CODE – F61

FINAL NEET(UG)–2023
  (EXAMINATION)
(Held On Sunday  7th MAY, 2023) 

BIOLOGY TEST PAPER WITH ANSWER

Botany : Section-A (Q. No. 101 to 135) 106. Identify the correct statements :
A. Detrivores perform fragmentation.

®
101. Movement and accumulation of ions across a
B. The humus is further degraded by some microbes
membrane against their concentration gradient can during mineralization.
be explained by C. Water soluble inorganic nutrients go down into
(1) Facilitated Diffusion (2) Passive Transport the soil and get precipitated by a process called
leaching.
(3) Active Transport (4) Osmosis
D. The detritus food chain begins with living
Ans. (3)
organisms.
102. Among ‘The Evil Quartet’, which one is considered E. Earthworms break down detritus into smaller
the most important cause driving extinction of particles by a process called catabolism.
Choose the correct answer from the option
species ?
given below :
(1) Over exploitation for economic gain
(1) B, C, D only (2) C, D, E only
(2) Alien species invasions
(3) D, E, A only (4) A, B, C only
(3) Co-extinctions Ans. (4)
(4) Habitat loss and fragmentation 107. Given below are two statements : One is labelled as
Ans. (4) Assertion A and the other is labelled as Reason R:

103. Identify the pair of heterosporous pteridophytes Assertion A : Late wood has fewer xylary
elements with narrow vessels.
among the following :
Reason R : Cambium is less active in winters.
(1) Selaginella and Salvinia
In the light of the above statements, choose the
(2) Psilotum and Salvinia correct answer from the options given below :
(3) Equisetum and Salvinia (1) Both A and R are true but R is NOT the correct
(4) Lycopodium and Selaginella explanation of A.
Ans. (1) (2) A is true but R is false.

104. Frequency of recombination between gene pairs on (3) A is false but R is true.
(4) Both A and R are true and R is the correct
same chromosome as a measure of the distance
explanation of A.
between genes to map their position on
Ans. (4)
chromosome, was used for the first time by
108. The process of appearance of recombination
(1) Sutton and Boveri (2) Alfred Sturtevant
nodules occurs at which sub stage of prophase I in
(3) Henking (4) Thomas Hunt Morgan meiosis ?
Ans. (2) (1) Pachytene (2) Diplotene
(3) Diakinesis (4) Zygotene
105. What is the function of tassels in the corn cob ?
Ans. (1)
(1) To trap pollen grains
109. Which of the following stages of meiosis involves
(2) To disperse pollen grains
division of centromere ?
(3) To protect seeds (1) Metaphase II (2) Anaphase II
(4) To attract insects (3) Telophase (4) Metaphase I
Ans. (1) Ans. (2)

1 
 Final NEET(UG)-2023 EXAM/07-05-2023 
 
110. During the purification process for recombinant 117. In gene gun method used to introduce alien DNA
DNA technology, addition of chilled ethanol into host cells, microparticles of _______ metal are
precipitates out used.
(1) DNA (2) Histones (1) Zinc (2) Tungsten or gold
(3) Polysaccharides (4) RNA (3) Silver (4) Copper
Ans. (1) Ans. (2)
111. Family Fabaceae differs from Solanaceae and

®
118. The thickness of ozone in a column of air in the
Liliaceae. With respect to the stamens, pick out the
atmosphere is measured in terms of :
characteristics specific to family. Fabaceae but not
(1) Decibels (2) Decameter
found in Solanaceae or Liliaceae.
(3) Kilobase (4) Dobson units
(1) Polyadelphous and epipetalous stamens
Ans. (4)
(2) Monoadelphous and Monothecous anthers
(3) Epiphyllous and Dithecous anthers 119. Unequivocal proof that DNA is the genetic material
(4) Diadelphous and Dithecous anthers was first proposed by
Ans. (4) (1) Alfred Hershey and Martha Chase
112. Large, colourful, fragrant flowers with nectar are (2) Avery, Macleoid and McCarthy
seen in: (3) Wilkins and Franklin
(1) bird pollinated plants (2) bat pollinated plants (4) Frederick Griffith
(3) wind pollinated plants (4) insect pollinated plants Ans. (1)
Ans. (4) 120. In the equation
113. Spraying of which of the following phytohormone GPP – R = NPP
or juvenile conifers helps in hastening the maturity GPP is Gross Primary Productivity
period, that leads to early seed production ? NPP is Net Primary Productivity
(1) Gibberellic Acid (2) Zeatin
R here is ____.
(3) Abscisic Acid (4) Indole-3-butyric Acid
(1) Respiratory quotient
Ans. (1)
114. Axile placentation is observed in (2) Respiratory loss

(1) China rose, Beans and Lupin (3) Reproductive allocation

(2) Tomato, Dianthus and Pea
(3) China rose, Petunia and Lemon
(4) Mustard, Cucumber and Primrose
Ans. (3)
115. Among eukaryotes, replication of DNA takes place
(4) Photosynthetically active radiation
Ans. (2)
121. What is the role of RNA polymerase III in the
process of transcription in Eukaryotes ?

in - (1) Transcription of tRNA, 5 srRNA and snRNA

(1) S phase (2) G1 phase (2) Transcription of precursor of mRNA
(3) G2 phase (4) M phase (3) Transcription of only snRNAs
Ans. (1)
(4) Transcription of rRNAs (28S, 18S and 5.8S)
116. How many ATP and NADPH2 are required for the
Ans. (1)
synthesis of one molecule of Glucose during Calvin
cycle ? 122. Which micronutrient is required for splitting of water
(1) 18 ATP and 12 NADPH2 molecule during photosynthesis ?
(2) 12 ATP and 16 NADPH2
(1) molybdenum (2) magnesium
(3) 18 ATP and 16 NADPH2
(3) copper (4) manganese
(4) 12 ATP and 12 NADPH2
Ans. (1) Ans. (4)

2 
  CODE – F6
 
123. In angiosperm, the haploid, diploid and triploid 127. Which hormone promotes internode/petiole
structures of a fertilized embryo sac sequentially are: elongation in deep water rice?
(1) Antipodals, synergids, and primary endosperm (1) Kinetin (2) Ethylene
nucleus (3) 2, 4–D (4) GA3
(2) Synergids, Zygote and Primary endosperm Ans. (2)
nucleus 128. Expressed Sequence Tags (ESTs) refers to
(3) Synergids, antipodals and Polar nuclei (1) All genes that are expressed as proteins.

®
(4) Synergids, Primary endosperm nucleus and (2) All genes whether expressed or unexpressed.
zygote (3) Certain important expressed genes.
Ans. (2) (4) All genes that are expressed as RNA.
124. The phenomenon of pleiotropism refers to Ans. (4)
(1) presence of two alleles, each of the two genes 129. Given below are two statements :
controlling a single trait. Statement I : The forces generated by
(2) a single gene affecting multiple phenotypic transpiration can lift a xylem-sized column of water
expression. over 130 meters height.
(3) more than two genes affecting a single Statement II : Transpiration cools leaf surfaces
character.
sometimes 10 to 15 degrees, by evaporative
(4) presence of several alleles of a single gene
cooling.
controlling a single crossover.
In the light of the above statements, choose the
Ans. (2)
most appropriate answer from the options given
125. Given below are two statements : One is labelled as
below:
Assertion A and the other is labelled as Reason R: (1) Both Statement I and Statement II are
Assertion A : ATP is used at two steps in incorrect.
glycolysis. (2) Statement I is correct but Statement II is
Reason R : First ATP is used in converting glucose incorrect.
into glucose-6-phosphate and second ATP is used in (3) Statement I is incorrect but Statement II is
conversion of fructose-6-phosphate into fructose-1- correct
6-diphosphate. (4) Both Statement I and Statement II are
In the light of the above statements, choose the
correct.
correct answer from the options given below :
Ans. (4)
(1) Both A and R are true but R is NOT the correct
130. Upon exposure to UV radiation, DNA stained with
explanation of A.
ethidium bromide will show
(2) A is true but R is false. (1) Bright blue colour (2) Bright yellow colour
(3) A is false but R is true. (3) Bright orange colour (4) Bright red colour
(4) Both A and R are true and R is the correct Ans. (3)
explanation of A. 131. The historic Convention on Biological Diversity,
Ans. (4) 'The Earth Summit' was held in Rio de Janeiro in
126. Cellulose does not form blue colour with Iodine the year:
because (1) 1992 (2) 1986
(1) It is a helical molecule. (3) 2002 (4) 1985
(2) It does not contain complex helices and hence Ans. (1)
cannot hold iodine molecules. 132. The reaction centre in PS II has an absorption
(3) It breakes down when iodine reacts with it. maxima at
(4) It is a disaccharide. (1) 700 nm (2) 660 nm
Ans. (2) (3) 780 nm (4) 680 nm
Ans. (4)
 

3 
 Final NEET(UG)-2023 EXAM/07-05-2023 
 
133. Given below are two statements : One is labelled as Botany : Section-B (Q. No. 136 to 150)
Assertion A and the other is labelled as Reason R :
136. Identify the correct statements:
Assertion A : The first stage of gametophyte in A. Lenticels are the lens-shaped openings
the life cycle of moss is protonema stage. permitting the exchange of gases.
B. Bark formed early in the season is called hard
Reason R : Protonema develops directly from
bark.

®
spores produced in capsule. C. Bark is a technical term that refers to all tissues
In the light of the above statements, choose the exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
most appropriate answer from the options given
E. Phellogen is single-layered in thickness.
below:
Choose the correct answer from the options given
(1) Both A and R are correct but R is NOT the below:
correct explanation of A. (1) A and D only (2) A, B and D only
(3) B and C only (4) B, C and E only
(2) A is correct but R is not correct.
Ans. (1)
(3) A is not correct but R is correct. 137. Match List I with List II :
(4) Both A and R are correct and R is the correct List I List II
A. Cohesion I. More attraction in
explanation of A.
liquid phase
Ans. (4) B. Adhesion II. Mutual attraction
134. In tissue culture experiments, leaf mesophyll cells among water
molecules
are put in a culture medium to form callus. This
C. Surface tension III. Water loss in liquid
phenomenon may be called as:
phase
(1) Dedifferentiation (2) Development D. Guttation IV. Attraction towards
(3) Senescence (4) Differentiation polar surfaces

Ans. (1) Choose the correct answer from the options given
below :
135. Given below are two statements:
(1) A-IV, B-III, C-II, D-I (2) A-III, B-I, C-IV, D-II
Statement I : Endarch and exarch are the terms (3) A-II, B-I, C-IV, D-III (4) A-II, B-IV, C-I, D-III
often used for describing the position of secondary Ans. (4)
138. Match List I with List II:
xylem in the plant body.
List I List II
Statement II : Exarch condition is the most
A. M Phase I. Proteins are
common feature of the root system. synthesized
In the light of the above statements, choose the B. G2 Phase II. Inactive phase
correct answer from the options given below; C. Quiescent stage III. Interval between
mitosis and initiation
(1) Both Statement I and Statement II are false.
of DNA replication
(2) Statement I is correct but Statement II is D. G1 Phase IV. Equational division
false. Choose the correct answer from the options given
below:
(3) Statement I is incorrect but Statement II is
(1) A-IV, B-II, C-I, D-III (2) A-IV, B-I, C-II, D-III
true. (3) A-II, B-IV, C-I, D-III (4) A-III, B-II, C-IV, D-I
(4) Both Statement I and Statement II are true. Ans. (2)

Ans. (3)
4 
  CODE – F6
 
139. Which of the following statements are correct about 142. Which of the following combinations is required for
Klinefelter's Syndrome? chemiosmosis?
A. This disorder was first described by Langdon (1) membrane, proton pump, proton gradient,
Down (1866). NADP synthase

B. Such an individual has overall masculine (2) proton pump, electron gradient, ATP synthase

development. However, the feminine (3) proton pump, electron gradient, NADP

®
development is also expressed. synthase

C. The affected individual is short statured. (4) membrane, proton pump, proton gradient, ATP

D. Physical, psychomotor and mental development synthase

Ans. (4)
is retarded.
E. Such individuals are sterile. 143. Which one of the following statements is NOT

Choose the correct answer from the options given correct?

below:
(1) C and D only (2) B and E only
(3) A and E only (4) A and B only
Ans. (2)
140. Given below are two statements :
Statement I : Gause's 'Competitive Exclusion
Principle' states that two closely related species
competing for the same resources cannot co-exist
indefinitely and competitively inferior one will be
eliminated eventually.
Statement II : In general, carnivores are more
adversely affected by competition than herbivores.
In the light of the above statements, choose the
(1) Algal blooms caused by excess of organic matter
in water improve water quality and promote
fisheries.
(2) Water hyacinth grows abundantly in eutrophic
water bodies and leads to an imbalance in the
ecosystem dynamics of the water body.
(3) The amount of some toxic substances of
industrial waste water increases in the organisms
at successive trophic levels.
(4) The micro-organisms involved in biodegradation
of organic matter in a sewage polluted water
body consume a lot of oxygen causing the death
of aquatic organisms.
Ans. (1)

correct answer from the options given below: 144. Match List I with List II :

(1) Both Statement I and Statement II are false. List I List II

(2) Statement I is correct but Statement II is (Interaction) (Species A and B)

false. A. Mutualism I. +(A), O(B)

(3) Statement I is incorrect but Statement II is B. Commensalism II. –(A), O(B)

C. Amensalism III. +(A), –(B)
true.
D. Parasitism IV. +(A), +(B)
(4) Both Statement I and Statement II are true.
Choose the correct answer from the options given
Ans. (2)
below:
141. How many different proteins does the ribosome
(1) A–IV, B–I, C–II, D–III
consist of?
(2) A–IV, B–III, C–I, D–II
(1) 60 (2) 40
(3) A–III, B–I, C–IV, D–II
(3) 20 (4) 80 (4) A–IV, B–II, C–I, D–III
Ans. (4) Ans. (1)

5 
 Final NEET(UG)-2023 EXAM/07-05-2023 
 
145. Main steps in the formation of Recombinant DNA 148. Given below are two statements : One is labelled as
are given below. Arrange these steps in a correct Assertion A and the other is labelled as Reason R.
sequence. Assertion A : In gymnosperms the pollen grains
A. Insertion of recombinant DNA into the host cell. are released from the microsporangium and carried
B. Cutting of DNA at specific location by
by air currents.
restriction enzyme.
Reason R : Air currents carry the pollen grains to
C. Isolation of desired DNA fragment.

®
the mouth of the archegonia where the male
D. Amplification of gene of interest using PCR.
gametes are discharged and pollen tube is not
Choose the correct answer from the options given
formed.
below:
In the light of the above statements, choose the
(1) C, A, B, D (2) C, B, D, A
correct answer from the options given below:
(3) B, D, A, C (4) B, C, D, A
Ans. (4) (1) Both A and R are true but R is NOT the correct

146. Match List I with List II : explanation of A.

List I List II (2) A is true but R is false.

A. Iron I. Synthesis of auxin (3) A is false but R is true
B. Zinc II. Component of (4) Both A and R are true and R is the correct
nitrate reductase explanation of A.
C. Boron III. Activator of catalase Ans. (2)
D. Molybdenum IV. Cell elongation and
149. Given below are two statements : One is labelled as
differentiation
Assertion A and the other is labelled as Reason
Choose the correct answer from the options given
below: R.
(1) A-II, B-III, C-IV, D-I Assertion A : A flower is defined as modified
(2) A-III, B-I, C-IV, D-II shoot wherein the shoot apical meristem changes to
(3) A-II, B-IV, C-I, D-III floral meristem.
(4) A-III, B-II, C-I, D-IV Reason R : Internode of the shoot gets condensed
Ans. (2) to produce different floral appendages laterally at
147. Match List I with List II : successive nodes instead of leaves.
List I List II In the light of the above statements, choose the
A. Oxidative I. Citrate correct answer from the options given below:
decarboxylation synthase (1) Both A and R are true but R is NOT the correct
B. Glycolysis II. Pyruvate explanation of A.
dehydrogenase
(2) A is true but R is false.
C. Oxidative III. Electron
(3) A is false but R is true.
phosphorylation transport sytem
D. Tricarboxylic IV. EMP pathway (4) Both A and R are true and R is the correct
acid cycle explanation of A.
Choose the correct answer from the options given Ans. (4)
below: 150. Melonate inhibits the growth of pathogenic bacteria
(1) A-II, B-IV, C-I, D-III by inhibiting the activity of
(2) A-III, B-I, C-II, D-IV (1) Amylase
(3) A-II, B-IV, C-III, D-I
(2) Lipase
(4) A-III, B-IV, C-II, D-I
(3) Dinitrogenase
Ans. (3)
(4) Succinic dehydrogenase
Ans. (4)

6 
 
Zoology : Section-A (Q. No. 151 to 185)
151. Given below are two statements :
Statement I : A protein is imagined as a line, the
left end represented by first amino acid (C-terminal)
and the right end represented by last amino acid (N-
CODE – F6
154. Given below are statements : one is labelled as
Assertion A and the other is labelled as Reason R.
Assertion A : Nephrons are of two types : Cortical
& Juxta medullary, based on their relative position
in cortex and medulla.
Reason R : Juxta medullary nephrons have short

®
terminal).
loop of Henle whereas, cortical nephrons have
Statement II : Adult human haemoglobin, consists
longer loop of Henle.
of 4 subunits (two subunits of  type and two
In the light of the above statements, choose the
subunits  type.)
correct answer from the options given below :
In the light of the above statements, choose the
(1) Both A and R are true but R is NOT the correct
correct answer from the options given below :
explanation of A.
(1) Both statement I and Statement II are false.
(2) A is true but R is false.
(2) Statement I is true but Statement II is false.
(3) A is false but R is true.
(3) Statement I is false but Statement II is true.
(4) Both A and R are true and R is the correct
(4) Both statement I and Statement II are true.
explanation of A.
Ans. (3)
Ans. (2)
152. Radial symmetry is NOT found in adults of
155. Match List I with List II with respect to human
phylum _________.
(1) Hemichordata (2) Coelenterata eye.

(3) Echinodermata (4) Ctenophora List I List II

Ans. (1) A. Fovea I. Visible coloured portion

153. Which of the following statements are correct of eye that regulates
diameter of pupil.
regarding female reproductive cycle ?
B. Iris II. External layer of eye
A. In non-primate mammals cyclical changes
formed of dense
during reproduction are called oestrus cycle.
connective tissue.
B. First menstrual cycle begins at puberty and is
C. Blind spot III. Point of greatest visual
called menopause.
acuity or resolution.
C. Lack of menstruation may be indicative of
D. Sclera IV. Point where optic nerve
pregnancy.
leaves the eyeball and
D. Cyclic menstruation extends between menarche
photoreceptor cells are
and menopause.
absent.
Choose the most appropriate answer from the
Choose the correct answer from the options given
options given below :
below :
(1) A and B only
(1) A-IV, B-III, C-II, D-I
(2) A, B and C only
(2) A-I, B-IV, C-III, D-II
(3) A, C and D only
(3) A-II, B-I, C-III, D-IV
(4) A and D only
(4) A-III, B-I, C-IV, D-II
Ans. (3)
Ans. (4)

7 
 Final NEET(UG)-2023 EXAM/07-05-2023 
 
156. Which of the following are NOT considered as the 160. Match List I with List II.
part of endomembrane system ? List I List II
(Cells) (Secretion)
A. Mitochondria
A. Peptic cells I.
Mucus
B. Endoplasmic Reticulum
B. Goblet cells II.
Bile juice
C. Chloroplasts C. Oxyntic cells III.
Proenzyme pepsinogen
D. Golgi complex D. Hepatic cells IV.
HCl and intrinsic factor

®
E. Peroxisomes for absorption of vitamin
B12
Choose the most appropriate answer from the
Choose the correct answer from the options given
options given below : below :
(1) A, C and E only (2) A and D only (1) A-II, B-I, C-III, D-IV
(3) A, D and E only (4) B and D only (2) A-III, B-I, C-IV, D-II
(3) A-II, B-IV, C-I, D-III
Ans. (1)
(4) A-IV, B-III, C-II, D-I
157. Broad palm with single palm crease is visible in a Ans. (2)
person suffering from - 161. Given below are two statements : one is labelled as
Assertion A and the other is labelled as Reason R.
(1) Turner's syndrome
Assertion A : Endometrium is necessary for
(2) Klinefelter's syndrome
implantation of blastocyst.
(3) Thalassemia Reason R : In the absence of fertilization, the
(4) Down's syndrome corpus luteum degenerates that causes
Ans. (4) disintegration of endometrium.
In the light of the above statements, choose the
158. Match List I with List II.
correct answer from the options given below :
List I List II (1) Both A and R are true but R is NOT the correct
A. P - wave I. Beginning of systole explanation of A.
B. Q - wave II. Repolarisation of (2) A is true but R is false.
ventricles (3) A is false but R is true.
(4) Both A and R are true and R is the correct
C. QRS complex III. Depolarisation of atria
explanation of A.
D. T - wave IV. Depolarisation of
Ans. (1)
ventricles 162. Which of the following is not a cloning vector ?
Choose the correct answer from the options given (1) YAC (2) pBR322
below : (3) Probe (4) BAC
Ans. (3)
(1) A-IV, B-III, C-II, D-I
163. Match List I with List II.
(2) A-II, B-IV, C-I, D-III
List I List II
(3) A-I, B-II, C-III, D-IV A. Taenia I. Nephridia
(4) A-III, B-I, C-IV, D-II B. Paramoecium II. Contractile vacuole
Ans. (4) C. Periplaneta III. Flame cells
D. Pheretima IV. Urecose gland
159. Which one of the following common sexually
Choose the correct answer from the options give
transmitted diseases is completely curable when below :
detected early and treated properly ? (1) A-I, B-II, C-IV, D-III
(1) Gonorrhoea (2) Hepatitis-B (2) A-III, B-II, C-IV, D-I
(3) A-II, B-I, C-IV, D-III
(3) HIV Infection (4) Genital herpes
(4) A-I, B-II, C-III, D-IV
Ans. (1) Ans. (2)

8 
  CODE – F6
 
164. Given below are two statements : 169. Once the undigested and unabsorbed substances
Statement I : Ligaments are dense irregular tissue. enter the caecum, their backflow is prevented by -
Statement II : Cartilage is dense regular tissue. (1) Ileo - caecal valve
In the light of the above statements, choose the (2) Gastro - oesophageal sphincter
(3) Pyloric sphincter
correct answer from the options given below :
(4) Sphincter of Oddi
(1) Both Statement I and Statement II are false.
Ans. (1)
(2) Statement I is true but Statement II is false.

®
170. Which one of the following techniques does not
(3) Statement I is false but Statement II is true. serve the purpose of early diagnosis of a disease for
(4) Both Statement I and Statement II are true. its early treatment ?
Ans. (1) (1) Serum and Urine analysis
165. Which of the following functions is carried out by (2) Polymerase Chain Reaction (PCR) technique
cytoskeleton in a cell ? (3) Enzyme Linked Immuno-Sorbent Assay (ELISA)
(1) Protein synthesis technique
(2) Motility (4) Recombinant DNA Technology
(3) Transportation Ans. (1)
(4) Nuclear division 171. Given below are two statements :
Ans. (2) Statement I : Low temperature preserves the
166. Match List I with List II. enzyme in a temporarily inactive state whereas high
temperature destroys enzymatic activity because
List I List II
proteins are denatured by heat.
A. Gene 'a' I. -galactosidase
Statement II : When the inhibitor closely
B. Gene 'y' II. Transacetylase
resembles the substrate in its molecular structure
C. Gene 'i' III. Permease
and inhibits the activity of the enzyme, it is known
D. Gene 'z' IV. Repressor protein
as competitive inhibitor.
Choose the correct answer from the options given In the light of the above statements, choose the
below : correct answer from the options given below :
(1) A-II, B-III, C-IV, D-I (1) Both Statement I and Statement II are false.
(2) A-III, B-IV, C-I, D-II (2) Statement I is true but Statement II is false.
(3) A-III, B-I, C-IV, D-II
(3) Statement I is false but Statement II is true.
(4) A-II, B-I, C-IV, D-III
(4) Both Statement I and Statement II are true.
Ans. (1)
Ans. (4)
167. Which of the following statements is correct ?
172. Match List I with List II.
(1) Biomagnification refers to increase in
List I List II
concentration of the toxicant at successive
(Type of Joint) (Found between)
trophic levels.
A. Cartilaginous I. Between flat skull bones
(2) Presence of large amount of nutrients in water
Joint
restricts 'Alagal Bloom'
B. Ball and II. Between adjacent
(3) Algal Bloom decreases fish mortality Socket Joint vertebrae in vertebral
(4) Eutrophication refers to increase in domestic column
sewage and waste water in lakes. C. Fibrous Joint III. Between carpal and
Ans. (1) metacarpal of thumb
168. Which one of the following symbols represents D. Saddle Joint IV. Between Humerus and
mating between relatives in human pedigree Pectoral girdle
analysis? Choose the correct answer from the options given
below :
(1) (2) (1) A-II, B-IV, C-I, D-III
(2) A-I, B-IV, C-III, D-II
(3) A-II, B-IV, C-III, D-I
(3) (4)
(4) A-III, B-I, C-II, D-IV
Ans. (1) Ans. (1)
 

9 
 Final NEET(UG)-2023 EXAM/07-05-2023 
 
173. Given below are two statements : 178. Match List I with List II.
Statement I : Vas deferens receives a duct from List I List II
seminal vesicle and opens into urethra as the
(A) CCK (I) Kidney
ejaculatory duct.
(B) GIP (II) Heart
Statement II : The cavity of the cervix is called
cervical canal which along with vagina forms birth (C) ANF (III) Gastric gland
canal. (D) ADH (IV) Pancreas

®
In the light of the above statements, choose the Choose the correct answer from the options given
correct answer from the options given below : below :
(1) Both Statement I and Statement II are false.
(1) A-III, B-II, C-IV, D-I
(2) Statement I is correct but Statement II is
(2) A-II, B-IV, C-I, D-III
false.
(3) A-IV, B-II, C-III, D-I
(3) Statement I incorrect but Statement II is
true. (4) A-IV, B-III, C-II, D-I
(4) Both Statement I and Statement II are true. Ans. (4)
Ans. (4) 179. Given below are two statements: one is labelled as
174. In which blood corpuscles, the HIV undergoes Assertion A and the other is labelled as Reason
replication and produces progeny viruses ?
R.
(1) B-lymphocytes (2) Basophils
(3) Eosinophils (4) TH cells Assertion A : Amniocentesis for sex determination

Ans. (4) is one of the strategies of Reproductive and Child

175. Match List I with List II. Health Care Programme.
List I List II Reason R : Ban on amniocentesis checks
A. Heroin I.
Effect on cardiovascular increasing menace of female foeticide.
system
In the light of the above statements, choose the
B. Marijuana II. Slow down body function
correct answer from the options given below :
C. Cocaine III. Painkiller
D. Morphine IV. Interfere with transport of (1) Both A and R are true and R is NOT the
dopamine correct explanation of A.
Choose the correct answer from the options given
(2) A is true but R is false.
below :
(1) A-I, B-II, C-III, D-IV (3) A is false but R is true.
(2) A-IV, B-III, C-II, D-I (4) Both A and R are true and R is the correct
(3) A-III, B-IV, C-I, D-II explanation of A.
(4) A-II, B-I, C-IV, D-III
Ans. (3)
Ans. (4)
176. Vital capacity of lung is______ . 180. Given below are two statements:
(1) IRV + ERV + TV + RV Statement I : RNA mutates at a faster rate.
(2) IRV + ERV + TV - RV Statement II : Viruses having RNA genome and
(3) IRV + ERV + TV
shorter life span mutate and evolve faster.
(4) IRV + ERV
Ans. (3) In the light of the above statements, choose the
177. Select the correct group/set of Australian correct answer from the options given below :
Marsupials exhibiting adaptive radiation. (1) Both Statement I and Statement II are false.
(1) Numbat, Spotted cuscus, Flying phalanger
(2) Statement I is true but Statement II is false.
(2) Mole, Flying squirrel, Tasmanian tiger cat
(3) Lemur, Anteater, Wolf (3) Statement I false but Statement II is true.
(4) Tasmanian wolf, Bobcat, Marsupial mole (4) Both Statement I and Statement II are true.
Ans. (1) Ans. (4)

10 
  CODE – F6
 
181. Match List I with List II. 184. Match List I with List II.
List I List II List I List II
A. Vasectomy I. Oral method A. Ringworm I. Haemophilus
B. Coitus interruptus II. Barrier method influenzae
C. Cervical caps III. Surgical method B. Filariasis II. Trichophyton
D. Saheli IV. Natural method C. Malaria III. Wuchereria bancrofti
Choose the correct answer from the options given D. Pneumonia IV. Plasmodium vivax

®
below : Choose the correct answer from the options given
(1) A-III, B-IV, C-II, D-I below :
(2) A-II, B-III, C-I, D-IV (1) A-II, B-III, C-I, D-IV (2) A-III, B-II, C-I, D-IV
(3) A-IV, B-II, C-I, D-III (3) A-III, B-II, C-IV, D-I (4) A-II, B-III, C-IV, D-I
(4) A-III, B-I, C-IV, D-II Ans. (4)
Ans. (1) 185. Match List I with List II.
182. Given below are two statements: List I List II
Statement I : Electrostatic precipitator is most (Interacting species) (Name of Interaction)
widely used in thermal power plant. A. A Leopard and I. Competition
Statement II : Electrostatic precipitator in thermal a Lion in a
power plant removes ionising radiations forest/grassland
In the light of the above statements, choose the B. A Cuckoo laying II. Brood parasitism
most appropriate answer from the options given egg in a Crow's nest
below : C. Fungi and root of a III. Mutualism
(1) Both Statement I and Statement II are higher plant in
incorrect. Mycorrtizae
(2) Statement I is correct but Statement II is D. A cattle egret and IV. Commensalism
incorrect. a Cattle in a field
(3) Statement I incorrect but Statement II is Choose the correct answer from the options given

correct. below :
(4) Both Statement I and Statement II are (1) A-I, B-II, C-IV, D-III (2) A-III, B-IV, C-I, D-II
(3) A-II, B-III, C-I, D-IV (4) A-I, B-II, C-III, D-IV
correct.
Ans. (4)
Ans. (2)
183. Given below are two statements: Zoology : Section-B (Q. No. 186 to 200)

Statement I : In prokaryotes, the positively 186. Which of the following statements are correct ?
charged DNA is held with some negatively charged A. Basophils are most abundant cells of the total
proteins in a region called nucleoid. WBCs
Statement II : In eukaryotes, the negatively B. Basophils secrete histamine, serotonin and
charged DNA is wrapped around the positively heparin
charged histone octamer to form nucleosome. C. Basophils are involved in inflammatory response
In the light of the above statements, choose the D. Basophils have kidney shaped nucleus
correct answer from the options given below : E. Basophils are agranulocytes
Choose the correct answer from the options given
(1) Both Statement I and Statement II are false.
below:
(2) Statement I is correct but Statement II is
(1) C and E only
false.
(2) B and C only
(3) Statement I incorrect but Statement II is
(3) A and B only
true.
(4) D and E only
(4) Both Statement I and Statement II are true.
Ans. (2)
Ans. (3)
 

11 
 Final NEET(UG)-2023 EXAM/07-05-2023 
 
187. Match List I with List II. 190. Given below are two statements:
List I List II Statement I : During G0 phase of cell cycle, the
cell is metabolically inactive.
A. Mast cells I. Ciliated epithelium
Statement II : The centrosome undergoes
B. Inner surface of II. Areolar
duplication during S phase of interphase.
bronchiole connective tissue In the light of the above statements, choose the
C. Blood III. Cuboidal epithelium most appropriate answer from the options given

®
D. Tubular parts IV. specialised below :
of nephron connective tissue (1) Both Statement I and Statement II are
Choose the correct answer from the options give incorrect.
(2) Statement I is correct but Statement II is
below :
incorrect.
(1) A-II, B-III, C-I, D-IV (3) Statement I incorrect but Statement II is
(2) A-II, B-I, C-IV, D-III correct.
(3) A-III, B-IV, C-II, D-I (4) Both Statement I and Statement II are
(4) A-I, B-II, C-IV, D-III correct.
Ans. (2) Ans. (3)
191. Select the correct statements with reference to
188. Select the correct statements.
chordates.
A. Tetrad formation is seen during Leptotene. A. Presence of mid-dorsal, solid and double nerve
B. During Anaphase, the centromeres split and cord.
chromatide separate. B. Presence of closed circulatory system
C. Terminalization takes place during Pachytene. C. Presence of paired pharyngeal gillslits
D. Presence of dorsal heart
D. Nucleolus, Golgi complex and ER are reformed
E. Triploblastic pseudocoelomate animals
during Telophase. Choose the correct answer from the options given
E. Crossing over takes place between sister below:
chromatids of homologous chromosome. (1) B and C only (2) B, D and E only
Choose the correct answer from the options given (3) C, D and E only (4) A, C and D only
Ans. (1)
below:
192. Match List I with List II.
(1) B and D only
List I List II
(2) A, C and E only
A. Logistic growth I. Unlimited resource
(3) B and E only availability condition
(4) A and C only B. Exponential growth II. Limited resource
Ans. (1) availability condition
C. Expanding age III. The percent
189. In cockroach, excretion is brought about by-
pyramid individuals of pre-
A. Phallic gland reproductive age is
B. Urecose gland largest followed by
C. Nephrocytes reproductive and post
D. Fat body reproductive age groups
D. Stable age IV. The percent
E. Collaterial glands
pyramid individuals of pre-
Choose the correct answer from the options given reproductives and
below: reproductive age group
(1) A, B and E only are same
(2) B, C and D only Choose the correct answer from the options given
below :
(3) B and D only
(1) A-II, B-III, C-I, D-IV (2) A-II, B-IV, C-I, D-III
(4) A and E only (3) A-II, B-IV, C-III, D-I (4) A-II, B-I, C-III, D-IV
Ans. (2) Ans. (4)

12 
  CODE – F6
 
193. Which one of the following is the sequence on 196. The unique mammalian characteristics are :
corresponding coding strand, if the sequence on (1) hairs, pinna and mammary glands
mRNA formed is as follows (2) hairs, pinna and indirect development
5' AUCGAUCGAUCGAUCGAUCG AUCG (3) pinna, monocondylic skull and mammary glands
AUCG 3'? (4) hairs, tympanic membrane and mammary glands
(1) 3' UAGCUAGCUAGCUAGCUA Ans. (1)

®
GCUAGCUAGC 5' 197. Which one of the following is NOT an advantage of
(2) 5' ATCGATCGATCGATCGATCG inbreeding?
ATCGATCG 3' (1) It exposes harmful recessive genes that are
(3) 3' ATCGATCGATCGATCGATCG eliminated by selection.
ATCGATCG 5' (2) Elimination of less desirable genes and
(4) 5' UAGCUAGCUAGCUAGCUAGC accumulation of superior genes takes place due
UAGC UAGC 3' to it.
Ans. (2) (3) It decreases the productivity of inbred
194. Which of the following is characteristic feature of population, after continuous inbreeding.
cockroach regarding sexual dimorphism? (4) It decreases homozygosity.
(1) Presence of anal styles Ans. (3)
(2) Presence of sclerites 198. The parts of human brain that helps in regulation of
(3) Presence of anal cerci sexual behaviour, expression of excitement,
(4) Dark brown body colour and anal cerci pleasure, rage, fear etc. are :
Ans. (1) (1) Corpora quadrigemina & hippocampus
195. Which of the following statements are correct (2) Brain stem & epithalamus
regarding skeletal muscle ? (3) Corpus callosum and thalamus
A. Muscle bundles are held together by (4) Limbic system & hypothalamus
collagenous connective tissue layer called Ans. (4)
fascicle. 199. Which of the following statements are correct?
B. Sarcoplasmic reticulum of muscle fibre is A. An excessive loss of body fluid from the body
a store house of calcium ions. switches off osmoreceptors.
C. Striated appearance of skeletal muscle fibre B. ADH facilitates water reabsorption to prevent
is due to distribution pattern of actin and diuresis.
myosin proteins. C. ANF causes vasodilation.
D. M line is considered as functional unit of D. ADH causes increase in blood pressure.
contraction called sarcomere. E. ADH is responsible for decrease in GFR.
Choose the most appropriate answer from the Choose the correct answer from the options given
options given below: below:
(1) B and C only (1) B, C and D only
(2) A, C and D only (2) A, B and E only
(3) C and D only (3) C, D and E only
(4) A, B and C only (4) A and B only
Ans. (1) Ans. (1)

13 
 Final NEET(UG)-2023 EXAM/07-05-2023 
 
200. Which of the following are NOT under the control
of thyroid hormone?
A. Maintenance of water and electrolyte balance
B. Regulation of basal metabolic rate
C. Normal rhythm of sleep-wake cycle
D. Development of immune system
E. Support the process of R.B.Cs formation

®
Choose the correct answer from the options given
below:
(1) B and C only
(2) C and D only
(3) D and E only
(4) A and D only
Ans. (2)

14