants
including chemical mutagens and carcinogens in a day-to-day life
[1]. Increase in cases of skin cancer year by year due to the
increased exposure to environmental pollutants and UV rays is
alarming and raises the concern [2]. The better understanding of
molecular mechanisms of skin tumor development could be helpful
in its control. Aberrant expression of the Ras proto-oncogene family
proteins including K-Ras are among the molecular changes in skin
cancer [3]. K-Ras leads to hyper activation of PI3K/AKT pathways
*
IITR communication number: 3233.
* Corresponding author.
E-mail address: krishnag522@yahoo.co.in (K.P. Gupta).
survival signaling networks through activation of its downstream
target AKT [4]. Activated AKT promotes cell growth and survival
with various mechanisms [5]. Importance of PTEN in skin tumori-
genesis has been shown by developing the skin Squamous cell
carcinoma (SCC) after the epidermal deletion of PTEN [6]. PTEN
regulates PI3K signalling and PI3-kinase/AKT pathway plays a
major role in activation of NF-kB by phosphorylating IkB [7]. NF-kB
transcriptionally activates many pro-survival and anti-apoptotic
genes including cyclin D1 and MMP-9 [7e9]. Overexpression of
cyclin D1 shortens the G1-phase and accelerates cell growth [8,10],
whereas, MMP-9 (92-kDa gelatinase B) is over expressed during
metastasis of tumor cells [11,12].
Micro RNAs are the short non coding RNA molecules and are
involved in the tumor formation and progression [13]. It has been
reported that let-7a, a tumor suppressor micro RNA, represses the

http://dx.doi.org/10.1016/j.biochi.2015.11.027
0300-9084/© 2015 Published by Elsevier B.V.
 P. Tiwari et al. / Biochimie 121 (2016) 112e122
expression of K-Ras [14] and miR-21, a PTEN suppressor micro RNA,
is overexpressed in different carcinomas [15,16]. MiR-20a is the
most commonly overexpressed micro RNA during tumorigenesis
and metastasis [17]. Whereas miR-211, an assumed tumor sup-
pressive micro RNA, has been shown to inhibit the expression of
MMP-9 [18,19].
Natural agents and phytochemicals have been shown to
inhibit the PI3K/AKT pathway and its downstream transcriptional
factors as targets for chemoprevention [13,20]. Indole-3-carbinol,
curcumin, resveratrol, epigallocatechin-3-gallate or isoflavone
could modulate the expression of micro RNAs in inhibiting cell
growth and inducing the apoptosis [21]. It is suggested that
specific targeting of PI3K/AKT pathways and micro RNAs by
natural agents can be utilized for better chemoprevention [21].
There are several newer agents that are non toxic and are not
well studies for their effects during the course of tumor devel-
opment and its basis. Butyric acid (BA), a short chain fatty acid
prevents mouse skin tumorigenesis and support cellular differ-
entiation [22,23]. Nicotinamide (NA) is a form of vitamin B3
which reduces tumorigenesis and support DNA repair system
[24]. Calcium glucarate (CAG) enhances phase II detoxification by
inhibiting b-glucuronidase and is shown to inhibit mouse skin
tumorigenesis [25,26]. 7, 12-dimethylbenz [a] anthracene
(DMBA) has been widely used for mouse skin tumorigenesis [22].
It is a suitable model system to follow the development of tu-
mors with respect to time and study the molecular events at any
point of the tumor development.
Earlier we have shown that the enhanced preventive effect of
BA, NA and CAG in combination against DMBA induced the
deregulation of miR-203 via modulation of epigenetic regulator and
the regulators of micro RNA biogenesis [27]. Now, in order to
dissect the basis of the preventive effects of BA, NA and CAG alone
or in combination further, the present study was aimed to evaluate
the status of KeRas/PI3K/AKT pathway, associated micro RNAs and
some of the downstream transcriptional factors during tumori-
genesis and their control by BA, NA or CAG individually or in
combination at different end points. To know the early molecular
changes before the tumor development, we have selected 1 or 8
weeks end point and to know the molecular changes when tumors
developed, we have selected 32 weeks end point.
2. Materials and methods
2.1. Animals
Female Swiss mice (4e6-weeks of age and 10e12 g of body
weight) at the in-house animal breeding colony at CSIR-IITR Luck-
now, India, were kept on a pelleted diet (M/S Provimi Animal
Nutrition India Pvt. Ltd, Bangalore, India) and water ad libitum
under 12 h light and dark cycles.
The study was approved and the animals were handled as per
the norms of the Institutional Animal Ethics Committee.
2.2. Chemicals
7, 12-dimethylbenz [a] anthracene, Nicotinamide and Calcium
glucarate were procured from Sigma Co., USA. Butyric acid was
purchased from SISCO Res. Lab. India. The rest of the chemicals
were procured from the local commercial sources and were of
analytical grade.
2.3. Chronic animal bioassay
Chronic animal bioassay was done as reported earlier [27]. Mice
were divided into six groups of 10 mice each and were topically
113
treated on shaved back in the inter-scapular region twice weekly.
Group 1-Control, (100 ml acetone/Mouse); Group 2- DMBA (5 mg
DMBA/mouse); Group 3- DMBA þ BA (5 mg DMBA/mouse followed
by 17.62 mg BA/Mouse); Group 4- DMBA þ NA (5 mg DMBA/mouse
followed by 5 mg NA/Mouse); Group 5- DMBA þ CAG (5 mg DMBA/
mouse followed by 5 mg CAG/Mouse); Group 6- DMBA þ CAG (5 mg
DMBA/mouse followed by 17.62 mg BA, 5 mg NA, and 5 mg CAG/
mouse). The rationale of using these doses is based on our earlier
studies [22,24,26e28]. The experiment was terminated at the three
end points: 1, 8 and 32 weeks that include time before and after the
tumor development. At the end, skin from the treated area was
excised, cleaned, snap frozen in liquid nitrogen and stored at
80  C until used. Tumor volume was measured by Vernier calipers
using the formula:
V ¼ ð4=3ÞP½D1=2½D2=2½D3=2
where D1, D2 and D3 are the diameters of length, width and the
height (mm) of the tumor.
2.4. Histopathology
Skin tissues were fixed in 10% buffered formalin and wax
embedded blocks were prepared. Blocks were sectioned (5 mm) and
stained with hematoxylin e eosin as per standard procedure.
Stained sections were examined under Leica DFC 295 camera using
Leica DM 1000 microscope.
2.5. Epidermal homogenates preparation and western blotting
Epidermal lysates (10%) were prepared by tissue homogeniza-
tion in lysis buffer, pH 7.6 and protein expressions were analyzed by
western blotting as described [29]. Briefly, tissue lysate equivalent
to 50 mg proteins was resolved on SDS-PAGE and then transferred
onto the PVDF membrane (Millipore Co. USA). The membrane was
probed with primary antibodies for K-Ras (Sc-30), p-AKT (Ser-473)
(Sc-7985-R), NF-kB p50 (Sc-114), Cyclin D1(Sc-20044), MMP-9 (Sc-
6840) from Santa Cruz Biotech, USA and PI3K p110a (#4249), AKT
(#2938), PTEN (#9559) from Cell Signalling Technology, USA, fol-
lowed by the appropriate secondary antibody (Bangalore Genei,
India).
Signals were visualized by the Super Signal West Femto Max
Substrate (Thermo Fischer Scientific, USA) on Versa Doc (Bio-Rad).
For normalization membranes were stripped and re-probed with b-
actin antibody (Sigma Co, USA) for every blot.
2.6. RNA isolation, c DNA preparation and polymerase chain
reaction (PCR)
RNA was isolated using TRIzol (Invitrogen,USA) and reverse
transcribed to cDNA utilizing the AMV kit (Bangalore Genei, India)
as per manufacturer's instructions. cDNA, thus obtained, was
amplified by controlled PCR condition as described [27]. Gene
specific primers (MWG, Germany) were used for amplification of K-
Ras, PI3K, AKT, PTEN, NF-kB, Cyclin D1 or MMP-9 (Table 1). PCR
products were visualized on 1.5% agarose gel containing ethidium
bromide and quantification was done using Gene Tool Synegene
software.
2.7. Real-time quantitative PCR for the evaluation of micro RNA
levels
Total RNA enriched with miRNA was isolated using a mirVana
miRNA isolation kit (Applied Biosystems, USA). cDNA was prepared
using the TaqMan MicroRNA Reverse Transcription kit (Applied
114 P. Tiwari et al. / Biochimie 121 (2016) 112e122
Table 1
Nucleotide sequence of primers for RT-PCR.
Gene Primer sequences
K-Ras F 50 -CGTTCATTGAGACCTCAGCA-30
R 50 -GTGACCCCTCAGTGTCCAGT-30
PI3K(p110a) F 50 -GGGGGCGCTGCAGTTCAACA-30
F 50 -TTGCCACGCAGTACCCAGCG-30
AKT F 50 -AGAGAAGGCCACAGGCCGCT-30
F 50 -AAGCAGAGGCGGTCGTGGGT-30
PTEN F 50 -TCTGCAGGAAATCCCATAGC-30
R 50 -CATGACAGCCATCATCAAAGA-30
NF-kB p50 F 50 -GCACAGACGGTGTCTAGCAA-30
R 50 -GCGGAGGGACAGCAGTAACA-30
Cyclin D1 F 50 TGTTCGTGGCCTCTAAGATGAAG30
R 50 AGGTTCCACTTGAGCTTGTTCAC30
MMP-9 F 50 -GGACGGTTGGTACTGGAAGT-30
F 50 -TGCCTGTGTACACCCACATT-30
b-actin F 50 -TGTGATGGTGGGAATGGGTCAG-30
R 50 -TTTGATGTCACGCACGATTTCC-30
Biosystems, USA) and let-7a, miR-21 or miR-20a stem loop RT
primers [27]. MiRNA levels were determined by real time quanti-
tative PCR using gene-specific TaqMan®Gene Expression Assays as
per manufacturer instruction (Applied Biosystems, USA). U6 anal-
ysis served as internal control.
For the detection of miR-211, cDNA was prepared using miScript
II RT kit (Qiagen, The Netherlands) and real-time quantitative PCR
was done as described in miScript SYBR Green PCR kit (Qiagen, The
Netherlands). Universal reverse primer was provided with the kit.
Sequences for forward primers for miR-211 and U6 were 50 -
TTCCCTTTGTCATCCTTTGCCT-30 and 50 AGCTGGTGTTGTGAATCAGG
CCG-30 respectively. The relative expression of let-7a, miR-21, miR-
20a and miR-211 was based on DDCt values.
2.8. Immuno-histochemical analyses
IHC was performed on wax embedded skin sections as re-
ported earlier with slight modifications [30]. Parafinized sections
were first de-paraffinized in xylene and rehydrated in descend-
ing alcohol concentrations. Antigen retrieval was done on hy-
drated sections by boiling sections in 0.01 M citrate buffer pH-6.0
containing 0.05% Tween-20 at 95  C for 10 min. After cooling and
rinsing with PBS, slides were kept in 3% H2O2 solution in meth-
anol for 10 min to quench peroxidase activity. Sections were
incubated with horse serum (Vector Lab) for unspecific protein
blocking and were probed with primary antibody of p-AKT at the
dilution of 1:500 at 4  C for overnight. HRP conjugated appro-
priate secondary antibodies (prepared in blocking) were used
with 1:500 dilution for 1 h. Signals were visualized using dia-
minobenzidine (DAB) as HRP substrate and Hematoxylin was
used as nuclear stain. Expression of proteins was expressed in
terms of DAB density. 15e20 micrographs were randomly taken
from each DAB stained section and signal intensity was analyzed
using Image J software. Representative photographs are shown in
the results.
2.9. Statistical analyses
All the data were subjected to statistical analysis. Mean values
and ±SD of all the groups were calculated. One way ANOVA
following StudenteNewmaneKeuls tests for post hoc analyses was
employed to assess the statistical significance of the difference
between different treatment groups. Significance was determined
in terms of ‘p’ values. A ‘p’ value of <0.05 was considered to be
statistically significant.
Annealing temperature  (C) Product size (base pair)
58 574
58 122
60 171
60 120
58 131
60 136
59 173
60 514
3. Results
3.1. DMBA induced skin tumor development and its prevention
3.1.1. Gross examination
Previously we have addressed DMBA induced tumorigenesis
after 4 and 16 weeks of exposure [27]. Further, to address much
earlier and much later events, here we have evaluated the DMBA
induced tumorigenesis at 1, 8 and 32 weeks after the exposure.
Tumors did not appear at the end of 1 or 8 weeks but 100%
tumorigenesis was observed by the end of 32 weeks of DMBA
exposure. BA, NA or CAG delayed the DMBA induced onset of tu-
mors by 2e3 weeks but a concomitant combination of compounds
delayed the onset of tumors by 4 weeks. Large tumors were
observed in all the DMBA treated mice at 32 weeks with a total 83
tumors). Application of BA, NA or CAG after DMBA exposure
reduced the cumulative number of tumors to 29, 22 or 24 at the end
of 32 weeks. But the application of concomitant combination of BA,
NA and CAG after DMBA exposure reduced the cumulative number
of tumors to 6 at the end of 32 weeks. Application of BA, NA or CAG
exhibited 79, 88 or 64% inhibition in tumor volume at 32 weeks but
the tumor inhibitory effect was enhanced to 98% after the appli-
cation of concomitant combination of compounds (Fig. 1, II).
3.1.2. Microscopic examination
Microscopic analysis of H&E stained sections of mouse skin
showed that the skin histology remained unaltered at all the time
points in control mice. Hyperplasia was observed at the end of 8
weeks in DMBA exposed mice. Whereas, at the end of 32 weeks,
large size tumors were observed in all DMBA treated mice. Only
skin hyperplasia was observed in animals treated with BA, NA or
CAG after DMBA exposure, but animals treated with concomitant
combination of BA, NA and CAG after DMBA exposure showed
almost normal skin histology (Fig. 1, I).
3.2. Expression of K-Ras and PI3K
Deregulation of K-Ras and PI3K was analyzed at the protein
(Fig. 2- I and II) and mRNA level (Fig. 2- III and IV) in treated mice at
the end of 1, 8 or 32 weeks of exposure with respect to control. K-
Ras and PI3K were unaffected at the end of 1 week of DMBA
exposure. Afterwards, the expression of K-Ras and PI3K was upre-
gulated in a time dependent manner at 8 or 32 weeks. K-Ras was
upregulated by 54 or 160% at the protein and 50 or 154% at the
mRNA level at the end of 8 or 32 weeks. PI3K was upregulated by 52
or 211% at the protein and 42 or 188% at the mRNA level at the end
 P. Tiwari et al. / Biochimie 121 (2016) 112e122 115

Fig. 1. DMBA induced mouse skin tumorigenesis and its prevention in the presence of BA, NA and CAG individually or in concomitant combination. The figure shows the histo-
pathological examination (I, 100X) of mouse skin at 1, 8 and 32 weeks of exposure. The single head arrow shows tumors and epidermis thickness is shown by double head arrow.
Quantitative analysis of tumors at 32 weeks is shown by histograms in terms of average tumor volume per mice (II) and the cumulative number of tumors (III). Bars represent the
standard deviation. *P < 0.05, **P < 0.001, ***P < 0.0001 with respect to control. ###P < 0.0001 with respect to DMBA.

of 8 or 32 weeks. by 54 or 74% at the respective time points. In the presence of BA/NA/

In the presence of BA/NA/CAG, K-Ras and PI3K protein upregu-
lation was 12 or 67%/17 or 70%/20 or 74% for K-Ras and 18 or 75%/20
or 59%/22 or 61% for PI3K at the end of 8 or 32 weeks. At the mRNA
level, K-Ras and PI3K upregulation was 9 or 65%/13 or 67%/19 or
69% for K-Ras and 16 or 50%/17 or 52%/21 or 56% for PI3K at the
respective time points. However, concomitant application of BA, NA
and CAG along with DMBA, the upregulation of K-Ras and PI3K was
6 or 25% and 7 or 21% at the protein level. At the mRNA level, K-Ras
and PI3K upregulation was 3 or 22% and 8 or 21% at the respective
time points. Result suggests the involvement of K-Ras and PI3K
during skin tumorigenesis and their attenuation by a combination
of compounds.
3.3. Levels of let-7a
K-Ras,a targets of let-7a, was analyzed for its deregulation in
treated mice at 1, 8 or 32 weeks after exposure with respect to
control (Fig. 2-V). DMBA application down regulated the let-7a
levels by 18, 70 or 98% in a time dependent manner at 1, 8 or
32 weeks in comparison to control. Whereas, in the presence of
BA/NA/CAG, let-7a was upregulated by 1, 5 or, 9%/1, 4, 90%/1, 4,
96% at the respective time points. Concomitant application of BA,
NA and CAG along with DMBA, let-7a upregulation was 2, 20 or
122% at the respective time points. Result suggests the let-7a
downregulation with concurrent upregulation of K-Ras during
skin tumorigenesis and its enhanced attenuation by a combination
of compounds.
3.4. Status of AKT and p-AKT(Ser-473)
AKT expression was analyzed at the protein or mRNA level
(Fig. 3- I, III) and p-AKT level was analyzed at protein level in
treated mice at the end of 1, 8 or 32 weeks of exposure with respect
to control (Fig. 3- II). Initially, AKT and p-AKT were unaffected at the
end of 1 week but DMBA upregulated the AKT and p-AKTexpression
in a time dependent manner at 8 or 32 weeks by 35or 64% and 45 or
108% at the protein level. At the mRNA level, AKT was upregulated
CAG, upregulation of AKT and p-AKT protein was reduced to 10 or
32%/16 or 34%/19 or 37% and 22 or 42%/26 or 44%/28 or 46% at the
end of 8 or 32 weeks. At the mRNA level, AKT upregulation was
reduced to 25 or 40%/26 or 42%/28 or 43% respectively at the end of
8 or 32 weeks. But in the presence of concomitant combination of
BA, NA and CAG, AKT and p-AKT protein upregulation was further
reduced to 9 or 17% and 11 or 19% at the respective time points. At
mRNA level, AKT upregulation was reduced to 8 or 18% at respective
time points.
p-AKT, an indicator of activated PI3K- AKT pathway, was
analyzed by IHC (Fig. 3-IV). IHC analysis confirmed the upregu-
lation of p-AKT (108% and 212% respectively at the end of 8 and
32 weeks) in DMBA exposed mice with respect to control.
Although BA/NA/CAG tried to prevent the upregulation of p-AKT
(31 or 87%/47 or 90%/51 or 97% respectively at the end of 8 or 32
weeks). But in the presence of concomitant combination of BA,
NA and CAG, p-AKT upregulation was further reduced to 20 or
30% respectively at the end of 8 or 32 weeks. Result suggests the
upregulation of AKT and p-AKT during skin tumorigenesis in a
time dependent manner and its enhanced prevention by a
combination of compounds.
3.5. Expression of PTEN
PTEN expression was analyzed at the protein (Fig. 4- I) and
mRNA level (Fig. 4 e II) in treated mice at the end of 1, 8 or 32
weeks after exposure with respect to control. Initially, PTEN was
unaffected at the end of 1 week but it was down regulated in a
time dependent manner at 8 or 32 weeks. PTEN protein was
down regulated by 31 or 64% and mRNA was downregulated
by 22 or 55% at the respective time points in comparison to
control. In the presence of BA/NA/CAG, PTEN downregulation was
13 or 33%/16 or 36%/20 or 37% at the protein level and 10 or 23%/
12 or 24%/14 or 30% at the mRNA level. After concomitant
application of BA, NA and CAG along with DMBA, PTEN down-
regulation was further reduced and was 5, or 21% at the protein
and 6 or 23% at the mRNA level at the respective time points.
116 P. Tiwari et al. / Biochimie 121 (2016) 112e122

Fig. 2. DMBA induced over expression of K-Ras or PI3K, downregulation of let-7a and the preventive effect of BA, NA or CAG alone or in concomitant combination with time (i.e.
before tumor appearance: 1 or 8 weeks; after tumor appearance: 32 weeks). Three samples from each group were analyzed for K-Ras, PI3K and let-7a expression and were subjected
to statistical analysis (n ¼ 3). Qualitative and quantitative analysis of K-Ras and PI3K is shown at the protein level in (I and II) and at the mRNA level in (III and IV). Relative
quantification of let-7a is shown in (V). Bars represent the standard deviation. *P < 0.05, **P < 0.001, ***P < 0.0001 with respect to control. 1 week, 8 weeks, 32 weeks.

Result suggests the downregulation of PTEN with concurrent 3.6. Levels of miR-21
upregulation of PI3K during skin tumorigenesis in a time
dependent manner and its enhanced attenuation by a combina- MiR-21 level (Fig. 4- III) was analyzed in treated mice at the
tion of compounds. end of 1, 8 or 32 weeks after exposure with respect to control.
 P. Tiwari et al. / Biochimie 121 (2016) 112e122 117

Fig. 3. DMBA induced over expression of AKT or p-AKT and the preventive effect of BA, NA or CAG alone or in concomitant combination with time (i.e. before tumor appearance: 1
or 8 weeks; after tumor appearance: 32 weeks). Three samples from each group were analyzed for AKTor p-AKTexpression and were subjected to statistical analysis (n ¼ 3).
Qualitative and quantitative analysis of AKT or p-AKT is shown at the protein level in (I and II) and at the mRNA level in (III and IV). IHC analysis of p-AKT level is shown in (IV). Bars
represent the standard deviation. *P < 0.05, **P < 0.001, ***P < 0.0001 with respect to control. 1 week, 8 weeks, 32 weeks.

DMBA application up regulated the miR-21 levels by 32, 70 or
162% in a time dependent manner at 1, 8 or 32 weeks in
comparison to control. Whereas, in the presence of BA/NA/CAG,
miR-21 levels were upregulated by 10, 35 or 72%/16, 29 or 70%/11,
40 or 82% at the end of 1, 8 or 32 weeks. Concomitant
application of BA, NA and CAG along with DMBA, miR-21
upregulation was 1, 19 or 24% at the respective time points.
Result suggests the upregulation of miR-21 during skin tumori-
genesis in time dependent manner and its enhanced prevention
by a combination of compounds. Percent change is with respect
to control.
118 P. Tiwari et al. / Biochimie 121 (2016) 112e122

Fig. 4. DMBA induced down regulation of PTEN, over expression of miR-21 and the preventive effect of BA, NA or CAG alone or in concomitant combination with time (i.e. before
tumor appearance: 1 or 8 weeks; after tumor appearance: 32 weeks). Three samples from each group were analyzed for PTEN and miR-21 expression and were subjected to
statistical analysis (n ¼ 3). Qualitative and quantitative analysis of PTEN is shown at the protein level in (I) and at the mRNA level in (II). Relative quantification of miR-21 is shown in
(III). Bars represent the standard deviation. *P < 0.05, **P < 0.001, ***P < 0.0001 with respect to control. 1 week, 8 weeks, 32 weeks.

3.7. Expression of NF-kB and cyclin-D1
NF-kB and cyclin-D1 expressions were analyzed at the protein
(Fig. 5-I, II) and mRNA level (Fig. 5- III, IV) in treated mice at the end
of 1, 8 or 32 weeks after exposure with respect to control. Initially,
NF-kB and cyclin-D1 were unaffected at the end of 1 week. After-
wards, NF-kB and cyclin-D1 expressions were upregulated in a time
dependent manner at 8 or 32 weeks by 48 or 140% and 50 or 213%
at the protein level. At the mRNA level, NF-kB and cyclin-D1
upregulation was 42 or 145% and 51 or 173% at the respective
time points. In the presence of BA/NA/CAG, NF-kB and cyclin-D1
upregulation was attenuated to 18 or 49%/20 or 52%/22 or 54%
and 21 or 65%/25 or 66%/28 or 68% respectively at the protein level.
At the mRNA level, NF-kB and cyclin-D1 upregulation was reduced
to 10 or 38%/12 or 40%/18 or 44% and 11 or 55%/15 or 56%/22 or 61%
respectively at the end of 8 or 32 weeks. Concomitant application of
BA, NA and CAG along with DMBA further attenuated the NF-kB and
cyclin-D1 upregulation to 3 or 23% and 10 or 23% at the protein
level and at the mRNA level, NF-kB and cyclin-D1 upregulation was
attenuated to 4 or 22% and 8 or 20% at the end of 8 or 32 weeks.
Result suggests the upregulation of NF-kB and cyclin-D1 during
skin tumorigenesis in a time dependent manner and enhanced
prevention by a concomitant combination of compounds. NF-kB
upregulation could be the result of PI3K/AKTpathway activation.
Whereas, cyclin-D1 upregulation could be the result of NF-kB
overexpression.
3.8. Levels of miR-20a
MiR-20a levels were analyzed in treated mice at the end of 1, 8
or 32 weeks after exposure with respect to control (Fig. 5- V).
DMBA application up regulated the miR-20a expression in a time
dependent manner at 1, 8 or 32 weeks by 21, 60 or 141%. In the
presence of BA/NA/CAG, miR-20a was upregulated by 9, 28 or 67%/
6, 27 or 71%/9, 30 or 81% at the end of 1, 8 or 32 weeks.
Concomitant application of BA, NA and CAG along with DMBA
further attenuated the miR-20a upregulation to 1, 19 or 23% at the
end of the respective time points. Result suggests the upregula-
tion of miR-20a during skin tumorigenesis in a time dependent
manner and enhanced prevention by a concomitant application of
compounds.
3.9. Status of MMP-9
MMP-9 status was analyzed at the protein (Fig. 6-I) and mRNA
level (Fig. 6- II) in treated mice at the end of 1, 8 or 32 weeks after
exposure with respect to control. Initially, MMP-9 was unaffected at
1 week. Afterwards, DMBA application upregulated the MMP-9
 P. Tiwari et al. / Biochimie 121 (2016) 112e122 119

Fig. 5. DMBA induced over expression of NF-kB or cyclin D1, over expression of miR-20a and the preventive effect of BA, NA or CAG alone or in concomitant combination with time
(i.e. before tumor appearance: 1 or 8 weeks; after tumor appearance: 32 weeks). Three samples from each group were analyzed for NF-kB, cyclin D1 and miR-20a expression and
were subjected to statistical analysis (n ¼ 3). Qualitative and quantitative analysis of NF-kB and cyclin D1 is shown at the protein level in (I and II) and at the mRNA level in (III and
IV). Relative quantification of miR-20a is shown in (V). Bars represent the standard deviation. *P < 0.05, **P < 0.001, ***P < 0.0001 with respect to control. 1 week, 8 weeks, 32
weeks.

expression in a time dependent manner at 8 or 32 weeks by 20 or
70% at the protein level and by 22 or 75% at the mRNA level. In the
presence of BA/NA/CAG, MMP-9 upregulation was attenuated to 9
or 31%/10 or 33%/11 or 35% at the protein level and at mRNA level
MMP-9 upregulation was reduced to 10 or 35%/11 or 36%/13 or 38%
at the respective time points. Concomitant application of BA, NA
and CAG along with DMBA further attenuated the MMP-9 upre-
gulation to 2 or 18% at the protein level and by 4 or 19% at the mRNA
level. Result suggests the upregulation of MMP-9 during skin
tumorigenesis in a time dependent manner and enhanced pre-
vention by a combination. MMP-9 upregulation could be the result
of NF-kB overexpression.
120 P. Tiwari et al. / Biochimie 121 (2016) 112e122

Fig. 6. DMBA induced over expression of MMP-9, down regulation of miR-211 and the preventive effect of BA, NA or CAG alone or in concomitant combination with time (i.e. before
tumor appearance: 1 or 8 weeks; after tumor appearance: 32 weeks). Three samples from each group were analyzed for MMP-9 and miR-211 expression and were subjected to
statistical analysis (n ¼ 3). Qualitative and quantitative analysis of MMP-9 is shown at the protein level in (I) and at the mRNA level in (II). Relative quantification of miR-211 is
shown in (III). Bars represent the standard deviation. *P < 0.05, **P < 0.001, ***P < 0.0001 with respect to control. 1 week, 8 weeks, 32 weeks.

3.10. Levels of miR-211
MiR-211 level was analyzed in treated mice at the end of 1, 8 or
32 weeks after DMBA exposure with respect to control (Fig. 6- III).
Initially, miR-211 was unaffected at the end of 1 week. Afterwards,
downregulation of miR-211 was observed in DMBA treated mice
just before the onset of tumors that progressed in a time dependent
manner showing 37 or 68% downregulation at 8 or 32 weeks.
Whereas, in the presence of BA/NA/CAG, miR-211 downregulated
was reduced to 17 or 35%/19 or 39%/20 or 42% at the respective time
points. The concomitant application of BA, NA and CAG along with
DMBA further reduced the miR-211 down regulation to 9 or 15% at
the end of 8 or 32 weeks. Result suggests the downregulation of
miR-211 during skin tumorigenesis in a time dependent manner
and enhanced prevention by a combination. Downregulation of
miR-211 could be the cause of MMP-9 upregulation.
4. Discussion
The rise in cancer associated morbidity and mortality increased
the interest in exploring the newer strategies for cancer prevention
[31]. Combination of compounds has been shown to exhibit
increased efficacy as compared to single compound [32]. BA, NA or
CAG have individually been shown to inhibit mouse skin tumori-
genesis following different pathways [23,24,28].
Recently, we have shown the enhanced preventive effect of BA,
NA and CAG in combination against DMBA induced deregulation of
miR-203 via modulation of epigenetic regulator and micro RNA
biogenesis regulators [27]. We also observed the enhanced pro-
apoptotic effect of BA, NA and CAG in combination [33]. Enforced
over expression of miR-203 has been shown to inhibit the
expression of phosphoinositide 3-kinase catalytic subunit alpha
(PIK3CA) thereby suppresses the PI3K/AKT pathway and promote
cell apoptosis [34].
In view of this and to explore further, we showed that the
enhanced chemopreventive efficacy of BA, NA and CAG in-
combination by inhibition of K-Ras/PI3K/AKT/NF-kB pathway and
modulation of regulatory micro RNAs (let-7a, miR-21, miR-20a, and
miR-211) in mouse skin exposed to DMBA as a function of time.
Ras proteins play an essential role in controlling the keratino-
cyte and epidermal proliferation as keratinocytes ceased to prolif-
erate and entered into senescence upon Ras elimination [3].
Phosphoinositide 3-kinases (PI3Ks) play an important role as me-
diators of Ras-mediated cell survival and proliferation [4,35].
Upregulation of K-Ras and PI3K start after 8 weeks of DMBA
exposure and progressed with time. Antitumor agents have been
shown to reduce the expression of K-Ras and PI3K [36,37]. Here also
of K-Ras and PI3K upregulation was attenuated by BA, NA or CAG
alone but it was further more attenuated by the combination of
compounds that define their critical importance during the devel-
opment of tumors. K-Ras is one of the targets of a tumor suppressor
micro RNA let-7a and lower expression of let-7a has been shown to
 P. Tiwari et al. / Biochimie 121 (2016) 112e122
be associated with over expression of K-Ras in different malig-
nancies [38e40]. In this study, let-7a downregulation appeared
even before the onset of tumor at 1 or 8 weeks and downregulation
was more with time as the tumor developed. It suggests that the K-
Ras overexpression is a result of downregulated let-7a and let-7a
downregulation is critical during the early stages of exposure
even before the onset of tumors. BA, NA or CAG alone or in
concomitant combination prevented the Let-7a downregulation
suggesting the targeting of let-7a for effective inhibition of K-Ras by
antitumor agents.
PI3K⁄AKT pathway is an important intracellular signalling
pathway [41]. So the dissection of this pathway and regulatory
micro RNAs during tumorigenesis is expected to provide an effec-
tive way of cancer control. Activated PI3K generates the second
messenger phosphatidylinositol-3,4,5-trisphosphate (PIP3), which
induces downstream phosphorylation of AKT and is involved in the
activation of survival serine/threonine kinase kinase AKT impli-
cated in cancer progression [5,42,43]. Activated AKT promotes cell
growth and survival with different mechanisms [5]. As a result of
PI3K upregulation, AKT/p-AKT is over expressed even before the
tumor develops at 8 weeks and progressed with time as tumor
developed. This upregulation of p-AKT was supported by IHC an-
alyses. Other reports also show the inhibition of AKT activation by
the antitumor agents [37]. We also show that the reduced AKT or p-
AKT upregulation is responsive to the presence of antitumor agent
BA, NA and CAG alone or in concomitant combination, supporting
the involvement of PI3K mediated activation of AKT during the
development of tumors. PI3K activity is negatively regulated by
PTEN, an important tumor suppressor protein [5]. DMBA caused the
downregulation of PTEN before the tumor developed at 8 weeks
and was further downregulated with time as the tumor progressed.
This downregulation of PTEN supports the higher level of p-AKT as
a result of increased PI3K activity. PTEN is negatively regulated by
miR-21 which is over expressed in different malignancies and is
arguably the only miRNA that is up-regulated in all types of carci-
nomas [16,44]. The upregulation of miR-21 at 1 week and its further
progression with time suggests that the PTEN downregulation
could be the result of successive miR-21 upregulation. Effects of
antitumor agent BA, NA and CAG alone or in combination on the
status of miR-21 and PTEN further supported their role in the
development of tumors.
NF-kB proteins participate downstream of PI3K/AKT pathway in
cellular growth, inflammation and neoplasia by regulating tran-
scription of multiple genes involved in these processes [45]. NF-kB,
is, very frequently activated in different tumors [7]. The NF-kB
supports pro-survival and anti-apoptotic pathways such as PI3-
kinase/AKT pathway including cyclin D1 and MMP-9 in various
cancers [7e9]. Cyclin-D1 is among the downstream transcriptional
targets of NF-kB and plays a crucial role in controlling the check-
point of G0/G1 to S phase transition in cell proliferation and
tumorigenesis [8,46]. NF-kB and cyclin D1 overexpressed at 8
weeks of DMBA exposure and were upregulated further with time.
NF-kB upregulation appeared to be a result of over expressed PI3K
and p-AKT and NF-kB overexpression could be the cause of cyclin
D1 upregulation. Cyclin D1 induces miR-17/5p and miR-20a
expression through the binding to the miR-17/20 promoter region
and miR-20a, an oncogenic micro RNA is associated with cellular
proliferation [47,48]. MiR-20a was upregulated as early as 1 week of
DMBA exposure, the time before the onset of tumors and pro-
gressed further as tumors developed with time. The response of NF-
kB, cyclin-D1 and miR-20a towards BA, NA and CAG alone or in
combination show that the over expression of miR-20a could be the
result of cyclin-D1 upregulation. NF-kB induces the expression of
MMP-9 by transcriptional activation [49]. MMP-9 play crucial role
in the invasion and metastasis of tumor cells and over expression of
121
MMP-9 has been observed in metastatic tumor tissues [11,12].
MMP-9 is negatively regulated by miR-211 [18,19]. In view of this,
the downregulation of miR-211 at 8 weeks of DMBA exposure
resulted in the upregulation of MMP-9 in a time dependent
manner. The response towards BA, NA and CAG alone or in com-
bination supports the authenticity of the observations. We can say
that the upregulation of MMP-9 might be the result of NF-kB over
expression and miR-211 downregulation during the development
of tumors.
Our study suggested thr involvement of over expressed K-Ras,
PI3K, AKT, p-AKT, NF-kB, Cyclin D1 and MMP-9 during skin
tumorigenesis. It also suggested the correlation between the
reduced level of let-7a with over expressed K-Ras, over expressed
miR-21 with a reduced level of PTEN, over expressed Cyclin D1 with
over expressed miR-20a and downregulated miR-211 with over
expressed MMP-9 in DMBA induced skin tumorigenesis. Inhibition
of these DMBA induced changes by BA, NA and CAG individually or
in combination could be related to their anti-tumor effect. Although
the combination of the compound was more effective, that suggests
the enhanced chemopreventive potential of natural compound in
combination. Thereby, the targeting of this pathway by a combi-
nation of compounds will provide an effective means of cancer
prevention.
Conflict of interest
There is no conflict of interest among the authors.
Acknowledgments
Authors thank the Director, CSIR-Indian Institute of Toxicology
Research, Lucknow, for his support. Financial support was provided
by the Council of Scientific and Industrial Research, Department of
Science and Technology and University Grants Commission (UGC),
New Delhi, India.
References
[1] L. Hou, X. Zhang, D. Wang, A. Baccarelli, Environmental chemical exposures
and human epigenetics, Int. J. Epidemiol. 41 (2012) 79e105.
[2] R.T. Narendhirakannan, M.A.C. Hannah, Oxidative stress and skin cancer: an
overview, Indian J. Clin. Biochem. 28 (2013) 110e115.
[3] M. Drosten, C.G. Lechuga, M. Barbacid, Ras signaling is essential for skin
development, Oncogene 33 (2014) 2857e2865.
[4] E. Grabocka, Y. Pylayeva-Gupta, M.J. Jones, V. Lubkov, E. Yemanaberhan,
L. Taylor, et al., Wild-type H-and N-Ras promote mutant K-Ras-driven
tumorigenesis by modulating the DNA damage response, Cancer Cell 25
(2014) 243e256.
[5] L. Liu, S. Zhu, Z. Gong, B.C. Low, K-ras/PI3K-AKTsignaling is essential for
zebrafish hematopoiesis and angiogenesis, PLoS One 3 (2008) e2850.
[6] K. Hertzler-Schaefer, G. Mathew, A.K. Somani, S. Tholpady, M.P. Kadakia,
Y. Chen, et al., Pten loss induces autocrine FGF signalling to promote skin
tumorigenesis, Cell Rep. 6 (2014) 818e826.
[7] N. Ghosh-Choudhury, C.C. Mandal, G. Ghosh-Choudhury, Simvastatin induces
derepression of PTEN expression via NF-kB to inhibit breast cancer cell
growth, Cell. Signal. 22 (2010) 749e758.
[8] W. Ouyang, W. Luo, D. Zhang, J. Jian, Q. Ma, J. Li, et al., PI-3K/AKTpathway-
dependent cyclin D1 expression is responsible for arsenite-induced human
keratinocyte transformation, Environ. Health Perspect. 116 (2008) 1e6.
[9] J.C. Cheng, C.H. Chou, M.L. Kuo, C.Y. Hsieh, Radiation-enhanced hepatocellular
carcinoma cell invasion with MMP-9 expression through PI3K/Akt/NF-kB
signal transduction pathway, Oncogene 25 (2006) 7009e7018.
[10] D. Resnitzky, M. Gossen, H. Bujard, S.I. Reed, Acceleration of the G1/S phase
transition by expression of cyclins D1 and E with an inducible system, Mol.
Cell. Biol. 14 (1994) 1669e1679.
[11] S.D. Farris, J.H. Hu, R. Krishnan, I. Emery, T. Chu, L. Du, et al., Mechanisms of
urokinase plasminogen activator (uPA)-mediated atherosclerosis: role of the
uPA receptor and S100A8/A9 proteins, J. Biol. Chem. 286 (2011)
22665e22677.
[12] C.L. Liao, K.C. Lai, A.C. Huang, J.S. Yang, J.J. Lin, S.H. Wu, et al., Gallic acid in-
hibits migration and invasion in human osteosarcoma U-2 OS cells through
suppressing the matrix metalloproteinase-2/-9, protein kinase B (PKB) and
PKC signaling pathways, Food Chem. Toxicol. 50 (2012) 1734e1740.
122 P. Tiwari et al. / Biochimie 121 (2016) 112e122
[13] B. Zhang, X. Pan, G.P. Cobb, T.A. Anderson, microRNAs as oncogenes and tumor
suppressors, Dev. Biol. 302 (2007) 1e12.
[14] S.M. Johnson, H. Grosshans, J. Shingara, M. Byrom, R. Jarvis, A. Cheng, et al.,
RAS is regulated by the let-7 microRNA family, Cell 120 (2005) 635e647.
[15] S. Volinia, G.A. Calin, C.G. Liu, S. Ambs, A. Cimmino, F. Petrocca, et al.,
A microRNA expression signature of human solid tumors defines cancer gene
targets, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 2257e2261.
[16] X. Ma, M. Kumar, S.N. Choudhury, L.E.B. Buscaglia, J.R. Barker,
K. Kanakamedala, et al., Loss of the miR-21 allele elevates the expression of its
target genes and reduces tumorigenesis, Proc. Natl. Acad. Sci. 108 (2011)
10144e10149.
[17] A. Esquela-Kerscher, F.J. Slack, OncomirsdmicroRNAs with a role in cancer,
Nat. Rev. Cancer 6 (2006) 259e269.
[18] C. Levy, M. Khaled, D. Iliopoulos, M.M. Janas, S. Schubert, S. Pinner, et al.,
Intronic miR-211 assumes the tumor suppressive function of its host gene in
melanoma, Mol. Cell 40 (2010) 841e849.
[19] S. Asuthkar, K.K. Velpula, C. Chetty, B. Gorantla, J.S. Rao, Epigenetic regulation
of miRNA-211 by MMP-9 governs glioma cell apoptosis, chemosensitivity and
radiosensitivity, Oncotarget 3 (2012) 1439e1454.
[20] C.J. Weng, G.C. Yen, The in vitro and in vivo experimental evidences disclose
the chemopreventive effects of Ganoderma lucidum on cancer invasion and
metastasis, Clin. Exp. Metastasis 27 (2010) 361e369.
[21] Y. Li, D. Kong, Z. Wang, F.H. Sarkar, Regulation of microRNAs by natural
agents: an emerging field in chemoprevention and chemotherapy research,
Pharm. Res. 27 (2010) 1027e1041.
[22] K.P. Gupta, N.K. Mehrotra, Differential effects of butyric acid on mouse skin
tumorigenesis, Biomed. Environ. Sci. 10 (1997) 436e441.
[23] M. Waldecker, T. Kautenburger, H. Daumann, C. Busch, D. Schrenk, Inhibition
of histone-deacetylase activity by short-chain fatty acids and some poly-
phenol metabolites formed in the colon, J. Nutr. Biochem. 19 (2008) 587e593.
[24] K.P. Gupta, R. Rani, Effect of nicotinamide on 12-O-tetradecanoyl-phorbol-13-
acetate exposed mouse skin endonuclease activity and DNA synthesis, Bio-
med. Environ. Sci. 13 (2000) 122e130.
[25] Z. Walaszek, M. Hanausek, T.J. Slaga, Mechanisms of chemoprevention, CHEST
J. 125 (2004) 128Se133S.
[26] J. Singh, K.P. Gupta, Calcium glucarate prevents tumor formation in mouse
skin, Biomed. Environ. Sci. 16 (2003) 9e16.
[27] P. Tiwari, K.P. Gupta, Modulation of miR-203 and its regulators as a function of
time during the development of 7, 12 dimethylbenz [a] anthracene induced
mouse skin tumors in presence or absence of the antitumor agents, Toxicol.
Appl. Pharmacol. 278 (2014) 148e158.
[28] J. Singh, K.P. Gupta, Induction of apoptosis by calcium D-glucarate in 7,12-
dimethyl benz [a] anthracene-exposed mouse skin, J. Environ. Pathol. Tox-
icol. Oncol. 26 (2007) 63e73.
[29] N.K. Gupta, K.P. Gupta, Effects of C-Phycocyanin on the representative genes
of tumor development in mouse skin exposed to 12-O-tetradecanoyl-phor-
bol-13-acetate, Environ. Toxicol. Pharmacol. 34 (2012) 941e948.
[30] M. Pandey, K.P. Gupta, Involvement of STAT3, NF-kB and associated down-
stream molecules before and after the onset of urethane induced lung tumors
in mouse, Environ. Toxicol. Pharmacol. 34 (2012) 502e511.
[31] N.P. Gullett, A.R. Ruhul Amin, S. Bayraktar, J.M. Pezzuto, D.M. Shin, F.R. Khuri,
et al., Cancer prevention with natural compounds, Semin. Oncol. 37 (2010)
258e281.
[32] R.H. Liu, Potential synergy of phytochemicals in cancer prevention: mecha-
nism of action, J. Nutr. 134 (2004) 3479Se3485S.
[33] P. Tiwari, S. Sahay, M. Pandey, S.S. Qadri, K.P. Gupta, Combinatorial chemo-
preventive effect of butyric acid, nicotinamide and calcium glucarate against
the 7,12-dimethylbenz(a)anthracene induced mouse skin tumorigenesis
attained by enhancing the induction of intrinsic apoptotic events, Chem. Biol.
Interact. 226 (2014) 1e11.
[34] X.F. Ke, J. Fang, X.N. Wu, C.H. Yu, MicroRNA-203 accelerates apoptosis in LPS-
stimulated alveolar epithelial cells by targeting PIK3CA, Biochem. Biophys.
Res. Commun. 450 (2014) 1297e1303.
[35] E. Castellano, J. Downward, Role of RAS in the regulation of PI 3-kinase, Curr.
Top. Microbiol. Immunol. 346 (2011) 143e169.
[36] S.B. Bharate, B. Singh, B.R.A. Vishwakarma, Modulation of k-Ras signaling by
natural products, Curr. Med. Chem. 19 (2012) 2273e2291.
[37] H. Jiang, X. Shang, H. Wu, S.C. Gautam, S. Al-Holou, C. Li, , et al.J. Kuo, L. Zhang,
M. Chopp, Resveratrol downregulates PI3K/Akt/mTOR signaling pathways in
human U251 glioma cells, J. Exp. Ther. Oncol. 8 (2009) 25e33.
[38] B.C. Christensen, B.J. Moyer, M. Avissar, L.G. Ouellet, S.L. Plaza, M.D. McClean,
et al., A let-7 microRNA-binding site polymorphism in the KRAS 30 UTR is
associated with reduced survival in oral cancers, Carcinogenesis 30 (2009)
1003e1007.
[39] A.J. O'Hara, L. Wang, B.J. Dezube, W.J. Harrington, B. Damania, D.P. Dittmer,
Tumor suppressor microRNAs are under represented in primary effusion
lymphoma and Kaposi sarcoma, Blood 113 (2009) 5938e5941.
[40] W. Zhang, T. Winder, Y. Ning, A. Pohl, D. Yang, M. Kahn, et al., A let-7
microRNA-binding site polymorphism in 30 -untranslated region of KRAS gene
predicts response in wild-type KRAS patients with metastatic colorectal
cancer treated with cetuximab monotherapy, Ann. Oncol. 22 (2011) 104e109.
[41] B.T. Hennessy, D.L. Smith, R.T. Ram, Y. Lu, G.B. Mills, Exploiting the PI3K/
AKTpathway for cancer drug discovery, Nat. Rev. Drug Discov. 4 (2005)
988e1004.
[42] C. Hafner, M. Landthaler, T. Vogt, Activation of the PI3K⁄AKTsignalling
pathway in non-melanoma skin cancer is not mediated by oncogenic PIK3CA
and AKT1 hotspot mutations, Exp. Dermatol. 19 (2010) e222e7.
[43] R. Joseph, B. Alfanso, AKTplays a central role in tumorigenesis, Proc. Natl.
Acad. Sci. 98 (2001) 10983e10985.
[44] S. Volinia, M. Galasso, S. Costinean, L. Tagliavini, G. Gamberoni, A. Drusco, et
al., Reprogramming of miRNA networks in cancer and leukemia, Genome Res.
20 (2010) 589e599.
[45] B. Rayet, C. Gelinas, Aberrant rel/nfkb genes and activity in human cancer,
Oncogene 18 (1999) 6938e6947.
[46] V. See, N.K. Rajala, D.G. Spiller, M.R. White, Calcium dependent regulation of
the cell cycle via a novel MAPKeNF-kB pathway in Swiss 3T3 cells, J. Cell Biol.
166 (2004) 661e672.
[47] Z. Yu, C. Wang, M. Wang, Z. Li, M.C. Casimiro, M. Liu, et al., A cyclin D1/
microRNA 17/20 regulatory feedback loop in control of breast cancer cell
proliferation, J. Cell Biol. 182 (2008) 509e517.
[48] K.A. O'Donnell, E.A. Wentzel, K.I. Zeller, C.V. Dang, J.T. Mendell, c-Myc regu-
lated micro RNAs modulate E2F1 expression, Nature 435 (2005) 839e843.
[49] C.B. Yeh, M.J. Hsieh, Y.H. Hsieh, M.H. Chien, H.L. Chiou, S.F. Yang, Anti-
metastatic effects of norcantharidin on hepatocellular carcinoma by tran-
scriptional inhibition of MMP-9 through modulation of NF-kB activity, PLoS
One 7 (2012) e31055.