Li 2018

Article
Aerobic Glycolysis Controls Myeloid-Derived

Suppressor Cells and Tumor Immunity via a Specific
CEBPB Isoform in Triple-Negative Breast Cancer
Graphical Abstract Authors
Wei Li, Takashi Tanikawa,
Ilona Kryczek, ..., Kaixiong Tao,
Guobin Wang, Weiping Zou
Correspondence
kaixiongtao@hust.edu.cn (K.T.),
wgb@hust.edu.cn (G.W.),
wzou@med.umich.edu (W.Z.)
In Brief
Tumor-derived myeloid-derived
suppressor cells (MDSCs) are critical
tumor immunosuppression components.
Li et al. show that the high glycolytic rate
in triple-negative breast cancer cells is
associated with MDSC promotion
through an AMPK-ULK1 and autophagy
pathway. Glycolysis restriction inhibits
tumor G-CSF and GM-CSF and
consequently MDSC development.
Highlights
d Aerobic glycolysis affects G-CSF and GM-CSF expression
in TNBC
d Aerobic glycolysis regulates CEBPB isoform, LAP, via AMPK-

ULK1-autophagy pathway
d LAP controls G-CSF and GM-CSF expression and MDSC

development
d Aerobic glycolysis impacts tumor immunity and patient

outcome through MDSCs
Li et al., 2018, Cell Metabolism 28, 1–17

July 3, 2018 Published by Elsevier Inc.
https://doi.org/10.1016/j.cmet.2018.04.022
Please cite this article in press as: Li et al., Aerobic Glycolysis Controls Myeloid-Derived Suppressor Cells and Tumor Immunity via a Specific CEBPB
Isoform in Triple-Negative Breast Cancer, Cell Metabolism (2018), https://doi.org/10.1016/j.cmet.2018.04.022
Cell Metabolism
Article
Aerobic Glycolysis Controls Myeloid-Derived

Suppressor Cells and Tumor Immunity via a Specific
CEBPB Isoform in Triple-Negative Breast Cancer
Wei Li,1,2 Takashi Tanikawa,1 Ilona Kryczek,1 Houjun Xia,1 Gaopeng Li,1 Ke Wu,2 Shuang Wei,1 Lili Zhao,3 Linda Vatan,1
Bo Wen,4 Pan Shu,4 Duxin Sun,4,5 Celina Kleer,6 Max Wicha,5,7 Michael Sabel,1,5 Kaixiong Tao,2,* Guobin Wang,2,*
and Weiping Zou1,5,6,8,9,*
1Department of Surgery, University of Michigan School of Medicine, BSRB, 109 Zina Pitcher Place, Ann Arbor, MI 48109-0669, USA
2Department of Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Jiefang Avenue 1277,
Wuhan, Hubei 430022, China
3Department of Biostatistics, University of Michigan School of Medicine, Ann Arbor, MI, USA
4Department of Pharmaceutical Sciences, University of Michigan College of Pharmacy, Ann Arbor, MI, USA
5University of Michigan Rogel Cancer Center, University of Michigan School of Medicine, Ann Arbor, MI, USA
6Department of Pathology, University of Michigan School of Medicine, Ann Arbor, MI, USA
7Department of Medicine, University of Michigan School of Medicine, Ann Arbor, MI, USA
8Graduate Programs in Immunology and Tumor Biology, University of Michigan School of Medicine, Ann Arbor, MI, USA
9Lead Contact
*Correspondence: kaixiongtao@hust.edu.cn (K.T.), wgb@hust.edu.cn (G.W.), wzou@med.umich.edu (W.Z.)

https://doi.org/10.1016/j.cmet.2018.04.022
SUMMARY These reprogrammed activities are recognized as hallmarks of

cancer (Hanahan and Weinberg, 2011). Interestingly, recent
Myeloid-derived suppressor cells (MDSCs) inhibit work has shown that tumors actively reprogram metabolic path-
anti-tumor immunity. Aerobic glycolysis is a hallmark ways to evade effective anti-tumor immunity. It has been re-
of cancer. However, the link between MDSCs and ported that glycolysis regulates T cell activation and effector
glycolysis is unknown in patients with triple-negative function (Chang et al., 2013; Gubser et al., 2013). Given that nu-
breast cancer (TNBC). Here, we detect abundant trients, including glucose, are poorly replenished in the tumor, it
is assumed that T cell glycolytic metabolism has been altered
glycolytic activities in human TNBC. In two TNBC
due to the Warburg effect in the tumor microenvironment (Brand
mouse models, 4T1 and Py8119, glycolysis restriction
et al., 2016; Chang et al., 2013, 2015; Ho et al., 2015; Zhao et al.,
inhibits tumor granulocyte colony-stimulating factor 2016). In support of this, tumor glycolysis can alter effector mem-
(G-CSF) and granulocyte macrophage colony- ory (Brand et al., 2016; Chang et al., 2015; Zhao et al., 2016) and
stimulating factor (GM-CSF) expression and reduces naive (Xia et al., 2017) T cell function in the tumor microenviron-
MDSCs. These are accompanied with enhanced ment and tumor-draining lymph nodes. Furthermore, the oxy-
T cell immunity, reduced tumor growth and metas- gen-sensing prolyl-hydroxylase proteins (Clever et al., 2016),
tasis, and prolonged mouse survival. Mechanistically, necrotic cells releasing potassium ions (Eil et al., 2016), and
glycolysis restriction represses the expression of a abnormal zinc metabolism (Singer et al., 2016) can impair
specific CCAAT/enhancer-binding protein beta effector T cell function in the tumor microenvironment. In addi-
(CEBPB) isoform, liver-enriched activator protein tion to T cells, recent studies have shown that natural killer cell
function is impaired by tumor glycolysis (Brand et al., 2016)
(LAP), via the AMP-activated protein kinase (AMPK)-
and myeloid dendritic cells (Cubillos-Ruiz et al., 2015), and reg-
ULK1 and autophagy pathways, whereas LAP controls
ulatory T cells (Maj et al., 2017) are functionally altered by oxida-
G-CSF and GM-CSF expression to support MDSC tive stress in the tumor microenvironment.
development. Glycolytic signatures that include Myeloid-derived suppressor cells (MDSCs) are a chief compo-
lactate dehydrogenase A correlate with high MDSCs nent of immunosuppressive networks (Gabrilovich et al., 2012;
and low T cells, and are associated with poor human Huang et al., 2006; Kusmartsev et al., 2000; Ma et al., 2011;
TNBC outcome. Collectively, tumor glycolysis orches- Zou, 2005). Human MDSCs inhibit T cell immunity and promote
trates a molecular network of the AMPK-ULK1, auto- cancer stem-like properties in the tumor microenvironment in
phagy, and CEBPB pathways to affect MDSCs and patients with cancer (Cui et al., 2013; Peng et al., 2016). Tumor
maintain tumor immunosuppression. cells secrete a variety of factors, including granulocyte colony-
stimulating factor (G-CSF) and granulocyte macrophage col-
ony-stimulating factor (GM-CSF), to promote MDSC develop-
INTRODUCTION ment (Gabrilovich et al., 2012; Morales et al., 2010; Shojaei
et al., 2009). However, the potential link between MDSCs and tu-
Tumors reprogram metabolic pathways to meet the bioener- mor glycolysis is not established in patients with breast cancer,
getic, biosynthetic, and redox demands of malignant cells. including triple-negative breast cancer (TNBC).
Cell Metabolism 28, 1–17, July 3, 2018 Published by Elsevier Inc. 1

A B C
0.010 r = 0.49, p < 0.0001 0.010 r = 0.36, p < 0.0001 0.010 r = 0.45, p < 0.0001
0.008 0.008 0.008
CSF3
CSF3
0.006 0.006
CSF3
0.006
0.004 0.004 0.004
0.002 0.002 0.002
0.000 0.000 0.000

0.0 0.5 1.0 1.5 2.0 2.5 0.0 0.5 1.0 1.5 0.0 0.1 0.2 0.3 0.4 0.5
LDHA HK1 GPI
D E F G H
0.010 1.2 Py8119
r = 0.34, p < 0.0001 0.010
r = 0.55, p < 0.0001 4T1 1.2 9 4T1
G-CSF mRNA fold change

1.0 8
0.008 0.008 1.0
7
G-CSF (ng/ml)
0.8 0.8 6
CSF3
0.006 0.006
*
CSF3
5
0.6 0.6
4
0.004 0.004
0.4 0.4 3
0.002 0.002
* 2 *
0.2 0.2
1
0.000 0.000 0 0 0
0.00 0.05 0.10 0.15 0.00 0.01 0.02 0.03
2-DG - + 2-DG - + 2-DG - +
PKM2 PFKM
I J L M
Scr shLDHA1 shLDHA2
70 Py8119 LDHA 1.2 4T1 1.2
1 2 Py8119

60 1 0.02 0.01 1.0 1.0

50
G-CSF (pg/ml)
β-actin 0.8 0.8

40
K 0.6 0.6
30 Scr shLDHA1 shLDHA2 *
0.4 * 0.4
20 * *
LDHA *
10 0.2 0.2
1 0.19 0.004
0 0 0
2-DG - + β-actin Scr shLDHA1 shLDHA2 Scr shLDHA1 shLDHA2
N O P
Scramble shLDHA1 shLDHA2
70 4T1 500 Py8119
60
400
G-CSF (pg/ml)
G-CSF (ng/ml)
50
40 300
*
30 200
* DAPI DAPI DAPI
20 * * G-CSF G-CSF G-CSF
100
10
0 0
Scr shLDHA1shLDHA2 Scr shLDHA1 shLDHA2
Figure 1. Glycolysis Regulates Tumor G-CSF and GM-CSF Expression

(A–E) Correlations between G-CSF and glycolysis enzymes. Expression of lactate dehydrogenase A (LDHA) (A), hexokinase-1 (HK1) (B), glucose-6-phosphate
isomerase (GPI) (C), pyruvate kinase muscle isozyme 2 (PKM2) (D), and phosphofructokinase muscle subunit gene (PFKM) (E) was analyzed based on the dataset
containing 250 TNBC patients. Gene expression was normalized to b-actin. Pearson’s correlation was calculated.
(legend continued on next page)

2 Cell Metabolism 28, 1–17, July 3, 2018
TNBC has been characterized by several aggressive clinical S1C–S1F) expression in TNBC. Thus, glycolytic profile correlates
features—including high rates of metastasis, recurrence, and with G-CSF and GM-CSF expression in human TNBC.
poor survival—compared with those with no-TNBC breast can- To biologically validate this correlation, we treated mouse 4T1
cers (Bauer et al., 2007; Bianchini et al., 2016; Harris et al., and Py8119 cells (Gibby et al., 2012), two TNBC cells, with
2016; Schott and Hayes, 2012). In the present work, we have 2-deoxy-D-glucose (2-DG). 2-DG is a glycolysis inhibitor and
focused our studies on TNBC. We have examined the interac- competitively inhibits the production of glucose-6-phosphate. As
tions between glycolytic metabolism and immune system in expected, 2-DG reduced extracellular acidification rates (ECARs)
two mouse TNBC models and extended our research to patients (Figure S1G) and lactate levels (Figure S1H) in 4T1 cells. Interest-
with TNBC. We have found that tumor glycolysis regulates the ingly, 2-DG suppressed G-CSF mRNA (Figures 1F and 1G) and
expression of the secondary isoform of CCAAT/enhancer-bind- protein (Figures 1H and 1I) but had no effect on interleukin-1b
ing protein beta (CEBPB), liver-enriched activator protein (LAP), (IL-1b) expression in 4T1 (Figure S1I) and transforming growth
via the AMP-activated protein kinase (AMPK)-ULK1, and auto- factor b (TGF-b) expression in Py8119 cells (Figure S1J). In addi-
phagy-signaling pathways; LAP subsequently controls the tion, 2-DG suppressed GM-CSF expression in 4T1 and Py8119
expression of G-CSF and GM-CSF in tumor cells and conse- (Figures S1K and S1L). 2-DG induced 4T1 cell apoptosis but had
quently affects MDSC development, anti-tumor immunity, and no effect on Py8119 cell apoptosis as shown by Annexin V and
TNBC outcome. 7-aminoactinomycin D (7AAD) staining (Figure S1M). As 2-DG
treatment resulted in less than 5% of tumor cell apoptosis (Fig-
RESULTS ure S1M), apoptotic cell loss was an unlikely cause of the inhibitory
effect of 2-DG on tumor cell G-CSF expression. LDHA is a rate-
Glycolysis Regulates Tumor G-CSF and GM-CSF limiting enzyme in glycolysis processes. It reduces the replenish-
Expression ment of NAD+, indirectly reduces GAPDH function, and catalyzes
Aerobic glycolysis affects effector T cell phenotype and function pyruvate to lactate. Genetic knockdown of LDHA (LDHA KD)
in patients with cancer (Chang et al., 2015; Zhao et al., 2016). Hu- with two specific short hairpin RNAs (shRNAs) (shLDHA1 and
man MDSCs inhibit tumor immunity and endow stem-like proper- shLDHA2) (Figures 1J and 1K) inhibited glycolysis as shown by
ties to cancer cells in patients with cancer, including TNBC (Cui reduced ECAR (Figure S1N) and lactate production (Figure S1O).
et al., 2013; Peng et al., 2016). TNBC patients have weak anti-tu- Consistent with the effect of 2-DG on G-CSF and GM-CSF expres-
mor immunity and poor survival with limited therapeutic option sion (Figures 1F–1I), our gene array revealed that G-CSF and GM-
(Bauer et al., 2007; Harris et al., 2016; Schott and Hayes, 2012). CSF were among the top reduced five to ten genes in shLDHA1-
It is unknown whether cancer aerobic glycolysis plays a role in expressing 4T1 cells (Figure S1P). As a confirmation, we found
MDSC development, subsequently affecting tumor immunity that LDHA KD caused reduced G-CSF mRNA expression (Figures
and outcomes in TNBC patients. To address these questions, 1L and 1M) and protein levels, as detected with ELISA (Figures 1N
we evaluated and compared the metabolism profiles of TNBC and 1O), as well as by in situ intracellular cytokine staining (Fig-
and non-TNBC breast cancer in the Cancer Genome Atlas ure 1P) in 4T1 and Py8119 cells, but had no effect on TGF-b
Network database (Koboldt et al., 2012). Gene set enrichment expression (Figures S1Q and S1R). We observed a similar effect
analysis (GSEA) demonstrated that TNBC exhibited an enriched of shLDHAs on GM-CSF expression in 4T1 (Figure S1S) and
glycolysis profile (Figure S1A) rather than an oxidative phosphor- Py8119 cells (Figure S1T). Similarly, LDHA KD in human TNBC
ylation profile (Figure S1B) as compared with other types of breast MDA-MB-231 cells (Figures S1U and S1V) caused reduced GM-
cancer (Koboldt et al., 2012). G-CSF and GM-CSF control MDSC CSF protein expression (Figure S1W). In addition to 4T1, Py8119,
development in cancer (Gabrilovich et al., 2012; Morales et al., and MDA-MB-231 cells, we included five additional non-TNBC
2010; Shojaei et al., 2009). To explore the potential relationship tumor cells in the study. These cells expressed minimal levels of
between tumor glycolysis and MDSCs in human TNBC, we hy- G-CSF and/or moderate levels of GM-CSF (Figures S1X and
pothesized that tumor glycolysis affected expression of G-CSF S1Y). LDHA KD (Figure S1Z) had no effect on their production of
and GM-CSF to regulate MDSC development. To test this hy- G-CSF (Figure S1X) and GM-CSF (Figure S1Y). Thus, tumor glycol-
pothesis, we initially analyzed Oncomine TNBC dataset (Curtis ysis promotes G-CSF and GM-CSF expression in TNBC cells.
et al., 2012). We found that the expression levels of multiple key
glycolytic enzymes, including lactate dehydrogenase A (LDHA), Glycolysis Targets CEBPB Isoform LAP to Control G-CSF
hexokinase-1, glucose-6-phosphate isomerase, phosphofructo- and GM-CSF Expression
kinase muscle subunit gene, and pyruvate kinase muscle isozyme We next dissected the molecular mechanism by which glycolysis
2, correlated with G-CSF (Figures 1A–1E) and GM-CSF (Figures regulates G-CSF and GM-CSF expression in breast cancer cells.
(F–I) Effect of 2-DG on tumor G-CSF expression. 4T1 (F and H) and Py8119 (G and I) cells were treated with 5 mM 2-DG for 12 hr. G-CSF transcript was quantified
by real-time PCR (F and G) and G-CSF protein was measured in culture supernatant with ELISA (H and I) (n = 3/group, one of three experiments is shown,
*p < 0.001).
(J and K) Effect of shLDHAs on tumor LDHA expression. Immunoblot analysis of LDHA knockdown (KD) by shLDHAs (shLDHA1 and shLDHA2) in 4T1 cells (J) and
Py8119 cells (K). Scramble shRNA (Scr) was used as control. One of three experiments is shown.
(L–O) Effect of shLDHAs on tumor G-CSF expression. Scramble and shLDHA-expressing 4T1 and Py8119 cells were cultured for 24 and 48 hr, respectively.
G-CSF transcript was quantified by real-time PCR (L and M) and G-CSF protein was measured in culture supernatant with ELISA (N and O) (n = 3/group, one of
three experiments is shown, *p < 0.003). Data represent mean ± SEM.
(P) Immunofluorescence staining. Scramble and LDHA KD 4T1 cells were cultured for 48 hr and were stained with primary antibody anti-G-CSF and secondary
antibody conjugated with Alexa Fluor 594. Scale bar, 20 mm. One of three experiments is shown.
Cell Metabolism 28, 1–17, July 3, 2018 3

A B C
1.2 4T1 4T1 4T1 Py8119
60
1.0 50 0h 2h 4h 0 2h 4h 2-DG
G-CSF (ng/ml)
0.8 40 LAP*
0.6
* 30
0.4
* 20 *
* LAP
0.2 10
1 0.62 0.50 1 0.77 0.54
0 0
β-actin
D E F
4T1 Py8119 4.0
*

Scr shLDHA1 Scr shLDHA1 Con LAP* LAP*mut LAP 3.5
LAP* LAP* 3.0

2.5
2.0
LAP *
1.5
LAP
1 1.5 1.1 6.3 1.0
1 0.32 1 0.43
0.5
β-actin β-actin
0
Con LAP* LAP*mut LAP
G H I J
10 2.0 *
*
25
*
G-CSF mRNA fold changed
9 1.8
Con LAP KO LAP OE
8 1.6 20
* *
G-CSF (ng/ml)
7 1.4
G-CSF (ng/ml)
6 1.2 * 15 LAP*
5 1.0
4 0.8 10
3 0.6 LAP
2 0.4 5
1 0.2 1 0 3.8
0 0 0 Actin
Con LAP* LAP*mut LAP Scr shLDHA1 shLDHA+LAP Scr shLDHA1 shLHDA+LAP
K L M
6 90 *
*
80 CTR LAP KO LAP OE

5
G-CSF protein (ng/ml)
70
4 60
3
50 *
40
2 30
*
20
1
10
0 0
Scr LAP KO LAP OE Scr LAP KO LAP OE DAPI DAPI DAPI
G-CSF G-CSF G-CSF
Figure 2. Glycolysis Targets CEBPB Isoform LAP to Control G-CSF Expression

(A and B) Effect of shCEBPB on tumor G-CSF expression. Scramble and shCEBPB (shCEBPB1 and shCEBPB2)-infected 4T1 cells were cultured for 24 hr. G-CSF
transcript was quantified by real-time PCR (A) and G-CSF protein was measured in culture supernatant with ELISA (B) (n = 3/group, one of three experiments is
shown, *p < 0.003).
(C) 4T1 and Py8119 cells were treated with 2-DG (10 mM) for different times. Tumor CEBPB isoforms were detected by western blotting. One of three experiments
is shown.
CEBPB may regulate G-CSF expression in hematopoietic stem Glycolysis Targets LAP via the AMPK-ULK1 Pathway
cells (Akagi et al., 2008) and myeloid cells (Marigo et al., 2010). Next, we studied how glycolysis controlled LAP expression in
We hypothesized that CEBPB controlled G-CSF expression in tumor cells. Glycolysis is the predominant pathway to generate
breast cancer cells. To test this hypothesis, we genetically ATP for many tumor cells. Glycolysis inhibition can lead to
knocked down CEBPB with two specific shRNAs (shCEBPB1 increased AMP and ATP ratios in tumor cells (Pradelli et al.,
and shCEBPB2) (Figures S2A and S2B). CEBPB shRNAs 2010). AMPK is a central sensor for energy stress in cells (Kim
reduced G-CSF transcripts (Figure 2A) and protein expression et al., 2011). In line with this, we observed that treatment with
(Figure 2B) in breast cancer cells. Thus, CEBPB controls 2-DG (Figure S3A) and LDHA KD with shLDHA (Figure S3B)
G-CSF expression in breast cancer cells. increased the AMP and ATP ratios in breast cancer cells.
We wondered whether glycolysis affected CEBPB expression Furthermore, 2-DG treatment (Figure 3A) and LDHA KD (Fig-
and in turn regulated G-CSF expression. To test this, we treated ure 3B) activated the AMPK-ULK1 pathway in 4T1 and
breast cancer cells with 2-DG and assessed the expression of Py8119 cells. To investigate if the AMPK-ULK1 pathway
CEBPB. CEBPB mRNA produces four N-terminally truncated affected the expression of LAP, we treated LDHA KD tumor
isoforms: a 38-kDa full-length CEBPB (LAP*), a 34-kDa LAP, a cells with dorsomorphin, a specific AMPK inhibitor. Dorsomor-
21-kDa liver-enriched inhibitory protein (LIP), and a 14-kDa iso- phin inhibited AMPK phosphorylation (Figure 3C) and recovered
form through alternative translation from different AUG (Schrem LAP protein level (Figure 3D) and G-CSF expression (Figure 3E)
et al., 2004) (Figure S2C). We found that 2-DG treatment exclu- in a dose-dependent manner. Similarly, ULK1 knockdown
sively and efficiently reduced the expression levels of the with small interfering RNA (siRNA) restored LAP protein level
second isoform of CEBPB, LAP, in both 4T1 and Py8119 cells (Figure 3F), and G-CSF mRNA (Figures 3G and 3H) and protein
(Figure 2C). This suggests that glycolysis inhibition may reduce (Figures 3I and 3J) in 4T1 and Py8119 cells, which expressed
LAP expression. In support of this notion, knockdown of LDHA specific shLDHA. Thus, glycolysis may regulate tumor G-CSF
exclusively resulted in decreased LAP expression in 4T1 and expression by controlling LAP expression via the AMPK and
Py8119 cells (Figure 2D). We questioned whether LAP regulated ULK1 pathway.
G-CSF expression in breast cancer cells. To examine this, we
constructed the vectors expressing LAP*, LAP* mutant, or Glycolysis Controls LAP Expression via Autophagy
LAP (Figures 2E and S2D). Forced expression of LAP* and Activation
LAP, but not LAP* mutant, promoted G-CSF transcription (Fig- We further explored the mechanism by which the AMPK
ure 2F) and protein expression (Figure 2G) in the breast cancer pathway controlled the LAP expression. Autophagy can
cells. CEBPB isoforms had no effect on TGF-b (Figure S2E) and degrade cytoplasmic proteins and organelles during stress
MMP9 (Figure S2F) expression. LAP also promoted GM-CSF conditions (Klionsky and Emr, 2000). ULK1 is an essential
expression (Figure S2G). In addition, we conducted two rescue component of autophagy initial complex (Ganley et al., 2009),
experiments. First, we expressed LAP in shLDHA-expressing and AMPK activation induces autophagy via phosphorylation
tumor cells and found that forced LAP expression recovered of ULK1 (Alers et al., 2012; Kim et al., 2011). Given that glycol-
G-CSF transcript (Figure 2H) and protein (Figure 2I) expression ysis restriction activated the AMPK-ULK1 pathway (Figures 3A
in shLDHA tumor cells. Second, we expressed LAP in and 3B), we hypothesized that autophagy affected LAP expres-
shCEBPB tumor cells and observed that expression of LAP sion. We observed that 2-DG treatment (Figure 4A) and LDHA
recovered G-CSF expression in shCEBPB tumor cells (Fig- KD (Figure 4B) induced the autophagy formation in 4T1 and
ure S2H). Furthermore, using CRISPR technology, we specif- Py8119 cells, as demonstrated by increased LC3b-II expres-
ically mutated the second ATG of CEBPB DNA to knock out sion. Immunofluorescence staining revealed more autophagy
LAP (Figures S2D and 2J) and detected a dramatic decrease puncta in LDHA-deficient tumor cells compared with control
in G-CSF and GM-CSF mRNA and protein expression (Figures cells with or without chloroquine (CQ), an autophagy inhibitor
2K–2M, S2I, and S2J). These effects were recovered by LAP (Figures 4C and 4D). In addition, siULK1 attenuated the auto-
overexpression in LAP knockout (KO) cells (Figures 2K–2M, phagy formation in the LDHA KD 4T1 and Py8119 cells (Fig-
S2I, and S2J). Thus, tumor LDHA targets specific CEBPB ure S4A). The data suggest that glycolysis orchestrates a mo-
isoform LAP and controls G-CSF and GM-CSF expression in lecular network among LDHA, the AMPK-ULK1 signaling, and
breast cancer cells. the autophagy pathways in breast cancer cells, which might
(D) CEBPB isoforms were detected by western blotting in whole-cell lysis of scramble and shLDHA-expressing 4T1 and Py8119 cells. One of three experiments
is shown.
(E) 4T1 cells were transfected with plasmid vectors expressing CEBPB isoforms LAP*, LAP* mutant, and LAP. Expression of LAP*, LAP* mutant, and LAP was
detected by western blotting. One of three experiments is shown.
(F and G) 4T1 cells were transfected with the plasmid vectors expressing LAP*, LAP* mutant, and LAP. G-CSF transcript was quantified by real-time PCR (F) and
G-CSF protein was measured in culture supernatant with ELISA (G) (n = 3/group, one of three experiments is shown, *p < 0.001).
(H and I) LDHA KD 4T1 cells were transfected with plasmid vectors expressing LAP. G-CSF transcript was quantified by real-time PCR (H) and G-CSF protein was
measured in culture supernatant with ELISA (I) (n = 3/group, one of three experiments is shown, *p < 0.001).
(J) LAP was knocked out in 4T1 cells (LAP KO) and LAP KO cells were infected with LAP overexpressing (LAP OE) lentivirus. LAP protein was detected by western
blot. One of three experiments is shown. Data represent mean ± SEM.
(K–M) Role of LAP in G-CSF expression. G-CSF transcript was quantified by real-time PCR (K). G-CSF protein was measured in culture supernatant with ELISA (L)
(n = 3/group, *p < 0.001). (M) Intracellular G-CSF was stained with anti-G-CSF, revealed with Alexa Fluor 594-conjugated secondary antibody, and detected by
fluorescence microscope. Scale bar, 20 mm. One of three experiments is shown.

A B C
4T1 Py8119 4T1 Py8119
Dorsomorphin
- + - + 2-DG Scr shLDHA1 Scr shLDHA1
0 1 10 μM
p-AMPK
p-AMPK
1 4.15 1 4.2
1 1.79 1 2.2 p-AMPK
AMPK
AMPK
1 1.00 1 1.08 1 0.34 0.15
1 1.08 1 1.07
p-ULK1(317) AMPK
p-ULK1(317)
1 2.72 1 3.68
1 2.36 1 2.10
1 0.86 0.80
ULK1
ULK1
1 0.83 1 0.96 β-actin
1 0.81 1 1.10
β-actin
β-actin
D E F
4T1 Py8119
Scr shLDHA
3.0 - - + + - - + + shLDHA
- + - + Dors
- + - + - + - +
siULK1
2.5
2.0 ULK1
LAP*
1.5 1 0.19 0.79 0.07 1 0.48 0.98 0.50
*
1.0 LAP*
LAP
0.5
1 1.49 0.53 1.15 LAP
0
Actin DMSO Dor DMSO Dor 1 0.98 0.43 0.79 1 1.34 0.46 0.96
Scr LDHA KD
Actin
G H I J
4T1 Py8119 4T1 Py8119
2.0 7 200
1.6
* *
* 1.8 180
G-CSF mRNA fold chagne
1.4
6
1.6 * 160 *
**
1.2
1.4 5 140
G-CSF (ng/ml)
*
G-CSF (pg/ml)
1.0 1.2 120

4
0.8 1.0 100
0.8 3 80
0.6
0.6 2 60
0.4
0.4 40
0.2 0.2 1 20
0 0 0 0
Con siULK1 Con siULK1 Con siULK1 Con siULK1 Con siULK1 Con siULK1 Con siULK1 Con siULK1
Scr LDHA KD Scr LDHA KD Scr LDHA KD Scr LDHA KD
Figure 3. Glycolysis Targets LAP via the AMPK-ULK1 Pathway

(A) 4T1 and Py8119 cells were treated with 2-DG (20 mM) for 1 hr. AMPK and ULK1 were detected by western blotting. One of three experiments is shown.
(B) Immunoblot analysis of AMPK, p-AMPK, ULK1, and p-ULK1 in whole-cell lysis of scramble and shLDHA1-expressing 4T1 and Py8119 cells. One of three
experiments is shown.
(C) LDHA KD 4T1 cells were treated with dorsomorphin for 1 hr. AMPK and AMPK phosphorylation were detected by western blotting. One of three experiments
is shown.
(D) Scramble and shLDHA-expressing 4T1 cells were treated with dorsomorphin for 24 hr. LAP* and LAP were detected by western blotting. One of three ex-
periments is shown.

control LAP expression. To test this possibility, we treated 4T1 (Figures S5E–S5H), we detected reduced tumor MDSCs in
cells with CQ to inhibit the autophagy formation. When auto- shLDHA 4T1 tumor-bearing NSG mice compared with control
phagy was activated in shLDHA tumor cells (Figures 4B–4D), NSG mice (Figure S5K). We next examined T cell profiles in
CQ treatment prevented LAP reduction (Figure 4E) and restored mice bearing shLDHA tumor and control. We detected
G-CSF expression (Figure 4F) in shLDHA tumor cells. We genet- increased interferon-g+ (IFN-g+) and tumor necrosis factor
ically blocked an autophagy component FIP200 with siRNA alpha+ (TNF-a+) effector CD8+ T cells in tumor tissues (Fig-
(Hara et al., 2008; Wei et al., 2009, 2011) and investigated the ure 5H and 5I) and tumor-draining lymph nodes (Figures 5J
level of LAP and the expression of G-CSF. Knockdown of and 5K) in mice bearing shLDHA 4T1 tumor compared with
FIP200 restored LAP level (Figure 4G), and G-CSF mRNA (Fig- control. Similar immune profiles were obtained in mice bearing
ures 4H and 4I) and protein (Figures 4J and 4K) expression in shLDHA Py8119 tumor (Figure S5L). The results suggest that
4T1 and Py8119 cells, which expressed shLDHA. We observed tumor LDHA may regulate T cell immunity in vivo. In further
similar effects on ATG5 and LC3b knockdown tumor cells (Fig- support of this, we demonstrated that CD4+ and CD8+ T cell
ures S4B–S4G). In addition to autophagy inhibitor CQ, we depletion (Figure 5L) abolished the immune protective effect
treated 4T1 tumor cells with rapamycin, an inducer of auto- of tumor LDHA KD on tumor growth in vivo (Figure 5M).
phagy via inhibiting the Ser/Thr protein kinase mammalian Thus, the data suggest that tumor LDHA may control MDSCs
target of rapamycin (mTOR). We found that treatment with rapa- and, in turn, regulate T cell tumor immunity and tumor
mycin reduced LAP expression (Figure S4H). As autophagy in- progression.
hibition did not cause a full recovery of LAP expression (Figures
4E and 4G), we treated shLDHA 4T1 cells with MG132, a protea- Tumor LDHA Regulates Tumor Immunity via G-CSF
some inhibitor. We observed that MG132 and CQ both partially We next examined whether tumor LDHA affected G-CSF expres-
enhanced LAP protein levels (Figure S4I). The data suggest that sion in vivo to control MDSCs and tumor immunity. In line with
proteasomes may also be involved in the regulation of LAP our in vitro data (Figures 1F–1O, S1X, and 1Y), we detected lower
expression (Fu et al., 2015). Thus, tumor glycolysis prevents levels of G-CSF mRNA (Figure S6A) and protein (Figure S6B) in
the AMPK-ULK1 signaling activation and its associated auto- tumor tissues (Figures S6A and S6B) and peripheral blood
phagy formation and reduces autophagy-mediated partial (Figure S6C) in mice bearing shLDHA 4T1 tumor compared
LAP reduction and, in turn, LAP enhances G-CSF expression with controls. To study the role of G-CSF in vivo, we ectopically
and supports MDSC development in the tumor. expressed G-CSF in shLDHA tumor cells and parental tumor
cells and then inoculated these tumor cells into wild-type mice.
Tumor LDHA Affects MDSCs to Control Tumor Immunity We confirmed that shLDHA tumors grew slower than scramble
To determine whether tumor LDHA affects MDSCs to control tumors, as shown by tumor volume (Figure 6A). As expected,
tumor immunity in vivo, we inoculated shLDHA-expressing forced G-CSF expression abolished this protective effect of
4T1 and Py8119 cells into wild-type BALB/C and C57/BL6 shLDHA on tumor growth (Figure 6A). In line with these observa-
mice, respectively. LDHA KD 4T1 tumor-bearing mice ex- tions, tumor LDHA KD caused reduced MDSCs in the tumor tis-
hibited slower tumor growth (Figure 5A), less tumor metastasis sues and spleen, and forced G-CSF expression recovered the
(Figures 5B and 5C), and enhanced survival (Figure 5D) amount of MDSCs (Figure 6B). In addition, tumor LDHA KD re-
compared with control mice. Similarly, LDHA KD resulted in sulted in increased IFN-g+ and TNF-a+ effector CD8+ T cells in
reduced PY8119 tumor growth in C57/BL6 wild-type mice tumor (Figure 6C) and tumor-draining lymph nodes (Figure 6D);
(Figure S5A). The potential differential effects of tumor LDHA this effect was diminished with forced G-CSF expression (Fig-
on cell proliferation may depend on the tumor cell types ures 6C and 6D).
(Brand et al., 2016; Le et al., 2010; Xian et al., 2015). We To link this observation to the role of MDSCs in vivo, we admin-
observed similar cell cycles in vitro with or without LDHA KD istered anti-Ly6G antibody to deplete MDSCs in mice bearing
in 4T1 and Py8119 cells (Figures S5B–S5D), comparable different 4T1 tumor cells. We showed that in vivo MDSC deple-
tumor growth (Figures S5E and S5F), lung metastasis (Fig- tion reduced tumor growth in mice bearing 4T1 tumor compared
ure S5G), and mouse survival (Figure S5H) in NOD SCID with isotype control (Figure S6D). Furthermore, when MDSCs
gamma-deficient (NSG) mice bearing 4T1 tumors expressing were depleted in mice, tumor volumes were similar between
shLDHA and control. Interestingly, LDHA KD resulted in a LDHA-proficient and -deficient tumor-bearing mice (Figure S6D).
reduced amount of MDSCs in tumor tissues and spleen The data suggest that tumor LDHA regulates MDSCs, and in
compared with controls in 4T1 tumor-bearing wild-type mice turn, MDSCs mediate immunosuppression. In confirmation, we
(Figures 5E–5G) and Py8119 tumor-bearing wild-type mice showed that 4T1 tumor-associated (Figures S6E and S6F) and
(Figures S5I and S5J). Although shLDHA did not affect 4T1 tu- Py8119 tumor-associated (Figures S6G and S6H) MDSCs in-
mor growth, metastasis, and mouse survival in NSG model hibited T cell activation (Figures S6E and S6G), as shown by
(E) Scramble and shLDHA-expressing 4T1 cells were treated with dorsomorphin for 24 hr. G-CSF transcripts were quantified by real-time PCR (n = 3/group, one
of three experiments is shown, *p < 0.001).
(F) Scramble and shLDHA-expressing 4T1 and Py8119 cells were transfected with siULK and control for 12 hr. Cells were cultured for an additional 24 hr. LAP*
and LAP were detected by western blotting. One of three experiments is shown.
(G–J) Scramble and shLDHA-expressing 4T1 and Py8119 cells were transfected with siULK and control for 12–24 hr. Cells were cultured for an additional 48 hr.
G-CSF transcripts and proteins were detected by real-time PCR (G and H) and ELISA (I and J), respectively (n = 3/group, one of three experiments is shown, * p <
0.001). Data represent mean ± SEM.

A B C
Scr shLDHA1
4T1 Py8119 4T1 Py8119
- + - + 2-DG Scr shLDHA1 Scr shLDHA1
LC3b-ǀ - CQ
LC3b-ǀ
LC3b-ǁ LC3b-ǁ
1 20.68 1 14.10 1 3.40 1 2.70
β-actin β-actin
+ CQ
DAPI
LC3
D E 25 μm
35
- - + + shLDHA
4T1
* - + - + CQ
Autophagy puncta (%)
30
25
LAP*
20
LAP
15
1 0.90 0.18 0.61
10
Actin
5
0
SCR ShLDHA1
F G H
4T1 Py8119
- - + + - - + + shLDHA
siFIP200 3.0 4T1
1.8 - + - + - + - +
* *
*
1.6 2.5
FIP200
1.4
1 0.64 1.21 0.57 0.73 0.31 2.0
1.2 1 0.23 *
1.0
1.5
0.8 LAP*
0.6 1.0
0.4 LAP 0.5
0.2
0 1 0.95 0.45 0.70 1 1.35 0.37 1.06 0
CTR CQ CRT CQ CTR siFIP200 CTR siFIP200
Actin Scr LDHA KD
Scr LDHA KD
I J K
Py8119 4T1 Py8119
1.6 8 200
1.4 7 180
* 160 *
1.2 6
* 140
G-CSF (pg/ml)
5
G-CSF (ng/ml)
1.0 120
0.8 4 100
0.6 3 80
60
0.4 2
40
0.2 1
20
0 0 0
CTR siFIP200 CTR siFIP200 Con siFIP200 Con siFIP200 Con siFIP200 Con siFIP200
Scr LDHA KD Scr LDHA KD Scr LDHA KD
Figure 4. Glycolysis Controls LAP Expression via Autophagy Activation

(A) 4T1 and Py8119 cells were treated with 2-DG (5 mM) for 12 hr. LC3b-I and LC3b-II were detected by western blotting. One of three experiments
is shown.

reduced T cell CD25 and CD69 expression and suppressed signature (Figure 7B) in patients with high LDHA expression. In
effector T cell IFN-g and TNF-a expression (Figures S6F contrast, the T cell metagenes (Figure 7C) and T cell receptor
and S6H). (TCR) complex signature (Figure 7D) were enriched in patients
In addition to ectopic G-CSF expression, we used with low LDHA expression. We observed similar correlations in
CRISPR gene editing technology, created G-CSF KO 4T1 the enrichment network analysis (Figure 7E). We confirmed these
cells, and further tested the role of tumor G-CSF in tumor observations in an additional dataset from the GEO (GEO:
progression in vivo. As expected, we detected negligible GSE58812) (Jezequel et al., 2015) with 107 TNBC patients (Fig-
levels of G-CSF in the in vitro cultured G-CSF KO 4T1 tumor ures S7A–S7D). The data suggest that glycolysis and MDSC may
cells (Figure S6I) and in sera (Figure S6J) from mice bearing be important negative modulators in anti-tumor immunity in pa-
G-CSF KO 4T1 tumor. Furthermore, we detected smaller tu- tients with TNBC.
mor volume (Figure 6E), decreased MDSCs in spleen and We next evaluated the relationship between the glycolytic
tumor tissues (Figure 6F), and increased tumor-infiltrating pathway and MDSCs in the TNBC tumor microenvironment. A
IFN-g+ and TNF-a+ effector CD8+ T cells in tumor tissues recent report has identified a specific MDSC-associated gene
(Figure 6G) and tumor-draining lymph nodes (Figure 6H) in signature in patients with cancer (Welte et al., 2016). Based
mice bearing G-CSF KO tumor compared with wild-type tu- on this (Welte et al., 2016) and the availability of clinical informa-
mor. As expected, G-CSF KO abolished the protective effect tion, we combined and analyzed the two breast cancer data-
of shLDHA on tumor growth (Figure 6E). In line with this sets, EGAS00000000083 (Curtis et al., 2012) and GEO:
observation, G-CSF KO resulted in comparable IFN-g+ and GSE58812 (Jezequel et al., 2015). We found that glycolysis
TNF-a+ effector CD8+ T cells between the shLDHA and signature score correlated with that of MDSCs in 357 patients
Scr groups in tumor (Figure 6G) and tumor-draining lymph with TNBC (Figures 7F and 7G; Table S1). In contrast, MDSC
nodes (Figure 6H). signature score negatively correlated with that of T cell meta-
To confirm the effect of LAP on the regulation of G-CSF and genes (Figures 7F and 7H), TCR complex (Figures 7F and
tumor immune response, we used CRISPR/CAS9-mediated S7E), and adaptive immune response signatures (Figures 7F
point mutation to mutate the second ATG in the CEBPB and S7F). In addition, glycolysis signature negatively correlated
gene, specifically knocked out LAP in 4T1 cells, and examined with T cell metagenes (Figure 7I). We extended our studies to
the role of LAP in tumor progression in vivo. LAP KO dramati- the third breast cancer dataset (Koboldt et al., 2012) and ob-
cally decreased tumor volume (Figure 6I), MDSCs in spleen tained similar correlations among these factors (Figures S7G–
and tumor tissues (Figure 6J), and increased tumor-infiltrating S7J). Furthermore, we found that in the combined datasets
IFN-g+ and TNF-a+ effector CD8+ T cells in tumor tissues (Fig- (EGAS00000000083 and GEO: GSE58812), LDHA expression,
ure 6K) and tumor-draining lymph nodes (Figure 6L) in mice the glycolysis-associated signature score, and the MDSC-
bearing LAP KO tumor compared with wild-type tumor. This associated signature score were negatively associated with
phenotype was reversed by ectopic expression of LAP (Figures overall survival (Figures 7J–7L) and metastasis-free survival
6I–6L). Thus, tumor LDHA regulates MDSCs via LAP, controlling (Figures S7K and S7L) in patients with TNBC, whereas the
G-CSF expression, and affects tumor immunity and tumor T cell metagene score favorably predicted the TNBC patient
progression. outcome (Figure 7M; Table S1). Furthermore, the hazard func-
tion of MDSC signature, LDHA, glycolysis signature, and
Glycolysis, MDSC, and T Cell Response Correlate in T cell response signature are risk factors for TNBC survival
TNBC Patients (Table S1). Thus, glycolysis, MDSC, and T cell response func-
Finally, we evaluated the potential correlations among the tionally correlate in TNBC patients and are clinically associated
glycolytic pathway, MDSC levels, immune signatures, and with the patient outcome.
their associations with patient survival. We performed GSEA in
a dataset from the European Genome-phenome Archive DISCUSSION
(EGAS00000000083) (Curtis et al., 2012). Based on the median
values of LDHA expression in 250 TNBC patients, we found en- Tumor cells reprogram metabolic pathways to meet their
riched glycolytic gene signature (Figure 7A) and MDSC gene bioenergetics and biosynthetic demands. Preferential aerobic
(B) Scramble and shLDHA-expressing 4T1 and Py8119 cells were cultured for 24 hr. LC3b-I and LC3b-II were detected by western blotting. One of three ex-
periments is shown.
(C and D) Scramble and shLDHA-expressing 4T1 cells were treated with and without chloroquine (CQ). Autophagy puncta were revealed with anti-LC3b
monoclonal antibody staining and were analyzed with fluorescence microscope (C). Results were shown as the percentage of puncta-positive cells ± SEM (D)
(n = 6/group, one of three experiments is shown, *p < 0.0001). Scale bar, 25 mm.
(E) Scramble and shLDHA-expressing 4T1 cells were treated with CQ for 24 hr. LAP* and LAP were detected by western blotting. One of three experiments
is shown.
(F) Scramble and shLDHA-expressing 4T1 cells were treated with CQ for 24 hr. G-CSF transcript was detected by real-time PCR (n = 3/group, one of three
experiments, *p < 0.0001).
(G) Scramble and shLDHA-expressing 4T1 and Py8119 cells were transfected with FIP200 siRNA for 36 hr. CEBPB isoforms were detected by western blotting.
One of three experiments is shown.
(H–K) Scramble and shLDHA-expressing 4T1 and Py8119 cells were transfected with FIP200 siRNA for 12–24 hr. Cells were cultured for 48 hr. G-CSF transcripts
and proteins were detected by real-time PCR (H and I) and ELISA (J and K), respectively (n = 3/group, one of three experiments is shown, *p < 0.0001). Data
represent mean ± SEM.

A B C D
1000
60
Metastasis percentage
900
Tumor volume (mm3)
Scr 100
800 Scr 50
700 shLDHA1 Scr
80 shLDHA1
Survival
600 40
500 * 60
400 30
300 40
shLDHA1 20
200
100 10 20
0 p=0.0015
days 4 6 8 10 12 14 16 18
0 0
Scr shLDHA1 0 2 4 6 8
weeks
E F G
Scr shLDHA
Spleen
69% 18% 80 Tumor
100
MDSCs in CD45+ cells (%)

MDSCs in CD45+ cells (%)
Spleen 60 * 80
*
60
25%
40
69%
40
Tumor 20
20
Gr1
0 0
CD11b Scr shLDHA1 Scr shLDHA1
H I J
Scr shLDHA1 Scr shLDHA1
Tumor
TNF-α IFN-γ
TNF-α
Cytokines in CD8+ T cells (%)
80 TNF-α
* *
35% 65% 60 12% 40%
40
IFN-γ 20 IFN-γ
65%
CD8
30% 5%
CD8
0 13%
Cytokine Scr shLDHA1 Scr shLDHA1

Cytokine
K L M
TDLN Scr shLDHA1
2500
Scr
TNF-α IFN-γ
Cytonkines in CD8+ T cells (%)
SSA
50 10% 24% 2000 shLDHA1

Tumor volumn (mm3)
IgG
40 * Scr + CD4&CD8 depleted *
*
1500 shLDHA1 +
30 CD4&CD8 depleted
1000
20
* 0.5% 0.4%
CD4&CD8 *
10 Depletion 500
0 CD3 0
5 7 9 11 13 15 17
Scr shLDHA1 Scr shLDHA1
Figure 5. Tumor LDHA Affects MDSCs to Control Tumor Immunity

(A–D) Effect of shLDHA on tumor growth (A), metastasis (B and C), and mouse survival (D). Scramble and LDHA KD 4T1 cells (2.5 3 104) were inoculated into
female BALB/c mice. (A) Tumor growth was monitored and tumor size was measured (n = 10/group, *p < 0.001). Bioluminescence detection showed the distant
4T1 metastasis (B) and metastatic rate (C) on 30 days (n = 7/group, one of two experiments is shown).

glycolysis is observed across many types of cancer cells and is (2) this regulation is controlled by the second isoform of
considered a hallmark of cancer (Hanahan and Weinberg, 2011). CEBPB, LAP; and (3) the levels of LAP protein are modulated
However, whether and how aerobic glycolysis affects MDSCs by the autophagy-associated pathway. The latter may be under
and, in turn, regulates tumor immunity, are not well defined in pa- the control of tumor glycolysis via the AMPK-ULK1 pathway
tients with cancer. In this work, we focus on patients with TNBC (Kim et al., 2011). Notably, CEBPB protein stability can be regu-
and demonstrate that aerobic glycolysis controls tumor G-CSF lated by the 26S proteasome in myoblasts (Fu et al., 2015).
and GM-CSF expression, regulates MDSC development via Furthermore, CEBPB isoforms may be kinetically controlled
distinct molecular mechanisms, and consequently affects tumor by endoplasmic reticulum stress in fibroblasts (Li et al., 2008)
progression and outcome. We, along with our peers, have shown and by mTOR signaling in osteoclasts (Smink et al., 2009). We
that tumor glycolysis can modulate effector memory T cell have studied the impact of tumor glycolysis on CEBPB isoform
phenotype and function in the tumor microenvironment in cancer expression in TNBC epithelial cells. We suggest that an auto-
patients (Chang et al., 2013, 2015; Ho et al., 2015; Zhao et al., phagy-mediated regulation may be a previously unappreciated
2016) and in tumor-bearing mouse models (Brand et al., 2016; mechanism controlling the second isoform of CEBPB isoform
Chang et al., 2013, 2015; Ho et al., 2015; Zhao et al., 2016). LAP in the context of tumor glycolysis. The potential molecular
Thus, our current work has established a potential causal link be- details (including specific CEBPB isoform synthesis, transla-
tween tumor metabolic reprogramming and MDSC-mediated tion, and stability) remain to be examined in the context of tumor
immunosuppression. glycolysis. Nonetheless, we provide important insights into
In line with previous reports (Gabrilovich et al., 2012; Morales CEBPB biology in the regulation of tumor MDSC development
et al., 2010; Shojaei et al., 2009), we have found that tumor- and tumor immunity. We suggest that tumor glycolytic meta-
derived G-CSF and GM-CSF are important cytokines promot- bolism may potentially orchestrate a molecular network of
ing MDSC development in TNBC both in vitro and in vivo. AMPK-ULK1, autophagy, and CEBPB (LAP) to efficiently
Recent studies have elucidated the role of tumor glycolysis in promote tumor G-CSF and GM-CSF expression and to estab-
T cells (Brand et al., 2016; Chang et al., 2015; Zhao et al., lish and maintain MDSC development and to evade tumor
2016). Thus, we have focused our studies on whether tumor immunity.
glycolysis can regulate MDSCs via targeting G-CSF and GM- After deciphering the molecular mechanism by which tumor
CSF expression. We have shown that biochemical and genetic glycolysis regulates MDSC development, we investigated the
inhibition of tumor glycolysis results in an increase of the AMP immunological and clinical relevance of this regulation in
and ATP ratio (Pradelli et al., 2010), which subsequently acti- TNBC-bearing animal models and patients. We have shown
vates an energy sensor, AMPK (Mihaylova and Shaw, 2011); that genetic silence of tumor LDHA and manipulation of tumor
stimulates ULK1 phosphorylation; and activates and induces G-CSF results in alterations in MDSCs and effector T cell profile
autophagy formation (Kim et al., 2011). Interestingly, we have in vivo. Analogously, tumor growth, metastasis, and mouse sur-
made a molecular link between G-CSF and GM-CSF expres- vival are accordingly changed. In line with mouse data, the
sion, autophagy function, and CEBPB expression. There are scores of glycolytic gene signature including LDHA, MDSC
three isoforms of CEBPB including LIP, LAP, and LAP* (Qiu gene signature, and T cell gene signature correlate in TNBC pa-
et al., 2008), and different CEBPB isoforms can be induced dur- tients. Furthermore, these three signature scores are associated
ing granulocyte differentiation (Marigo et al., 2010; Rosenbauer with TNBC patient survival. Human TNBC is pathologically and
and Tenen, 2007). It is thought that the transcription factor clinically aggressive, with high rates of metastasis and recur-
CEBPB in myeloid cells regulates MDSCs in tumor (Marigo rence and poor patient survival. TNBC patients are poor re-
et al., 2010). However, it is unknown whether CEBPB in tumor sponders to hormonal or trastuzumab-based standard therapies
cells and/or which CEBPB isoform(s) in tumor cells affects (Bauer et al., 2007; Bianchini et al., 2016; Harris et al., 2016;
the production of key cytokines critical for tumor MDSC devel- Schott and Hayes, 2012) and checkpoint blockade treatment
opment, and how CEBPB expression is regulated in the context (Zou et al., 2016). Given that autophagy-associated innate im-
of tumor glycolysis. Unexpectedly, we have observed that mune signaling (Yu et al., 2017) and effector T cells (Wang
the AMPK-ULK1-activated autophagy signaling pathway is et al., 2016) regulate cancer chemotherapy resistance, it will be
involved in the regulation of the secondary isoform of CEBPB, interesting to explore whether this LAP and autophagy network
LAP. Furthermore, we have defined that LAP is a relatively spe- additionally contributes to TNBC therapeutic response.
cific isoform of CEBPB controlling tumor G-CSF and GM-CSF Our work demonstrates that tumor glycolytic metabolism
expression through glycolysis. Our work shows that (1) CEBPB biologically, immunologically, and clinically controls MDSCs
in tumor cells regulates the expression of G-CSF and GM-CSF; and affects anti-tumor immunity in TNBC patients. Thus,
(E–G) Gr1+CD11b+ cells in tumor-bearing mice. (E) Representative flow cytometry dot plots showed spleen and tumor tissue Gr1+CD11b+CD45+ cells in mice
bearing scramble and LDHA KD 4T1 tumors. (F and G) Percentages of Gr1+CD11b+ cells were shown in spleen (F) and tumor tissues (G) (n = 6/group, one of two
experiments is shown, *p < 0.05).
(H and I) Representative flow cytometry dot plots (H) and the percentages of TNF-a and IFN-g (I) were shown in CD8+ T cells in 4T1 tumor tissue (n = 5–6/group,
one of two experiments is shown, *p < 0.05).
(J and K) Representative flow cytometry dot plots (J) and the percentages of TNF-a and IFN-g (K) were shown in CD8+ T cells in 4T1 tumor draining lymph nodes
(TDLNs) (n = 5–6/group, one of two experiments is shown, *p < 0.05).
(L and M) Effect of CD4 and CD8 T cell depletion on 4T1 tumor growth. (L) Representative flow cytometry dot plots showed T cell depletion efficiency. (M) Tumor
volume was shown in different groups (n = 5/group, one of two experiments is shown, *p < 0.05). Data represent mean ± SEM.

A B C
Spleen Tumor Tumor
800 1 Scr 80 * ns
80 IFN-γ TNF-α
* ns
Cytokines in CD8+ cells (%)

700 2 shLDHA
* * *
Ly6G+ in CD45 cells (%)

600 3 Scr G-CSF OE ns
60 60
500 4 shLDHA G-CSF OE
* *
400 40 40
* * ns
300
*
200 20 20 ns
100
0 0 0
4 6 8 10 12 14 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4
D E F
TDLN
IFN-γ TNF-α Spleen Tumor
60 500
1 100
* * *
450
WT Scr
*
Ly6G+ in CD45+ cells (%)

*
2 WT LDHAKD2
400
Tumor volume (mm3)
3 KO Scr 80
40
350
4 KO LDHAKD2 *
ns 300 * 60
*
ns 250
*
20
200 40 * ns
150
100 20
ns ns
50
0 0 0
1 2 3 4 1 2 3 4 5 8 10 12 14 1 2 3 4 1 2 3 4
G H I
Tumor TDLN
IFN-γ TNF-α IFN-γ TNF-α 450
*
100 ns 1 CTR
80 400
* ns
ns
*
Tumor volume (mm3)
ns 2 LAP KO
350
Cytoknes in CD8+ T cells (%)
80
60 * ns
* 300 3 LAP OE
*
60 * * 250
*
40 200
40
150
20 100
20
50
0 0 0
1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 4 6 8 10 12 14
J K L
Tumor TDLN
Spleen Tumor IFN-γ TNF-α IFN-γ TNF-α
100 80
* *
80 * *
* *
*
Ly6G+ in CD45+ cells (%)
80
* 60 60
60
* 40 40
40 * * *
20 20
20
0 0
0
1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3
Figure 6. Tumor LDHA Regulates Tumor Immunity via G-CSF

(A) Effect of forced G-CSF overexpression (G-CSF OE) on tumor growth. 4T1 cells (0.5 3 105/mouse) were inoculated into female BALB/c mice. Tumor size was
measured every 2 days (n = 5/group, one of two experiments is shown, *p < 0.05).

reprogramming tumor glycolysis may be a biologic and immuno- B Flow Cytometry Analysis (FACS)
logic strategy to treat patients with TNBC. B Immunofluorescence Staining
B Metabolic Assay
Limitations of Study B Lactate Detection
Crosstalk between AMPK and mTOR signaling pathways affects B ATP and AMP Measurement
protein translation. We have found that the autophagy pathway B Microarray
regulates LAP expression in the context of tumor glycolysis. B MDSC Suppression Assay
Thus, the next step is to examine whether and how autophagy, B Bioinformatics Analysis
AMPK, and mTOR signaling pathways may be coordinated in d QUANTIFICATION AND STATISTICAL ANALYSIS
the regulation of LAP expression. Moreover, it is important to un- d DATA AND SOFTWARE AVAILABILITY
derstand the genetic and molecular basis of potent glycolytic
metabolic pattern in TNBC. Given that myeloid cells including SUPPLEMENTAL INFORMATION
macrophages, myeloid dendritic cells, and myeloid suppressor
Supplemental Information includes seven figures and two tables and can be
cells express PD-L1 and mediate immunosuppression in the hu-
found with this article online at https://doi.org/10.1016/j.cmet.2018.04.022.
man tumor microenvironment and draining lymph nodes (Curiel
et al., 2003; Lin et al., 2018), it is clinically relevant to explore ther- ACKNOWLEDGMENTS
apeutic approaches by targeting MDSCs and tumor glycolysis in
combination with PD-L1/PD-1 blockade (Zou et al., 2016) to treat We thank Daniel Hayes for fruitful discussion and intellectual support. This
patients with TNBC. work is supported (in part) by NIH grants (CA123088, CA099985, CA156685,
CA171306, CA190176, CA193136, CA211016, and 5P30CA46592). This
work was supported in part by research grants from the NIH/NCI R01 (to
STAR+METHODS W.Z.) (CA123088, CA099985, CA193136, and CA152470), the NIH through
the University of Michigan’s Cancer Center Support Grant (CA46592), and
Detailed methods are provided in the online version of this paper the Major State Basic Research Development Program of China (973 Program,
and include the following: 2015CB554007).
d KEY RESOURCES TABLE AUTHOR CONTRIBUTIONS

d CONTACT FOR REAGENT AND RESOURCE SHARING
W.L. designed the experiments, processed tissues, performed flow cytometry
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
and western blotting, collected the data, and wrote the paper. T.T., S.W., and
B Animals L.V. performed some mouse experiments. I.K. helped design the experiments
B Cell Culture Studies and analyzed human data. G.L. and H.X. assisted with CRISPR KO and the
d METHOD DETAILS autophagy pathway study. K.W. assisted with human studies. B.W., P.S.,
B Short Pairpin RNAs (shRNA), Small Interfering RNA and D.S. helped and performed ATP and AMP detections. L.Z. performed sta-
(siRNA) and Genetic Knockout tistical analysis and helped write the paper. M.S., C.K., M.W., G.W., and K.T.
advised and consulted on all aspects of this work, provided expertise on
B G-CSF and shLDHA Co-Expression Vectors
oncology and pathology, and/or supported the project. W.L. and W.Z. planned
B G-CSF Knockout Cells
and supported the project, analyzed data, and wrote the paper.
B MDSC and CD4/CD8 T cell Depletion
* *
B LAP , LAP Mutant, and LAP Expressing Vectors DECLARATION OF INTERESTS
B LAP Knock Out Cells
The authors declare no competing financial interests.
B LAP Over Expression Lentivirus
B Cytokine Detection
Received: March 28, 2017
B Western Blot Revised: September 15, 2017
B RNA Extraction, Reverse Transcription, and Real-Time Accepted: April 30, 2018
Polymerase Chain Reaction Published: May 24, 2018
(B) Effect of G-CSF OE on MDSCs. Ly6G+CD11b+ cells were analyzed by flow cytometry in CD45+ cells in tumor-bearing mice. The percentages of Ly6G+CD11b+
cells were shown in spleen and tumor (n = 5/group, one of two experiments is shown, *p < 0.01).
(C and D) Effect of G-CSF OE on CD8+ T cell profile. The percentages of IFN-g+ and TNF-a+ in CD8+ T cells in tumor tissue (C) and TDLN (D) were shown (n = 5/
group, one of two experiments is shown, *p < 0.05).
(E) Effect of G-CSF knockout (G-CSF KO) on tumor growth. 4T1 cells (0.5 3 105/mouse) were inoculated into female BALB/c mice. Tumor size was measured
every 2 days (n = 6–7/group, one of two experiments is shown, *p < 0.05).
(F) Effect of G-CSF KO on MDSCs. Ly6G+CD11b+ cells were analyzed by flow cytometry in CD45+ cells in tumor-bearing mice. The percentages of Ly6G+CD11b+
cells were shown in spleen and tumor (n = 6–7/group, one of two experiments is shown, *p < 0.01).
(G and H) Effect of G-CSF KO on CD8+ T cell profile. The percentages of IFN-g+ and TNF-a+ in CD8+ T cells in tumor tissue (G) and TDLN (H) were shown (n = 6–7/
group, one of two experiments is shown, *p < 0.05).
(I) Effect of LAP knockout (LAP KO) on tumor growth. 4T1 cells (0.5 3 105/mouse) were inoculated into female BALB/c mice. Tumor size was measured every
2 days (n = 8–9/group, one of two experiments is shown, *p < 0.05).
(J) Effect of forced LAP KO on MDSCs. Ly6G+CD11b+ cells were analyzed by flow cytometry in CD45+ cells in tumor-bearing mice. The percentages of
Ly6G+CD11b+ cells were shown in spleen and tumor tissues (n = 8–9/group, one of two experiments is shown, *p < 0.01).
(K and L) Effect of LAP KO on CD8+ T cell profile. The percentages of IFN-g+ and TNF-a+ in CD8+ T cells in tumor tissues (K) and TDLN (L) were shown (n = 8–9/
group, one of two experiments is shown, *p < 0.05). Data represent mean ± SEM.

A B E Adaptive immune response

Glycolysis signature MDSC signature up genes pathways
0.6 0.5
0.5 0.4
0.4 0.3
0.3 0.2 Innate immune
0.1 response pathways
0.2 NES=2.4 0.0 NES=1.6
0.1
0.0
p=0.000 -0.1 p=0.000
-0.2
MDSC-sig down genes
Cytokine_cytokine
receptor pathways
LDHA High LDHA Low LDHA High LDHA Low MDSC-sig up genes
C D
T cell metagenes TCR complex signature
0.0 0.0
-0.1 -0.1
-0.2 -0.2
-0.3 -0.3
-0.4 -0.4
-0.5
-0.5
-0.6 NES=-2.7 -0.6 NES=-2.2 Glucose metabolism
-0.7
-0.8
p=0.000 -0.7
-0.8 p=0.000 pathways
-0.9 -0.9
LDHA high-expression group Amino acid metabolism

LDHA High LDHA Low LDHA High LDHA Low pathways
LDHA low-expression group
F G
1.0
MDSC signature score

Glycolysis signature score
0.8
0.6
T cell metagene score
0.4
TCR complex signature score r = 0.54
0.2 p < 0.0001
Adaptive immune
n = 357
Response signature score
0.0
0.0 0.2 0.4 0.6 0.8 1.0
H I J
1.0 r = -0.78 1.0
r = -0.38 100
p < 0.0001 p < 0.0001

0.8 n = 357 0.8 n = 357 80
Overall survival
0.6 0.6 60
0.4 0.4 40
p = 0.014
n = 357
0.2 0.2 20 LDHA Low
LDHA High
0.0 0.0 0
0.0 0.2 0.4 0.6 0.8 1.0 0.0 0.2 0.4 0.6 0.8 1.0 0 100 200 300
T cell metagene score T cell metagene score Months
K L M
100
100 100
Overall survival
80
Overall survival
Overall survival
80 80
60 60 60
40
p < 0.0001 p = 0.011 p = 0.0038
40 40
n = 357 n = 357 n = 357
20 Low Glycolysis signature score 20 Low MDSC signature score Low T cell metagene score
20
High Glycolysis signature score High MDSC signature score High T cell metagene score
0 0 0
0 100 200 300 0 100 200 300 0 100 200 300
Months Months Months
Figure 7. Glycolysis, MDSCs, and T Cell Response Correlate in TNBC Patients

(A–D) Correlation between LDHA and protective immune signature in human TNBC. Glycolytic (A) and immune cell (B–D) gene signatures were analyzed and
compared between high and low LDHA-expressing TNBCs (EGAS00000000083, n = 250). The normalized enrichment score (NES) (green line) reflects the degree

REFERENCES Eil, R., Vodnala, S.K., Clever, D., Klebanoff, C.A., Sukumar, M., Pan, J.H.,
Palmer, D.C., Gros, A., Yamamoto, T.N., Patel, S.J., et al. (2016). Ionic immune
Akagi, T., Saitoh, T., O’Kelly, J., Akira, S., Gombart, A.F., and Koeffler, H.P. suppression within the tumour microenvironment limits T cell effector function.
(2008). Impaired response to GM-CSF and G-CSF, and enhanced apoptosis Nature 537, 539–543.
in C/EBPbeta-deficient hematopoietic cells. Blood 111, 2999–3004. Fu, D., Lala-Tabbert, N., Lee, H., and Wiper-Bergeron, N. (2015). Mdm2 pro-
Alers, S., Loffler, A.S., Wesselborg, S., and Stork, B. (2012). Role of AMPK- motes myogenesis through the ubiquitination and degradation of CCAAT/
mTOR-Ulk1/2 in the regulation of autophagy: cross talk, shortcuts, and feed- enhancer-binding protein beta. J. Biol. Chem. 290, 10200–10207.
backs. Mol. Cell. Biol. 32, 2–11. Gabrilovich, D.I., Ostrand-Rosenberg, S., and Bronte, V. (2012). Coordinated
Bauer, K.R., Brown, M., Cress, R.D., Parise, C.A., and Caggiano, V. (2007). regulation of myeloid cells by tumours. Nat. Rev. Immunol. 12, 253–268.
Descriptive analysis of estrogen receptor (ER)-negative, progesterone recep-
Ganley, I.G., Lam du, H., Wang, J., Ding, X., Chen, S., and Jiang, X. (2009).
tor (PR)-negative, and HER2-negative invasive breast cancer, the so-called tri-
ULK1.ATG13.FIP200 complex mediates mTOR signaling and is essential for
ple-negative phenotype: a population-based study from the California cancer
autophagy. J. Biol. Chem. 284, 12297–12305.
Registry. Cancer 109, 1721–1728.
Gibby, K., You, W.-K., Kadoya, K., Helgadottir, H., Young, L.J., Ellies, L.G.,
Bianchini, G., Balko, J.M., Mayer, I.A., Sanders, M.E., and Gianni, L. (2016).
Chang, Y., Cardiff, R.D., and Stallcup, W.B. (2012). Early vascular deficits
Triple-negative breast cancer: challenges and opportunities of a heteroge-
are correlated with delayed mammary tumorigenesis in the MMTV-PyMT
neous disease. Nat. Rev. Clin. Oncol. 13, 674–690.
transgenic mouse following genetic ablation of the NG2 proteoglycan.
Brand, A., Singer, K., Koehl, G.E., Kolitzus, M., Schoenhammer, G., Thiel, A., Breast Cancer Res. 14, R67.
Matos, C., Bruss, C., Klobuch, S., Peter, K., et al. (2016). LDHA-associated lac-
Gubser, P.M., Bantug, G.R., Razik, L., Fischer, M., Dimeloe, S., Hoenger, G.,
tic acid production blunts tumor immunosurveillance by T and NK cells. Cell
Durovic, B., Jauch, A., and Hess, C. (2013). Rapid effector function of memory
Metab. 24, 657–671.
CD8+ T cells requires an immediate-early glycolytic switch. Nat. Immunol. 14,
Chang, C.-H., Qiu, J., O’Sullivan, D., Buck, M.D., Noguchi, T., Curtis, J.D., 1064–1072.
Chen, Q., Gindin, M., Gubin, M.M., van der Windt, G.J.W., et al. (2015).
Hamilton, M.J., Banath, J.P., Lam, V., Lepard, N.E., Krystal, G., and
Metabolic competition in the tumor microenvironment is a driver of cancer pro-
Bennewith, K.L. (2012). Serum inhibits the immunosuppressive function of
gression. Cell 162, 1229–1241.
myeloid-derived suppressor cells isolated from 4T1 tumor-bearing mice.
Chang, C.H., Curtis, J.D., Maggi, L.B., Jr., Faubert, B., Villarino, A.V., Cancer Immunol. Immunother. 61, 643–654.
O’Sullivan, D., Huang, S.C., van der Windt, G.J., Blagih, J., Qiu, J., et al.
Hanahan, D., and Weinberg, R.A. (2011). Hallmarks of cancer: the next gener-
(2013). Posttranscriptional control of T cell effector function by aerobic glycol-
ation. Cell 144, 646–674.
ysis. Cell 153, 1239–1251.
Hara, T., Takamura, A., Kishi, C., Iemura, S., Natsume, T., Guan, J.L., and
Clever, D., Roychoudhuri, R., Constantinides, M.G., Askenase, M.H.,
Mizushima, N. (2008). FIP200, a ULK-interacting protein, is required for auto-
Sukumar, M., Klebanoff, C.A., Eil, R.L., Hickman, H.D., Yu, Z., Pan, J.H.,
phagosome formation in mammalian cells. J. Cell Biol. 181, 497–510.
et al. (2016). Oxygen sensing by T cells establishes an immunologically tolerant
metastatic niche. Cell 166, 1117–1131.e14. Harris, L.N., Ismaila, N., McShane, L.M., Andre, F., Collyar, D.E., Gonzalez-
Angulo, A.M., Hammond, E.H., Kuderer, N.M., Liu, M.C., Mennel, R.G., et al.
Cubillos-Ruiz, J.R., Silberman, P.C., Rutkowski, M.R., Chopra, S., Perales-
(2016). Use of biomarkers to guide decisions on adjuvant systemic therapy
Puchalt, A., Song, M., Zhang, S., Bettigole, S.E., Gupta, D., Holcomb, K.,
for women with early-stage invasive breast cancer: American Society of
et al. (2015). ER stress sensor XBP1 controls anti-tumor immunity by disrupting
Clinical Oncology Clinical Practice Guideline. J. Clin. Oncol. 34, 1134–1150.
dendritic cell homeostasis. Cell 161, 1527–1538.
Ho, P.-C., Bihuniak, J.D., Macintyre, A.N., Staron, M., Liu, X., Amezquita, R., Tsui,
Cui, T.X., Kryczek, I., Zhao, L., Zhao, E., Kuick, R., Roh, M.H., Vatan, L.,
Y.-C., Cui, G., Micevic, G., Perales, J.C., et al. (2015). Phosphoenolpyruvate is a
Szeliga, W., Mao, Y., Thomas, D.G., et al. (2013). Myeloid-derived suppressor
metabolic checkpoint of anti-tumor T cell responses. Cell 162, 1217–1228.
cells enhance stemness of cancer cells by inducing microRNA101 and sup-
pressing the corepressor CtBP2. Immunity 39, 611–621. Huang, B., Pan, P.Y., Li, Q., Sato, A.I., Levy, D.E., Bromberg, J., Divino, C.M.,
and Chen, S.H. (2006). Gr-1+CD115+ immature myeloid suppressor cells
Curiel, T.J., Coukos, G., Zou, L., Alvarez, X., Cheng, P., Mottram, P., Evdemon-
mediate the development of tumor-induced T regulatory cells and T-cell
Hogan, M., Conejo-Garcia, J.R., Zhang, L., Burow, M., et al. (2004). Specific
anergy in tumor-bearing host. Cancer Res. 66, 1123–1131.
recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege
and predicts reduced survival. Nat. Med. 10, 942–949. Jezequel, P., Loussouarn, D., Guerin-Charbonnel, C., Campion, L., Vanier, A.,
Curiel, T.J., Wei, S., Dong, H., Alvarez, X., Cheng, P., Mottram, P., Krzysiek, R., Gouraud, W., Lasla, H., Guette, C., Valo, I., Verriele, V., and Campone, M.
Knutson, K.L., Daniel, B., Zimmermann, M.C., et al. (2003). Blockade of B7-H1 (2015). Gene-expression molecular subtyping of triple-negative breast cancer
improves myeloid dendritic cell-mediated antitumor immunity. Nat. Med. 9, tumours: importance of immune response. Breast Cancer Res. 17, 43.
562–567. Kim, J., Kundu, M., Viollet, B., and Guan, K.L. (2011). AMPK and mTOR regu-
Curtis, C., Shah, S.P., Chin, S.F., Turashvili, G., Rueda, O.M., Dunning, M.J., late autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 13,
Speed, D., Lynch, A.G., Samarajiwa, S., Yuan, Y., et al. (2012). The genomic 132–141.
and transcriptomic architecture of 2,000 breast tumours reveals novel sub- Klionsky, D.J., and Emr, S.D. (2000). Autophagy as a regulated pathway of
groups. Nature 486, 346–352. cellular degradation. Science 290, 1717–1721.
to which the gene set is over-represented at the top or bottom of the ranked list of genes. A positive value indicates more correlation with ‘‘high LDHA-expressing
tumor,’’ and a negative value indicates more correlation with ‘‘low LDHA-expressing tumor.’’
(E) GSEA comparison between patients with high LDHA expression (red) and low LDHA expression (blue). Median split, n = 250 (EGAS00000000083). Cytoscape
and Enrichment map were used for visualization of the GSEA results (p value cutoff: 0.05). Enrichment results were mapped as a network of gene sets. Nodes
represent enriched gene sets, which were grouped by their similarities according to the related gene sets. Node size was proportional to the total number of genes
within each gene set. Proportion of shared genes between gene sets was presented as the thickness of the green lines between nodes.
(F–I) Estimates of signature correlation among MDSC, glycolysis, and T cell immune response. Signature scores were calculated as reported previously (Welte
et al., 2016). The correlations were evaluated by Person’ correlation test controlled by cohort (EGAS00000000083 and GEO: GSE58812, n = 357).
(J–M) Kaplan-Meier estimates of overall survival in TNBC patients. Patients were divided into low and high groups based on the median of LDHA expression (J),
glycolysis signature score (K), MDSC signature score (L), and T cell metagene signature score (M); p values were calculated using the log-rank test controlled by
cohort (EGAS00000000083 and GEO: GSE58812, n = 357).

Koboldt, D.F., Fulton, R.S., McLellan, M.D., Schmidt, H., Fielding, P., predicts a favorable prognosis in estrogen receptor-negative and HER2-pos-
Ozenberger, B.A., Guyer, M.S., Sofia, H.J., and Palchik, J.D. (2012). itive breast cancers. Breast Cancer Res. 11, R15.
Comprehensive molecular portraits of human breast tumours. Nature Rosenbauer, F., and Tenen, D.G. (2007). Transcription factors in myeloid
490, 61–70. development: balancing differentiation with transformation. Nat. Rev.
Kusmartsev, S.A., Li, Y., and Chen, S.H. (2000). Gr-1+ myeloid cells derived Immunol. 7, 105–117.
from tumor-bearing mice inhibit primary T cell activation induced through Schott, A.F., and Hayes, D.F. (2012). Defining the Benefits of neoadjuvant
CD3/CD28 costimulation. J. Immunol. 165, 779–785. chemotherapy for breast cancer. J. Clin. Oncol. 30, 1747–1749.
Le, A., Cooper, C.R., Gouw, A.M., Dinavahi, R., Maitra, A., Deck, L.M., Royer, Schrem, H., Klempnauer, J., and Borlak, J. (2004). Liver-enriched transcription
R.E., Vander Jagt, D.L., Semenza, G.L., and Dang, C.V. (2010). Inhibition of factors in liver function and development. Part II: the C/EBPs and D site-bind-
lactate dehydrogenase A induces oxidative stress and inhibits tumor progres- ing protein in cell cycle control, carcinogenesis, circadian gene regulation, liver
sion. Proc. Natl. Acad. Sci. USA 107, 2037–2042. regeneration, apoptosis, and liver-specific gene regulation. Pharmacol. Rev.
Li, Y., Bevilacqua, E., Chiribau, C.B., Majumder, M., Wang, C., Croniger, C.M., 56, 291–330.
Snider, M.D., Johnson, P.F., and Hatzoglou, M. (2008). Differential control of Shannon, P., Markiel, A., Ozier, O., Baliga, N.S., Wang, J.T., Ramage, D., Amin,
the CCAAT/enhancer-binding protein beta (C/EBPbeta) products liver-en- N., Schwikowski, B., and Ideker, T. (2003). Cytoscape: a software environment
riched transcriptional activating protein (LAP) and liver-enriched transcrip- for integrated models of biomolecular interaction networks. Genome Res. 13,
tional inhibitory protein (LIP) and the regulation of gene expression during 2498–2504.
the response to endoplasmic reticulum stress. J. Biol. Chem. 283,
Shojaei, F., Wu, X., Qu, X., Kowanetz, M., Yu, L., Tan, M., Meng, Y.G., and
22443–22456.
Ferrara, N. (2009). G-CSF-initiated myeloid cell mobilization and angiogenesis
Lin, H., Wei, S., Hurt, E.M., Green, M.D., Zhao, L., Vatan, L., Szeliga, W., mediate tumor refractoriness to anti-VEGF therapy in mouse models. Proc.
Herbst, R., Harms, P.W., Fecher, L.A., et al. (2018). Host expression of PD- Natl. Acad. Sci. USA 106, 6742–6747.
L1 determines efficacy of PD-L1 pathway blockade-mediated tumor regres-
Singer, M., Wang, C., Cong, L., Marjanovic, N.D., Kowalczyk, M.S., Zhang, H.,
sion. J. Clin. Invest. 128, 805–815.
Nyman, J., Sakuishi, K., Kurtulus, S., Gennert, D., et al. (2016). A distinct gene
Liu, G., Yang, K., Burns, S., Shrestha, S., and Chi, H. (2010). The S1P(1)-mTOR module for dysfunction uncoupled from activation in tumor-infiltrating T cells.
axis directs the reciprocal differentiation of T(H)1 and T(reg) cells. Nat. Cell 166, 1500–1511.e9.
Immunol. 11, 1047–1056. Smink, J.J., Begay, V., Schoenmaker, T., Sterneck, E., de Vries, T.J., and
Ma, G., Pan, P.Y., Eisenstein, S., Divino, C.M., Lowell, C.A., Takai, T., and Leutz, A. (2009). Transcription factor C/EBPbeta isoform ratio regulates osteo-
Chen, S.H. (2011). Paired immunoglobin-like receptor-B regulates the sup- clastogenesis through MafB. EMBO J. 28, 1769–1781.
pressive function and fate of myeloid-derived suppressor cells. Immunity 34, Srivastava, M.K., Sinha, P., Clements, V.K., Rodriguez, P., and Ostrand-
385–395. Rosenberg, S. (2010). Myeloid-derived suppressor cells inhibit T-cell activa-
Maj, T., Wang, W., Crespo, J., Zhang, H., Wang, W., Wei, S., Zhao, L., Vatan, tion by depleting cystine and cysteine. Cancer Res. 70, 68–77.
L., Shao, I., Szeliga, W., et al. (2017). Oxidative stress controls regulatory T cell Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L.,
apoptosis and suppressor activity and PD-L1-blockade resistance in tumor. Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., and
Nat. Immunol. 18, 1332–1341. Mesirov, J.P. (2005). Gene set enrichment analysis: a knowledge-based
Marigo, I., Bosio, E., Solito, S., Mesa, C., Fernandez, A., Dolcetti, L., Ugel, S., approach for interpreting genome-wide expression profiles. Proc. Natl.
Sonda, N., Bicciato, S., Falisi, E., et al. (2010). Tumor-induced tolerance and Acad. Sci. USA 102, 15545–15550.
immune suppression depend on the C/EBPbeta transcription factor. Sun, T.T., He, J., Liang, Q., Ren, L.L., Yan, T.T., Yu, T.C., Tang, J.Y., Bao, Y.J.,
Immunity 32, 790–802. Hu, Y., Lin, Y., et al. (2016). LncRNA GClnc1 promotes gastric carcinogenesis
Mihaylova, M.M., and Shaw, R.J. (2011). The AMPK signalling pathway coor- and may act as a modular scaffold of WDR5 and KAT2A complexes to specify
dinates cell growth, autophagy and metabolism. Nat. Cell Biol. 13, the histone modification pattern. Cancer Discov. 6, 784–801.
1016–1023. Tanikawa, T., Wilke, C.M., Kryczek, I., Chen, G.Y., Kao, J., Núñez, G., and Zou,
Morales, J.K., Kmieciak, M., Knutson, K.L., Bear, H.D., and Manjili, M.H. W. (2012). Interleukin-10 ablation promotes tumor development, growth, and
(2010). GM-CSF is one of the main breast tumor-derived soluble factors metastasis. Cancer Res. 72, 420–429.
involved in the differentiation of CD11b-Gr1- bone marrow progenitor cells Uematsu, S., Kaisho, T., Tanaka, T., Matsumoto, M., Yamakami, M., Omori, H.,
into myeloid-derived suppressor cells. Breast Cancer Res. Treat. Yamamoto, M., Yoshimori, T., and Akira, S. (2007). The C/EBP beta isoform
123, 39–49. 34-kDa LAP is responsible for NF-IL-6-mediated gene induction in activated
Peng, D., Tanikawa, T., Li, W., Zhao, L., Vatan, L., Szeliga, W., Wan, S., Wei, S., macrophages, but is not essential for intracellular bacteria killing.
Wang, Y., Liu, Y., et al. (2016). Myeloid-derived suppressor cells endow stem- J. Immunol. 179, 5378–5386.
like qualities to breast cancer cells through IL6/STAT3 and NO/NOTCH cross- Wang, W., Kryczek, I., Dostal, L., Lin, H., Tan, L., Zhao, L., Lu, F., Wei, S., Maj,
talk Signaling. Cancer Res. 76, 3156–3165. T., Peng, D., et al. (2016). Effector T cells abrogate stroma-mediated chemo-
Pradelli, L.A., Beneteau, M., Chauvin, C., Jacquin, M.A., Marchetti, S., Munoz- resistance in ovarian cancer. Cell 165, 1092–1105.
Pinedo, C., Auberger, P., Pende, M., and Ricci, J.E. (2010). Glycolysis inhibi- Wei, H., Gan, B., Wu, X., and Guan, J.L. (2009). Inactivation of FIP200 leads to
tion sensitizes tumor cells to death receptors-induced apoptosis by AMP ki- inflammatory skin disorder, but not tumorigenesis, in conditional knock-out
nase activation leading to Mcl-1 block in translation. Oncogene 29, mouse models. J. Biol. Chem. 284, 6004–6013.
1641–1652. Wei, H., Wei, S., Gan, B., Peng, X., Zou, W., and Guan, J.L. (2011).
Qiu, X., Aiken, K.J., Chokas, A.L., Beachy, D.E., and Nick, H.S. (2008). Distinct Suppression of autophagy by FIP200 deletion inhibits mammary tumorigen-
functions of CCAAT enhancer-binding protein isoforms in the regulation of esis. Genes Dev. 25, 1510–1527.
manganese superoxide dismutase during interleukin-1beta stimulation. Welte, T., Kim, I.S., Tian, L., Gao, X., Wang, H., Li, J., Holdman, X.B.,
J. Biol. Chem. 283, 25774–25785. Herschkowitz, J.I., Pond, A., Xie, G., et al. (2016). Oncogenic mTOR signalling
Roby, K.F., Taylor, C.C., Sweetwood, J.P., Cheng, Y., Pace, J.L., Tawfik, O., recruits myeloid-derived suppressor cells to promote tumour initiation. Nat.
Persons, D.L., Smith, P.G., and Terranova, P.F. (2000). Development of a syn- Cell Biol. 18, 632–644.
geneic mouse model for events related to ovarian cancer. Carcinogenesis 21, Xia, H., Wang, W., Crespo, J., Kryczek, I., Li, W., Wei, S., Bian, Z., Maj, T., He,
585–591. M., Liu, R.J., et al. (2017). Suppression of FIP200 and autophagy by tumor-
Rody, A., Holtrich, U., Pusztai, L., Liedtke, C., Gaetje, R., Ruckhaeberle, E., derived lactate promotes naive T cell apoptosis and affects tumor immunity.
Solbach, C., Hanker, L., Ahr, A., Metzler, D., et al. (2009). T-cell metagene Sci. Immunol. 2, https://doi.org/10.1126/sciimmunol.aan4631.

Xian, Z.Y., Liu, J.M., Chen, Q.K., Chen, H.Z., Ye, C.J., Xue, J., Yang, H.Q., Li, geting microRNAs and EZH2 via glycolysis restriction. Nat. Immunol.
J.L., Liu, X.F., and Kuang, S.J. (2015). Inhibition of LDHA suppresses tumor 17, 95–103.
progression in prostate cancer. Tumour Biol. 36, 8093–8100.
Zou, W. (2005). Immunosuppressive networks in the tumour environment and
Yu, T., Guo, F., Yu, Y., Sun, T., Ma, D., Han, J., Qian, Y., Kryczek, I., Sun, D.,
their therapeutic relevance. Nat. Rev. Cancer 5, 263–274.
Nagarsheth, N., et al. (2017). Fusobacterium nucleatum promotes chemoresist-
ance to colorectal cancer by modulating autophagy. Cell 170, 548–563.e16. Zou, W., Wolchok, J.D., and Chen, L. (2016). PD-L1 (B7-H1) and PD-1 pathway
Zhao, E., Maj, T., Kryczek, I., Li, W., Wu, K., Zhao, L., Wei, S., Crespo, J., Wan, blockade for cancer therapy: mechanisms, response biomarkers, and combi-
S., Vatan, L., et al. (2016). Cancer mediates effector T cell dysfunction by tar- nations. Sci. Transl. Med. 8, 328rv4.

STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Anti-human/mouse LDHA Cell Signaling Technology Cat# 2012S; RRID: AB_2137173
Anti-human/mouse AMPKa Cell Signaling Technology Cat# 2532S; RRID: AB_330331
Anti-human/mouse p-AMPKa Cell Signaling Technology Cat# 2535S; RRID: AB_331250
Anti-human/mouse ULK1 Cell Signaling Technology Cat# 8054S; RRID: AB_11178618
Anti-human/mouse p-ULK1(Ser317)(D2B6Y) Cell Signaling Technology Cat# 12753S; RRID: AB_2687883
Anti-human/mouse LC3B (D11) Cell Signaling Technology Cat# 3868; RRID: AB_2137707
Anti-human/mouse b-actin (8H10D10) Cell Signaling Technology Cat# 3700; RRID: AB_2242334
Anti-human/mouse CEBPB (C-19) Santa Cruz Biotechnology Cat# sc-150; RRID: AB_2260363
Anti-mouse CD3e (clone 500A2) BD Biosciences Cat# 557984; RRID: AB_396972
Anti-mouse CD4 (clone RM4-5) BD Biosciences Cat# 558107; RRID: AB_397030
Anti-mouse IFN-g (clone XMG1.2) BD Biosciences Cat# 560660; RRID: AB_1727533
Anti-mouse CD8a (clone 3-6.7) BD Biosciences Cat# 557654; RRID: AB_396769
Anti-mouse TNF-a (clone MP6-XT22) BD Biosciences Cat# 557644; RRID: AB_396761
Anti-mouse Ly-6G/Ly-6C (clone RB6-8C5) BD Biosciences Cat# 565033
Anti-mouse Ly-6G (clone 1A8) BD Biosciences Cat# 560601; RRID: AB_1727562
Anti-mouse CD45 (clone 30-F11) Thermo Fisher Scientific Cat# MCD4530; RRID: AB_2539700
Anti-mouse Ly-6C (clone HK1.4) Thermo Fisher Scientific Cat# 47-5932-82; RRID: AB_2573992
Anti-mouse CD11b (clone M1/70) Thermo Fisher Scientific Cat# 17-0112-83; RRID: AB_469344
Anti-Rabbit IgG (H+L), Alexa Fluor 594 Thermo Fisher Scientific Cat# R37117; RRID: AB_2556545
Anti-mouse G-CSF (clone EPR3203 (N) (B)) Abcam Cat# ab181053
Anti-mouse Ly6G (clone 1A8) Bioxcell Cat# BE0075-1; RRID: AB_1107721
Anti-mouse CD4 (clone GK1.5) Bioxcell Cat# BE0003-1; RRID: AB_1107636
Anti-mouse CD8a (clone YTS169.4) Bioxcell Cat# BE0117; RRID: AB_10950145
Anti-Rat IgG2b isotype control (clone LTF-2) Bioxcell Cat# BE0090; RRID: AB_1107780
Bacterial and Virus Strains
Stbl3 Chemically Competent E. coli Thermo Fisher Scientific Cat# C737303
DH5a Competent Cells Thermo Fisher Scientific Cat# 18258012
Chemicals, Peptides, and Recombinant Proteins
Chloroquine Sigma-Aldrich Cat# C6628
2-Deoxy-D-glucose Sigma-Aldrich Cat# D6134
Dorsomorphin Sigma-Aldrich Cat# P5499
AMP Sigma-Aldrich Cat# A2252
ATP 100 mM Solution Sigma-Aldrich Cat# GE27-2056-01
Ovalbumin (323-339) Sigma-Aldrich Cat# O1641
Ovalbumin (257-264) Sigma-Aldrich Cat# S7951
Critical Commercial Assays
Mouse G-CSF DuoSet ELISA R&D systems Cat# DY414
Mouse GM-CSF DuoSet ELISA R&D systems Cat# DY415
Human GM-CSF DuoSet ELISA R&D systems Cat# DY215
Lactate Assay Kit Sigma-Aldrich Cat# MAK064-1KT
Direct-zol RNA MiniPrep Kit Zymo Research Cat# R2051
Myeloid-Derived Suppressor Cell Isolation Kit Miltenyi Biotec Cat# 130-094-538
Deposited Data
Raw data for gene expression arrays This study GEO: GSE103925
(Continued on next page)
e1 Cell Metabolism 28, 1–17.e1–e6, July 3, 2018

Continued
Experimental Models: Cell Lines
4T1 cells Fred R Miller (Karmanos Cancer Institute) N/A
Py8119 cells ATCC Cat# CRL-3278
MDA-MB-231 cells ATCC Cat# HTB-26
NIH/3T3 cells ATCC Cat# CRL-1658
LLC1 cells ATCC Cat# CRL-1642
B16-F10 cells ATCC Cat# CRL-6475
HEK293T cells ATCC Cat# CRL-3216
MC38 cells Walter Storkus N/A
ID8 cells Roby et al., 2000 N/A
Experimental Models: Organisms/Strains
Mouse: C57BL/6J The Jackson Laboratory Stock No: 000664
Mouse: BALB/cJ The Jackson Laboratory Stock No: 000651
Mouse: NSG The Jackson Laboratory Stock No: 005557
Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Stock No: 003831
Mouse: C.Cg-Tg(DO11.10)10Dlo/J The Jackson Laboratory Stock No: 003303
Oligonucleotides
Primers for colony This paper See Table S2
siRNA for mouse ULK1 Qiagen Cat# GS22241
siRNA for mouse FIP200 Qiagen Cat# GS12421
siRNA for mouse ATG5 Qiagen Cat# GS11793
siRNA for mouse LC3b Qiagen Cat# GS67443
Mouse G-CSF primer Origene Cat# MP202847
Mouse GM-CSF primer Origene Cat# MP202843
Mouse LDHA primer Origene Cat# MP207257
Mouse ACTb primer Origene Cat# MP200232
Mouse IL-1b primer Origene Cat# MP206724
Mouse TGF-b primer Origene Cat# MP217184
Mouse CEBPB primer Origene Cat# MP201856
Mouse MMP9 primer Origene Cat# MP207904
Mouse LC3B primer Origene Cat# MP208170
Human LDHA primer Origene Cat# HP208683
Human GM-CSF primer Origene Cat# HP200702
Human ACTB primer Origene Cat# HP204660
Recombinant DNA
Mouse LDHA shRNA#1 Dharmacon Cat# V2LMM_80290
Mouse LDHA shRNA#2 Dharmacon Cat# V2LMM_165731
Mouse CEBPB shRNA#1 Dharmacon Cat# V3LMM_504726
Mouse CEBPB shRNA#2 Dharmacon Cat# V3LMM_504727
Human LDHA shRNA#1 Dharmacon Cat# V3LHS_388269
Human LDHA shRNA#2 Dharmacon Cat# V3LHS_388270
Scramble shRNA This paper N/A
psPAX2 This paper N/A
pMD2.G This paper N/A
pLLEV-Luc Biomedical Research Core Facilities N/A
of University of Michigan
Csf3 Mouse Tagged ORF Clone Origene Cat# MR225697
Cebpb Mouse Tagged ORF Clone Origene Cat# MR227563
pcDNA 3.1(-) mouse C/EBP beta (LAP) Addgene Cat# 12557
(Continued on next page)
Cell Metabolism 28, 1–17.e1–e6, July 3, 2018 e2

Continued
pSpCas9(BB)-2A-Puro (PX459) V2.0 Addgene Cat# 62988
G-CSF Double Nickase Plasmid Santa Cruz Cat# sc-419844-NIC
Software and Algorithms
GSEA Subramanian et al., 2005 http://software.broadinstitute.org/
gsea/index.jsp/
Cytoscape 3.4 Shannon et al., 2003 http://www.cytoscape.org/
ImageJ NIH N/A
SAS 9.4 SAS Institute N/A
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Weiping
Zou (wzou@med.umich.edu).
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Animals
Six to eight week old female BALB/c, C57/BL6 and NOD SCID gamma deficient (NSG) mice were used for this study (Jackson Lab-
oratory). The work was approved by the committee on Use and Care of Animals at the University of Michigan. LDHA knockdown and
scramble 4T1 cells with luciferase expression were implanted into the secondary right mammary fat pad of BALB/c mice. Tumor size
was measured every three days using calipers fitted with Vernier scale. Tumor volume was calculated as described previously (Ta-
nikawa et al., 2012). Py8119 cells with LDHA knockdown were implanted into the mammary fat pad of C57/BL6 mice. The distant
metastatic foci were quantified by Bioluminescence imaging system. In some cases, single cell suspensions were made from spleen
and tumor tissues for immune phenotype and functional analysis
Cell Culture Studies

All cells were cultured at 37 C in a humidified atmosphere containing 5% CO2. Murine 4T1 breast cancer cells (sex: female) were
cultured in PRMI 1640 medium supplemented with 10% fetal bovine serum (FBS). Py8119 cells (sex: female) were cultured in
F-12K medium (ATCC, 30-2004) supplemented with 5% FBS. MDA-MB-231 breast cancer cells (sex: female) were cultured in
Leibovitz’s L-15 medium (Thermo, 11415064) supplemented with 10% FBS. NIH/3T3 (sex: male), LLC1, MC38 (sex: female), ID8
(sex: female), B16-F10 (sex: male), and HEK293T (sex: female) cells were cultured in DMEM (Thermo, 11965167) medium supple-
mented with 10% FBS.
METHOD DETAILS
Short Pairpin RNAs (shRNA), Small Interfering RNA (siRNA) and Genetic Knockout
Plasmids expressing short hairpin RNA targeting LDHA, CEBPB or scramble sequences were purchased from GE Dharmacon.
ShRNA sequences were packed into a lentivirus packaging construct and transfected into HEK293T cells with lipofectamine 2000
(Invitrogen). 4T1 and Py8119 cells were infected with shRNA expressing lentiviruses and selected with 10 mg/ml puromycin.
siRNAs targeting ULK1, FIP200, ATG5 and LC3b (Qiagen) were transfected into tumor cells with HiPerFect transfection reagent
(Qiagen).
G-CSF and shLDHA Co-Expression Vectors

G-CSF fragment with CMV promoter was cloned from G-CSF expression plasmid (MR225697, Origene) using KOD Xtreme hot start
DNA polymerase (EMD Millipore). The GFP with CMV promoter in pGIPZ plasmid was cut off from shRNA (shLDHA and Scramble)
expression plasmids (GE Dharmacon) with Xbaǀ and NotI (New England Biolabs) and replaced by G-CSF fragment with CMV pro-
moter using T4 DNA Ligase (New England Biolabs). The following primers were used to clone G-CSF fragment: CTAGtctagatagttat
taatagtaatcaattacggggtc and TTTTCCTTTTgcggccgcCTAGGCCAAGTGGTGCAGAGCA. G-CSF-pGIPZ plasmid was packaged
with psPAX2 and pMD2.G plasmids in HEK293T cells to produce G-CSF expressing lentivurs.
G-CSF Knockout Cells

4T1 cells were transfected with G-CSF Double Nickase Plasmid (sc-419844-NIC, Santa Cruz) according to the manufacturer’s in-
structions. Two days later, the transfected cells were cultured in RPMI 1640 complete medium with 5 mg/ml puromycin for
3 days. Living cells were seeded into 96 well plates with unlimited dilution to reach one cell per well. G-CSF knockout clones
were validated with ELISA.

MDSC and CD4/CD8 T cell Depletion

MDSCs were depleted with anti-Ly6G antibody (1A8, BioXCell). Anti-Ly6G antibody and isotype controls (200mg per mouse) were
administered intraperitoneally (i.p.) into tumor bearing mice every three days starting from day 3. CD4+ and CD8+ T cells were
depleted with anti-CD4 (GK1.5, BioXCell) and anti-CD8 (YTS 169.4, BioXCell) antibodies. Anti-CD4 (100mg per mouse) and anti-
CD8 (100mg per mouse) antibodies were injected i.p. at the beginning of tumor inoculation and continuously administered every three
days.
LAP*, LAP* Mutant, and LAP Expressing Vectors

Full length CEBPB LAP* expressing plasmid was purchased from Origene company. Site-directed mutation of second translation
initiation site in LAP* mRNA ATG/GCG (Uematsu et al., 2007) was introduced using KOD Xtreme hot start DNA polymerase (EMD
Millipore) according to the manufacturer’s instructions. The following primers were used to yield LAP* mutant expressing vector:
gcctttagacccGCggaagtggccaac and gttggccacttccGCgggtctaaaggc. LAP expressing plasmid was gifted from Addgene (Pla-
mid #12557).
LAP Knock Out Cells

Guide RNA sequences for CRISPR/CAS9 were developed at CRISPR design web interface (http://crispr.mit.edu/). Three gRNAs
around second ATG (initial translation site for LAP) were selected.
gRNA#1
5’-CACCGGCCCGCCGCCTTTAGACCCA-3’/5’-AAACTGGGTCTAAAGGCGGCGGGCC-3’.
gRNA#2
5’-CACCGGTCGGGCTCGTAGTAGAAGT-3’/5’-AAACACTTCTACTACGAGCCCGACC-3’.
gRNA#3
5’-CACCGGTAGAAGTTGGCCACTTCCA-3’/5’-AAACTGGAAGTGGCCAACTTCTACC-3’.
The complementary oligonucleotides for guide RNAs were annealed and cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addg-
ene Plasmid #62988). The homologous recombination template with ATG mutation (ssDNA Ultramer from IDT) is ssDNA #1
CGCGTTCATGCACCGCCTGCTGGCCTGGGACGCAGCATGCCTCCCGCCGC
CGCCCGCCGCCTTTAGACCCgcaGAAGTGGCaAACTTCTACTACGAGCCC
GACTGCCTGGCCTACGGGGCCAAGGCGGCCCGCGCCGCGCCGCGCGCCCC and ssDNA #2 GGGGCGCGCGGCGCGGCGC
GGGCCGCCTTGGCCCCGTAGGCCAGGCAGTCGGGCTCGTAGTAGAAGTTtGCCACcTCtgcGGGTCTAAAGGCGGCGGGCGGCG
GCGGGAGGCATGCTGCGTCCCAGGCCAGCAGGCGGTGCATGAACGCG
4T1 cells were transfected with either pX459/gRNA#1 with ssDNA#1 or pX459/gRNA#2 and gRNA#3 with ssDNA#2 using Lipofect-
amine 2000 (Thermo Fisher Scientific). Two days later, the transfected cells were cultured in RPMI 1640 complete medium with 5 mg/
ml puromycin for another two days. Living cells were seeded into 96 well plates with unlimited dilution to reach one cell per well. LAP
knockout clones were confirmed by Western blot.
LAP Over Expression Lentivirus

LAP fragment with CMV promoter was cloned from LAP expression plasmid (plasmid #12557, Addgene) using KOD Xtreme hot
start DNA polymerase (EMD Millipore). The GFP with CMV promoter in pGIPZ plasmid was cut off from Scramble plasmids (GE
Dharmacon) with Xbaǀ and NotI (New England Biolabs) and replaced by LAP fragment with CMV promoter using T4 DNA Ligase
(New England Biolabs). The following primers were used to clone LAP: 5’-CTAGtctagatagttattaatagtaatcaattacggggtc-3’ and
5’-TTTTCCTTTTgcggccgcCTAGCAGTGGCCCGCCGAGGCC-3’. LAP-pGIPZ plasmid was packaged with psPAX2 and pMD2.G
plasmids in HEK293T cells to produce LAP expressing lentivurs.
Cytokine Detection
Tumor cells were cultured in different conditions. The cells were subject to real-time PCR assay. The culture supernatants were sub-
ject to cytokine measurement with ELISA kits (R&D System).
Western Blot
Cell lysates were prepared in RIPA buffer (Thermo Fisher Scientific). The protein concentrations of cell lysates were determined by
BCA protein assay kit (Thermo Scientific). Equivalent amounts of total cellular protein were separated by SDS PAGE and transferred
to nitrocellulose membranes. The proteins were detected with specific antibodies to CEBPB (SantaCruz Biotechnology), LDHA,
p-AMPK, AMPK, p-ULK1 (317), ULK1, LC-3b, and b-actin (Cell Signaling Technology). The protein expression levels were quantified
with ImageJ software and were normalized to 1 in specific control groups (Liu et al., 2010).
RNA Extraction, Reverse Transcription, and Real-Time Polymerase Chain Reaction

RNA extraction, reverse-transcription, and real-time polymerase chain reaction (PCR) were described previously (Curiel et al., 2004;
Wang et al., 2016). Primers were purchased from OriGene Technologies.

Flow Cytometry Analysis (FACS)

Single cell suspensions were prepared from different organs and tumor tissues. Single cells were stained with fluorescence-conju-
gated anti-CD45, anti-CD3, anti-CD4, anti-CD8, anti-TNF-a, anti-IFN-g, anti-IL-2, anti-Gr-1, anti-Ly6G, and anti-CD11b (BD, USA),
and were analyzed with LSR II flow cytometry (BD Biosciences, San Jose).
Immunofluorescence Staining
For G-CSF staining, tumor cells were cultured and fixed with Foxp3 fixation transcription factor and permeabilization buffer and
washed with Foxp3 transcription factor wash buffer (Thermo Fisher Scientific). Then, the cells were blocked with 2.5% normal
goat serum blocking solution (Vector laboratories) and were stained with anti-G-CSF antibody (abcam) and goat anti-rabbit Alexa
fluor 594 secondary antibody (Thermo Fisher Scientific). For autophagy staining, tumor cells were seeded in 24 well plates and
treated with 50 mM chloroquine (CQ) (Sigma-Aldrich) for 6 hours. Cells were washed and stained with primary antibody, anti-mouse
LC-3b antibody (Cell Signaling Technology) and secondary antibody, goat anti-rabbit Alexa fluor 594 secondary antibody (Thermo
Fisher Scientific), and counter-stained with DAPI. Cells were analyzed with fluorescence microscope (Leica Biosystems).
Metabolic Assay
Tumor glucose metabolism was measured in a Seahorse XFe24 analyzer on V7-PET XF24 cell culture microplates (Seahorse Biosci-
ence). One day before the assay, Tumor 4T1 cells were seeded into the wells and cultured in complete RPMI 1640 medium. Before
testing, the cells were washed three times with Seahorse XF assay medium (Seahorse Bioscience) and were added 225 ml Seahorse
XF assay medium. Different metabolic modifiers were added as indicated.
Lactate Detection
Tumor cells were cultured in six well plates with complete RPMI 1640 medium for 24 hours. Culture supernatant was collected and
filtered with protein concentrators PES 10 K MWCO (Thermo Fisher Scientific). Lactate was measured with lactate assay kit (Sigma-
Aldrich) according to the instruction.
ATP and AMP Measurement

Tumor cells (107) were lysed with 1 ml lysis buffer and filtered with protein concentrators PES 10 K MWCO (Thermo Fisher Scientific).
The filtered lysates were detected by Liquid chromatography–mass spectrometry (LC-MS) (Angilent). ATP and AMP standards were
purchased from Sigma-Aldrich.
Microarray
Scramble and LDHA KD 4T1 cells were cultured for 24 hours and the total RNA of Scramble and LDHA KD 4T1 cells was extract with
Direct-zol RNA MiniPrep Kit (Zymo Research). Gene expression microarray was carried out at the University of Michigan Microarray
Core Facility using Affymetrix Mouse Gene ST 2.1 Chip according to the standard protocol. Two biological replicates of each sample
were prepared independently. Data was analyzed by the University of Michigan Bioinformatics Core Facility. RMA was used to fit log2
expression values to the data using the oligo bioconductor package in R version 3.4.0. Volcano plots were generated by R. The re-
sults were uploaded into GEO as GEO: GSE103925.
MDSC Suppression Assay

MDSC suppressive assay was performed as previously described (Hamilton et al., 2012; Srivastava et al., 2010). Ly6G+ MDSCs cells
were isolated from tumor tissues of 4T1 and Py8119 tumor models with Myeloid-Derived Suppressor Cell Isolation Kit (Miltenyi Bio-
tec). Splenocytes were isolated from OT-II and OT-I transgenic mice, respectively. OT-II and OT-I cells were stimulated with 1 mg/ml
OVA peptide (323–339) and 10 mg/ml OVA peptide (257-264), respectively, and co-coultured with MDSCs. T cell activation markers
and cytokines were detected by flow cytometry (FACS).
Bioinformatics Analysis
TCGA (n=547) data set was obtained from the Cancer Genome Atlas Network reported by Kobodt (Koboldt et al., 2012). METABRIC
data set was obtained from the European Genome-phenome Archive (EGAS00000000083) reported by Curtis (Curtis et al., 2012) and
the clinical information of this data set was download from Oncomine reported by Curtis (Curtis et al., 2012). The clinical information
was matched with the gene expression data on the basis of patient identifiers. GEO: GSE58812 data set was downloaded from Gene
Expression Omnibus (GEO) (Jezequel et al., 2015). GSEA analysis was performed as we previously reported (Subramanian et al.,
2005; Sun et al., 2016). The gene sets used for the enrichment analysis including h.all.v5.2.symbols, c5.all.v5.2.symbols and
c2.cp.kegg.v5.2.symbols were from the Molecular Signatures Database-MsigDB and immune response metagene clusters (Rody
et al., 2009). MDSC signature gene set and gene signature score calculation were previously defined (Welte et al., 2016). High specific
signature score indicates high specific pathway activation. The network of enrichment results was mapped with Cytoscape 3.4
(Shannon et al., 2003). Data sets were normalized by standard deviation by R. Pathway signature scores were calculated and re-
scaled by R.

QUANTIFICATION AND STATISTICAL ANALYSIS
Comparisons of measurement data between two groups were performed using two-sided Student’s t-test. Tumor growths in
different groups were tested by repeated measures ANOVA. The Pearson’s correlation coefficient was calculated to evaluate the as-
sociation between markers and a p-value < 0.05 indicates that the correlation is significantly different from zero. To control for cohort
(dataset), the Pearson’s partial correlation was used. Overall patient survival was defined as the time from date of diagnosis to dis-
ease-related death. Metastasis free survival was defined as the interval from date of diagnosis to first metastasis. Survival data was
censored at the last date the patient was known to be alive or free of metastasis. Survival functions were estimated by the Kaplan-
Meier method and compared using the log-rank test. To control for cohort, the log-rank test was stratified according to cohort.
Furthermore, the Cox proportional hazards model was used to assess the effect of each maker to survival. In the model, continuous
maker data was used and cohort was controlled by allowing a different baseline hazard function for each cohort. The assumptions of
proportional hazard and linear form of covariates were assessed by martingale residuals plots and the Kolmogorov-type supremum
test. All analyses for survival data were done using SAS 9.4 software. P < 0.05 was considered significant.
DATA AND SOFTWARE AVAILABILITY
The accession number for the raw data for gene expression arrays reported in this paper is GEO: GSE103925.

Li 2018

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Li 2018

Uploaded by

Copyright:

Available Formats

Article

Aerobic Glycolysis Controls Myeloid-Derived

d Aerobic glycolysis regulates CEBPB isoform, LAP, via AMPK-

d LAP controls G-CSF and GM-CSF expression and MDSC

d Aerobic glycolysis impacts tumor immunity and patient

Li et al., 2018, Cell Metabolism 28, 1–17

Aerobic Glycolysis Controls Myeloid-Derived

*Correspondence: kaixiongtao@hust.edu.cn (K.T.), wgb@hust.edu.cn (G.W.), wzou@med.umich.edu (W.Z.)

SUMMARY These reprogrammed activities are recognized as hallmarks of

Cell Metabolism 28, 1–17, July 3, 2018 Published by Elsevier Inc. 1

0.008 0.008 0.008

0.004 0.004 0.004

0.002 0.002 0.002

0.000 0.000 0.000

G-CSF mRNA fold change

G-CSF mRNA fold change

60 1 0.02 0.01 1.0 1.0

β-actin 0.8 0.8

Figure 1. Glycolysis Regulates Tumor G-CSF and GM-CSF Expression

(legend continued on next page)

Cell Metabolism 28, 1–17, July 3, 2018 3

G-CSF mRNA fold change

LAP* LAP* 3.0

80 CTR LAP KO LAP OE

Figure 2. Glycolysis Targets CEBPB Isoform LAP to Control G-CSF Expression

Cell Metabolism 28, 1–17, July 3, 2018 5

1.0 1.2 120

Figure 3. Glycolysis Targets LAP via the AMPK-ULK1 Pathway

(legend continued on next page)

Cell Metabolism 28, 1–17, July 3, 2018 7

1 20.68 1 14.10 1 3.40 1 2.70

Figure 4. Glycolysis Controls LAP Expression via Autophagy Activation

(legend continued on next page)

Cell Metabolism 28, 1–17, July 3, 2018 9

MDSCs in CD45+ cells (%)

Cytokine Scr shLDHA1 Scr shLDHA1

50 10% 24% 2000 shLDHA1

Figure 5. Tumor LDHA Affects MDSCs to Control Tumor Immunity

10 Cell Metabolism 28, 1–17, July 3, 2018

Cell Metabolism 28, 1–17, July 3, 2018 11

Cytokines in CD8+ cells (%)

Ly6G+ in CD45 cells (%)

Ly6G+ in CD45+ cells (%)

Cytokines in CD8+ T cells (%)

Figure 6. Tumor LDHA Regulates Tumor Immunity via G-CSF

(legend continued on next page)

d KEY RESOURCES TABLE AUTHOR CONTRIBUTIONS

Cell Metabolism 28, 1–17, July 3, 2018 13

A B E Adaptive immune response

LDHA high-expression group Amino acid metabolism

MDSC signature score

p < 0.0001 p < 0.0001

Figure 7. Glycolysis, MDSCs, and T Cell Response Correlate in TNBC Patients

(legend continued on next page)

Cell Metabolism 28, 1–17, July 3, 2018 15

16 Cell Metabolism 28, 1–17, July 3, 2018

Cell Metabolism 28, 1–17, July 3, 2018 17

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

e1 Cell Metabolism 28, 1–17.e1–e6, July 3, 2018

Cell Metabolism 28, 1–17.e1–e6, July 3, 2018 e2

CONTACT FOR REAGENT AND RESOURCE SHARING

LAP, LAP Mutant, and LAP Expressing Vectors