Gene Reports 29 (2022) 101695

Contents lists available at ScienceDirect

Gene Reports
journal homepage: www.elsevier.com/locate/genrep

Investigation of mobile colistin resistance (mcr) genes among carbapenem

resistance Pseudomonas aeruginosa isolates from bovine mastitis in
Mashhad, Iran
Abolfazl Rafati Zomorodi a, b, Niloufar Mohseni c, Maryam Hafiz c, Helia Nikoueian c,
GholamReza Hashemitabar c, Himen Salimizand d, e, Fatemeh Aflakian c, *
a
Department of Bacteriology and Virology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
b
Student Research Committee, Shiraz University of Medical Sciences, Shiraz, Iran
c
Department of Pathobiology, School of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran
d
Vaccine and Infectious Disease Organization Saskatoon, SK, Canada
e
Department of Vaccinology and Immunotherapeutics, School of Public Health, University of Saskatchewan, Saskatoon, SK, Canada

A R T I C L E I N F O A B S T R A C T

Edited by Jormay Lim Background: The most severe pathology affecting the dairy industry is bovine mastitis (BVM). Pseudomonas
aeruginosa is widely associated with several infections, including the BVM. The current study aimed to investigate
Keywords: the incidence of carbapenemase and mobile-colistin resistance (mcr) genes among resistant P. aeruginosa isolates
Antimicrobial susceptibility from Mashhad, northeast Iran.
Bovine mastitis
Methods: The current study was conducted on archived P. aeruginosa isolates from mastitis. The antimicrobial
Carbapenem
susceptibility testing was performed; the carbapenem resistance isolates were subsequently sought to demon­
Colistin
Multi-drug resistance strate the carbapenemase-producing isolates using the modified-carbapenem inactivation method. In addition,
the colistin broth disc elution method was carried out to determine the frequency of resistance against colistin.
Finally, resistance isolates were further tested for detecting related carbapenemase and mobile-colistin resistance
(mcr) genes, including blaNDM, blaOXA-48, blaVIM, blaKPC, blaIMP, and mcr1-5, using the polymerase chain
reaction procedure (PCR).
Results: Among carbapenem-tested antibiotics, meropenem has revealed the least activity (8 %); on the other
hand, aztreonam, gentamycin, and tobramycin were 100 % effective. Two isolates (4 %) have shown colistin
resistance (with MIC ≥4 μg/mL). The PCR analysis has displayed the high frequency of blaVIM among (43/43)
meropenem resistance isolates. Also, the presence of mcr-2 was detected for two colistin resistance isolates.
Conclusion: The substantial resistance to carbapenems and emerging colistin resistance in veterinary have been
observed. Thus, the following antimicrobial stewardship in farm animals reduces the increasing multi-drug
resistance of P. aeruginosa isolates.

1. Introduction
In the dairy industry, bovine mastitis (BVM) is indicated as a sig­
nificant concerning result of economic loss worldwide (Krishnamoorthy
et al., 2021). Bacterial infections are introduced as the main reason for
BVM; subsequently, antibiotic therapy has been propounded as the first
line of combat in mastitis cases because antibiotic residue in milk will
develop diminishing antibiotic resistance to the environment (Ashraf
and Imran, 2018; Ajose et al., 2022). Indeed, waste or discarded milk is
created whenever dairy cows are given medication with a withdrawal
period (when the milk cannot be delivered to commercial dairy for
human consumption). Sometimes, this used milk is dumped into drains
or waterways (Firth et al., 2021). Various bacterial species have been
reported as the causative factor for BVM. Generally, causative bacteria
in mastitis are subdivided into two forms based on the origin of conta­
gious and environmental forms that are epidemiologically distinguished

Abbreviations: mcr, Mobile Colistin Resistance; BVM, Bovine Mastitis; mCIM, Modified Carbapenem Inactivation Method; CBED, Colistin Broth Disc Elution
Method; CBED-EDTA, Colistin Broth Disc Elution Method - Ethylenediamine Tetraacetic Acid.
* Corresponding author.
E-mail address: fatemeh_aflakian@yahoo.com (F. Aflakian).

https://doi.org/10.1016/j.genrep.2022.101695
Received 8 August 2022; Received in revised form 24 September 2022; Accepted 3 October 2022
Available online 13 October 2022
2452-0144/© 2022 Published by Elsevier Inc.
A.R. Zomorodi et al.
(Cheng and Han, 2020). Staphylococcus aureus, Streptococcus agalactiae,
and Mycoplasma spp. have been identified as common bacteria causing
contagious form; that can be transferred cow-to-cow chiefly during
milking (Sharun et al., 2021). Also, Escherichia coli, Streptococcus uberis,
and Pseudomonas spp. are highlighted as bacterial isolated for environ­
mental types; despite the contiguous type, environmental bacteria are
not found in teat skin and cows' udder (Cheng and Han, 2020).
Pseudomonas spp. are prevalent environmental pathogens in humid
environments. Poor environmental cleanliness and biofilm development
in the milking parlor may be risk factors for intra-mammary infections
(IMI). Investigations have linked contaminated intramammary anti­
biotic infusions given under unsanitary circumstances to the origin of
mastitis (Schauer et al., 2021). Among Pseudomonas spp., P. aeruginosa is
widely associated with several infections, including the BVM (Park et al.,
2014). Also, P. aeruginosa is listed as a critical priority pathogen by the
World Health Organization due to emerging multi-, extended- and pan-
drug resistance P. aeruginosa isolates (Torres et al., 2022).
Carbapenems and colistin drugs are used as the last resort for treating
infections by MDR gram-negative bacteria, including P. aeruginosa
(Waltenburg et al., 2022; Abavisani et al., 2021). However, emerging
carbapenem and colistin resistance isolates among farm animals are a
significant global concern because they may be a reservoir of related
resistance genes and contribute to their spread (Silva et al., 2022).
The legislation on using carbapenems in farm industries varies
worldwide; the epidemiology of carbapenem resistance has not been
well known yet. In addition, detection and monitoring of the resistance
rate against these agents are vitally essential to prevent treatment failure
and transmission to humans and the environment. Thus, the present
study was performed to aim to assess the prevalence of carbapenemase
and mobile-colistin resistance (mcr) genes among phenotypic resistant
P. aeruginosa isolates from mastitis from Mashhad, northeast Iran.
2. Material and methods
2.1. Sample collection
The current study was conducted on a collection of P. aeruginosa
isolates from mastitis cases kept at the Microbiology laboratory, faculty
of veterinary, Ferdowsi University of Mashhad. These archived isolates
were isolated from raw milk samples of mastitis cows, during
2018–2020, from dairy farms in Mashhad, northeast Iran. Before sam­
pling, the teat ends were cleansed with 4 % chlorhexidine. The initial
few milliliters of milk were discarded, then volumes ranging from 20 to
50 mL of milk were aseptically collected into sterile vials. A total of 167
samples were instantly transferred to the Microbiology laboratory, vet­
erinary faculty, Ferdowsi University of Mashhad.
2.2. Isolation and identification of P. aeruginosa
A total of 50 P. aeruginosa isolates from mastitis cases were subjected
to the current study. For isolation, first, 10 mL of each sample was added
to 90 mL Tryptone Soya Broth (Merk, Germany), and overnight incu­
bation was performed at 37 ◦ C. Then, 10 μL of suspension were cultured
onto nutrient agar and cetrimide agar (Merck, Germany) as a basic and
selective medium, respectively; the second incubation was done for 24 h
at 37 ◦ C. Eventually, the presumptive colonies were tested using gram-
staining and biochemical examination followed by: Catalase/Oxidase,
Indole, Methyl Red, Voges Proskauer, Simon Citrate utilization, and
Triple Sugar Iron (TSI); as recommended by Swetha et al. (2017).
2.3. DNA extraction
The DNA of all tested isolates was extracted using the boiling method
described in the prior study (Ernst et al., 2019) and resuspended 5–7
pure overnight colonies into 500 μL of ultrapure sterile water in a 1.5 mL
microtube. Then, the microtubes containing homogenized suspension
2
Gene Reports 29 (2022) 101695
were placed into the water bath at 95 ◦ C for 10 min. After the heating
step, the microtubes were immediately transferred onto the ice box
immediately for 5 min. In the end, the microtubes were centrifuged for 5
min at 8000 rpm; 100 μL of supernatant was removed carefully. The
purity of extracted DNA was measured using the A260/A280 and A230/
280 ratios detected by photometric measurements (Nanodrop 2000
UV–Vis spectrophotometer, Thermo Scientific, USA).
2.4. Molecular confirmation of P. aeruginosa
The P. aeruginosa isolates were further confirmed by amplifying the
16 s rRNA gene using the polymerase chain reaction (PCR) method.
Using primer for this purpose were Forward: 5′ -GGGGGATCTTCG­
GACCTCA-3′ and Reverse: 5′ - TCCTTAGAGTGCCCACCCG-3′ , which
have been designed with the previous study. The PCR condition consists
of initial denaturation for 2 min at 95 ◦ C, following the 25 cycles
comprising each of 20 s at 94 ◦ C, 20 s at the annealing temperature of
58 ◦ C, and 40 s extension at 72 ◦ C. A final extension of 1 min at 72 ◦ C was
carried out (Spilker et al., 2004).
2.5. Antimicrobial susceptibility testing
Regarding the (CLSI 2021), the Kirby-Bauer method was performed
to determine the antimicrobial susceptibility pattern of all isolates
against nine antibiotics (CLSI, 2021). The list of nine tested antibiotics is
as follows: ceftazidime (30 μg), cefepime (30 μg), piperacillin (100 μg),
meropenem (10 μg), imipenem (10 μg), aztreonam (30 μg), ciprofloxa­
cin (5 μg), tobramycin (10 μg), and gentamycin (10 μg) (Mast Group,
UK). Briefly, the suspension of fresh overnight bacteria was prepared in
equal turbidity with 0.5 McFarland Standards; subsequently, inoculated
using a sterile swab onto the Muller-Hinton agar plates. The antibiotics
disc were placed onto the surface of cultured plates at a 24 mm distance
from each other and incubated at 35 ± 2 ◦ C for 18–24 h. The
P. aeruginosa ATCC 27853 and Escherichia coli ATCC25922 strains were
applied as quality control.
2.6. Phenotypic confirmation of carbapenemase-producing
The resistant isolates to either imipenem or meropenem were
selected for confirmation as a carbapenemase-producing using the
modified carbapenem inactivation method (mCIM), as explained pre­
viously (Tsai et al., 2020). A 1 μL loopful of fresh bacteria was inoculated
into the tube containing a 2 mL tryptic soy broth (TSB) medium. Then a
meropenem disc was added to the tube, and incubation was done at
35 ◦ C for 4 h ± 15 min. The discs were replaced from tubes onto the
center of Mueller-Hinton agar plates freshly plated with carbapenem-
susceptible E. coli ATCC25922 strain at 0.5 MacFarland suspension. In
the end, the plates were incubated at 35 ◦ C for 16–20 h. The interpre­
tation of the results was made as follows: negative, ≥19 mm; positive, 6
to 15 mm; or intermediate (defined as positive) if pinpoint colonies are
observed within a 16- to 18-mm zone (Fig. 1). In addition, Klebsiella
pneumoniae ATCC BAA-1705 and ATCC BAA-1706 strains were consid­
ered as positive and negative controls, respectively.
2.7. Colistin susceptibility and phenotypic confirmation of mcr genes
The colistin broth disc elution method (CBDE) was used as recom­
mended by CLSI (2021) to demonstrate the colistin-resistant isolates;
The colistin-resistant isolates (with MIC ≥4 μg/mL) were further tested
using the CBDE-EDTA method as a phenotypic method to identify the
mcr gene (Fig. 2). Indeed, the mcr metalloenzyme-mediated resistance is
inhibited through EDTA and exhibits MIC reduction (Fenwick et al.,
2020).
A.R. Zomorodi et al. Gene Reports 29 (2022) 101695

A) Bacterial Suspension

MRP

35 C◦ ± 2
4 hr ± 15 min

+
Incubator

em
en
op
er
MRP

M
(TSB=2ml)

1. Add 10 μl of bacterial fresh culture 2. Vortex the suspension 3. Add Meropenem (10 μg) disc 4. Incubate the bacterial suspension
to the tube to the tube containing MRP disc

C) Zone of inhibition
B) 4. Place the incubated MRP disc mm
in the center of the plate
6. (Incubation) MRP
Carbapenemase producing

Positive Intermediate Negative

MRP
MRP
6-15 mm 16-18 mm ≥ 19 mm
MRP

5. Prepare a culture of 35 C ◦± 2
E. coli ATCC25922 16-20 hr
(Muller Hinton Agar)

Fig. 1. The modified carbapenem inactivation methods (mCIM). Parts of the figure were drawn by using pictures from Servier Medical Art. Servier Medical Art by
Servier is licensed under a Creative Commons Attribution 3.0 Unported License (https://creativecommons.org/licenses/by/3.0/).

3.Shake the tubes to elute the Colistin

1. Lable set 1 tubes (without EDTA), then 2. Add Colistin discs from discs, then put tubes at room 4. Prepare a bacterial suspension(0.5 MacFarland)
add 10 ml Muller Hinton Broth to them to each tube temperature for 30 mins then add to the tubes, incubate for 16-20 hr.

A) CBDE 50 µl
istin

1 2 0 1 3 0 30 mins
3 2
CS
Col
Negative Control

Negative Control

±2
Vortex

10 ml (MHB)
Incubation

B) EDTA-CBDE
1. Lable set 2 tubes (with EDTA), then add 10 µl 2. Prepare a solution of EDTA with 4. Let the tubes sit in room
3. Add Colistin discs to the tubes
Muller Hinton Broth. (*Tube 1= 25 µl) concentartion of (0.5 M), then add to the tubes temperature for elution of
12 1
discs ( 30 mins )

45 µl 20 µl 20 µl 20 µl 20 µl 12 1
Negative Control

in

1 2 1 2 3 4 0
list

Negative Control

3 4 0
Negative Control

1 2
Co

24 hr 3 4 0 Vortex
10 µg

25 ml 10 ml 10 ml 10 ml 10 ml 0.4 µg 1 µg 2 µg 4 µg
EDTA
(0.5 M)
5. Prepare a bacterial suspension of
Colistin-resistant isolates (0.5 MacFarland)

Bacterial suspension 125 µl 50 µl 50 µl 50 µl 50 µl

1 2 3 4 0 ±2

Incubation

Fig. 2. A) The CBDE to demonstrate the colistin-resistant isolates. B) The CBDE-EDTA method as a phenotypic method to identify the mcr gene regarding MIC
reduction through the mcr metalloenzyme-mediated resistance is inhibited through EDTA. Parts of the figure were drawn by using pictures from Servier Medical Art.
Servier Medical Art by Servier is licensed under a Creative Commons Attribution 3.0 Unported License (https://creativecommons.org/licenses/by/3.0/).

3
A.R. Zomorodi et al. Gene Reports 29 (2022) 101695

2.8. Molecular detection of carbapenem and colistin-related resistant Table 2

genes The antimicrobial susceptibility pattern of P. aeruginosa isolates from bovine
mastitis (n = 50).
The frequency of five carbapenem-resistant genes (blaNDM, blaOXA- Class of antibiotics Type of Sensitive Intermediate Resistance
48, blaVIM, blaKPC, blaIMP) and five mediated-colistin resistant genes antibiotics
(mcr1–5) was sought among carbapenemase-producing and colistin- Cephalosporin Ceftazidime 49 – 1
resistant P. aeruginosa isolates, respectively. The PCR amplification Cephalosporin Cefepime 49 1 –
was set up as a monoplex PCR procedure at the final 25 μL reaction, β-Lactams Piperacillin 50 – –
Carbapenem Meropenem 4 6 40
consisting of 12.5 μL of PCR 2× Master Mix (Amplicon, Denmark)
Carbapenem Imipenem 45 3 2
containing Taq DNA Polymerase, reaction buffer, dNTPs mixture, a Monobactam Aztreonam 50 – –
protein stabilizer, and the convenience for use was optimized by adding Fluoroquinolones Ciprofloxacin 50 – –
sediment for electrophoresis, and 2× solution of loading dye, 1 μL of Aminoglycoside Tobramycin 50 – –
each primer (2 μM), 2 μL of template DNA and up to 25 μL final volume Aminoglycoside Gentamycin 50 – –
Polymyxin Colistin 47 1 2
added nuclease-free water. The PCR condition for carbapenemase genes
started with initial denaturation at 95 ◦ C for 10 min and 36 cycles,
including 30 s at 94 ◦ C, 40 s at 52 ◦ C, and 50 s at 72 ◦ C, with a final (≤2 μg/mL); continuously, one colistin-resistance isolate was positive
extension at 72 ◦ C for 5 min. Also, amplification of mcr genes were upon the CBDE-EDTA test.
carried out with the following thermal cycling conditions: the first
denaturation at 94 ◦ C for 15 min, followed by 25 cycles comprising of
denaturation at 94 ◦ C for 30 s, annealing at 58 ◦ C for 90 s, and extension 3.2. Molecular detection of antimicrobial resistance genes
at 72 ◦ C for 60 s, and a final cycle of extension at 72 ◦ C for 10 min.
The Sequence of oligonucleotides used as primers in the PCR re­ All 43 carbapenemase-producing isolates were sought for harboring
actions is listed in Table 1. the carbapenemase genes. The highest frequency was detected for the
blaVIM (100 %) gene; also, six isolates harbored the blaKPC gene
(Table 3). However, three other tested carbapenemase-related genes
2.9. Nucleotide sequencing were not demonstrated, including blaNDM, blaIMP, and blaOXA-48. The
presence of the mcr-2 gene was determined among one colistin-
The purified positive reaction PCR product was sent to the Macrogen resistance isolate. Co-existing of carbapenemase genes has been recog­
Company (Seoul, South Korea) for sequencing target genes. The online nized for the blaVIM and blaKPC among six out of 43 isolates, one of
BLAST program of the National Center for Biotechnology Information them co-harbored the mcr-2 gene (Fig. 3).
(http://blast.ncbi.nlm.nih.gov/Blast.) was done for sequence alignment.
4. Discussion
3. Results
The spread of carbapenemase and colistin-resistant Gram-negative
3.1. Antimicrobial susceptibility testing bacteria in animals used for food production recently raised concerns
about the actual effectiveness of antibiotic administration in treating,
Among carbapenem-tested antibiotics, all isolates were susceptible preventing, and promoting growth in animals (Dandachi et al., 2019; Al-
to aztreonam (100 %). Also, the least susceptibility was determined for Tawfiq et al., 2017).
meropenem, four out of 50 isolates (8 %) (Table 2). The mCIM test for 46 The highlighted resistance to meropenem (80 %) was determined,
comprising 40 resistance and six intermediate isolates against mer­ while the frequency of resistance to imipenem was (4 %) among tested
openem showed 43 carbapenemase-producing isolates. carbapenem antibiotics; however, aztreonam has revealed the highest
According to the CBDE test, two out of 50 isolates were colistin- activity (100 %) as monobactam antibiotics. The highest meropenem
resistance (≥4 μg/mL); also, one isolate was identified as intermediate resistance might be related to the overusing of these antibiotics in farms

Table 1
The oligonucleotide sequences were used as primers for PCR amplification.
Primer name Sequence 5′ -3′ Gene name Annealing temperature (◦ C) Product size (bp) References

IMP-F GGAATAGAGTGGCTTAAYTCTC blaIMP 232

IMP-R GGTTTAAYAAAACAACCACC
VIM-F GATGGTGTTTGGTCGCATA blaVIM 390 (Poirel et al., 2011)
VIM-R CGAATGCGCAGCACCAG
NDM-F GGTTTGGCGATCTGGTTTTC blaNDM 52 621
NDM-R CGGAATGGCTCATCACGATC
KPC-F CGTCTAGTTCTGCTGTCTTG blaKPC 798
KPC-R CTTGTCATCCTTGTTAGGCG
OXA-48-F GCGTGGTTAAGGATGAACAC blaOXA-48 438
OXA-48-R CATCAAGTTCAACCCAACCG
mcr1-F AGTCCGTTTGTTCTTGTGGC mcr-1 320
mcr1-R AGATCCTTGGTCTCGGCTTG
mcr2-F CAAGTGTGTTGGTCGCAGTT mcr-2 715
mcr2-R TCTAGCCCGACAAGCATACC
mcr3-F AAATAAAAATTGTTCCGCTTATG mcr-3 58 929 (Rebelo et al., 2018)
mcr3-R AATGGAGATCCCCGTTTTT
mcr4-F TCACTTTCATCACTGCGTTG mcr-4 1116
mcr4-R TTGGTCCATGACTACCAATG
mcr5-F ATGCGGTTGTCTGCATTTATC mcr-5 1644
mcr5-R TCATTGTGGTTGTCCTTTTCTG
16S rRNA-F GGGGGATCTTCGGACCTCA 16S rRNA 58 965 (Spilker et al., 2004)
16S rRNA-R TCCTTAGAGTGCCCACCCG

4
A.R. Zomorodi et al. Gene Reports 29 (2022) 101695

Table 3
The molecular detection of antimicrobial resistance genes among P. aeruginosa isolates from bovine mastitis (n = 50).
No. of isolates Carbapenemase genes Mobile colistin resistance (Mcr)

blaNDM blaOXA-48 blaIMP blaVIM blaKPC Mcr-1 Mcr-2 Mcr-3 Mcr-4 Mcr-5

Positive – – – 50 6 – 3 – – –
Negative 50 50 50 – 44 50 47 50 50 50

A B

C D

Fig. 3. The PCR amplified products were displayed using agarose gel electrophoresis (1.5 % agarose). A) Lane M: DNA marker (100 bp DNA Ladder); Lane NC:
negative control; Lanes 1–12: Detection of 16S rRNA gene for confirmation of P. aeruginosa isolates. B) Lane M: DNA marker (100 bp DNA Ladder); Lane PC: positive
control; Lane NC: negative control; Lanes 1–7: detection of blaVIM gene in carbapenem resistance P. aeruginosa isolates. C) Lane M: DNA marker (100 bp DNA
Ladder); Lane PC: positive control; Lane NC: negative control; Lanes 31, 32 & 34: Detection of blaKPC gene in carbapenem resistance P. aeruginosa isolates. D) Lane M:
DNA marker (100 bp DNA Ladder); Lane PC: positive control; Lane NC: negative control; Lane 34: Detection of mcr-2 gene in colistin resistance P. aeruginosa isolate.

in this region or the link between humans and animals as a One Health
issue. Even though prior studies reported the rate of imipenem and
meropenem resistant P. aeruginosa isolates from BVM lower than the
present survey (0–1 %) (Ohnishi et al., 2011; Gharieb et al., 2022).
However, Park et al. (2014) from Korea have released remarkably
resistance to aztreonam (86.9 %) for P. aeruginosa isolates from BVM
(Park et al., 2014). These differences may be connected to the Animal
Medicinal Drug Use Clarification Act of 1994 in the United States and
similar laws in other countries, where carbapenems are not allowed for
animal use in veterinary medicine (Mutua et al., 2020). In addition,
differences in the sample size or diversity of investigated serotypes can
influence the results.
Colistin has been used for decades to treat pig, poultry, cattle, sheep,
goats, and rabbit infections orally, in aquaculture, and topically for
bovine mastitis (Catry et al., 2015). Colistin resistance is unlikely to be
clinically significant in bovine mastitis because this medicine (or other
polymyxins) is rarely used to treat the disease (Filioussis et al., 2020).
However, two P. aeruginosa isolates were colistin-resistant to the study
population. Although few investigations have sought the colistin resis­
tance rate among P. aeruginosa isolated from livestock, Tator et al. have
published colistin resistance P. aeruginosa isolates (8/10) from BVM
(Tartor et al., 2021). Late in 2015, bacterial strains from animals,
humans, and the environment were reported to carry the plasmid-borne
mcr-1 gene, which codes for phosphoethanolamine transferase, resulting
in polymyxin resistance (Caniaux et al., 2017). One mcr-2 positive
isolate distinguished in the current study was correlated with earlier
surveys that reported mcr positive P. aeruginosa isolates from animals
(Ahmed et al., 2019). Although there are few investigations about the
prevalence of mcr genes among P. aeruginosa isolated from animal
sources, emerging mcr positive P. aeruginosa isolates recovered from
hospitalized human patients are rising worldwide (Pathak et al., 2020;
Zarate et al., 2021; Abd El-Baky et al., 2020). This might relate to the
spreading of mcr among P. aeruginosa isolates from either animal or
environmental sources. However, further study should be performed to
assess the epidemiological relationship. In addition, the significant
prevalence of blaVIM in the present experiment is in line with previous
articles (Alkhudhairy and Al-Shammari, 2020; Aruhomukama et al.,
2019; Costa-Júnior et al., 2021) that indicated this gene as of the most
predominant carbapenemase genes among P. aeruginosa isolates.
Further analyses are suggested to characterize the isolated co-
harboring resistance genes by whole-genome sequencing technique
and evaluation epidemiological investigations to determine the relation
between mcr positive isolates collected from animals, the food industry,
and hospitalized patients.

5
A.R. Zomorodi et al.
5. Conclusion
In conclusion, although aztreonam as a monobactam antibiotic was
effective, there has been substantial resistance to carbapenems and
emerging colistin resistance in veterinary. Thus, the following antimi­
crobial stewardship in farm animals reduces increasing MDR
P. aeruginosa isolates. Additionally, the present results have proposed
using third-generation cephalosporins and aminoglycosides antibiotics
besides aztreonam in emergencies in farm animals.
CRediT authorship contribution statement
A.R. Zomorodi: Design the study, Conceptualization, Writing -
original draft. N. Mohseni, M. Hafiz & H. Nikoueian: Data curation,
Investigation, Methodology, Resources. Gh. Hashemitabar & H. Sali­
mizand: Project administration, Consulting the group. F. Aflakian:
Review & Editing.
Funding
None to declare.
Declaration of competing interest
The authors declare that there is no conflict of interest.
Data availability
Data will be made available on request.
Acknowledgments
The authors thank Mrs. Somayeh Bagherzadeh for her technical
assistance. The authors would also like to thank Ferdowsi University of
Mashhad (FUM) for providing the facilities required to conduct this
study.
References
Abavisani, M., et al., 2021. Evaluation of efflux pumps overexpression and β-lactamase
genes among colistin resistant Pseudomonas aeruginosa. Gene Rep. 24, 101301
https://doi.org/10.1016/j.genrep.2021.101301.
Abd El-Baky, R.M., et al., 2020. Prevalence and some possible mechanisms of colistin
resistance among multidrug-resistant and extensively drug-resistant Pseudomonas
aeruginosa. Infect. Drug Resist. 13, 323. https://doi.org/10.2147/IDR.S238811.
Ahmed, Z.S., et al., 2019. Evidence of colistin resistance genes (mcr-1 and mcr-2) in wild
birds and its public health implication in Egypt. Antimicrobial Resistance &
InfectionControl 8 (1), 1–8. https://doi.org/10.1186/s13756-019-0657-5.
Ajose, D.J., et al., 2022. Combating bovine mastitis in the dairy sector in an era of
antimicrobial resistance: ethnoveterinary medicinal option as a viable alternative
approach. Frontiers in veterinaryScience 287. https://doi.org/10.3389/
fvets.2022.800322.
Alkhudhairy, M., Al-Shammari, M., 2020. Prevalence of metallo-β-lactamase–producing
Pseudomonas aeruginosa isolated from diabetic foot infections in Iraq. New
Microbes New Infect. 35, 100661 https://doi.org/10.1016/j.nmni.2020.100661.
Al-Tawfiq, J.A., Laxminarayan, R., Mendelson, M., 2017. How should we respond to the
emergence of plasmid-mediated colistin resistance in humans and animals? Int. J.
Infect. Dis. 54, 77–84. https://doi.org/10.1016/j.ijid.2016.11.415.
Aruhomukama, D., et al., 2019. blaVIM-and blaOXA-mediated carbapenem resistance
among Acinetobacter baumannii and Pseudomonas aeruginosa isolates from the
Mulago hospital intensive care unit in Kampala, Uganda. BMC Infect. Dis. 19 (1),
1–8. https://doi.org/10.1186/s12879-019-4510-5.
Ashraf, A., Imran, M., 2018. Diagnosis of bovine mastitis: from laboratory to farm. Trop.
Anim. Health Prod. 50 (6), 1193–1202. https://doi.org/10.1007/s11250-018-1629-
0.
Caniaux, I., et al., 2017. MCR: modern colistin resistance. Eur. J. Clin. Microbiol. Infect.
Dis. 36 (3), 415–420. https://doi.org/10.1007/s10096-016-2846-y.
Catry, B., et al., 2015. Use of colistin-containing products within the European Union and
European Economic Area (EU/EEA): development of resistance in animals and
possible impact on human and animal health. Int. J. Antimicrob. Agents 46 (3),
297–306. https://doi.org/10.1016/j.ijantimicag.2015.06.005.
Gene Reports 29 (2022) 101695
Cheng, W.N., Han, S.G., 2020. Bovine mastitis: risk factors, therapeutic strategies, and
alternative treatments-a review. Asian Australas. J. Anim. Sci. 33 (11), 1699–1713.
https://doi.org/10.5713/ajas.20.0156.
CLSI, 2021. Performance standards for antimicrobial susceptibility testing. In: CLSI
Supplement M100, , 31st ed.2021. Clinical and Laboratory Standards Institute.
Costa-Júnior, S.D., et al., 2021. Emergence of rmtD1 gene in clinical isolates of
Pseudomonas aeruginosa carrying blaKPC and/or blaVIM-2 genes in Brazil. Brazilian
Journal of Microbiology 52 (4), 1959–1965. https://doi.org/10.1007/s42770-021-
00576-2.
Dandachi, I., et al., 2019. Understanding the epidemiology of multi-drug resistant gram-
negative bacilli in the Middle East using a one health approach. Frontiers in
microbiology 10, 1941. https://doi.org/10.3389/fmicb.2019.01941.
Ernst, C., et al., 2019. Improved DNA extraction and purification with magnetic
nanoparticles for the detection of methicillin-resistant Staphylococcus aureus. Vet.
Microbiol. 230, 45–48. https://doi.org/10.1016/j.vetmic.2019.01.009.
Fenwick, A.J., et al., 2020. Evaluation of the NG-test MCR-1 lateral flow assay and EDTA-
colistin broth disk elution methods to detect plasmid-mediated colistin resistance
among gram-negative bacterial isolates. J. Clin. Microbiol. 58 (4), e01823-19
https://doi.org/10.1128/JCM.01823-19.
Filioussis, G., et al., 2020. Bovine mastitis caused by a multidrug-resistant, mcr-1-
positive (colistin-resistant), extended-spectrum β-lactamase–producing Escherichia
coli clone on a Greek dairy farm. J. Dairy Sci. 103 (1), 852–857. https://doi.org/
10.3168/jds.2019-17320.
Firth, C.L., et al., 2021. The effects of feeding waste milk containing antimicrobial
residues on dairy calf health. Pathogens 10 (2), 112.
Gharieb, R., et al., 2022. Occurrence, virulence, carbapenem resistance, susceptibility to
disinfectants and public health hazard of Pseudomonas aeruginosa isolated from
animals, humans and environment in intensive farms. J. Appl. Microbiol. 132 (1),
256–267. https://doi.org/10.1111/jam.15191.
Krishnamoorthy, P., et al., 2021. An understanding of the global status of major bacterial
pathogens of milk concerning bovine mastitis: a systematic review and meta-analysis
(Scientometrics). Pathogens 10 (5), 545. https://doi.org/10.3390/
pathogens10050545.
Mutua, F., et al., 2020. A review of animal health and drug use practices in India, and
their possible link to antimicrobial resistance. Antimicrobial Resistance &
InfectionControl 9 (1), 1–13. https://doi.org/10.1186/s13756-020-00760-3.
Ohnishi, M., et al., 2011. Antimicrobial susceptibilities and bacteriological
characteristics of bovine Pseudomonas aeruginosa and Serratia marcescens isolates
from mastitis. Vet. Microbiol. 154 (1–2), 202–207. https://doi.org/10.1016/j.
vetmic.2011.06.023.
Park, H., et al., 2014. Characterisation of Pseudomonas aeruginosa related to bovine
mastitis. Acta Vet. Hung. 62 (1), 1–12. https://doi.org/10.1556/avet.2013.054.
Pathak, A., et al., 2020. Emergence of chromosome borne colistin resistance gene, mcr-1
in clinical isolates of Pseudomonas aeruginosa. Int. J. Infect. Dis. 101, 22. https://
doi.org/10.1016/j.ijid.2020.09.096.
Poirel, L., et al., 2011. Multiplex PCR for detection of acquired carbapenemase genes.
Diagn. Microbiol. Infect. Dis. 70 (1), 119–123. https://doi.org/10.1016/j.
diagmicrobio.2010.12.002.
Rebelo, A.R., et al., 2018. Multiplex PCR for detection of plasmid-mediated colistin
resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance
purposes. Eurosurveillance 23 (6), 17–00672.
Schauer, B., et al., 2021. Tracing mastitis pathogens—epidemiological investigations of a
Pseudomonas aeruginosa mastitis outbreak in an Austrian dairy herd. Animals 11
(2), 279.
Sharun, K., et al., 2021. Advances in therapeutic and managemental approaches of
bovine mastitis: a comprehensive review. Vet. Q. 41 (1), 107–136. https://doi.org/
10.1080/01652176.2021.1882713.
Silva, J.M.D., et al., 2022. Companion animals—an overlooked and misdiagnosed
reservoir of carbapenem resistance. Antibiotics 11 (4), 533. https://doi.org/
10.3390/antibiotics11040533.
Spilker, T., et al., 2004. PCR-based assay for differentiation of Pseudomonas aeruginosa
from other pseudomonas species recovered from cystic fibrosis patients. J. Clin.
Microbiol. 42 (5), 2074–2079. https://doi.org/10.1128/JCM.42.5.2074-2079.2004.
Swetha, C., et al., 2017. A study on the antimicrobial resistant patterns of Pseudomonas
aeruginosa isolated from raw milk samples in and around Tirupati, Andhra Pradesh.
Asian J. Dairy Food Res 36 (2), 100–105.
Tartor, Y.H., et al., 2021. Virulence determinants and plasmid-mediated colistin
resistance mcr genes in gram-negative bacteria isolated from bovine milk. Front.
Cell. Infect. Microbiol. 1114. https://doi.org/10.3389/fcimb.2021.761417.
Torres, R.T., et al., 2022. A high-risk carbapenem-resistant Pseudomonas aeruginosa
clone detected in red deer (Cervus elaphus) from Portugal. Sci. Total Environ. 829,
154699 https://doi.org/10.1016/j.scitotenv.2022.154699.
Tsai, Y.-M., et al., 2020. Combination of modified carbapenem inactivation method
(mCIM) and EDTA-CIM (eCIM) for phenotypic detection of carbapenemase-
producing Enterobacteriaceae. BMC Microbiol. 20 (1), 1–7. https://doi.org/
10.1186/s12866-020-02010-3.
Waltenburg, M.A., et al., 2022. A survey of current activities and technologies used to
detect Carbapenem resistance in bacteria isolated from companion animals at
veterinary diagnostic laboratories—United States, 2020. Journal of Clinical
Microbiology 60 (3), e02154-21. https://doi.org/10.1128/jcm.02154-21.
Zarate, M., et al., 2021. Frequency of colistin resistance in Pseudomonas aeruginosa: first
report from Peru. Rev. Peru. Med. Exp. Salud Publica 38, 308–312. https://doi.org/
10.17843/rpmesp.2021.382.6977.