MANIPULATING GENOMES — MODULE 6 SPECIFICATION POINTS {a) the principles of DNA sequencing and the development of new DNA sequencing techniques To include the rapid advancements of the techniques used in sequencing, which have increased the speed of sequencing and allowed whole genome sequencing e.g. high-throughput sequer HSW7 (b) (i) how gene sequencing has allowed for genome-wide comparisons between individuals and between species i) how gene sequencing has allowed for the sequences of amino acids in polypeptides to be predicted ii) how gene sequencing has allowed for the development of synthetic biology With reference to bioinformatics and computational biology and how these fields are contributing to biological research into genotype-phenotype relationships, epidemiology and searching for evolutionary relationships. PAG10 HSW7, HSW9- (c) the principles of DNA profiling and its uses To include forensics and analysis of disease risk. Hsw9 (q) the principles of the polymerase chain reaction (PCR) and its application in DNA analysis. (@) the principles and uses of electrophoresis for separating nucleic acid fragments or proteins Opportunity for practical use of electrophoresis. PAGS Hswa (f) (i) the principles of genetic engineering (ii) the techniques used in genetic engineering To include the isolation of genes from one organism and the placing of these genes into another organism using suitable vectors. To include the use of restriction enzymes, plasmids and DNA ligase to form recombinant DNA with the desired gene and electroporation, Hsw2 (g) the ethical issues (both positive and negative) relating to the genetic manipulation of animals (including humans), plants and microorganisms To include insect resistance in genetically modified soya, genetically modified pathogens for research and “pharming’ i.e. genetically modified animals to produce pharmaceuticals, AND issues relating to patenting and technology transfer e.g. making genetically modified seed available to poor farmers. Hsw10 (h) the principles of, and potential for, gene therapy in medicine To include the differences between somatic cell gene therapy and germ line cell gene therapy. Hsw9, Hswi2awoueb ajoymM e saidoo |j90 ® ‘YN Jo seouenbes yous sejeaijdes AJUO YOd « aseoleH WNQ ewAzue 84} JOU pue — spued}s pulq pue ayesedas 0} Buljooo pue Buneey sasq YOd + uoneoljdes Wels 0} Jad e Spaeu YOd « }89 e ul UOHedI|des VNG 9} JUSIOUIP YOd S! MOH 200, 52904 uosip 92 Jo wuoy hip 34 un320 94 sy uowooHdaY VN ss0p0u4 5 09 20 Ay 51 StL YNG Jo puDuis Hou 240 uD le suo Bures409 \20e puo saouanbasjo.uop! yim Ye aioe[ou ub aut Jo satden 2 SON SIL, -paajout 220tpo 459 944 io} 04 pas s pasoafas ABauD aut pu JJ0 way 2.0 sno ‘awk oy 1 oe pwioy -Asouounjéues 26s Joy 2yoyuas 9 $0420 pos yo ‘sa stossuea utaus ous, YG Jo spumus OM 1 uojvoydou ‘We wP} usyuoypau o paisa6Ens KoyoIpounuy 494s fapOw yoHD-UOsLOA a4 Jo Asnoog SUL cop PNG dvoay uonesyydue yd¢ yNa JO UODeS |JELUS B EUO|D/AI|dWe Oo} poyjow WY ‘bulouanbas yNQ “y S2qoug YNQ Jo asn ‘¢ sisauoydoujoaja jag “2 (dd) uolfoveu ulpYy> asvuawdAjog “T “sanbiuyse4 % pudjsuapun o4 peau nox, XSOTONHOAL SNSD 9 FINGOWThe PCR process The PCR is a cyclic reaction cer; 3 5 3 sl cwmem«§,r ammo; = « ur r 5 Es 3° SN. eer . 84 A / a ALLL Sammy denaturation B SAUL 31 94-96°C c 3 \ 5° 3 5" <—eomr«r wT romp 7 Add a uu ULL 44 5 3. 5s 7 ON B c omer ty = primer annealing elongation ULL. 4 = nucleotide at 68°C a72°C to™ vA tognent om lu NA potmerase sracregruceates | ne we ‘Smits Separaton Sms Mos 2 ith — we ‘Separated sands of NA agment 7 JN IN LN LNpaui9jsues mou st eeu! uUE6UY WNC ‘I ‘aqoud jusosesony /eajoeolpes py :uonesIPUGAH 4 UB!) AN sy Aes x 0} esodxe pue > ‘syj6u9] Jenbe Jo spueq oyu! seyesedes WNC “OD ysoxjoInb onow sjuewibey ISeU!EWS ‘H SNUILUE} Engisod 0) j96 YEnosIp SeACW WNG “O quauno oujoaa Aiddy “a uonnjos J8ynq e pue sey O}U! Nd “Vv jel ye SyI6Ue| JUe/eyIp OVW! IND WNG “a saseajonuopUuy UONOUISeY UUM YNG XIN “3 siseioydoijo9/3 [85 EWS Sts y osneoaq ysayoInb J ‘ones 11 GOON ‘wines poo|q au} Ul - uno pue euun au \ { ewer Ul payeio9s si a10W | pue ewojekw out tu, peonposdisno w ss ureyo aun wnses uigojSounwiu! uy eunyxiw e& ul ezis/sselu JUaJayIp Jo Sula}OJd sayesedeg sule}oid Jo siseuoydo.yoe]y ssosoudonars 2 (Stouuyso Assquap? 04) Buy.joud/Buysuiidsobus yNO Ut pasn si 5)4L 4380100 Aus09 01 6uluoaw a6onbunj yooug ays wows 2u0> Yat sisaioues puD As 29/2 40 ABsoUa auf 04 Busss2y2u 61322/3 sisauoydouja|3 [29Separation techniques Explain why only selected sections of non-coding DNA are used when profiling a human.Compare probes and primers Similarities Differences 12 Marks A cheek swab contains 10 cells. How might you use these to identify the presence of the cystic fibrosis allele?euioueb ueWny aly peel 0} BuIYSeU! BuO eye} pInoM 4 sAep Jo Jaquinu wnwiulw uy szeym ejejdwos 0} sunoy Z 400} poyjeus Bulouenbas yoee yi (4 awoueb uewny 984} Peal 0} paouanbes 8q 0} papssu aq pjnom yeu) sjuewBey Jo Jaquinu winuiyujw ay) ayeino|e9 (e sured eseq 00g ee Fey YN Jo sjuewBey eouenbas (ju0 ues poyyew Bulouenbes siLp J} € s} ewoueb uewny ey NOIISSND Buo| suted aseq u ISS VNE /pas1uB0001 8112088) yBnouty sessed 1 sy ‘peunojco 51 sousnbas ypee w aseq BUNBUAMLA: a4 seBues pes Aq 1/61 Ul psdojanep sem poyjows uoneuE, eyo Axoapip 24 ‘uious6 ain peas oj pasn si Bulguanbas YNG UCU, sowkzus aseejonuopua uojouse4 Bulsn suaWiBey, J9y!wS o1UI no 2q 0} speed (A1esq)| au=6 e Woy pussetd 10) awoues ou, ‘awous6 uowny ou {U1 496 yoke UI seseq Jo Jopu0 exp peoueNbes GOH au MOY sUIEIdKO SIL Bulouanbes YNGHigh-throughput sequencing The speed of sequencing has increased and allowed whole genome sequencing using new techniques e.g. high-throughput sequencing. This allows millions of fragments to be sequenced at the same time and the base sequence is read in real time, as new nucleotides are added by DNA polymerase. How was this process different to Sanger sequencing? http://www.sumanasinc.com/webcontent/animations/content/highthroughput2.htm! Double bubble[ousexs Aap sues} aga uonsen (outuope xoapip sere sant von>ee4 2asayuts, nok es would peo ul sapAacopea Yo saquINE B43 15009 BN “y ‘2g uonseas oyu 1uosexdandojeue ooappp aa pm sie ey sy8Ue puesS eNwouo}e> ‘295500 aun fe Uno AIBN e151 00} gM UONDED! waLa}NP BIE MO; “= oe-02 vapmag sou an Aas Uy spseapnu 5 13 d304 Dyes 05. 03,5} sou a4 UNO BAUM YOR “2 “epacepnvogybeoap (euuutig-coapp sues) 2gny uosrey ere duway awinsnoas na ‘nua owoNan035 NE7% |unuay ononanb25 wna a 243 908 9) £2 wOULBEH a MON “S ~ 9 wo enuanbas 29 pnoysszaquiny ay opI0 ‘pasuonbas ag 61 YN 241 Uo won| apn93}nU 9:19 ‘er spuedsaues ave yseaaeneaeg 15/34) B® SBN UBB} 24 36 TEN (euven-xoopip suenwes} agnt veR2eay,9, sum oNoNAFRS WNJoySe0ue UoUWoD yU99a) Siow e aneY AOY) SUESL SY _suatdes owoH 0 ja1 498010 B SI ULE NOK Op s@iseds WOIUAN \$ OVLOLVOVOODLVLIVLSDOOOVOOVOINLY € 8 $ DOLOLVOVOLLOOVLVLOBVOVODODLOBY.£¥ ‘sojoads sa\go z ul eouenbes yNG ewes S DOLOLVOVDDOOVIVLDDVOVOOVOLODV & Zaueb 0 ewiosyooyio 8p nage 1se66ns sul 1yBIeNs yUeINSe! 64 seop J8UM ‘seoue/9yIp pnosjonu jo Jequinu ety ysuIeBe Paros Ss} poBionlp Aiqewnsasd swsiue6y0 Jo ated yoee souls awn ey) LEU O68 S180 0 61 [see oe se os se 09 | nono To sopeds 00 a Nee mau e Ayquep! Bld we ‘save || ot pouyou © mooyosion | 2. Meat) bas. queposjuewiny, - pur esol og juaLeyip & YM y juopos ‘aua6 asepixo x “gases Jes 9 aulosyoo)As suonnyisans apnoajonn e sey sejads yors, “pofoig SaW0UdD 000‘00L 243 Supenyjep s! pue(Bug s31W0UaD = sywouss saisads juasajsip jo yo auiDs ays Jo sjpNpiAIpul U2amjaq auab aus ay Jo seouanbas asoq SuluodwiopDNA SEQUENCING CAN BE USED TO PREDICT AMINO ACID SEQUENCES Once we have sequenced a fragment of DNA we can start to predict the structure of a protein. To answer the below remember that DNA is anti-parallel The template DNA strand from which mRNA is synthesised has the sequence: 5’ CAATCAACTACCCTGGGTTGCCAT 3° a) Write out the coding DNA strand, which is complementary to the template strand. Write your sequence 5’ to 3’ s’ 3 b) Use the template strand to write out the mRNA sequence. Again write this 5’ to 3’ a 3 Use the genetic code to predict the sequence of amino acids. TIP The first amino acid should methionine. This is coded by the start codon AUG Give a reason why Leucine is not the last amino acid in this polypeptide . What is the term to describe the sequence of amino acids? . Name the enzyme that transcribes the template strand of DNA . Name the enzyme that is able to copy mRNA into cDNA . Amino acids such as serine (Ser) and threonine (Thr) are need to form the secondary structure. Describe the properties of these amino acid’s R groups. Rone UT twee y YOU oytire C Usk Sooeadon ak Sepcaon tuclstire F =} tig)}ivere 1 tec, . cw cou) AU assna) CSU BE nom L Elm exe} amare leony oe. P ett ouanee, SB) Ate | omar Efren anc | Moune | Ren } Sere s TA une 2 SS aan, uw: eau AU, epee oau G0 [veiw V 8° Lpaine eae and Efe, Gu, sco A \Gna ben: | Sae. G Uke Sep eaon_ UGC TroctanSuppose we compare the beta chain of hemoglobin (the oxygen-carrying protein in blood) between humans and a variety of other species. If we compare the human and the bush baby versions of the protein, we'll find 4 amino acid differences. If we instead compare the human and flying squirrel, we'll find 15 differences. With human compared to a cus cus, we're up to 45 amino acid differences, and with human versus mud skipper, we see 65 differences. Using this info put the species onto the phylogenetic tree XY 7 \~ Question The 2 species synthesise the same polypeptide, with the same primary structure, however, due to millions of years since a common ancestor the genes have different base sequences. Explain how this is possiblesweisks Jeo!Bojo1g jesnjeu Buys Jo uB\sepei ey) Jo ‘seoKKep, Jo Swis|UBB:0 ‘Skemyjed [e;oysUe JenoU Jo UOONASUOD “y suisiue60 Aylssepo e1ojo1eyy pue (YOUN) JoIse9ue UOUILLCD que0e1 ysOUL Jo euul} AyquEp! 0} SeoUANbas YNG BuUedWOD “¢ yeeuqino Jo Sells 91200] ueo seouenbes yNG UaBoyjed BuyedWi0g “yqreey 0} Bunejar si0j9e} 19y]O Pue SEsEAsiP JO [OIUCO aigissod pue ‘uonnquisip ‘eouepiout eu yw sieep SILL -Z, (sdnouB y usemjeq suonoeseqUl) aunjonas A1emey utejoud Bunoipead ‘seouenbes NG Jo sles e612) Buseduioo °B'3 “e1ep jeoI6o}01q Burpueyssepun 104 sj00) aiemyos pue Siejndwos Jo @sr) “| Urayoud ayou 04 pasn 9q 40uUED HOS] WII 04 (sipauuo) SpUIG YN! asuasiiUy 1 \ VNU 2suasiiuy veownow| \ [vaiviiv vnaw [ novnavyn Ss ynay* ‘wisojdo4A> 24 u uragoud you 04 pasn 2a fyonn prom Vaan SAL auab aut S2oua|is, SIU “Sisayiuds ulajoud syuanoud SIU “Wspjdo,Ad ays UI YNAW SIYL OF SPU 41 ‘WNewW bulpoo ulajoud 04 a2uenbas Aupjuaw2|dwod D SoH :¥Nzx asuasijuy seouenbes/sejeite Busnes eseesip Gulfynuep| “9 eIYUAD :wisiUeBI0 meu e BuonuisuoD pue seseq 221), woyy ewOUDs ajoUM e BuPjeU YO seseq aay WOM OUEB ‘mou & oyew 'BuLieeUlbue oNeUeH “NBOTOTG SHSUIUAS “s uujerosd 40) 2p09 SuOxe Buy} AIO JeneMOY SUOXA PUE SUOMMUT SULe]U0D NG Se jinowIp enosd eo Siu) - aua6 a4) Bursn sulB}oud Jo WONDSS PIE SUIUIE OY} INO YON “by 4Jo}se0ue UoWWC Jue|sip a10u! e yse6Gns seoualayip asoyy “(suoneinw) Seoueleyip Jo Joquunu ay Bulskjeue Aq seieds usemeq sdiysuoneies Kieuonnjone exedwioo —“AUSBOTRGd “€ (NGI UI asepIX0 9 ewOIY90){o — auAB JeinoMed e UL ‘se0U@loyip 10} }00| “S8DSTS TuSTeyTp 10 MOU BUIATUSPT °Z s6nup Jo sje6ue1, ayy 8q pinoo YI YNG Jo suoiBa1 Burdynusp! pue sures Buixynuep! pue syeaugino Buyeduioo ‘SuaBOYTET jo owoues Bulshjeuy “1 nsui Wo ‘B'e seujsipew! yew 0} psn eueyeg 40} iryesn eq Aew Siu) “uondeyU! eays 0} queysiseu 8g 0} paisoul6ue 9g Kew euereg 49 Auojoo oneunuks ¥ HT popynay snp sp awouan onayyUdy D YIM Dlla}ODg Paya. sjsyUarogONIGVSY VeLXSA puanbos 2498 yeuad © 0 Be sn0}9 © 10 suojssanu pa) apo mwoU28 an 28 fs 20 e789! Ue) SUOREIM Pe UED susKU2 6S aU * copy} ued UM, “sav Bose am a8 ‘yng 941 vorsos sun on sour eu ‘Uontsod pauyap eve spuess janop NG I Ue wUN se sukev> wou ‘ua jo sissu02 wists adh 659 YaSN9 pasn AOUNLOD OU SUL © 10M ABO|OUY®} HASIHD OU S2OP MOH yeausioey Naso v — Supe aucus &How the genome editor works Oe gRNA Snaps bates faint Capen e secure ch gue (GRNA).whichmatches that Se ieaaeee. afte gene teres. corresponding ONAseauence Snes A Cas9 ° Cas9 cuts both = 3 the Astra owt gRNABInds Senco ‘and the opposite strand (see below ——J Cas peter send pee ren Peon are E preety caemearee reniT ches ne . es era renee Reiss ONIGVAY VYELXS01/12/2022 isolate the gene e.g. Human Growth Factor addr to DNA sample 2, each enzyme cuts double stranded ONA at as__ 3, tteuts each strand (hydrolysis ofthe p__ bond ) ata cfferent point 4. This leaves unpaired b__: “Sticky ends” Js. These are available join other strands of DNA as they formH___b___withe. 6 ls. Useag {0 dentfy desired gene from ONA sample, 7. Use PCR to amplify desired gene I Tr MULE, Ege LLL, sre ~ Ter WT LT TT a. actif tit.“ Se TUT ae TE” TET so A ite, = AUL, Hydrolysis ofthe phosphodiester bonds To isolate the insulin gene using mRNA 1. Remove m__ from cytoplasm of cell that produces desired protein e.g. b___cell in pancreas 2.Use R Transcriptase to convert mRNA tol ‘single stranded 3.Use +0 form double stranded DNA, This is the 14. Add nucleotides to lends to form s, Isolate the gene using the polypeptide primary structure Insert into Vector — The Plasmid vay. is used to insert gene into bacteria 1, Remove p from bacteria - by centrifuging 2.Cut open using same r used fo cut out gene e5, 3.Creates complementary 5. 4. Mix plasmid and human gene 5. Sticky ends pair up (anneal) 6.DINA ligase links the pb T.Makes a P. 8, Some plasmids contain the gene, some simply re- {Join without the gene ‘Transformation: Plasmid inserted into bacteria | e. pulse of electricity applied to bacteria, mates bacteriac__w_ p ‘membrane {and nuclear membrane in eukaryotes) more p__ }+ can also use ¢ lons and ‘heat shock treatment” + About 1% bacteria take up a secombinant plasmid thsi calledat bgsua!oBjewin} wine}oeqoUBy Jo 2104 OU SI EUNA “L “‘paseeulbue Aijeonous6 si yueld & moy ino mesg “9 -10}08A Jo sodA} JUaI8YIp aNey aM op Aum pue (Buuesui6us o99Ua6 ul) JO}OaA e SI EU'S uojeiodosjo9je Jo 801 ey) equoseg “p (s} eue6 seysew pue) pew si}! Moy 9181S pue YNG JeUIqWODe: auysq “E op asejduosues) esi8ned SBOP JEUN\ 'Z pue Ayous e Jo yeueq 84) $1 14M pue puOg Je}saIpoydsoud ey) esAjoupAY 10} BJM MOUY WAZUB UONOUISEL Al) S2OP MOH *| SNOILSSND WO ‘ewosoch Ova wsiueBso oyu Bumsesuye 40} 7 aus6 04) a12|0s|"| pwovmteem emertoutsedar menos mmc exes cok mn nay PP “gue: samp ot papa sopeu 3g eo eu HIN fa S880 ssucoo:9u payoow AeopaN86 fa apou aq wou ues MeL (0),g pluiseid WWM eieIoRg @ Vv piuseid yim evaeg @ aua6 uyjnsut oy) ‘@ney SaIU0|09 esol reid enaL areid dary ‘BueB uynsul aig i05 “ved Uoiduny TON oncy Aout st oieid ouyofoensy 24g u anyuns spuuseid oun ‘at Uo mou6 Ajuo eusjoag || dn ueye) aneu JEU eNO}0eq AIUD | ““UIINSUI UJIM S8UO 84} PUL) 0} MOH uo1po6nfuos Aq suolynjndod uayso 04 saua6 QOUD{SISAU D1L0Iq!LUD UO Ssbd UDI DIJaLIDg ‘suoljoajur sNojas a4oW @snv2 pjno> pud aulsipaw ai,oigisup Aq pal}! 2q 40u pjnom viJaL20q asay ‘suoioindod j advasa pjnoo saua6 jupisisau 21401q\4uy :SW2[qoug Jayuny 21,2u29 UEP 24) UI SMB Auojoo aun (0 ujejoid yusosesony @ Jo} S9po0 124) suE6 e sey pluseld ayy AeAEWOIIY 2v08 soversisas owe E soueysisai ene} Jo} 0u96 au ySnosty Aempi. piuuseid 84) o}u! payesu! 1 (eve6 peuisep Jo ) ulinsul ou ‘sie\yew on6ueb se Wel) sn am ‘aoueisise1 anoique 40} seueb om) sey piuise|d jeuei0eg 2u26 counsisas euroAoeney auab ey) dn ueye} aney sij9o jeLe}oeq yorum Ajnuap| :suayew onauegESyOeqMeIp OU} OIE LUM Esiyoueg sy! ase yeyM pue HS! EU 4ajsuey ABojouys9} pue Buguayed 0} Buneias senss| “y eSyOeqmesp ayy ese UM, Esiyaueg sy axe ey pue HS! IU Buleug, “€ ESyoeqmelp ouy are EU Esqoueg sy oe JeyM UE H SIEUM youeasal 10) suaboyjed pay!pous AIjeo2U99 °Z eSyoeqmesp 043 O12 EU, esiyouag sy are yeym pur a S1EUM efos pay!pow fjjeoeue6 ul souejsiseu yosul “| ba WDneu 484) 40} wie0U00 e pue ‘sjgap ebie| ‘syinsei Jood Aun Jeye SEL Play 0} ey e 404 paljeo uisiold d vised adojanug snag saiqey UID sous y urarosdGENE THERAPY 01/12/2022Kdoaauy ou2ag) 1129 wass Appow [[22 usoud> joou aspasip 21,aueb yeu, ~ SSN) € 2401S AdVaaHl aN3a9 ‘AysojnGau paynadau 2q 04 spaau uo pany 404s 51 uawoau1 “| 8) ' ovou2ung pa2ojdou 244) 204m Apog 244 $129 1 py ‘Ajuo 5}129 sjua14od 24s 04 uout 24.06 ° J Payaiuiseu si | Lal ‘Any wisiuo6o j13un umouy 2g ou! ‘oul okuqure 0} 26009 “soduquua| 24oyndiuous of oowysoun “E> 4uauizva.y pays 0 puodes| tuo 40422n snuta sda990 jou dow uraysés| ‘unui 4504 Jaxamo}} "anssi4 426.01 04 206 sanjap 04 pasn sasmA“ | dyBiouss auow = oAsquia uo wna ‘vozoouads 0 povomtep ail“ GOT oni x2 pao2) paanjdau ways | puo parowau uo s1j90 21s10ads 40 "wo14029) $429 426404 04 2426 ~onjap ob anbuyres paon —— 6urids}40 s,4uai40d 0} uo passod '2q pine uosspjndiuow 2140U99 “7‘Annealing Dideoxy nucleotide DNA Polymerase DNA Probe DNA ‘Sequencing Gel electrophoresis DNA Ligase PcR Primer Electroporation Recombinant DNA Replica Plating Restriction Endonuclease Sticky Ends Vectorhe sana Popper osae o serena ‘a 2-1 serail oi } j ; ] I 1 i ! i 2 ;