You are on page 1of 73
OLA YpAI Eqyiito. 5 ( Leckey ae Abad) 2s capella yy geal alana iY a ye Alsi sill ( ys jbl) Sany cay) pda dag gl pall BURN gb cya pall Uae gis ve pT Aig y gsc al y cgi Y Ale spats Jally Gi inall il) pSllay (61 41g 5am yl teb a al) al ge ce Vets ty dal Nae gle spas (Hb. cla ged BLD yb ded gic tay abi aithy +e ADS Ge Soy Aoybll .. Gall aay. Sb paliall aay. pall any dllia GLa pb. Ain gj Chua ceil ( Sipps Gully ) 48 A dpaisl) & Cage ay Tp A gpa y Ayala aL g AIAN cea y lll om plac) flay dubia plalally + Cala oy and Gf yell Ge — Libs — dia dS gis dubeat Ast .. Uyele day He J ol Loaloo a (PCR ) pl 4 Sizhlibeed Gent sbi, Leh — tling ale og pact upla ... ( paliall ye DLE ) pal ++ Uo cy y Cay pS DMA J gly oh) bia deal (gyri) boi, te) this pt Glee ( sli) 9 6 youll (Appl) AB 6 Gia gy ( diy dl hes! ob 5 ga gl ve Ay yal Plt oy cil ie gba plbaall) Asi gf cae Agia ely. ( gl tbls) oo} Aalst yeti! plutly MyiMbagdl) GUY) Ay dy sls ad ist, Uk ie capee ue (Fekan shy) coal ( hy) dnp ape Upc cl cba) Ah ae be is gly. ( ¢ gtgll Iga) We thy ( syle) Legh path (gL) al : ++ Plead y tel Ww Looloo www. dvddarab.com (PCR) gle 6 vs Gaul JSG 6b aS) dually aSl Anan! Le pt Cy glaull ods ee lly La jubltnall y Guhl Gy une dali (yt paaaily BS) gine Mie lS g) Uiyel YL. Aaclpeally Cibl gall y GB ad oiS! «pl Lgastny Gags ogi ata Vda Quay al Ge ee gil ya gh Y) Sy ginal Nn a eee JS agony (ad | giles 9 ( Aceh hse) Adak) cual Qe Gly « Aglady ping isl By yuay GS juary Sy Nia. oat! oe Cy et) le a gn gi ol Cahill ol ¥ Ny! Leatag « cla gty ll Jy Gopal yy Ble JUilely JuGd aia vB clay ely tl gy Ay wee Ligne Lasctl Gel pall JS javony Aaitall Li 8) Lia). Quiledll ase Ral le 5 jewel ilascinall Lady .. (olaiay! Gblily Gee pee) i ool) lt) SiN «A poll (LH woe daly cg gine od = La is Jol — Gy kkk “Bd shy « neal Aa (pill ye pe) Ul Nia Caan peUbsy csitany « play lack aalay Yad Ogle s+ dab Shel etal ol ol eal a Ge GARY) qlLind (pil) yas) AB orig} Gully (yt oa is .. oe see Wea Oe take aah X SEU A jal) apply AB gaa hl Gale (P.CR) glu 8 lla Vani ols Bay eel Sal teall Up aly pple adaed Shall Lea igi (il Aad CaP. LALA ae Quality Y ye Sy Come Ay gly Le pa ae Gully Vy c Apallel) done) Lele CHAD) BN ggll land 3 jyeall Ay il) G yhgll alls os gay AUS) «las + A ek by gee OF BEY cygeblaty clase! Guy All alaj 68 gf lise, Atl) jaler gun pV 58 US. squall joludl Lac days Deal yar Gos lgelee ab ga e Lakhy aa (ple . anil sls AUD coat Jy Uahsy gf Ube Ay Gy all yl ve oy MS Cul Ayal). ads Guiles pte ociley (li fl aly : ig gines Tiley pads dle lL ih. pl jaiMS | quad pL) ll (AeoLatl aha) Aaalee ) ee ipl A pee ly OF ged py hee as Add ago Gel pall aa vo Qihaad) Sapanalls . gapalls gq die uw 6 gba! hy pal 2 gl 985 ol JE ve WOE Sa gl (gb lng ed pad lib Cy gSus . dle» ve ( gh yge cipcase ) Atul apa Jaa} .- pfladly gen Cpe all € lagy (piible Le GS). yen laa Js + ALAM JB hy Je oe GES pb tag jy ol ay Cet | geal» = Ch sal oe Ab See Cath od Ca Cy ood cel ote Wigy cad ot Gel Uy dite le Juail, a, these Na ed, Shey ed ed lly Ce Nged pte Y (il > —. «oe aS Vda al YG) iat Looloo Ba od ob paeddl e518 auch) (PCR) 5 10 ced Gf JLMLY Gad all ac 53 (95 elle 5 jal) 5b jana) Ege) Jady Meatball ig Sl) oo gh Aphiatl Cpkee JLURA 5 ya CaN 0 A aks Tale eos eal 3 agate chal. abil Ui. pelea) agit ge y apalail (2 + Colbie) Gale .. agaal al ysl oe GURY) gle tte 6p Stay UE Aisle (ad Like gi Baal) ste pall (Amb) pgm gyal piled ual ve Lape pliae daybed) .. Aisa ol) eG plied) 4a Sy asad) Wal ly (ula ls Syd pd Say GIS « AML al! 458 Gd GLY Gay "oh gle 4b f Aint) «thy gf «. CBU) ajLG 6 gual oe Ugnad alll Aa gl aay I Mpls Gis oo ay aj b Abas aah y .. 5 jae Ge deat lhe pL gf (Apecal) ) Abe Canal fli Adal yt Gye Ui yd Cab gl Hcg) 5 Bl ala Gall pL La G8) itl Last oy 13 (Anal se) At) oo. cael Ay pee bly, Aga Cathe aga oo cally pssst) Alle pall 5a pd Cli ape AME Lc Sis ay gl a dol dag opps Al gn sll Ay gill publicly agilac) | pul Lasic «uae oo Copaling Cons crall GAUSS 1 9B pg dl pace. Cay peal OS roth col Gusta Vg Absa aN Cy gity p gill Ale gal Legh Apple chal og s AB eld Bi gilt Jeay Ide » YplS Ayla) Yy Anphee Cpatleill Ll 0 ot Ms Ste Anges calls Comat gah gs Sea oe Cag alll og pli Al ay al Cou gall ve Mah ogy ool gt Y sll ( Goal) clea atta) ye pUlaaatll (Labs) A) comand pall 48 ears gly cl Aula) goa ayy Le aty Al pened Byline AS ++ Ap asD oayualll Cillsgd ules Vad Epa 1 eB pS Ql od GS al alally WAG) PAD foe Ls ures a (ut) (P.CR) gn 12 ves apd, Cpe Aad pee lal aly Mill po cot » 9 Ge daily poe) li ol MiG ene igi dale cai 9) os Apts jatl Aaah ob aed cag ol 1 yale Volos Jil cus ay Gt Soy yg iSall y ilina GLoaiy gill Jota = «oe Aga a JSG Gi prats .. dle del Ul» re gle oS GI gallo = «Me ga as > aE ae cpl teh pe ool) Cig By Ab ll Ge cine Use vo Bas gll oe oh Vy) ya 4y cand yg gh yc cll kkk pina Ghie AD. The Cid ( gq) spud gual) gis Capel 9k al Catal A IS. Ui Lay oy Al Gana 15 ( Aneta alae) Alaa). ual dy een Gil eee ol Rik eval Oe ve Gdliy dadaat cell e+ cS pAll glad] Ggad gl 5 slaall oF aeiticdsy «aly gb ella lab} 200 aly tag ja cls Ti Ls Ae oo GG pl AN Le gd Adee Gils Atle se pela > lp (8 bye Gd 4d old «o. Cilis Ley aes ol Yo. Gali alle cul » — Fg col JE. BURY) (ple Leen ty al All ay all ye : eae ce le bg jh dla. a lad a the of atl aj a > pd gis c cpillaiall shail) 5g) AAs Ug eal gf (ua pial He AAP GG as ald lst ol al ty. ayy cli oe ple Ga Ash aah i Shy lb Vl cee oy GLiy pill plate of Lijel al. Lae Ide yl MOBIOG fa aj) pe Ue Yio) as wwrwidvdderabcom (POR) si 14 Seal) glides lily ds Lik yo. ( gesgi sil) Apailti ced polls pls gay ( Lusaedle) .. VA) clas ty desi dob gb dl) pet Cb als gt ( il) 5 + Bega) cL ee pl ob lgalh Apln (y geclly | gilt SLELS glial Vag yy te hy Cypinagy « Adal) Salted cen gu). om he Sains Hyun oh Cem sigan gad Gea cibgla hy Gal Lily Kati Uglaladi gf cute) - em pall oll Lg ee SL ee Dall ppaey plane Aaa) ate dd!) john!) Utd dgoknad g} Sam gll pf Algal Gali ps Cay gSeagll Jslig SEY) Quan abled Gye + Saal glk dll 17 ( Acat stoe) Ada) unl Aye cag mee a vee ADS Ba A AG Cus pay gf ee hy. Sa Al A Gyo lal) vey Lalla all Bat gh spt le ol ( La ty) accel) Li se oe gedang Alay yiball oY Gul ya pel gh Ob sy Leb poe alg! iby yt Une 55H Alaa cpg gl sy. Ab ghially Addon Yils quads oj o> Alloa Ugh pated tpg IA Coady lane GS Slap dat Uaglag « VRS Lilley eit) Abel) ( rhesus Glu) 548 gf Md all gb as Solel le ball cs ad ol No uly Gal + Alona Ugyle 5 playeall y fe giles thy Be AD AS malay yg Saal le pa ood alll (8 sel dG al OS «pala Up) Abe Qual I glgha 8 ciskeatl 3} cyan ple cb jd sai (ewes) Sty Nin. ( 61 padd bait ) (PCR ) gdb 16 Vee Sf gan «+ agli Lay agaalil ge Cpl al pd pelle ve coat 4S) ead ll Gag UA Sy gall Pptrinns Leg il ally + asl) Bly pb Anal 6 pill calls oo lS lls utara pis + Mull ogy vo Pugh 8 ate Ghys yle Gall pie a 19) ( Avot alae) A). cual dy nes Ob) Se be GH ate ALT Ga gl paw ole Glee jg lill aie Samy cpl] ham ding) Yd dies All Cbg! gay « daniel ae ss oe ABS Cpa AST Ga chp fay placed aie ee os JANI Qu ya fay bd La (Boba!) Go ek ik al) 8 pe) ule ( ceil Sul ) Hiei} Gayaill ary 4) lb .. (ay pall Goals ele oll) ee Aggaall qildall Vas (g yal Las ca jill Ao jury pal pli pM ghd all & jp i Baty .. cig co Lal slay os fy pasey Lal ceily colgpualll ola gh) Sd clay (al e AGSLaN AG ply Ga aay Al pil Ui cls Caps pall isa ( jp) Anil 1iSiy mt gg — Vlas Geet g eae cole AM lH Clshg — Saal ok Lit kailly pg ¢ paseall (ys gael + fly Adne Ge Ayala! atl) Anes Looloo pete iis ) u iy iste a (P.C.R) ot Pee: cathy Lang ke ib 1 Gaal cr sy ul dum «(Ay Aeaagag) ga Caner Cade Lal Lanny Lao JeSs ghd ( cpeuse ) cells) Sala gs ogee DS Tos celthy gale aa gual) Giny JSG GS .. 54 jill 9a pala daca Jy 28 CR 6 hall cinl'y cyatd All gt +. all ce pe afi Ula Sl Alls Acar any «- Ane oof .. Sys) Ajaad cc g Saal) que Ale: Aly « il pplealy Aap} Jaa ll Jali ( cagtic ) J)580 decal Qesaadl ga Atte ah oJ a ceases sh gah ally. alli: JS ob ally yauty Lay elinal Ud Sd dy sally aah gS gb pill alah .. LSigMATLy cael il Ihe ; - Quail ya peg Ae hy Lay Ig Ao cindy) Cll ol oa gph ol day JB AIS. ga DE Gd GE ce Aaah glo Uylaty | 53 gldd) jae 21 (Aselid she) Abaabes ) appl dy pat ily v= GAM a Ad a Nay AD yaad ol lina Ap ast ol. gy sl ood [ay GiGi Qe ua Lis ( DIC pitied pile gl alas) fie 5 yp nuall odigd yy a4) 1 led te Quigg ge ali Lil whic! ... aia, 29 SSM) Abs Cally gio y Ayyli ly Hes Vip Atyye das oda. Sol Cpaaall (gl lly AS Ay ppl) Ay sey ( palac) J «oe lb od la, ad ait Ls lel gt igh » ny J Ve Lk GS a a. dy cob pad Gl ge). Aad Magda Lt ay gl cleat «.. gi oo Mpg Qu Le igaad til altel y « Aisle ody Cag) lise cob ely be yal lye a ed JS) Ils pial yl Rants colt ce high ullis gh ot .. Shaal i gaya Mlle ++ git ll (PGR ) yb 20 oe gala coll Spt cob slbly (uly) oy cy lll dalle 5 Asch pS y) Ade quills al gh cca oltl ab ngs gst ie id pla Ul cis ceeds Chale glides ply Latio qui ga da GN Lice t Bm gh Cine «tl Egle > uy Sy Coal lb AGS (pany Bad Ce lS Leste Vje® gti .. aad ( Marburg goysts) ong d yi el Goa ed fb gd Lea ALA ( gy ) Aedalia Get pel ny Laghy oy Vy Gee Cees al lS. Lila ol Cet ce hy) len g lll Aaclh ol) ( Y gu) Jy ( Led) 1 oh gaa pale Dg Copal colts giles nt gga oot By phy coiled J 23 ( Aveta 1364) Aedes)... cupadl Ay pene Obl 9) ctl Gobel JS) Sty ai gay. ele Gag hd dia» wheal) Cue SHG Gf igi Glug ad lia .. Glu! Yije «AS Aug) alle gl (5 lal GF Nae Vas Gal 8 gh yan GS layb Ges Lt oo Jay aa Ae apts Ay all Ge Guat CYL Gan oly . eS old gl oly chins gd y ( Auli ls) Shy slog dole obs bid Lia : dic deal Gh AY. sual span Ga Glug ad pad Lal — « .. Als Nia 8 GL kkk dagles Giang bal Ge Galil) 5 Audi gl 8 IAG, Jibs (gb BS chin .. Sina!) juga ww we thd Serre ESCH OS). cs piel) pauere (gh Ci bia Bas gll (P.CR) oe jd 4 a 3 ve lll Clue) (a ait. Asi yeaa AA dalell of ge diilie Jus! dia cals SSN y Ay gaall eile Adel ell! al By. Lele ij) le » Og BBA) She Sl bal) Gay 4a jad ae pl) Clty Oe ve HGS slardal ob 3 yigall Gd GLa)... pllball oe bs) Ge all ge Nga ob ADE Gils plinall aie Sead gall Gd GAS Gulls 8). istll Ge Gg) qed Saag we Aadd gy) dlikesy cil ESS (ye eal) Clay 2 dl Ake Gils gl > — «© Og peal perc dai Lig ala 25 ( Anal ta Aa). pl Ay pee ly ta ooh (yeas Algal ooh isl « AYN) uaa LY ily Gb VSL} Mah lla 1a ob egy a gh ould aay ee oS Np catia gly hl 6 ike pit Ica! sy qgndiatill (pall og gaa T Top cpauale al (ut Ui Ja © Ghana Uplacle oof aT Ge Guat ( culiy) clay Laie vee Sites La ciel gil of Jake .. gill Raninws ysl al Coed lh and Ay gla Salad. al) Gli aL, UN poe Brel). cs Sib Ua yt oot dy didlal pltl oe dad 96s CP cole gil aye 1368. ys gh hy ag cial ves gaagally Causal ali) YSiya OS Luly Glole dia 9S al ay ony pelos Shae tA jm gd pel ly pial ( calc ) Looloo vy 4 gual (PCR ) lil 24 $ cyaalll ge al of AMS Le gh al Tel sgl ga Ga SS od Lindl ud ce cyllly ab jad ise la Js gle peidl (iy ute GIS CIS apy dS cody « Ary pall lel oy! ploggll Na gis ail. Ay gill col glee) Ratt Glill Cia oye Fabia eats cpa ( dui Ay) ol ceatlall Gray « Belisy yay «Bate Aas pam ode CIS gl. NXE gl a gall Qyallall daca! Baal gh Ui wakes gle 5 oi als Y Lil peal gl gad » Ugale LS ASG pe Ugh isd Be US od pe Ul gh da cal RO) ay ll ay a Gyn ye GE Chad Byall olla oh vv Shine gb Nay Vl psall ood w+ Egeagall Gye puadalll 6 jell ay Lia Sita) ily Aaldigl Ge pyncy Cale hd cy yS Laat: eee py Ls nj he gl eal «eed JS Shela AL ggetl ogy Cus pall GS. Ul ole us pay 27 (Leet ae) dats) oes appl dy pcre culty cea) Sy ag ad. Lad Qual Yi dyla » = Cad ig ad Cig Cull Nips Gel] RNA Gu gyi Sel gill alt aad “ek ke Ved pyine foal) buat ¢ ty del of Guay Lia .. sll co) et) gle. gli ob dae alas 13 St al gl « Al a Batt of His Aligitl by. te pc deals 25 OS pl gt ia Byhd JS er ish ppl iss 635) Cae Lak Bb AA yt Ale Gag lll Jonas RNA i ( cat) Sl) lg ie DNA deg Go Cy Sa oi gh is 5g Laat. ( cy) Sl) algal Sta VHS oh ss ag al) Ab ay pel gag CLL Looioo - tial wrwedvdéarab.com (PCR) gta - 26 cot lay aad clog) (gd Capi gf Linked I. Gaye Ida > = cogadh. AS Y Njigldtly Alans cals Lat. gil aga Lgl) pj alka (pil Lal Aebes cy pie g aa A) Clea ub Ge oe GRAS be Vd a MB dag gs Legs plagll casuall coag plll Gigtey Ligue. cd pay Ud cals Cos tes hy) ub aul OS «Ata gle ya yg: Lay $ Lgeay Cpa Coaldys Calls gl M3Lad c dy tl) cya all en cost asl ll dy lb Le Ce jyidall cua [8a Saad ASS y Lalas 5 il Fld y 5 UE we Al y OLS Gaal ls hg pS Qual Abad (i) Sygate a) ey al. deal Cad Ups) cg gill Ah yal ayaa Cagle alla GAAS y « gp Licabll oe ASI Y dalja dae aigka ya) dats bid. fe digi Leste gis cays ¢ clay AaLesll cintsing Alle Cuong! fice UG pb swe dud) Jed oily. Spada te 29 ( AeolBN se) Ade) on suppl Ay pene ably) aaa pe ie AS hal pncay Algal ogy .. sl si + PG LS Anaad ogy gill v1 ih § sal] gS Si eal pty Cilbzel) dal js Alias bisa Sead gf lisa .. Calg sal Quail eine iS Alan diss Baa and. yale hal Lay yall ¢ you ob dil a 5 yb pensll Lijas ) ald elie dled le. Ge uly cy cial ch gual! pa cue Ayal Yl I pty egll 9 (cel ppl (teal) | plain) Lk ode cil Ge. Cee) ple! ++ GAS ppnaliza Cay Ce pawl cs y gil heey pill pS ates gf lide .. dil Bpiy cat gf ulisy w+ Alida Coy yl AS ca Lan Le lst sal og meg + call Gea ht od Able agi ye PCR hid! vl Ve yf ytd Oe ( pyar) OSs ga LGR) Ne Gay le sb gl o goed dal .. bay cay lll kkk (PCR ) s Mh 28 © ggg peel Woe gas hig Fhe Mab pLadell ap, Cot NgeiSisd Lpames Igbo Lbs Ss ol pagal yy cele ipl AiLialy op sith Ades ye debe aa utils. Upand se PCR i cod See gil i pian ain Ai Ib IS gata ob Seis ) ash (st ce cs) pened GSI Ge Lol aa) calls J +1 Sa paal gall Aas whisl 5) gh ( Kary Mullis cyl gs ys JS) Ss ps allel eel, «1993 ple Sagi 5 jie Lyle JUiy 1984 ple Ai jail on mae mnitl pl ad 6 A mle Al 96 lye sus Jap lia CMD pl ALS Ligne GAS 1) Le pny 6 Aalll als ci ey WU Le gaia ge cya bb Malad Utbly shy (Taq jepcilyyl) ) Ane Cue py ji) fli Cop) a Mm lly fa obs Cutsalill Gay g gill (pannel ANB Jules yaold debi) Qubius Gee sy gd Shey ay ill - Polymerase Chain Reaction (+) 31 (Asal aac) Abas ) oe. Guat Ay pace Ol gy Sy cYbaay) al de os gail silly Jy ill oh Gay wo Ugh ad cpl LES 9 jal Ges Oh VL gD Se Uy yo pen ply Lede ly be Gaigbladl alal Gully) aadany © Gas) alal duel gl pL) does Calb Laged aL OU Lede fs) Sasol 8 Jai Cys pH BS) Ve Ai pds Labs ue Lays Gila DIsll 1s are oak. Ligh Uae Aan ly p phy AL) papi 5 ie oda aged eed oyety dye 6 Ld allegs coll oh Bil Ugdily Cyl palee SL oda pie Jiaaiy « Ay idles Le Cage cg pSealls lean CUS Qf) ond Byhall ode .. Vyns pone gk Ape gs ile cus Cyc Fl Sem diol als G5 ve Aah ge AY ALY gl egal calc! ol) (bs 20) gill 5 he nif AS pat iy Lad co Cedig pill eine (ill CULL oe a) Galea y ¢ atu ww Looloo : san di (PCR ) sin 30 + PguaSll AGUA) BL ya9 ( ste) ol de DS e Glaay Coe OS is gi!) Geel) Gl cigad cul» eH gill (NG as GyS fill saad. ( aiglSgu) os Saag « ++ dy pal) Jl gle : aul gt RNA 699) yaeall ails sc) il A justly 4b ja pig -—-----—- co U jay 4d jay -------- Saul 5 gs G jah Al jayiy -------- Cal C jas Al jajiy -------- Cea gigas os Cetggalll Giles asd il) 5G Cig gh Quai Hae gf : Ja lie 38a) og ggill Ganaall an Ws AUCGAUAUAUAAUUAUAUAU a deel — Galtl Ge ALS etl lal ge — a i BS ( Anak whe) Aka)... cael Ay pee Nyy a4 vee Sad Leal) olay Jase coally «Jeet gb cath Gal il ge Ciuade elena) ood po ak alin of Gath Hcy. deny alli calls. Uy bat ad dad ailing alls cuhay lal) cad Yel (gle 5 ne » Ugdil Ge Ge sae OS SLuhaall oy ppley Ups amends ghg ( coiled) (ot dle : jal oe GAB YY. A Gigs. Yo BY. La i > — e+ Caw g lll cine cary Upland y Aoshi pally Upload Ca gS pall 1k. Cypplall tal aa Gye Le Dll ually lls a gf = Up 4g cuily Y Saas + SIs) Sy cl Nae | ghd gle Qua plies » — (hy oat Mot as LL PCR tlt ] (P.CR) jin 32 fo mt ag pell cb 6] gill QuS ab aad Giger » Ae uy CUily uae Gus iy agli lg. AIC pigt JS Gi al Sls gel By pleat odie aS Lay oT gy ce eg gual Spy oA Gg By yA. Ayla Ae slg sa ooh Un fac «ADA gl Anal Shy & igaaSll Ls ol) il Ul y call pc gs oll pts. de ju Nha Nya Gi gal » — «+ pitty) ald PARE yay! a ely Casal te coe Vik S35. AUB cay gi) ain sal Y > 35 (Reet) tae) Alek) all A pee ON fae opty Ue anal gl aay Ola! ode Ga pla JS ols vs a gyallly Laclall b Ad Gye » GGA 3 os) Care ala si ACA = ppl Gaede ala sevseesesses Beg SS col yad a gatll ply (ya 3g da calls Alanine Looloo wor dvddorab.com (PCR ) 5 il. 34 ali) oa) pai... ( sy) L emi ol dg ++ AS jos oy gllnall SIE pi Uae (lS ole ty yal any he el Y yh iS HUH ae gga (gle Ld aul cis .. dial) CS oe ogd ippde ME (gud) Aad pd gd Cag nd Gls gt aul cabal Y sh elaslly alaal of Iii pining Y alll 8 liga cya OF deat of te Cans «sp gall ptuens Cid yy Cuda Le ABMS MA) Shag yl Yl a. day of dud Yaty yl Uta + see glad gi Lasie: Al gia Ist) oda 5 Ye cus os Vaaeles (gle ai) Lily alla ge cud Wada col le 95 pans «65 3.) aed ul palin iy Ligh Sky Gis. aute| ab Yate ed Aide Igaamy .. Y La. lal ob dead Ul pall oY pode Neo. ges Sty algal A gay phe l y pale Nia 9S Gh Gay Ms geil w+ cll gl 37 ( AsehS) ahscY) Adaabs ) ... cual Ayan cil yy nen dia een a (8 cg al tel of Gs algelin clase) Sd pric Guage gall cally Apathy! Lasie egal caja) Gad spe al al ol dal Udy + Cag cms Es) pl Guy apae Fyed JS Cue | jodi (gf dle GL Sal) Ugist « allel) (68 pide aly cud .. adhe dain Wes al gh aga a Sil ghd aad gd pda Y gall ag ced gt a fl Salles ap gle od hl gl Aad pilose AS Sy sabe JS 5 FILE JS 9 OS) JS... (rity ve ALS od at Gh Ctl Vom Spins fhe des bs See Ip Ub lie ae dey a os glad gla il dye obs www dvddarab.com oe gil po GS | yp a dla 36 39 ( Acct ats) Lads)... Guuell Ay pee GUI, ually gle gyal) gle US cualad quia Sl lel Qa Line Aula) pLal) cya UigS da cad Lada Ga GBM GIS. digi cal) JIS Ly a ys aah OS al ceataly aged Jalal Ge e+ Gall ob ABN Ay seal) URN Apts Gay cies) Lj Cuda Lay eLall cigs co} paul idl Jas ese vo Vas) Woladl Gt And) col glad .. cal glad) Gaus Lin Lila pal YE cul ds alll Ge syed od ge cad, JEG Cylall Aeuly Eg pl paws .. Lier ga slid Jsd dosti « Gee la oe LS) Geseed (ill 6 bail) oll allel! «oy ghd cle > — FAN hy Gadd de pews ig il gay pd pty Lena Lyall woe GHD cg SNA gb uit bs Apa yal (PONE dy ctl Quill gag! Guay Lis www dvddarab.com = Ags sai JB IAN ogy gd Si giles Abia) oy (P.CR ) dn 38 w+ VHS Uppal cals . cilia a cals kkk + cle cals Gye gh Gla ia Ciel Y yj ets aN (le Ayulsey) Aue pall 8 ll cats day Aa GY pil Cita hg «Ady ood ( Gin) dre cane Gy Gd pies gig al ial alts «Sad Aa Cuan Vey 6 peal) (gf 5 ulS i lac od Glee Ao Lal wg Ly cll Ghee) sty Hyg pag 6 ag ae cya Ny 5p) Aalal ily lS Chae oY Vasa a gull alld sii = BRN A ooh Ga slaal l say bal cuts gall co pttind Galil «pig JS Sigh ually (gia Sle ula 93 ie) ob as) ly Uy ti el ge Anke 5 ga o Golall Gat dee Gi yt Guy nol jl) ead BS OS! Gy eit IS aya. call ob a gall pinai Lis ve atl ot CALS all coal 4s pene GL 9 Ge Say lhe lyad G haally 9 si J Le Gt ly + Le Ve ool Nay aly ale JS UB 8 Cispectilly 0 gl 5 yall ib igual Gheay Le Us Stab as gf Sad Qual) ga gS Sy g yall ge Vay A yaisudl Gad Yale ple Ys 1d tal oi ol pity : 4} old « dey = F gaa a El pla cass & 5g sh oli yaa play ob Stab af Aaa. Lad agit Y call Yul > os gl agag Y Ailes yt Es) ge cl st el penal Cla GLY ll » se pllall ood punt « ages 2, deta o 9) le Va elle G8) caine Se todipatian, dau pa JE cil glad 41 ( Asta) Jac du)... (PGR) s HL 40 ila GM glial) Legal. Giyel ¥ 8 Guat Gals Nala OS al BAS Gf) Ga dea... doll gd cal elie! dha gf vo Uickdae La Si ee Las. Guull ola cgi habs LS fle «Cale aks aL pall Gags itl le Leste y w+ oauall Le ppd al. dae ALL (6d gidey DU) GLELAN oe Habe gold ABs Alin ol cylin pall ch ja God clin) ys Lape tay al Vgd Sal Gaal pall Ut bY Gl pally cally J AS ool EAS Silay ly ll. pS lated ole J - eal yesh Ci gues ool Jib Aly pd oe (et) lpaad » — oe eb gic dad al. Aad Gla gles » + iby old} peal G8 Ao lle JS Ce ae ppt (eV phaae Cy ve he SS cial ob Lin Sly agit A. Ayana. Leiall 43 ( Aceh hae) Aas). ut dy ae ly tb cab plas Ob al Ge call gs «oe Abe Ul. pated Gf gal» — 2 Up Gata quad of quay diy ead ok ys Hh col gtd aio I 1 plod Ui Upsscad Sapse pol) Gill. Lgaleia! Gldiay + Ugsage 26 ya iu) Lal C8 de ott odgy OS al auutly « Mie OS al ad — 2 Cll oll Ga cag lia) ue Acad) tL Ay ll) All pls Wil git Uglaw Le Ning .. Lgall SY g ley ae Ty 6 ils) gl Oe GAG Lal eg) cg tl Sana 5h) Sb a jal oc gus La jgey + pawl Gat phy ig) alld «f Beall lala» A oo Bit ol alae 2c Looloo wwurdvdjerangan, g (P.CR ) git 42 ve cgi gh A glne cod chy acu ald. aly lial yo cals Ge ge lst civel oS aly f call ca ot al co Ihe Ja Uglcod GY SLGh as alles (ci) dada! y « gacaill aac agalg sd oY 55S) JUS Aish: £ Ab abs Ide JS. bald Jean OSs ply - Nshints oF pgalls) cy coe de gel cry city ve Bets Lal) gf a ipl cabo Led. GURY) gle iy eo Cig Alb Lali Vw Ayan Ul cle Athen Cig sh 9d pili plilll any cei te) EY) al ysl al. dil of aul ¥ pnllly : ( Sle a5) ) Anei al ca the le gil Gl auf 9d Lbs de ols hy — ve FV Lago hs ua ¢ Lilt) Ce Mee, pf el ay aly all lla Gil Cais coe Vy SB Nhe yg oe pal al. ab) (gle geal aay aL Sl Glau Jihe (A cht Gaal hole alka ve Say andl) Judy goal gi aap dal A ca dg ve pag JS Uy gl Jat GS ol 45 ( Mel hac) At). ll dy pee ally col Eakb o. og pall pall) lead yyy Le gl. Bua oe Upeatl ogle i all caus LY & yidage GIR gle Baill. Sad 5 le publ w+ Aah ge ge Ut AS 1 gl cll GS Vy pie Ge Y «. DY sy USN Saal gh qual (68 Ul y JSAM 6d Cah gg AY cull) ans Cul gin cilia) ge voves pla) lS dad Ailgig .. pel) Ags cals od # Uyay ay cid! so jf acl al «BSI Sail) plays ASDLa 48 iA G aly ol) cla, ail tot Nal uae age na hy ad 9) Glew lll 4 Saag ( Leball ) aed thy. pulall Guill gle gig (lh slain) pu : OF sty GS) .. Und aie acl y (P.CR) gun 44 HY Sas poet 4b (ped alle. ILS alle Nia » — oe Gama coll glint Vy Gulf a abet Gull .. placa oe Ud cpa Y ld ode... Mba ct 1). 2 gga gle lal Salud! cele dy cll «ss ae ue. dea yo Legal sgl ple cong sal pall Cas) Gan, aad cals Copa yal) pine Judy LS dna pea ug pal clay Uysly « Alle col Ade ph WE. Alig Quall Ugh Aad pall ey hl Spa wed Qua pil GSS al peal old (8. gyi) Alas yl bald Uplal of Gay .. Gai lag) (ple By gucthe culls y Jai CS) Natl abd. Baldy BLY Gu Lgeeny ol Lt oe 413 Cg Ob Cee mad Lays Slt + ppt G4 it Ot) Ladeic Lads apd Y Jalal .. aa Ag 5 ail concal als ve SL alles Sip OF a gamalls Gon lie cl) of lai e+ peal) (iluaat) .. Aco! pall .. cyl) . pall 5S. ¢y 52 jill) 47 (AselSD aise) Adak). quell Ay pace Call yy 1 cule aa! Bally ada) yo. pis AS ML GS al 5 yall ode Liga) Ske Sh SU pic a yal culls. aya gael) Gul y +» Qual BalallS Gipla Ligh basin yg od Lg oy ol dg JOEY Cp ty all GILG Gee Lat Lal BIG dsl tay ay 2B Gf aby ALN Cue - ll ve GLAS Jaliai al oe Ul cabal 38) Gale aus all. Lgt lag 9} Bi std By AE (A Ul cule gi Lele Slant gd cult gi ya Es ell y Be Sa gael y Aa gll 8 Gagan» Lica) eo cgiailiy Wy 98 ais (giSt pall Shadi. Lids Jalai al laa Linton 9 Ga = Looloo www dvddorab.com .. Glgal (PCR) ¢ jie 46 = ae agi. forks) ae Hy Flaall aera) ol oal alall oy + agl bal y Vay cee cod ula Cus pline US 68 ill le esa € 3) oA Gueat) paul! de gll alld ds Jota y « cilia Qoibia Yg dallas Cau Y Ae g a) ye sid dia .a8tl ldla Ud Leg any cole ld ut cs (gil ol aul did 4d cal. 87 day call gu adel Gigusy.. lia ail dios Ji AGS gt iS $i gh yaeidll aay Gay Y .. iphagll ee Qaeddl Up i i Costes Lgl y el as IY SLi Jal ge a sf alls + Cugitl yal) Sb GES Gis alist « iba we Ones salah lis. [Se Jag) Agua Bid cas col Gilly pen cya giASll Nn cogs y Gah Chall ogcly Ud gue dg-3d Jb gt. Biieish sasappiihcs wi ailt aut fl 49 ( Meth sae) Made) out da pees bly Malad ony of gi Lite JS ay Cis Ciel Vy. alsii al SHAM pod pad. BAM Ga NS Ab. LS oa Oe GS. aad pf gd BR. Ztas i gt a hy ally Ce SS chjal A gualy SLals thle Mall ols od Ui. ast Vm JS ep co) Cagle Ui CUBAN 03a cise all. Gy fas dg 95) coil aA Ga. Ab ay cuegy JS sill) 4S Je ial ol Ge gad ays dB gd Gl cy ve grip (pf MSG Vy Alga Atal a FY ot apace Legge pth cin). pie: Saaaeld AS ca ye gid Uy call SHS Ge 9S Gh gle Cea cellly Ups ll ch Spetinee Bagucl .. Ana pdall .g8 Lie 5 jhe CuilS Sauad LMS, vee Coll ee pill y Bally pauls Guially lyull, « . Alas .. Bua > ( P.C.R ) st 48 wa Glnall (ple Guanes US LOS Linda oul gl) ciel Y 7 Aig cin (cies litle By «S 4agil bla» — eTaly .. fee Usd cad... 423) cual » — Vie pd hay. % 98 gle coluas iil la dl | clad sty sped (te Lt alt 4 gal ol cau ble Wey 2 pS gd 4a Alay sony ME 2. Le Logg ay Cally Lidell Gand} Giger » — «oes al gel Ange tally Coane! id « f Ange al » — cow digi Via. Aealad) ob Aygit Lula » — « T Ausaigl gh Gl) 2uls clas gl likey » — ve Copal cg cS gl cpl. algel Mages sey diy Jala y» — «.. dil le 51 (Acoli shacY) dads) 2. quell dy poe Cbl Ligly «quae a igiedad pil atl Sed ould yells Boge AY pS) Gl al Qed. LGN Gye ph all Gly Uaila dia Ya). Ak Ales Af aaa! gf Qe : eS yl cl od Ga gSiy bald gh gel Gay 2 cally ja cob Cant) opis pllall «1 yi US pts oa of Ula chia da > — 4 o Qgtlsde agil |g ye ai laa | gate! Gay = egdadll GaaS (pill Ausland call pals Billy Abial) oh ode. ol GuigSt Giga» — Ske Ags BY) (ined Yule gil cay a ib GIS Le any Lay laa .. hd 34 iy og fas IS .. 5 Looloa: www dvddorab.com (P.GR ) gin 50 Legale iw iil. ctl pf Anas (oi ya I gh Nn jab Gg) ally « Vis GSaudd ube Abb oblbsl Joli gi we gt sl Lab Updos cod alan Gilad ool GY lentes wives Atal Ups) colli Gaal gl woe pA Goa Sigh sal Gale ah Uly agi gf (le ols kkk ve iy cals LILA alah 8 prieall suey cwcigeall al gil claioe aya ally ail oi Shy seal ee GB i pl hal Lbs Laie «(pl goa dela gayi Glasi) dual stig Gila phd Lagi @ yi ai « 6 jill te ol ley AN jig) aad Lege Ga) ay (i Aka) ged bat) Aah) aides AN) Cemeall abel Cuatiguall sl'gh «foul... faa» — OF gid. Leedll Gls ably a! le ols adsl ual gi Lis = Bye AT Upe Upinas le (gle dash bya 58) 4alll p 9h ye Nl Upc pL) ayia ot iil eas pal cyl aay 53 ( Meal hae) Att) 0 cull Sy pene lly cb Baie cyctiny gg uli dad Fudd. ABD te «T pat al. Gye» = «fT Qa pdain — «fT Coal Ja, diyle dy yd. Gia sad y — oe BAGS BUR Ge pied sl SLY .. pgill ate dle Lay oH GY (all el jad > = 6 ol GaBY oly Sah dia Ja yo vo hye Uglies Liye Clay Y Wal of ll Gey gd called Un y cn gh pel gly s Lyttle aby Vy lgiigic Vy Iyilss Lie ¥ of petty cet db gh. Alia (fille Goadl gf asd icy! : Ugal A dal (ya aS «of Adel pe CLE a Ja tooled |" oe aged Bethel | gh Cae plc elisa SU Lgl (P.CR ) efile 52 oii te Gy Alay Up) (od cul Cycle] gill Lady pleat cee cpaleal ol pod Lin cyySlea .. faye Cale Lgl ce pall kkk von ih gh ft Lis pad cual Sl JSS Sd pul oS Lge co Ne cal gi ve hae Ad ell > cag gh sisal) ole py sith gig 31 Jul 31 wen could! Gye agg gl Ube astitly .. 4a gl g il JS cob city upmtpalls gg el ob opti 8 Ut ol - oy equal She gic Aalsl al pill i yal ol cue a gall dl Ua pat pany Ages & gh Byad pgily gay Uilay sla) a cis 55 ( Anal ae) Ala). all Ay pee CL gy Ge CaS). Legit iy lla GU al Gaglne oll 5d £ pywnillg cg gll 14g2 gill cally dull. gy pS) acaba uate eng laud) pa il Shaeallg Ghul Si dail yg Agni) (fb di) gall das. Ica vee Gal clay Gay ab doll gotlall .. Suysel coh Oh. ed 3g Ball od. fay Gals pul yo ple oe dee Jl tee Pune Chall Lise kN) aU gall) yy pall Leda a gtd cals tml ped ee lll apeiall uly. ge cad) Lane (gtd Ay gH) Las jaell Gli plied ..! plas Lyi) celgmee si) as, Ayal) Qe late Lytle ae JS ces it Le sd i Lately cally pst ay Ug cual gl Aale ly usted pil 6 Jan filly tlds | dal) ak Oe a i te werwdvddarab.com 1 ‘ (P.CR ) ou 54 «Aye als... Giydl» — «8 pep ol Ce > — CF pla ab gh sy ..f eas Gull. Yale ls cal » — af AUS ual .. gga oY Up Be A Je Ups Bb ge gael al. Nak Ce eye cl cei Y > — : at dladl ijle Gu gi ol ui da. o 3a gael ug 8 ol Ja. AL gat. Spa he gS. a Legaes jl cil Ugic g ady Lin Ugy al Ul ..? tee ly ote os alge) deuad a Hglahalh AGL, Lge gj Gade gh Ala pel) 6] jal called ca ge oe Gopal) Cys Shaken Saal) Aud S. +e dal) gb VAe cul. Y oe Boye Cll Cad cy paced 57 ( Meat tae) Me) oe pall A puene ill gy Guia fyb cya yy Ue acd Alaa cia dle pay Boyan Malt polly ipl La yall 1c Vda ALYY cyusaatle g tl Vy UidSiud SLM cia; Misa. oda Lidl dyis, La aly FB pe NS Cte Jal og. Noh Gut heal) gutted cl) Gime) ob ph (ptiaay Lei clad ysl Gad CO pte hae. NA lel gilt ges eal) Sal ay Bas Gan Maal Gl pA) lea faites « Sulb ggliy pata Bog Ales ode ciylee ple say bale .. Ana dul) od 1 chy al al ALY) Qulal puke ole Ja. Lindl y ty Sob oss al Nigh Gyalanadl ab ood Mad Gal ail ¥ cs eo Lay oo. etl Noa ye lel Ge chy cl A vo Ugh KB g phe dyad YL caysioly Uyeda oi gl Jee (silt oly aya laa cifyall of Iya SN oy a ply + Cuadau| ad cogs. AR yg Y) Gy 1 Ga pe ce pall Nha aestl spd Gog gee Sigh Ade call atic tei Uy cath call (P.GR ) sn 56 28) god ly Gib pal) Cl ly aes Gye cpl Gf cubed Lise o> OpaMs Aad) olf cls Clit) aaa Yl Cay alg dapat cyl ol YD CF duals + ead be) i Ail) AB id a gall Vf aaa vos GAN BUR g «Ug allay cial) ead Ld. Gla Alaagly Ca ld caged) Lia + Ag!) of aallad 4a ol) culdny Galall cada) «et aly da. Ua i» «fiero « ? ASU Ua alii cel da! desl b ead» — ve Aad y andy AS Figs. dha lay Lia Dae FE geal Cpl oe eet IS cod wl Algill 8 ois Ligiall dad .. yay a G8 Un te Ub. ( jan) s Al pila!) Ais Ayana s Ai a Ugi) .. cle (lucid ge Uys sl 59 ( Acabad ase Y) Abad)... cual Ay pene Gb yy Quali pf self CO Bla cals .. Mail) Gif cal ce Lik lS gd Gull Suleys . Ghul) bY Og L4.. GCAU Glu ga SAG Cay Abu Capes ai J] GUA ie Apslts 2b Gig all ola Agilide ADEN Cig yall 585 gf GGA Jute Gugiltin + AAA (ia OA 6 Je ol gh Ne 8 ADL Cag all Ge Ua Coy pg tay dpa. Gag alll Qt all bp SOL) QA Jig « AyLa) Gilg pa jam ., deadline yt ain tcl hac) blade: hal = Gil. galga gm jul. palia ge wwe. dvddarab.com (PGR) gil 38 cb co ee he al gol OG ceed tl ie Ja > «oaks «$ bualy» — «das al ot Lely ala de gl lel cis pty» — «2 ak Gi pS Cais cally ell Abiaal) dca) (68 culls YH) Ge Gad A] JY. pad — Bale gll adatiol iy « Abas ly ge cil, oy alse ols cpl caghl cill gh El pull qual Las. Sas Ug ti on Chala polly AD os Ql gual oglil Head 40S). AG jade cpt as Aye gS DU Ce Ughl aly coll elial becisesessessey {ge LIANE G1 - (Meal Sac) Mads)... cual Ay puree ill yy SP ++ Ge Ny Sigil Ge ale ge cemy Jee Ace yar hing Wlaury Unes cys Ge aia Gg Cans gil) Abell gjaday Glinuwe .. jy pluiSall cial gel Bie ol oy chy pala) jal cpl) Ntieas ( pila) dll paall ood ¢ Aiwale dourg Ady olde CNS Gayla Aadall gill As JS QS AL gga Ys. gl pl dung SUMBAT Ug i Agta Uy Bog) gb Cea) Bek Gi ai gll yas. Wyle y Le: AB opt vo anata cipal g) Liat) plisce Qubmll sal dy pia ol Alba +. Cagall daly ve A gga Gedy Lyd es saa Ws an aA, cae i LS0 z eee VOIgO aaaly Lay Lf sal dads ol Ging £ (gute cml 63 ( AeelaD shacY) Ababa) o. quand Ayes Clty) vo (gle) Sst cplyace Bde WBS iat al Nig Gg AN shania (te caady « alyel Sie of al gill Gel US yphiy « ALighy Lin Goa dads (pated opal Lely cillialll oda) | pS i et CAS (al ey 0 dl al ep Gill sil Alba ago Je GAS all gl cb. LH lb oll... (ol) coal ia Cuts Led ye aah Ad ony al olka coll Galt cals ie pape asl of asl. agile Oe ool shee Op noe ALUM cob pmeey Baal y ABS ob Cie Ge eral Ge vo Usa alge Lgl coe josS chee digas SU! cia aly « pg CS ph pels «ae ge 3 ( cpl) pla Cig hI ode (2 Alla) 6 Gin ily quits all 5 gl isle cig AB) Ly CB os Lila yo Abb ( ply) qe cals Bally 4S yA) dala digi igo Wald gt jlae .. Ayaleaity ee ALG. a As cal ab UT Lal Abba lh Agi slay beet dS any then ty ob A A ge fly 9 8 sl LS gfaatd Reali lacey dual gil glad Ulla eels er 35) Usal Sus is pin agi a“ (P.CR ) 5 thn fe # Cones Gi Cig anes «NE alles gg 8 Adpcall Gitag Jd») — 2 Aba yM ALS ye ia i og Aida pan cigs oe tle ot Ge Gloag 4 dag Y Yo day be Gia Gi DB ( cella) Glad (gle Olals!) Gye Lis 2 alg’ bee gpl all ghd oo! ciluaad od» — coh g Aad pall Coie lal y Lc pall Uy ctals Laalé 5 bi + geal) gad oacle Gye oat «oe fbi of lb? dee Gold 2) hat da » — «. pel. chy aay yd Lb kkk Bang pd deal Bath gl Sl) ot) sila gl J chk Jad Ay dtl pal yy UAE Mig Cus «og il s+ igliall y a gagil G5 ( Aceta) ahae) Ad)... Gaal dy pee cy Wag Ah Gi cae al day UF. ole > = «.. gal daly gl dd Ad ys kkk + (dase) Gal cgheaill cgial pall Qual) C3 ood sluathy) dae Qua psi Atle gilts | sophomore Las . 45:44) dnstall _§ semester w pgeseeel oe Vghghs il lin Alt any Las AR dina Cone Aig A ads Agia Gls JANI seg) pli cals we Ay yucnall pupa Aas os ghd OSS pl ong « (ot! cS AS g « 5 yall (6B pi gh Cyaan aig Qu pi Gulls ve Wop glee Nap AGB. Ajab Yl § paleall iswall yanl ase US ply s Meade cig ish cue Die | lua cibgll ee ceB ol) Baka clea gl palea (pf yluday Lis plaid! dole daa 49g) Adana bobby J yal VIG Oy pil Clan oe thd iid Ald op Canc ah (+) © ee kunt cits etn 1 1. PO ak eel (P.CR) sin 64 Ce Kips esas pai dhl ¢ J Cayaey ( cella) os Bp Bi yal A) Ais ofp 8 Ast Ihe. Ube gS) al. a OF ia YY Gal eb cals 5 Bill ode g « pllall ALitsin w+ eh Gye 3 gh i gual Vg | iy al alll |e Chacralll y quildiat dary (lla 48 8 ( pila) ) ule e+ uals] g Ay pbuall ‘gai ddl oe Bye ch aan at Nhe ahs gh. fleas li iiel al» «. del Sb of gl. die y.. dhe yy» 2 AM al EI Ge daa ipl Gp Lay thy Hg Ne od yg jy ot Lea Aad et at Guill » «! gts Ao pa pl gd. lee pal ily al i) opt Caled Le uel » plall Ga Ls AS Loy ghy ily ly Le gauay al ily aLbill Jac 2 dala ¢gliisall 67 ( AcabSth ahacY) Atak)... Gav dy pace Call sy of NAN CB gl Na (9 Li ie Lill ane cules pla a Aad ple! dhe cyyetany Sad gnc ja elds! of od gay gh sy ve AB al ls ag be aay Aula AGU: Lily 28 GL o. AghiS ABC [ple call) Gigi Nis Gibay sill le ve Negi Egthe g) gay tal Uda vy ABC (yumunt Lptleay coin claal cae. plait cand (G15 Aygldall) abel) tty cad Lia oo USS Audis Udi gang Ug ALY dsulde 5 pice J gd we Sypes lla. Ugasda ge dant lal Yule bial ca, ve Gatpe Ugau jgig sill aac OY a UY) ole subd eed oo Mla) Ay dd Alay) Cin pLalil Cuamed's 4613 cad, te Aa oa Copal] cand Bald Ape yo (Giall 68 abel) ule 9) wwew.dvddarab.com : Bay cali (PCR) gts 66 LS Lege ey Aatitl sf a yell ool) Wkly ls Uthat) abi BN 8s igi Lal SG) Gamay (gill 9. June v= Gal tl aad algall uci y cual pladait | piled} (ol) ageing} Al call Cinall pl Latic 5 Legal oo ys cigar. hin tgs gals ol Abe Culley « teat ve dalle ppt ch) Las Ve je Sale il .. 5.963 (ol) dala 4th ( lay) ols ve Mgigs Ga MUbe Quay Y ALS a Lage wos ( Waste) Upaal OS gall cot dh. Ala ee age e Sag Anil jall (gf Aili «+ Peg kkk 2 dwagad 4BL ly hg ( oily) td «8 lie yd diye» 69 ( Meath aise Ys Adeaken) ... sopl mae cl yy Comgualll .. st! pam. LaDy gud gill .. Mononucleosis seve Lage Gayly 3 Aisle Aagly ly cotBlaal) Aiaey og] ib TMS cya. Uglgit ol pth Gl. jail y > = (PCR) 5 uw 68 Fahad) pdb Gitay ie die. cal > + Awaigad watly gh g lily ic yan ithe Feat pb CLL) Uplhe .. ue gued Ube y oe lap CG Gal el ode Gt. (gil d ylitial y 2 figtll Con 69) cob oily A881 lo Galeny «TAN od ye Le + bale call ve thee Ypatnngy cplalee Lgainy .. 5S Gladll » — itty El yt pl be Mila} plas) gle ily quel tay penal iat od Ga Ayia Sake aly gh « all ljhs! oe pall ans sgl. ulate ood le JS pple 5 yags ds Dial oda Bi gi Baya y VIAN Gal; Aa Di .. Ay gliked ae y Ai gdiny ate FY (Meal sae) Wat) «cued dee bay «., dice anil» — OS date Gah. cath ob ly cl dee = 4d gig. Sady Le gh sy Le Gay ¥ aly. LG gs geld ch UG ok Gols od ashatly ype ALL LGA » padlly seta Ge yall cl ia¥l Ne gle Gey. ¥ dist ol al Cot gl dake Gy «OA gale Gal » — cht) age pig» Via} dobey Y ice Ugely (Gleing ert papi) Liat iS 9Sll Aagls di peidisd po LS os Apa gsll opalsy «on ye ag Y .. Galgl ey = oe Boy We. tials gly agi dak > | - AUS late; ped das Gilly ww Looloo wewardicrabeom | yyy (PCR) gti 70 a ope inate tay Saual sl) i jylad dclally Gabel) Ge Gilaite ++ dull AG Ab J gs ald CdS ye si ga Li Lab ALS Coal) Gabel Gch agi og 52 all Gall 2B gd a yay OsBey Opel. Cell AL oc SY dil ge gy lity Sylat ALE Lavy opal Fung! apt .. GLE il ply «ALU ode Bly Sou of og Ball i AD eis. ACL Ly gle glass ve Galle (ye Lal ual ill 5 gal Gling of ge aN » — Jel plas gh cay. Stills AMM Ga dy 5 usaall Gb «.. gill) Cm Chat oy Call od Ups Gal all. Js Ls agi al ass. Vin dyad als QW 5S gud a cal a olga) vo Gaile Guus B gadll yqie Qe als (ot g ally Gand dia TR (Anal) hae) Mhdee) ... asad dy pee il gy Vasey « Boas Aga ool) Ant od CDA SLawuall LON) Gada casa dang igh dead Oh lS um GAH ota ye Gay oy A gadte yb Mal ISL of ofS) .. JE oi) Gilat: Gilad! oe Mal Sy Ble ogg US gd. eel 4 hs 5 oe Gels a AS ALG ot Aga. led 5 pga dA oe ale ae Na oh egies aby Ae Vay aol i cis >a} « T Vudd Lag phaol al Ji Ja» — + Dy pil ps (pty AS Solaall bi lik g .. Vt gh GS at. SS Gaull gt he = os Aa DU Asal Gi pail al «f ago — oe oe ees Sai hy angil of [te gy caltdy cig ogling Yl palieall yansd « 98 2) (PCR) sjdn 72 Wp sgl plshiy Ay glee Ab y ne oe ( nll) cual w+ oofhtel HIV yay all | jal) SU): gual dy la ces shy tase dish Nia GIS. uctily cgi) ade ye Bale ode jawed Of hE the of Abi) ude deliall plaid shag Nigh plat) 4b jen Aulsy 8 US aig lls Sang oof Aaa gs JOST sal Si mal yl Oo oS « dull 9] die ial ud =» CSN gf «pl ygalt cl gs aaliyah! : ald, ay OS... Jay! oe leis Gi wy Gea. eel > — SY Lak Lily cls ye lsat tla ol al as «. gash Up Gitta cahey Mia cle) hy. gt old Le ia» O « v- diige tse ote laa CTI gh. bd Ha ine gis Dell pl gel Maadty oo gtd pated ip .. dela) gall 15 Gasia sad). west gu Os wf AS sep MS Aas Get i ay oh yg ple lil of (Blas gucalg « Ae Las Checad Sie tsi) yall Gull Lily act = Ag 8) cas aj belli, HAN ee Lee cals (ple cect Vale GSS Sal iad UF ogde i Le Gil » — gmail boy cee oJ dite gf wittel «6 all gi ou oe Ayal Glam ipbdtiows gf NAMRU 2 odd (gle lla dead cides gay J ob eh ued 6 ct LiL! Gi LS pill (2 Usa » — ve cglainaall (gb GAjE Li yal gtd Conny Auld dial er Shad 555 yh g ( clue op) Abel .. asl Aalay | pits VgeiigSy at. WAST pill JY) Coan y diLiia Li cis Actos yall Conia Nisa. cdg! alld 8 Jas) GI jLGS! Ga yey oe Ciglall pall Cpa sl Ginal ih Gi). HB gall By ghds Grad By Cuagi ade dye : coh JUS! caged dan be Uissiee www dvddarab.com «fA dae — (PGR) gj 14 «fda Ug Cid ag = ei cil. dy 2 ds i ety Ge YY cea ght Yoh lay cay bg gual hae cya .. Nn oe phe gall) odge gyal af ys pl lilly » — «a pA) ga Lay. cod Yoo aaah JB Dyess Yt Yad olay 2 « o. Wedd ol qa Hyd) Ol dal Lig 8 al to. ents sl nell Gy gh je 13 sl al Cpe Hd, gold laos ual ea 8) (ole gay Ala ws aad Gf Age g 43) Ly Ae spi OLA Gg go pag ali SAL pd Ble 8s al ells ( AZT Gutydya i! ) » jes) Ayla dy gba 77 (Mok aac) hak). cual dy new Cd gs cay Nigel gd oly oiled ily i. glad 8 on ph lag gli ot Al i pitt. Ginn than og) cpinly ang AN FSM Anal (a ole cas ao Vike ciel. Ay pues ane ab yy Lilley « Tame gaia) 42 yl YAS GAN Gye lad of damege Shae pod ash pp ail gb ge og i Elags gil yall .. Giic 3 age cigs Mb Lyd aig LS gall Ci ae gly « claipa elllgs a Gh publ v edly eel Lidl. age Lasle Mayaye Samay CAL ci dati fo gicke Ul. a DU oe Al dole cus gd Vey os Upc 5p ply Und ab al olla. dad Gye QBS NS pd Hing ot aa phy Cuiplly Ang Fie Toate gh Bye Uganas Cit y Algal, spel Sst sl ple io cath oA Hak gall [gle +5 4) pgahy Looloo www. divdécrab.com kkk (PCR) ¢ iw 16 pty eat a. a oly gle a a alt» cpanel ob OS ool OY Tae all 63 gis) Yael ie «oe Alay dal ye say «oe Ladguall (gb Citay LS SN) dag al gt Gil» se Ladpuall 9§ Gute lab. Yo — SARE cigs .. cifigall Mgt A) clay! 4 oth cis Chall NS ain’ Lag)». pally Epi Lats Yagi! oe pal 4 Mapes 5) ll vlad! jis le .. Ig Agana ge .. HS 4} Lia Y the Sl ly at cuts oe Nie gh Ad cls hy Legale yy tall gal Lay» — el ge dea: Zid) Cbla ay Salis Y Laie Clubs! ++ Cll gal cy Yo. Gang oy Lin dl oe od gl ig eh dove cls Gulls gly CUall ge Gad of it dl penal «++ pall Ciliides of eats # cb pb. Byphees Altay ple asl gt by pull AS cal gay 79 (Avalat hac) Abd) oe cull Ay pew bl yy Va pee g pees ph eal og ALAN Adal og gles als pe gb aay Vay cna Last « Shelly yi) yj oo Ugh gglall ts) gil . Glia y Us CpeSy plisl alia CMS g « Adee lia calls oe Caguall Gite Gl i yhe Glas yas cghg gd CMa «ALi La cual ALalal) Ugilae j cathe Pld le uit Lin (ald gl. Ula JS isle ts igh aed Ids. Gel Y » = toe Guha Las lS 3M) Aplus Al, Wagag peel) od ll 8G Ae jae lis Gils y 2 Adaya) pitled « Gada ge) Gps pba « ¢ Ala Nala» oe Agana Oa ys ahd ole » — « $ lady» = Gol athe of sule — Looloo www dvddarab come «tb (P.CR) ¢jilu 78 ce pill acl Aylay aos dastall (gf alia ( Lyysle ) cals See OF WA pee oof plat (hy Gul) 3 jgy dae why. yal v= BBN) ula) od SUA. Nila Gye Se Ake Lys Allin + iG aly Lagi Gucl Leal aila gfs Pps ett gt Cue yp ey al Ua. all ga Ge a ia Fy pty Sis gl atic) g) geal gph » bagally Ales Yas , thay IS « Aaalall ye ihe ool} doa AGU cl yp ay OSE Ne ayy pds ol Ge. Bp Ace diag of + Gs w= daw Sled) gS). all adauey gi! el pol yee tly sad gh. cla Ll gle cally atin + ISH (ple ald we. eg dae vee Gal oiy om ob GRY) cs gas gl ig Ball pS Nisa kkk 81 ( Acta aac Aka) ough yy pd Sp Dbiaig dalad ose paul 9 Cala) bb te Lyall, Uplll Gy Aa yal + Aid poall [geld Loy Gye Lady gry id ods slay ciy ¥ wo fla) Cpe LU cop lua gd cl» Alpe Bd 4) .. ol Gayl cilgad oASs Ayan! odge ct GAY! 268i al pemll ah dl we lle ale fe cy ele putes Quail Jay pp all cs (ge j A lg Sag y Apel) spans gli I gilt SYS a Ugale .. Golda poe gay Adal! ct Aaa gll yes ced pany F sient nade 5 atlas gta ral agua gl ileal oe AB yg! olgs Gal Geka. ygas le Ades gl fA ALE Soe gh uk Seb kad ca ad YAS! Sealed 8 ullh » — POLO G1. cigasadl cy cigs yu oo «lila... Baily (P.CR) ¢ thn 80 5 Aue col eaey Cpa Linnea Cag 4! Vad Vases ol. Galles gy Abell » 2 panama Oe HESS og os plus cailty Lia 1 Ul cilaad oda yo al Ul quay « CHa gana ygill dia aby Glad of gy Coy Ba (gk calls. act gf Yih GS «ay YU ac Ytlnad Ga Ligh cea Sly cpiekinaall (of cipal y Slyall stay a al coll Lal) ald gl Leste: ( alls og) 5 jail Bashy pall ad Gayl igh GV ALIS Sans lg udy « bl - Al glad Lac dil dodgy ga ai gl «gel La gente AS (paaatin Gil Gus joy Le Gla Ging t Ugg wildy « $ Aiaje Gaal yl Ga da» = + Aas cats SHS y sped Sie pall ead cl LS) yal ad. yn A «ig 83 ( Acets ac) Aa). Qual A nee Ohl (PCR) ot a totalled) as geil) gail Gopal od ac gh Sb alla cals. Lead olf call ra hee aS pl AT Fahmi» ad aWe a4 SAT eR + KRY way pai gl GUA he Aglcis pe Lig all ote i ” Agultiie ADI Cig pall G96 gi GGA La Cagle .. AAA dia 4 em cpl gt Nae 8 ADEN iy pall cde Ja Cas le Uy Aga. Gay yalll Lgl 5 pha EA ND Jia « Ada) ciiy al v plabin| lg ag palley Mai pitted calamalall oS: asl tsb lal gab hae iad taal BS (All alae) Akaka)... cual Aa pee cil) LSioal Gets gb AaB pal. uate Go le gal ome He Cogs Galil Lexie 1941 ale jueuya 7 dia = HM Floss coll clay Ciel Lied cad. ey JS yt ll ve UB gly (gle Cig apd}. scl) youl kkk Bye has ( cal) Hyd culiy dase Bd pak ply) sue Uy deb yl ( tig) ve libel inte cg dalee .. igh Vis cake Ming « 5 fll Lage ood cals ( only, ) BM (Al cleat dilay GAS .. (hide) GLA cyatigal AYR gh feels .. AS pal LE tgs Cnt OOS Sa cst Mats ASIN Koay ip OS (P.C.R ) 5 ol 84 ee 2 AMIS Jl) gee By 6 LAD ob uss pil al & pe cM gg pal bylh Yl. Yl» — ooh Ley) All pase plSll agediall byl cole aopanll slaiy Ae id ai Gh dusts 8) « al Gye cle Ube ald iol ass Coil pi Aa ae ime pint At sl ot Seuglll oe BUS eRy pe a. plead) @ yall -. + AY! oa oe CE all Gaels allel Agi (ya Je Ligh ge Lijec ltl oY Gail pple ol gid clay we elif 5 Dy Gea Gaal 9 B7 (Meet alte) Ahad)... apa ae by cb ah Ags ( sile) lS gf GS! « I pis dial ay pdte « .. Afiis 4 yy EN) (ple. Last) ode Updo! 8 coal dal yy Sluis al pide gS Gl Sea) ca gee Uy Vhs Leal Ala ple .. Mile < Sandal GUY gly clpLodd 4544 See jis aay o- Aya shall cha is gags (pile dia (fb lay tis St pS) dy all Adel Ql hay OV oe gh es gh Al cg illy Ay al Oe lly oe. Yitaal ge aly we .. WLS ue uals yb Aagh pace ye And) we. olay pte oo Auch) pe 8 i Toye Hs ply Nang .. Aga pA) Blan Ay pt ay VAR SANG SA GV gh cya glad lay) aay Ly ged lap (PCR) gti 86 aches Lg cl daily Age Yt iy By Shad UB ls ++ DUS Gli (od Alga oof Lada « by yes alles cal) eed. fay 8 Goal) Quad calls uy gll ale Laie pA 48 daoe coll all ple pbs Alolcall GbUbaD ye cual LB es sete oe Lill pee and ob alli. Ly gl 5 tls « Nigh Lagadany Ge GLaiy gh Lag « +. Sag Fl Gig + iba ty Gali yl cuis Jase ly og paal day) ge doal de dy ai dl gl » — «ve Geucalll col cogasi Ol ple ould ail + Oy lbh aly yl cats die Gy [5 cud! atl gl. pdle gle Gull ya > — acell soy Ul. Ciyine Al iti igus Sigel aaliny 89 (Acelst ahscY) Ababa)... cast dy pare Silly ++ ped ce eg cull gay gay Gye ( ple) ols tay lll cave ho abe Ops jal dau. gH) aay «f flall Wis» — SS pple Abd aud pind oi ( hie) aie ded €.9) ; - ( dstjsa) CaS gage ly si ple GY Anaaltl Agi oda culls bday gg c GB bay gl AG sie AB Gye psind of clad Mullis ML 13 ly yi eae > — « } etfs Vile Lasic'g .. leh p98 JS tudy oy ld glag jl gla ee eee hh Miya) Mah of Ugh 20 ipo cyl Li dng 3 cial (P.C.R ) sd 88 CH eal) coh Css all) Maly pl pg Bh boing al Sth ga 2 Ad Jofh Jaaall ob lea j Julds .. 3 pall « ding} dle Lis » — 2 sly hy Ap pe ple hd ys «dy bol dla lag» — gta (ya lagi ab. cof al peu cl palduall [agi Isa 2 ode calid pilus call cas ties pla Gyaill pity Lauic .. sail dual) ely jl > — GLEN) wal gl. Saclill pa ode .. cil dloj eal ol Lt gf Ate gf ated... indy Giipull pattl (le «Mi + BS dais gi oy A on Lag elbacaltl amy cea « ALU AS 8 eLeall cucl 91 (AcetSD ose 9) Abide)... Qual 4 pee Gy) ++ Alpha!) ule cl sb ge Aagh alata al La Sonsy el pll Aaa aday .. Fyls Ay yl gle ily yls ve Quad Gig gh Ya) Sub pags pants Bi pall. aie Yea ob Sl yal alli Ja +» AGL, Ayla gall oe BH poly Blas ya) GIS gl aii y Gand) cabs ey Lad Looloo www. dvddorab.com (P.C.R ) sine 90 Ogi Y Gull) pV ge .. 98 dallas ding) Jay dab ol o- Gadly gh LS 5g Ay oe Gu 9 ciple aSaie fed JS > — we ype g GiB gl) aN 9d Lagi GLE 4p 98 dead of you A Sg Gheall Yyub cto Y eauaill Gye Aisee dejo dllia ce Gala Lagast Nae Tae Glas LIS. Gla gj dyla Lega +o JADU Labas) ja Yo. paell (ile ce atlas Ud ( pits) bay (ll 5 all 2 ode calls ssa. pall Gs all ye Ge Aine puch y Add gis coh ee) spell (ole 2) site| g Sola (ple GE! gs .. Bald cme Ou of isl ola ety Gf any Sead ad cab os Aagall cyla gl Gili phe ce SEY (ple Angi ppd Na 93 (Ack tae) Ae)... cual pee cy © gated) Gane jal sae gl el jal gf Cea coal ) wag peal) Ghd Lingual Cubs Ba. Cullis Cubs jae Cae + lll $day fall asad gall odge aigy libel ..f 108 (pine Le «Vag cle Lag Giaby pa eid Aglare Gye Lak co gta Y aT BJS ge lle oe pinged Gn ply + cgiSy Lay Shaal 3 jigie Abdel Lady AALS cy pSig Hui als ct SBE) Ge Ces ob ati al oly Al canes Lisa Sadly Ne cuts hy. HG pie aay. 5 SY) 5 sill ver ugha lbs (8 ve Laie ay SH Bade gk Les abi Lay pH ode cl gt AHN cd ices Lye list ol gy fii Lasie SLidll le Choa} cole cpadally ab Vda BLE ibs) yt sia y Aili pail Ann gj clan gl teal pS GIS Ad] Le SU. 5 pts : sSian AS phy « ( Lab ) ~(ua) (P.CR) ¢ du 92 a7 = ppc ppb Alario chilly Yash yaldll sguatll jl gad ch ab ca Ugh ey ally... lia GIS Apentipll gy Leal «Le aged MNS Gad gl Yt pbk a alle On oe gtd g gine gh dpa gall alias .. Ga rlgill ya Gal) Fe i ae um fall dees Qi ll Gyo ALLS Adal ollia SY Aah hag SE Asking oaks 6 Con gh atny pc Ay jalan) out Lala Bla gf -- Giyya AG cos gSall aul Jay ol] Gad ol pment Gf Leg yal « dla JS ile bey Aide Gash pil alsa all Gil ys Boe ad Gaal. G gl Wo ant Lead ve GletY Va Qe dia) Ga) Asus cls Lyi le Cys Gy sual Cat g YS « 3S cud alia cals Ce one (cob oh gg Bal) gi ( cpl Gj ah Alls ) Sag ti plage pigs Ugo) OV UY 8) sh cl Saal woe VLA Qe Ace Sg 95 ( Acoli alc) Abas)... Gua dy wee Gly Pym Cea gh aed al yh. Ie ip St. hal Uy — 4 PAy yaaa) clea Lal yall lb dasa! Jay Sladia! tia .. dna yySlur pa Mi ple Yo — os oy cod Yl al al Jal. acini Nae Cie «ft aS ac. a » erase Acad) aang 8 gis Ais) © Cope pall ASUS ls tl a (ob alls lat) a gall say + OLY Gaby ly adi .. SUDAN poll Jal Gat Gg) .. Glee deutill CoS a pl pla alin mah! (ple. Aadige gallic vee 9 o> opm alas oat cos Goll pal 5a : y lealo. Ais jill. Dygegad . Syladll 55 ye ooloo weww dvddorabcom $ CwglS ge Ja tf Nae Le (PGR) ste 94 Fa peal) odd y Soy juall ciple Qe pha Alay Iba ee AB ay Nhe cS heal) cued le Guay Agi © ou padeally Cub) Balls Saal yey clall aay Gigi! Clea yg gg) apeaally ileal! (lg) Ge (gb Abad dlay $ Aiaall y Amdt CABS y 2 2001 asia Ge pela gh Van gis JES pple Vda clic! yay. all Le Avigll @ lb Yad Lah pd aly La) iallde YS ayy dual GIS dle 2 Aga call Le gl (pte «at pi al Ja» o «.. Wa ge Jud Gis gla Gj» — > Guy oe Uk gS at ceil. 8) Lag Deel chy Gigs > «.. Maly Bo = ey Gaal) ola. Vala .. 8S Gals big ues dee z Gib pb cig) 97 ( Anal ata) Ade) oa pee OL 2 ih pb. dud y je Ot ll (oS of AY GIS. Lat od LG Kyl » — «sledge 1 Ades blo Bi «? Goa ly ee cl ol > oe OLS Sd. pA eY on Cig hee cuds oe Gyles Glie is gf tt gf La yd (oe Sod. Ayla Stal a gil AE ll Jay sg ad +» AULA (3 55 lass sR ne Cagall ae Col A) Aa) Gay cy yy Sli Ups lai ol. pray Aya gusall Sy sll Ache cya apalinn 8h oh alley « Ae pall ogy Lia yy Nghe (a a LI ge we aa Slay al Ss yl soe te (PCR) si 96 vex Goal) anit Ag § yt - ihe gi at od edly cp pla le Quand. wig 8 cial ay i fl cob nal xan) 2G 5 yh .. gill . AALAN le papi JY vee Uggs Apa! Ugh pd calabes aly cisall € wus gpa eee flan dal Ge kek 5 Ula, pha platy Alec oS gil Lae 3 ually Jit Gls eat LG yl. cae] cl Abell JS GY « bagel gibi Ld on tage Alla gb yal. ase Chay Upiceald ty Aye coy Casi) = Kgl pte ls ae gguweal sigly GAY Ge Sg «tén bal; den — 99 ( Asak whac Ys Abad) 2. Qual Ty wae Glbl gy «t drlew on gia) apa Gill ig ty yo 2 «oe Ge des y — vos aed cob Dall Aus JUSS) atts (ge jail Lal yale g ke Ss ty FBI gj Sys) Gh pd) Gass Jay yt Ja + figssaSll jlge 6b Gadel Go sill «Uysal Abe . dati bg Cavaly SUB pl Rds ph Coal Al) Catal) aud altiy Seay ssl Yaga cil ai NY. yas od dls y Ay yall) pedi!) lal jlge ole olgs 5 bd Clie «oe LAGS Lea ge Laud Ugule (alles + By 5 gg) Gyo ABS) city duly te ai «? dag} gl» PASH ERG al. A dal gi ty S werw.dvd4orab.com. We Edu (P.C.R) ge 98 coastal ab cpt all gh pall pple Guz I gil Ge ve Cumall Spal 5 all | gold Guill aby « Aulaall citat) ANS ple psa. call (ols) Giguall (pt La .. Abbas hme ANS g) ce ply il) Gilg yall 08 ci bball ells odiy cy pail Ja cnet als 8 Ugg) Gabe cad. (ctl © Gljalall (te Adly clad Gi anf Nba Gis .. « ty gt YS al atl Jal » ve gS cial ab ll Ide Sy Gysill Bal) «ag el holo uw ges a « pens dee tld » wf Gudaly we LH gh aa Ugdl) ads. Jed ada cls cps Bal Alt | A GIS. Upe d cal Ly pal » «as lodge Cee GLE) (at gf) a GIS. Ye fd Cubs Kyl » aoe ble Age vo Calbld Updis (ple 04 autrgy agill ALS cs ale LOL (Asahi shoe) Aas)... Gull dae cy Cj iia Gf cing. hig! deadie dG dbl ge cal» — soe LD Aly Sad Ay hl 05 cian Lay a Ji Y cing oe DD al Gl wt oye be . Aes digas SI ype oi, LELa oy planes J gaatlly Gandy Leo jin ob Yue lgang CAS. alg) SoS pny as oh 8 Nay US. Sy G Al 2 BN cally gy da Ul | SS Lap aly os peta cel. ( Cual aaah als) » 7 dat US dongs of sited .. sal) gi alae UY Lin Upslily v- Audley call al yl acy a. Yis elysly DU) wo TiS Na JSS. Upad de je gle LAY ay os al quay «oe Mall ALY) ob da leas of cs gis gS Al site| ole igvaaal (P.C.R) pti “100 on Cian gh Gig aa a) CLs. Aly Ag Gig > = 5 a8 gly « had ji ay Gaby Ball Al i Lod. pty AS. aad 1g) gett aa gf at al = LG cya Gaal gy Glaus GIS Adi sited .. ytd Ail Gye Suslin «oe ASN att ab cl sual) Ke Ge Gets Ly pay Lage of Ua pely SUG Gully pl Jyldy Ady yy AS pl aad .. alls Goo sill Latlac .. glell ble wn Agy Lat og yall b yates Cly pi Mba Lang Up cal. Bl pty ily pany Sem Ra. ga Saal clase Ge La ya Lyte Ugan dabi aa pol Sanaa GLY gD GIS ppt Gata il wo Gi gpel Be Up JG ob Aa pla ited Chass DUS! coe Ae gaps Ale SLGHI cle: Gyficlen ay Agi ye dah say cial (Al al gaysy .. pally Jo! ceciy « ARLEN i ch As Ugald Guay (ill Asai 44) = id Alga

You might also like