JOURNAL OF APPLIED ANIMAL RESEARCH, 2017

VOL. 45, NO. 1, 39–44

http://dx.doi.org/10.1080/09712119.2015.1091330

The effect of high nutrient on the growth performance, adipose deposition and gene
expression of lipid metabolism in the neonatal intrauterine growth-retarded piglets
Lin Chen, Xiangbing Mao, Fei Han, Bing Yu, Jun He, Ping Zheng, Jie Yu, Junqiu Luo and Daiwen Chen
Key Laboratory of Animal Disease-Resistance Nutrition, Ministry of Education, Animal Nutrition Institute, Sichuan Agricultural University, Ya’an,
People’s Republic of China

ABSTRACT ARTICLE HISTORY

Twelve pairs of intrauterine growth retardation (IUGR,1.84 ± 0.09 kg) and normal birth weight (NBW, 2.80 Received 22 October 2014
± 0.16 kg) of Duroc × Landrace × Yorkshire piglets (7-day old) were randomly assigned to four treatments Accepted 15 July 2015
(six replicates per treatment) in a 2 × 2 factorial design. IUGR and NBW piglets were fed diets of either
KEYWORDS
normal nutritional level (NN, 880 kcal/L, 50 g of protein/L) or high nutritional level (HN, 1320 kcal/L, 75 Intrauterine growth-retarded
g protein/L)for 21 days. IUGR decreased the average daily dry matter intake (ADMI), the average daily piglets; nutrient level;
growth (ADG) and leaf fat relative weight. Regardless of body weight, HN could increase the ADMI, adipose deposition; gene
ADG and intramuscular fat content, and enhance serum insulin, IGF-I and leptin concentrations, but expression; lipid metabolism
decreased serum adiponectin concentrations in IUGR piglets. Furthermore, HN could increase the PGC-
1α of liver and C/EBPα of longissimus expression in IUGR piglets. These results suggested that the IUGR
piglets had lower growth performance and adipose deposition than NBW piglets. However, HN in diets
could make up the defect of IUGR piglets in the uterus, and regulated the expression of lipid
metabolism genes in some tissues of IUGR piglets.

1. Introduction postnatal nutrition level is related to later development of over-

Intrauterine growth retardation (IUGR) is usually defined as
impaired growth and development of the embryo and/or its
organs during gestation (Wu et al. 2004). In sow, due to the
limitation of the content in uterus, IUGR occurred in 9–11% of
newborn piglets (Wu et al. 2006). Recent Studies have shown
that IUGR reduced neonatal survival, the efficiency of nutrient
utilization, organ development (i.e. small intestine, liver and
muscle), postnatal growth and impaired long-term health
(D’Inca et al. 2010; Wu et al. 2012). Evidence has shown that
the nutrient density could increase IUGR development or
growth (Nissen & Oksbjerg 2011; Sarr et al. 2012). For
example, High nutrient intake increased the growth and
impaired the immune function of neonatal piglets with IUGR,
but it is little known about the nutrient level (NL) in regulating
lipid metabolism during the suckling period (Han et al. 2013).
The risk of adult metabolic syndrome has increased in IUGR
newborns, which is associated with lipid abnormalities, obesity
or insulin resistance (Roberts et al. 1999). Evidence in human
has shown that the IUGR newborns had higher adiponectin con-
centrations, but the leptin concentrations was lower than
normal birth weight (NBW) newborns (Kotani et al. 2004).
Although it has been widely reported that IUGR decreased the
animal growth, impaired intestinal development and function,
the role of early high nutrient in regulating hormone metab-
olism is still vague. Meanwhile, the early time of the lipid metab-
olism is important to the intramuscular and intermuscular fat
syntheses, the meat quality at the slaughter time and so on.
Overnutrition associated with weight gain can also lead to
obesity and insulin resistance (Ferrannini et al. 1997). The
weight and other metabolic disorders. Studying the lipid
metabolism response of IUGR piglets to NL may provide
useful information on IUGR piglets fed a nutrient formula.
Therefore, this study was undertaken to investigate the
effects of NL in growth, hormone level and lipid-related gene
in liver, muscle and abdominal fat of IUGR piglets during the
newborn period.
2. Materials and methods
2.1. Animals and experimental design
The animal use and care protocol was approved by the Animal
Care and Use Committee of Sichuan Agricultural University. The
NBW piglets defined as the birth weight near mean litter birth
weight (SD ± 0.5), the IUGR piglets defined as at least 1.5 SD
lower birth weight. Twelve pairs of IUGR and NBW piglets
(Duroc × (Landrace × Yorkshire)) at 7-day-old from 12 sows
were allotted to normal nutrition (NN) and high nutrition (HN)
groups. The normal formula milk powder (Table 1) was formu-
lated according to previous studies (Dourmad et al. 1998; Cha-
telais et al. 2011). The normal NL was similar to sow milk
composition, mixing 1 kg of formula powder (dry matter (DM)
87.5%) with 4 L of water to a milk solution. The high nutrient-
level nutrient contents were about 1.5-fold those of the
former, mixing 1.73 kg of formula powder with 4 L of water to
the milk solution.
The experimental design consisted of four treatments
including two birth weights of piglets (IUGR and NBW) and
two feeding groups (NN and HN). The different nutritional

CONTACT Daiwen Chen dwchen@sicau.edu.cn

© 2015 Taylor & Francis
40 L. CHEN ET AL.

Table 1. Composition and NL of basal diet (87.5% DM basis, %). detected by Nan Jing Jian Cheng Bioengineering Institute
Ingredients % (Nanjing, China). The leaf fat was calculated to relative weight.
Whole milk powder (24% CP) 58.00 The intramuscular fat (IMF) content of the LM was determined
Whey protein concentrate (34% CP) 25.00 by chloroform–methanol extraction and expressed as the
Casein 5.70
Coconut oil 10.00 weight percentage of wet muscle tissue (Bligh & Dyer 1959).
CaH2PO4 0.10
Choline chloride (50%) 0.10
Vitamin premixa 0.10 2.3. RNA isolation and reverse transcription
Mineral premixb 0.50
L-Arg (98.5%) 0.06 Total RNA was extracted from liver, LM and leaf fat using the
DL-Met (98.5%) 0.06
L-Lys·HCl (78.5%) 0.30
Trizol reagent (TaKaRa, Dalian, China) according to the manufac-
L-Thr (98%) 0.03 turer’s instruction. The purity and integrity of RNA was detected
L-Trp (98%) 0.05 by UV/VIS spectrophotometer (Beckman Coulter, DU800) and
Total 100.00
Nutrient contentc
electrophoresis in 1% agarose gel, respectively. Reverse tran-
Digestible energy (MJ/kg) 18.39 scription (RT) was carried out by RT Reagents (TaKaRa, Dalian,
Crude protein (%) 25.30 China) according to the manufacturer’s instruction.
Calcium (%) 1.02
Total phosphorus (%) 0.81
Available phosphorus (%) 0.67
Digestible Lys (%) 1.93 2.4. Real-time PCR
Digestible Met (%) 0.63
Digestible Arg (%) 0.86 Following RT, expression levels of carnitine palmitoyltransferase-
a
Vitamin premix provided per kg powder diet: vitamin A, 0.94 mg; vitamin D3, 1 (CPT-1), heart-type fatty-acid-binding protein (H-FABP), peroxi-
0.01 mg; vitamin E, 20 mg; vitamin K3, 1 mg; vitamin B12, 0.04 mg; riboflavin, some proliferator-activated receptor-γ coactivator 1α (PGC-1α),
5 mg; niacin, 20 mg; pantothenic acid, 15 mg; folic acid, 1.5 mg; thiamin, 1.5 sterol regulatory element-binding protein-1c (SREBP-1c),
mg; pyridoxine, 2 mg; biotin, 0.1 mg.
b
Mineral premix provided per kg powder diet: Zn 90 mg; Mn 4.0 mg; Fe 90 mg; Cu CCAAT/enhancer-binding protein α (C/EBPα) and β-actin in the
6.0 mg; I 0.2 mg; Se 0.3 mg. liver, LM and leaf fat were analysed by real-time quantitative
c
The NLs of diet are calculated values. PCR using SYBR Premix Ex Taq reagents (TaKaRa, Dalian, China)
and CFX-96 Real-Time PCR Detection System (Bio-Rad Labora-
tories, Richmond, CA), as previously described (Chen et al. 2012;
levels of formula milk were formed from normal nutritional level
Mao et al. 2013). Briefly, the gene-specific primers used were
(NN, 880 kcal/L, 50 g of protein/L) and high nutritional level (HN,
given in Table 2, and purchased from TaKaRa (Dalian, China).
1320 kcal/L, 75 g protein/L). The nutritional formula milk was
The PCR system consisted of 5 μL SYBR Premix Ex TaqTM (2×), 1
made with the same formula milk powder (Table 1) but different
μL forward primers (4 μM), 1 L reverse primers (4 μM), 2 μL
amounts of water. Formula milk at 50 mL/kg body weight (BW)
double distilled water and 1 μL cDNA for a total volume of 10
per meal was fed to the piglets with feeding bottles for 7 times a
μL. Cycling conditions were as follows: 95°C for 10 s, and 40
day at 3 h intervals between 6:00 and 24:00 hours. Piglets had
cycles involving a combination of 95°C for 5 s, annealing temp-
free access to water. In the present study, the average birth
erature (Table 2) for 25 s and 72°C for 15 s. Relative gene
weight and 7-day-old weight (IUGR or NBW) of piglets used
expression to the reference gene (β-action) was performed in
were 0.87 or 1.68 and 1.52 or 2.78 kg, respectively. All the
order to correct for the variance in amounts of RNA input in the
piglets were housed in metabolism cages, individually. The
reaction. In addition, the relative gene expressions compared to
ambient temperature and humidity were controlled around 30°
the reference gene were calculated with the previous method
C and 50–60%, respectively. This experiment lasted for 21 days.
(Livak & Schmittgen 2001; Chen et al. 2012, Mao et al. 2013).
The BW and the formula milk intake of piglets were recorded
daily. The average daily DM intake (ADMI) was calculated by mul-
tiplying the average daily intake of formula milk by its corre- 2.5. Statistical analysis
sponding DM content. Formula milk intake was calculated as
the difference between the offered amounts and the refusals. All data, expressed as mean ± SD, were analysed as a 2 × 2 fac-
torial using the general linear model procedures of the SAS

2.2. Slaughter surveys and sampling Table 2. Primer sequences used for real-time RT-PCR.
Gene Product Annealing
Following overnight fasting, all piglets were anesthetized and
names Primer sequence (5′ -3′ ) length (bp) temperature (°C)
slaughtered after the experiment. Blood samples of piglets
β-actin F:TCTGGCACCACACCTTCT 132 60
were collected by jugular vein, and centrifuged at 3,500 × g R:TGATCTGGGTCATCTTCTCAC
for 10 min. Then, the serum was stored at −80°C until the CPT-1 F:CCACTATGACCCGGAAGACG 111 60
R:TTGAACGCGATGAGGGTGAA
hormone analysis. Leaf fat was removed from the carcass and
H-FABP F:CTCTTTCTCAGCCTAGCCCA 151 60
weighed immediately. The longissimus dorsi muscle (LM) R:TGTGGTAGGCTTGGTCATGTT
samples were immediately collected from the left side of PGC-1α F:GTCCTTCCTCCATGCCTGAC 145 60
R:TGGTTTGCATGGTTCTGGGT
carcass and stored at 4°C for determining meat quality. In
SREBP- F:GCGACGGTGCCTCTGGTAGT 110 60
addition, LM, liver and abdominal fat samples for RNA extrac- 1c R:CGCAAGACGGCGGATTTA
tion were rapidly removed and frozen in liquid nitrogen, and C/EBPα F:CACGGTGCGTCTAAGATGAGG 218 60
R:TCGGAGCGGTGAGTTTGC
then stored at −80°C until analysis. The serum hormone was
 JOURNAL OF APPLIED ANIMAL RESEARCH 41

Table 3. Effects of NL on the growth performance of intrauterine growth-retarded (IUGR) and normal birth weight (NBW) neonate piglets.
NN HN P-value
Items IUGR NBW IUGR NBW BW NL BW × NL
Birth weight (kg) 0.91 ± 0.07a 1.49 ± 0.06b 0.89 ± 0.02a 1.59 ± 0.11c .187 <.001 .079
Initial weight (kg) 1.84 ± 0.09a 2.80 ± 0.16b 1.86 ± 0.13a 2.85 ± 0.10b <.001 .556 .828
Final weight (kg) 5.52 ± 0.45a 7.39 ± 0.26b 6.76 ± 0.18b 8.85 ± 0.70c <.001 <.001 .608
ADG (g)
Days 0–7 111 ± 15a 136 ± 43a 160 ± 28a 241 ± 85b .042 .006 .257
Days 7–14 167 ± 23 192 ± 69 222 ± 52 251 ± 82 .357 .066 .955
Days 14–21 249 ± 60a 327 ± 81ab 316 ± 26ab 365 ± 55b .047 .087 .606
Days 0–21 175 ± 24a 218 ± 13b 233 ± 12b 286 ± 29c <.001 <.001 .645
ADMI (g)
Days 0–7 108 ± 27a 142 ± 16b 151 ± 19b 218 ± 10c <.001 <.001 .111
Days 7–14 118 ± 11a 155 ± 22ab 191 ± 59b 243 ± 27c .017 <.001 .664
Days 14–21 206 ± 21a 261 ± 10ab 315 ± 49b 406 ± 69c .004 <.001 .414
Days 0–21 144 ± 19a 186 ± 14b 219 ± 24c 289 ± 27d <.001 <.001 .206
FCR
Days 0–7 0.98 ± 0.21 1.11 ± 0.29 0.97 ± 0.25 1.06 ± 0.57 .537 .871 .882
Days 7–14 0.72 ± 0.10 0.92 ± 0.47 0.86 ± 0.15 1.06 ± 0.39 .209 .361 .991
Days 14–21 0.86 ± 0.21 0.84 ± 0.24 1.00 ± 0.23 1.14 ± 0.28 .638 .085 .520
Days 0–21 0.82 ± 0.06a 0.86 ± 0.11ab 0.95 ± 0.14ab 1.02 ± 0.17b .371 .031 .718
Notes: FCR was calculated by dividing the ADMI by its corresponding ADG. Mean values within a row with unlike superscript letters (a–d) were significantly different (P
< .05).
NN, normal nutrient; HN, high nutrient; NL, nutrient level; BW, body weight; ADG, average daily gain; ADMI, average daily DM intake; FCR, feed conversion ratio; IUGR,
intrauterine growth retardation; NBW, normal birth weight.

(Version 8.1; SAS Institute, Gary, NC). The factors in the models
included the main effects of birth weight (IUGR and NBW) and
NL (normal and high) as well as their interaction. P < .05 was
considered to indicate statistical significance.
between BW and NL on the relative weight of the leaf fat and
IMF content.
3.3. The IGF-1, adiponectin, insulin and leptin levels

3. Results
3.1. Growth performance
Regardless of the NL, the initial BW, final BW, average daily
growth (ADG) and ADMI of IUGR piglets were lower (P < .05)
than those of NBW neonates (Table 3). The feed conversion
ratio (FCR) of IUGR piglets throughout the experimental
period was non-significantly (P > .05) different from that of
NBW piglets. HN increased the final BW (P < .05), BW gain (P
< .05), ADG (P < .05), ADMI (P < .05) and FCR (P < .05) of piglets
throughout the experimental period compared with NN. BW
and NL had no profitable on the initial BW, final BW, ADG,
ADMI and FCR during the experimental period. Although
IUGR piglets that received HN had a comparable BW gain, the
final BW was still lower (P < .05) relative to NBW piglets.
3.2. Leaf fat index and IMF
As given in Table 4, regardless of the NL, the LF weight/BW ratio
of IUGR piglets was lower (P < .05) than that of NBW piglets.
Increasing NL in diets could increase the IMF (P < .05) content
of IUGR piglets. However, No interaction (P > .05) was found
As given in Table 5, regardless of the NL, the serum leptin con-
centrations of IUGR piglets were higher (P < .05) than that of
NBW piglets. HN increased the IGF-I and leptin concentrations
(P < .05), and decreased the adiponectin concentrations (P
< .05), but had non-significant (P > .05) on insulin concen-
trations in the serum of IUGR piglets. BW and NL had an inter-
action (P < .05) to increase the serum IGF-I concentrations, but
non-significant (P > .05) effect on the serum adiponectin,
insulin and letpin concentrations.
3.4. Expression of genes in the liver, muscle and adipose
tissue
The expression of gene involved in lipid metabolism in the liver,
longissimus dorsi and abdominal fat are given in Table 6. Regard-
less of the NL, the mRNA levels of PGC-1α (P < .05) and SREBP-1c
(P < .05) in longissimus dorsi of IUGR piglets were lower than
those of NBW piglets. HN increased the mRNA expression of
PGC-1α (P < .05) in liver, and PGC-1α (P < .05), C/EBPα (P < .05),
CPT-1 (P < .05) and SREBP-1c (P < .05) in longissimus dorsi, but
decreased the mRNA expression of CPT-1 (P < .05) in abdominal
fat. In addition, BW and NL had the interaction on the mRNA

Table 4. Effects of NL on the leaf fat index and the content of IMF in longissimus dorsi of IUGR and NBW neonate piglets.
NN HN P-value
Items IUGR NBW IUGR NBW BW NL BW × NL
LF weight/BW (g/kg) 1.20 ± 0.26a 1.67 ± 0.13bc 1.32 ± 0.35ab 2.01 ± 0.21c .001 .112 .392
IMF (%) 0.28 ± 0.06a 0.31 ± 0.06ac 0.42 ± 0.14bc 0.44 ± 0.04c .624 .010 .874
Note: Mean values within a row with unlike superscript letters (a–c) were significantly different (P < .05).
LF, leaf fat; IMF, intramuscular fat; NN, normal nutrient; HN, high nutrient; NL, nutrient level; BW, body weight; IUGR, intrauterine growth retardation; NBW, normal birth
weight.
42 L. CHEN ET AL.

Table 5. The effects of NL on hormone level of intrauterine growth-retarded (IUGR) and normal birth weight (NBW) neonate piglets.
Items NN HN P-value
IUGR NBW IUGR NBW BW NL BW × NL
IGF-I (μg/L) 201.53 ± 20.7a 220.01 ± 19.61a 246.57 ± 21.70bc 222.95 ± 1.89ac .780 .018 .034
Adiponectin (μg/L) 980.85 ± 156.17a 883.04 ± 154.18ac 708.11 ± 81.05bc 741.62 ± 80.29b .613 .006 .309
Insulin (mIU/L) 36.55 ± 7.87a 43.15 ± 4.01ac 44.69 ± 3.04bc 43.94 ± 3.41ac .263 .098 .165
Leptin (μg/L) 6.82 ± 0.89a 5.72 ± 0.86a 9.51 ± 0.70b 7.11 ± 0.73a .004 .002 .184
Note: Mean values within a row with unlike superscript letters (a–c) were significantly different (P < .05).
IGF-I, insulin-like growth factor I; NN, normal nutrient; HN, high nutrient; NL, nutrient level; BW, body weight; IUGR, intrauterine growth retardation; NBW, normal birth
weight.

Table 6. Effects of NL on the expression of lipid gene in the longissimus dorsi, abdominal fat and liver of intrauterine growth-retarded (IUGR) and normal birth weight
(NBW) neonate piglets.
NN HN P-value
Items IUGR NBW IUGR NBW BW NL BW × NL
Longissimus dorsi
PGC-1α 0.68 ± 0.11a 1.0 ± 0.16b 0.79 ± 0.12ab 1.32 ± 0.19c <.001 .007 .148
CPT-1 1.21 ± 0.24ab 1.0 ± 0.23a 1.32 ± 0.26ab 1.49 ± 0.08b .835 .019 .104
a ac bc b
C/EBPα 0.86 ± 0.24 1.0 ± 0.25 1.56 ± 0.48 1.54 ± 0.27 .782 .012 .694
H-FABP 1.16 ± 0.26a 1.0 ± 0.07a 0.99 ± 0.36a 1.64 ± 0.31b .103 .078 .008
SREBP-1c 0.81 ± 0.10a 1.0 ± 0.13a 0.99 ± 0.28a 2.07 ± 0.18b .001 .001 .001
Abdominal fat
PGC-1α 1.03 ± 0. 37 1.0 ± 0.32 1.14 ± 0.40 1.18 ± 0.41 .983 .451 .847
CPT-1 0.99 ± 0.21a 1.0 ± 0.06a 0.69 ± 0.22bc 0.74 ± 0.10ac .676 .001 .862
C/EBPα 0.79 ± 0.44a 1.0 ± 0.24ac 0.97 ± 0.31bc 1.41 ± 0.67a .176 .214 .636
H-FABP 1.34 ± 0.28 1.0 ± 0.33 1.46 ± 0.28 1.50 ± 0.61 .498 .179 .397
SREBP-1c 0.66 ± 0.12 1.0 ± 0.09 0.91 ± 0.29 0.98 ± 0.21 .116 .234 .236
Liver
PGC-1α 0.94 ± 0.34a 1.0 ± 0.03ac 1.54 ± 0.37bc 1.55 ± 0.46bc .873 .011 .922
CPT-1 1.36 ± 0.13a 1.0 ± 0.09b 1.13 ± 0.35ab 1.18 ± 0.18ab .178 .833 .098
C/EBPα 0.75 ± 0.04 1.0 ± 0.21 0.92 ± 0.22 0.98 ± 0.11 .086 .361 .268
H-FABP 1.07 ± 0.01 1.0 ± 0.12 1.10 ± 0.47 1.10 ± 0.20 .795 .640 .786
SREBP-1c 1.04 ± 0.21ab 1.0 ± 0.24ab 0.78 ± 0.04a 1.27 ± 0.30b .069 .961 .035
Note: Mean values within a row with unlike superscript letters (a–c) were significantly different (P < .05).
CPT-1, carnitine palmitoyltransferase-1; C/EBPα, ccat/enhancer-binding protein; SREBP-1c, sterol regulatory element-binding protein-1c; PGC-1α, peroxisome prolifera-
tors-activated receptor-γcoactivator-1α, H-FABP, heart fatty-acid-binding protein; NN, normal nutrient; HN, high nutrient; NL, nutrient level; BW, body weight; IUGR,
intrauterine growth retardation; NBW, normal birth weight.

expression of SREBP-1c (P < .05) in liver, and H-FABP (P < .05) and
SREBP-1c (P < .05) in longissimus dorsi.
4. Discussion
In the previous studies, in polytocous species including the pig,
there were variations in birth weight and skeletal muscle fibre
number (Rehfeldt & Kuhn 2006). In the pig, undernutrition in
utero causes low birth weight, and decrease in muscle fibre
number and a reduction in postnatal growth rate, but the
growth rate could be improved with increasing the feeding
level (Campbell et al. 1984; Dwyer et al. 1994). Intestine, liver,
kidney and pancreas are important organs involved in digestion,
absorption and metabolism of dietary nutrients (Jobgen et al.
2006; Han et al. 2013) IUGR was found to reduce the visceral
organ weight, impair intestinal growth by decreasing cell
number and size as well as reduce the villi height. Our findings
showed that IUGR piglets exhibited differential adipose depo-
sition and mRNA expressions of lipid metabolism related to
liver, abdominal fat and muscle by HN. Specifically, the
changes of hormone level were more sensitive to HN in piglets
with IUGR. Furthermore, postnatal HN during the suckling
period allowed rapid postnatal catch-up growth in piglets with
IUGR. In agreement with previous reports (Han et al. 2013), the
present study showed that the BW of IUGR piglets were lower
than NBW at 7 and 28 days of age, but IUGR piglets achieved
catch-up growth when received HN. Therefore, it is possible
that the growth retardation of IUGR piglets was due to the devel-
opment of visceral organ and villi height was limited in utero,
which reduced the absorption of nutrients. Increasing the NL
in diets may promote the absorption of nutrition and skeletal
muscle fibre hypertrophy or adipocyte differentiation prolifer-
ation to promote the IUGR piglets catch-up growth.
In this study, the LF weight/BW ratio of IUGR piglets was
lower than that of NBW piglets. However, increasing NL in
diets could increase the IMF content of IUGR piglets. The pre-
vious reports have shown that the lower birth weight of
newborn animals reduced the weight of adipose tissue, and
delayed the adipocyte proliferation or differentiation (Shelley
1961; Lapillonne et al. 1997), but the high-protein diet could
increase the IMF content (Teye et al. 2006), which is similar to
our results. It is possible that IUGR piglets used more nutrients
to muscle or bone growth in utero, so the proliferation and
differentiation of adipocyte cells was reduced hence the
weight of adipose tissue was reduced. It is possible that IUGR
piglets exhibited an increase in the proliferation and differen-
tiation of adipocyte cells when the nutrient supply was ade-
quate during the newborn period to promote the fat
deposition. It maybe had tissues or time specificity of fat depo-
sition and one of the reasons to IUGR piglets’ catch-up growth.
Growth of adipose tissue results from both proliferation and
differentiation of adipocyte precursor cells, and subsequent

enlargement of the mature fat cells, which is under the control
of hormones and growth factors (Gregoire et al. 1998; Louveau
& Gondret 2004). Insulin stimulates the anabolic lipid metab-
olism pathways and regulates of maturation of pre-adipocytes
into adipocytes, since in vitro, and is required for all adipocyte
cell-type differentiation (Mersmann & Smith 2005). Adiponectin
is a hormone secreted by adipocytes that regulates energy
homoeostasis and glucose and lipid metabolism (Yamauchi
et al. 2002). IGF-I regulates proliferation and differentiation of
a multitude of cell types, and promotes animal growth
(Cohick & Clemmons 1993). Leptin is the protein product of
the obese gene and is involved in the regulation of food
intake, BW and whole body energy balance (Barb et al. 2001).
Accumulation of intracellular lipids due to deficient fatty-acid
oxidation by mitochondria leads to the suppression of insulin
signalling(Lowell & Shulman 2005) and insulin resistance
(Krebs & Roden 2004). The previous reports have shown that
lower BW has higher leptin concentrations of human than
that of higher BW (Phillips et al. 1999), but had lower IGF-I con-
centrations in plasma of pigs than that of higher BW (Scho-
knecht et al. 1997). Our data are similar to the previous
studies. It is possible that the hormone promoted more material
to oxidation, letting more energy to maintain growth in utero.
Adipose tissue development is regulated by many genes
(MacDougald & Lane 1995). A previous study has shown that,
during adipogenesis, C/EBPs, SREBP-1c and PPARγ can regulate
the development of fat-laden mature adipocytes (Rosen et al.
2000). H-FABPs may regulate fatty-acid uptake and intracellular
transport (Storch & Thumser 2000). PGC-1α, coactivator by
PPARγ, can activate specific gene expression associated with
the conversion of pre-adipocytes to brown adipocytes (Tiraby
& Langin 2003). CPT-1 catalyses the rate determining step in
mitochondrial fatty-acid β-oxidation (Kerner & Hoppel 2000).
Our results showed that the birth weight had no significant
effect on the expression of gene in abdominal fat and liver,
but high birth weight could increase the expression of PGC-
1α, SREBP-1c in longissimus dorsi. The NL increased the
expression of PGC-1α, C/EBPα, SREBP-1c in longissimus dorsi,
the BW and NL had an effect on the expression of H-FABP in
longissimus dorsi and SREBP-1c in longissimus dorsi and liver,
which was consistent with the previous studies (Kim & Park
2008; Williams et al. 2009). It is possible that HN allowed the
more nutrients to be used to the muscle fibre hypertrophy
rather than fat deposition during the suckling period of IUGR
piglets. Therefore, the gene expression of lipid metabolism
was not affected by HN. But, the birth weight and NL had an
effect on the growth and the fat deposition may be regulated
via the expression of gene in muscles.
5. Conclusion
In conclusion, IUGR piglets’ performance was lower than that of
NBW piglets. 50% higher dietary nutrient concentration could
improve growth performance of IUGR piglets, but the IUGR
piglets could not achieve the same weight of NBW piglets at
28 days. Higher nutrient concentration increased the risk of
lipid metabolic disorder in IUGR piglets, which may have a
danger to the animal health in later growth.
JOURNAL OF APPLIED ANIMAL RESEARCH 43
Disclosure statement
No potential conflict of interest was reported by the authors.
Funding
This work was financially supported by the earmarked fund for the National
973 Project [2012CB124701], and the grant from National Natural Science
Foundation of China [grant number. 31372323].
References
Barb C, Hausman GJ, Houseknecht KL. 2001. Biology of leptin in the pig.
Domest Anim Endocrin. 21:297–317.
Bligh E, Dyer WJ. 1959. A rapid method of total lipid extraction and purifi-
cation. Can J Biochem Physiol. 37:911–917.
Campbell RG, Taverner MR, Curic DM. 1984. Effect of feeding level and
dietary protein content on the growth, body composition and rate of
protein deposition in pigs growing from 45 to 90 kg. Anim Prod.
38:233–240.
Chatelais L, Jamin A, Gras-Le Guen C, Lallès JP, Le Huërou-Luron I, Boudry G.
2011. The level of protein in milk formula modifies ileal sensitivity to LPS
later in life in a piglet model. PloS One. 6:e19594.
Chen Y, Chen D, Tian G, He J, Mao X, Mao Q, Yu B. 2012. Dietary arginine sup-
plementation alleviates immune challenge induced by Salmonella enter-
ica serovar Choleraesuis bacterin potentially through the Toll-like
receptor 4-myeloid differentiation factor 88 signalling pathway in
weaned piglets. Br J Nutr. 108:1069–1076.
Cohick W, Clemmons D. 1993. The insulin-like growth factors. Annu Rev
Physiol. 55:131–153.
D’Inca R, Kloareg M, Gras-Le Guen C, Le Huërou-Luron I. 2010. Intrauterine
growth restriction modifies the developmental pattern of intestinal struc-
ture, transcriptomic profile, and bacterial colonization in neonatal pigs. J
Nutr. 140:925–931.
Dourmad J, Noblet J, Etienne M. 1998. Effect of protein and lysine supply on
performance, nitrogen balance, and body composition changes of sows
during lactation. J Anim Sci. 76:542–550.
Dwyer CM, Stickland NC, Fletcher JM. 1994. The influence of maternal nutri-
tion on muscle fiber number development in the porcine fetus and on
subsequent postnatal growth. J Anim Sci. 72:911–917.
Ferrannini E, Natali A, Bell P, Cavallo-Perin P, Lalic N, Mingrone G. 1997.
Insulin resistance and hypersecretion in obesity. European Group for
the Study of Insulin Resistance (EGIR). J Clin Invest. 100:1166–1173.
Gregoire FM, Smas CM, Sul HS. 1998. Understanding adipocyte differen-
tiation. Physiol Rev. 78:783–809.
Han F, Hu L, Xuan Y, Ding X, Luo Y, Bai S, He S, Zhang K. 2013. The Effects of
high nutrient intake on the growth performance, intestinal morphology
and immune function of neonatal intra-uterine growth-retarded pigs. Br J
Nutr. 110:1819–1827.
Jobgen WS, Fried SK, Fu WJ, Meininger CJ, Wu G. 2006. Regulatory role for
the arginine-nitric oxide pathway in metabolism of energy substrates. J
Nutr Biochem. 17:571–588. Epub 2006 Mar 10.
Kerner J, Hoppel C. 2000. Fatty acid import into mitochondria. BBA Mol Cell
Biol L. 1486:1–17.
Kim JY, Park T. 2008. Genes are differentially expressed in the epididymal fat
of rats rendered obese by a high-fat diet. Nutr Res. 28:414–422.
Kotani Y, Kotani Y, Yokota I, Kitamura S, Matsuda J, Naito E, Kuroda Y. 2004.
Plasma adiponectin levels in newborns are higher than those in adults
and positively correlated with birth weight. Clin Endocrinol. 61:418–423.
Krebs M, Roden M. 2004. Nutrient-induced insulin resistance in human skel-
etal muscle. Curr Med Chem. 11:901–908.
Lapillonne A, Braillon P, Claris O, Chatelain PG, Delmas PD, Salle BL. 1997.
Body composition in appropriate and in small for gestational age
infants. Acta Paediatr. 86:196–200.
Livak JK, Schmittgen DT. 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2− ΔΔCT method. Methods. 25:402–408.
Louveau I, Gondret F. 2004. Regulation of development and metabolism of
adipose tissue by growth hormone and the insulin-like growth factor
system. Domest Anim Endocrin. 27:241–255.
44 L. CHEN ET AL.
Lowell BB, Shulman GI. 2005. Mitochondrial dysfunction and type 2 diabetes.
Science. 307:384–387.
MacDougald OA, Lane MD. 1995. Transcriptional regulation of gene expression
during adipocyte differentiation. Annu Rev Biochem. 64:345–373.
Mao XB, Qi S, Yu B, He J, Yu J, Chen D. 2013. Zn2+ and l-isoleucine induce the
expressions of porcine β-defensins in IPEC-J2 cells. Mol Biol Rep. 40:1547–1552.
Mersmann H, Smith S. 2005. Development of white adipose tissue lipid
metabolism. Biol Grow Anim. 3:275–302.
Nissen P, Oksbjerg N. 2011. Birth weight and postnatal dietary protein level
affect performance, muscle metabolism and meat quality in pigs. Animal.
5:1382–1389.
Phillips DI, Fall C, Cooper C, Norman RJ, Robinson JS, Owens PC. 1999. Size at
birth and plasma leptin concentrations in adult life. Int J Obes Relat
Metab Disord. 23:1025–1029.
Rehfeldt C, Kuhn G. 2006. Consequences of birth weight for postnatal
growth performance and carcass quality in pigs as related to myogenesis.
J Anim Sci. 84:E113–E123.
Roberts A, et al. 1999. Liver function tests and glucose and lipid metabolism
in growth-restricted fetuses. Obstet Gynecol. 94:290–294.
Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM. 2000. Transcriptional
regulation of adipogenesis. Gene Dev. 14:1293–1307.
Sarr O, Louveau I, Le Huërou-Luron I, Gondret F. 2012. Adipose tissue pro-
teomes of intrauterine growth-restricted piglets artificially reared on a
high-protein neonatal formula. J Nutr Biochem. 23:1417–1424.
Schoknecht P, Schoknecht PA, Ebner S, Skottner A, Burrin DG, Davis TA, Ellis K,
Pond WG. 1997. Exogenous insulin-like growth factor-I increases weight
gain in intrauterine growth-retarded neonatal pigs. Pediatr Res. 42:201–207.
Shelley HJ. 1961. Glycogen reserves and their changes at birth and in anoxia.
Brit Med Bull. 17:137–143.
Storch J, Thumser AE. 2000. The fatty acid transport function of fatty acid-
binding proteins. BBA Mol Cell Biol L. 1486:28–44.
Teye G, Sheard P, Whittington F, Nute G, Stewart A, Wood J. 2006. Influence
of dietary oils and protein level on pork quality. 1. Effects on muscle
fatty acid composition, carcass, meat and eating quality. Meat Sci.
73:157–165.
Tiraby C, Langin D. 2003. Conversion from white to brown adipocytes: a
strategy for the control of fat mass? Trends Endocrin Met.
14:439–441.
Williams P, Marten N, Wilson V, Litten-Brown J, Corson A, Clarke L, Symonds
M, Mostyn A. 2009. Influence of birth weight on gene regulators of lipid
metabolism and utilization in subcutaneous adipose tissue and skeletal
muscle of neonatal pigs. Reproduction. 138:609–617.
Wu G, Fuller WB, Timothy AC, Cynthia JM, Thomas ES. 2004. Maternal nutri-
tion and fetal development. J Nutr. 134:2169–2172.
Wu G, Bazer F, Wallace J, Spencer T. 2006. Board-invited review: intrauterine
growth retardation: implications for the animal sciences. J Anim Sci.
84:2316–2337.
Wu G, Imhoff-Kunsch B, Girard AW. 2012. Biological mechanisms for nutri-
tional regulation of maternal health and fetal development. Paediatr
Perinat Ep. 26:4–26.
Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S,
Noda M, Kita S, Ueki K. 2002. Adiponectin stimulates glucose utilization
and fatty-acid oxidation by activating AMP-activated protein kinase.
Nat Med. 8:1288–1295.
Copyright of Journal of Applied Animal Research is the property of Taylor & Francis Ltd and
its content may not be copied or emailed to multiple sites or posted to a listserv without the
copyright holder's express written permission. However, users may print, download, or email
articles for individual use.