2015Glomerulonephritis-Induced Changes in Urinary and Kidney MicroRNA Profiles in Rats

ToxSci Advance Access published March 9, 2015
Revised manuscript with tracked changes
Title:
Glomerulonephritis-induced changes in urinary and kidney microRNA profiles in rats
Authors:
Mira Pavkovic *,†
(mira_pavkovic@hms.harvard.edu)
Björn Riefke *
(bjoern.riefke@bayer.com)
Anna-Lena Frisk ‡
(anna-lena.frisk@bayer.com)
Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

Ina Gröticke§
(ina.groeticke@bayer.com)
Heidrun Ellinger-Ziegelbauer *
(heidrun.ellinger-ziegelbauer@bayer.com)
Affiliations:
* Investigational Toxicology, GDD-GED-Toxicology, Bayer Pharma AG, 42096 Wuppertal and
13353 Berlin, Germany.
† current: Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences,

Harvard Medical School, 02115 Boston, Massachusetts, USA.
‡ Pathology, GDD-GED-Toxicology, Bayer Pharma AG, 13353 Berlin, Germany.
§ Indication Expansion, GDD-GCGE-Common Mechanism Research, Bayer Pharma AG, 13353

Berlin, Germany
Running title:
Urine miRNA biomarker and glomerulonephritis
Corresponding author and address:

Dr. Heidrun Ellinger-Ziegelbauer
Aprather Weg 18a, Bldg 514
42096 Wuppertal, Germany
Office: +49 202 36 4396
Email: heidrun.ellinger-ziegelbauer@bayer.com
1
Abstract
MicroRNAs (miRNAs) regulate gene expression post-transcriptionally and thus are involved in
various physiological and pathological states. Due to their stability in biofluids miRNAs have
also been proposed as biomarkers (BMs) for tissue injury. We investigated the usefulness of
urinary miRNAs for detection of site-specific renal damage in an anti-glomerular basement
membrane (GBM) glomerulonephritis (GN) model in rats by comparing GN-induced urinary
miRNAs profiles to traditional and newer protein BMs, and to proximal tubular injury-induced

urinary miRNA profiles observed previously after cisplatin treatment.
Male Wistar Kyoto and Sprague Dawley rats were dosed once with 1, 2.5 and 5 ml/kg
nephrotoxic serum (NTS) or 1.5 and 5 ml/kg NTS, respectively. GN and tubular damage were
observed histopathologically in all treated rats after 14 days. Although serum creatinine and
BUN were not changed, several protein BMs and 74 urinary miRNAs were found to be
increased 8 and 14 days after NTS administration. Of these 74 miRNAs, five were identified as
increased after NTS- but not after cisplatin treatment. Using in situ hybridization two of them,
miR-10b and -100, were found to be localized in distal segments of the nephron, potentially
reflecting the tubular injury in those regions.
Furthermore, evaluation of both miRNA and mRNA expression in the kidney revealed possible
miRNA-mRNA interactions mostly associated with fibrotic and transforming growth factor β
signaling.
In conclusion, our investigations support the potential of urinary miRNAs as specific BMs for
kidney injury, and suggest a role of miRNAs in pathological processes during GN in the kidney.
Keywords: urinary microRNAs, biomarker, glomerulonephritis
2
1. Introduction
Detection of kidney injury is a challenge either in preclinical and clinical phases of drug
development, or in patients with acute kidney injury (AKI) caused by other reasons, since
especially in the latter case patients are at high risk to develop chronic or end-stage renal
diseases (Guengerich, 2011; Hsu et al., 2013). As traditional biomarkers for kidney function like
serum creatinine and blood urea nitrogen are associated with low sensitivity, specificity, and
capability for early diagnosis (Vaidya et al., 2008), large efforts were and are still being

undertaken in the exploration of new kidney injury biomarkers (BMs) with enhanced
characteristics. Significant success was achieved within the protein BM research leading to
regulatory qualification of new BMs in urine for detection of nephrotoxicity in rats (EMA, 2009).
Although these new protein BMs outperform traditional BMs in sensitivity and specificity, they
are partly limited for instance in terms of antibody availability to ensure translatability across pre-
clinical laboratory animal species and to humans (Jensen, 2004) or in terms of stability in
biofluids (Dieterle and Sistare, 2010). Additionally, none of these is exclusively specific for
glomerular injury.
Recently another molecule class, microRNAs (miRNAs), has entered the BM research field.
Accumulating evidence suggests them as promising new BMs for tissue injury. MiRNAs are
small (approximately 22 nucleotides), non-coding RNAs known to post-transcriptionally regulate
gene expression through binding to 3'-untranslated region of target mRNAs (Bartel, 2004). They
are evolutionarily conserved across a wide range of species and involved in essential
physiological functions, including proliferation, apoptosis and differentiation (Krol et al., 2010).
Not unexpected in light of their wide range of functions, miRNA involvement was identified in
various pathological states like cancer, cardiovascular as well as kidney diseases (Hermeking,
2012; Schena et al., 2014; Small and Olson, 2011). With the discovery of miRNAs in body fluids
(Weber et al., 2010) their features as ideal BMs were recognized: tissue-specificity, less-
3
invasive accessibility, high stability in biofluids, translational potential and sensitive
quantification with real-time PCR (Saikumar et al., 2014, Mall et al., 2013).
Several studies have already reported the BM potential of e.g. plasma miRNAs for the detection
of cancer (Fu et al., 2014), drug induced liver injury (Wang et al., 2014;), or myocardial injury
(Nishimura et al., 2014). Compared to reports on blood-based miRNAs as potential BMs, data
for urinary miRNAs as candidate BMs for kidney damage is limited, yet still promising, as
suggested by studies analyzing urine of patients with AKI or immunoglobulin A nephropathy

(Ramachandran et al., 2013; Saikumar et al., 2012; Wang et al., 2011).
Recently the Health and Environmental Science Institute1 (HESI) Biomarkers of Nephrotoxicity
Committee engaged into investigation of the potential of miRNA measurements in urine for
detection of site-specific renal damage, studying compounds with known specific toxic effects
on discrete segments of the nephron in a pre-competitive collaboration. In a first study we
examined the miRNA profile in urine from Wistar rats with cisplatin-induced proximal tubular
injury and found many miRNAs with significantly increased urinary levels upon cisplatin
treatment (Pavkovic et al., 2014a). These results were confirmed by other HESI Committee
members reporting several identical miRNAs to be increased in urine after cisplatin and
gentamicin induced proximal tubular injury in Sprague Dawley rats (Kanki et al., 2014;
Nassirpour et al., 2014).
The objective of the present study was to investigate urinary miRNA levels in a rat injury model
affecting a different part of the nephron i.e. the glomerulus and to identify site-specific miRNAs
by comparing urinary miRNA profiles after glomerular vs. proximal tubular injury. Therefore we
employed nephrotoxic serum (NTS) which contains antibodies against the glomerular basement
membrane (GBM) to induce glomerulonephritis (GN). Anti-GBM GN models in rats are widely
used since its biochemical and histopathological characteristics are similar to crescentic
nephritis and Goodpasture's disease in humans (Pusey, 2003); although, such models are
challenging since tubular damage is a known side effect of antiserum-induced GN models
4
(Salant and Cybulsky, 1988). To our knowledge, this is the first time that urinary miRNA were
profiled in an anti-GBM GN model. Urine was collected 8 and 14 days after a single injection of
1, 2.5 and 5 ml/kg NTS in male Wistar Kyoto rats and of 1.5 and 5 ml/kg NTS in male Sprague
Dawley rats. In addition to analyses of classical endpoints and several newer protein BMs,
urinary miRNA profiles were measured by quantitative real-time PCR. Potential site-specific
localization of two miRNAs apparently specific for the injury present in the GN model was
investigated by in situ hybridization. Furthermore, since different rat strains show differential

susceptibility to NTS-induced GN, two different rat strains were chosen for characterization of
molecular processes affected in this model, by investigating gene expression in the kidneys
from both rat strains.
5
2. Materials and Methods
2.1. Animal Studies
All animal experiments were performed according to the German guidelines for care and use of
laboratory animals. Male Wistar Kyoto (WKY) and Sprague Dawley (SD) rats, 8 weeks old, were
purchased from Charles River laboratories (Sulzbach, Germany). Animals were individually
housed in type III makrolon cages, with a 12h light-dark cycle. Standard rodent chow pellets and
water were provided ad libitum.

Rats were randomly grouped (WKY: control group n=3, treatment groups n=5; SD: all groups
n=6) and dosed once iv with 0, 1 (WKY), 1.5 (SD), 2.5 (WKY) or 5 ml/kg nephrotoxic serum
(NTS; Sheep Anti-Rat Glomerular Basement Membrane (GBM) Serum (PTX-001S); Probetex,
San Antonio, TX). Control groups received appropriate volumes of normal saline solution.
Doses were selected based on Probetex recommendations and dose finding studies performed
in house. For urine collection animals were housed in individual metabolism cages (24h) and
had access to food and water. Urine was collected over ice on day 8 and 14, centrifuged
(3000xg 10 min 10°C) and the supernatant was stored at -80°C. Blood was collected on day 14
and resulting serum and plasma were stored at -80°C. On day 14 rats were euthanized and the
kidneys were removed for histopathological examination and RNA isolation. Kidney tissue for
RNA isolation was shock frosted with liquid nitrogen and stored at -80°C.
2.2. Biochemical and histopathological analyses
Blood urea nitrogen and serum creatinine concentrations were measured with an ADVIA 1650
using reagents from Siemens Diagnostics (Fernwald, Germany). Creatinine was determined by
the Jaffe´ method. Urinary total protein was determined quantitatively with an ADVIA 2400 using
reagents from Siemens Diagnostics (Fernwald, Germany). Urinary creatinine was measured
using an enzymatic test on a Roche Cobas cIII.
6
Urinary protein biomarkers were analyzed with two different platforms according to the
manufacturer’s instructions. MesoScale Discovery (MSD; Gaithersburg, MD): urinary albumin
(ALB) was measured with the Kidney Injury Panel 1 Assay Kit. Luminex xMAP (LMX; purchased
from Novagen, EMD Chemicals; Madison, WI): urinary β-2-microglobulin (β2M), glutatione-S-
transferase alpha (αGST), kidney injury molecule-1 (KIM-1), tissue inhibitor of metallopeptidase-
1 (TIMP-1), vascular endothelial growth factor (VEGF), and calbindin (CALB), clusterin (CLU),
cystatin C (CysC), lipocalin-2 (neutrophil gelatinase-associated lipocalin, NGAL), osteopontin

(OPN) were measured with the WideScreen Rat Kidney Toxicity Panels 1 and 2, respectively.
Absolute concentrations were normalized to the corresponding urinary creatinine concentration.
Statistical analysis was performed with ANOVA and Dunnett’s test or with the Student’s t-test
using GraphPad Prism 5 (GraphPad Software Inc., USA) between replicates of the treatment
groups and corresponding time-matched control group.
For histopathological examination kidneys were fixed in 10% neutral buffered formalin, trimmed,
embedded, sectioned and stained with hematoxylin and eosin. Histopathological findings
(mesangial hypercellularity, accumulation of glomerular matrix, hyperplasia of Bowman capsule,
hyaline casts, tubular degeneration/regeneration, tubular dilatation, interstitial fibrosis,
mononuclear cell infiltration) were graded separately per parameter using a severity scoring
system: grade 0, absent; grade 1, minimal; grade 2, slight; grade 3, moderate; grade 4, marked;
grade 5, very severe. In order to further characterize the lesion a Periodic acid-Schiff reaction
(PAS) stain was performed, too. Additional findings in the SD rats, included cysts, tubular
basophilia, and pelvic dilation, these findings were interpreted to be spontaneous background
findings.
2.3. RNA extraction
Total RNA including small RNA species (miRNAs) was isolated from 200 µl urine using the
miRNeasy Mini Kit (Qiagen; Hilden, Germany). Each urine sample was mixed with 700 µl
7
QIAzol, and then spiked with 2.5 fmol synthetic control miRNA ath-miR-159a (Sigma Aldrich;
Hamburg, Germany); all following procedures were performed according to the manufacturer’s
instructions. Finally, RNA was eluted with 40 µl RNase-free water.
Total kidney RNA including small RNA species was also isolated with the miRNeasy Mini Kit
from 20 mg kidney tissue whereas total kidney RNA (mRNA) was isolated with the RNeasy Mini
Kit (Qiagen) from 70 mg kidney tissue, both according to the manufacturer’s instructions.
The quality of isolated RNAs was assessed using Bioanalyzer Small or Pico RNA Kits (Agilent;

Santa Clara, CA) and the quantity was determined with a spectrophotometer.
2.4. Quantitative real-time PCR and data analysis
Urinary miRNA profiles were analyzed with TaqMan® Low Density A Arrays (TaqMan cards,
Applied Biosystems by life technologies; Darmstadt, Germany), representing 373 unique rodent
miRNAs and several small RNAs. A fixed volume of 3 µl of the RNA eluate was employed.
Megaplex reverse transcription, megaplex pre-amplification and final quantitative PCR on the
TaqMan cards were performed according to the manufacturer’s instructions. MiRNA levels were
calculated according to the ‘modified ∆Ct quantification’ approach as described previously
(Pavkovic, et al., 2014a). This approach is based on calculating 230-Ct and normalizing to urinary
creatinine (230-Ct/uCrea) to derive a unit-less absolute amount, corrected for urine dilution. For
selection of affected miRNAs derived from the TaqMan card data, tools implemented in Analyst
software (Genedata; Basel, Switzerland) were employed, including ANOVA with factors
treatment and time (BH-Q<0.05 considered as significant), Student’s t-test (treated vs. control,
p<0.01 considered as significant) and a 2-fold change cutoff between treated and control
groups.
Selected miRNAs were re-analyzed in urine samples with TaqMan® MicroRNA Assays followed
by absolute quantification using standard curves run in parallel, as described previously
(Pavkovic, et al., 2014a). For several miRNAs for which we did not obtain a reliable standard
8
curve with TaqMan® MicroRNA Assays, we used miCURY LNATM PCR assays from Exiqon
(Vedbaek, Denmark). A fixed volume of 2 µl of the RNA eluate was employed for these assays.
Universal reverse transcription followed by a specific SYBER green based quantitative PCR
were conducted according to the manufacturer’s instructions.
Kidney miRNAs were measured with TaqMan cards according to the manufacturer’s
instructions. Relative levels of kidney miRNAs (treated vs. control) were calculated using the
general ∆∆Ct method with small RNA U6 as endogenous control gene: ∆∆Ct = (Cttarget miRNA –

CtU6)treated - (Cttarget miRNA – CtU6)control. Tools available via Genedata’s Analyst software, including
Student’s t-tests (treated vs. control, p<0.05 considered as significant) and a 1.5-fold change
cutoff between treated and control groups, were used for selection of deregulated miRNAs.
2.5. Microarray expression profiling
Biotin-labeled copyRNA samples prepared from 500 ng high quality total kidney RNA were
hybridized on GeneChip® Rat genome 230_2.0 arrays (Affymetrix; Santa Clara, CA) according
to the manufacturer’s instructions. After scanning of the fluorescent GeneChip images with the
Affymetrix GeneChip Scanner 3000, raw data image files (dat) were converted into cel-files.
Finally, one intensity value per probe set was derived with Affymetrix Microarray Suite (MAS)
5.0. The GeneChip® Rat genome 230_2.0 array comprises over 31000 probe sets representing
approximately 28700 well annotated rat genes.
Using Genedata’s Analyst, genes encoding mRNAs, whose levels were significantly changed,
were selected separately for each rat strain using ANOVA based on the factor treatment (BH-
Q<0.005 considered as significant), Student’s t-test (p<0.001 considered as significant) and a 2-
fold deregulation cutoff between treated and control groups.
Ingenuity Pathway Analysis (IPA, Ingenuity® Systems, www.ingenuity.com) was employed for
pathway analysis in general and to search for deregulated mRNAs containing sequences
complementary to those present in the deregulated miRNAs, i.e. so-called miRNA target
9
analysis for identification of mRNAs potentially regulated by miRNAs. The following filter criteria
were applied: (1) experimentally observed and/or highly predicted target relation, i.e. sequence
complementarity between a mRNA and a miRNA, (2) opposite direction of expression change
after NTS administration, since miRNAs are mostly negative regulators of the mRNAs they can
bind, and (3) known expression of the miRNAs in kidney.
2.6 in situ Hybridization

In a separate experiment the localization of selected miRNAs was investigated in the kidney of a
healthy male Wistar rat. After whole-body perfusion with a fixing solution containing 3% formalin
and 1% glutaraldehyde, kidneys were immediately removed, fixed in neutral buffered formalin,
trimmed and paraffin embedded. In situ hybridization was performed on approximately 5 µm
thick sections using double-digoxigenin (DIG) labeled miRNA probes from Exiqon according to
the manufacturer’s instructions with minor modifications. In brief, sections were first
deparaffinized with xylene and ethanol (100%, 96% and 70%) followed by incubation with
proteinase-K (2.5 µg per slide for 10 min 37°C). After washing with 1xPBS, sections were
dehydrated with ethanol (70%, 96% and 100%), air dried for 15 min and pre-hybridized for 30
min at 55°C with 1xExiqon’s hybridization buffer supplemented with 4.3% salmon sperm DNA
(Sigma-Aldrich; Hamburg, Germany). Hybridization with the miRNA probes (miR-10b:
ACACAAATTCGGTTCTACAGGG, Tm 82°C, 100 nM; miR-100: CACAAG-
TTCGGATCTACGGGTT, Tm 83°C, 100 nM; miR-26a: AGCCTATCCTGGATTACTTGAA, Tm
85°C, 100 nM; miR-192: GGCTGTCAATTCATAGGTCAG, Tm 83°C, 80 nM) was performed for
one hour 30°C under the RNA melting temperature corresponding to the optimal hybridization
temperature. Sections were washed sequentially with pre-heated SSC-buffer (1x, 0.2x, 0.1x) at
55°C and blocked with blocking-buffer (1% BSA, 2% sheep serum in 0.1% PBS-T) for 30 min at
room temperature. Alkaline phosphatase (AP) conjugated anti-DIG (Roche Diagnostics,
Mannheim, Germany) was diluted 1:800 in antibody-dilution-buffer (1% BSA, 1% sheep serum
10
in 0.05% PBS-T) and incubated for one hour at room temperature. After washing with 0.1%
PBS-T, sections were incubated with AP-substrate solution (NBT-BCIP ready-to-use tablets;
Roche Diagnostics, Mannheim, Germany) light-protected over night at room temperature. The
AP reaction was stopped with cold water. For counter staining sections were incubated in 0.01%
eosin for approximately one minute, dehydrated with ethanol (70%, 90% and 100%) and then
xylene. Finally, sections were scanned and analyzed using the MIRAX Scanner and Viewer,
respectively (Zeiss; Jena, Germany). General experimental settings were established with

Exiqon’s positive controls (U6 probe: abundant nuclear signal; miR126 probe: abundant
endothelial signal) and negative controls (scrambled probe: no complementarity to any known
miRNAs sequence). The pictures shown are representative for at least three independent in situ
hybridization experiments.
11
3. Results
3.1 Histopathology and clinical chemistry
Wistar Kyoto (WKY) and Sprague Dawley (SD) rats were treated once with different doses of
nephrotoxic serum (NTS). The WKY kidneys were histologically examined after 14 days.
Glomerulonephritis (GN), characterized by mesangial hypercellularity, glomerular matrix
accumulation and Bowman’s capsule hyperplasia, was diagnosed in all NTS-treated rats (Fig.1).
Further, an accumulation of PAS positive material in the mesangium was seen in both rat

strains (Suppl.Fig.2). Although fully formed glomerular crescents were not detected, the
activation/hyperplasia of the Bowman’s capsule epithelia (hyperplasia) might represent dose
dependent initial lesions of crescent formation and/or the hypercellularity might
develop/contribute to crescent formations in a later stage.
All findings increased dose-dependently from minimal to moderate severity scores, and were
not observed in control rats. In addition to glomerular changes, tubular degeneration and
regeneration was observed in the cortex including the corticomedullary junction and extending
to the inner stripe of the outer medulla. Treated SD rats, examined 8 and 14 days after NTS
injection, showed comparable findings, but glomerular changes were less severe than in WKY
rats, while tubular damage and intra group variability were larger. All histopathological findings
are listed in Suppl.Tab.1.
Traditional kidney injury biomarkers like blood urea nitrogen and serum creatinine were not
increased after NTS treatment (Suppl.Fig.1 A and B), but severe proteinuria was detected. 8
and 14 days after NTS administration total protein levels were significantly and dose-
dependently increased in urine from WKY and SD rats (Fig. 2).
3.2 Evaluation of urinary protein biomarkers for kidney injury
For measurement of newly qualified, recently endorsed, or exploratory protein biomarkers (BMs)
urine was collected 8 and 14 days after NTS treatment. Corresponding to severe proteinuria a
12
large increase of albumin (ALB) was measured in urine from all treated rats of both strains at
both time points (Tab.1). β-2-microglobuline (β2M), kidney injury molecule (KIM-1), clusterin
(CLU) and cystatin C (CysC) showed similar urinary profiles: no increase after treatment with
the lowest doses in both rat strains on both days, an increase after treatment of WKY rats with
the middle dose of 2.5 ml/kg NTS on both days and a significant increase after treatment with
the high dose (5 ml/kg) in both rat strains on both days (Tab.1). None of the other BMs, i.e.
neutrophil gelatinase-associated lipocalin (NGAL), osteopontin (OPN), α-glutathione-S-

transferase (αGST), tissue inhibitor of metallopeptidase-1 (TIMP-1), or vascular endothelial
growth factor (VEGF), were increased in urine after treatment with the lowest doses in both rat
strains, and after treatment of WKY rats with the middle dose of 2.5 ml/kg NTS; only NGAL and
VEGF were significantly increased on day 14 and 8 NTS (Tab.1 and Suppl.Tab.2), respectively.
Treatment with 5 ml/kg NTS increased urinary levels of all other BMs, except calbindin (CALB)
which showed no significant changes in urinary levels at any time point. Overall, the NTS-
induced increases of all urinary BM levels were dose-dependent, larger on day 8 than on day 14
per dose group and higher in WKY rats than in SD rats. Interestingly, despite both ALB and
KIM-1 showing a strong treatment-dependent increase in urine, the treatment vs. control ratios
were clearly higher for ALB than for KIM-1, e.g. approximately 140-fold higher 14 days after
treatment of WKY rats with 5 ml/kg NTS.
3.3 Comparison of urinary miRNAs increased by GN-associated vs. cisplatin-induced proximal
tubular injury
To explore miRNAs increased or decreased in urine with GN-associated kidney damage, we
measured over 350 miRNAs in urine samples from control and NTS (5 ml/kg) groups on day 8
and 14 using TaqMan cards. After statistical analysis, in total 74 miRNAs were found showing
significantly increased levels in urine from WKY (72 miRNAs) and SD (30 miRNAs) rats after
NTS treatment (Suppl.Fig.4). The miRNA increases were higher and displayed less intra-group
13
variability in urine from WKY than from SD rats (Suppl.Tab.3). For further analysis we selected
12 miRNAs: miR-10a, -10b, -21, -26a, -34a, -34b, -100, -184, -192, -197, -211 and -486. The
selection was based on two main considerations: known expression in the glomerulus or at least
in the kidney and either increased or not increased in urine compared to previously reported
urinary miRNA profiles after cisplatin (Cp) induced proximal tubular injury (Pavkovic, et al.,
2014a). The latter consideration refers to the identification of miRNAs potentially specific for one
kidney etiology, here proximal glomerular vs. tubular injury. Candidates were derived from a

comparison of GN- and Cp-affected urinary miRNA groups (Fig.3), which were essentially all
increased in urine by the respective treatment (Supp Fig. 2 and Pavkovic, et al., 2014a). In the
Cp study we identified in total 136 significantly affected miRNA in urine after a single
administration of 3 mg/kg with analysis 3, 5, 8, 15 and 24 days thereafter. Maximal necrosis had
been detected histopathologically 8 days after Cp treatment. 68 urinary miRNAs of the 74 NTS-
and 136 Cp- increased urinary miRNAs were identical. Although then 68 miRNAs appeared to
be specifically increased by Cp, a qualitative examination of the profiles of these miRNAs after
NTS treatment revealed that they were also increased in the GN rat models (data not shown).
Still, five of the six miRNAs increased in a significant manner only by NTS (miR-10a, -10b, -100,
-211 and -486) remained as apparently specific for NTS-induced injury after inspection of the
profile of these miRNAs in urine from Cp-treated rats, i.e. appeared not consistently affected by
Cp. They were thus selected for further analysis together with seven other miRNAs. For
verification of their profiles derived from TaqMan card PCR, absolute urinary concentrations
were measured using single miRNA-specific TaqMan or Exiqon assays with standard curves
run in parallel which currently represents a reliable and accepted method for urinary miRNA
quantification. Applying standard curve quantification most of the 12 urinary miRNA increases
after 5 ml/kg NTS seen before with TaqMan card measurement could be verified. For nine
miRNAs the increases were also statistically significant in WKY rats after treatment with the
highest dose of NTS on either day 8 (seven miRNAs) or 14 (4 miRNAs), with two miRNAs
14
significantly increased at both time points. In SD rats only miR-21 was also found significantly
increased 8 days after treatment (Tab.2). Comparison with our Cp data showed that four of
these 12 selected miRNAs, miR-21, -34a, -184, -192, were clearly increased after NTS and Cp
treatment based on the measurement of absolute urinary concentrations in both studies. The
increase of the five miRNAs, miR-10a, -10b, -100, -211, -486, which seemed to be specifically
increased after NTS treatment only based on TaqMan card data, could also be verified with
standard curve quantification for WKY rats after NTS treatment.

We additionally measured the selected miRNAs in urine samples from rats treated with lower
NTS doses. In urine from WKY rats treated with 2.5 ml/kg NTS only miR-10a (1.4-fold) and miR-
21 (4.6-fold) were significantly increased on day 8 (Tab.2). MiR-10b and -100, although not
significant in three out of four cases, appeared strongly increased in urine from WKY rats
treated with 2.5 and 1 ml/kg NTS after 14 days. In urine from SD rats treated with 1.5 ml/kg NTS
clearly increased miRNAs were not detected (Tab.2). The increase of urinary microRNAs after
lower NTS doses correlates with increased levels of several protein BMs. Except for ALB, none
of the protein BMs was significantly increased after the lowest doses of 1 and 1.5 ml/kg NTS in
WKY and SD rat urine, respectively. Yet a few did show higher levels after 2.5 ml/kg NTS in
urine from WKY rats (Tab.1).
3.4 Distinct localization of miR-10b and 100 in the rat kidney
In situ hybridization (ISH) experiments were performed to investigate where in the normal
kidney those miRNAs are expressed which were found to be specifically increased by NTS-
induced GN but not Cp-induced proximal tubular injury. We used untreated and not treated
kidney, since the latter may be of insufficient quality for detection of ISH signals, and since the
knowledge of the localization of a miRNA in normal kidney should allow to infer the damage
location if such a miRNA is increased in urine after a toxic treatment, provided that this miRNA
is not induced at the expression level in another location by the toxic treatment. Based on this
15
observation we hypothesized the five miRNAs listed above, i.e. miR-10a, -10b, -100, -211 and -
486 to be localized in glomeruli within the kidney, since this should be the primary damage site
impacted by NTS treatment. For initial evaluation we selected miR-10b and -100 since they
were most increased in urine after NTS treatment (Tab.2) but were not changed in the kidney
tissue (Suppl.Tab.6). With U6 and miR-126 as positive controls, we observed the expected
nuclear and endothelial staining, respectively (Fig.4 A and B), while no staining was observed
with the negative control (Fig.4 E), establishing that the protocol used can detect site-specific

localization of a miRNA. Furthermore, miR-26a and -192, which are known to be expressed in
kidney, were both detected in glomeruli and proximal tubules (Fig.4 C and D). Unexpectedly, in
the normal rat kidney miR-10b and -100 expression was localized in distal segments of the
nephron, more precisely in the descending thin limb of the loop of Henle, the distal convoluted
tubule, the connecting tubule and the cortical collecting duct; but not in glomeruli (Fig.5).
3.5 mRNA and miRNA patterns associated with rat kidney glomerulonephritis
For elucidation of molecular pathways which may play a role or may be associated with NTS-
induced GN and to potentially identify a molecular basis for different strain susceptibility, mRNA
and miRNA levels were examined in the kidney 14 days after NTS administration in both rat
strains. Gene i.e. mRNA expression measured with Affymetrix GeneChip microarrays resulted
in 428 and 40 significantly deregulated mRNAs in kidneys from WKY and SD rats, respectively;
yielding in total 439 mRNAs deregulated in both strains together (data not shown). Gene
expression profiles were comparable within the two rat strains in terms of direction of
deregulation and dose dependency (Suppl.Fig.4). 253 of the 439 deregulated genes could be
functionally assigned to categories like inflammation, proliferation, regeneration, structural
remodeling and others (Suppl.Tab.4). The categories with the highest numbers of genes
assigned to them were inflammation with mRNAs coding for e.g. interleukin-24 (Il-24) or CD53,
and regeneration with mRNAs coding for e.g. different collagens like Col1a1 or Col4a1. Two
16
mRNAs were oppositely changed by NTS treatment in the two rat strains, being decreased in
kidneys from SD rats but increased in kidneys from WKY rats. Both proteins encoded by these
mRNAs are associated with immune response/ inflammation: RT1 class II, locus Ba (Rt1-Bb)
and complement component 6 (C6) (Suppl.Fig.4 and Suppl.Tab.4).
Since NTS effects were more prominent in WKY than in SD rats, we focused on WKY rats for
miRNA analysis. Kidney miRNA levels measured with TaqMan cards resulted in 80 significantly
deregulated miRNAs after NTS administration (Suppl.Tab.5). Some of the miRNAs increased in

urine were found to be increased (miR-21, -34b, -146b, -197) or decreased (miR-192, -193b) in
kidneys after NTS treatment. To identify possible regulatory influences of miRNAs on mRNAs in
the kidney during GN, we employed tools implemented in the Ingenuity Pathway analysis (IPA)
software. Within the pool of 439 significantly deregulated mRNAs in the kidney after NTS
treatment, we identified 69 mRNAs that could potentially be targeted by 44 of the 80
deregulated kidney miRNAs (Suppl.Tab.7). These mRNAs encode proteins associated with e.g.
fibrosis or the TGFβ-pathway and the corresponding miRNA-mRNA pairs mostly showed the
expected opposite direction of change (Fig.6 A and B). For example, increased levels of miR-
197 and -132 could be associated with decreased levels of insulin-like growth factor binding
protein 3 (Igfbp3) and matrix metallopeptidase 9 (Mmp9) mRNAs , respectively, in the kidney
after NTS-induced GN (Fig.6A).
17
4. Discussion
To investigate whether miRNAs could complement or enhance urinary protein biomarkers (BMs)
with respect to diagnosis of glomerular kidney injury, urinary miRNA profiles were examined in a
glomerulonephritis (GN) model in two rat strains. The study encompassed administration of
Wistar Kyoto (WKY) and Sprague Dawley (SD) rats with different doses of nephrotoxic serum
(NTS), followed by measurement of traditional and newer protein BMs 8 and 14 days after
treatment, and histological examination of the kidneys 8 (SD only) and 14 days after treatment.

Urinary miRNA profiles obtained with this GN model were then compared with previously
reported urinary miRNA profiles after cisplatin (Cp)-induced proximal tubular injury to search for
miRNAs specifically associated with glomerular damage. To reveal potential involvement of
miRNA-mRNA pairs in GN-induced kidney damage, miRNA and mRNA expression was
examined in the kidney.
Although traditional BMs did not indicate kidney damage, confirming their insensitivity (Urbschat
et al., 2011), both glomerular and tubular damage were observed histopathologically on day 14.
Tubular damage was a secondary response to glomerular changes, since the latter can lead to
protein overload in primary urine and thus to injury in exposed tubules (Togashi et al.,
2013).The severity of tubular damage indicates potential primary tubular injury, possibly due to
reabsorption of the NTS or cross-reactivity of the polyclonal antibodies in the NTS with tubular
structures. We suspect onset of tubular damage already on day 8, as seen for SD rats and as
KIM-1, a qualified protein BM for proximal tubular injury (Vaidya et al., 2010), was even higher in
urine on day 8 compared to day 14 in WKY rats. Tubular damage was probably also the reason
for increased levels of other protein BMs most of which are qualified for proximal tubular injury
(Fuchs and Hewitt, 2011).
In parallel to proteinuria, albumin (ALB) was the only protein BM in urine clearly increased after
all NTS doses in both rat strains. ALB indicates loss of glomerular integrity and/or impaired
18
proximal tubular function (Swain et al., 2011). It was increased after both Cp-induced tubular
injury reported earlier (Pavkovic et al., 2014b) and NTS-induced GN reported here, indicating
that as expected urinary ALB alone is not sufficient for differentiation between tubular vs.
glomerular injury. We still suggest that treatment-induced increases of urinary ALB in relation to
that of proximal tubular specific urinary KIM-1 can serve to localize the primary site of injury,
since in our data ALB vs. KIM-1 ratios were much higher in the GN study associated with
glomerular (and tubular) injury compared to the Cp study with tubular injury, only.

Using a PCR profiling approach (Pavkovic, et al., 2014a) 74 miRNAs were identified with
significantly increased urinary levels 8 and/or 14 days after high dose NTS treatment in both rat
strains. For about one third of these miRNAs kidney expression has already been described
(Landgraf et al., 2007; Tian et al., 2008). Corresponding to the more pronounced pathological
findings in WKY rats, a higher number of significantly changed miRNAs associated with higher
fold-changes were found in urine from WKY compared to SD rats. Slightly increased urinary
levels at lower NTS doses were observed for miR-10b, -21, -34b, -100 and -192 in WKY rats, in
parallel to minimal changes seen histopathologically in the corresponding kidneys and
increased urinary ALB levels, indicating that they may represent potentially quite sensitive BMs.
Nevertheless, none of the urinary miRNA significantly outperformed all protein BMs, thus at
least in this study their usefulness as BMs is rather associated with specific information about
the localization of injury than with increased sensitivity.
The majority of the urinary miRNAs affected by NTS treatment overlapped with miRNAs
described previously to be affected by Cp-induced proximal injury (Pavkovic, et al., 2014a). One
explanation is that many identical miRNAs are expressed in different kidney compartments
(Kriegel et al., 2013). As described above, a second obvious but not mutually exclusive
explanation is that apart from glomerular injury, tubular injury was also present our GN model.
Although Cp is an acute toxicant leading to early injury development, we still suggest that the
19
comparison to NTS-induced GN is reasonable since the even the maximal dose of 3 mg/kg Cp
caused maximal necrosis on day 8 only. Nevertheless, five miRNAs (miR-10a, -10b, -100, -211
and -486) seemed to be NTS-specific.
Since these five were particularly interesting in terms of finding miRNAs specific for glomerular
injury, the localization of two of them, miR-10b and -100, was investigated within the normal rat
kidney by in situ hybridization. Contrary to our expectations that they would be expressed in

glomeruli, these two were found to be localized in the descending thin limb of the loop of Henle,
the distal convoluted tubule, the connecting tubule and the cortical collecting duct. Yet
interestingly, their location partially overlapped with that of the observed tubular lesions. An
impairment of these portions of the nephron, in addition to glomerular damage, corresponds to
findings by Iida et al. (2014) describing distal nephron segment injuries in rats with anti-GBM
GN as well as in patients with Ig A nephropathy (Iida et al., 2014). Therefore, increased miR-
10b and miR-100 levels in urine and detectable but not altered expression in kidney tissue after
NTS, instead of indicating direct glomerular injury, may rather indicate leakage out of damaged
distal nephron regions, for which qualified and specific BMs are also still missing (Huang et al.,
2014). Further, this would be in line with findings for miR-100 being increased in urine after
gentamicin-induced injury affecting proximal and distal convoluted tubules (Nassirpour, et al.,
2014) but not after Cp-induced proximal tubular injury (Kanki, et al., 2014; Pavkovic, et al.,
2014a). Ichii et al.(2014) found miR-10b to be abundantly expressed in mouse glomeruli. This
apparent contrasting result could be due to species differences or to the fact that their
measurement was based on isolated glomeruli only. The same group found miR-26a and -126
as the two most abundantly expressed miRNAs in mouse glomeruli. They also found miR-26a
elevated in urine from a murine GN model and from patients with lupus nephritis. We found
increased urinary miR-26a levels in both our GN model here, and in our previously reported
proximal tubule injury model (Pavkovic, et al., 2014a). Our in situ hybridization experiments as
20
well as PCR data from Ichii et al. (2014) indicate that miR-26a is not exclusively expressed in
glomeruli but also in proximal tubules. On the other hand, miR-126 is reported as specifically
expressed in endothelial cells (Wang et al., 2008), which we confirmed by in situ hybridization.
We did not observe increased levels of miR-34c, as found by Church et al. (2014) after
Doxorubicin-induced glomerular injury. As miR-34-family members can be induced by the DNA
damage responsive transcription factor p53, one explanation may be that the measured miR-

34c increase by Church et al. may rather be due to DNA damage induced by Doxorubicin, by its
action as inhibitor of Topoisomerase 2 (Zunino et al., 1990), and not by glomerular damage in
general. This would correspond to an increase of miR-34a in urine and kidney we observed
after Cp treatment, which apart from proximal tubular damage induces DNA strand breaks. MiR-
34c and miR-34a are two miR-34 family members with the same seed sequence. We did
observe, though, an increase of miR-34b in urine and kidneys from WKY rats after NTS
treatment. MiR-34b is known to be clustered with miR-34c (miRbase.org), yet which has a
different seed sequence for target mRNAs than miR-34c and miR-34a. Besides p53, the miR-34
family is also regulated by other transcription factors like Myc or FoxO3a and involved in cell
cycle regulation, apoptosis and epithelial-mesenchymal transition (EMT) (Rokavec et al., 2014).
Therefore it is possible that different members of the miR-34 family are involved in various
functions, including DNA damage response regulation or glomerular injury. Further specific
investigations are needed to clarify details.
With respect to miRNAs indicating kidney injury in general, our GN study corroborates previous
findings suggesting urinary miR-21 and -192 as promising BMs. Both have conserved
sequences in mice, rats, dogs, rhesus monkeys and humans and are expressed in the kidney
(miRBase, 2013). MiR-21 was previously reported as increased in urine form rats with
gentamicin-induced kidney injury and renal ischemia-reperfusion injury (Nassirpour, et al., 2014;
Saikumar, et al., 2012) as well as in urine from patients suffering from nephrotic syndrome,
21
diabetic nephropathy or AKI (Konta et al., 2014; Ramachandran, et al., 2013). Both were found
increased early in urine from rats after Cp-induced kidney injury (Kanki, et al., 2014; Pavkovic,
et al., 2014a). In contrast, these two miRNAs were not increased in urine from rats after
methapyrilene-induced liver injury (Pavkovic, et al., 2014a), suggesting specificity concerning
kidney vs. liver damage.
To obtain insight into molecular processes during GN pathogenesis, mRNA and miRNA

expression was investigated in the kidneys after NTS treatment. The immunopathological
processes during GN are still not fully understood and likely involve both innate and adaptive
immunity (Henique et al., 2014). In the present study, several hundred mRNAs were found
deregulated, which functionally were mostly associated with inflammation and regeneration.
The data discussed in this publication have been deposited in NCBI's Gene Expression
Omnibus (Edgar et al., 2002) and are accessible through GEO Series accession number
GSE64265 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE64265).
The β-chain of the major histocompatibility complex class II RT1.B (Rt1-Bb) and complement
component 6 (C6) were identified as two mRNAs differentially expressed between WKY and SD
rat strains which could be related to known different susceptibilities to NTS of different rat
strains (Kawasaki et al., 1992); both were increased in WKY and decreased in SD rats.
Increased Rt1-Bb expression in WKY rats could indicate a stronger and more persistent cellular
reaction of the adaptive immune system in this strain, in line with findings indicating adaptive
immune reactions during GN (Huang et al., 1997; Tam et al., 1999). The complement cascade
is also known to be essential for GN development, especially terminal cascade products like C6
(Nangaku et al., 1997).
The other major functional category indicated to be affected, regeneration, describes mainly
increased expression of genes encoding proteins involved in amino acid synthesis, protein
translation, protein transport and cell adhesion. Some of these mRNAs, which include potential
22
targets for deregulated miRNAs, are reported to be involved in fibrotic pathways. Fibrosis is
described to follow glomerular inflammation in a GN model similar to the one used here (Zhou et
al., 2010). Transforming growth factor β (TGFβ) is known as the main cytokine in renal fibrosis
(Stahl and Felsen, 2001), and several mRNAs related to TGFβ signaling including those coding
for Tgfb2, as well as typical TGFβ down-stream targets like transgelin (Tagln, a.k.a. smooth
muscle protein 22α) and collagen genes, were increased by NTS treatment. Further, TGFβ-
dependent EMT was described in proximal tubular and glomerular epithelia cells which could

contribute to the development of fibroblasts during GN (Abbate et al., 2002; Marshall et al.,
2011). In line with this, vimentin (Vim) an activated fibroblasts marker, also found in renal
biopsies from patients with glomerulonephritis (Bob et al., 2014), was increased after NTS
treatment while predicted miRNA-regulators of Vim mRNA, miR-382-5p and let-7g, were
decreased. A further potential regulatory interaction was found here for decreased matrix
metalloproteinase 9 (Mmp9) mRNA and increased miR-132-3p. The MMP9 protein is an
important regulator of extracellular matrix (ECM) degradation, and Kuroda et al. (2004)
described that Mmp9 was decreased after NTS treatment as seen here, leading to increased
ECM. A regulatory connection between Mmp9 and miR-132-3p was also suggested in an in
vitro model for cardiac fibrosis (Jiang et al., 2013).
Increased miR-21 levels in our GN model may also be associated with fibrotic changes in the
kidneys. In a murine model of diabetic nephropathy, also characterized by ECM accumulation,
miR-21 was increased in the kidney and its expression correlated positively with collagen 4
(Col4) and negatively with Mmp9 (Wang et al., 2013) as seen in our GN model.
In summary, we found a considerable number of urinary miRNAs increased after NTS-induced
GN with stronger changes overall in WKY vs. SD rats, confirming the former as more
appropriate to study GN. By comparison of GN-associated urinary miRNA profiles with those
after Cp-induced tubular injury, we found that most had similar profiles, due to also observed
23
tubular injury in our GN model and many miRNAs likely being expressed broadly in the kidney.
Still, five miRNAs could be identified as being potentially GN-specific miRNAs. Investigation of
the localization of two of these, miR-10b and -100, by in situ hybridization in the normal kidney
revealed their expression within distal nephron segments. Thus, although appearance of these
two miRNAs in urine apparently does not indicate glomerular damage, they may represent BMs
for distal tubular injury. Finally, potential mRNA-miRNA regulatory interactions associated with
GN are suggested from their expression profiles in kidney.
24
Supplementary figure legends
Supplementary Figure 1 Blood urea nitrogen (BUN; A) and in serum creatinine (sCrea; B)
concentrations in Wistar Kyoto (WKY) and Sprague Dawley (SD) rats 14 days after a single
injection of the indicated nephrotoxic serum (NTS) amount in ml/kg. Shown are means (WKY
control n=3, treated n=5; SD n=6) with standard deviation. Statistical analysis was performed
with ANOVA and Dunnett’s test. Statistical significance is indicated by * p<0.05, ** p<0.01 and
*** p<0.001 compared to time matched control groups.

Supplementary Figure 2 Representative Periodic acid–Schiff (PAS) stained kidney sections of
Wistar Kyoto (WKY) rats 14 days after injection of saline (control) or 5 ml/kg nephrotoxic serum
(NTS). Scale bars: 50 µm.
Supplementary Figure 3 Hierarchical clustering of 74 miRNAs affected by treatment with
nephrotoxic serum (NTS) in urine samples 8 and 14 days. Shown are treated vs. control ratios
derived from TaqMan card data quantified according to the ‘modified ∆Ct approach’. WKY:
Wistar Kyoto, SD: Sprague Dawley.
Supplementary Figure 4 Hierarchical clustering of 253 significantly changed and categorized
mRNAs in kidney samples 14 days after the treatment with NTS. Shown are treated vs. control
ratios derived from measurement with Affymetrix GeneChip arrays. Categories, to which these
deregulated genes were assigned, are indicated on the right. WKY: Wistar Kyoto, SD: Sprague
Dawley, Rt1-Bb: RT1 class II, locus Ba, C6: complement component 6.
Supplementary table legends (all tables are in one Excel file)
Supplementary Table 1 Histopathological findings of kidneys from Wistar Kyoto (WKY) 14
days after and Sprague Dawley (SD) rats 8 and 14 days after a single injection of nephrotoxic
25
serum (NTS). Shown is the number of animals with positive findings from each dose group
(WKY control n=3, treated n=5; SD n=6). Severity score system: grade 0, absent; grade 1,
minimal; grade 2, slight; grade 3, moderate; grade 4, marked; grade 5, very severe. N/E: not
examined.
Supplementary Table 2 Mean ± Standard deviation of protein biomarker concentrations
normalized to urinary creatinine (µg/mmol urinary creatinine). These values were used for fold-

change calculations and statistical analysis presented in Tab. 1. WKY: Wistar Kyoto, SD:
Sprague Dawley; N/A: not available; Q: qualified; E: recently endorsed for qualification.
Supplementary Table 3 74 nephrotoxic serum (NTS) affected miRNAs in urine samples 8 and
14 days after treatment. Shown are treated vs. control ratios derived from TaqMan card data
quantified according to the ‘modified ∆Ct approach’ and corresponding Student’st-test p-values;
bold p-values are <0.05 and were considered as significant. WKY: Wistar Kyoto, SD: Sprague
Dawley, rno: Rattus norvegicus. The table corresponds to the heatmap shown in Supplementary
Figure 2.
Supplementary Table 4 253 significantly changed mRNAs in kidney samples 14 days after the
treatment with nephrotoxic serum (NTS). Shown are treated vs. control ratios derived from
measurement with Affymetrix GeneChip arrays and assigned categories for mechanistical
analysis. WKY: Wistar Kyoto, SD: Sprague Dawley. The table corresponds to the heatmap
shown in Supplementary Figure 3.
Supplementary Table 5 80 significantly changed miRNAs in kidney samples 14 days after the
treatment with nephrotoxic serum (NTS). Shown are treated vs. control ratios derived from
26
TaqMan card data quantified according to the ∆∆Ct method with U6 as endogenous control.
WKY: Wistar Kyoto, rno: Rattus norvegicus.
Supplementary Table 6 Expression levels in kidney tissue of the five potentially specific
miRNAs are indicated as mean copies/ng kidney RNA used (with standard deviation) as derived
from miRNA standard curves run in parallel. Results for Wistar Kyoto (WKY) and Sprague
Dawley (SD) are shown (WKY control n=3, treated n=5; SD control and treated n=6). Statistical

analysis was performed with Student’s t-test and statistical significance (p<0.05) compared to
time matched control groups is indicated with bold means. N/M: not measured, EQ: measured
with Exiqon’s PCR assays, TM: measured with TaqMan PCR assays.
Supplementary Table 7 Identified target mRNAs of the affected miRNAs in the pool of altered
mRNAs after NTS-induced glomerulonephritis using Ingenuity Pathway Analysis. rno: Rattus
norvegicus. The table corresponds partially to the networks shown in Figure 4.
27
Acknowledgements
We would like to thank Sabine Michel-Kaulmann, Kerstin Noklies, and Brigitte Poschmann for
technical assistance. We especially thank Dr. Ute Bach and Dr. Matthias Rinke for histological
examination of the in situ hybridization data. We furthermore would like to acknowledge the
continuous support by Dr. Thomas Steger-Hartmann and all members of the HESI Biomarkers
of Nephrotoxicity Project Committee for valuable advice and discussion. Finally, we thank Vishal
S. Vaidya, PhD (Harvard Medical School) for helpful discussions during the manuscript

preparation.
28
References
Abbate, M., Zoja, C., Rottoli, D., Corna, D., Tomasoni, S., and Remuzzi, G. (2002). Proximal
tubular cells promote fibrogenesis by TGF-beta1-mediated induction of peritubular
myofibroblasts. Kidney Int 61(6), 2066-77.
Bartel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116(2),
281-97.

Bob, F., Gluhovschi, G., Herman, D., Petrica, L., Bozdog, G., Gluhovschi, C., Velciov, S.,
Gadalean, F., Timar, R., Potencz, E., Dema, A., and Schiller, A. (2014). Immunohistochemical
study of tubular epithelial cells and vascular endothelial cells in glomerulonephritis. Renal failure
36(8), 1208-14.
Church, R. J., McDuffie, J. E., Sonee, M., Otieno, M., Ma, J. Y., Liu, X., Watkinsa, P. B., and
Harrilla, A. H. (2014). MicroRNA-34c-3p is an early predictive biomarker for doxorubicin-induced
glomerular injury progression in male Sprague-Dawley rats. Toxicology Research 3(5), 384-394.
Dieterle, F., Perentes, E., Cordier, A., Roth, D. R., Verdes, P., Grenet, O., Pantano, S., Moulin,
P., Wahl, D., Mahl, A., End, P., Staedtler, F., Legay, F., Carl, K., Laurie, D., Chibout, S. D.,
Vonderscher, J., and Maurer, G. (2010). Urinary clusterin, cystatin C, beta2-microglobulin and
total protein as markers to detect drug-induced kidney injury. Nat Biotechnol 28(5), 463-9.
EMA (2009). Final conclusions of the pilot joint EMEA/FDA VXDA experience on qualification of
nephrotoxicity biomarkers. www.emea.europa.eu Doc.ref. EMEA/679719/2008 Rev.
1(Committee for medicinal products for human use).
29
Dieterle, F., and Sistare, F. (2010). Biomarkers of Acute Kidney Injury. In Biomarkers: In
Medicine, Drug Discovery, and Enviromental Health (V. S. Vaidya, and J. V. Bonventre, Eds.)
doi, pp. 237-263. Wiley & Sons, Inc.
Edgar, R., Domrachev, M., and Lash, A. E. (2002). Gene Expression Omnibus: NCBI gene
expression and hybridization array data repository. Nucleic acids research 30(1), 207-10.

Fu, Z., Qian, F., Yang, X., Jiang, H., Chen, Y., and Liu, S. (2014). Circulating miR-222 in plasma
and its potential diagnostic and prognostic value in gastric cancer. Medical oncology 31(9), 164.
Fuchs, T. C., and Hewitt, P. (2011). Preclinical perspective of urinary biomarkers for the
detection of nephrotoxicity: what we know and what we need to know. Biomarkers in medicine
5(6), 763-79.
Guengerich, F. P. (2011). Mechanisms of drug toxicity and relevance to pharmaceutical
development. Drug Metab Pharmacokinet 26(1), 3-14.
Hartner, A., Hilgers, K. F., Bitzer, M., Veelken, R., and Schocklmann, H. O. (2003). Dynamic
expression patterns of transforming growth factor-beta(2) and transforming growth factor-beta
receptors in experimental glomerulonephritis. J Mol Med (Berl) 81(1), 32-42.
Henique, C., Papista, C., Guyonnet, L., Lenoir, O., and Tharaux, P. L. (2014). Update on
crescentic glomerulonephritis. Seminars in immunopathology 36(4), 479-90.
Hermeking, H. (2012). MicroRNAs in the p53 network: micromanagement of tumour
suppression. Nat Rev Cancer 12(9), 613-26.
30
Ho, J., Ng, K. H., Rosen, S., Dostal, A., Gregory, R. I., and Kreidberg, J. A. (2008). Podocyte-
specific loss of functional microRNAs leads to rapid glomerular and tubular injury. Journal of the
American Society of Nephrology : JASN 19(11), 2069-75.
Hsu, R. K., McCulloch, C. E., Dudley, R. A., Lo, L. J., and Hsu, C. Y. (2013). Temporal changes
in incidence of dialysis-requiring AKI. Journal of the American Society of Nephrology : JASN

24(1), 37-42.
Huang, J. X., Blaskovich, M. A., and Cooper, M. A. (2014). Cell- and biomarker-based assays
for predicting nephrotoxicity. Expert opinion on drug metabolism & toxicology 10(12), 1621-35.
Huang, X. R., Tipping, P. G., Apostolopoulos, J., Oettinger, C., D'Souza, M., Milton, G., and
Holdsworth, S. R. (1997). Mechanisms of T cell-induced glomerular injury in anti-glomerular
basement membrane (GBM) glomerulonephritis in rats. Clin Exp Immunol 109(1), 134-42.
Ichii, O., Otsuka-Kanazawa, S., Horino, T., Kimura, J., Nakamura, T., Matsumoto, M., Toi, M.,
and Kon, Y. (2014). Decreased miR-26a expression correlates with the progression of podocyte
injury in autoimmune glomerulonephritis. PloS one 9(10), e110383.
Iida, T., Fujinaka, H., Xu, B., Zhang, Y., Magdeldin, S., Nameta, M., Liu, Z., Yoshida, Y., Yaoita,
E., Tomizawa, S., Saito, A., and Yamamoto, T. (2014). Decreased urinary calbindin 1 levels in
proteinuric rats and humans with distal nephron segment injuries. Clinical and experimental
nephrology 18(3), 432-43.
31
Jensen, O. N. (2004). Modification-specific proteomics: characterization of post-translational
modifications by mass spectrometry. Current opinion in chemical biology 8(1), 33-41.
Jiang, X., Ning, Q., and Wang, J. (2013). Angiotensin II induced differentially expressed
microRNAs in adult rat cardiac fibroblasts. The journal of physiological sciences : JPS 63(1), 31-
8.
Kanki, M., Moriguchi, A., Sasaki, D., Mitori, H., Yamada, A., Unami, A., and Miyamae, Y. (2014).

Identification of urinary miRNA biomarkers for detecting cisplatin-induced proximal tubular injury
in rats. Toxicology 324, 158-68.
Kanno, K., Okumura, F., Toriumi, W., Ishiyama, N., Nishiyama, S., and Naito, K. (1998).
Nephrotoxic serum-induced nephritis in Wistar-Kyoto rats: a model to evaluate antinephritic
agents. Jpn J Pharmacol 77(2), 129-35.
Kawasaki, K., Yaoita, E., Yamamoto, T., and Kihara, I. (1992). Depletion of CD8 positive cells in
nephrotoxic serum nephritis of WKY rats. Kidney Int 41(6), 1517-26.
Konta, T., Ichikawa, K., Suzuki, K., Kudo, K., Satoh, H., Kamei, K., Nishidate, E., and Kubota, I.
(2014). A microarray analysis of urinary microRNAs in renal diseases. Clinical and experimental
nephrology 18(5), 711-7.
Kriegel, A. J., Liu, Y., Liu, P., Baker, M. A., Hodges, M. R., Hua, X., and Liang, M. (2013).
Characteristics of microRNAs enriched in specific cell types and primary tissue types in solid
organs. Physiol Genomics 45(23), 1144-56.
32
Krol, J., Loedige, I., and Filipowicz, W. (2010). The widespread regulation of microRNA
biogenesis, function and decay. Nat Rev Genet 11(9), 597-610.
Kuroda, T., Yoshida, Y., Kamiie, J., Kovalenko, P., Nameta, M., Fujinaka, H., Yaoita, E., Endo,
T., Ishizuka, S., Nakabayashi, K., Yamada, A., Nagasawa, T., and Yamamoto, T. (2004).
Expression of MMP-9 in mesangial cells and its changes in anti-GBM glomerulonephritis in
WKY rats. Clinical and experimental nephrology 8(3), 206-15.

Lai, J. Y., Luo, J., O'Connor, C., Jing, X., Nair, V., Ju, W., Randolph, A., Ben-Dov, I. Z., Matar,
R. N., Briskin, D., Zavadil, J., Nelson, R. G., Tuschl, T., Brosius, F. C., 3rd, Kretzler, M., and
Bitzer, M. (2014). MicroRNA-21 in Glomerular Injury. Journal of the American Society of
Nephrology : JASN doi: 10.1681/ASN.2013121274.
Landgraf, P., Rusu, M., Sheridan, R., Sewer, A., Iovino, N., Aravin, A., Pfeffer, S., Rice, A.,
Kamphorst, A. O., Landthaler, M., Lin, C., Socci, N. D., Hermida, L., Fulci, V., Chiaretti, S., Foa,
R., Schliwka, J., Fuchs, U., Novosel, A., Muller, R. U., Schermer, B., Bissels, U., Inman, J.,
Phan, Q., Chien, M., Weir, D. B., Choksi, R., De Vita, G., Frezzetti, D., Trompeter, H. I.,
Hornung, V., Teng, G., Hartmann, G., Palkovits, M., Di Lauro, R., Wernet, P., Macino, G.,
Rogler, C. E., Nagle, J. W., Ju, J., Papavasiliou, F. N., Benzing, T., Lichter, P., Tam, W.,
Brownstein, M. J., Bosio, A., Borkhardt, A., Russo, J. J., Sander, C., Zavolan, M., and Tuschl, T.
(2007). A mammalian microRNA expression atlas based on small RNA library sequencing. Cell
129(7), 1401-14.
Mall, C., Rocke, D. M., Durbin-Johnson, B., and Weiss, R. H. (2013). Stability of miRNA in
human urine supports its biomarker potential. Biomarkers in medicine 7(4), 623-31.
33
Marshall, C. B., Krofft, R. D., Blonski, M. J., Kowalewska, J., Logar, C. M., Pippin, J. W., Kim, F.,
Feil, R., Alpers, C. E., and Shankland, S. J. (2011). Role of smooth muscle protein SM22alpha
in glomerular epithelial cell injury. American journal of physiology. Renal physiology 300(4),
F1026-42.
miRBase (2013). http://mirbase.org/. In (Vol. 20. Faculty of Life Sciences at the University of

Manchester with funding from the BBSRC, and was previously hosted and supported by the
Wellcome Trust Sanger Institute.
Nangaku, M., Alpers, C. E., Pippin, J., Shankland, S. J., Kurokawa, K., Adler, S., Johnson, R. J.,
and Couser, W. G. (1997). Renal microvascular injury induced by antibody to glomerular
endothelial cells is mediated by C5b-9. Kidney Int 52(6), 1570-8.
Nassirpour, R., Mathur, S., Gosink, M. M., Li, Y., Shoieb, A. M., Wood, J., O'Neil, S. P., Homer,
B. L., and Whiteley, L. O. (2014). Identification of tubular injury microRNA biomarkers in urine:
comparison of next-generation sequencing and qPCR-based profiling platforms. BMC genomics
15, 485.
Nishimura, Y., Kondo, C., Morikawa, Y., Tonomura, Y., Torii, M., Yamate, J., and Uehara, T.
(2014). Plasma miR-208 as a useful biomarker for drug-induced cardiotoxicity in rats. Journal of
applied toxicology : JAT doi: 10.1002/jat.3044.
Pavkovic, M., Riefke, B., and Ellinger-Ziegelbauer, H. (2014a). Urinary microRNA profiling for
identification of biomarkers after cisplatin-induced kidney injury. Toxicology 324, 147-57.
34
Pavkovic, M., Riefke, B., Gutberlet, K., Raschke, M., and Ellinger-Ziegelbauer, H. (2014b).
Comparison of the MesoScale Discovery and Luminex multiplex platforms for measurement of
urinary biomarkers in a cisplatin rat kidney injury model. J Pharmacol Toxicol Methods 69(2),
196-204.
Pusey, C. D. (2003). Anti-glomerular basement membrane disease. Kidney Int 64(4), 1535-50.

Ramachandran, K., Saikumar, J., Bijol, V., Koyner, J. L., Qian, J., Betensky, R. A., Waikar, S.
S., and Vaidya, V. S. (2013). Human miRNome profiling identifies microRNAs differentially
present in the urine after kidney injury. Clin Chem 59(12), 1742-52.
Rokavec, M., Li, H., Jiang, L., and Hermeking, H. (2014). The p53/miR-34 axis in development
and disease. Journal of molecular cell biology 6(3), 214-30.
Saikumar, J., Hoffmann, D., Kim, T. M., Gonzalez, V. R., Zhang, Q., Goering, P. L., Brown, R.
P., Bijol, V., Park, P. J., Waikar, S. S., and Vaidya, V. S. (2012). Expression, circulation, and
excretion profile of microRNA-21, -155, and -18a following acute kidney injury. Toxicol Sci
129(2), 256-67.
Saikumar, J., Ramachandran, K., and Vaidya, V. S. (2014). Noninvasive micromarkers. Clin
Chem 60(9), 1158-73.
Salant, D. J., and Cybulsky, A. V. (1988). Experimental glomerulonephritis. Methods Enzymol
162, 421-61.
35
Schena, F. P., Serino, G., and Sallustio, F. (2014). MicroRNAs in kidney diseases: new
promising biomarkers for diagnosis and monitoring. Nephrology, dialysis, transplantation :
official publication of the European Dialysis and Transplant Association - European Renal
Association 29(4), 755-63.
Small, E. M., and Olson, E. N. (2011). Pervasive roles of microRNAs in cardiovascular biology.
Nature 469(7330), 336-42.

Stahl, P. J., and Felsen, D. (2001). Transforming growth factor-beta, basement membrane, and
epithelial-mesenchymal transdifferentiation: implications for fibrosis in kidney disease. Am J
Pathol 159(4), 1187-92.
Swain, A., Turton, J., Scudamore, C. L., Pereira, I., Viswanathan, N., Smyth, R., Munday, M.,
McClure, F., Gandhi, M., Sondh, S., and York, M. (2011). Urinary biomarkers in hexachloro-1:3-
butadiene-induced acute kidney injury in the female Hanover Wistar rat; correlation of alpha-
glutathione S-transferase, albumin and kidney injury molecule-1 with histopathology and gene
expression. Journal of applied toxicology : JAT 31(4), 366-77.
Tam, F. W., Smith, J., Morel, D., Karkar, A. M., Thompson, E. M., Cook, H. T., and Pusey, C. D.
(1999). Development of scarring and renal failure in a rat model of crescentic
glomerulonephritis. Nephrology, dialysis, transplantation : official publication of the European
Dialysis and Transplant Association - European Renal Association 14(7), 1658-66.
Tian, Z., Greene, A. S., Pietrusz, J. L., Matus, I. R., and Liang, M. (2008). MicroRNA-target pairs
in the rat kidney identified by microRNA microarray, proteomic, and bioinformatic analysis.
Genome Res 18(3), 404-11.
36
Togashi, Y., Imura, N., and Miyamoto, Y. (2013). Urinary cystatin C as a renal biomarker and its
immunohistochemical localization in anti-GBM glomerulonephritis rats. Exp Toxicol Pathol 65,
1137-1143.
Urbschat, A., Obermuller, N., and Haferkamp, A. (2011). Biomarkers of kidney injury.
Biomarkers 16 Suppl 1, S22-30.

Vaidya, V. S., Ferguson, M. A., and Bonventre, J. V. (2008). Biomarkers of acute kidney injury.
Annu Rev Pharmacol Toxicol 48, 463-93.
Vaidya, V. S., Ozer, J. S., Dieterle, F., Collings, F. B., Ramirez, V., Troth, S., Muniappa, N.,
Thudium, D., Gerhold, D., Holder, D. J., Bobadilla, N. A., Marrer, E., Perentes, E., Cordier, A.,
Vonderscher, J., Maurer, G., Goering, P. L., Sistare, F. D., and Bonventre, J. V. (2010). Kidney
injury molecule-1 outperforms traditional biomarkers of kidney injury in preclinical biomarker
qualification studies. Nat Biotechnol 28(5), 478-85.
Wang, G., Tam, L. S., Li, E. K., Kwan, B. C., Chow, K. M., Luk, C. C., Li, P. K., and Szeto, C. C.
(2011). Serum and urinary free microRNA level in patients with systemic lupus erythematosus.
Lupus 20(5), 493-500.
Wang, J., Gao, Y., Ma, M., Li, M., Zou, D., Yang, J., Zhu, Z., and Zhao, X. (2013). Effect of miR-
21 on Renal Fibrosis by Regulating MMP-9 and TIMP1 in kk-ay Diabetic Nephropathy Mice. Cell
Biochem Biophys 67(2), 537-546.
37
Wang, S., Aurora, A. B., Johnson, B. A., Qi, X., McAnally, J., Hill, J. A., Richardson, J. A.,
Bassel-Duby, R., and Olson, E. N. (2008). The endothelial-specific microRNA miR-126 governs
vascular integrity and angiogenesis. Developmental cell 15(2), 261-71.
Wang, Y., Chen, T., and Tong, W. (2014). miRNAs and their application in drug-induced liver
injury. Biomarkers in medicine 8(2), 161-72.

Weber, J. A., Baxter, D. H., Zhang, S., Huang, D. Y., Huang, K. H., Lee, M. J., Galas, D. J., and
Wang, K. (2010). The microRNA spectrum in 12 body fluids. Clin Chem 56(11), 1733-41.
Zhou, C., Wu, J., Torres, L., Hicks, J. M., Bartkowiak, T., Parker, K., and Lou, Y. H. (2010).
Blockade of osteopontin inhibits glomerular fibrosis in a model of anti-glomerular basement
membrane glomerulonephritis. American journal of nephrology 32(4), 324-31.
Zunino, F., and Capranico, G. (1990). DNA topoisomerase II as the primary target of anti-tumor
anthracyclines. Anti-cancer drug design 5(4), 307-17.
38
Footnote
1
The Health and Environmental Sciences Institute (HESI) is a nonprofit institution whose
mission is to engage scientists from academia, government and industry to identify and resolve
global health and environmental issues.
39
Figure legends
Figure 1 Histopathological changes in the kidney of rats administered nephrotoxic serum (NTS).
14 days after the injection of 5 ml/kg NTS, enlarged glomeruli with hypercellularity, increased
amounts of eosinophilic glomerular matrix (white arrow) and hyperplasia of the Bowman’s
capsule (black arrow) were observed in animals give NTS (B), but not in rats given vehicle (A).
Shown are representative haematoxilin and eosin stained kidney sections from Wistar Kyoto
rats. Scale bars: 50 µm.

Figure 2 Increased urinary total protein levels in Wistar Kyoto (WKY) and Sprague Dawley (SD)
rats 8 and 14 days after administration of different doses of NTS. Shown are the means (WKY
control n=3, treated n=5; SD n=6) with standard deviation from urinary creatinine (uCrea)
normalized concentrations. Statistical analysis was performed with ANOVA and Dunnett’s test.
Statistical significance is indicated by * p<0.05, ** p<0.01 and *** p<0.001 compared to time
matched control groups.
Figure 3 Venn diagram of urinary miRNAs selected to be significantly affected after treatment of
nephrotoxic serum or cisplatin.
Figure 4 U6 as general positive control (A), miR-126 as positive control for endothelia cells (B),
miR-26a (C) and miR-192 (D) expression observed by in situ hybridization in the kidney from a
healthy male Wistar rat. Using the scrambled probe as negative control (E) no staining was
observed. Blue: positive probe signal, pink: eosin counter staining, black arrows point to
positively stained glomerular cells, white arrows point to positively stained proximal tubular cells,
the grey arrow points to positively stained endothelial cells.
40
Figure 5 Localization of miR-10b (A and C) and miR-100 (B and D) expression observed by in
situ hybridization in the kidney from a healthy male Wistar rat. C and D are magnifications of A
and B, respectively. Blue: positive probe signal, pink: eosin counter staining, black arrows point
to positive staining in distal tubules.
Figure 6 Mechanistic analysis of miRNAs and mRNAs deregulated in the kidney after NTS
administration. Using Ingenuity Pathway Analysis target mRNAs of the affected miRNAs were

identified in the pool of deregulated mRNAs after NTS-induced glomerulonephritis. A) miRNAs
and potential target mRNAs associated with fibrosis. B) miRNAs and potential target mRNAs
associated with the TGFβ-pathway. The color represents NTS-induced increase (red shading)
and decrease (green shading) in kidneys of Wistar Kyoto rats 14 days after NTS administration.
Black and gray arrows represent miRNA-mRNA interaction showing and not showing inverse
changes in expression levels after NTS treatment, respectively.
41
Table 1 Protein biomarker measurement in rat urine after administration of nephrotoxic serum (NTS).
WKY SD
1 ml/kg NTS 2.5 ml/kg NTS 5 ml/kg NTS 1.5 ml/kg NTS 5 ml/kg NTS
Biomarker Day 8 Day 14 Day 8 Day 14 Day 8 Day 14 Day 8 Day 14 Day 8 Day 14
ALBQ 353 ** (t) 201 N/A 4204 ** N/A 2836 * 100 105 3216 ** (t) N/A
β2MQ 6.5 2.7 41 88.1 *** 121 *** 119 *** 1.1 1 38.4 ** 66 ***
KIM-1Q 1.2 0.9 73 6.6 * 200 ** 19.6 *** 2.4 1.3 50.9 * 13 **
CLUQ 1.5 2 237 55.4 1230 *** 349 ** 2 1.5 472 136
CysCQ 1.2 1.3 15 ** 5.6 *** 31.4 *** 8.2 *** 1.4 1.2 9.9 *** 4.3 **
NGALE 1.1 2.4 4.3 5.3 *** 12 *** 9.2 *** 3.8 4.4 6.7 ** 6.3 *
OPNE 0.7 1.9 1.2 1.5 29.7 * 4.8 2.1 2 9.5 3.3
aGST 1.7 1 4.6 1.9 19.2 *** 3.8 *** 3.7 1.9 8.3 * 0.7
TIMP-1 2.3 1.5 111 46.1 549 ** 58.1 3.2 1.2 34.3 * 2.8
VEGF 1.8 1.1 4.4 *** 2.1 8.3 *** 3.5 ** 2.1 1.3 3.7 ** 1.5 *
CALB 0.8 1.2 0.9 1 1.1 1.4 1.3 1.3 0.8 1.2
Biomarker levels urinary creatinine normalized and relative to the mean of time-matched control groups measured in urine from
Wistar Kyoto (WKY) and Sprague Dawley (SD) rats after a single injection of NTS. Statistical analysis: ANOVA and Dunnett’s test or
Student’s t-test (t) with * p<0.05, ** p<0.01 and *** p<0.001 compared to time matched control groups. N/A: not available; Q:
qualified; E: recently endorsed for qualification.
42

Table 2 Profiles of 12 selected miRNAs using standard curve quantification.
WKY SD
1 ml/kg NTS 2.5 ml/kg NTS 5 ml/kg NTS 1.5 ml/kg NTS 5 ml/kg NTS
miRNA Day 8 Day 14 Day 8 Day 14 Day 8 Day 14 Day 8 Day 14 Day 8 Day 14
#,TM
miR-10a 0.6 ± 0.1* 0.3 ± 0.1 1.4 ± 0.6* 1.1 ± 0.7 3.5 ± 2.4* 1.1 ± 0.7 0.78 ± 0.73 0.89 ± 0.28 1.15 ± 0.55 2.02 ± 2.12
#,EQ
miR-10b 1.0 ± 0.3 63.9 ± 16.8* 0.0 ± 0.0 66.1 ± 129.4 63.4 ± 118.4* 0.7 ± 0.5
#,EQ
miR-100 0.9 ± 0.3 37.6 ± 12.9 0.0 ± 0.0 102.5 ± 143.0 38.5 ± 68.7* 0.8 ± 0.9 N/M
#,EQ
miR-486 0.8 ± 0.2 12.4 ± 3.2 0.0 ± 0.0 9.7 ± 18.2 15.4 ± 25.3* 0.7 ± 0.2
TM
miR-197 1.3 ± 0.2 1.9 ± 0.3 0.6 ± 0.2* 3.0 ± 4.5 4.9 ± 2.0** 1.5 ± 0.4 0.73 ± 0.05 1.55 ± 1.63 1.25 ± 0.57 1.60 ± 0.64
#,TM
miR-211 1.4 ± 0.3 1.6 ± 0.4 1.0 ± 0.4* 2.6 ± 3.0 4.8 ± 1.8** 1.8 ± 0.4* 0.88 ± 0.09 1.94 ± 2.86 1.76 ± 1.01 1.80 ± 0.73*
TM
miR-21 2.2 ± 1.5 1.1 ± 0.7 4.6 ± 4.7* 1.2 ± 0.5 4.2 ± 1.1* 2.8 ± 0.6** 0.78 ± 0.25 1.02 ± 0.41 5.81 ± 4.40** 2.26 ± 1.64
TM
miR-192 1.6 ± 1.4 2.3 ± 2.0 1.9 ± 1.7 1.8 ± 0.5 1.7 ± 0.6 3.9 ± 2.1* 0.31 ± 0.18** 0.84 ± 0.59 2.80 ± 3.04 2.12 ± 1.46
EQ
miR-26a 1.5 ± 0.5 1.3 ± 0.4 1.9 ± 0.7 1.2 ± 0.7 1.0 ± 0.3 1.6 ± 0.2** N/M
TM
miR-34a 4.5 ± 3.3 5.4 ± 3.9 1.1 ± 1.1 2.0 ± 2.8 4.0 ± 2.6 2.0 ± 0.3 0.58 ± 0.37 1.37 ± 0.81 0.59 ± 0.46 1.16 ± 0.79
TM
miR-34b 5.3 ± 7.3 2.5 ± 3.4 2.8 ± 3.6 0.5 ± 0.2 4.2 ± 2.6 1.3 ± 0.5 0.43 ± 0.52 0.94 ± 0.61 4.75 ± 3.69 1.78 ± 1.76
TM
miR-184 1.9 ± 1.6 5.8 ± 5.1 1.0 ± 1.0 2.8 ± 2.7 2.7 ± 1.5 6.0 ± 7.0 0.21 ± 0.13** 0.60 ± 0.32 0.73 ± 0.48 2.52 ± 2.96
Shown are treated vs. control ratio means ± standard deviation of urinary miRNA levels after injection of Wistar Kyoto (WKY) and
Sprague Dawley (SD) with NTS (WKY control n=3, treated n=5; SD n=6) derived from urinary creatinine normalized absolute miRNA
concentrations. Statistical analysis was performed with Student’s t-test and statistical significance is indicated by * p<0.05, ** p<0.01
43

and *** p<0.001 compared to time matched control groups. #: apparently NTS-specific, N/M: not measured, E: measured with
Exiqon’s PCR assays, T: measured with TaqMan PCR assays.
44

Fig.1. Histopathological changes in the kidney of rats administered nephrotoxic serum (NTS). 14 days after
the injection of 5 ml/kg NTS, enlarged glomeruli with hypercellularity, increased amounts of eosinophilic
glomerular matrix (white arrow) and hyperplasia of the Bowman’s capsule (black arrow) were observed in
animals give NTS (B), but not in rats given vehicle (A). Shown are representative haematoxilin and eosin
stained kidney sections from Wistar Kyoto rats. Scale bars: 50 µm
87x33mm (300 x 300 DPI)
1

Fig. 2. Increased urinary total protein levels in Wistar Kyoto (WKY) and Sprague Dawley (SD) rats 8 and 14
days after administration of different doses of NTS. Shown are the means (WKY control n=3, treated n=5;
SD n=6) with standard deviation from urinary creatinine (uCrea) normalized concentrations. Statistical
analysis was performed with ANOVA and Dunnett’s test. Statistical significance is indicated by * p<0.05, **
p<0.01 and *** p<0.001 compared to time matched control groups.
61x46mm (300 x 300 DPI)
Fig.3. Venn diagram of urinary miRNAs selected to be significantly affected after treatment of nephrotoxic
serum or cisplatin
70x55mm (300 x 300 DPI)
Fig.4. U6 as general positive control (A), miR-126 as positive control for endothelia cells (B), miR-26a (C)
and miR-192 (D) expression observed by in situ hybridization in the kidney from a healthy male Wistar rat.
Using the scrambled probe as negative control (E) no staining was observed. Blue: positive probe signal,
pink: eosin counter staining, black arrows point to positively stained glomerular cells, white arrows point to
positively stained proximal tubular cells, the grey arrow points to positively stained endothelial cells.
103x102mm (300 x 300 DPI)
Fig.5. Localization of miR-10b (A and C) and miR-100 (B and D) expression observed by in situ hybridization
in the kidney from a healthy male Wistar rat. C and D are magnifications of A and B, respectively. Blue:
positive probe signal, pink: eosin counter staining, black arrows point to positive staining in distal tubules.
106x72mm (300 x 300 DPI)
Fig.6. Mechanistic analysis of miRNAs and mRNAs deregulated in the kidney after NTS administration. Using
Ingenuity Pathway Analysis target mRNAs of the affected miRNAs were identified in the pool of deregulated
mRNAs after NTS-induced glomerulonephritis. A) miRNAs and potential target mRNAs associated with
fibrosis. B) miRNAs and potential target mRNAs associated with the TGFβ-pathway. The color represents
NTS-induced increase (red shading) and decrease (green shading) in kidneys of Wistar Kyoto rats 14 days
after NTS administration. Black and gray arrows represent miRNA-mRNA interaction showing and not
showing inverse changes in expression levels after NTS treatment, respectively.
103x63mm (300 x 300 DPI)

2015Glomerulonephritis-Induced Changes in Urinary and Kidney MicroRNA Profiles in Rats

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

2015Glomerulonephritis-Induced Changes in Urinary and Kidney MicroRNA Profiles in Rats

Uploaded by

Copyright:

Available Formats

ToxSci Advance Access published March 9, 2015

Revised manuscript with tracked changes

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

† current: Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences,

‡ Pathology, GDD-GED-Toxicology, Bayer Pharma AG, 13353 Berlin, Germany.

§ Indication Expansion, GDD-GCGE-Common Mechanism Research, Bayer Pharma AG, 13353

Corresponding author and address:

urinary miRNAs for detection of site-specific renal damage in an anti-glomerular basement

membrane (GBM) glomerulonephritis (GN) model in rats by comparing GN-induced urinary

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

reflecting the tubular injury in those regions.

Keywords: urinary microRNAs, biomarker, glomerulonephritis

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

small (approximately 22 nucleotides), non-coding RNAs known to post-transcriptionally regulate

suggested by studies analyzing urine of patients with AKI or immunoglobulin A nephropathy

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

on discrete segments of the nephron in a pre-competitive collaboration. In a first study we

Nassirpour et al., 2014).

challenging since tubular damage is a known side effect of antiserum-induced GN models

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

from both rat strains.

2.1. Animal Studies

water were provided ad libitum.

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

2.2. Biochemical and histopathological analyses

using an enzymatic test on a Roche Cobas cIII.

manufacturer’s instructions. MesoScale Discovery (MSD; Gaithersburg, MD): urinary albumin

cystatin C (CysC), lipocalin-2 (neutrophil gelatinase-associated lipocalin, NGAL), osteopontin

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

Absolute concentrations were normalized to the corresponding urinary creatinine concentration.

groups and corresponding time-matched control group.

(mesangial hypercellularity, accumulation of glomerular matrix, hyperplasia of Bowman capsule,

hyaline casts, tubular degeneration/regeneration, tubular dilatation, interstitial fibrosis,

2.3. RNA extraction

instructions. Finally, RNA was eluted with 40 µl RNase-free water.

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

2.4. Quantitative real-time PCR and data analysis

calculated according to the ‘modified ∆Ct quantification’ approach as described previously

by absolute quantification using standard curves run in parallel, as described previously

were conducted according to the manufacturer’s instructions.

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

2.5. Microarray expression profiling

approximately 28700 well annotated rat genes.

Q<0.005 considered as significant), Student’s t-test (p<0.001 considered as significant) and a 2-

fold deregulation cutoff between treated and control groups.

bind, and (3) known expression of the miRNAs in kidney.

2.6 in situ Hybridization

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

trimmed and paraffin embedded. In situ hybridization was performed on approximately 5 µm

(Sigma-Aldrich; Hamburg, Germany). Hybridization with the miRNA probes (miR-10b:

ACACAAATTCGGTTCTACAGGG, Tm 82°C, 100 nM; miR-100: CACAAG-

TTCGGATCTACGGGTT, Tm 83°C, 100 nM; miR-26a: AGCCTATCCTGGATTACTTGAA, Tm

room temperature. Alkaline phosphatase (AP) conjugated anti-DIG (Roche Diagnostics,

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

3.1 Histopathology and clinical chemistry

Glomerulonephritis (GN), characterized by mesangial hypercellularity, glomerular matrix

Downloaded from http://toxsci.oxfordjournals.org/ at University of Toledo on March 15, 2015

activation/hyperplasia of the Bowman’s capsule epithelia (hyperplasia) might represent dose

dependent initial lesions of crescent formation and/or the hypercellularity might

develop/contribute to crescent formations in a later stage.

are listed in Suppl.Tab.1.

dependently increased in urine from WKY and SD rats (Fig. 2).

3.2 Evaluation of urinary protein biomarkers for kidney injury

neutrophil gelatinase-associated lipocalin (NGAL), osteopontin (OPN), α-glutathione-S-