Simon C Masha - PHD Dissertation

Trichomonas vaginalis infection among pregnant women
in Kilifi, Kenya
Prevalence, risk factors, genotyping, and
interaction with the vaginal microbiome and HIV
Simon Chengo Masha
Dissertation submitted in partial fulfilment of the requirements

for the degree of “Doctor in Health Sciences”
Academic year: 2017 – 2018
1
I dedicate the present work, sum of great effort and sacrifice,
to a man that deeply impacted my life;
examples of passion, love and discipline:
To the loving memory of my father

Your values have been undoubtedly a great source
of inspiration to my life, vision and work.
Simon Chengo Masha was supported with a PhD Scholarship

by the Government of Belgium through VLIR-UOS
Cover image: iStock by Getty Images

ISBN: 978-94-6197-637-6
© 2018 | Simon Chengo Masha | Ghent | Belgium
All rights reserved. No part of this work may be reproduced in any form or by any means,
electronically, mechanically, by print, or otherwise, without prior written permission of the
author.
2
Simon Chengo Masha
Laboratory for Bacteriology Research
Department of Clinical Chemistry, Microbiology and Immunology
Faculty of Medicine & Health Sciences
Ghent University, Belgium
PROMOTERS
Prof. Dr. Mario Vaneechoutte

Laboratory Bacteriology Research
Faculty of Medicine & Health Sciences
Prof. Dr. Eduard J. Sanders

University of Oxford
KEMRI-Wellcome Trust Kilifi
Kilifi, Kenya
Dr. Tania Crucitti

HIV/STI Reference Laboratory
Department of Clinical Sciences
Institute of Tropical Medicine
Antwerp, Belgium
3
Members of the jury
Prof. Dr. Joris Delanghe (president)

Faculty of Medicine & Health Sciences, Ghent University
Prof. Dr. Bruno Levecke (secretary)

Department of Virology, Parasitology and Immunology
Faculty of Veterinary Sciences, Ghent University
Dr. Jaco J. Verweij

Laboratory for Medical Microbiology and Immunology
Elisabeth Tweesteden Ziekenhuis, Tilburg, the Netherlands
Prof. Steven Callens

Department of Internal Medicine
Prof. Dr. An De Sutter

Department of General Practice and Primary Health Care
Dr. Stefan Heytens

Department of General Practice and Primary Health Care
4
“All infections, of whatever type, with no exceptions, are products of parasitic beings;
that is, by living organisms that enter in other living organisms,
in which they find nourishment, that is, food that suits them,
here they hatch, grow and reproduce themselves”
— Agostino Bassi
5
6
Table of contents
Members of the jury ................................................................................................................................. 4
Abbreviations .......................................................................................................................................... 10
Chapter One | General Introduction ............................................................................................ 13
1 Curable sexually transmitted infections ..................................................................................... 14
1.1 Scope of the problem.................................................................................................................. 14
1.2 Trichomonas vaginalis ................................................................................................................ 15
1.2.1 History ................................................................................................................................. 16
1.2.2 Taxonomic classification ..................................................................................................... 16
1.2.3 Morphology ......................................................................................................................... 17
1.2.4 Genome............................................................................................................................... 19
1.2.5 Life cycle and transmission ................................................................................................. 23
1.2.6 Pathogenesis and clinical manifestations ........................................................................... 24
1.2.7 Diagnosis and detection ...................................................................................................... 25
1.2.8 Treatment ........................................................................................................................... 30
1.2.9 Prevalence of T. vaginalis ................................................................................................... 32
1.2.10 Factors associated with sexually transmitted infections .................................................... 34
1.3 References .................................................................................................................................. 38
Chapter Two | Outline and Objectives ......................................................................................... 45
2 Outline......................................................................................................................................... 46
Objective 1 .............................................................................................................................................. 46
Objective 2 .............................................................................................................................................. 46
Objective 3 .............................................................................................................................................. 47
Objective 4. ............................................................................................................................................. 47
Objective 5. ............................................................................................................................................. 47
7
Chapter Three | Prevalence and risk factors of curable sexually transmitted infections ............ 49
3 High prevalence of curable sexually transmitted infections among pregnant women in a rural
county hospital in Kilifi, Kenya ................................................................................................................ 50
3.1 Abstract ....................................................................................................................................... 50
3.2 Introduction ................................................................................................................................ 51
3.3 Methods ...................................................................................................................................... 51
3.4 Results ......................................................................................................................................... 53
3.5 Discussion.................................................................................................................................... 57
3.6 References .................................................................................................................................. 63
Chapter Four | Urogenital pathogens, associated with Trichomonas vaginalis, among pregnant
women in Kilifi, Kenya: A nested case-control study.................................................................... 67
4 Urogenital pathogens, associated with Trichomonas vaginalis, among pregnant women in Kilifi,
Kenya: A nested case-control study ........................................................................................................ 68
4.1 Abstract ....................................................................................................................................... 69
4.2 Introduction ................................................................................................................................ 70
4.3 Materials and methods ............................................................................................................... 71
4.4 Results ......................................................................................................................................... 75
4.5 Discussion.................................................................................................................................... 77
4.6 References .................................................................................................................................. 81
Chapter Five | Trichomonas vaginalis typing ............................................................................... 93
5 Molecular typing of Trichomonas vaginalis isolates by actin gene sequence analysis and
carriage of T. vaginalis viruses ................................................................................................................ 94
5.1 Abstract ....................................................................................................................................... 94
5.2 Background ................................................................................................................................. 94
5.3 Methods ...................................................................................................................................... 95
5.4 Results ......................................................................................................................................... 96
5.5 Discussion.................................................................................................................................... 99
5.6 Conclusion ................................................................................................................................. 101
5.7 References ................................................................................................................................ 101
8
Chapter Six | Interaction of Trichomonas vaginalis and vaginal microbiome ........................... 115
6 Comparative analysis of the vaginal microbiome of pregnant women with either Trichomonas
vaginalis or Chlamydia trachomatis ..................................................................................................... 116
6.1 Abstract ..................................................................................................................................... 117
6.2 Introduction .............................................................................................................................. 118
6.3 Materials and methods ............................................................................................................. 119
6.4 Results ....................................................................................................................................... 122
6.5 Discussion.................................................................................................................................. 128
6.6 Conclusion ................................................................................................................................. 130
6.7 References ................................................................................................................................ 130
Chapter Seven |Trichomonas vaginalis and HIV interaction...................................................... 141
7 Trichomonas vaginalis and HIV infection acquisition: A systematic review and meta-analysis
142
7.1 Abstract ..................................................................................................................................... 143
7.2 Introduction .............................................................................................................................. 144
7.3 Methods .................................................................................................................................... 144
7.4 Results ....................................................................................................................................... 147
7.5 Discussion.................................................................................................................................. 154
7.6 Conclusion ................................................................................................................................. 157
7.7 References ................................................................................................................................ 157
Chapter Eight | Summary and future perspectives .................................................................... 163
8 References ................................................................................................................................ 173
Chapter Nine | Samenvatting en toekomstperspectieven ......................................................... 175
9 References ................................................................................................................................ 186
Curriculum vitae .......................................................................................................................... 187
Acknowledgments....................................................................................................................... 191
9
Abbreviations
aHR Adjusted hazard ratio

AIDS Acquired immunodeficiency syndrome
ANC Antenatal care
AOR Adjusted odds ratio
ART Antiretroviral therapy
ARV Antiretroviral
ASHA Australian Sexual Health Alliance
BASHH British Association For Sexual Health and HIV
BV Bacterial vaginosis
Ca M. girerdii Candidatus Mycoplasma girerdii
C. trachomatis Chlamydia trachomatis
CDC Centers for disease control and prevention
CE European conformity/Conformité européenne
CI Confidence interval
CMV Cytomegalovirus
COR Crude odds ratio
CT Chlamydia trachomatis
DNA Deoxyribonucleic acid
E. coli Escherichia coli
FDA Food and Drug Administration Agency
FSW Female sex workers
GBS Group B Streptococcus
HindII Haemophilus influenzae II restriction enzyme
HIV Human immunodeficiency virus
HSV-1/2 Herpes simplex virus type ½
IQR Interquartile range
ITM Institute of Tropical Medicine, Antwerp, Belgium
KCH Kilifi County Hospital, Kilifi, Kenya
10
KEMRI Kenya Medical Research Institute
KWTRP Kenya Medical Research Institute-Wellcome Trust Research Programme
LBR Laboratory for Bacteriology Research, University of Ghent, Belgium
LGV Lymphogranuloma venereum
M. gentialium Mycoplasma gentialium
M. hominis Mycoplasma hominis
MLC Minimum lethal concentration
MseI Micrococcus species I restriction enzyme
N. gonorrhoeae Neisseria gonorrhoeae
NAATs Nucleic acid amplification tests
NGS Next-generation sequencing
OR Odds ratio
OTU Operational taxonomic unit
PCoA Principal coordinates analysis
PCR Polymerase chain reaction
PID Pelvic inflammatory disease
PMTCT Prevention of mother-to-child transmission
POC Point of care
PREP Pre exposure prophylaxis
PRISMA Preferred reporting items for systematic reviews and meta- analyses
qPCR Quantitative polymerase chain reaction
RFLP Restriction fragment length polymorphism
rRNA Ribosomal ribonucleic acid
RNA Ribonucleic acid
RsaI Rhodopseudomonas sphaeroides I restriction enzyme
RTI Reproductive tract infection
SDG Sustainable development goals
sSA sub-Saharan Africa
STI Sexually transmitted infection
11
STD Sexually transmitted disease
TAC Taqman array card
T. vaginalis Trichomonas vaginalis
TVV Trichomonas vaginalis virus
TVV1 Trichomonas vaginalis virus type 1
UGent Ghent University
UTI Urinary tract infection
WHO World Health Organization
12
Chapter One | General Introduction
13
Chapter One
1 Curable sexually transmitted infections
According to the World Health Organization (WHO), there exist over 30 different viruses,
bacteria, and eukaryotic parasites that may be transmitted through sexual contact. Only
eight of these pathogens comprise the greatest incidence of sexually transmitted disease
(STD). Of these eight infections, five are currently curable: chlamydia, gonorrhea, syphilis
and trichomoniasis, accounting for an estimated 357 million new sexually transmittible
infections (STIs) in 2012 [1], and Hepatitis B virus (HBV). With an estimated 257 million
people living with HBV virus infection (defined as hepatitis B surface antigen positive).
The other three are viral infections and are incurable: Herpes Simplex Virus (HSV),
Human immunodeficiency virus (HIV), and Human papillomavirus (HPV), whereby the
latter is the most common STI.
1.1 Scope of the problem
Sexually transmitted infections (STIs) have been encountered in every continent and
climate and with no seasonal variability. Every day over 1 million STIs are transmitted,
STIs like herpes and syphilis can increase the risk of HIV acquisition three-fold or more
[2]. Mother-to-child transmission of STIs can result in stillbirth, neonatal death, low-birth-
weight and prematurity, sepsis, pneumonia, neonatal conjunctivitis, and congenital
deformities [3]. Over 900 000 pregnant women were infected with syphilis resulting in
approximately 350 000 adverse birth outcomes including stillbirth in 2012 [4]. HPV
infection causes 528 000 cases of cervical cancer and 266 000 cervical cancer deaths
each year [5]. STIs such as chlamydia gonorrhoea and trichomoniasis are major causes
of pelvic inflammatory disease (PID) and infertility in women [6]. Table 1.1 summarizes
the burden of STIs in the various WHO regions in 2012.
Although, there are several curable STIs, in this dissertation the term curable sexually
transmitted infection is used exclusively to refer to chlamydia, gonorrhea, syphilis and
trichomoniasis. This chapter provides a summary of various aspects of Trichomonas
vaginalis.
14
Chapter One
Table 1.1 Global and regional estimates of the prevalence (thousands) in 2012 of
sexually transmitted infections (95% uncertainty interval).
Reprinted from reference [1].
It is important to note that there is paucity of data to feed into models that provides
estimates of incidence or prevalence of STIs such as the one use to generate Table 1.1.
For instance no data points for trichomoniasis in men from the African region met the
study inclusion criteria for during this analysis. A study had to have met the following
criteria; sample size of at least 100; specimens collected from 2005 through 2012;
population could be considered representative of the general population and study used
an internationally recognized diagnostic test with adequate performance characteristics
on urine, urethral, or cervicovaginal specimens [1].
1.2 Trichomonas vaginalis
Trichomonas vaginalis is a parasitic protozoan and the causative agent of trichomoniasis,

the most prevalent curable STI worldwide [1]. The WHO estimated that in 2012, among
adults aged 15–49 years, there were 143 (98–202) million new cases of trichomoniasis
[1]. Although T. vaginalis can infect both men and women, women bear a
15
Chapter One
disproportionate amount of the burden of this infection. Newman et al. [1] estimated the
global prevalence for trichomoniasis among women aged 15–49 years to be 5.0% (95%
uncertainty intervals (UI): 4.0–6.4%) while that of men was estimated at 0.6% (0.4–0.8%).
1.2.1 History
Alfred Donné reported the first description of the protozoan T. vaginalis almost two
centuries ago (1836) [7]. Donné cited Dujardin’s unpublished description of this
organism. Dujardin considered it a composite combining the characteristics of both
monas and tricodes groups, hence the original name Tricomonas vaginiae, which was
later changed by Ehrenberg to Trichomonas vaginalis [8]. Although T. vaginalis is the
scientific name, there are several names or short forms that are commonly used to refer
to this pathogen; trich, ureitis, and TV.
1.2.2 Taxonomic classification
x Domain: Eukarya – larger, more complex cells with a nucleus.

x Kingdom: Protista – unicellular eukaryotic organisms that are not an animal, plant
or fungus are found here
x Phylum: Metamonada – flagellated
x Class: Parabasilia – have modified mitochondria, have one or more flagella,
require host/partake in symbiosis
x Order: Trichomonadida – have undulating membrane, axostyle
x Genus: Trichomonas – members of this genus infect or are commensal organisms
of birds and mammals.
x Species: Trichomonas vaginalis – this species infects only humans
Other Trichomonas species have been identified in clinical studies in both human and
nonhuman hosts summary of this Trichomonas spp is provided in Table 1.2.
16
Chapter One
Table 1.2. Overview of human and nonhuman Trichomonas spp. and their
corresponding host.
Ref. Trichomonas spp. Primary host Site of isolation Clinical
manifestation
[9] Trichomonas foetus Bovine UGT Vaginitis,
endometritis, or a
mummified fetus.
[10] Trichomonas gallinae Birds GIT and RT Pulmonary infection
[11] Trichomonas gallinarum Birds GIT and RT Pulmonary infections
[12] Trichomonas muris Rodents GIT* NA
[13] Trichomonas tenax Human Bucal cavity Salivary
trichomonosis,
pulmonary infections
[14] Pentatrichomonas hominis Human and GIT chronic diarrhea in
Cats cats
[15] Trichomonas brixi Cats and Dogs Bucal cavity Salivary
trichomonosis,
pulmonary infections
[16] Tritrichomonas musculis Rodents GIT* NA
Legend: GIT; gastrointestinal tract, NA; not applicable, RT; respiratory tract, UGT;
urogenital tract; *, symbiont
1.2.3 Morphology
T. vaginalis is a single-celled, pear-shaped eukaryote Figure 1.1 that varies in size and
shape [17], with the average length and width being 10 and 7 μm, respectively [18]. The
parasite takes on a more amoeboid appearance upon attaching to epithelial cells Figure
1.1. T. vaginalis is a flagellated protozoan possessing four anterior and one posterior
flagellum the parasite. An axial, rod-like structure, known as axostyle, bisects the
protozoan longitudinally and sticks out beyond the posterior end of the parasite.
17
Chapter One
The posterior flagellum is incorporated at the centre of the axostyle. This structure is
thought to anchor the pathogen to epithelial cells, causing inflammation. Half of the cell
body also has an undulating membrane, which helps to sweep nutrients into the
pathogens ‘mouth-like’ structure, called the cytosome. The nucleus in T. vaginalis is
located at its anterior portion, and, as in other eukaryotes, it is surrounded by a porous
nuclear envelope [18].
Figure 1.1 Morphology of Trichomonas vaginalis
Figure 1.1 (A) T. vaginalis parasite as seen in broth culture. The axostyle, undulating membrane,
and flagella are clearly visible. (B) T. vaginalis on the surface of a vaginal epithelial cell prior to
amoeboid transformation. (C) Amoeboid morphology of T. vaginalis as seen in cell culture. Bars,
5 μm. Reprinted from reference [4].
18
Chapter One
1.2.4 Genome
In 2007, Carlton et al. [19] published the first draft genome of T. vaginalis. Repeats and
transposable elements comprise about two-thirds of the ‫׽‬160-megabase genome, which
comprises of about 60,000 genes residing on six chromosomes [19]. Some strains of T.
vaginalis harbour Trichomonas vaginalis viruses (TVVs) with some T. vaginalis strains
concurrently harbouring up to four different TVV species [20]. Several typing attempts
have been made done to shed lights of the strain diversity among T. vaginalis isolates
Table 1.3 provides a summary of typing techniques and main findings.
19
Chapter One
Table 1. 3 Summary of Trichomonas vaginalis typing techniques and main results
Authors year [Ref.] Basis of typing technique Main results
Vohra et al. 1991 [21] Iso-enzyme analysis Isolates from symptomatic and asymptomatic individuals could not
be grouped on the basis of iso-enzyme analysis alone
Malla et al. 2011 [22] Trichomonas vaginalis virus (TVV) All strains harbored TVV
Torian et al. 1988 [23] Antigenic heterogeneity of a major Six different epitopes of the antigen were identified
surface antigen
Upcroft et al. 2006 [24] Pulsed field gel electrophoresis and The pyruvate:ferredoxin oxidoreductase B gene probe identified
hybridization with a variety of gene two to seven copies of pfoB (or its closely related homologue pfoA)
probes per genome in different isolates and was an obvious candidate
probe to identify epidemiological linkage between infections.
Fraga et al. 2010 [25] Random Amplified Polymorphic Demonstrated existence of concordance between the genetic
DNA analysis (30 different random relatedness and the presence of TVV in T. vaginalis isolates.
primers used) and Trichomonas
vaginalis virus
Crucitti et al. 2008 [26] PCR-restriction fragment length Eight T. vaginalis actin genotypes. Actin genotype type E was more
polymorphism on the actin gene common in the Democratic Republic of Congo, whereas type G was
the commonest type in Zambia.
20
Chapter One
Authors year [ref] Basis of typing technique Main results
Kaulet al. 2004 [27] Random amplified polymorphic The isolates with similar banding pattern were assigned as a single
DNA analysis. Five different type. The primer with the highest typing showed18 types.
random primers used. Phylogenetic analysis using RAPD distance software indicated two
distinct lineages.
Conrad et al. 2011 [28] 21 microsatellites, six single-copy The markers showed that T. vaginalis is a genetically diverse
genes and TVV detection parasite in a population of commonly used laboratory strains.
Phylogenetic methods can be used to infer evolutionary
relationships from these markers in population analyses
Conrad et al. 2012 [29] 21 microsatellites, six single-copy Using population genetic analysis, they show that T. vaginalis is a
genes and TVV detection genetically diverse parasite with a unique population structure
consisting of two types present in equal proportions world-wide.
Parasites belonging to the two types (type 1 and type 2) differ
significantly in the rate at which they harbor the T. vaginalis virus,
a dsRNA virus implicated in parasite pathogenesis, and in their
sensitivity to the widely-used drug, metronidazole.
Legend: DNA; Deoxy ribonucleic acid, ds RNA; double stranded ribonucleic acid, RAPD; Randomly amplified polymorphic
DNA analysis, PCR; polymerase chain reaction, TVV; Trichomonas vaginalis virus.
21
Chapter One
Still, of the several typing techniques highlighted in Table 1.3, only two have been widely
used to perform typing on a large number of isolates covering a wide geographical area.
The two techniques are that of Conrad et al. [29] which was used to type 211 isolates
from Mexico, Chile, India, Australia, Papua New Guinea, Italy, South Africa and the United
States. The other one is the typing proposed by Crucitti et al. [26] which was used to type
151 isolates from Zambia and the Democratic Republic of Congo. The two techniques
differ on how they assign isolates to specific genotypes and are not comparable on that
basis.
The method used by Conrad et al. [29] groups T. vaginalis into two clusters ‘type 1’ and
‘type 2’ and showed that the two types were present at nearly equal frequencies and are
well distributed among all geographical locations, apart from two exceptions, i.e. isolates
from South Africa and Mexico, which were significantly biased towards type 1 and type 2,
respectively [29]. The same authors also noted a highly significant difference in the
minimum lethal concentration (MLC) of metronidazole necessary to kill isolates, with type
1 isolates at a mean MLC of 76.6 μg/ml of metronidazole as compared to type 2 isolates
at a mean MLC of 228.4 μg/ml of metronidazole. They also found that carriage of TVV
occurred significantly more frequently in type 1 isolates than in type 2.
Alternative gel-based methods, such as the restriction fragment length polymorphism

analysis (RFLP) of the actin gene, as proposed by Crucitti et al. [26], offer a more
affordable alternative to the MLST scheme and can provide good resolution at short-
temporal scales [26]. However, the MLST approach is usually preferred because in gel-
based approaches, comparison of results between laboratories is often problematic and
a high level of expertise is needed to interpret and to translate banding patterns. A good
strain typing method should provide sufficient discriminatory power to distinguish between
isolates from unlinked sources and be sufficiently reliable to cluster isolates from the
same source [30]. Additionally, when performing T. vaginalis typing, it is important to
factor in TVV as they appear to have a role in the pathogenesis of T. vaginalis.
22
Chapter One
1.2.5 Life cycle and transmission
The life cycle of T. vaginalis has not been clearly described. The natural hosts are human
beings, whereby the parasite lives in the female lower genital tract and the male urethra
and prostate, where it replicates asexually by mitotic division and binary fission. No sexual
reproduction of T. vaginalis has been documented. T. vaginalis is a facultative anaerobe
which exists only in a trophozoite phase with no cystic phase [18].
Since T. vaginalis lacks a cyst, and the flagellate dies outside the human body unless
protected against drying and extreme temperature, a moist environment is critical for
transmission to occur. T. vaginalis may survive for at least an hour in urine [31] or for
several hours on swimming pool water [32].
Sexual transmission is the main mode of transmission, although non-sexual transmission

has been reported [33]. Newborn infants of mothers infected with T. vaginalis may
become infected by T. vaginalis when the parasites are transferred into the neonate’s
urinary or vaginal tract during passage through the infected birth canal [34]. Although
neonatal infection with T. vaginalis is infrequently reported, it has been noted to cause
urinary tract infections and vaginitis in infants as young as 14 weeks [34]. T. vaginalis has
also been associated with upper respiratory distress among infants, where it has been
isolated from nasopharyngeal secretions of infants presenting with significant respiratory
distress [35].
T. vaginalis has been detected in the rectum of individuals reporting anal sex [36].
However, these studies utilized nucleic acid amplification tests (NAATs) to detect T.
vaginalis. Detection of rectal T. vaginalis using culture would be needed to demonstrate
viability of T. vaginalis in the rectum and shade light on plausibility of the rectum being a
reservoir for T. vaginalis. However, given the low sensitivity culture 65% - 85% on female
vaginal specimen where the organisim is know to thrive [37]. Using culture tests in rectal
detection of T. vaginalis may lead to many cases going undetected.
23
Chapter One
Other possibilities of non-sexual transmission have been suggested to occur through

contact with contaminated toilet seats, water, specula, sex toys, towels, underwear or
linen. Whittington (1957) showed, by smearing vaginal material containing trichomonads
on toilet seats, that the parasite remained viable for 45 minutes on bakelite and polished
seats and for 30 minutes on an unpolished seat with an absorbent surface [38]. It is
however highly unlikely that this can result into an actual infection in another woman,
based on the low possibility of the vulva to come into contact with the toilet seat and the
number of trichomonads required for an infection to occur, i.e., approximately 105 motile
trichomonads per mL, based on the squirrel monkey T. vaginalis infection model [39].
1.2.6 Pathogenesis and clinical manifestations
Many mechanisms are thought to be involved in T. vaginalis pathogenesis and these

include cell-to-cell adhesion [40], hemolysis [41] and/or excretion of soluble factors [42]
which all lead to epithelial cell damage and inflammation although the later varies from
case to case [43].
T. vaginalis is a free-living protozoan that can colonize mucosal epithelial surfaces.

Infection with T. vaginalis in men generally persists between 2 weeks to 4 months [44],
while untreated infection in women may persist for up to 5 years [45]. T. vaginalis has
often been detected in individuals who are asymptomatic, a prospective multicenter study
found that 72 % of male sex partners of women with trichomoniasis were also infected
with T. vaginalis, and 77 % of these men were asymptomatic [46]. Whereas detection of
T. vaginalis is often in asymptomatic individuals, among women, symptoms associated
with trichomoniasis include; purulent vaginal discharge, abnormal vaginal odour, pruritus,
dysuria, dyspareunia, lower abdominal pain, “colpitis macularis” “strawberry cervix” [47].
Trichomoniasis has been associated with infertility [18] and adverse pregnancy
outcomes, the most established association of adverse pregnancy outcomes are preterm
delivery and low-birth-weight [48]. Women with trichomoniasis have been reported to be
at a significantly higher risk of pelvic inflammatory disease than women without
24
Chapter One
trichomoniasis [6]. Vaginal infections including T. vaginalis were reported to be significant

predictors of HIV vertical transmission in a study of HIV-infected pregnant women in
Zimbabwe [49]. Some studies have suggested that infection with T. vaginalis increases
the likelihood of HIV infection acquisition although the degree by which this is increases
likelihood has not been computed.
While it was once nearly ignored, T. vaginalis infection in men is now recognized as an
important cause of non-gonococcal urethritis [50], is associated with prostatitis [51] and
infertility among men [52].
1.2.7 Diagnosis and detection
Diagnosis of T. vaginalis infection may be achieved by clinical syndromic diagnosis and/or

by laboratory-based testing. Clinical diagnosis relies on the classical symptoms
associated with T. vaginalis, which include a yellowish-green frothy vaginal discharge,
vaginal odour, pruritus, dysuria, dyspareunia, and the “strawberry” cervix [18]. However,
clinical manifestations may not be reliable diagnostic parameters as the clinical symptoms
may be synonymous with those of other Sexually Transmitted Diseases (STDs). Thus
laboratory investigations are warranted for the accurate diagnosis of trichomoniasis [37].
There is a wide array of methods available and in development to detect and investigate
T. vaginalis in both clinical and research settings. Below is a highlight of the main
laboratory diagnostic techniques:
A. Microscopy
Laboratory detection of T. vaginalis has traditionally depended on wet smear microscopy.
This technique was first described in 1836 [53]. A swab is used to collect material from
the vaginal fornix and placed into a 0.5 to 1.0 mL of saline. A drop of the saline preparation
is placed on a microscope glass slide and viewed with a microscope at a 400 x
magnification. Motile trichomonads can be seen moving in the preparation with a
distinctive jerky movement [54]. https://www.youtube.com/watch?v=9B1PFJXuJUs
25
Chapter One
Organisms lose motility ex vivo because of temperature shock, so to avoid false negative
results slides should be prepared and read as soon as possible or within 2 hours if the
sample is placed in phosphate buffered saline at room temperature otherwise T. vaginalis
becomes significantly attenuated and no motility can be observed [37]. Correct
reading/interpretation of wet smear microscopy depends on the inoculum size because
as this test has a detection threshold of 104 organisms/mL, time and conditions under
which the samples are kept and the experience of the one performing the microscopy
[53]. Observation of motile trichomonads is highly specific and thus is very useful for
determining a course of treatment. However, the sensitivity of this technique is generally
low. Nevertheless, wet mount microscopy remains one of the best options for clinicians
to quickly and specifically diagnose T. vaginalis in their clinical practice. But clinicians
should be aware of the negative results may be false, missing approximately 50% or more
infections, when dealing with a population at high-risk of T. vaginalis, more sensitive tests
should be used.
T. vaginalis may also be identified in smears after staining with acridine orange, Giemsa,
Gram, Leishman, Diffquick, Fontana, periodic acid schiff or Papanicolaou (Pap) stain [54-
56], whereby the sensitivity of these stains have been shown to be slightly better or similar
to that of a wet mount.
B. Culture
Biological amplification of T. vaginalis in culture increases the sensitivity when compared
to direct microscopic observation 85% sensitivity versus 50% for direct microscopy when
compared to newer techniques. The broth culture method has been the “gold standard”
for the detection of T. vaginalis for half a century. It is easy to interpret and requires as
few as 300 to 500 trichomonads/mL of inoculum to initiate growth [18].
The initial laboratory-based diagnostic culture test was on the Diamond medium.
Diamond Trichomonas medium was developed by Diamond in 1957. The Center for
Disease Control (CDC) modified the formulation in 1980 by substituting sheep serum with
horse serum, increasing the concentration of maltose, cysteine, and ascorbic acid, and
adding antibiotics to the medium to suppress the growth of bacteria and fungi. Culture
26
Chapter One
positivity is assessed by microscopy of a slide prepared from a drop of the culture

medium, daily for up to 7 days [37]. However, there are inherent limitations to culture-
based diagnosis. An incubation period of 2 to 7 days is usually necessary to identify T.
vaginalis by means of culture, during which time infected patients may continue to
transmit the infection.
An improvement in the culture technique was devised in the form of the InPouch TV test
(Biomed Diagnostics, Santa Clara, CA). The InPouch TV is a self-contained culture pouch
made of oxygen-resistant, optically clear plastic. It is a two-chambered pouch that allows
one to perform an immediate wet-mount by microscopic examination through the bag, as
well as a culture that can be microscopically examined directly during culture, eliminating
the need to remove material from the culture for daily examination. InPouch TV can be
stored at room temperature before use, and inoculated pouches can remain at room
temperature up to 48 h before incubation at 37°C. Sood et al. [57] showed that the
InPouch system sensitivity for the detection of T. vaginalis was twice that of wet mount.
There have been no further evolutions in culture techniques mainly due to the laborious
nature of culture but also viable organisms are not a requirement to make a diagnosis of
infection with T. vaginalis. The main utility of culture moving forward will be to obtain viable
organisms that may be important for antimicrobial susceptibility testing.
C. Immunological techniques
Several immunological techniques, including agglutination, complement fixation, enzyme-
linked immunosorbent assay, fluorescent antibody microscopy, gel diffusion, and indirect
hemagglutination, have previously been used to demonstrate the presence of
antitrichomonal antibodies [58-60]. The only commercially available antigen detection test
include OSOM (Sekisui, Framingham, MA). The assay relies on a latex-tagged antibody
to bind specifically to Trichomonas proteins and a secondary capture antibody to bind the
complex to the lateral flow device [37].
27
Chapter One
D. Nucleic acid amplification tests (NAATs)

The advent of highly sensitive and specific NAATs has provided crucial new tools for
diagnosis of infections with T. vaginalis. NAAT techniques help detect nonviable
organisms and also have the ability to detect target sequences in clinical samples that
have undergone fixation or partial degradation. NAATs are characterized by the
amplification up to millions of copies from specific individual DNA or RNA target
sequences. Thus, the analytical sensitivity of NAATs is fundamentally superior to that of
microscopy, culture, antigen detection or nucleic acid probe assays, which detect existing
organisms or their constituents.
The high analytical specificity of NAATs stems from the use of nucleotide primer and
probe sequences that are unique to the target organism. The type of urogenital
specimens that can be used with NAATs includes non-invasive urine samples and
minimally invasive self-collected vaginal swabs, in addition to clinician-collected vaginal,
urethral and endocervical swabs and endocervical specimens collected for liquid-based
Pap cytology. NAATs are now recognized as the gold standard for the screening and
diagnosis of Chlamydia trachomatis and Neisseria gonorrhoeae [61].
Several nucleic acid amplification-based assays are now commercially available for
detection of T. vaginalis. The following assays are both Food and Drug Administration
agency (FDA) approved and have a CE marking (“Conformité Européene”/”European
Conformity”): Aptima TV assay (Hologic, San Diego, CA). Aptima TV has clinical
sensitivity and specificity of 100% and 99.0% for vaginal swabs, 100% and 99.4% for
endocervical swabs, 100% and 99.6% in ThinPrep samples, and 95.2% and 98.9% in
urine specimens, respectively [62]. T. vaginalis Qx amplified DNA assay, which can be
performed on the automated BD Viper system (BD, Sparks, MD) has sensitivity and
specificity of 100% and 99.53% respectively when compared to culture [63]. AmpliVue
Trichomonas assay (Quidel, San Diego, CA). Sensitivity for AmpliVue compared to
Aptima was 90.7%, with 98.9% specificity [64]. Solana Trichomonas Assay (Quidel, San
Diego, CA) Sensitivity and specificity compared to Aptima-TV, was 89.7% and 99.0% for
swabs and 100% and 98.9% for urines respectively [65]. The recently FDA approved
28
Chapter One
NAATs is the Xpert TV assay (Cepheid, Sunnyvale, CA). When screening women
specimens (urine samples, self-collected vaginal swabs, and endocervical swabs) it has
a diagnostic sensitivity and specificity ranging from 99.5 to 100% and 99.4 to 99.9%,
respectively. When tested on male urine samples, the diagnostic sensitivity and specificity
are 97.2% and 99.9% [66].
The main factor as to why NAATs are not routinely used in resource limited countries
where the prevalence of STIs is high is the cost of testing using NAATs. The costs are
high and can range from approximately 20 € to over 100 € per test. Several aspects
determine cost of the test, this include; location, test volume, the price of the test kits, the
number of tests per kit, size of the testing run, the number of controls required per testing
run, and the type and amount of ancillary supplies [37]. Most NAATs kits do not contain
nucleic acid extraction reagents, so additional equipment and reagents are necessary
and can add approximately 3 € per test. Batch testing of samples may reduce the cost
per test; however, often batching is not practical if the time to result is delayed beyond a
period it would affect either clinical management or infection control practices.
Another cost factor for NAATs is the cost of instrumentation which can be substantial per
instrument, and higher volume laboratories may require multiple instruments. In the
overall costing of tests, technical time is also factored in, this is also highly variable
depending on the test complexity and run size. Finally, the costs for quality control,
proficiency testing, and competency assessment all affect the overall cost per test. Apart
from cost often NAATs involve multistep process which can make these assays laborious
to set up and allow for the introduction of contamination at several steps.
A growing strength of NAATs is ability to multiplex enabling a single specimen to be

interrogated for the presence of multiple pathogens associated with various clinical
syndromes [37]. The Xpert TV assay (Cepheid, Sunnyvale, CA) is an example of a newly
FDA approved T. vaginalis NAAT which is bridging the gap in terms of costs but also
turnaround time. A number of specimens may be used [66], it has no requirement for
separate nucleic acid extraction saving on time and costs, is equipped with internal quality
controls. In addition GeneXpert platform may be used for other tests C. trachomatis,
29
Chapter One
N. gonorrhoeae, Mycobacterium tuberculosis, further sharing the instrumentation costs.

The Xpert TV assay can provide on-demand results in 63 minutes or less, with early
termination for positive results within 40 min [66]. This quicker turnaround time makes the
GeneXpert platform ideal for use in high-risk settings where diagnosis and treatment
could ideally take place in real time, catering for patients who may otherwise not return
for treatment.
1.2.8 Treatment
T. vaginalis infection has been commonly treated using metronidazole, marketed under
the trade name Flagyl. This is a 5-nitroimidazole drug derived from the Streptomyces
antibiotic azomycin, which was found to be highly effective in the systemic treatment of
trichomoniasis in 1959 [18]. Table 1.4 summarizes the currently recommended treatment
regimens. Because T. vaginalis is mostly sexually transmitted, partner treatment is also
recommended.
Table 1.4 Current recommended regimens for treatment of Trichomonas vaginalis

infection
Regimen ASHA_2017 BASHH_2014 CDC_2015 WHO_2001

[67] [68] [69] [70]]
Metronidazole 2 g √ √ √ √
orally single dose
Metronidazole 500 mg - HIV infected Alternative _
orally twice daily for 7 days HIV infected
Metronidazole 400-500 mg Alternative √ - Alternative
orally twice daily for 5-7 days
Tinidazole 2 g √ Alternative √ √
orally single dose
Tinidazole 500 mg - - - Alternative
orally twice daily 5 days
Legend: ASHA: Australian Sexual Health Alliance, BASHH: British Association for Sexual Health and HIV,
CDC: Centers for Disease Control and Prevention, WHO: World Health Organization, √: recommended by
the guidelines, -: Not mentioned in the guidelines
30
Chapter One
A recent study found that 2 g single oral dose of metronidazole was not as effective as
500 mg of metronidazole twice daily for 7 days among HIV-infected women [71]. In a
recent meta-analysis comparing treatment failure between single versus multidose
metronidazole for the treatment of T. vaginalis. The pooled risk ratio indicated higher
treatment failure for single dose compared to multidose 1.87 (95% confidence interval,
1.23-2.82; P < 0.01) [72].
There have been several reports of metronidazole-resistant T. vaginalis [73], which can
be categorized as either aerobic or anaerobic resistance. Resistance development is
stepwise with aerobic resistance occurring first. Resistance occurs in clinical isolates from
patients with treatment failure. Aerobic resistance is mostly the result of interference with
intracellular oxygen through ferredoxin or oxygen-scavenging pathway [74]. Mechanisms
involved in anaerobic resistance involve a decrease or cessation of activity of pyruvate
ferredoxin oxidoreductase which in turn leads to low or no production of nitro radicals
which are responsible for attacking T. vaginalis DNA [73, 75]. However, metronidazole
resistant T. vaginalis is still not widely spread when compared to antibiotic resistance in
other STI agents, such as N. gonorrhoeae.
Before assessing T. vaginalis resistance, one must first consider other sources of
treatment failure such as non-compliance, vomiting post oral administration of
metronidazole, re-infection from an untreated partner, infection from a new partner,
insufficient drug absorption, and inadequate transport of drug to site of infection. Most
importantly is that there is no standardized technique for determining T. vaginalis
resistance to metronidazole.
The British association for sexual health and HIV (BASHH) guidelines recommend a
treatment protocol for non-response to standard T. vaginalis therapy [68]. This involves a
repeat course of 7-day standard therapy: Metronidazole 400-500 mg twice daily for 7
days. For patients failing this second regimen: Higher dose course of nitroimidazole, i.e.
metronidazole or tinidazole 2 g daily for 5-7 days or metronidazole 800 mg three times
daily for 7 days [68].
31
Chapter One
For those failing this third regimen, resistance testing is suggested. In most cases the
resistance testing is not possible as there is no standard protocol. The next option is a
high dose tinidazole regimens may be considered: tinidazole 1 g twice or three times
daily, or 2 g twice daily for 14 days +/- intravaginal tinidazole 500 mg twice daily for 14
days [68].
Other treatments with some reported success include paromomycin intravaginally 250
mg once or twice daily for 14 days or Furazolidone intravaginally 100 mg twice daily for
12-14 days. Acetarsol pessaries 500 mg nocte for 2 weeks or 6% nonoxynol pessaries
nightly for 2 weeks is also listed an option [68]. In a randomized dose-ranging pilot study
conducted in two phases, whereby in the first phase, participants were randomized to the
vaginal suppository (metronidazole 750 mg/miconazole nitrate 200 mg) twice a day for 7
days versus oral metronidazole 2 g single dose, while in the second phase, participants
randomized to suppository used it once a day for 7 days. There were no significant
differences in cure rates between the vaginal suppositories and oral metronidazole in
either phase. The overall efficacy across both follow-up visits was 80% versus 90% for
the suppository (2×/d) versus oral medication arms in phase 1 (P = 1.00) and 78% versus
70% for the suppository (1×/d) versus oral medication arms in phase 2 (P = 1.00) [76].
1.2.9 Prevalence of T. vaginalis
To generate a brief overview of the current prevalence of T. vaginalis infection in various

countries, the PubMed database was searched, using the combination of all of the
following search terms “Trichomonas vaginalis”, “T. vaginalis” or “trichomoniasis” with the
following search term “prevalence”. The search was restricted to articles published
between April and June 2018. The following data were extracted; authors, year of sample
collection, study population, T. vaginalis detection method and the prevalence, as
summarized in Table 1.5. The prevalence of T. vaginalis from recently published studies
varies widely, from 0% among men in the general population in the UK to 39.8% among
women at a study recruiting women from a family planning in Jamaica.
32
Chapter One
Table 1.5 Current prevalence of Trichomonas vaginalis
Ref. Authors & Year of Study population TV Prevalence of

Country Sample detection
collection method T. vaginalis
(%)
[77] Daugherty et al. 2013-2016 men 18-59 years NAAT 0.49
USA
[78] Ronda et al.USA 2015-2017 female adolescents NAAT 9.0
and young adults,
mean age 22.3 years
[79] Teasdale et al. 2003-2006 Pregnant, women NAAT 3.7
South Africa and aged 18-50 years
Zimbabwe
[80] Shahesmaeili et 2015 FSW 18-44 years NAAT 11.9
al. Iran
[81] Garrett et al. 2016-2017 Women attending Immunologic 3.0

South Africa the clinic for STI al rapid test
aged 18-40 years
[82] Ijasan et al. 2016 HIV-positive Direct 10.0
Nigeria pregnant women microscopy
aged 15-49 years
[83] Zia et al. Jamaica 2012-2014 Women at family NAAT 39.8
planning clinics,
Median age 25 years
[84] Dionne-Odom et 2015 HIV positive, median NAAT 13.3
al. USA age 46.8 years
[85] Davey et al. Not HIV positive NAAT 10.0
South Africa indicated pregnant women,
median age 30 years
[86] Sarier et al. 2016-2017 Renal transplant NAAT 1.3
Turkey patients men &
women, mean age
45 years
[87] Price et al. 2016-2017 HIV positive NAAT 20.0
pregnant women,
South Africa mean age 30.1 years
33
Chapter One
Ref Authors & Year of Study population TV Prevalence of

Country Sample detection
collection method T. vaginalis
[88] Schwebke et al. 2012-2013 Men & Women NAAT 6.1 Men, 11.3
USA attending family Women
planning/STD clinics,
age range < 18 - >50
years
[89] Jacob et al. 2013-2015 Women attending Not 0.2
Germany 271 German mentioned
gynecological clinics,
age range < 20 - >60
years
[90] Barnabas et al. 2013-2015 HIV-seronegative NAAT 5.0
South Africa adolescent females,
16-22 years
[91] Wynn et al. 2015-2016 Pregnant women NAAT 5.0
Botswana attending antenatal
clinic, median age 30
years
[92] Field et al. UK 2010-2012 General population, NAAT 0.3 women,
aged 16-44 years
0% men
Legend: NAAT; Nucleic Acid Amplification Test, TV; Trichomonas vaginalis. Studies are
arranged starting from the most recently published.
1.2.10 Factors associated with sexually transmitted infections
Globally, the geographic distribution of STIs is unequal. Apart from the prevalence of
syphilis [93], the prevalence of STIs seems to be generally decreasing or under control in
high-income countries. However, high prevalences continue to be reported in low- and
middle-income countries, particularly among sexually active risk groups such as
commercial sex workers or men who have sex with men [94]. To better understand the
disparities in the prevalence of STIs, some factors associated with STIs are highlighted.
It is important to note that factors associated with STIs differ in various regions.
34
Chapter One
Individuals engaging in high-risk sexual behaviour are all at a higher risk of STIs. From a
survey in Belgium, higher frequency of swinging was associated with an STI diagnosis (p
= 0.036) [95]. It should be noted that swingers form a network through which STIs can
easily spread.
Among women, bacterial vaginosis (BV) is another factor that has been associated with
increased susceptibility to STIs [96]. The burden of BV is highest in sub-Sahara Africa
(sSA) [97] and in women of sSA descent living elsewhere [96]. Additionally, among
women, vaginal douching has been shown to increase the risk of BV which would
consequently increase the risk of STIs. In a longitudinal study, the relative risk for BV
among those who practice regular vaginal douching as compared with no douching was
1.21 (95% confidence interval: 1.08, 1.38) [98].
Individuals who abuse alcohol and other drugs have been also shown to be at a high-risk
of STIs [95, 99]. Binge drinking, and using drugs like “club drugs” like ecstasy, and
poppers can alter an individual’s judgment, lower inhibitions, and impair decisions about
sex or other drug use including injection of drugs. Alcohol and drug abusers are more
likely to have unplanned and unprotected sex, have a challenge in using a condom the
right way every time they have sex. All these behaviours increase their risk of exposure
to STIs including HIV. HIV on its own is associated with curable STIs, as the rate of
curable STIs among HIV-infected individuals is generally higher compared to HIV-
negative individuals [84].
Socioeconomic status, which most of the time goes hand in hand with a lower level of
education, has been associated with higher levels of STIs [100]. This is not surprising,
since lower income is associated with less access to preventative information and
healthcare, and increased used of sex for economic purposes and as a psychosocial
coping mechanism [101]. In a study among female adolescents, ages 12-21 years, who
leave on the streets in Kenya, the prevalence of chlamydia, gonorrhoea, HSV-2, HIV and
trichomoniasis was 16%, 15%, 35%, 15%, 10% respectively, higher than what is seen in
the general population [102].
35
Chapter One
In multi-racial countries and especially in the US, it has long been recognized that STI
risk is strongly patterned by race/ethnicity, with the higher rates amongst African-
Americans [103]. This may stem from the fact that black men have higher-risk sexual
behaviours than white men [104]. However, even within strata of sexual and substance-
use behaviour, there remain large differences in STI rates between race/ethnicities,
particularly for black individuals [104]. It seems like there are unknown factors other than
individual risk behaviours and covariates which appear to account for racial difference in
STI prevalence and future studies may investigate this.
Mobile populations have been identified to be at high risk of STI due to their propensity
to engage in concurrent relationships and transactional sex. Mobile populations constitute
a risk group for local and international STI-transmission. In a systematic review and meta-
analysis, examining the evidence regarding travel-related sexual risk-taking, the pooled
prevalence of casual travel sex was 35% and prevalence of non-condom use was 17%
[105]. Long distance truck drivers in sSA are particularly prone to acquiring STIs, with a
previous study documenting prevalence rate of HIV of 15.4% in Mozambique [106], 26%
South Africa [107] and 10% Nigeria [108].
Young age at first sexual intercourse has been associated with an increased risk of
acquiring STIs [109], as young sexual debutants are more likely to have sexual risk
behaviours at first sexual experience [110] and may be particularly prone to other risky
behaviours later in life [111]. For example, in a study in Tanzania, women who had their
first sexual intercourse at age 20+ 54 times less likely to have STIs, including HIV-1 and
HSV-2, than women who had their first intercourse before their 18th birthday [109].
Some professions, such as military personnel, bar-maids/waiters, commercial sex

workers, and fisherfolk, have also been associated with high prevalence of STIs. For
instance, in Ugandan Lake Victorian fisherfolk communities, the HIV prevalence is
estimated to be 22% [112], much higher than in the Ugandan general population, for
whom HIV prevalence is estimated to be 7.3% [113]. Vulnerability to STI stems from
complex, interacting factors that may include the mobility of many fisherfolk, the time
fishermen spend away from home, their daily access to cash income in an overall context
36
Chapter One
of high poverty and vulnerability, their demographic profile, the ready availability of
commercial sex in fishing ports and the subcultures of risk-taking. The subordinate
economic and social position of women in many fishing communities in lowǦincome
countries makes them even more vulnerable. The fisherfolk communities also have low
access to STI care including HIV testing and health-care in general [114].
In conclusion, several factors may be associated with STIs and these factors will vary
depending with the study population. Consequently it is essential for researchers,
evaluating factors associated with STIs, to collect information on previous factors that
have been associated with STIs. But additionally also collect information on other factors
that they may consider to be important with regards to STIs, which may be unique to the
population they are working with.
37
Chapter One
1.3 References
1. Newman, L., et al. Global estimates of the prevalence and incidence of four curable
sexually transmitted infections in 2012 based on systematic review and global
reporting. PLoS One. 2015;10(12): p. e0143304.
2. Looker, K.J., et al. Effect of HSV-2 infection on subsequent HIV acquisition: an
updated systematic review and meta-analysis. Lancet Infect Dis. 2017;17(12):
1303-16.
3. Mullick, S., et al. Sexually transmitted infections in pregnancy: prevalence, impact
on pregnancy outcomes, and approach to treatment in developing countries. Sex
Trans Infect. 2005;81(4):294-302.
4. Newman, L., et al. Global estimates of syphilis in pregnancy and associated
adverse outcomes: analysis of multinational antenatal surveillance data. PLoS
Med. 2013;10(2):p. e1001396.
5. de Sanjose, S., et al., Worldwide prevalence and genotype distribution of cervical
human papillomavirus DNA in women with normal cytology: a meta-analysis.
Lancet Infect Dis. 2007. 7(7):453-9.
6. Moodley, P., et al. Trichomonas vaginalis is associated with pelvic inflammatory
disease in women infected with human immunodeficiency virus. Clin Infect Dis.
2002. 34(4):519-22.
7. Powell, W.N. Trichomonas vaginalis DONNE 1836: its morphologic
characteristics, mitosis and specific identity. Americ J Epi. 1936; 24(1):145-69.
8. Despommier D.D., et al. Trichomonas vaginalis (Donné 1836). In: Parasitic
Diseases: Springer, New York, NY; 1995.
9. Pereira-Neves, A., et al. Identification of Tritrichomonas foetus pseudocysts in
fresh preputial secretion samples from bulls. Vet Parasitol. 2011;175(1-2):1-8.
10. Dudek, B.M., et al. Prevalence and risk factors of Trichomonas Gallinae and
trichomonosis in golden eagle (Aquila chrysaetos) nestlings in Western North
America. J Wildl Dis. 2018.
11. Amin, A., et al. Axenization and optimization of in vitro growth of clonal cultures of
Tetratrichomonas gallinarum and Trichomonas gallinae. Exp Parasitol. 2010;
124(2): 202-8.
12. Zarei, Z., et al. Detection of pseudocyst forms of Trichomonas muris in rodents
from Iran. Iran J Public Health. 2018;47(5): 729-34.
13. Yao, C. and J.K. Ketzis. Aberrant and accidental trichomonad flagellate infections:
rare or underdiagnosed? Trans R Soc Trop Med Hyg. 2018;112(2):64-72.
14. Bastos, B.F., et al. Pentatrichomonas hominis infection in two domestic cats with
chronic diarrhea. JFMS Open Rep. 2018; 4(1): p. 2055116918774959.
15. Kellerova, P. and J. Tachezy. Zoonotic Trichomonas tenax and a new trichomonad
species, Trichomonas brixi n. sp., from the oral cavities of dogs and cats. Int J
Parasitol. 2017; 47(5):247-55.
16. Chudnovskiy, A., et al. Host-protozoan interactions protect from mucosal infections
through activation of the inflammasome. Cell. 2016;167(2):444-456.e14.
38
Chapter One
17. Arroyo, R., et al. Signalling of Trichomonas vaginalis for amoeboid transformation
and adhesion synthesis follows cytoadherence. Mol Microbiol. 1993;7(2): 299-309.
18. Petrin, D., et al. Clinical and microbiological aspects of Trichomonas vaginalis. Clin
Microbiol Rev. 1998;11(2):300-17.
19. Carlton, J.M., et al. Draft genome sequence of the sexually transmitted pathogen
Trichomonas vaginalis. Science. 2007;315(5809):207-12.
20. Goodman, R.P., et al. Clinical isolates of Trichomonas vaginalis concurrently
infected by strains of up to four Trichomonasvirus species (Family Totiviridae). J
Virol. 2011;85(9):4258-70.
21. Vohra, H., et al. Correlation of zymodeme patterns, virulence & drug sensitivity of
Trichomonas vaginalis isolates from women. Indian J Med Res. 1991;93:37-9.
22. Malla, N., et al. The presence of dsRNA virus in Trichomonas vaginalis isolates
from symptomatic and asymptomatic Indian women and its correlation with in vitro
metronidazole sensitivity. Indian J Med Microbiol. 2011; 29(2):52-7.
23. Torian, B.E., et al. Antigenic heterogeneity in the 115,000 Mr major surface antigen
of Trichomonas vaginalis. J Protozool.1988;35(2):273-80.
24. Upcroft, J.A., et al. Genotyping Trichomonas vaginalis. Int J Parasitol. 2006;36(7):
821-8.
25. Fraga, J., et al. Double-stranded RNA viral infection of Trichomonas vaginalis and
correlation with genetic polymorphism of isolates. Exp Parasit. 2011;127(2):593-9.
26. Crucitti, T., et al. Molecular typing of the actin gene of Trichomonas vaginalis
isolates by PCR-restriction fragment length polymorphism. Clin Microbiol Infect.
2008;14(9):844-52.
27. Kaul, P., et al. Trichomonas vaginalis: random amplified polymorphic DNA analysis
of isolates from symptomatic and asymptomatic women in India. Parasitol Int.
2004;53(3):255-62.
28. Conrad, M., et al. Microsatellite polymorphism in the sexually transmitted human
pathogen Trichomonas vaginalis indicates a genetically diverse parasite. Mol
Biochem Parasitol. 2011;175(1):30-8.
29. Conrad, M.D., et al. Extensive genetic diversity, unique population structure and
evidence of genetic exchange in the sexually transmitted parasite Trichomonas
vaginalis. PLoS Negl Trop Dis. 2012;6(3):e1573.
30. Unemo, M. and J.A. Dillon. Review and international recommendation of methods
for typing neisseria gonorrhoeae isolates and their implications for improved
knowledge of gonococcal epidemiology, treatment, and biology. Clin Microbiol
Rev. 2011;24(3):447-58.
31. Shafir, S.C. and F.J. Sorvillo. Viability of Trichomonas vaginalis in urine:
Epidemiologic and clinical implications. J Clinic Microbiol. 2006;44(10):3787-9.
32. Pereira-Neves, A. and M. Benchimol. Trichomonas vaginalis: in vitro survival in
swimming pool water samples. Exp Parasitol. 2008;118(3):438-41.
33. Crucitti, T., et al. Non-sexual transmission of Trichomonas vaginalis in adolescent
girls attending school in Ndola, Zambia. Plos One. 2011;6(1).
34. Danesh, I.S., J.M. Stephen, and J. Gorbach, Neonatal Trichomonas vaginalis
infection. J Emerg Med. 1995;13(1):51-4.
39
Chapter One
35. Carter, J.E. and K.C. Whithaus. Neonatal respiratory tract involvement by
Trichomonas vaginalis: a case report and review of the literature. Am J Trop Med
Hyg. 2008; 78(1):7-9.
36. Francis, S.C., et al., Prevalence of rectal Trichomonas vaginalis and Mycoplasma
genitalium in male patients at the San Francisco STD clinic, 2005-2006. Sex
Transm Dis. 2008; 35(9):797-800.
37. Van Der Pol, B. Clinical and laboratory testing for Trichomonas vaginalis infection.
J Clin Microbiol. 2016. 54(1):7-12.
38. Whittington, M.J., Epidemiology of Infections with Trichomonas vaginalis in the
light of improved diagnostic methods. Br J Vener Dis. 1957;33(2):80-9.
39. Street, D.A., D. Taylor-Robinson, and C.M. Hetherington. Infection of female
squirrel monkeys (Saimiri sciureus) with trichomonas vaginalis as a model of
trichomoniasis in women. Br J Vener Dis. 1983. 59(4):249-54.
40. Alderete, J.F. and G.E. Garza, Identification and properties of Trichomonas
vaginalis proteins involved in cytadherence. Infect Immun. 1988;56(1):28-33.
41. Krieger, J.N., M.A. Poisson, and M.F. Rein. Beta-hemolytic activity of Trichomonas
vaginalis correlates with virulence. Infect Immun. 1983;41(3):1291-5.
42. Mallinson, D.J., et al. Identification and molecular cloning of four cysteine
proteinase genes from the pathogenic protozoon Trichomonas vaginalis.
Microbiol. 1994;140 ( Pt 10):2725-35.
43. Gilbert, R.O., et al. Cytopathogenic effect of Trichomonas vaginalis on human
vaginal epithelial cells cultured in vitro. Infect Immun. 2000;68(7):4200-6.
44. Weston, T.E.T. and C.S. Nicol. Natural history of trichomonal infection in males.
Br J Vener Dis.1963;39(4):251-7.
45. Bowden, F.J. and G.P. Garnett. Trichomonas vaginalis epidemiology:
parameterising and analysing a model of treatment interventions. Sex Transm
Infect. 2000;76(4):248-56.
46. Sena, A.C., et al. Trichomonas vaginalis infection in male sexual partners:
implications for diagnosis, treatment, and prevention. Clin Infect Dis. 2007;44(1):
13-22.
47. Pastorek, J.G., 2nd, et al. Clinical and microbiological correlates of vaginal
trichomoniasis during pregnancy. The vaginal infections and prematurity study
group. Clin Infect Dis. 1996;23(5):1075-80.
48. Moodley, D., et al. Pregnancy outcomes in association with stds including genital
HSV-2 shedding in a South African cohort study. Sex Transm Infect.
2017;93(7):460-6.
49. Gumbo, F.Z., et al. Risk factors of HIV vertical transmission in a cohort of women
under a PMTCT program at three peri-urban clinics in a resource-poor setting. J
Perinatol. 2010; 30(11):717-23.
50. Schwebke, J.R. and E.W. Hook. High rates of Trichomonas vaginalis among men
attending a sexually transmitted diseases clinic: implications for screening and
urethritis management. J Infect Dis. 2003;188(3):465-8.
51. Iqbal, J., J. Al-Rashed, and E.O. Kehinde. Detection of Trichomonas vaginalis in
prostate tissue and serostatus in patients with asymptomatic benign prostatic
hyperplasia. BMC Infect Dis. 2016;16(1):506.
40
Chapter One
52. Benchimol, M., et al. Trichomonas adhere and phagocytose sperm cells: adhesion
seems to be a prominent stage during interaction. Parasitol Res. 2008;102(4): 597-
604.
53. Garber, G.E. The laboratory diagnosis of Trichomonas vaginalis. Can J Infect Dis
Med Microbiol. 2005.16(1):35-8.
54. Afzan, M.Y., S. Sivanandam, and G.S. Kumar. Modified field's staining--a rapid
stain for Trichomonas vaginalis. Diagn Microbiol Infect Dis. 2010; 68(2):159-62.
55. Krieger, J.N., et al. Diagnosis of trichomoniasis. Comparison of conventional wet-
mount examination with cytologic studies, cultures, and monoclonal antibody
staining of direct specimens. Jama, 1988. 259(8):1223-7.
56. Nathan, B., et al. Microscopy outperformed in a comparison of five methods for
detecting Trichomonas vaginalis in symptomatic women. Int J STD AIDS, 2015.
26(4): p. 251-6.
57. Sood, S., et al., InPouch TV culture for detection of Trichomonas vaginalis. Indian
J Med Res. 2007;125(4):567-71.
58. Mason, P.R. Serodiagnosis of Trichomonas vaginalis infection by the indirect
fluorescent antibody test. J Clin Pathol. 1979;32(12):1211-5.
59. Mathews, H.M. and G.R. Healy. Evaluation of two serological tests for
Trichomonas vaginalis infection. J Clin Microbiol.1983;17(5):840-3.
60. Sibau, L., et al. Enzyme-linked immunosorbent assay for the diagnosis of
trichomoniasis in women. Sex Transm Dis. 1987;14(4):216-20.
61. Papp J.R., et al. Recommendations for the laboratory-based detection of
Chlamydia trachomatis and Neisseria gonorrhoeae 2014. MMWR Recomm Rep.
2014;63(Rr-02):1-19.
62. Schwebke, J.R., et al. Molecular testing for Trichomonas vaginalis in women:
results from a prospective U.S. clinical trial. J Clin Microbiol. 2011;49(12):4106-11.
63. Lord, E., et al. Detecting asymptomatic Trichomonas vaginalis in females using the
BD ProbeTec Trichomonas vaginalis Q(x) nucleic acid amplification test. Int J STD
AIDS. 2017;28(4):357-61.
64. Gaydos, C.A., et al. Rapid diagnosis of Trichomonas vaginalis by testing vaginal
swabs in an isothermal helicase-dependent AmpliVue™ assay. Sex Transm Dis.
2016;43(6):369-73.
65. Gaydos, C.A., et al. Clinical performance of the Solana(R) point-of-care
trichomonas assay from clinician-collected vaginal swabs and urine specimens
from symptomatic and asymptomatic women. Expert Rev Mol Diagn. 2017;17(3):
303-6.
66. Schwebke, J.R., et al. Clinical evaluation of the cepheid Xpert TV assay for
detection of Trichomonas vaginalis with prospectively collected specimens from
men and women. J Clin Microbiol. 2018;56(2).
67. Australian Sexual Health Alliance.2017;Available from:
http://www.sti.guidelines.org.au/sexually-transmissible-
infections/trichomoniasis#management. Accessed 20 JUNE 2018.
68. British Association for Sexual Health and HIV. 2014; Available from:
https://www.bashhguidelines.org/current-guidelines/vaginal-
discharge/trichomonas-vaginalis-2014/. Accessed 20 JUNE 2018.
41
Chapter One
69. Center for Disease Control and Prevention. 2015; Available from:
https://www.cdc.gov/std/tg2015/trichomoniasis.htm. Accessed 20 JUNE 2018.
70. World Health Organisation. 2001; Available from:
http://apps.who.int/medicinedocs/en/d/Jh2942e/4.9.html#Jh2942e.4.9. Accessed
20 JUNE 2018.
71. Kissinger, P., et al. A randomized treatment trial: single versus 7-day dose of
metronidazole for the treatment of Trichomonas vaginalis among HIV-infected
women. J Acquir Immune Defic Syndr. 2010;55(5):565-71.
72. Howe, K. and P.J. Kissinger. Single-dose compared with multidose metronidazole
for the treatment of trichomoniasis in women: a meta-analysis. Sex Transm Dis.
2017;44(1):29-34.
73. Dunne, R.L., et al. Drug resistance in the sexually transmitted protozoan
Trichomonas vaginalis. Cell Res. 2003;13(4):239-49.
74. Rasoloson, D., et al. Metronidazole-resistant strains of Trichomonas vaginalis
display increased susceptibility to oxygen. Parasitol. 2001;123(Pt 1):45-56.
75. Upcroft, P. and J.A. Upcroft. Drug targets and mechanisms of resistance in the
anaerobic protozoa. Clin Microbiol Rev. 2001;14(1):150-64.
76. Schwebke, J.R., S.Y. Lensing, and J. Sobel. Intravaginal
metronidazole/miconazole for the treatment of vaginal trichomoniasis. Sex Transm
Dis. 2013;40(9):710-4.
77. Daugherty, M., K. Glynn, and T. Byler. The prevalence of Trichomonas vaginalis
infection among US males, 2013-2016. Clin Infect Dis, 2018.
78. Ronda, J., et al. Does the sex risk quiz predict Mycoplasma genitalium Infection in
urban adolescents and young adult women?. Sex Transm Dis. 2018.
79. Teasdale, C.A., et al. Incidence of sexually transmitted infections during
pregnancy. PLoS One. 2018. 13(5):e0197696.
80. Shahesmaeili, A., et al. Symptom-based versus laboratory-based diagnosis of five
sexually transmitted infections in female sex workers in Iran. AIDS Behav. 2018.
81. Garrett, N.J., et al. Beyond syndromic management: opportunities for diagnosis-
based treatment of sexually transmitted infections in low- and middle-income
countries. PLoS One. 2018.13(4):e0196209.
82. Ijasan, O., K.S. Okunade, and A.A. Oluwole. The prevalence and risk factors for
Trichomonas vaginalis infection amongst human immunodeficiency virus-infected
pregnant women attending the antenatal clinics of a university teaching hospital in
Lagos, South-Western, Nigeria. Niger Postgrad Med J. 2018;25(1):21-26.
83. Zia, Y., et al. Assessing prevalence of missed laboratory-confirmed sexually
transmitted infections among women in Kingston, Jamaica: results from a
secondary analysis of the sino-Implant clinical trial. BMJ Open. 2018;8(4):
e019913.
84. Dionne-Odom, J., et al. Sexually transmitted infection prevalence in women with
HIV: is there a role for targeted screening?. Sex Transm Dis. 2018.
85. Davey, D.J., et al. Sexual behaviors of HIV-infected pregnant women and factors
associated with sexual transmitted infection in South Africa. Sex Transm Dis. 2018.
86. Sarier, M., et al. Prevalence of sexually transmitted diseases in asymptomatic
renal transplant recipients. Exp Clin Transplant. 2018.
42
Chapter One
87. Price, C.M., et al. Prevalence and detection of Trichomonas vaginalis in HIV-
infected pregnant women. Sex Transm Dis. 2018; 45(5):332-36.
88. Schwebke, J., et al. Screening for Trichomonas vaginalis in a large high-risk
population: prevalence among men and women determined by nucleic acid
amplification testing. Sex Transm Dis. 2018; 45(5):e23-e24.
89. Jacob, L., et al. Prevalence and treatment of sexually transmitted diseases in
gynecological practices in Germany: A retrospective study with more than
1,000,000 patients. Int J Clin Pharmacol Ther. 2018; 56(5):212-6.
90. Barnabas, S.L., et al. Converging epidemics of sexually transmitted infections and
bacterial vaginosis in southern African female adolescents at risk of HIV. Int J STD
AIDS. 2018; 29(6):531-9.
91. Wynn, A., et al. Prevalence and treatment outcomes of routine Chlamydia
trachomatis, Neisseria gonorrhoeae and Trichomonas vaginalis testing during
antenatal care, Gaborone, Botswana. Sex Transm Infect. 2018;94(3):230-5.
92. Field, N., et al., Trichomonas vaginalis infection is uncommon in the British general
population: implications for clinical testing and public health screening. Sex
Transm Infect. 2018;94(3):226-9.
93. Vargas, L., et al., High prevalence of syphilis in parturient women and congenital
syphilis cases in public maternities in Salvador-Bahia Brazil. Bjog. 2018.
94. Sanders, E.J., et al., High prevalence of Chlamydia trachomatis and Neisseria
gonorrhoeae infections among HIV-1 negative men who have sex with men in
coastal Kenya. Sex Transm Infect. 2010;86(6):440-1.
95. Platteau, T., et al. Sexual behavior and sexually transmitted infections among
swingers: results from an online survey in Belgium. J Sex Marital Ther. 2017;43(8):
709-19.
96. van de Wijgert, M. and V. Jespers. The global health impact of vaginal dysbiosis.
Res Microbiol. 2017; 168(9):859-64.
97. Jespers, V., et al. Prevalence and correlates of bacterial vaginosis in different sub-
populations of women in sub-Saharan Africa: a cross-sectional study. PLoS One.
2014. 9(10): e109670.
98. Brotman, R.M., et al. A longitudinal study of vaginal douching and bacterial
vaginosis a marginal structural modeling analysis. Am J Epidemiol. 2008;
15;168(2):188-96.
99. Chersich, M.F., et al. Heavy episodic drinking among Kenyan female sex workers
is associated with unsafe sex, sexual violence and sexually transmitted infections.
Int J STD AIDS. 2007;18(11):764-9.
100. Harling, G., et al. Socioeconomic disparities in sexually transmitted infections
among young adults in the United States: examining the interaction between
income and race/ethnicity. Sex Transm Dis. 2013. 40(7):575-81.
101. Hogben, M. and J.S. Leichliter. Social determinants and sexually transmitted
disease disparities. Sex Transm Dis. 2008;35(12 Suppl):S13-8.
102. Winston, S.E., et al. Prevalence of sexually transmitted infections including HIV in
street-connected adolescents in western Kenya. Sex Transm Infect. 2015; 91(5):
353-9.
43
Chapter One
103. Miller, W.C., et al. The prevalence of trichomoniasis in young adults in the United
States. Sex Transm Dis. 2005;32(10):593-8.
104. Hallfors, D.D., et al. Sexual and drug behavior patterns and HIV and STD racial
disparities: the need for new directions. Am J Public Health. 2007;97(1):125-32.
105. Svensson, P., et al. A meta-analysis and systematic literature review of factors
associated with sexual risk-taking during international travel. Travel Med Infect Dis.
2018;S1477-8939(18):30045.
106. Botao, C., et al. Prevalence of HIV and associated risk factors among long distance
truck drivers in inchope, mozambique. 2012. AIDS Behav. 2016; 20(4):811-20.
107. Delany-Moretlwe, S., et al. HIV prevalence and risk in long-distance truck drivers
in South Africa: a national cross-sectional survey. Int J STD AIDS. 2014; 25(6):
428-38.
108. Azuonwu, O., O. Erhabor, and N. Frank-Peterside. HIV infection in long-distance
truck drivers in a low income setting in the Niger Delta of Nigeria. J Community
Health. 2011;36(4):583-7.
109. Ghebremichael, M., U. Larsen, and E. Paintsil. Association of age at first sex with
HIV-1, HSV-2, and other sexual transmitted infections among women in northern
Tanzania. Sex Transm Dis. 2009; 36(9):570-6.
110. Harrison, A., et al. Early sexual debut among young men in rural South Africa:
heightened vulnerability to sexual risk?. Sex Trans Infect. 2005;81(3):259-61.
111. Slaymaker, E. A critique of international indicators of sexual risk behaviour. Sex
Trans Infect. 2004;80(suppl 2):ii13-ii21.
112. Opio, A., M. Muyonga, and N. Mulumba. HIV infection in fishing communities of
lake victoria basin of Uganda a cross-sectional sero-behavioral survey. PLoS One.
2013;8(8):e70770.
113. Bogart, L.M. Barriers to linkage to HIV Care in Ugandan fisherfolk communities: A
Qualitative Analysis. AIDS Behav. 2016;20(10):2464-76.
114. Smolak, A. A meta-analysis and systematic review of HIV risk behavior among
fishermen. AIDS Care. 2014; 26(3):282-91.
44
Chapter Two | Outline and Objectives
45
Chapter Two
2 Outline
This Chapter provides an outline and the objectives of this dissertation. Sub-Saharan
Africa (sSA) has the highest rates of curable Sexually Transmitted Infections (STI)
worldwide, and more specifically of Trichomonas vaginalis (T. vaginalis), the most
common non-viral STI. T. vaginalis affects both men and women but is more common in
women. Chapter 3 covers the epidemiology of curable STIs among pregnant women in a
rural county hospital in Kilifi, Kenya. Chapter 4 covers urogenital pathogen correlates of
Trichomonas vaginalis among pregnant women in Kilifi, Kenya. Chapter 5 discusses
Trichomonas vaginalis genotypes and their association with Trichomonas vaginalis
viruses. Chapter 6 discusses the interaction of Trichomonas vaginalis and the vaginal
microbiome. Chapter 7 discusses the interaction of Trichomonas vaginalis and HIV.
Objective 1. In sSA, epidemiological data on curable STIs, including risk factors among
pregnant women in rural areas, are very scarce, although they are necessary to design
and implement curable STI prevention and treatment strategies. Therefore, the first
objective of this dissertation was to assess the prevalence and risk factors associated
with curable STIs among pregnant women at a rural county hospital in Kilifi, Kenya. This
objective is addressed in Chapter 3.
Objective 2. Classical screening of STIs is frequently only oriented towards the

diagnosis of chlamydia, gonorrhea, syphilis and trichomoniasis, while pathogens, such as
Mycoplasma genitalium among others, which demonstrate similar urogenital syndromes,
remain undiagnosed and/or untreated. Determining pathogens associated with
Trichomonas vaginalis, which is the most common curable STI may influence optimal
patient management. Therefore, the second objective of this dissertation was to assess
the urogenital pathogen correlates of Trichomonas vaginalis among pregnant women in
Kilifi, Kenya. This objective is addressed in Chapter 4.
46
Chapter Two
Objective 3. At present, little is known regarding the degree of strain variability within
the species T. vaginalis as no data exists about the genetic diversity of T. vaginalis in
Kenya. Therefore, the third objective of this dissertation was to assess the genetic
diversity of T. vaginalis isolates among pregnant women in Kilifi, Kenya. This objective is
addressed in Chapter 5.
Objective 4. Although the significance of the human vaginal microbiome for health and
disease is increasingly acknowledged, differences in the composition of the vaginal
microbiome upon infection with different sexually transmitted pathogens remains
generally under explored. Therefore, the fourth objective of this dissertation was to
describe the vaginal microbiome of pregnant women in relation to Trichomonas vaginalis
and Chlamydia trachomatis. This objective is addressed in Chapter 6.
Objective 5. Individuals infected with T. vaginalis are thought to be at an increased risk

of acquiring HIV and to have increased genital shedding of HIV compared to those
individuals not infected with T. vaginalis. Therefore, the fifth objective of this dissertation
was to assess to what extent T. vaginalis infection is: associated with HIV acquisition.
This was achieved by means of systematic review and meta-analysis. This objective is
addressed in Chapter 7.
Finally, Chapters 8 and 9 summarize the objectives and main findings of this dissertation
and provide future perspectives.
47
48
Chapter Three | Prevalence and risk factors of curable
sexually transmitted infections
49
RESEARCH ARTICLE
High prevalence of curable sexually

transmitted infections among pregnant
women in a rural county hospital in Kilifi,
Kenya
Simon Chengo Masha1,2,3 , Elizabeth Wahome1, Mario Vaneechoutte2, Piet Cools2,
Tania Crucitti4, Eduard J. Sanders1,5
1 Centre for Geographic Medicine Research–Coast, Kenya Medical Research Institute (KEMRI), Kilifi,
a1111111111
Kenya, 2 Laboratory Bacteriology Research, Faculty of Medicine and Health Sciences, Ghent University,
a1111111111 Ghent, Belgium, 3 Pwani University, Faculty of Pure and Applied Sciences, Department of Biological
a1111111111 Sciences, Kilifi, Kenya, 4 HIV/STI Reference Laboratory, Department of Clinical Sciences, Institute of
a1111111111 Tropical Medicine, Antwerp, Belgium, 5 Nuffield Department of Medicine, University of Oxford, Headington,
a1111111111 United Kingdom
* schengo@kemri-wellcome.org
23(1 $&&(66 Abstract

Citation: Masha SC, Wahome E, Vaneechoutte M,
Cools P, Crucitti T, Sanders EJ (2017) High
prevalence of curable sexually transmitted Background
infections among pregnant women in a rural
Women attending antenatal care (ANC) in resource-limited countries are frequently
county hospital in Kilifi, Kenya. PLoS ONE 12(3):
e0175166. https://doi.org/10.1371/journal. screened for syphilis and HIV, but rarely for other sexually transmitted infections (STIs). We
pone.0175166 assessed the prevalence of curable STIs, defined as infection with either Chlamydia tracho-
Editor: David N. Fredricks, Fred Hutchinson Cancer matis or Neisseria gonorrhoeae or Trichomonas vaginalis, from July to September 2015.
Research Center, UNITED STATES
Received: December 16, 2016 Methods

Accepted: March 21, 2017 In a cross-sectional study, women attending ANC at the Kilifi County Hospital, Kenya, had a
urine sample tested for C. trachomatis/N. gonorrhoeae by GeneXpert and a vaginal swab
Published: March 31, 2017
for T. vaginalis by culture. Bacterial vaginosis (BV) was defined as a Nugent score of 7–10
Copyright: 2017 Masha et al. This is an open
of the Gram stain of a vaginal smear in combination with self-reported vaginal discharge.
access article distributed under the terms of the
Creative Commons Attribution License, which Genital ulcers were observed during collection of vaginal swabs. All women responded to
permits unrestricted use, distribution, and questions on socio-demographics and sexual health and clinical symptoms of STIs. Predic-
reproduction in any medium, provided the original tors for curable STIs were assessed in multivariable logistic regression.
author and source are credited.
Data Availability Statement: All relevant data are Results

within the paper and its Supporting Information
files. A total of 42/202 (20.8%, 95% confidence interval (CI):15.4–27.0) women had a curable
Funding: SCM is supported for his PhD by the
STI. The prevalence was 14.9% for C. trachomatis (95% CI:10.2–20.5), 1.0% for N. gonor-
Belgian Development Cooperation. SCM received rhoeae (95% CI: 0.1–3.5), 7.4% for T. vaginalis (95% CI:4.2–12.0), 19.3% for BV (95% CI:
Investigator initiated research funds from 14.1–25.4) and 2.5% for genital ulcers (95% CI: 0.8–5.7). Predictors for infection with cur-
International AIDS Vaccine Initiative, who are
able STIs included women with a genital ulcer (adjusted odds ratio (AOR) = 35.0, 95% CI:
funded by USAID. The Kenya Medical Research
Institute-Wellcome Trust Research Programme 2.7–461.6) compared to women without a genital ulcer, women who used water for cleaning
(KWTRP) at the Centre for Geographical Medicine after visiting the toilet compared to those who used toilet paper or other solid means (AOR =
PLOS ONE | https://doi.org/10.1371/journal.pone.0175166 March 31, 2017 1 / 16

50
Curable sexually transmitted infections among pregnant women in Kilifi, Kenya
Research-Kilifi is supported by core funding from 4.1, 95% CI:1.5–11.3), women who reported having sexual debut 17 years compared to
the Wellcome Trust (#077092). The funders had no women having sexual debut 18 years (AOR = 2.7, 95% CI:1.1–6.6), and BV-positive
role in study design, data collection and analysis,
decision to publish, or preparation of the
women (AOR = 2.7, 95% CI:1.1–6.6) compared to BV-negative women.
manuscript.
Competing interests: The authors have declared Conclusion

that no competing interests exist.
One in five women attending ANC had a curable STI. These infections were associated with
genital ulcers, hygiene practices, early sexual debut and bacterial vaginosis.
Introduction
Sexually transmitted infections (STIs) are a major public health concern globally and especially
among women in resource-limited countries [1]. Common curable STIs among women in
sub-Saharan Africa (sSA) include Chlamydia trachomatis, Neisseria gonorrhoeae and Tricho-
monas vaginalis [2]. Additionally, bacterial vaginosis (BV), which has been associated with an
increased risk of incident infection with C. trachomatis and N. gonorrhoeae [3, 4], is highly
prevalent [5]. These curable STIs and BV have been associated with a number of adverse preg-
nancy outcomes such as spontaneous abortion, ectopic pregnancy, preterm delivery, low birth
weight, stillbirth, postpartum sepsis, and congenital infection [6]. Infants born of mothers with
genital C. trachomatis are at an increased risk of suffering from neonatal pneumonia and oph-
thalmia neonatorum [7]. At present the efficacy of neonatal ocular prophylaxis with erythro-
mycin for prevention of C. trachomatis ophthalmia is not clear [8]. These associated sequelae
of STIs hence necessitate prevention and management of curable STIs and BV, especially dur-
ing pregnancy.
Pregnant women attending antenatal care (ANC) in resource-limited countries are fre-
quently screened for syphilis [9] and HIV [10], but rarely for other curable STIs or BV. More-
over, curable STIs and BV are associated with increased acquisition and transmission of HIV
[11–13]. Among pregnant HIV positive women C. trachomatis is associated with increased
risk of HIV mother-to-child transmission [14]. Many resource-limited countries have adopted
the World Health Organization’s syndromic approach for the management of curable STI
[15]. This syndromic approach is deficient in both sensitivity and specificity because STIs may
be asymptomatic or have non-specific clinical signs and symptoms [16, 17].
There is a paucity of epidemiological and risk factor data on curable STIs among women
residing in rural areas, including among pregnant women in coastal Kenya. Most of the recent
information about the prevalence of curable STIs among women in Kenya has been from stud-
ies done among high-risk individuals [18], women residing in cities [19, 20] or from regions
with high incidence of HIV [13]. Consequently, we assessed the prevalence and predictors of
curable STIs in pregnant women attending ANC at a rural county hospital in Coastal Kenya.
Methods
This was a cross-sectional study conducted from July to September 2015, at the ANC clinic of
the Kilifi County Hospital (KCH), Kenya, a clinic attended to by approximately 4,000 women
annually [21]. We aimed to enroll a convenience sample of 350 consecutive pregnant women
to identify 20–25 women with T. vaginalis for detailed molecular studies of T. vaginalis and
assessment of the vaginal microbiome. Here, we report on a sub-study of 202 women who
were tested for curable STIs, i.e. C. trachomatis, N. gonorrhoeae, T. vaginalis, and for BV.

51
Procedures
Recruitment: A nurse at the ANC clinic provided general information about the study to
women who had completed their ANC visit. Women interested to know more about the study
were invited to participate and up to nine consecutive women were enrolled per day.
Inclusion criteria: Women were eligible if they met the following criteria: age 18–45 years,
gestation 14 weeks, resident of the Kilifi Health and Demographic Surveillance area [22]
and willing to undergo free STI and BV screening procedures.
Study procedures: Consenting women underwent a short private interview with the nurse
at the ANC clinic using a structured questionnaire capturing symptoms of vaginal infections.
This was followed by a collection of vaginal swabs by the ANC nurse. During the collection of
vaginal swabs, the nurse observed for abnormal vaginal discharge and genital ulcers. Three
vaginal swabs were collected, by inserting one swab at a time approximately 2 inches into the
vaginal opening and gently turning around twice ensuring rubbing the swab against the vagi-
nal wall.
The first swab was used for BV diagnosis and vaginal smears were prepared by rolling the
swab onto a microscope glass slide. Slides were air-dried at the clinic before being transported
to the laboratory for heat fixation followed by Gram staining and microscopy using the scoring
system described by Nugent [23]. Women who self-reported discharge and had a Nugent
score of 7–10 were considered BV-positive, and were treated as recommended [8]. Women
with a Nugent score of 7–10 but without discharge were considered BV-negative.
The second swab was used to diagnose T. vaginalis using a commercially available T. vagi-
nalis InPouchTM system (BioMed Diagnostics, White City, Oregon, USA). The vaginal swab
was inoculated in the upper-chamber of the InPouch at the clinic. The inoculated InPouch was
transferred to the laboratory for direct microscopy of the upper chamber, after which the
upper chamber was merged with the lower chamber and incubated at 37˚C. Daily microscopy
was performed and samples with motile trichomonads within 5 days of culture were consid-
ered positive for T. vaginalis.
The third swab was placed in a sterile labeled 2 ml Eppendorf tube, the swab shaft was broken
by bending the shaft against the neck of the Eppendorf tube. The bottom portion of the swab with
the specimen was transported to the laboratory where it was immediately stored at -80˚C for
molecular studies of the vaginal microbiome. No transport or freezing medium was added.
Women provided fresh first catch urine for C. trachomatis and N. gonorrhoeae testing, that
was performed by the GeneXpert1 CT/NG Assay (Cepheid, Sunnyvale, California), according
to the manufacturer’s instructions.
Results for C. trachomatis, N. gonorrhoeae, for T. vaginalis direct microscopy and for BV
were reported on the same day of the visit, and STI and BV treatment was offered according to
Kenyan national guidelines [24], except for treatment of N. gonorrhoeae where ceftriaxone was
used in place of quinolones [25]. Women who were negative on T. vaginalis direct microscopy
but positive on culture were contacted to return to the ANC clinic for treatment immediately
after the culture turned positive. Treatment was also offered for the partners of the women
with curable STIs.
Syphilis and HIV test results were obtained from each participant’s ANC records. Syphilis
results were based on testing for treponemal antibodies only, done at the hospital laboratory
using a commercial test kit Advanced Quality One Step Anti-TP (InTec products INC, Xia-
men, China). Rapid HIV testing was done by the Alere Determine HIV-1/2 kit (Alere Medical
Co Ltd, Chiba, Japan), the First response HIV 1-2-0 kit (Premier Medical Corporation Lim-
ited, Daman, India) was used to confirm positive results, and the Uni-Gold kit (Trinity Bio-
tech, Wicklow, Ireland) was used to resolve any discordant test results.

52
After clinical procedures were completed, all study participants were interviewed. The
interviews were conducted in Kiswahili by a trained female fieldworker. The questionnaire
covered sociodemographic, hygienic and sexual behavior questions. These included age, edu-
cation level, marital status, number of children, occupation, consumption of alcohol, con-
sumption of tobacco and other substances, age at first sex, number of sexual partners, history
of STIs, and hygiene and sanitary practices.
Ethical considerations
The study was approved by the KEMRI Scientific and Ethics Review Unit (#3022). All partici-
pants provided written informed consent for study participation. Permission to use hospital
records on syphilis and HIV status was obtained from Kilifi County Health department.
Data analysis
Data were entered in the REDCapTM electronic data capture tool, version 6.5.0 (Vanderbilt
University, Nashville, Tennessee). Prevalence of STIs was determined as the number of partici-
pants with either C. trachomatis, N. gonorrhoeae and/or T. vaginalis out of 202 women that
could be tested, expressed as a percentage. Exact 95% binomial confidence intervals (CIs) were
calculated for prevalence estimates. Bivariable logistic regression was used to determine associ-
ations of sociodemographic, hygienic, behavioral and clinical characteristics with curable STIs.
Variables significant at p 0.1 in bivariable analysis were entered into a multivariable model
to identify independent associations. Crude odds ratios (COR) and adjusted odds ratios
(AOR) were calculated. These statistical analyses were done using STATA version 13.1 (Stata-
Corp, College Station, Texas).
Results
From June to September 2015, a total of 373 women were invited to participate in the study.
Twenty-three (6.2%) women declined to participate citing no interest in research, lacking time or
having no permission from spouse/partner as the main reasons. Of the 350 women enrolled, 148
(42.3%) women did not have C. trachomatis and N. gonorrhoeae tests performed due the unavail-
ability of the tests at the beginning of the study. Therefore, a total of 202 women were tested for
C. trachomatis, N. gonorrhoeae, T. vaginalis and BV and were included in this sub-analysis (Fig 1).
Characteristics of the study population

The median age and gestation age including the interquartile range (IQR) for the participants
was 26 (22–31) years and 24 (20–28) weeks respectively. The majority of the participants were
married (93.6%) and Christian (72.3%). A quarter of the participants had secondary school
education and above. The median age and IQR of sexual debut was 18 (16–20) years, although
20.8% of the participants were not sure or did not respond to this question. Forty-two percent
of the participants had given birth before and the number of children ranged from 1–7. Sixty-
two percent of the participants had previously experienced signs/symptoms associated with
reproductive tract infection and one third had ever received syndromic treatment for genital
signs or symptoms of infection. The socio-demographic characteristics of the participants are
summarized in Table 1.
Prevalence of curable STIs, BV, HIV and syphilis

A total of 20.8% (42/202) (95% confidence interval (CI): 15.4–27.0) women had a curable STI
and 19.4% (39/202) (95% CI: 14.2–25.6) women had BV i.e. Nugent score of 7–10 and reported

53
Fig 1. Flow chart of women attending antenatal care clinic at Kilifi County Hospital invited to
participate in the study, June- September 2015
https://doi.org/10.1371/journal.pone.0175166.g001
vaginal discharge. The prevalence was 14.9% for C. trachomatis (95% CI: 10.2–20.5), 1.0% for
N. gonorrhoeae (95% CI: 0.1–3.5) and 7.4% for T. vaginalis (95% CI: 4.2–12.0) (Fig 1). Five
(11.9%) women had more than one STI, while 13 (31%) out of the 42 women with a curable
STI also had BV. Only two women (1.0%) had asymptomatic BV and none of them had a cur-
able STI (data not shown).
Thirteen women were HIV-positive, a prevalence of 6.4% (95% CI: 3.4–10.8), including
four (2.0%; 95% CI: 0.5–5.0) women who were newly diagnosed. Of note, HIV prevalence in
82 women aged 18–24 vs. 120 women aged 25 years was 0% vs. 10.8% (p = 0.002). All nine
HIV positive women who knew their status were on anti-retroviral therapy. Among the 13
women with HIV, three women had curable STIs, i.e. a prevalence of 23.1% (95% CI: 5.0–
53.8). All women with HIV and a curable STI also had BV. The prevalence of curable STIs, or
BV in the 13 women with HIV was not statistically significantly different from that of the 189
women without HIV (data not shown).
Two women had treponemal antibodies, a prevalence of 1.0% (95% CI: 0.1–3.6). Prevalence
of HIV, treponemal antibodies and T. vaginalis for the 148 women who were not tested for C.
trachomatis and N. gonorrhoeae was not statistically significantly different than the prevalence
of HIV, syphilis, and T. vaginalis in the 202 tested for C. trachomatis and N. gonorrhoeae in the
sub-study.
Clinical signs and symptoms

The most commonly self-reported symptoms amongst all participants were vaginal discharge
(73.8%) and lower abdominal pain (46.5%). However, during collection of specimen by the
study nurse, only 17.3% of the participants had an abnormal discharge (defined as excess

54
Table 1. Socio-demographic, hygienic, and behavioral characteristics of 202 women attending ante-
natal care and tested for sexually transmitted infections and bacterial vaginosis in Kilifi County Hos-
pital, Kenya, July-September 2015.
Total Positive for curable STIs n = 42
n = 202 (%)
Demographic characteristics
Age group (Years)
18–24 82 24 (29.3)
25 120 18 (15.0)
Religion
Christian 146 28(19.2)
Muslim 28 7 (25.0)
Other/None 28 7 (25.0)
Education
None 35 7 (20.0)
Primary 118 26 (22.0)
Secondary/Tertiary 49 9 (18.4)
Marital status
Single 13 5 (38.5)
Married 189 37 (19.6)
Residency
Living with partner 138 27 (19.6)
Not living with the partner 64 15 (23.4)
Employment status
Employed/self-employed 115 20 (17.4)
Unemployed 87 22 (25.3)
Parity
0 58 15 (25.9)
1–2 69 17 (24.6)
3+ 75 10 (13.3)
Gestational age (weeks)**
14–25 114 24 (21.1)
26 87 18 (20.7)
Hygiene characteristics
Toilet type
Flushing toilet 75 15 (20.0)
Pit latrine 105 22 (21.0)
Bush/Other 22 5 (22.7)
Mode of cleaning after visiting the toilet
Tissue paper/other solid materials 64 7 (10.9)
Water 138 35 (25.4)
Vaginal washing when bathing ‡
External 32 6 (18.8)
Internal 166 35 (21.1)
Behavioral characteristics
Sexual debut age (years)
17 64 21 (32.8)
18 96 14 (14.6)
Don’t know/no response 42 7 (16.7)
Number of lifetime sex partners
1 96 16 (16.7)
(Continued )

55
Table 1. (Continued)

n = 202 (%)
2+ 106 26 (24.5)
Partner had other sexual partners in the last 6
months
No 182 38 (20.9)
Yes 20 4 (20.0)
Alcohol consumption ever
No 160 35 (21.9)
Yes 42 7 (16.7)
Tobacco smoking/chewing ever
No 191 41 (21.5)
Yes 11 1 (9.1)
Drugs/substance use ever
No 194 39 (20.1)
Yes 8 3 (37.5)
Sexually transmitted infections/ reproductive tract
infection
HIV
Negative 189 39 (20.6)
Positive 13 3 (23.1)
Syphilis
Negative 198 42 (21.2)
Positive 2 0 (0.0)
Bacterial vaginosis*
Negative 162 29 (17.9)
Positive 39 13 (33.3)
Clinical signs and symptoms of STI¥
Previous history of vaginal discharge
No 75 13 (17.3)
Yes 127 29 (22.8)
Previous syndromic treatment of genital infection
No 136 28 (20.6)
Yes 66 14 (21.2)
Current vaginal discharge (self-reported)
No 52 10 (19.2)
Yes 149 32 (21.5)
Abnormal vaginal discharge foul smell/color
(observed)
No 165 32 (19.4)
Yes 36 10 (27.8)
Dysuria
No 159 32 (20.1)
Yes 42 10 (23.8)
Dyspareunia
No 150 29 (19.3)
Yes 51 13 (25.5)
Vaginal itching
No 146 31 (21.2)
Yes 55 11 (20.0)
(Continued)

56

n = 202 (%)
Lower abdominal pain
No 107 24 (22.4)
Yes 94 18 (19.1)
Genital warts
No 196 40 (20.4)
Yes 5 2(40.0)
Genital ulcer (observed)
No 196 38 (19.4)
Yes 5 4 (80.0)
Vaginitis
No 195 40 (20.5)
Yes 6 2 (33.3)
Curable STIs = Infection with any of the following sexually transmitted infectious agents: Chlamydia
trachomatis, Neisseria gonorrheae and/or Trichomonas vaginalis
‡ Four participants did not respond to this question
*Bacterial vaginosis result for one participant was not available
** Gestational age for one participant was missing
*** Syphilis hospital records for two participants were unavailable.
¥
Clinical signs and symptoms of STI records for one participant were missing.
https://doi.org/10.1371/journal.pone.0175166.t001
discharge/foul smelling discharge/colored discharge) upon examination. Five (2.5%) women

had genital ulcers upon examination, of which 4 (9.6%) of the 42 women with a curable STI vs.
1 (0.6%) of the 159 women without a curable STI (p = 0.001). None of the women with genital
ulcers had HIV or treponemal antibodies. Other self-reported clinical signs or symptoms were
not associated with curable STIs.
Based on symptoms routinely used in syndromic management of STIs (i.e. genital ulcer,
lower abdominal pain or abnormal vaginal discharge), 45.2% of the 42 women with curable
STIs were asymptomatic.
Risk factors/predictors
In bivariable analysis, curable STIs were more common among participants who were 24
years, had less than 3 children, had a sexual debut 17 years, used water to clean themselves
after visiting the toilet, had a genital ulcer or were BV positive (Table 2).
In multivariable analysis, independent predictors associated with curable STIs included
women with a genital ulcer (AOR = 35.0, 95% CI: 2.7–461.6) compared to women without a
genital ulcer, women who used water for cleaning after visiting the toilet compared to those
who used toilet paper or other solid materials (AOR = 4.1, 95% CI: 1.5–11.3), women who
reported having sexual debut 17 years compared to women having sexual debut 18 years
(AOR = 2.7, 95% CI: 1.1–6.6), and BV-positive women (AOR = 2.7, 95% CI: 1.1–6.6) com-
pared to BV-negative women (Table 2).
Discussion
We found that one in five out of 202 pregnant women attending the ANC at the Kilifi County
Hospital, Kenya, during the period July to September 2015 had at least one curable STI. The

57
Table 2. Bivariable and multivariable analysis of socio-demographic, hygienic, behavioral, and clinical characteristics of pregnant women with
curable sexually transmitted infections attending antenatal clinic at Kilifi County Hospital, July—September 2015 (n = 202).
CurableSTIs n(%) Bivariable analysis Multivariable analysis
Demographic characteristics COR (95% C.I) P- AOR (95% C.I) P-value
value
Age group (Years)
18–24 24 (29.3) 2.3 (1.2–4.7) 0.016 1.8 (0.7–4.4) 0.226
25 18 (15.0) Ref
Religion
Christian 28 (19.2) Ref
Muslim 7 (25.0) 1.4 (0.5–3.6) 0.483 - -
Other/None 7 (25.0) 1.4 (0.5–3.6) 0.483 - -
Education
None 7 (20.0) Ref
Primary 26 (22.0) 1.1 (0.4–2.9) 0.797 - -
Secondary/Tertiary 9 (18.4) 0.9 (0.3–2.7) 0.851 - -
Marital status
Single 5 (38.5) Ref
Married 37 (19.6) 0.4 (0.1–1.3) 0.115 - -
Residency
Living with partner 27 (19.6) Ref
Not living with partner 15 (23.4) 1.3 (0.6–2.6) 0.529 - -
Employment status
Employed/self-employed 20 (17.4) Ref
Unemployed 22 (25.3) 1.6 (0.8–3.2) 0.173 - -
Parity
0 15 (25.9) 2.3 (0.9–5.5) 0.071 2.7 (0.8–8.9) 0.111
1–2 17 (24.6) 2.1 (0.9–5.0) 0.087 1.9 (0.7–5.2) 0.237
3+ 10 (13.3) Ref
Gestational age (weeks)
14–25 23 (20.5) Ref
26 18 (20.7) 1.0 (0.5–2.0) 0.979 - -
Toilet type
Flushing toilet 15 (20.0) Ref
Pit latrine 22 (21.0) 1.1 (0.5–2.2) 0.876 - -
Bush/Other 5 (22.7) 1.2 (0.4–3.7) 0.781 - -
Tissue paper/other solid material 7 (10.9) Ref
Water 35 (25.4) 2.8 (1.2–6.6) 0.022 4.1 (1.5–11.3) 0.007
Vaginal washing when bathing*
External 6 (18.8) Ref
Internal 35 (21.1) 1.2 (0.4–3.0) 0.766 - -
Behavioral characteristics
Sexual debut age (years)
17 21 (32.8) 2.9 (1.3–6.2) 0.007 2.7 (1.1–6.6) 0.026
18 14 (14.6) Ref
Don’t know/no response 7 (16.7) 1.2 (0.4–3.2) 0.754 - -
Number of lifetime sex partners
1 16 (16.7) Ref
(Continued)

58

value
2 26 (24.5) 1.6 (0.8–3.3) 0.171 - -
Partner has had other sexual partner(s) in the last 6 months
No 38 (20.9) 1.1 (0.3–3.3) 0.927 - -
Yes 4 (20.0) Ref
Alcohol consumption ever
No 35 (21.9) 1.4 (0.6–3.4) 0.461 - -
Yes 7 (16.7) Ref
Tobacco smoking/chewing ever
No 41 (21.5) 2.7 (0.3–22.0) 0.344 - -
Yes 1 (9.1) Ref
Drugs/Substance use ever
No 39 (20.1) 0.4 (0.1–1.8) 0.248 - -
Yes 3 (37.5) Ref
Clinical characteristics
HIV status
Negative 39 (20.6) Ref
Positive 3 (23.1) 1.2 (0.3–4.4) 0.834 - -
Bacterial vaginosis
Negative 29 (17.9) Ref
Positive 13 (33.3) 2.3 (1.1–5.0) 0.036 2.7 (1.1–6.6) 0.031
Clinical signs and symptoms of STI
No 13 (17.3) Ref
Yes 29 (22.8) 1.4(0.7–2.9) 0.353 - -
No 28 (20.5) Ref
Yes 14 (21.2) 1.0 (0.5–2.1) 0.918 - -
Current vaginal discharge (self-reported)
No 10 (19.2) Ref
Yes 32 (21.5) 1.1 (0.5–2.5) 0.732 - -
Abnormal vaginal discharge (observed)
No 32 (19.4) Ref
Yes 10 (27.8) 1.6 (0.7–3.6) 0.265 - -
Dysuria
No 32 (20.1) Ref
Yes 10 (23.8) 1.2 (0.6–2.8) 0.602 - -
Dyspareunia
No 29 (19.3) Ref
Yes 13 (25.5) 1.4 (0.7–3.0) 0.352 - -
Vaginal itching
No 31 (21.2) Ref
Yes 11 (20.0) 0.9 (0.4–2.0) 0.848 - -
No 24 (22.4) Ref
Yes 18 (19.1) 0.8 (0.4–1.6) 0.568 - -
Genital warts
No 40 (20.4) Ref
Yes 2 (40.0) 2.6 (0.4–16.1) 0.304 - -
(Continued)

59

value
Genital ulcer (observed)
No 38 (19.4) Ref
Yes 4 (80.0) 16.6 (1.8–153.1) 0.013 35.0 (2.7–461.6) 0.031
Vaginitis
No 40 (20.5) Ref
Yes 2 (33.3) 1.9 (0.3–11.0) 0.454 - -
Curable STI = Infection with any of the following sexually transmitted infectious agents: Chlamydia trachomatis, Neisseria gonorrheae, Trichomonas
vaginalis
AOR: Adjusted Odds Ratio
CI: Confidence interval
COR: Crude Odds Ratio
*One participant did not respond to this question
https://doi.org/10.1371/journal.pone.0175166.t002
high burden of curable STIs was mostly due to cases of C. trachomatis (14.9% of women) and
T. vaginalis (7.4% of women). We also found approximately 19.4% of the women to have BV,
defined as the presence of vaginal discharge in combination with a Nugent score 7. Four out
of the 5 women with genital ulcers also had a curable STI. Our study documented that having
genital ulcers, cleaning with water as opposed to use of toilet paper after visiting the toilet,
early sexual debut, and BV were strongly associated with the presence of curable STIs.
The high prevalence (14.9%) of C. trachomatis found in this study is comparable to a preva-
lence of 13% (95% CI: 8.6–16.8) among women seeking family planning services in Nairobi,
Kenya [20] and 9.9% (95% CI: 7.2–13.2) among women in a multi-country (Kenya, Rwanda
and South Africa) cross-sectional study [26]. Two other recent studies reported lower preva-
lence rates of C. trachomatis: 5.6% (95% CI: 4.4–7.0) among 1300 HIV-seronegative ANC-
attending women at two district hospitals in rural western Kenya [13], and 6.0% (95% CI: 3.6–
9.3) in another study among 300 women attending outpatient clinics in Nairobi [27]. Since the
high prevalence of C. trachomatis among pregnant women may likely reflect ongoing trans-
mission of C. trachomatis among the general rural population in Kilifi, further studies con-
firming the high prevalence and ongoing C. trachomatis transmission among this population
would be helpful. Chlamydia infection has been found to be an independent predictor of HIV-
1 acquisition in a recent study from western Kenya, with also syphilis, yeast infection/colonisa-
tion and BV showing strong associations with incident HIV-1 infection [13].
We documented a prevalence of T. vaginalis (7.4%) comparable to 6.0% among HIV-sero-
negative ANC-attending women in rural western Kenya [13], and 7.7% among women attend-
ing a child-health clinic in Mombasa, Kenya [28]. In vitro evidence suggests that T. vaginalis
may alter the vaginal microbiome towards BV [29]. T. vaginalis has also been associated with
increased viral shedding and increased acquisition of HIV [30, 31], potentially contributing to
a significant number of additional HIV infections globally [31].
The prevalence of HIV-1 (6.4%) in this study was substantial, with all known and newly diag-
nosed cases occurring amongst the 120 women 25 years. In Coastal Kenya, HIV-1 prevalence
estimates in women aged 15–24 years decreased from 5.7% in 2007 to 2.0% in 2012 (p = 0.026)
[32]. Our results suggest a further decline in HIV-1 prevalence, among women 24 years.

60
A relatively low prevalence of N. gonorrhoeae (1%) and treponemal antibodies (1%) were
found in our study. The prevalence of treponemal antibodies was similar to the study among
HIV-seronegative ANC-attending women in rural western Kenya, [13] while the N. gonor-
rhoeae prevalence in the latter study was 3.0%.
BV diagnosis in our study was based on an a priori self-report of vaginal discharge in combi-
nation with a Nugent score of 7 (while only 2 (1%) women had asymptomatic BV). Women
with BV had an almost 3-fold higher risk of infection with a curable STIs than women without
BV, comparable to other studies [4, 33]. It might be advisable to better document the presence
of BV. However, general screening for BV among all women attending ANC, using the Nugent
score [23] or Amsel’s criteria [34], would require significant commitment of resources and staff.
Using simple point of care testing, Madhivanan et al. [35] demonstrated that a vaginal pH >4.5
and a positive whiff test had a sensitivity of 83% but a specificity of only 47% for diagnosing BV.
Although, not specific this approach may be adopted for BV screening in resource poor settings.
Alternatively, presumptive treatment with intravaginal metronidazole (750 mg) plus micona-
zole (200 mg) for five consecutive nights each month for 12 months was shown to be effective
to improve vaginal health and to decrease susceptibility to bacterial STIs, in a recent trial among
non-pregnant women [36], but the frequency of treatment would make it challenging to upscale
this intervention.
Our findings reinforce the need to integrate STI services at ANC. Screening for T. vaginalis
can be achieved at a relatively affordable cost (US $ 5), making screening for T. vaginalis po-
tentially feasible. Recent acquisition by the Kenyan government of over 120 GeneXpert IV
machines for county and sub-county hospitals for tuberculosis testing [37], has potentially
expanded the diagnostic capacity for curable STIs using the same testing platform at larger
hospitals. However, the cost of the C. trachomatis and N. gonorrhoeae test kits are currently
high. Without assay costs becoming considerably less expensive, it seems unlikely that ANC-
attending women will be routinely tested for C. trachomatis and N. gonorrhoeae. Cost-effective
studies have played an important role of informing policy on the gains of syphilis screening in
pregnancy while minimizing on the expenditure [38]. Such cost-effectiveness studies of ANC
screening and treatment of C. trachomatis, N. gonorrhoeae, and T. vaginalis should be con-
ducted in resource poor settings.
Treatment of STIs in both infected persons and their partner is pivotal for STI management,
ensuring reduction in cases of reinfection or non-resolving infections and prevention of adverse
outcomes [8]. In our study a presumptive patient delivered partner treatment approach was
adopted. Despite the fact that we did not collect information on the number of partners who
were treated, this approach has been shown to be acceptable and feasible among pregnant
women in Kenya [39].
Early sexual debut was strongly associated with curable STIs in our study population, simi-
lar to findings in other studies [40, 41]. Kilifi county is one of the poorest counties in Kenya,
characterized by low literacy levels mostly among women, young age at marriage of women,
and high fertility rates [42]. Structural changes focusing on the economic empowerment of
communities, including improved access to education, and legislation protecting women from
early marriage will be necessary to reduce the high burden of curable STIs among pregnant
women.
A salient predictor of curable STIs in our study population was the use of water to clean after
visiting the toilet as compared to those women who reported to use toilet paper or other solid
materials. Unfortunately, our hygiene question did not distinguish urinating from defecating,
or inquired whether the cleaning mode included both anus and vagina. It is possible that such
cleaning transported bacteria from the perianal area to the vagina, as pathogens causing curable
STIs may be found in paragenital areas [43]. Moreover, there is a strong correspondence in

61
bacterial species and loads between the vagina and rectum of pregnant women [44]. McClelland
et.al [31] showed that vaginal washing increased risk of HIV-1 acquisition among African
women. Although, we did not assess whether water used by our study participants was shared,
sharing of water may potentially lead to contamination of the vagina [45]. Pereira-Neves and
Benchimol [46] showed in vitro that T. vaginalis remained viable and infective in swimming
pool water samples for several hours. Further research is required to investigate the potential
role that sanitary and hygiene practices may play in women with high prevalence of curable
STIs and BV.
Observed genital ulcers had the strongest association with curable STIs, and were found in
2.5% of study participants. Presumptively treating curable STIs on the basis of observed genital
ulcers in pregnant women would have treated ~10% of the curable STIs in our study. Studies
examining microbial aetiology of genital ulcer disease, have shown that genital ulcers can be
attributed to several sexually transmitted pathogens with most cases being attributed to Herpes
Simplex virus type 2 [47, 48]. Genital ulcers were also identified as the strongest predictor of
acute HIV acquisition in attendees of STD clinics who initially had HIV-seronegative or dis-
cordant rapid test results [49]. While in our study no women with genital ulcers had HIV,
observing genital ulcers in women may help initiate risk reduction during ANC counselling
and targeted acute HIV screening [50].
Our study had some limitations. First, our study only included a relatively small sample of
pregnant women limiting the precision of our prevalence estimates. Second, we only included
adult women and were not able to enroll pregnant women who were minors. Minors are
potentially more vulnerable and may have presented with different STIs. Third, we included
only women residing within the Kilifi Health and Demographic Surveillance Area [22], and
therefore will have excluded women from outside the surveillance area who may have different
health characteristics. Fourth, our hygiene and sanitary questions were few, and limited [51].
Finally, this was a cross-sectional study, only allowing for an assessment of associations and
we did not collect data on pregnancy outcomes.
Despite these limitations, we showed that there is high prevalence of curable STIs among
pregnant women attending an antenatal clinic at Kilifi County Hospital, Kenya. Curable STIs
were associated with genital ulcers, hygienic practices, early sexual debut and BV. We recom-
mend that antenatal care programs consider strengthening their diagnostic screening for cur-
able STIs and BV.
Acknowledgments
We would like to thank the study participants and a special thanks to all nurses at the ANC
clinic of the Kilifi County Hospital and to Sarah Kioko (field worker). This manuscript was
submitted for publication with permission from the Director of the Kenya Medical Research
Institute (KEMRI).
Author Contributions
Conceptualization: SCM MV EJS.
Data curation: SCM EW.
Formal analysis: SCM EW.
Funding acquisition: SCM MV EJS.
Investigation: SCM.

62
Project administration: SCM EJS.

Supervision: SCM EJS.
Validation: SCM.
Visualization: SCM EW.
Writing – original draft: SCM.
Writing – review & editing: SCM EW MV PC TC EJS.
References
1. World Health Organization. Global Incidence and Prevalence of Selected Curable Sexually Transmitted
Infections, Overview and Estimates. WHO, 2008 ISBN 978 92 4 150383 9.
2. Newman L, Rowley J, Vander Hoorn S, Wijesooriya NS, Unemo M, Low N, et al. Global Estimates of
the Prevalence and Incidence of Four Curable Sexually Transmitted Infections in 2012 Based on Sys-
tematic Review and Global Reporting. PloS one. 2015; 10(12):e0143304. Epub 2015/12/10. PubMed
Central PMCID: PMCPMC4672879. https://doi.org/10.1371/journal.pone.0143304 PMID: 26646541
3. Ness RB, Kip KE, Soper DE, Hillier S, Stamm CA, Sweet RL, et al. Bacterial vaginosis (BV) and the risk
of incident gonococcal or chlamydial genital infection in a predominantly black population. Sex Transm
Dis. 2005; 32(7):413–7. Epub 2005/06/25. PMID: 15976598
4. Abbai NS, Reddy T, Ramjee G. Prevalent bacterial vaginosis infection—a risk factor for incident sexu-
ally transmitted infections in women in Durban, South Africa. International journal of STD & AIDS. 2015.
Epub 2015/11/06.
5. Kenyon C, Colebunders R, Crucitti T. The global epidemiology of bacterial vaginosis: a systematic
review. American Journal of Obstetrics & Gynecology. 209(6):505–23.
6. Mullick S, Watson-Jones D, Beksinska M, Mabey D. Sexually transmitted infections in pregnancy: prev-
alence, impact on pregnancy outcomes, and approach to treatment in developing countries. Sexually
transmitted infections. 2005; 81(4):294–302. PubMed Central PMCID: PMCPmc1745010. https://doi.
org/10.1136/sti.2002.004077 PMID: 16061534
7. Adachi K, Nielsen-Saines K, Klausner JD. Chlamydia trachomatis Infection in Pregnancy: The Global
Challenge of Preventing Adverse Pregnancy and Infant Outcomes in Sub-Saharan Africa and Asia.
BioMed Research International. 2016; 2016:9315757. https://doi.org/10.1155/2016/9315757 PMID:
27144177
8. Kimberly A. Workowski, Bolan GA. Sexually Transmitted Diseases Treatment Guidelines, 2015, Cen-
ters for Disease Control and Prevention, Morbidity and Mortality Weekly Report, Vol. 64 / No. 3.
9. Kuznik A, Habib AG, Manabe YC, Lamorde M. Estimating the public health burden associated with
adverse pregnancy outcomes resulting from syphilis infection across 43 countries in sub-Saharan
Africa. Sex Transm Dis. 2015; 42(7):369–75. PubMed Central PMCID: PMCPMC4520246. https://doi.
org/10.1097/OLQ.0000000000000291 PMID: 26222749
10. Gunn JKL, Asaolu IO, Center KE, Gibson SJ, Wightman P, Ezeanolue EE, et al. Antenatal care and
uptake of HIV testing among pregnant women in sub-Saharan Africa: a cross-sectional study. Journal
of the International AIDS Society. 2016; 19(1). PubMed Central PMCID: PMCPMC4718968.
11. Van Der Pol B, Kwok C, Pierre-Louis B, Rinaldi A, Salata RA, Chen PL, et al. Trichomonas vaginalis
infection and human immunodeficiency virus acquisition in African women. The Journal of infectious
diseases. 2008; 197(4):548–54. Epub 2008/02/16. https://doi.org/10.1086/526496 PMID: 18275275
12. Buve A, Jespers V, Crucitti T, Fichorova RN. The vaginal microbiota and susceptibility to HIV. Aids.
2014; 28(16):2333–44. Epub 2014/11/13. PMID: 25389548
13. Kinuthia J, Drake AL, Matemo D, Richardson BA, Zeh C, Osborn L, et al. HIV acquisition during preg-
nancy and postpartum is associated with genital infections and partnership characteristics. Aids. 2015;
29(15):2025–33. Epub 2015/09/10. PubMed Central PMCID: PMCPMC4692052. https://doi.org/10.
1097/QAD.0000000000000793 PMID: 26352880
14. Adachi K, Klausner JD, Bristow CC, Xu J, Ank B, Morgado MG, et al. Chlamydia and Gonorrhea in HIV-
Infected Pregnant Women and Infant HIV Transmission. Sex Transm Dis. 2015; 42(10):554–65. Epub
2015/09/16. PubMed Central PMCID: PMCPMC4571193. https://doi.org/10.1097/OLQ.
0000000000000340 PMID: 26372927
15. World Health Organization: Guidelines For The Management of Sexually Transmitted Infections.
Geneva, Switzerland, 1 February 2004. ISBN 9241546263.

63
16. Pettifor A, Walsh J, Wilkins V, Raghunathan P. How effective is syndromic management of STDs?: A
review of current studies. Sex Transm Dis. 2000; 27(7):371–85. Epub 2000/08/19. PMID: 10949428
17. Fonck K, Kidula N, Jaoko W, Estambale B, Claeys P, Ndinya-Achola J, et al. Validity of the vaginal dis-
charge algorithm among pregnant and non-pregnant women in Nairobi, Kenya. Sexually transmitted
infections. 2000; 76(1):33–8. PubMed Central PMCID: PMCPmc1760552. https://doi.org/10.1136/sti.
76.1.33 PMID: 10817066
18. Gomih-Alakija A, Ting J, Mugo N, Kwatampora J, Getman D, Chitwa M, et al. Clinical characteristics
associated with Mycoplasma genitalium among female sex workers in Nairobi, Kenya. Journal of clinical
microbiology. 2014; 52(10):3660–6. Epub 2014/08/08. PubMed Central PMCID: PMCPMC4187795.
https://doi.org/10.1128/JCM.00850-14 PMID: 25100823
19. Kohli R, Konya WP, Obura T, Stones W, Revathi G. Prevalence of genital Chlamydia infection in urban
women of reproductive age, Nairobi, Kenya. BMC research notes. 2013; 6:44. PubMed Central PMCID:
PMC3570388. https://doi.org/10.1186/1756-0500-6-44 PMID: 23375142
20. Maina AN, Kimani J, Anzala O. Prevalence and risk factors of three curable sexually transmitted infec-
tions among women in Nairobi, Kenya. BMC research notes. 2016; 9(1):193. Epub 2016/03/31.
21. Nyiro JU, Sanders EJ, Ngetsa C, Wale S, Awuondo K, Bukusi E, et al. Seroprevalence, predictors and
estimated incidence of maternal and neonatal Herpes Simplex Virus Type 2 infection in semi-urban
women in Kilifi, Kenya. BMC Infectious Diseases. 2011; 11:155–. https://doi.org/10.1186/1471-2334-
11-155 PMID: 21627803
22. Scott JAG, Bauni E, Moisi JC, Ojal J, Gatakaa H, Nyundo C, et al. Profile: The Kilifi Health and Demo-
graphic Surveillance System (KHDSS). International Journal of Epidemiology. 2012; 41(3):650–7.
PubMed Central PMCID: PMCPmc3396317. https://doi.org/10.1093/ije/dys062 PMID: 22544844
23. Nugent RP, Krohn MA, Hillier SL. Reliability of diagnosing bacterial vaginosis is improved by a standard-
ized method of gram stain interpretation. Journal of clinical microbiology. 1991; 29(2):297–301. PubMed
Central PMCID: PMCPmc269757. PMID: 1706728
24. Ministry of Health Kenya, National guidelines for Reproductive Tract Infection Services. 2006. https://
www.k4health.org/toolkits/kenya-health/national-guidelines-reproductive-tract-infection-services.
25. Duncan S, Thiong’o AN, Macharia M, Wamuyu L, Mwarumba S, Mvera B, et al. High prevalence of quin-
olone resistance in Neisseria gonorrhoeae in coastal Kenya. Sexually transmitted infections. 2011; 87
(3):231. Epub 2011/02/11. https://doi.org/10.1136/sti.2010.048777 PMID: 21307154
26. Cools P, Jespers V, Hardy L, Crucitti T, Delany-Moretlwe S, Mwaura M, et al. A Multi-Country Cross-
Sectional Study of Vaginal Carriage of Group B Streptococci (GBS) and Escherichia coli in Resource-
Poor Settings: Prevalences and Risk Factors. PloS one. 2016; 11(1):e0148052. Epub 2016/01/27.
PubMed Central PMCID: PMCPMC4727807. https://doi.org/10.1371/journal.pone.0148052 PMID:
26811897
27. Kohli R, Konya WP, Obura T, Stones W, Revathi G. Prevalence of genital chlamydia infection in urban
women of reproductive age, Nairobi, Kenya. BMC research notes. 2013; 6(1):1–5.
28. Chersich MF, Kley N, Luchters SM, Njeru C, Yard E, Othigo MJ, et al. Maternal morbidity in the first
year after childbirth in Mombasa Kenya; a needs assessment. BMC pregnancy and childbirth. 2009;
9:51. Epub 2009/11/07. PubMed Central PMCID: PMCPmc2777848. https://doi.org/10.1186/1471-
2393-9-51 PMID: 19891784
29. Fichorova RN, Buck OR, Yamamoto HS, Fashemi T, Dawood HY, Fashemi B, et al. The villain team-up
or how Trichomonas vaginalis and bacterial vaginosis alter innate immunity in concert. Sexually trans-
mitted infections. 2013; 89(6):460–6. Epub 2013/08/02. PubMed Central PMCID: PMCPMC3746192.
https://doi.org/10.1136/sextrans-2013-051052 PMID: 23903808
30. Sorvillo F, Kerndt P. Trichomonas vaginalis and amplification of HIV-1 transmission. Lancet. 1998; 351
(9097):213–4. Epub 1998/02/05.
31. McClelland RS, Sangare L, Hassan WM, Lavreys L, Mandaliya K, Kiarie J, et al. Infection with Tricho-
monas vaginalis increases the risk of HIV-1 acquisition. The Journal of infectious diseases. 2007; 195
(5):698–702. Epub 2007/01/31. https://doi.org/10.1086/511278 PMID: 17262712
32. Kimanga DO, Ogola S, Umuro M, Ng’ang’a A, Kimondo L, Murithi P, et al. Prevalence and incidence of
HIV infection, trends, and risk factors among persons aged 15–64 years in Kenya: results from a nation-
ally representative study. Journal of acquired immune deficiency syndromes. 2014; 66 Suppl 1:S13–26.
33. Wiesenfeld HC, Hillier SL, Krohn MA, Landers DV, Sweet RL. Bacterial vaginosis is a strong predictor
of Neisseria gonorrhoeae and Chlamydia trachomatis infection. Clinical infectious diseases: an official
publication of the Infectious Diseases Society of America. 2003; 36(5):663–8. Epub 2003/02/21.
34. Amsel R, Totten PA, Spiegel CA, Chen KC, Eschenbach D, Holmes KK. Nonspecific vaginitis. Diagnos-
tic criteria and microbial and epidemiologic associations. Am J Med. 1983; 74(1):14–22. Epub 1983/01/
01. PMID: 6600371

64
35. Madhivanan P, Krupp K, Hardin J, Karat C, Klausner JD, Reingold AL. Simple and inexpensive point-of-
care tests improve diagnosis of vaginal infections in resource constrained settings. Tropical medicine &
international health: TM & IH. 2009; 14(6):703–8. Epub 2009/04/28. PubMed Central PMCID:
PMCPMC3625926.
36. Balkus JE, Manhart LE, Lee J, Anzala O, Kimani J, Schwebke J, et al. Periodic Presumptive Treatment
for Vaginal Infections May Reduce the Incidence of Sexually Transmitted Bacterial Infections. The Jour-
nal of infectious diseases. 2016; 213(12):1932–7. Epub 2016/02/26. PubMed Central PMCID:
PMCPMC4878720. https://doi.org/10.1093/infdis/jiw043 PMID: 26908758
37. Rafferty H, Ngoi C, Wahome E, Oduor C, van der Elst E, Berger R, et al. Assessing Training Needs of
Clinical Officers to Target Acute HIV Infection Evaluation of Adult Patients Seeking Urgent Healthcare
in Kenya. R4P2016.
38. Terris-Prestholt F, Vickerman P, Torres-Rueda S, Santesso N, Sweeney S, Mallma P, et al. The cost-
effectiveness of 10 antenatal syphilis screening and treatment approaches in Peru, Tanzania, and Zam-
bia. International Journal of Gynaecology and Obstetrics. 2015; 130(Suppl 1):S73–S80.
39. Unger JA, Matemo D, Pintye J, Drake A, Kinuthia J, McClelland RS, et al. Patient-Delivered Partner
Treatment for Chlamydia, Gonorrhea, and Trichomonas Infection Among Pregnant and Postpartum
Women in Kenya. Sexually transmitted diseases. 2015; 42(11):637–42. https://doi.org/10.1097/OLQ.
0000000000000355 PMID: 26462189
40. Ma Q, Ono-Kihara M, Cong L, Xu G, Pan X, Zamani S, et al. Early initiation of sexual activity: a risk fac-
tor for sexually transmitted diseases, HIV infection, and unwanted pregnancy among university students
in China. BMC Public Health. 2009; 9:111. Epub 2009/04/23. PubMed Central PMCID:
PMCPMC2674603. https://doi.org/10.1186/1471-2458-9-111 PMID: 19383171
41. Hallett TB, Lewis JJ, Lopman BA, Nyamukapa CA, Mushati P, Wambe M, et al. Age at first sex and HIV
infection in rural Zimbabwe. Studies in family planning. 2007; 38(1):1–10. Epub 2007/03/28. PMID:
17385378
42. Kenya National Bureau of Statistics and Society for International Development. Exploring Kenya’s
Inequality-Pulling apart or Pooling together?. 2013. http://www.knbs.or.ke/index.php?option=com_
phocadownload&view=category&id=114:exploring-kenya-s-inequality&Itemid=599.
43. Chan PA, Robinette A, Montgomery M, Almonte A, Cu-Uvin S, Lonks JR, et al. Extragenital Infections
Caused by Chlamydia trachomatis and Neisseria gonorrhoeae: A Review of the Literature. Infectious
diseases in obstetrics and gynecology. 2016; 2016. PubMed Central PMCID: PMCPMC4913006.
44. El Aila NA, Tency I, Saerens B, De Backer E, Cools P, dos Santos Santiago GL, et al. Strong correspon-
dence in bacterial loads between the vagina and rectum of pregnant women. Research in microbiology.
2011; 162(5):506–13. Epub 2011/04/26. https://doi.org/10.1016/j.resmic.2011.04.004 PMID: 21513795
45. Crucitti T, Jespers V, Mulenga C, Khondowe S, Vandepitte J, Buve A. Trichomonas vaginalis is highly
prevalent in adolescent girls, pregnant women, and commercial sex workers in Ndola, Zambia. Sex
Transm Dis. 2010; 37(4):223–7. https://doi.org/10.1097/OLQ.0b013e3181c21f93 PMID: 19940808
46. Pereira-Neves A, Benchimol M. Trichomonas vaginalis: in vitro survival in swimming pool water sam-
ples. Exp Parasitol. 2008; 118(3):438–41. Epub 2007/10/24. https://doi.org/10.1016/j.exppara.2007.09.
005 PMID: 17949719
47. Gomes Naveca F, Sabidó M, Amaral Pires de Almeida T, Araújo Veras E, Contreras Mejı́a MdC, Gal-
ban E, et al. Etiology of Genital Ulcer Disease in a Sexually Transmitted Infection Reference Center in
Manaus, Brazilian Amazon. PloS one. 2013; 8(5):e63953. https://doi.org/10.1371/journal.pone.
0063953 PMID: 23704961
48. O’Farrell N, Hoosen AA, Coetzee KD, van den Ende J. Genital ulcer disease: accuracy of clinical diag-
nosis and strategies to improve control in Durban, South Africa. Genitourinary medicine. 1994; 70(1):7–
11. Epub 1994/02/01. PubMed Central PMCID: PMCPMC1195171. PMID: 8300105
49. Powers KA, Miller WC, Pilcher CD, Mapanje C, Martinson FE, Fiscus SA, et al. Improved detection of
acute HIV-1 infection in sub-Saharan Africa: development of a risk score algorithm. Aids. 2007; 21
(16):2237–42. PubMed Central PMCID: PMCPMC2673577. https://doi.org/10.1097/QAD.
0b013e3282f08b4d PMID: 18090052
50. Sanders EJ, Wahome E, Powers KA, Werner L, Fegan G, Lavreys L, et al. Targeted screening of at-risk
adults for acute HIV-1 infection in sub-Saharan Africa. Aids. 2015; 29 Suppl 3:S221–30. Epub 2015/11/
13. PubMed Central PMCID: PMCPMC4714928.
51. Brown JE, Brown RC. Traditional intravaginal practices and the heterosexual transmission of disease: a
review. Sex Transm Dis. 2000; 27(4):183–7. Epub 2000/04/27. PMID: 10782738

65
66
Chapter Four | Urogenital pathogens, associated with
Trichomonas vaginalis, among pregnant women in Kilifi,
Kenya: A nested case-control study
67
Chapter Four
4 Urogenital pathogens, associated with Trichomonas vaginalis, among

pregnant women in Kilifi, Kenya: A nested case-control study
*Simon C. Masha MSc1, 2, 3, Piet Cools PhD2, Patrick Descheemaeker PhD4, Marijke
Reynders MD4, Eduard J. Sanders PhD1, Mario Vaneechoutte PhD2
1Centre for Geographic Medicine Research – Coast, Kenya Medical Research Institute,
Kilifi, Kenya
2Laboratory Bacteriology Research, Faculty of Medicine and Health Sciences, Ghent
University, De Pintelaan 185, Ghent, Belgium
3Pwani University, Faculty of Pure and Applied Sciences, Department of Biological
Sciences, Kilifi, Kenya
4Department of Laboratory Medicine, Medical Microbiology, AZ St-Jan Brugge-Oostende,
Bruges, Belgium
*Correspondence to Simon C. Masha, Kenya Medical Research Institute, Centre for

Geographic Medicine Research – Coast, P.O. Box 230, Kilifi, Kenya.
Tel: +254 41 7522133; fax: +254 41 7522390; e-mail: schengo@kemri-wellcome.org
Submitted to BMC Infect Dis. 30 JAN 2018.
68
Chapter Four
4.1 Abstract
BACKGROUND: Screening of curable sexually transmitted infections is frequently

oriented towards the diagnosis of chlamydia, gonorrhea, syphilis and trichomoniasis,
whereas other pathogens, sometimes associated with similar urogenital syndromes,
remain undiagnosed and/or untreated. Some of these pathogens are associated with
adverse pregnancy outcomes.
METHODS: In a nested case-control approach, vaginal swabs from 79 pregnant women,

i.e., 28 T. vaginalis-positive (cases) and 51 T. vaginalis-negative (controls), were
screened by quantitative PCR for Adenovirus 1 and 2, Cytomegalovirus, Herpes Simplex
Virus 1 and 2, Chlamydia trachomatis, Escherichia coli, Haemophilus ducreyi,
Mycoplasma genitalium, M. hominis, candidatus M. girerdii, Neisseria gonorrhoeae,
Streptococcus agalactiae, Treponema pallidum, Ureaplasma parvum, U. urealyticum,
and Candida albicans. Additionally, we determined whether women with pathogens highly
associated with T. vaginalis had distinct clinical signs and symptoms compared to women
with T. vaginalis mono-infection.
RESULTS: M. hominis was independently associated with T. vaginalis (adjusted odds

ratio = 6.8, 95% CI: 2.3–19.8). Moreover, M. genitalium and Ca M. girerdii were
exclusively detected in women with T. vaginalis (P = 0.002 and P = 0.001), respectively.
Four of the six women co-infected with T. vaginalis and Ca M. girerdii complained of
vaginal itching, compared to only 4 out of the 22 women infected with T. vaginalis without
Ca M. girerdii (P = 0.020).
CONCLUSION: We confirm M. hominis as a correlate of T. vaginalis in our population,

and the exclusive association of both M. genitalium and Ca. M. girerdii with T. vaginalis.
Screening and treatment of this pathogens should be considered.
Key words:
Trichomonas vaginalis, Mycoplasma hominis, M. genitalium, Candidatus Mycoplasma

girerdii, pregnant, screening, sexually transmitted infections, Kenya
69
Chapter Four
4.2 Introduction
Sexually transmitted infections (STIs) are among the most common acute infections
globally [1]. The most common curable STIs include Chlamydia trachomatis, Neisseria
gonorrhoeae, Treponema pallidum subspecies pallidum (syphilis), Trichomonas vaginalis
and Hepatitis B virus. These five infections cause acute conditions such as cervicitis-
endometritis, vaginal/urethral discharge, urethritis and genital/anorectal/oral ulceration.
They can also lead to severe complications and long term sequelae, including pelvic
inflammatory disease, oophoritis, salpingitis, ectopic pregnancy, infertility, neurological
disease, neonatal death, premature delivery and blindness [2]. Another public health
concern is the association of STIs with the increased risk of HIV acquisition and
transmission [3].
Of the four common curable STIs, T. vaginalis is globally the most prevalent pathogen
[1], with a prevalence of up to 11.5% among women in sub-Sahara Africa [1]. Although
there is a wealth of data regarding the clinical presentation and global burden of T.
vaginalis [4], studies assessing associations of T. vaginalis with other genital pathogens
are scarce, although it has been suggested that T. vaginalis has a unique symbiotic
relationship with Mycoplasma hominis (M. hominis) [5]. T. vaginalis is also associated
with an increase in vaginal pH [6] which may influence the composition of the associated
vaginal microbial community and is strongly associated with bacterial vaginosis (BV) [6].
Less appreciated pathogens like M. hominis, M. genitalium, Ureaplasma parvum and U.
urealyticum are increasingly being associated with adverse pregnancy outcomes as well
as respiratory infections in neonates [7].
Sexually transmitted infection (STI) screening programs and STI research mostly focus
on the four most common curable STIs, whereas other pathogens, associated with similar
urogenital syndromes, remain undiagnosed and/or untreated. Detection of urogenital
pathogens that may be associated with T. vaginalis may be important as it might have an
effect on the clinical presentation and management and the long-term outcome of those
infections. Here, we assess the occurrence of specific urogenital species in T. vaginalis-
positive (cases) and T. vaginalis-negative (controls) among pregnant women in Kilifi,
Kenya.
70
Chapter Four
4.3 Materials and methods
Study setting
Kenya is divided administratively into 47 counties. Kilifi County, which lies along the Indian
Ocean Coast, is one of the poorest and is typical of a rural equatorial African setting.
Among pregnant women in Kilifi the HIV prevalence is estimated to be 6.4 %, for
chlamydia 14.9 %, for gonorrhea 1.0 % and 7.4 % for trichomoniasis [8].
From July till September 2015, we carried out a cross-sectional study (curable STI study)
at the antenatal care clinic of Kilifi County Hospital, Kenya. The main aim of the curable
STI study was to describe the prevalence and predictors of curable sexually transmitted
infections (STIs) among 350 pregnant women attending the antenatal care clinic [8].
Women were eligible if they met the following criteria: age 18-45 years, gestation ≥ 14
weeks, being residents of the Kilifi Health and Demographic Surveillance area,
willingness to undergo free STI and bacterial vaginosis (BV) screening procedures and
willing to give written informed consent. This study presents a secondary objective of the
above-mentioned study, namely to describe urogenital pathogen correlates of T. vaginalis
among pregnant women in Kilifi, Kenya.
For the above-described curable STI study, a nurse collected vaginal secretions from the
vaginal introitus using two sterile cotton swabs. The first vaginal swab was inoculated at
the clinic in the upper-chamber of an InPouch system (BioMed Diagnostics, White City,
Oregon, USA), a highly specific and sensitive device containing a fluid medium supporting
the growth of T. vaginalis and allowing microscopic observation of T. vaginalis. The
inoculated InPouch was transferred to the laboratory within 15 minutes for direct
microscopy of the upper chamber, after which it was merged with the lower chamber and
incubated at 37 °C ± 1 °C. Daily microscopic observation (at both ×10 and ×40
magnification, for six fields) of the InPouch system was performed by qualified
technicians. Samples with motile trichomonads within 5 days of culture were considered
positive for T. vaginalis.
Women found to be positive for T. vaginalis by means of direct microscopy were treated
on the same day. Women who were negative for T. vaginalis direct microscopy but
71
Chapter Four
positive on culture were contacted to return to the clinic for treatment immediately after
the culture turned positive. Secnidazole 2 g statim was administered as treatment, and
participants were also asked to refer their sexual partner(s) to the clinic for treatment or
were given the same medication to take to their sexual partner(s).
The second swab was placed in a sterile labeled 2 ml Eppendorf tube, the swab shaft
was broken by bending the shaft against the neck of the Eppendorf tube, and the tube
containing the swab tip was closed and transported to the laboratory where it was
immediately stored at -80 °C for molecular studies of the vaginal microbiome. No transport
or freezing medium was added.
Specimens for this case-control study are derived from the stored swabs from the curable
STI study, published previously [7]. Because of financial and logistic constraints we could
process only a subset of the 350 vaginal swabs from the main study. Vaginal swabs from
79 pregnant women were divided in two groups for analysis, i.e., those from women
positive for T. vaginalis (cases) and those from women negative for T. vaginalis (controls)
as determined by PCR. Controls were age-matched (+/- 5 years) and all were bacterial
vaginosis (BV) negative by Nugent score, largely matching the cases because only 4 out
of the 28 T. vaginalis positive cases were BV+. Selection of controls was guided by being
T. vaginalis negative. The statistical power of a study can be increased by enrolling more
controls than cases. However, the additional power that is achieved diminishes as the
ratio of controls to cases increases, and ratios greater than 4:1 have little additional impact
on power. Nevertheless, if the data on controls is easily obtained, there is no reason to
limit the number of controls. For financial reasons we had to settled for 2:1 ratio which is
acceptable. The swabs of 51 women selected as controls were not significantly different
from the swabs of the other 270 women not selected as controls (Supplementary Table
4.1).
DNA extraction
Before DNA extraction, was performed in Kilifi, the frozen swabs were thawed at room
temperature for 30 minutes. Extraction was performed using the QIAamp DNA Mini Kit
(Qiagen, Hilden, Germany) according to manufacturer’s instructions and 160 μL of eluted
DNA was transferred to Eppendorf tubes and frozen at -80 °C until shipment to the
72
Chapter Four
Laboratory of Bacteriology Research (LBR, Ghent University, Belgium), using shipping

boxes filled with dry ice (-78.5°C). Once at the LBR the Eppendorf tubes with DNA-
extracts were transferred back to -80 °C until molecular analysis was performed. No
thawing and freezing occurred after freezing the DNA extract until the point of molecular
testing in the laboratory in Belgium.
TaqMan® Array Card
This assay has multiple genetic targets per pathogen in order to maximize both specificity
and sensitivity [9]. Samples were determined to be positive for a specific species on the
TaqMan® Array Card (TAC), only in case the assay was positive for two independent
PCR targets of that species. Sample quality was assessed by amplification of human
DNA, to evaluate the quantity of epithelial cells recovered by the swab. Most quantitative
PCRs were performed using this highly sensitive and specific TaqMan® Array Card
(TAC), developed at AZ Sint-Jan Brugge-Oostende, Belgium. The array card was used
for detecting Chlamydia trachomatis (including Lymphogranuloma venereum (LGV) or C.
trachomatis serovars L1-L2-L3), Haemophilus ducreyi, Neisseria gonorrhoeae,
Mycoplasma genitalium (including M. genitalium macrolide resistance-mediating
mutations A2058G, A2059G, A2058T, A2058C in region V of the 23S rRNA gene), M.
hominis, Ureaplasma parvum, U. urealyticum, Treponema pallidum, Herpes Simplex
virus-1/-2 (HSV 1/2), adenoviruses, Cytomegalovirus (CMV), and T. vaginalis
qPCRs
Further individual qPCRs were performed at the LBR for Candida albicans [10],
Escherichia coli [11] and Streptococcus agalactiae [11,12]. The amplification, detection
and quantification were carried out using the LightCycler 480 platform and the LightCycler
1480 Software Version 1.5 (Roche). Each qPCR was performed in a final volume of 10 μl
of which 2 μl of DNA extract or 2 μl of HPLC water as negative template control or 2 μl of
a positive control. All the specific primers and probes were synthesized by Eurogentec,
Liège, Belgium. Specific qPCR details are provided in Supplementary Table 2.
For the construction of qPCR standard curves, the procedures as described by Cools et
al. [10] were adopted. Briefly, DNA was extracted from overnight cultures of C. albicans
ATCC 90028 grown on Sabouraud agar (Becton Dickinson, Erembodegem, Belgium) and
73
Chapter Four
of E. coli ATCC 25922 or S. agalactiae LMG 14694T grown on TSA + 5% sheep blood
(Becton Dickinson). All growth was harvested from the plate and re-suspended in 1 ml of
saline. DNA of this suspension was extracted using the High Pure PCR Template
Preparation Kit (Roche Applied Science, Basel, Switzerland), according to the
manufacturer’s instructions. DNA-concentration was determined by means of Nanodrop
and the number of genomes was calculated. A tenfold dilution series in HPLC-grade water
was made to establish for each dilution the number of colonies needed to pass the
detection threshold. Using these data, a regression curve was constructed.
PCR for T. vaginalis and for Candidatus Mycoplasma girerdii (Ca. M. girerdii)
PCRs for T. vaginalis targeting the actin gene, using outer primers, previously used in a
nested PCR [13] and yielding a fragment of 1100 bp and for Ca. M. girerdii, yielding a
fragment of 594 bp [14], were carried out on the ABI Veriti thermocycler platform
(ThermoFisher Scientific, Waltham, Massachusetts). The primers were synthesized by
Eurogentec, Liège, Belgium. Amplified fragments were visualized under UV light after
agarose gel electrophoresis and EtBr staining.
Details of these species-specific PCRs are summarized in Suppl. Table 4.2.
Sequencing
Sequencing of PCR amplicons of Ca. M. girerdii was carried out by GATC Biotech
(Constance, Germany) to confirm specificity of the PCR products. Sequencing was done
using the forward PCR primers (Suppl. Table 2). Sequences were cleaned using
Chromas Lite version 2.1 (Technelysium, Brisbane, Australia). BLAST was performed on
the sequences to confirm the identity.
Data analysis
Epidemiological data were analyzed using StataCorp. 2013. Stata Statistical Software:
Release 13 (College Station, TX: StataCorp LP). Prevalence of urogenital pathogens
were computed with 95% confidence intervals (CIs). Associations between T. vaginalis
positivity and socio-demographic, hygienic and behavioral characteristics were calculated
using the χ2 test. To build a multivariate model of urogenital species associated with T.
vaginalis, we first carried out univariate regression analysis. For computation of odds
74
Chapter Four
ratios (ORs), we replaced all zero values in cells by the value ‘0.5’, as suggested by Deeks
& Higgins [13].
Species that were significantly associated with T. vaginalis in univariate regression
analysis P-value ≤ 0.1 were selected for multivariate logistic regression analysis.
Associations in the final multivariate model were expressed as adjusted odds ratios
(AORs) with p-values ≤ 0.05 considered significant. We further assessed whether
pathogens, significantly associated with T. vaginalis infection, had an implication on the
clinical presentation.
Ethical considerations
We obtained ethical approval from the Kenya Medical Research Institute Scientific and
Ethics Review Unit (#3022). Written informed consent was obtained from all the
participants.
4.4 Results
A total of 23 out of 350 samples (6.5%) were positive by InPouch culture for Trichomonas
vaginalis, of which eight (34.8%) were initially positive on direct microscopy. The T.
vaginalis-specific PCR [13] detected one additional case of T. vaginalis from a sample
that was negative by InPouch culture but positive by the TAC assay, which found four
more positive samples. In summary, sensitivity of direct microscopy, of T. vaginalis
InPouch culture and of T. vaginalis-specific PCR were respectively 28.6%, 82.1% and
85.7%, when compared to the TAC assay. For this study cases of T. vaginalis was based
on the TAC assay results.
Distribution of age, religion, education level, marital status, parity, gestational age and
number of lifetime sex partners were similar among cases and controls (Table 4.1). HIV
and BV status was different between the two groups by our case-control study design
(Table 4.2), but the resulting overall difference was minimal, i.e. 0 HIV and 0 BV cases in
the control group compared to 3 HIV-positives (10.7 %) and 4 BV-positives (14.3 %) in
the Trichomonas positive group. Moreover, we could show that these differences had no
influence on the species associated with T. vaginalis (Supplementary Table 4.3 and 4.4).
Additionally, occupation was also significantly different (Table 4.2).
75
Chapter Four
Prevalence of urogenital species
The prevalence of the co-infecting urogenital species is indicated in Table 4.2.

Adenovirus, Haemophilus ducreyi, Neisseria gonorrhoeae and Treponema pallidum were
not detected and are not reported in Table 4.2. Ureaplasma parvum was the most
prevalent at 74.7% (95% Confidence interval (CI): 63.6-83.8), followed by U. urealyticum
at 48.1% (CI: 36.7-59.6).
Univariate and multivariate association analysis
Although, M. genitalium and Ca. M. girerdii, had generally a low prevalence of

respectively 6.3% and 7.6%, the two were exclusively detected in women with T. vaginalis
(Chi-square test: χ2 = 9.7, df = 1, P < 0.002 and χ2 = 11.8, df = 1, P < 0.001, respectively).
Both M. genitalium and Ca. M. girerdii were significantly associated with T. vaginalis on
univariate analysis but not on multivariable analysis (Table 4.2) as they were not included
in the multivariable analysis. None of the samples for which M. genitalium could be
detected showed macrolide resistance-associated mutations. In a univariate regression
analysis, M. hominis and U. urealyticum were significantly associated with T. vaginalis
(crude odds ratio (COR) = 7.3; 95% CI: 2.6–20.5 and COR = 2.2; 95% CI: 0.9–5.7,
respectively). We detected M. hominis from the vaginal DNA extracts of approximately
70% of women with T. vaginalis. M. hominis was also independently associated with T.
vaginalis in a multivariate regression analysis (adjusted odds ratio (AOR) = 6.8; 95% CI:
2.3–19.8).
Tables 4.3- 4.5 compare clinical signs and symptoms among T. vaginalis-infected women
co-infected or not with M. hominis (Table 4.3), or with Ca M. girerdii (Table 4.4) or with M.
genitalium (Table 4.5).
Women co-infected with T. vaginalis and Ca. M. girerdii were more likely to report vaginal
itching compared to T. vaginalis-positive women not co-infected with Ca. M. girerdii
(66.8% vs. 18.2% (p = 0.020)). There was no difference in clinical presentation of T.
vaginalis-infected pregnant women co-infected with M. hominis or with M. genitalium,
compared to those not co-infected with these species.
Of the five participants that had M. genitalium and the six that had Ca M. girerdii, only one
participant had a co-infection with M. genitalium and Ca M. girerdii. However, M. hominis
76
Chapter Four
was always present in vaginal samples from which M. genitalium and Ca M. girerdii were
detected. Due to the detection of CMV, HSV 1/ 2, M. genitalium and Ca. M. girerdii
exclusively in cases or controls, the species were excluded from the regression model.
4.5 Discussion
Our results indicate that women with Trichomonas vaginalis (n = 28) have a high rate
(71.4%) of co-infection with Mycoplasma hominis compared to only 25.5% of 51 women
not infected with T. vaginalis. Comparable rates of co-infection have been reported by
Becker et al. [15], i.e., 56.7% in Brazil and by Xiao et al. [16], i.e., 50.0% in China. Rappelli
et al. [18] reported much higher rates (94.3%) of co-infection among Italian, Mozambican,
and Angolan women. M. hominis has been shown to have a symbiotic relationship with
T. vaginalis. Owing to its small genome, this bacterial species is strongly dependent on
host cell metabolism. M. hominis has the ability to enter trichomonad cells by endocytosis
and to multiply in coordination with the protozoan [5]. We could not establish differences
in clinical presentation of women co-infected with both T. vaginalis and M. hominis as
compared to those infected with only T. vaginalis, in agreement with previous data [19].
As such, at present, co-infection of T. vaginalis with M. hominis seems to be of limited
clinical relevance, also because antibiotic treatment of the former will probably
consecutively diminish the presence of the latter.
The pathogenic potential of M. genitalium among pregnant women in Kenya has not been
extensively investigated probably because its prevalence is overshadowed by a higher
prevalence of other STIs, as was the case in this study. Our results indicate that in our
population M. genitalium was strongly associated with T. vaginalis (p = 0.002). Given the
presence of M. genitalium exclusively in women with T. vaginalis infection, screening and
treatment of women for T. vaginalis might also at once reduce the prevalence of M.
genitalium. Although macrolide resistance associated mutations among M. genitalium
strains are on the rise, as was recently shown among female sex workers in Belgium [20],
macrolide resistance-associated mutations could not be detected in any of the five
samples positive for M. genitalium and therefore our results, although based on a very
77
Chapter Four
small sample, suggest that macrolides can still be used for treatment of M. genitalium in
this population in Kilifi, Kenya.
To our knowledge, this is the first report of Ca. M. girerdii in Africa. In agreement with the
two initial reports on the prevalence of Ca. M. girerdii [15, 21], we found it to be strongly
associated with T. vaginalis (p = 0.001). Fettweis et al. [15], using a pyrosequencing
approach, were the first to detect Ca. M. girerdii DNA in the vaginal swabs of a few women
not infected with T. vaginalis, as assessed with qPCR, although in our study, Ca. M.
girerdii was found only in T. vaginalis positive women. A recent report by Costello et al.
[22] is in support of the close association of Ca. M. girerdii and T. vaginalis as they
recovered Ca. M. girerdii and T. vaginalis genomes from the saliva of a premature infant.
Our data suggest that T. vaginalis-positive women, co-infected with Ca. M. girerdii, were
more likely to report vaginal itching compared to T. vaginalis mono-infected women.
Future studies should elucidate the nature of the interaction of these two pathogens and
the effect that co-infection may have on clinical presentation.
U. parvum and U. urealyticum are commonly isolated from the vaginal microbiome of
asymptomatic pregnant women [23], as was the case in our study. Although detection of
U. parvum has been associated with preterm birth [24], opinions differ with regard to the
need to screen and treat Ureaplasma spp. infection during pregnancy, since its presence
often represents colonization rather than infection [25]. Our data did not show any
association between T. vaginalis and either U. parvum or U. urealyticum.
C. trachomatis was highly prevalent (13.9%) in our study. All isolates were non-LGV
strains, and were not associated with T. vaginalis infection. Our results on urogenital
carriage of Candida, E. coli, and GBS indicate that the three were not associated with T.
vaginalis infection, either. While the prevalence of Candida in our study was higher than
that reported in a cross-sectional study by Cools et al. [11] among women in Kenya,
Rwanda and South-Africa, our prevalence for E. coli and GBS is comparable to what they
reported.
Our study had some limitations. First, it only included a relatively small sample size of
pregnant women limiting the precision of our prevalence estimates. Furthermore, only BV
negative samples were included in the control arm, which may represent a bias on the
78
Chapter Four
interpretation of the results. Among the 28 T. vaginalis-positive women, only four were
positive for BV and excluding them in the analysis does not affect the results (Suppl. Table
3). It should be noted that our T. vaginalis/BV co-infection rate of 14 % was comparable
to that observed in a recent study, i.e. 17.5% among HIV + women [26]. Finally, no internal
control was added during the DNA extraction process, so inefficient genome extraction or
(partial) PCR inhibition could not be documented. However, sample adequacy was
evaluated by detecting a minimal level of human DNA present in the sample, which was
the case for all samples, moreover none of the samples that were culture-positive for T.
vaginalis were missed by PCR.
In conclusion, we observed notable prevalence of urogenital micro-organisms, pathogens

and colonizing germs among pregnant women which emphasizes the need for laboratory
testing and treatment to avoid unfavorable pregnancy outcomes. We confirm M. hominis
as a correlate of T. vaginalis in our population, but the most salient finding was the
exclusive association of both M. genitalium and Ca. M. girerdii with T. vaginalis. The latter
finding ought to be further addressed using a larger sample size.
Acknowledgements
We would like to thank the study participants. A special thanks to all nurses at the ANC
Clinic of the Kilifi County Hospital. This manuscript was submitted for publication with
permission from the Director of the Kenya Medical Research Institute (KEMRI).
Funding
This research has been supported by a PhD Scholarship to Simon C. Masha from the
Belgian Development Cooperation through VLIR-UOS. The funders had no role in the
design of the study and collection, analysis, and interpretation of data and in writing the
manuscript. The views expressed here are those of the authors and do not necessarily
represent the views of the Belgian Development Cooperation.
Declaration
All authors declare no conflicts of interest.
79
Chapter Four
Author contributions
Author contributions: S.C.M, P.C, E.J.S and M.V designed the study. S.C.M supervised
the field data collections. S.C.M, P.C, P.D and M.R. conducted laboratory analysis and
contributed to the interpretation of results. S.C.M wrote the initial manuscript draft, P.C,
P.D, M.R, E.J.S and M.V contributed to the interpretation of data and critically reviewed
the manuscript. All authors read and approved the final version of the manuscript.
Consent for publication
Not applicable
Availability of data and material
The data supporting the conclusions of this article is included within the article and its
supplementary material.
80
Chapter Four
4.6 References
1. Newman L, Rowley J, Vander Hoorn S, et al. Global estimates of the prevalence

and incidence of four curable sexually transmitted infections in 2012 based on
systematic review and global reporting. PloS One 2015; 10:e0143304.
2. Vos T, Barber RM, Bell B, et al. Global, regional, and national incidence,
prevalence, and years lived with disability for 301 acute and chronic diseases and
injuries in 188 countries, 1990 -2013: a systematic analysis for the Global Burden of
Disease Study 2013. Lancet 2015; 386:743-800.
3. McClelland RS, Sangare L, Hassan WM, et al. Infection with Trichomonas vaginalis
increases the risk of HIV-1 acquisition. J Infect Dis 2007; 195:698-702.
4. Petrin D, Delgaty K, Bhatt R, et al. Clinical and microbiological aspects of
Trichomonas vaginalis. Clin Microbiol Rev 1998; 11:300-317.
5. Fichorova R, Fraga J, Rappelli P, et al. Trichomonas vaginalis infection in
symbiosis with Trichomonasvirus and Mycoplasma. Res Microbiol 2017; 168:882-
891.
6. Azargoon A, Darvishzadeh S. Association of bacterial vaginosis, Trichomonas
vaginalis, and vaginal acidity with outcome of pregnancy. Arch Iranian Med 2006;
9:213-217.
7. Donders GGG, Ruban K, Bellen G, et al. Mycoplasma/Ureaplasma infection in
pregnancy: to screen or not to screen. J perinat med. 2017; 45(5):505-515.
8. Masha SC, Wahome E, Vaneechoutte M, et al. High prevalence of curable sexually
transmitted infections among pregnant women in a rural county hospital in Kilifi,
Kenya. PloS One 2017; 12:e0175166.
9. Steensels D, Reynders M, Descheemaeker P, et al. Clinical evaluation of a multi-
parameter customized respiratory TaqMan® array card compared to conventional
methods in immunocompromised patients. J Clin Vir 2015; 72:36-41.
10. Duyvejonck H, Cools P, Decruyenaere J, et al. Validation of High Resolution
Melting Analysis (HRM) of the amplified ITS2 region for the detection and
identification of yeasts from clinical samples: Comparison with culture and MALDI-
TOF based identification. PLoS ONE 2015; 10:e0132149. Erratum in: PLoS One
2015; 10:e0139501.
11. Cools P, Jespers V, Hardy L, et al. A multi-country cross-sectional study of vaginal
carriage of group B streptococci (GBS) and Escherichia coli in resource-poor
settings: prevalences and risk factors. Plos One 2016; 11:e0148052.
81
Chapter Four
12. El Aila NA, Cools P, Deschaght P, et al. Strong correspondence of the vaginal and
rectal load of group B streptococci in pregnant women. J Clin Gynecol Obst 2013;
2:61-67.
13. Deeks JJ, Higgins JPT. Statistical algorithms in Review Manager 5. 2010.
http://training.cochrane.org/handbook/statistical-methods-revman5. Accessed 6 Jun
2018.
14. Crucitti T, Abdellati S, Van Dyck E, Buve A. Molecular typing of the actin gene of
Trichomonas vaginalis isolates by PCR-restriction fragment length polymorphism.
Clin Microbiol Infect. 2008; 14:844-52.
15. Fettweis JM, Serrano MG, Huang B, et al. An emerging Mycoplasma associated
with trichomoniasis, vaginal infection and disease. PloS One 2014; 9:e110943.
16. Becker DD, dos Santos O, Frasson AP, et al. High rates of double-stranded RNA
viruses and Mycoplasma hominis in Trichomonas vaginalis clinical isolates in South
Brazil. Infect Genet Evol 2015; 34:181-187.
17. Xiao JC, Xie LF, Fang SL, et al. Symbiosis of Mycoplasma hominis in Trichomonas
vaginalis may link metronidazole resistance in vitro. Parasit Res 2006; 100:123-
130.
18. Rappelli P, Addis MF, Carta F, et al. Mycoplasma hominis parasitism of
Trichomonas vaginalis. Lancet 1998; 352:1286.
19. Van Belkum A, Van der Meijden WI, Verbrugh HA, et al. A clinical study on the
association of Trichomonas vaginalis and Mycoplasma hominis infections in women
attending a sexually transmitted disease (STD) outpatient clinic. Immun Med
Microbiol 2001; 32:27-32.
20. Coorevits L, Traen A, Binge L, et al. Macrolide resistance in Mycoplasma genitalium
in female sex workers, Belgium. J Glob Antimicrob Resist 2017; In press.
21. Martin DH, Zozaya M, Lillis RA, et al. Unique vaginal microbiota that includes an
unknown Mycoplasma-like organism is associated with Trichomonas vaginalis
infection. J Infect Dis 2013; 207:1922-1931.
22. Costello EK, Sun CL, Carlisle EM, et al. Candidatus Mycoplasma girerdii replicates,
diversifies, and co-occurs with Trichomonas vaginalis in the oral cavity of a
premature infant. Sci Rep 2017; 7:3764.
23. Taylor-Robinson D. Mollicutes in vaginal microbiology: Mycoplasma hominis,
Ureaplasma urealyticum, Ureaplasma parvum and Mycoplasma genitalium. Res
Microbiol 2017; 168:875-881.
24. Payne MS, Ireland DJ, Watts R, et al. Ureaplasma parvum genotype, combined
vaginal colonisation with Candida albicans, and spontaneous preterm birth in an
Australian cohort of pregnant women. BMC Pregnancy Childbirth 2016; 16:312.
82
Chapter Four
25. Donders GG, Ruban K, Bellen G, et al. Mycoplasma/Ureaplasma infection in

pregnancy: to screen or not to screen. J Perinatal Med 2017; 45:505-515.
26. Gatski M, Martin DH, Clark RA, et al. Co-occurrence of Trichomonas vaginalis and
bacterial vaginosis among HIV-positive women. Sex Transm Dis 2011; 38:163-166.
83
Chapter Four
Table 4.1. Study participant characteristics

Socio-demographic and behavioral characteristics of Trichomonas vaginalis qPCR
positive women (cases) and T. vaginalis qPCR negative women (controls), attending
antenatal care at Kilifi County Hospital, Kenya.
Characteristic Cases (%) Controls (%) χ2

N = 28 N = 51 P-value
Age group (Years)
18-24 42.9 31.4 0.307
≥ 25 57.1 68.6
Religion
Christian 64.3 68.6 0.383
Muslim 10.7 17.7
Other/None 25.0 13.7
Education
None 21.4 23.5 0.946
Primary 60.7 56.9
Secondary/Tertiary 17.9 19.6
Employment status
Employed/self-employed 50.0 72.6 0.045
Unemployed 50.0 27.5
Parity
0 25.0 35.3 0.234
1-2 46.4 25.4
3+ 28.6 37.3
Gestational age
14-27 57.1 58.8 0.885
≥ 28 42.9 41.2
Number of lifetime sex
1 82.1 90.2 0.303
3+ 21.7 9.8
Legend
In bold: significantly associated, i.e., P ≤ 0.05
84
Chapter Four
Table 4.2 Prevalence of urogenital species and univariate and multivariate analysis of the co-occurrence of other species
with Trichomonas vaginalis
Species Overall prevalence %TV+/%TV- Univariate analysis Multivariate analysis

(N = 79)
COR P-value AOR P-value
(95% CI)
(95% CI) (95% CI)
Candida albicans 24.1(15.1-35.0) 32.1/19.6 1.9 (0.7-5.6) 0.216 - -
Chlamydia trachomatis 13.9 (7.2-23.5) 21.4/9.8 2.5 (0.7-9.1) 0.163 - -

Escherichia coli 27.8 (18.3-39.1) 35.7/23.5 1.8 (0.7-4.9) 0.251 - -
Mycoplasma genitalium 6.3(2.1-14.2) 17.9/0.0 5.0 (0.3-94.3)* 0.002
Ca. Mycoplasma girerdii 7.6 (2.8-15.8) 21.4/0.0 4.3 (0.2-78.4)* 0.001
Mycoplasma hominis 41.8 (30.8-53.4) 71.4/25.5 7.3 (2.6-20.5) < 0.001 6.8 (2.3-19.8) < 0.001
Streptococcus agalactiae 11.4 (5.3-20.5) 7.1/13.7 0.5 (0.1-2.5) 0.386 - -
Ureaplasma parvum 74.7 (63.6-83.8) 78.9/72.6 1.4(0.5-4.1) 0.557 - -
Ureaplasma urealyticum 48.1 (36.7-59.6) 60.7/41.2 2.2 (0.9-5.7) 0.099 1.3 (0.4-3.8) 0.624
Cytomegalovirus 1.3 (0-6.9) 0.0/2.0 1.7 (6.6-4210.4)* 0.456
HIV 3.8 (0.7-10.7) 10.7/0.0 7.9 (0.4-158.5)* 0.017
HSV 1, HSV 2 2.5 (0.3-8.8) 7.1/0.0 11.1 (0.5-238.6)* 0.053
Bacterial vaginosis 5.1 (1.4-12.5) 14.3/0.0 6.2 (0.3-118.4)* 0.006
Legend: TV+: Trichomonas vaginalis positive; TV-: Trichomonas vaginalis negative; HIV: human immunodeficiency virus; HSV1:
herpes simplex virus type 1; herpes simplex virus type 2; COR: crude odds ratio; AOR: adjusted odds ratio; in bold: significantly
associated, i.e., P ≤ 0.05* Separate computation not included in multivariable model.
85
Chapter Four
Table 4.3 Comparison of women co-infected with Trichomonas vaginalis and M. hominis
with those infected with T. vaginalis only
Comparison of clinical signs and symptoms among women co-infected with Trichomonas
vaginalis and Mycoplasma hominis with those infected with T. vaginalis only
Clinical sign or symptom TV with MH TV without MH χ2

N = 20 (%) N = 8 (%) P-value
Dyspareunia 40.0 37.5 0.903

Dysuria 30.0 37.5 0.701
Foul smelling vaginal discharge 30.0 12.5 0.334
Genital ulcers 15.0 12.5 0.864
Genital warts 10.0 0.0 0.353
Lower abdominal pain 40.0 25.0 0.454
Vaginal discharge 75.0 62.5 0.508
Vaginal itching 30.0 25.0 0.791
Legend:
MH: Mycoplasma hominis; TV: Trichomonas vaginalis
86
Chapter Four
Table 4.4 Comparison of women co-infected with Trichomonas vaginalis and Ca

Mycoplasma girerdii with those infected with T. vaginalis only
vaginalis and Ca Mycoplasma girerdii and those infected with T. vaginalis only
Clinical sign or symptom TV with Ca MG TV without Ca χ2

MG
N = 6 (%) P-value
N = 22 (%)
Dysuria 50.0 27.3 0.291
Legend:
Ca MG: Candidatus Mycoplasma girerdii; TV: Trichomonas vaginalis; in bold: significantly
associated.
87
Chapter Four
Table 4.5 Comparison of women co-infected with Trichomonas vaginalis and M.

genitalium with those infected with T. vaginalis only
vaginalis and Mycoplasma genitalium compared to those infected with T. vaginalis only
Clinical sign or symptom TV with MG TV without MG (χ2).P-value
N = 5 (%) N = 23 (%)

Dysuria 20.0 34.8 0.521
Legend:
MG: Mycoplasma genitalium; TV: Trichomonas vaginalis.
88
Chapter Four
Supplementary Table 4.1. Socio-demographic and behavioral characteristics of women

selected as controls and women not selected as controls, attending antenatal care at
Kilifi County Hospital, Kenya.
Characteristic Not selected as controls Selected as controls χ2
(%)N = 270* (%) N = 51
P-value
Age group (Years)

18-24 38.5 31.4 0.333
≥ 25 61.5 68.6
Religion
Christian 72.2 68.6 0.872
Muslim 15.6 17.7
Other/None 12.2 13.7
Education
None 16.7 23.5 0.387
Primary 57.0 56.9
Secondary/Tertiary 26.3 19.6
Employment status
Employed/self-employed 55.2 72.6 0.021
Unemployed 44.8 27.5
Parity
0 25.6 35.3 0.207
1-2 39.3 25.4
3+ 35.2 37.3
Gestational age
14-27 63.7 58.8 0.511
≥ 28 36.3 41.2
Number of lifetime sex
1 88.9 90.2 0.784
3+ 11.1 9.8
Legend
In bold: significantly associated, i.e., P ≤ 0.05
* Socio-demographic and behavioral characteristics for one participant were missing and thus
270 and not 271.
89
Chapter Four
Supplementary Table 4.2. Specific PCR details;
Target Composition and primer reference (final volumes: 10 μl)* Thermocycler

organism conditions
[reference]
Candida LightCycler 4801SYBR Green I Master (Roche): 5 μl 50 °C for 2 min

albicans Forward primer: 0.3 μM, , 0.13 μl CA_FW: 95 °C for 10 min
[9] CAACGAACTGAACTGGCAGA 40 x (95 °C for 15 s
Reverse primer: 0.3 μM, , 0.13 μl CA_RV: and 60 °C for 1
CATTACGCTGCGATGGAT min)
Escherichia LightCycler 4801 SYBR Green I Master (Roche): 5 μl 50 °C for 2 min

coli Forward primer: 0.3 μM, 0.1 μl Ecoli_FW: 95 °C for 10 min
[10] CAACGAACTGAACTGGCAGA 40 x (95 °C for 15 s
Reverse primer: 0.3 μM, 0.1 μl Ecoli_RV: and 60 °C for 1
CATTACGCTGCGATGGAT min)
Probe: 0.3 μM, 0.1 μl TATCCCGCCGGGAATGGTGA
Streptococcus LightCycler 4801SYBR Green I Master (Roche): 5 μl 95 °C for 5 min
agalactiae Forward primer: 0.5 μM, 0.25 μl Sip1: 40 x (95 °C for 10
[11] ATCCTGAGACAACACTGACA s, 58 °C for 15 s
Reverse primer: 0.5 μM, 0.25 μl Sip2 and 72 °C for 20 s)
TTGCTGGTGTTTCTATTTTCA
Probe: 0.3 μM, 0.10 μl
6-FAM–ATCAG AAGAGTCATACTGCCACTTC–
TAMRA
Trichomonas Faststart PCR master (Roche): 10 μl 95 °C for 5 min
vaginalis Forward primer: 0.2 μM , 0.2 μl Tv8S 40 x (95 °C for 30
[13] TCT GGA ATG GCT GAA GAA GAC G s, 58 °C for 30 s
Reverse primer: 0.2 μM, 0.2 μl Tv9R and 72 °C for 3min)
CAG GGT ACA TCG TAT TGG TC 72°C for 7 min
Candidatus Faststart PCR master (Roche): 10 μl 95 °C for 5 min,
Mycoplasma Forward primer: 0.2 μM, 0.2 μl M1_Contig1-3_F: 40 x (95 °C for 30
girerdii TGCATATCCATCTAATGCAACC s, 50 °C for 30 s
Reverse primer: 0.2, 0.2 μl μM M1_Contig1-3_R: and 72 °C for 45 s)
[14] AGGGACTGTATTTTATCGCAATGG 72°C for 7 min
Legend:
* Candidatus Mycoplasma girerdii and Trichomonas vaginalis PCRs were carried out in a total
volume of 20 μl. 2 μL of DNA extract was used for each PCR
90
Chapter Four
Supplementary Table 4.3. Prevalence of urogenital species among Trichomonas vaginalis qPCR positive women (24 cases)
and T. vaginalis qPCR negative women (51 controls) and Univariate and Multivariate analysis of the presence of species
among cases vs controls among 75 women attending antenatal care at Kilifi County Hospital, Kenya. (Four women with BV
are excluded)
Species Overall prevalence N = 75 Univariate analysis Multivariate analysis
(N = 75) (95% CI) (24/51)
COR (95% CI) P-value AOR (95% CI) P-value
(%TV+/%TV-)
Candida albicans 24.0 (14.9-35.1) 33.3/19.6 2.1 (0.7-6.1) 0.199 - -
Chlamydia trachomatis 13.3 (6.5-23.2) 20.8/9.8 2.4 (0.6-9.3) 0.199 - -

Mycoplasma genitalium 5.3 (1.5-13.1) 16.7/0.0 5.3 (0.3-102.1)* 0.003
Ca. Mycoplasma girerdii 8.0 (3.0-16.6) 25.0/0.0 3.7 (0.2-67.6)* < 0.001
Mycoplasma hominis 38.7 (27.6-50.6) 66.7/25.5 5.8 (2.0-16.8)* 0.001 5.5 (1.8-16.4) 0.002
Ureaplasma parvum 74.7 (63.3-84.0) 79.2/72.6 1.4 (0.5-4.6) 0.540 - -
Ureaplasma urealyticum 46.7 (35.1-58.6) 58.3/41.2 2.0 (0.7-5.4) 0.168 1.3 (0.4-3.8) 0.678
Cytomegalovirus 1.3 (0-7.2) 0.0/2.0 1.4 (5.6-3631.8)* 0.490
HIV 2.7 (0.3-9.3) 8.3/0.0 9.5 (0.4-205.8)* 0.037
HSV 1, HSV 2 1.3 (0.0-7.2) 4.2/0.0 15.9 (0.6-403.5)* 0.142
Legend: TV+: Trichomonas vaginalis positive; TV-: Trichomonas vaginalis negative HIV: human immunodeficiency virus; HSV1;
HSV2: herpes simplex virus type 1 or type 2; COR: crude odds ratio; AOR: adjusted odds ratio; in bold: significantly associated, i.e.,
P ≤ 0.05, * Separate computation not included in multivariate analysis.
91
Chapter Four
Supplementary Table 4.4. Prevalence of urogenital species among Trichomonas vaginalis qPCR positive women (22 cases)
and T. vaginalis qPCR negative women (51 controls) and Univariate and Multivariate analysis of the presence of species
among cases vs controls among 73 women attending antenatal care at Kilifi County Hospital, Kenya. (Six women with either
HIV or BV are excluded)
Species Overall N = 73 Univariate analysis Multivariate analysis

prevalence
(22/51)
(N = 73) (95% CI) COR P-value AOR P-value†
(%TV+/%TV-
) (95% CI) (95% CI)
Candida albicans 24.7 (15.3-36.1) 36.4/19.6 2.3(0.8-7.1) 0.133 - -
Chlamydia trachomatis 15.9 (7.9-27.3) 22.7/9.8 2.7(0.7-10.5) 0.151 - -
Mycoplasma genitalium 5.5 (15.1-13.4) 18.2/0.0 4.9 (0.3-94.0)* 0.002
Ca. Mycoplasma girerdii 8.2 (3.1-17.0) 27.3/0.0 3.4 (0.2-62.2)* <0.001
Mycoplasma hominis 38.4 (27.2-50.5) 68.2/25.5 6.3 (2.1-18.7) 0.001 5.5 (1.8-17.1) 0.003
Ureaplasma parvum 74.0 (62.4-83.5) 77.3/72.6 1.2 (0.4-4.1) 0.673 - -
Ureaplasma urealyticum 47.9 (36.1-60.0) 63.6/41.2 2.5 (0.9-7.0) 0.082 1.6 (0.5.4.9) 0.434
Cytomegalovirus 1.4 (0.0-7.4) 0.0/2.0 1.3 (5.1-3342.5)* 0.508
HSV1, HSV2 1.4 (0.0-7.4) 4.6/0.0 14.6 (0.6-371.4)* 0.125
Legend: TV+: Trichomonas vaginalis positive; TV-: Trichomonas vaginalis negative; HIV: human immunodeficiency virus; HSV1;
HSV2: herpes simplex virus type 1 or type 2; COR: crude odds ratio; AOR: adjusted odds ratio; in bold: significantly associated, i.e.,
P ≤ 0.05;* Separate computation not included in multivariate analysis.
92
Chapter Five | Trichomonas vaginalis typing
93
Masha et al. Parasites & Vectors (2017) 10:537
DOI 10.1186/s13071-017-2496-7
RESEARCH Open Access
Molecular typing of Trichomonas vaginalis

isolates by actin gene sequence analysis
and carriage of T. vaginalis viruses
Simon C. Masha1,2,3*, Piet Cools2, Tania Crucitti4, Eduard J. Sanders1 and Mario Vaneechoutte2
Abstract
Background: The protozoan parasite Trichomonas vaginalis is the most common non-viral, sexually transmitted
pathogen. Although T. vaginalis is highly prevalent among women in Kenya, there is lack of data regarding
genetic diversity of isolates currently in circulation in Kenya.
Methods: Typing was performed on 22 clinical isolates of T. vaginalis collected from women attending the antenatal
care clinic at Kilifi County Hospital, Kenya, in 2015. Genotyping followed a previously proposed restriction fragment
length polymorphism (RFLP) scheme, which involved in silico cleavage of the amplified actin gene by HindII, MseI and
RsaI restriction enzymes. Phylogenetic analysis of all the sequences was performed to confirm the results obtained by
RFLP-analysis and to assess the diversity within the RFLP genotypes. Additionally, we determined carriage of the four
different types of Trichomonas vaginalis viruses (TVVs) by polymerase chain reaction.
Results: In silico RFLP-analysis revealed five actin genotypes; 50.0% of the isolates were of actin genotype E, 27.3%
of actin genotype N, 13.6% of actin genotype G and 4.5% of actin genotypes I and P. Phylogenetic analysis was in
agreement with the RFLP-analysis, with the different actin genotypes clustering together. Prevalence of TVVs was
43.5% (95% confidence interval, CI: 23.2–65.5). TVV1 was the most prevalent, present in 39.1% of the strains and
90% of the T. vaginalis isolates which harbored TVVs had more than one type of TVV. None of the isolates of actin
genotype E harbored any TVV.
Conclusion: The presence of five actin genotypes in our study suggests notable diversity among T. vaginalis
isolates occurring among pregnant women in Kilifi, Kenya. Isolates of the most prevalent actin genotype E
lacked TVVs. We found no association between T. vaginalis genotype, carriage of TVVs and symptoms. Further
studies with higher number of strains should be conducted in order to corroborate these results.
Keywords: Trichomonas vaginalis, Trichomonas vaginalis viruses, actin gene, Typing, Kilifi, Kenya
Background inflammation, and a ‘strawberry cervix’ characterized by

Trichomonas vaginalis is a flagellated protozoan parasite punctate hemorrhagic lesions [2]. Men typically remain
that infects the human urogenital tract, causing the most asymptomatic, but can suffer from urethral discharge,
common non-viral, sexually transmitted infectious dysuria, urethritis, epididymitis and prostatitis [2, 3].
disease worldwide [1]. The prevalence of T. vaginalis Trichomonas vaginalis has been associated with adverse
among women in sub-Saharan Africa is 11.5% [1]. In pregnancy outcomes, such as preterm birth and prema-
about half of the infected women, T. vaginalis causes a ture rupture of membranes [4–6], increased shedding
malodorous vaginal discharge, vulval irritation and and acquisition of the human immunodeficiency virus
(HIV) [7, 8], hence contributing to the HIV pandemic.
* Correspondence: schengo@kemri-wellcome.org The global prevalence of T. vaginalis and the health
1
Centre for Geographic Medicine Research – Coast, Kenya Medical Research sequelae associated with it have necessitated the need to
Institute (KEMRI), P.O. Box 230-80108, Kilifi, Kenya
2
Laboratory Bacteriology Research, Faculty of Medicine and Health Sciences,
understand its genetic make-up. Trichomonas vaginalis is a
Ghent University, De Pintelaan, 185 9000 Ghent, Belgium complex pathogen, with a genome size of ~160 megabases,
Full list of author information is available at the end of the article
© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
94
Masha et al. Parasites & Vectors (2017) 10:537 Page 2 of 9
two-thirds of which is composed of repeats and transpos- A total of 349 pregnant women were included in the
able elements [9]. Some strains of T. vaginalis can harbor study. A nurse collected vaginal secretions from the
up to four types of Trichomonas vaginalis viruses (TVVs) vaginal introitus using a sterile cotton swab. The vaginal
[10]. TVVs are members of the family Totiviridae under swab was inoculated at the clinic in the upper-chamber
the distinct genus Trichomonasvirus [11]. Carriage of TVVs of an InPouch system (BioMed Diagnostics, White City,
has been suggested to upregulate pro-inflammatory host Oregon, USA). The inoculated InPouch was transferred
responses [12] and T. vaginalis immunogenic protein P270 to the laboratory within 15 min for direct microscopy of
[13] and is also associated with differential qualitative and the upper chamber, after which it was merged with the
quantitative expression of cysteine proteinases [14]. Thus, lower chamber and incubated at 37 ± 1 °C under aerobic
since TVVs induce various phenotypic changes that may conditions. Daily microscopic observation of the
impact T. vaginalis virulence [14], determining carriage of InPouch system was performed and media with motile
TVVs seems to be essential in the characterization of T. trichomonads within 5 days of culture were considered
vaginalis infection. However, no method has been adapted positive for T. vaginalis. Two ml of the contents of each
as a standard clinical diagnostic test for TVVs [15]. InPouch system positive for T. vaginalis were transferred
Better understanding the diversity of T. vaginalis and into a 2.0 ml Eppendorf tube and stored at -80 °C until
geographical distribution of various genotypes may shipment to the Laboratory of Bacteriology Research
improve our knowledge regarding the epidemiology of this (Ghent University, Belgium) using shipping boxes filled
infectious agent and contribute to vaccine development with dry ice (-78.5 °C). The samples were stored at -80 °C
efforts. At present, none of the described techniques have until molecular analysis was performed.
been recognized as the “gold standard” for genotyping of Women found to be positive for T. vaginalis using
T. vaginalis isolates [16–23]. direct microscopy, i.e. microscopy of the upper chamber,
In this study, we opted to sequence the T. vaginalis were treated on the same day, while women who were
actin gene to better understand the genetic diversity of negative for T. vaginalis using direct microscopy but
T. vaginalis. Actin is a ubiquitous well conserved struc- positive on culture were contacted to return to the clinic
tural protein in all eukaryotic cells [24] and has been for treatment immediately after the culture turned positive.
used to clarify the molecular phylogeny of protists, Partners of women treated for T. vaginalis infection re-
plants, animals and fungi [25]. ceived presumptive treatment.
The data produced by sequencing are unambiguous,
reproducible and portable, thus offering the advantage that Nucleic acid extraction
public databases can be constructed. In Kenya, screening Frozen cultures were first thawed at room temperature
for T. vaginalis is not routinely done. However, recent stud- for 30 min, after which the tubes were vortexed for 30 s
ies have indicated that there is high prevalence of T. to ensure that a homogeneous mix was achieved before
vaginalis among different groups in Kenya [26–29]. Despite starting the nucleic acid extraction. Total nucleic acid ex-
this, no typing has been carried out. In this study, we traction was performed using the NucliSENS® easyMAG®
genotyped T. vaginalis isolated from pregnant women (bioMérieux, Marcy l’Etoile, France) according to the
attending ANC in Kilifi, Kenya. manufacturer’s instructions (generic protocol 2.0.1).
Actin gene PCR

Methods The actin gene was amplified using the outer primers
Study design, population and specimens processing previously used in a nested polymerase chain reaction
From July through to September 2015, we conducted a (PCR), i.e. primers Tv8S (5′-TCT GGA ATG GCT
cross-sectional study at the antenatal care clinic of Kilifi GAA GAA GAC G-3′) and Tv9R (5′-CAG GGT
County Hospital, Kenya. The main aim of that study was ACA TCG TAT TGG TC-3′) [20], with the following
to describe the prevalence and predictors of curable sexu- thermocycling conditions: 5 min at 95 °C, 40 cycles
ally transmitted infections (STIs) among pregnant women of 30 s at 95 °C, 30 s at 55 °C and 3 min at 72 °C,
attending to the antenatal care clinic [29]. Women were followed by 7 min at 72 °C. This was performed on
eligible if they met the following criteria: age 18–45 years, the ABI Veriti thermocycler platform (ThermoFisher
gestation ≥ 14 weeks, resident of the Kilifi Health and Scientific, Waltham, Massachusetts, USA).
Demographic Surveillance area, willingness to undergo
free STI and bacterial vaginosis screening procedures, and Gel electrophoresis
able and willing to give written informed consent [29]. PCR amplification products were visualized under UV light
The current study presents a secondary objective of the after electrophoresis on 1% agarose gels in Tris-acetate-
above-mentioned study, namely to perform typing of T. EDTA buffer pH 8.5 (30 min at 10 V/cm) and staining with
vaginalis clinical isolates from this study population. ethidium bromide (0.5 mg⁄ l; Sigma, Bornem, Belgium). The
95
size of the amplified products was assessed by compari- CCA GTT GCT TTC CG-3′) and TVV4R1834 (5′-TTC
son with a commercial weight marker, Smart Ladder CCC AAT AGT TAT CAG-3′) [10]. The amplification con-
(Eurogentec, Liege, Belgium). ditions were: 5 min at 95 °C, 40 cycles of 30 s at 95 °C, 30 s
at 50 °C and 45 s at 72 °C, followed by 7 min at 72 °C. The
Sequencing PCR products were visualized by electrophoresis as de-
Amplicons (20 μl) were sent for sequencing to GATC scribed above.
Biotech (Constance, Germany), using the Sanger sequen-
cing technique. Sequencing was performed bi-directionally Statistical analysis
using the same primers used in PCR amplification of the The socio-demographic and clinical data of the partici-
actin gene. pants were entered in the REDCapTM electronic data
capture tool, version 6.5.0 (Vanderbilt University, Nashville,
Genotyping of T. vaginalis Tennessee). Prevalence of T. vaginalis was expressed as a
Trichomonas vaginalis actin sequences were edited using percentage with exact 95% binomial confidence intervals
Chromas Lite 2.01 (http://technelysium.com.au/wp/). Fur- (CIs). Univariable logistic regression was used to de-
thermore, we identified the T. vaginalis actin genotypes termine associations of T. vaginalis presence with
amongst our isolates by means of in silico RFLP-analysis socio-demographic data, hygienic data, sexual behav-
Webcutter version 2.0; http://rna.lundberg.gu.se/cutter2/ ior, and vaginal signs & symptoms. Variables signifi-
with the three restriction enzymes (HindII, MseI and RsaI) cant at P ≤ 0.1 in bivariable analysis were entered
used by Crucitti et al. [20]. The in silico analysis was done into a multivariable model to identify independent as-
on our clinical isolates and on retrieved sequences repre- sociations. Crude odds ratios (COR) and adjusted
senting the genotypes that have been proposed. To identify odds ratios (AOR) were calculated. These statistical
if there were additional T. vaginalis actin genotypes not analyses were done using STATA, version 13.1
captured by the previous proposed scheme, in silico (Stata-Corp, College Station, Texas).
RFLP was performed on actin sequences retrieved
from the GenBank whose actin genotype is yet to be Results
documented. The sequences were of at least 1100 bp Characteristics of the study population
in length (Additional file 1: Table S1). The median age and gestation age including the inter-
To compare results obtained in the RFLP analysis, and quartile range (IQR) for the participants was 27 (22–31)
to determine the genetic variation among the identified years and 25 (20–30) weeks, respectively. The majority
genotypes, we performed phylogenetic analysis of the se- of the participants were married (93.6%) and Christian
quences. Sequences obtained in our study were aligned (72.3%). Approximately a quarter of the participants had
using MEGA software and compared with analogous se- received secondary school education and above. The
quences representative of known T. vaginalis actin ge- median age and IQR of sexual debut was 18.6 (16–20)
notypes identified in from our isolates. years, although 17.4% of the participants were not sure
Evolutionary distances were calculated by Kimura’s or did not respond to this question. Seventy-three
two-parameter model (Kimura, 1980) and a phylogenetic percent of the participants had given birth before and
tree was generated using the Maximum Likelihood the number of children ranged between 1 and 10. Sixty-
method using the MEGA software (version 7.0) [30]. Fi- five percent of the participants had previously experi-
nally, confidence levels were estimated using bootstrap enced signs/symptoms associated with reproductive tract
resampling on 1000 randomly selected pseudoreplicates. infection and about one third had ever received syndromic
treatment for genital signs or symptoms of infection. The
Detection of Trichomonas vaginalis viruses socio-demographic characteristics of the participants are
Synthesis of cDNA was performed on the nucleic acid summarized in Table 1.
extract using the RevertAid First Strand cDNA Synthesis
Kit (ThermoFisher Scientific, Gent, Belgium). The cDNA Prevalence, clinical signs and symptoms
was used to amplify the four known TVVs by means of A total of 23/349 (6.6%, 95% CI: 4.2–9.7) women
previously described type specific primers: TVV1F2875 (5′- were culture-positive for T. vaginalis, and 34.8% of
ATT AGC GGT GTT TGT GAT GCA-3′) and these cases were positive by direct microscopy prior
TVV1R3443 (5′-CTA TCT TGC CAT CCT GAC TC-3′), to further incubation. Based on symptoms routinely
TVV2F1401 (5′-ATT AGC GGT GTT TGT GAT GCA- used in syndromic management of STIs (i.e. genital
3′) and TVV2R1953b (5′-GGT TCG TGG AAG CGG ulcer, lower abdominal pain or abnormal vaginal discharge),
TTG ATG A-3′), TVV3F1474 (5′-CTA CCA AGA AGG 43.5% of the 23 women with T. vaginalis infection were
AGG CTT GA-3′) and TVV3R2025b (5′-GGT TCG TGG asymptomatic. The most commonly self-reported symp-
AAG CGG TTG ATG A-3′), and TVV4F1338 (5′-ATG toms amongst all participants included vaginal discharge
96
Table 1 Univariable and multivariable analysis of characteristics Table 1 Univariable and multivariable analysis of characteristics
of pregnant women with T. vaginalis attending antenatal care of pregnant women with T. vaginalis attending antenatal care
clinic at Kilifi County Hospital, Kenya clinic at Kilifi County Hospital, Kenya (Continued)
Variable N = 349 Percentage with Crude OR P-value Variable N = 349 Percentage with Crude OR P-value
T. vaginalis (95% CI) T. vaginalis (95% CI)
c
Demographic characteristics Number of lifetime sex partners
Age group (years) 1 158 3.8
18–24 132 6.8 1.1 (0.4–2.5) 0.894 2+ 189 9.0 2.5 (1.0–6.5) 0.060a
≥ 25 217 6.5 Polygamous partner
Religion No 303 6.9 1.6 (0.4–7.2) 0.515
Christian 248 5.7 Yes 46 4.4
Muslim 54 5.7 1.0 (0.3–3.5) 0.979 Alcohol consumption ever
Other/None 47 12.8 2.4 (0.9–6.7) 0.083 a No 262 6.5 0.9 (0.4–2.5) 0.894
Education Yes 87 6.9
None 63 7.9 Tobacco use
Primary 200 7.0 0.9 (0.3–2.5) 0.802 No 332 6.6 1.1 (0.1–8.9) 0.904
Secondary/Tertiary 86 4.7 0.6 (0.1–2.1) 0.411 Yes 17 5.9
Marital status Other drugs/substance use ever
Single 25 4.0 No 332 6.6 1.1 (0.1–8.9) 0.904
Married 224 6.8 1.7 (0.2–13.5) 0.593 Yes 17 5.9
Residency Sexually transmitted infections/reproductive tract infections
Living with partner 255 5.5 HIV
Not living with a 94 9.6 1.8 (0.8–4.4) 0.178 Negative 324 6.2
partner Positive 25 12.0 2.1 (0.6–7.5) 0.268
Employment status Bacterial vaginosisd
Employed/self- 199 5.0 Negative 293 6.5
employed
Positive 53 7.6 1.1 (0.4–3.6) 0.775
Unemployed 150 8.7 1.8 (0.8–4.2) 0.180
Clinical signs and symptoms of STI
Parity
0 94 6.4 1.1 (0.3–3.5) 0.843
No 122 5.6
1–2 133 7.5 1.3 (0.5–3.6) 0.570
Yes 227 7.1 1.2 (0.5–3.1) 0.638
3+ 122 5.7
c
Gestational age (weeks)
No 229 6.6
14–25 183 5.5
Yes 120 6.7 1.0 (0.4–2.5) 0.967
≥ 26 165 7.9 1.5 (0.6–3.4) 0.382
Current vaginal discharge (self-reported)c
No 96 3.1
Toilet type
Yes 252 7.9 2.7 (0.8–9.2) 0.119
Flushing toilet 117 7.7
Abnormal vaginal discharge foul smell/color (observed)c
Pit latrine 197 5.1 0.6 (0.3–1.6) 0.350
No 271 5.9
Bush/Other 35 11.4 1.5 (0.4–5.4) 0.491
Yes 77 9.1 1.6 (0.6–4.0) 0.324
Dysuriac
Tissue paper/Other 106 2.8
solid materials No 263 6.1
Water 243 8.2 3.1 (0.9–10.5) 0.074a Yes 85 8.2 1.4 (0.5–3.5) 0.489
Behavioral characteristics Dyspareuniac
Sexual debut age (years) No 245 4.9
≤ 17 106 8.5 1.8 (0.7–4.7) 0.231 Yes 103 10.7 2.3 (1.0–5.4) 0.053
≥ 18 183 4.9 Vaginal itchingc
Do not know/No 60 6.7 1.5 (0.4–5.0) 0.523 No 231 6.5

response Yes 117 6.8 1.1 (0.4–2.6) 0.903
97
Table 1 Univariable and multivariable analysis of characteristics traditionalist or reported having no religion compared to
of pregnant women with T. vaginalis attending antenatal care participants who were Christians or Muslims, used water
clinic at Kilifi County Hospital, Kenya (Continued) to clean themselves after visiting the toilet compared to
Variable N = 349 Percentage with Crude OR P-value those who used tissue paper or other solid materials, re-
T. vaginalis (95% CI)
c
ported having ≥ 2 lifetime sexual partners, reported
dyspareunia, had genital warts, and/or had a genital
No 169 8.3 ulcer (Table 1). In multivariable analysis, the only inde-
Yes 179 5.0 0.6 (0.2–1.4) 0.226 pendent predictor associated with T. vaginalis was hav-
Genital wartsc ing a genital ulcer (AOR = 7.6, 95% CI: 1.4–42.3).
No 341 6.2
Yes 7 28.6 6.1 (1.1–33.3) 0.037a Genotyping analysis
Genital ulcer (observed)c The actin gene target could be amplified from 21 of the
23 T. vaginalis isolates. All 21 amplicons had the ex-
No 338 5.6
pected length of approximately 1100 bp. The two
Yes 10 40.0 11.2 (2.9–43.1) < 0.001b
remaining isolates could only be amplified by a higher
Vaginitisc
primer concentration of 0.5 μM, instead of 0.3 μM.
No 334 6.6 However, one of these clinical isolates did not yield an
Yes 14 7.1 1.1 (0.1–8.7) 0.935 interpretable sequence and thus only sequences from 22
Symptomaticc clinical isolates were utilized in the typing. Five different
No 145 6.9 actin types (E, G, I, N and P) were identified according
Yes 203 6.4 0.9 (0.4–2.2) 0.855 to the position and the number of cleavage sites, follow-
a
Significant in univariable analysis
ing the scheme proposed by Crucitti et al. [20] (Table 2).
b
Significant on multivariable association; symptomatic (any or a The most prevalent actin genotype was E, representing
combination of the three symptoms, i.e. genital ulcer, lower abdominal 50.0% of the isolates. The other genotypes were, in order
pain or abnormal vaginal discharge)
c
Missing data/some participants did not respond to this question(s) of descending frequency, N (27.3%), G (13.6%) and I and
d
Bacterial vaginosis results for three participants were not available due to P (each 4.5%).
poor slides
Multiple sequence analysis to compare polymorphic sites
found on our actin sequences, and those retrieved from the
(72.4%). However, during collection of specimens by the GenBank, revealed a total of 33 single nucleotide differ-
study nurse, only 22.1% of the participants had an abnormal ences in the open reading frame of the actin gene. Three of
discharge (defined as excess discharge/foul smelling dis- these single nucleotide polymorphisms were exclusively
charge/colored discharge) upon examination. A total of found in actin sequences from our study (Additional file 2).
51.4% of the women reported having lower abdominal pain, The nucleotide sequences obtained of the actin gene for all
genital ulcers were observed in 2.9% of the women. Dyspar- the 22 isolates were submitted in GenBank under accession
eunia, genital warts and genital ulcers were the only clinical numbers: (MF350322–MF350343). The phylogenetic ana-
signs or symptoms significantly associated with T. vaginalis lysis (Fig. 1) showed that actin genotype E clustered with a
infection (Chi-square test: χ2 = 3.93, df = 1, P < 0.048; bootstrap value of 99. Lower bootstrap values were ob-
χ2 = 5.58, df = 1, P < 0.018; and χ2 = 18.60, df = 1, P < 0.05, served for actin genotypes N, G, I and P.
respectively).
Prevalence of T. vaginalis viruses
Predictors of T. vaginalis infection TVVs were present in 43.5% (95% CI: 23.2–65.5) (10/23)
Univariable analysis indicated that T. vaginalis infection of T. vaginalis isolates. Trichomonas vaginalis virus type
was more common among participants who were 1 (TVV1) was the most prevalent (39.1%), followed by
Table 2 Number and position of restriction sites using HindII, MseI and RsaI restriction enzymes
Genotype No. of HindII MseI RsaI
isolates
213 273 699 185 314 518 103 190 426 878 994
E 11 × × × × × × × ×
G 3 × × × × × × ×
I 1 × × × × × × × ×
N 6 × × × × × × × × ×
P 1 × × × × × × × × ×
× indicates the presence of a restriction cut site
98
Fig. 1 Phylogenetic tree for actin gene nuclotide sequences of T. vaginalis. The tree was generated using Maximum Likelihood method.
Bootstrap test for 1000 replicates. Sequences from Kilifi isolates (n = 22) have accession numbers with the prefix “MF”, all other sequences were
retreived from GenBank and are representative of the five actin genotypes. Scale-bar: 0.001 (1 substitution per 1000 nucleotides)
TVV2 (26.1%), TVV3 (17.4%) and TVV4 (13.0%). Nine 49 years in the World Health Organization Africa region in
out of 10 T. vaginalis isolates with TVVs harbored more 2012, which was estimated to be 11.5% (95% CI: 9.0–14.6)
than one type of TVV (Table 3). TVV1 was present in [1]. This is suggestive of lower rates of T. vaginalis among
all virus-positive T. vaginalis isolates but one (TV207). the general population of women in Kilifi, Kenya compared
All 11 genotype E isolates were virus-negative. to other African countries [31].
Finally, the distribution of symptomatic and asymptom- Although T. vaginalis does not traditionally present with
atic cases was not linked to any particular T. vaginalis actin genital ulcers [32], multivariable analysis showed that
genotype. Similarly, presence or absence of TVVs did not genital ulcers were the only predictor of an infection with
appear to have an influence as to whether a patient was T. vaginalis in our study. Ulcers could not be due to
symptomatic or asymptomatic. syphilis, which was not diagnosed in any of the women
with T. vaginalis, but we did not test for the Herpes
Discussion simplex virus, which is also associated with genital ulcers.
To our knowledge, this is the first study determining T. The association of genital ulcer with T. vaginalis is not
vaginalis genotypes and co-occurrence of T. vaginalis vi- unique to our study as it has been reported amongst female
ruses in Kenya. We sequenced the actin gene for 22 isolates sex workers in China [33].
and identified five types of T. vaginalis by in silico RFLP- Nucleotide sequence analysis of actin sequences showed
analysis of the amplified actin gene. We found notable gen- 33 polymorphic sites, three of which caused amino acid
etic diversity by full actin gene sequence analysis among T. substitution. Two of these amino acid substitutions have
vaginalis isolates in Kilifi, as well as those retrieved from been previously reported to occur in genotypes G, N, I and
GenBank. Prevalence of T. vaginalis in this study (6.6% in P, in which nucleotide 371 substituted alanine for valine,
349 pregnant women) was high but, however, fell short of and nucleotide 904 substituted lysine for glutamine [20,
the prevalence of T. vaginalis among women aged 15– 34]. A unique polymorphism leading to an amino acid
99
Table 3 Genotypes of Trichomonas vaginalis and carriage of T. studies have reported lower carriage of TVV, 18.7% (95%
vaginalis viruses, in relation to symptoms among 23 T. vaginalis CI: 11.5–28.0) in the Philippines [37] and 17.3% (95%
isolates in Kilifi, Kenya CI: 7.8–31.4) among Iranian isolates [38], although the
Sample ID TVV1 TVV2 TVV3 TVV4 Genotype Symptomatica latter study only determined the presence of TVV1.
TV279 + – + – * + However, higher prevalence rates of TVV have been re-
TV022 – – – – E + ported as well, 81.9% (95% CI: 71.1–90.0) in South
TV042 – – – – E +
Africa [39], and 75.0% (95% CI: 55.1–89.3) in Baltimore
City, Maryland [40]. The presence of TVV, in addition
TV050 – – – – E –
to metronidazole susceptibility, has been found to differ
TV066 – – – – E + significantly between T. vaginalis isolates genotyped by a
TV075 – – – – E + panel of 21 microsatellites and six single-copy genes of
TV176 – – – – E – T. vaginalis, which classifies T. vaginalis into two types:
TV188 – – – – E – type 1 and type 2 [23]. Type 2 is characteristically free of
TV203 – – – – E +
TVV and resistant to metronidazole [23]. Metronidazole
susceptibility in relation to actin genotypes is yet to be
TV224 – – – – E –
determined.
TV299 – – – – E + Fifty-seven percent of isolates in our study did not
TV323 – – – – E – harbor TVV, suggesting that they might be of type 2.
TV185 + – + + G – Our study might have been biased towards type 2;
TV207 – + – – G + 63.6% were recovered from patients who were diag-
TV238 + + + – G +
nosed by culture, after direct microscopy had been
determined to be negative, suggesting that the para-
TV307 + + – – I –
site load in the patient was low. Conrad et al. [23]
TV116 + + – – N – observed that type 1 parasites are often diagnosed by
TV131 + + – – N + direct microscopy and suggested that this may be in-
TV156 + – – + N – dicative of higher parasite load in type 1 which har-
TV190 + + + – N + bor TVVs. Additional studies, sampling a more
TV210 – – – – N +
diverse population and other regions in Kenya, are
needed to confirm the population type and distribu-
TV234 + – – + N –
tion of T. vaginalis in the country.
TV140 – – – – P + A total of 22 TVVs were identified in 10 T. vaginalis
Abbreviations: TVV1 Trichomonas vaginalis virus type 1, TVV2 T. vaginalis virus cultures, with multiple TVVs detected in nine cultures
type 2, TVV3 T. vaginalis virus type 3, TVV4 T. vaginalis virus type 4
Code: *Not typed; + present; − absent (Table 2). The higher prevalence of T. vaginalis cultures
a
Symptomatic: any or a combination of the three symptoms, i.e. genital ulcer, with either TVV1 or TVV2 than with TVV3 or TVV4 is
lower abdominal pain and/or abnormal vaginal discharge
consistent with previous reports [10, 37]. In these publi-
cations, concurrent TVV infection, with at least two or
substitution, in which nucleotide 892 substituted 3 TVVs, was recorded in six and three T. vaginalis sam-
threonine for serine, was observed to be exclusively ple cultures, respectively. Although we identified single
present on a GenBank sequence (accession number actin genotypes in all T. vaginalis cultures, which is indi-
XM_001301892). As such, in silico genotyping of cative for the presence of only 1 T. vaginalis strain per
isolates provides an opportunity to distinguish closely culture, we cannot rule out that the presence of the mul-
related isolates based on these polymorphic sites and tiple TVVs may be the result of a mixture of T. vaginalis
to further identify such polymorphic sites. strains, each infected with a different TVV. Therefore,
Our phylogenetic analysis confirms RFLP as a good our data does not necessarily indicate concurrent infec-
typing method, as the results from this method were in tion of TVVs in a single TV strain. The lytic cycle of
agreement with phylogenetic analysis. Phylogenetic ana- TVVs is yet to be described, and attempts to infect
lysis and detection of carriage of TVVs, revealed that uninfected isolates have been unsuccessful [41]. There-
none of the isolates of the most prevalent actin genotype fore, it is plausible that the virus may solely be acquired
E harbored a TVV. Furthermore, phylogenetic analysis through vertical transmission, making its presence an
indicated that genotype E formed a distinct phylogenetic important genetic marker [42].
lineage, suggesting clonal stability of this genotype [35]. Fifty-six percent of women with T. vaginalis infection in
The high prevalence (43.5%) of TVVs found in this our study were symptomatic and the symptoms occurred
study is comparable to a prevalence of 55% (95% CI: independently of the presence of TVV in the protozoon.
38.4–70.7) among Cuban isolates [36]. Two recent In vitro studies have shown that TVVs are sensed by the
100
human epithelial cells via Toll-like receptor 3, triggering Availability of data and materials
Interferon Regulating Factor − 3, interferon type I and The datasets supporting the conclusions of this article are included within
the article and its additional files. In addition, sequence generated in the study
pro-inflammatory cascades previously implicated in are available on GenBank under the accession numbers MF350322–MF350343.
preterm birth and HIV-1 susceptibility [12]. While
treatment with metronidazole generally eliminates T. Authors’ contributions
SCM, PC, EJS and MV designed the study. SCM supervised the field data
vaginalis, this may aggravate T. vaginalis-associated collections. SCM and PC conducted laboratory analysis and contributed to
inflammation caused by the release of TVV by stressed the interpretation of data. SCM wrote the initial manuscript draft, PC, EJS, TC
or dying parasites [12]. Additionally, TVVs upregulate and MV contributed to the interpretation of data and critically reviewed the
manuscript. All authors read and approved the final manuscript.
levels of phenotypically variable immunogen mRNA
P270 of T. vaginalis [13], while also playing a role in Ethics approval and consent to participate
T. vaginalis protein composition and its growth The study was approved by the Kenya Medical Research Institute (KEMRI)
Scientific and Ethics Review Unit (#3022). All participants provided written
kinetics [14]. informed consent for study participation.
Consent for publication

Conclusion Not applicable.
Our study was limited by the small number of isolates,
Competing interests
which rendered it difficult to investigate the implication The authors declare that they have no competing interests.
of TVV carriage on clinical signs and symptoms. Despite
the low number of T. vaginalis isolates, the presence of Publisher’s Note
all four types of TVVs in our isolates, in addition to the Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
five actin genotypes, demonstrates there is notable
genetic diversity of T. vaginalis isolated from pregnant Author details
women in Kilifi, Kenya. Isolates of the most prevalent 1
Centre for Geographic Medicine Research – Coast, Kenya Medical Research
Institute (KEMRI), P.O. Box 230-80108, Kilifi, Kenya. 2Laboratory Bacteriology
actin genotype E lacked TVVs; further studies with
Research, Faculty of Medicine and Health Sciences, Ghent University, De
higher number of strains should be conducted in order Pintelaan, 185 9000 Ghent, Belgium. 3Department of Biological Sciences,
to corroborate these results. The actin gene should be Faculty of Pure and Applied Sciences, Pwani University, P.O. BOX 195-80108,
Kilifi, Kenya. 4HIV/STI Reference Laboratory, Department of Clinical Sciences,
considered as a potential genetic marker for molecular
Institute of Tropical Medicine, Nationalestraat 155, 2000 Antwerpen, Belgium.
epidemiology and genotypic traits of T. vaginalis.
Received: 6 July 2017 Accepted: 23 October 2017
Additional files
References
1. Newman L, Rowley J, Vander Hoorn S, Wijesooriya NS, Unemo M, Low N,
Additional file 1: Table S1. Genotype, number and position of et al. Global estimates of the prevalence and incidence of four curable
restriction sites using HindII, MseI and RsaI restriction enzymes for actin sexually transmitted infections in 2012 based on systematic review and
sequences retrieved from GenBank. (DOCX 15 kb) global reporting. PLoS One. 2015;10:e0143304.
Additional file 2: Figure S1. Alignment of the T. vaginalis actin gene 2. Petrin D, Delgaty K, Bhatt R, Garber G. Clinical and microbiological aspects
nucleotide sequences retrieved from GenBank and those of from the of Trichomonas vaginalis. Clin Microbiol Rev. 1998;11:300–17.
clinical T. vaginalis isolates of the present study. (PDF 1746 kb) 3. Krieger JN. Prostatitis syndromes: pathophysiology, differential diagnosis,
and treatment. Sex Transm Dis. 1984;11:100–12.
4. Sangkomkamhang US, Lumbiganon P, Prasertcharoensuk W, Laopaiboon M.
Antenatal lower genital tract infection screening and treatment programs
Abbreviations
for preventing preterm delivery. Cochrane Database Syst Rev. 2015;2:Cd006178.
RFLP: Restriction fragment length polymorphism; TVV: Trichomonas vaginalis
5. Nakubulwa S, Kaye DK, Bwanga F, Tumwesigye NM, Mirembe FM. Genital
viruses
infections and risk of premature rupture of membranes in Mulago hospital,
Uganda: a case control study. BMC Res Notes. 2015;8:573.
Acknowledgments 6. Silver BJ, Guy RJ, Kaldor JM, Jamil MS, Rumbold AR. Trichomonas vaginalis as
We would like to thank the study participants and a special thanks to all a cause of perinatal morbidity: a systematic review and meta-analysis. Sex
nurses at the ANC clinic of the Kilifi County Hospital. This manuscript was Transm Dis. 2014;41:369–76.
submitted for publication with permission from the Director of the Kenya 7. McClelland RS, Sangare L, Hassan WM, Lavreys L, Mandaliya K, Kiarie J, et al.
Medical Research Institute (KEMRI). Infection with Trichomonas vaginalis increases the risk of HIV-1 acquisition. J
Infect Dis. 2007;195:698–702.
8. Sorvillo F, Kerndt P. Trichomonas vaginalis and amplification of HIV-1
Funding transmission. Lancet. 1998;351:213–4.
This research has been supported by a PhD Scholarship for SCM from the 9. Carlton JM, Hirt RP, Silva JC, Delcher AL, Schatz M, Zhao Q, et al. Draft
Belgian Development Cooperation through VLIR-UOS. The Kenya Medical genome sequence of the sexually transmitted pathogen Trichomonas
Research Institute-Wellcome Trust Research Programme (KWTRP) at the vaginalis. Science. 2007;315:207–12.
Centre for Geographical Medicine Research-Kilifi is supported by core 10. Goodman RP, Freret TS, Kula T, Geller AM, Talkington MWT, Tang-Fernandez
funding from the Wellcome Trust (#077092). The funders had no role in V, et al. Clinical isolates of Trichomonas vaginalis concurrently infected by
the in the design of the study and collection, analysis, and interpretation strains of up to four trichomonasvirus species (family Totiviridae). J Virol.
of data and in writing the manuscript. The views expressed here are 2011;85:4258–70.
those of the authors and do not necessarily represent the views of the 11. Goodman RP, Ghabrial SA, Fichorova RN, Nibert ML. Trichomonasvirus: a new
Belgian Development Cooperation, or the Wellcome Trust. genus of protozoan viruses in the family Totiviridae. Arch Virol. 2011;156:171–9.
101
12. Fichorova RN, Lee Y, Yamamoto HS, Takagi Y, Hayes GR, Goodman RP, et al. 36. Fraga J, Rojas L, Sariego I, Fernandez-Calienes A. Double-stranded RNA viral
Endobiont viruses sensed by the human host beyond conventional infection in Cuban Trichomonas vaginalis isolates. Brazil J Infect Dis. 2005;9:521–4.
antiparasitic therapy. PLoS One. 2012;7:e48418. 37. Rivera WL, Justo CA, Relucio-San Diego MA, Loyola LM. Detection and
13. Khoshnan A, Alderete JF. Trichomonas vaginalis with a double-stranded RNA molecular characterization of double-stranded RNA viruses in Philippine
virus has upregulated levels of phenotypically variable immunogen mRNA. Trichomonas vaginalis isolates. J Microbiol Immunol Infect. 2015;10.1016/j.
Virology. 1994;68:4035–8. jmii.2015.07.016.
14. Provenzano D, Khoshnan A, Alderete JF. Involvement of dsRNA virus in the 38. Heidary S, Bandehpour M, Valadkhani Z, Seyyed-Tabaee S, Haghighi A,
protein composition and growth kinetics of host Trichomonas vaginalis. Abadi A, et al. Double-stranded RNA viral infection in Tehran Trichomonas
Arch Virol. 1997;142:939–52. vaginalis isolates. Iranian J Parasitol. 2013;8:60–4.
15. Fichorova R, Fraga J, Rappelli P, Fiori PL. Trichomonas vaginalis infection in 39. Weber B, Mapeka TM, Maahlo MA, Hoosen AA. Double stranded RNA virus
symbiosis with Trichomonasvirus and Mycoplasma. Res Microbiol. 2017;10. in south African Trichomonas vaginalis isolates. J Clin Pathol. 2003;56:542–3.
1016/j.resmic.2017.03.005. 40. Wendel KA, Rompalo AM, Erbelding EJ, Chang TH, Alderete JF. Double-
16. Vohra H, Sharma P, Sofi BA, Gupta I, Ganguly NK, Mahajan RC, et al. stranded RNA viral infection of Trichomonas vaginalis infecting patients
Correlation of zymodeme patterns, virulence & drug sensitivity of attending a sexually transmitted diseases clinic. J Infect Dis. 2002;186:558–61.
Trichomonas vaginalis isolates from women. Indian J Med Res. 1991;93:37–9. 41. Wang AL, Wang CC. The double-stranded RNA in Trichomonas vaginalis
17. Torian BE, Connelly RJ, Barnes RC, Kenny GE. Antigenic heterogeneity in the may originate from virus-like particles. Proc Natl Acad Sci USA. 1986;83:
115,000 mr major surface antigen of Trichomonas vaginalis. PRO. 1988;35:273–80. 7956–60.
18. Upcroft JA, Delgadillo-Correa MG, Dunne RL, Sturm AW, Johnson PJ, Upcroft 42. Malla N, Kaul P, Sehgal R, Gupta I. The presence of dsRNA virus in
P. Genotyping Trichomonas vaginalis. Int J Parasitol. 2006;36:821–8. Trichomonas vaginalis isolates from symptomatic and asymptomatic Indian
19. Fraga J, Rojas L, Sariego I, Fernandez-Calienes A. Double-stranded RNA viral women and its correlation with in vitro metronidazole sensitivity. Indian J
infection of Trichomonas vaginalis and correlation with genetic Med Microbiol. 2011;29:152–7.
polymorphism of isolates. Exp Parasitol. 2011;127:593–9.
20. Crucitti T, Abdellati S, Van Dyck E, Buve A. Molecular typing of the actin
gene of Trichomonas vaginalis isolates by PCR-restriction fragment length
polymorphism. Clin Microbiol Infect. 2008;14:844–52.
21. Kaul P, Gupta I, Sehgal R, Malla N. Trichomonas vaginalis: random amplified
polymorphic DNA analysis of isolates from symptomatic and asymptomatic
women in India. Parasitol Int. 2004;53:255–62.
22. Conrad M, Zubacova Z, Dunn LA, Upcroft J, Sullivan SA, Tachezy J, et al.
Microsatellite polymorphism in the sexually transmitted human pathogen
Trichomonas vaginalis indicates a genetically diverse parasite. Mol Biochem
Parasitol. 2011;175:30–8.
23. Conrad MD, Gorman AW, Schillinger JA, Fiori PL, Arroyo R, Malla N, et al.
Extensive genetic diversity, unique population structure and evidence of
genetic exchange in the sexually transmitted parasite Trichomonas vaginalis.
PLoS Negl Trop Dis. 2012;6:e1573.
24. Kabsch W, Vandekerckhove J. Structure and function of actin. Annu Rev
Biophys Biomol Struct. 1992;21:49–76.
25. Drouin G. Moniz de Sa M, Zuker M. The Giardia lamblia actin gene and the
phylogeny of eukaryotes. J Mol Evol. 1995;41:841–9.
26. Gomih-Alakija A, Ting J, Mugo N, Kwatampora J, Getman D, Chitwa M, et al.
Clinical characteristics associated with Mycoplasma genitalium among
female sex workers in Nairobi, Kenya. J Clin Microbiol. 2014;52:3660–6.
27. Unger JA, Matemo D, Pintye J, Drake A, Kinuthia J, McClelland RS, et al.
Patient-delivered partner treatment for chlamydia, gonorrhea, and
trichomonas infection among pregnant and postpartum women in Kenya.
Sex Transm Dis. 2015;42:637–42.
28. Kerubo E, Laserson KF, Otecko N, Odhiambo C, Mason L, Nyothach E, et al.
Prevalence of reproductive tract infections and the predictive value of girls'
symptom-based reporting: findings from a cross-sectional survey in rural
western Kenya. Sex Transm Infect. 2016;92:251–6.
29. Masha SC, Wahome E, Vaneechoutte M, Cools P, Crucitti T, Sanders EJ. High
prevalence of curable sexually transmitted infections among pregnant
women in a rural county hospital in Kilifi, Kenya. PLoS One. 2017;12:e0175166.
30. Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics
analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870–4.
31. Hokororo A, Kihunrwa A, Hoekstra P, Kalluvya SE, Changalucha JM,
Fitzgerald DW, et al. High prevalence of sexually transmitted infections in Submit your next manuscript to BioMed Central
pregnant adolescent girls in Tanzania: a multi-community cross-sectional and we will help you at every step:
study. Sex Transm Infect. 2015;91:473–8.
32. Swygard H, Sena AC, Hobbs MM, Cohen MS. Trichomoniasis: clinical • We accept pre-submission inquiries
manifestations, diagnosis and management. Sex Transm Infect. 2004;80:91–5. • Our selector tool helps you to find the most relevant journal
33. Luo L, Reilly KH, Xu JJ, Wang GX, Ding GW, Wang N, et al. Prevalence and
• We provide round the clock customer support
correlates of Trichomonas vaginalis infection among female sex workers in a
city in Yunnan Province. China Int J STD AIDS. 2016;27:469–75. • Convenient online submission
34. Momeni Z, Sadraei J, Kazemi B, Dalimi A. Molecular typing of the actin gene • Thorough peer review
of Trichomonas vaginalis isolates by PCR-RFLP in Iran. Exp Parasitol. 2015;159:259–63.
• Inclusion in PubMed and all major indexing services
35. Tibayrenc M, Kjellberg F, Ayala FJ. A clonal theory of parasitic protozoa: the
population structures of Entamoeba, Giardia, Leishmania, Naegleria, • Maximum visibility for your research
Plasmodium, Trichomonas, and Trypanosoma and their medical and
taxonomical consequences. Proc Natl Acad Sci USA. 1990;87:2414–8. Submit your manuscript at
www.biomedcentral.com/submit
102
Additional file 1: Table S1. Genotype, number and position of restriction sites using HindII, Mse1 and Rsa1 restriction
enzymes for actin sequences retrieved from GenBank
Gene Bank Accession Origin Position of restriction sites Genotype
HindII MseI RsaI
KX452108 Iran 213 273 314 518 103 190 426 994 E
KX452109 Iran 213 273 314 518 103 190 426 994 E
KX452110 Iran 213 273 314 518 103 190 426 994 E
KX452111 Iran 213 273 314 518 103 190 426 994 E
EU0765780 ATCC 50141 213 273 314 518 103 190 426 994 E
KF747375 Iran 213 273 314 518 103 190 426 994 E
KF747376 Iran 213 273 314 518 103 190 426 994 E
KP400515 Iran 213 273 314 518 103 190 426 994 E
KP400516 Iran 213 273 314 518 103 190 426 994 E
EU076582 Zambia 213 273 314 518 103 190 426 994 E
EU076578 ATCC 30001 213 273 699 518 190 426 994 G
KF747377 Iran 213 273 699 518 190 426 994 G
XM_001301892.1 strain PRA-98 (G3) 213 273 699 518 103 190 426 994 H
EU076579 ATCC 30240 213 273 699 518 103 190 426 994 H
EU0765781 Zambia 213 273 699 518 103 190 426 994 H
KP400513 Iran 213 273 699 518 103 190 426 994 H
EU076585 Zambia 213 273 699 518 190 426 878 994 I
EU076583 DRC 213 273 699 185 518 190 426 994 M
EU076584 DRC 213 273 699 185 518 103 190 426 994 N
EU076586 Zambia 213 273 699 518 103 190 426 878 994 P
KP400514 Iran 213 273 699 518 103 190 426 878 994 P
Legend: DRC Democratic Republic of the Congo.
103
Additional file 2: Alignment of the T. vaginalis actin gene nucleotide sequences retrieved from GenBank and
those of from our clinical T. vaginalis isolates
104
105
106
107
108
109
110
111
112
113
Legend: Sequences accession numbers with the prefix MF are from our study, the other T. vaginalis actin sequences were retrieved from
GenBank, and the suffix letter indicates the assigned actin genotype.
114
Chapter Six | Interaction of Trichomonas vaginalis and
vaginal microbiome
115
Chapter Six
6 Comparative analysis of the vaginal microbiome of pregnant women

with either Trichomonas vaginalis or Chlamydia trachomatis
Simon Chengo Masha1, 2, 3*, Collins Owuor1, Joyce Mwongeli Ngoi1, Piet Cools2, Eduard
J. Sanders1,6, Mario Vaneechoutte2, Tania Crucitti 7†, Etienne P. de Villiers1, 4, 5†
1KEMRI-Wellcome Trust Research Programme, Centre for Geographic Medicine
Research-Coast, Kilifi, Kenya.
2Laboratory Bacteriology Research, Faculty of Medicine and Health Sciences, Ghent
University, Ghent, Belgium

3Department of Biological Sciences, Pwani University, Kilifi, Kenya
4Centre for Tropical Medicine and Global Health, Nuffield Department of Medicine
Research Building, University of Oxford, Oxford, UK.

5Department of Public Health, Pwani University, Kilifi, Kenya.
6Nuffield Department of Clinical Medicine, University of Oxford, Oxford, UK.
7HIV/STI Reference Laboratory, Department of Clinical Sciences, Institute of Tropical
Medicine, Nationalestraat 155, Antwerp, Belgium
*Correspondence to Simon C. Masha, Kenya Medical Research Institute, Centre for

Geographic Medicine Research – Coast, P.O. Box 230, Kilifi, Kenya. Tel: +254 41
7522133; fax: +254 41 7522390; e-mail: schengo@kemri-wellcome.org
†Joint senior authors on this work.
Submitted to BMC Microbiome 13 JUN 2018
116
Chapter Six
6.1 Abstract
Background: Although the significance of the human vaginal microbiome for health and
disease is increasingly acknowledged, differences in the composition of the vaginal
microbiome upon infection with different sexually transmitted pathogens remain generally
under explored.
Method: The vaginal bacterial composition of women with Trichomonas vaginalis (T.
vaginalis, N = 18) was compared to that of women with Chlamydia trachomatis (C.
trachomatis, N = 14), and controls (N = 21) (women negative for both T. vaginalis and C.
trachomatis). The vaginal bacterial composition was determined using high throughput
sequencing with the Ion 16S metagenomics kit of the variable regions 2, 4 and 8 of the
bacterial 16S ribosomal RNA gene from the vaginal swab DNA extract of the women.
QIIME and R package “Phyloseq” were used to assess the α- and β-diversity and absolute
abundance of the 16S rRNA gene per location in the three groups. Differences in taxa at
various levels were determined using the independent T-test.
Results: A total of 545 operational taxonomic units (OTUs) were identified in all the three
groups of which 488 occurred in all three groups (core OTUs). Bacterial α-diversity, by
both Simpson’s and Shannon’s indices, was significantly higher, (p = 0.056) and (p =
0.001) respectively, among women with either T. vaginalis or C. trachomatis than among
controls (mean α-diversity T. vaginalis-infected > C. trachomatis-infected > Controls). At
the genus level, women infected with TV had significantly (p < 0.01) higher abundance of
Parvimonas and Prevotella species compared to both controls and C. trachomatis-
infected women, whereas women infected with C. trachomatis had significantly (p < 0.05)
higher abundance of Anaerococcus, Collinsella, Corynebacterium and Dialister.
Conclusion: The vaginal microbiomes of T. vaginalis and C. trachomatis-infected women

were markedly different from each other and from women without T. vaginalis and C.
trachomatis. Future studies should determine whether the altered microbiomes are
merely markers of disease, or whether they actively contribute to the pathology of the two
genital infections.
117
Chapter Six
Key words: Chlamydia trachomatis, pregnancy, Kenya, Trichomonas vaginalis, vaginal

microbiome,
6.2 Introduction
The human body hosts approximately 4 * 1013 bacterial cells, roughly equaling the number
of human cells [1]. Bacteria represent the major part of microbiomes on the human body
and have been shown to play a significant role in human health, affecting development of
the immune system, nutrition and weight, among other physiological aspects [2]. Instead
of distinct microbial species being either beneficial or harmful to human health, changes
in the global balance of the microbiome might play a more crucial function [3]. Therefore,
it is important to understand how the bacterial communities may vary under different
circumstances.
Genital infections with either Trichomonas vaginalis (T. vaginalis) or Chlamydia

trachomatis (C. trachomatis) were estimated to affect over a quarter of a billion women
worldwide in 2012 [4]. These two pathogens invade the vaginal microbiome despite it
having various protective mechanisms, including low pH [5, 6]. A vaginal microbiome
associated with vaginal health is typically characterized by the predominance of one or
few species of lactobacilli [7]. Lactobacillus crispatus and L. iners are the most prevalent
vaginal lactobacilli in women of reproductive age, [7-9] and L. crispatus plays a major role
in maintaining the vaginal environment in equilibrium, whereas L. iners has been
associated with both eubiotic vaginal microbiomes as well as dysbiotic vaginal
microbiomes associated with bacterial vaginosis (BV) or sexually transmitted infections
(STIs) [9].
T. vaginalis has been associated with a vaginal pH ≥ 4.5 [10]. The increased vaginal pH
associated with T. vaginalis would potentially lead to invasion of other pathogenic
organisms as well as overgrowth of the aciduric lactobacilli by many different species.
Martin et al. [11] suggested that T. vaginalis infection was associated with Mycoplasma
hominis and Candidatus Mycoplasma girerdii a species almost exclusively found in
women infected with T. vaginalis. Vaginal dysbiosis has been associated with an
increased risk of STIs, including C. trachomatis [12].
118
Chapter Six
Imbalances in the vaginal microbiome during pregnancy are associated with an increased
risk of post-abortion infection [13], both early and late miscarriage [14,15], preterm
premature rupture of membranes [16], and preterm birth [17]. Preterm birth complications
are of unique importance as they are estimated to be responsible for 14 % of the world’s
annual neonatal deaths [18]. Here, we determined the vaginal microbiome profiles of
three groups of pregnant women (T. vaginalis-infected, C. trachomatis-infected, and
controls, i.e. women with none of the two infections) attending antenatal care at Kilifi,
County Hospital, Kenya, and compare our results with previous findings.
6.3 Materials and methods
This report utilized repository samples from a study of 350 pregnant Kenyan women, as
previously described [19]. Briefly, from July until September 2015, women attending the
antenatal care clinic of Kilifi County Hospital, Kenya, were recruited into a cross-sectional
study. The main aim of that study was to describe the prevalence and the predictors of
curable STIs among pregnant women [19]. Women were eligible if they met the following
criteria: age 18-45 years, gestation ≥ 14 weeks, being residents of the Kilifi Health and
Demographic Surveillance area, willingness to undergo free STI and BV screening
procedures and willing to give written informed consent.
For the above-described study, a nurse collected vaginal secretions from the vaginal
introitus using three sterile cotton swabs. The first vaginal swab was inoculated at the
clinic in the upper-chamber of an InPouch system (BioMed Diagnostics, White City,
Oregon), a highly specific and sensitive device containing a fluid medium supporting the
growth of T. vaginalis and allowing microscopic observation of T. vaginalis. The
inoculated InPouch was transferred to the laboratory within 15 minutes for direct
microscopy of the upper chamber, after which it was merged with the lower chamber and
incubated at 37 °C ± 1 °C. Daily microscopic observation (at both ×10 and ×40
magnification, for six fields) of the InPouch system was performed by qualified
technicians. Samples with motile trichomonads within 5 days of culture were considered
positive for T. vaginalis.
119
Chapter Six
The second swab was used for BV diagnosis using the scoring system described by
Nugent [20].
The third swab was placed in a sterile labelled 2 ml Eppendorf tube and the swab shaft
was broken by bending the shaft against the neck of the Eppendorf tube. The bottom
portion of the swab with the specimen was transported to the laboratory where it was
immediately stored dry at -80 °C for molecular studies of the vaginal microbiome. No
transport or freezing medium was added. C. trachomatis and N. gonorrhoeae detection
was performed on fresh first catch urine, using the GeneXpert® CT/NG Assay (Cepheid,
Sunnyvale, California), according to the manufacturer’s instructions.
Specimens for this study are derived from the stored swabs. Due to financial and logistic
constraints, we could process only a subset of the 350 vaginal swabs from the main study.
Vaginal swabs from 53 pregnant women were divided into three groups: 18 vaginal swabs
from women culture-positive for T. vaginalis, 14 vaginal swabs from women PCR-positive
for C. trachomatis in urine and 21 vaginal swabs from women culture-negative for T.
vaginalis and PCR-negative for C. trachomatis in urine (controls). Additional specific
criteria for controls included BV-negativity by Nugent score and HIV-negativity by rapid
HIV 1/2 antibody test.
DNA extraction
Before DNA extraction the frozen swabs were thawed at room temperature for 30
minutes. Extraction was performed using the QIAamp DNA Mini Kit (Qiagen, Hilden,
Germany) according to manufacturer’s instructions and 160 μl of eluted DNA was
transferred to Eppendorf tubes and frozen at -80 °C until molecular analysis was
performed.
Bacterial 16S ribosomal RNA (rRNA) gene PCR and sequencing
The Ion 16S MetagenomicsTM Kit (ThermoFisher Scientific, Waltham, MA) primer set V2-
4-8 was used to amplify the hypervariable regions of the 16S rRNA gene from bacteria
for all the samples and from a positive control (DNA from Microbial Mock Community A
120
Chapter Six
(HM-278D – BEI)), according to the kit instructions. The amplicons were then purified
using the AMPure magnetic bead-based purification system (Beckman Coulter,
Porterville, CA) and quantified using the Qubit® 2.0 Fluorometer and the Qubit dsDNA
HS Assay kit (ThermoFisher Scientific).
Sequencing libraries were synthesized using the Ion Plus™ Fragment Library Kit
(ThermoFisher Scientific) to ligate barcoded adapters to the amplicons. For quality
control, each barcoded library was assessed in order to determine proper ligation of the
adapters by checking the size distribution and concentration of libraries. The Agilent
Bioanalyzer (Agilent, Santa Clara, CA) was used for size distribution, while the library
concentration was determined using the Ion Library TaqMan® Quantitation Kit
(ThermoFisher Scientific) according to the kit instructions. The barcoded libraries were
pooled in equimolar amounts with 25 libraries and one positive control (Microbial Mock
Community A) pooled into one batch. Templating of the pooled library was done using
the Ion PGM™ Hi-Q™ OT2 Kit on the OneTouch2™ system according to the
manufacturer’s recommendations (ThermoFisher Scientific). The templated library was
then enriched for template-positive Ion Sphere particles on the ion one touch ES system
followed by 400-bp sequencing on the Ion Torrent PGM (ThermoFisher Scientific) using
the Ion PGM™ Hi-Q™ Sequencing Kit and a 318 v2 chip (ThermoFisher Scientific).
Data processing and statistical analysis
Identification of bacterial taxa in vaginal samples
After sequencing, the individual sequence reads were filtered by the Personal Genome
Machine (PGM) software to remove low quality and polyclonal sequences. This was an
automated process performed using the Ion software. Reads that are removed are those
that are of mixed DNA templates on an Ion sphere particle in a given well. Sequences
matching the PGM 3′ adaptor were automatically trimmed. All PGM quality-approved,
trimmed and filtered data were exported as sff files and further visualized and trimmed on
quality in CLC Genomics Workbench version 9.5.3. Quality trimmed reads were exported
as fasta files and processed using QIIME version 1.9.1 [21]. Sequences with a length
between 200 and 250 bp, mean sequence quality score > 25 were retained.
121
Chapter Six
Presence of homopolymers of > 6 bp, and sequences with mismatched primers were
omitted. In order to calculate downstream diversity measures (α- and β-diversity indices,
Unifrac analysis), 16S rRNA Operational taxonomic units (OTUs) were defined at ≥ 97%
sequence homology using the open reference picking pipeline and taxonomy assignment
workflow of QIIME and the Greengenes version 13.8 reference dataset [22].
The alpha diversity (diversity within samples) was evaluated using Simpson’s and
Shannon indices. Samples were clustered into three groups, i.e. C. trachomatis-infected,
T. vaginalis-infected, and controls, and median diversity indices per group were compared
using Analysis of variance (ANOVA). The beta diversity (diversity between samples) was
evaluated using Bray Curtis and illustrated using Principal coordinate Analysis (PCoA).
The 16S rRNA gene sequences reported in this study have been submitted to the
European nucleotide archive (ENA) under accession number PRJEB25935. Low
abundant OTUs were excluded from subsequent analysis, i.e. only those OTUs were
included that had a relative abundance of > 0.01 (assigned reads/total number of reads)
in at least one sample.
Data-mining and statistical analysis was done in Calypso version 8.54, available at
(http://bioinfo.qimr.edu.au/calypso/), including visualization of the taxonomic information
[23]. Chi-square was used to compare the socio-demographic and behavioral
characteristics when comparing the groups of women on STATA version 13.1 (Stata
Corp, College Station, Texas).
6.4 Results
Two of the women with a T. vaginalis infection were co-infected with HIV but both were
not on HIV therapy at the time of sample collection as HIV had just been diagnosed
(Supplementary Table 6.1). There were no significant differences in the socio-
demographic and behavioral characteristics of women with T. vaginalis and the controls
(Supplementary Table 6.2). However, women with C. trachomatis compared to the
controls differed significantly with reference to age and number of lifetime sexual partners
122
Chapter Six
(Supplementary Table 6.3). No difference was observed when comparing of socio-

demographic and behavioral characteristics of women with T. vaginalis and those of
women with CT (Supplementary Table 6.4). Finally, the swabs of 21 women selected as
controls were not significantly different from the swabs of the other 251 women not
selected as controls (Supplementary Table 6.5).
To quantify the community composition of the three study groups of pregnant women
(Controls, TV-infected and CT-infected women), amplicons were clustered in operational
taxonomic units (OTUs) using UCLUST [16] with a sequence similarity threshold of 97%.
After quality filtering and chimeric checking, a total of 7232969 reads were assigned to
545 OTUs. Four hundred and eighty eight OTUs were considered as the core OTUs since
they occurred in all three groups. Controls and TV-infected women had 4 unique OTUs
each, while CT-infected women had 5 unique OTUs (Figure 6.1)
123
Chapter Six
Figure 6.1 Venn diagram of OTU’s for each group.
The circles represent C. trachomatis-infected, T. vaginalis-infected and healthy controls

with numbers within circles or overlapping areas indicating the number of OTU’s in
common.
Bacterial α-diversity was significantly higher among women with either T. vaginalis or C.
trachomatis compared to controls, with the mean α-diversity of T. vaginalis-infected
women being higher than that of C. trachomatis-infected and the mean α-diversity of the
CT-infected women being higher than that of controls (Figure 6.2).These findings suggest
that the diversity of bacteria may be affected by the nature of concomitant genital
infections.
124
Chapter Six
Figure 6. 2 Bacterial α-diversity among the different groups of women
Figure shows that bacterial α-diversity analysis reveals significant difference in the vaginal
bacteria of pregnant women in Kilifi, Kenya infected with T. vaginalis (n = 18), C. trachomatis (n
= 14) and controls (n = 21). Dot plot (A) Shannon index and (B) Simpson index. Statistical analysis
was performed using ANOVA. Lines inside dot plot represent mean ± standard error.
β-diversity analysis was used to evaluate whether there was dissimilarity in variation
between the three groups of women. Analysis of dissimilarity between groups was
performed by Bray-Curtis (non-phylogeny based method that only takes the relative
abundance of OTUs into account) and visualized through principal coordinates analysis
(PCoA). The analysis of similarity (Anosim) test showed that the vaginal microbiome
diversity within each group was not significantly different between the groups.
Non-metric multidimensional scaling (NMDS) analysis was applied to the dataset. PCoA
was used to model the variation between samples based on the three groups. The
centroids, or average center, were not significantly different for the three groups (Figure
6.3).
125
Chapter Six
Figure 6.3 β-diversity of vaginal microbiomes among the different groups of

women
β-diversity of vaginal microbiomes among pregnant women with T. vaginalis (n = 18), C.

trachomatis (n = 14) and a control group (n = 21). (A) Non-metric multidimensional scaling
(NMDS) plot of the vaginal bacteria of the three groups. Points represent the vaginal microbiomes
of individual women at all taxonomic levels; colors indicate the infection status. (B) Principle
coordinates analysis (PCoA) based on Bray Curtis metric on Operational Taxonomic Units
(OTUs).
Taxonomic similarities between each of the three groups were assessed by comparing
the bacterial abundance in the three groups at various taxonomic levels. At the genus
level, women infected with TV had significantly (p < 0.01) higher abundance of
Parvimonas and Prevotella compared to controls and to CT-infected women. Women
infected with CT had in addition to abundant Chlamydia, significantly (p < 0.05) higher
abundance of Anaerococcus, Collinsella, Corynebacterium and Dialister (Figure 6.4).
At family level, abundance by Lactobacillaceae was evident across the three groups and
not significantly different between groups (Supplementary Figure 6.1).
126
Chapter Six
Figure 6.4 Bar graphs showing relative abundance of genera
Lege
The bar graphs are of genera that were significantly different among women with T. vaginalis (n
= 18), C. trachomatis (n = 14) and controls (n = 21). Pair-wise comparisons are done by t-test and
annotated as *; p < 0.05, **; p < 0.01.Standard error is depicted by error bars.
We further performed analysis based on Nugent scores irrespective of genital infection

status. We compared women with a normal Nugent score (0-3) (n = 42) with those with
an intermediate Nugent score (4-6) (n = 11). Bacterial α-diversity was higher among
women with intermediate Nugent scores as compared to those with normal Nugent scores
(Supplementary Figure 2). At family level, the abundance of Aerococcaceae,
Alcaligenaceae, Clostridiaceae, Coriobacteriaceae, Fusobacteriaceae, Gemellaceae,
Lachnospiraceae, Lactobacillaceae, Leptotrichiaceae, Prevotellaceae and
Tissierellaceae was significantly different between the two groups (Supplementary Figure
6.3).
127
Chapter Six
6.5 Discussion
This molecular epidemiological study, using high-throughput sequencing of the 16S rRNA
gene of vaginal microbiomes intended to decipher whether vaginal microbiomes differ
among pregnant women with genital infections with Chlamydia trachomatis (C.
trachomatis), Trichomonas vaginalis (T. vaginalis) and women without C. trachomatis and
T. vaginalis infection. We demonstrated increased α-diversity during infection with both
T. vaginalis and C. trachomatis as compared to women not infected with either or both
infectious agents. Both indices used to determine the α-diversity take into account the
abundance and evenness of the OTUs present. Thus this suggests that infection with
either T. vaginalis or C. trachomatis is associated with an increase in species diversity.
In a previous study [24], TV infection was associated with vaginal microbiota consisting
of low proportions of lactobacilli and high proportions of Mycoplasma, Parvimonas,
Sneathia and other anaerobes. Martin et al. [11] similarly identified Parvimonas and
Prevotella as significantly associated with T. vaginalis infection. Also in our study, women
infected with T. vaginalis had significantly (p < 0.01) higher abundance of Parvimonas
and Prevotella (Figure 6.4) as compared to controls and to C. trachomatis-infected
women. Parvimonas is mostly associated with acute and chronic dental root canal
infections [25], whereas the proportion of Prevotella has been shown to be elevated in
women with BV [26]. Whether Parvimonas and Prevotella play an active role in the
pathology of T. vaginalis or are markers of infection with T. vaginalis is not clear.
High throughput sequencing confirmed that women infected with C. trachomatis had a
significantly higher vaginal abundance of Chlamydia as compared to those with T.
vaginalis or controls, whereas C. trachomatis detection assay had been performed on
urine samples. Other genera that were more abundant among samples of women with C.
trachomatis included Anaerococcus, Collinsella, Corynebacterium and Dialister (Figure
6.4). Tamarelle et al. [27], reported that infection with C. trachomatis was associated with
vaginal microbiomes dominated by Lactobacillus iners and largely lacking other
Lactobacillus species respectively with a wide array of strict and facultative anaerobes.
128
Chapter Six
The clinical relevance of genera associated with C. trachomatis in our study varies.
Anaerococcus has been isolated in cases of urinary tract infections [28]. Bacteria of the
genus Collinsella, although statistically significant, are probably not as meaningful not
really known to be associated with vaginal dysbiosis. They are mainly found in the gut
and their abundance in the gut of patients with rheumatoid arthritis correlates strongly
with increased production of the proinflammatory cytokine IL-17A [29]. Bacteria of the
genus Corynebacterium are increasingly being recognized as causing opportunistic
infections in patients who are immunocompromised, have prosthetic devices, or have
been in hospitals/nursing homes for long-term periods of time [30]. While Dialister species
have been implicated in oral diseases, the importance of Dialister species in human
clinical samples remains unknown [31].
In general, the genus Lactobacillus was most abundant in all three groups, without
significant differences. Our sequencing depth could not allow for identification of all
species in the samples, to check whether individuals with T. vaginalis or C. trachomatis
were colonized by different Lactobacillus species as compared to the controls, although
e.g. L. iners and L. crispatus may play very different roles [9] whereby L. crispatus is more
protective against urogenital infections.
Our study had a few limitations; first, we did not perform a biochemical analysis to check
if the participants were on antibiotics. Antibiotics used for various treatments might also
interfere with a healthy bacterial equilibrium in the vaginal microbiome, specifically
causing a decrease in the prevalence of commensal Lactobacillus spp. However, we
collected data using a questionnaire on antibiotic use and none of the participants
declared to be on antibiotics. Second, no internal control was added during the DNA
extraction process, so inefficient genome extraction may have occurred, although a
genomic DNA from Microbial Mock Community A (HM-278D – BEI) was used as a positive
control during amplification. Third, other STIs were not analyzed and they may have had
an effect on the microbiome, or other unknown confounding factors. Finally, our sample
was limited due to financial constraints and was obtained using a cross-sectional survey
a longitudinal survey would have provided additional info on the dynamics of the change
in microbiome.
129
Chapter Six
6.6 Conclusion
Colinsella, Dialister and Prevotella were significantly increased in C. trachomatis- and T.

vaginalis -infected women compared to controls, Anaerococcus and Corynebacterium
were most abundant in C. trachomatis-infected women and significantly more abundant
when compared to T. vaginalis-infected women, and finally Parvimonas was most
abundant in T. vaginalis-infected women and significantly increased compared to
controls. Future research should focus on the functional importance of the various vaginal
bacteria, including specific Lactobacillus species, associated with either T. vaginalis or C.
trachomatis. Longitudinal studies of vaginal microbiome and STIs are critical in order to
determine causality, including its direction, and temporality.
6.7 References
1. Sender, R., S. Fuchs, and R. Milo, Revised estimates for the number of human and
bacteria cells in the body. PLoS Biol. 2016; 14(8): e1002533.
2. Gill, S.R., et al. Metagenomic analysis of the human distal gut microbiome. Science.
2006; 312(5778): 1355-9.
3. Human Microbiome Project Consortium. Structure, function and diversity of the
healthy human microbiome. Nature. 2012; 486(7402):207-14.
reporting. PLoS One. 2015;10(12):e0143304.
5. Alakomi, H.L., et al. Lactic acid permeabilizes gram-negative bacteria by disrupting
the outer membrane. Appl Environ Microbiol. 2000;66(5):2001-5.
6. Kaewsrichan, J., et al. Selection and identification of anaerobic lactobacilli producing
inhibitory compounds against vaginal pathogens. FEMS Immunology & Med Microb.
2006;48(1):75-83.
7. Verhelst, R., et al. Comparison between Gram stain and culture for the
characterization of vaginal microflora: Definition of a distinct grade that resembles
grade I microflora and revised categorization of grade I microflora. BMC Microbol.
2005;5(1):61.
8. Antonio, M.A., et al. The identification of vaginal Lactobacillus species and the
demographic and microbiologic characteristics of women colonized by these species.
J Infect Dis. 1999;180(6):1950-6.
9. Vaneechoutte, M. 2017. Lactobacillus iners: The unusual suspect. Res Microbiol.
2017;168(9-10):826-836.
130
Chapter Six
10. Bell, C., et al. Targeted screening for Trichomonas vaginalis in women, a pH-based
approach. Int J STD AIDS. 2007;18(6):402-3.
11. Martin, D.H., et al. Unique vaginal microbiota that includes an unknown Mycoplasma-
like organism is associated with Trichomonas vaginalis infection. J Infect Dis. 2013;
207(12):922-1931.
12. Bautista, C.T., et al. Association of bacterial vaginosis with chlamydia and gonorrhea
among women in the U.S. Army. Am J Prev Med. 2017;52(5):632-9.
13. Larsson, P.G., et al., Treatment with 2% clindamycin vaginal cream prior to first
trimester surgical abortion to reduce signs of postoperative infection: a prospective,
double-blinded, placebo-controlled, multicenter study. Acta Obstet Gynecol Scand.
2000; 79(5):390-6.
14. Ralph, S.G., et al, Influence of bacterial vaginosis on conception and miscarriage in
the first trimester: cohort study. Bmj. 1999;319(7204):220-3.
15. Llahi-Camp, J.M., et al., Association of bacterial vaginosis with a history of second
trimester miscarriage. Hum Reprod. 1996;11(7):1575-8.
16. Parry, S. and J.F. Strauss, 3rd, Premature rupture of the fetal membranes. N Engl J
Med. 1998;338(10): 663-70.
17. Leitich, H., et al., Bacterial vaginosis as a risk factor for preterm delivery: a meta-
analysis. Am J Obstet Gynecol. 2003. 189(1):139-47.
18. Liu, L., et al., Global, regional, and national causes of child mortality: an updated
systematic analysis for 2010 with time trends since 2000. Lancet.
2012;379(9832):2151-61.
19. Masha, S.C., et al. High prevalence of curable sexually transmitted infections among
pregnant women in a rural county hospital in Kilifi, Kenya. PLoS One. 2017;12(3):
e0175166.
20. Nugent, R.P., et al. Reliability of diagnosing bacterial vaginosis is improved by a
standardized method of gram stain interpretation. J Clin Microbiol.1991;29(2):297-301
21. Caporaso, J.G., et al. QIIME allows analysis of high-throughput community
sequencing data. Nat Methods. 2010;7(5):335-6.
22. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and
workbench compatible with ARApplied, B., and environmental. Microbiology.
2006;72:5069–5072.
23. Zakrzewski, M., et al. Calypso: a user-friendly web-server for mining and visualizing
microbiome-environment interactions. Bioinformatics. 2017;33(5):782-3.
24. Brotman, R.M., et al. Association between Trichomonas vaginalis and vaginal
bacterial community composition among reproductive-age women. Sex Transm Dis.
2012;39(10): 807-12.
25. Santos, A.L., et al. Comparing the bacterial diversity of acute and chronic dental root
canal infections. PLoS One. 2011;6(11):e28088.
26. Srinivasan, S. and D.N. Fredricks, The human vaginal bacterial biota and bacterial
vaginosis. Interdiscip Perspect Infect Dis. 2008;2008:750479.
27. Tamarelle, J., et al. Vaginal microbiota composition and association with prevalent
Chlamydia trachomatis infection: a cross-sectional study of young women attending a
STI clinic in France. Sex Transm Infect. 2018.
131
Chapter Six
28. Domann, E., et al. Culture-independent identification of pathogenic bacteria and

polymicrobial infections in the genitourinary tract of renal transplant recipients. J Clin
Microbiol. 2003;41(12):5500-10.
29. Chen, J., et al. An expansion of rare lineage intestinal microbes characterizes
rheumatoid arthritis. Genome Med. 2016;8(1):43.
30. Funke, G., et al. Clinical microbiology of coryneform bacteria. Clin Microbiol Rev.
1997. 10(1):125-59.
31. Morio, F., et al. Antimicrobial susceptibilities and clinical sources of Dialister species.
Antimicrob Agents Chemother. 2007;51(12):4498-501.
132
Chapter Six
Supplementary Table 6.1. Clinical characteristics of pregnant women attending antenatal

care at Kilifi County Hospital, Kenya (N=53).
Characteristic TV-infected CT-infected *Controls

N = 18 N = 14 N = 21
HIV
Positive 2 0 0
Negative 0 0 0
Neisseria gonorrhea
Positive 0 1 0
Negative 0 0 0
Nugent scores
Normal (0-3) 10 12 20
Intermediate (4-6) 8 2 1
Legend:
TV; Trichomonas vaginalis, CT; Chlamydia trachomatis, *Controls were not infected with T. vaginalis, C.
trachomatis, BV or HIV.
133
Chapter Six
Supplementary Table 6.2. Socio-demographic and behavioral characteristics of

Trichomonas vaginalis qPCR positive women (cases) and T. vaginalis qPCR negative
women (controls), attending antenatal care at Kilifi County Hospital, Kenya.
N = 18 N = 21 P-value
Age group (Years)
18-24 38.9 28.6
≥ 25 61.1 71.4 0.496
Religion
Christian 72.2 66.7
Muslim 11.1 9.5
Other/None 16.7 23.8 0.857
Education
None 22.2 19.1
Primary 61.1 61.9
Secondary/Tertiary 16.7 19.1 0.961
Parity
0 27.8 19.2
1-2 44.4 42.7
3+ 27.8 38.1 0.728
Gestational age
14-27 55.6 66.7
≥ 28 44.4 33.3 0.477
Number of lifetime
≤2 77.8 95.2
≥3 22.2 4.8 0.104
134
Chapter Six

Chlamydia trachomatis qPCR positive women (cases) and C. trachomatis qPCR negative
women (controls), attending antenatal care at Kilifi County Hospital, Kenya.
N = 14 N = 21 P-value
Age group (Years)
18-24 64.3 28.6
≥ 25 35.7 71.4 0.036
Religion
Christian 78.6 66.7
Muslim 21.4 9.5
Other/None 0.0 23.8 0.115
Education
None 21.4 19.1
Primary 57.2 61.9
Parity
0 21.4 19.1
1-2 57.1 42.9
3+ 21.5 38.0 0.571
Gestational age
14-27 53.9 66.7
≥ 28 46.1 33.3 0.455
Number of lifetime
≤2 64.3 95.2
≥3 35.7 4.8 0.017
Legend
In bold: significantly differed, i.e., P ≤ 0.05
135
Chapter Six

Trichomonas vaginalis qPCR positive women and Chlamydia trachomatis qPCR negative
women, attending antenatal care at Kilifi County Hospital, Kenya.
Characteristic T. vaginalis (%) C. trachomatis (%) χ2
N = 18 N = 14 P-value
Age group (Years)
18-24 38.9 64.3
≥ 25 61.1 35.7 0.154
Religion
Christian 72.2 78.6
Muslim 11.1 21.4
Other/None 16.7 0.0 0.233
Education
None 22.2 21.5
Primary 61.1 57.1
Parity
0 27.8 21.5
1-2 44.4 57.1
3+ 27.8 21.4 0.776
Gestational age
14-27 55.6 53.9
≥ 28 44.4 46.1 0.952
Number of lifetime
≤2 77.8 64.3
≥3 22.2 35.7 0.400
136
Chapter Six
Supplementary Table 6.5. Socio-demographic and behavioral characteristics of women

selected as controls and women not selected as controls, attending antenatal care at Kilifi
County Hospital, Kenya.
Characteristic Selected as controls (%) Not selected as controls (%) χ2
N = 21 N = 251 P-value
Age group (Years)
18-24 28.6 36.4
≥ 25 71.4 63.6 0.474
Religion
Christian 66.7 72.3
Muslim 9.5 15.8
Other/None 23.8 11.9 0.251
Education
None 19.1 17.0
Primary 61.9 57.7
Parity
0 19.1 26.4
1-2 42.9 36.8
3+ 38.1 36.8 0.753
Gestational age
14-27 66.7 60.3
≥ 28 33.3 39.6 0.567
Number of lifetime
≤2 95.2 88.8
≥3 4.8 11.2 0.362
137
Chapter Six
Supplementary Figure 6.1. Bar graph showing relative abundance at family level based on
genital infection
Legend. Bar graphs are of taxa that are significantly different with a p-value < 1 are shown. A
Pair-wise comparisons is performed by t-test and annotated as *: p<0.05, **: p<0.01, ***: p<0.001
for women with T. vaginalis (n = 18), C. trachomatis (n = 14) and controls (n = 21).
138
Chapter Six
Supplementary Figure 6.2. Bacterial α-diversity using Simpson and Shannon indices of
women based on Nugent scores.
Legend. Intermediate Nugent score; 4-6 (n = 11), Normal Nugent score; (0-3) (n=42).
139
Chapter Six
Supplementary Figure 6.3. Bar graph showing relative abundance at family level based on Nugent scores
The bar chart display taxa that are significantly different taxa based on an Anova analysis Only taxa that are significantly different with
a p-value < 1 are shown A Pair-wise comparisons is then done by t-test and annotated as *: p<0.05, **: p<0.01, ***: p<0.001 Standard
error is depicted by error bars. Intermediate Nugent score: 4-6 (n = 11), Normal Nugent score: 0-3 (n=42).
140
Chapter Seven |Trichomonas vaginalis and HIV interaction
141
Chapter Seven
7 Trichomonas vaginalis and HIV infection acquisition: A systematic

review and meta-analysis
Simon C. Masha*1, 2, 3, Piet Cools*2, Eduard J. Sanders1,4, Mario Vaneechoutte2, Tania

Crucitti5
1Centre for Geographic Medicine Research – Coast, Kenya Medical Research Institute,
Kilifi, Kenya
2Laboratory for Bacteriology Research, Faculty of Medicine and Health Sciences, Ghent
University, Corneel Heymanslaan 10, Ghent, Belgium
3Department of Biological Sciences, Pwani University, Kilifi, Kenya
4Nuffield Department of Clinical Medicine, University of Oxford, Oxford, UK.
5HIV/STI Reference Laboratory, Department of Clinical Sciences, Institute of Tropical
Medicine, Nationalestraat 155, 2000 Antwerpen, Belgium
*Shared first authorship
Correspondence to Simon C. Masha, Kenya Medical Research Institute, Centre for

Geographic Medicine Research – Coast, P.O. Box 230, Kilifi, Kenya.
Tel: +254 41 7522133; fax: +254 41 7522390; e-mail: schengo@kemri-wellcome.org
Submitted to BMJ STI 07 JUN 2018
142
Chapter Seven
7.1 Abstract
BACKGROUND
Trichomoniasis is the most prevalent curable sexually transmitted infection (STI) globally,
with the highest incidence and prevalence in sub-Saharan Africa (sSA). STIs have largely
been associated with an increase in HIV acquisition. We assessed the existing literature
regarding the association of Trichomoniasis and HIV acquisition.
METHODS
The review protocol was registered at the International Prospective Register of

Systematic Reviews (PROSPERO) as/under number CRD42018082702. We searched
MEDLINE, EMBASE and SCOPUS databases to collect articles measuring the
association of Trichomonas vaginalis infection and HIV acquisition and performed a meta-
analysis and qualitative synthesis of the literature.
RESULTS
We identified 1806 unduplicated citations, of which 18 papers and one conference

abstract were eligible for inclusion in the review after applying our inclusion and exclusion
criteria. All the studies included in the systematic review had been carried out in sSA. The
articles reported various measures of effects, namely: hazard ratios (HR), rate ratios, risk
ratios, and odds ratios. In a meta-analysis restricted to 11 studies reporting HR,
individuals infected with T. vaginalis were 1.5 times more likely to acquire HIV compared
to individuals not infected with T. vaginalis (95% Confidence Interval, 1.3 –1.7; p < 0.001).
CONCLUSIONS
T. vaginalis is an important factor in HIV acquisition especially in sSA where the

prevalence of T. vaginalis is high. This systematic review and meta-analysis firms up the
evidence that infection with T. vaginalis augments HIV acquisition with 50%. Diagnosis
and treatment of T. vaginalis infection in both high-risk and low-risk individuals may be a
potential tool to reduce new HIV infections.
KEYWORDS: HIV acquisition; sub-Saharan Africa; Trichomonas vaginalis
143
Chapter Seven
7.2 Introduction
The protozoan Trichomonas vaginalis is responsible for trichomoniasis, the most common
curable sexually transmitted infection [1]. T. vaginalis infects both men and women,
although this unicellular parasite is more prevalent in women than men. Among people
aged 15–49 years, it was estimated that in 2012 the global prevalence of T. vaginalis
infection among women was 5.0%, vs. 0.6% among men. These figures correspond to
an estimated 143 million infected individuals [1]. Similar to HIV, T. vaginalis is more
prevalent in sub-Saharan Africa (sSA), as the cumulative prevalence was estimated to be
11.5 % among women aged between 15-49 years in sSA in 2012 [1].
According to The Joint United Nations Programme on HIV and AIDS [2], about 5000 new
HIV infections occurred daily in 2016, with a huge proportion, i.e., 64%, of new infections
occurring in (sSA). Already two decades ago, reports suggested that individuals infected
with T. vaginalis were at an increased risk of HIV acquisition [3]. Some studies have also
indicated that T. vaginalis and HIV co-infection increases genital shedding of HIV [4], but
opinions differ, especially in the context of antiretroviral therapy (ART) [5]. In summary,
there is growing evidence that there is a need for special treatment considerations for T.
vaginalis among women with HIV co-infection [6].
Better understanding of the association T. vaginalis and HIV may provide insights on HIV
infections that may be attributed to T. vaginalis. In addition it may enhance understanding
on how control of T. vaginalis may impact HIV transmission as a potentially cost-effective
strategy for reducing HIV transmission, particularly in regions where T. vaginalis is
common. The objective of this systematic review and meta-analysis was to clarify the
extent to which T. vaginalis infection is associated with HIV infection and acquisition.
7.3 Methods
Protocol and registration: We followed the Preferred Reporting Items for Systematic
Reviews and Meta-Analyses (PRISMA) guidelines [7] for carrying out and reporting this
systematic review and meta-analysis, using an a priori defined protocol. The protocol for
this systematic review and meta-analysis was registered at the International Prospective
Register of Systematic Reviews (PROSPERO)(https://www.crd.york.ac.uk/PROSPERO/)
under registration number CRD42018082702.
144
Chapter Seven
Eligibility criteria We included studies that reported both T. vaginalis infection status
and HIV status. We only included studies written in English, and that documented odds
ratio (OR), or risk ratio (RR), or hazard ratios (HR), or provided the absolute numbers for
these parameters to be calculated. There were no restrictions in terms of study design
and there was no lower bound date of publication. We included papers that were
published up to 11th March 2018.
Reviews, narrative only conference abstracts, comments, guidelines, case reports or

case series, unpublished articles, multiple reports of the same data and in vitro and animal
studies were not considered for inclusion. Infection with T. vaginalis was defined as the
presence of the pathogen as assessed by culture, wet mount or molecular methods.
While HIV status was defined by the presence of HIV antibodies, HIV proteins, HIV RNA
or DNA.
Search strategy We searched EMBASE, MEDLINE (through PubMed) and Scopus. We

used the combination of all of the following search terms (Trichomonas vaginalis, T.
vaginalis, trichomoniasis) with all of the following search terms (AIDS, acquired
immunodeficiency syndrome, human immunodeficiency virus, HIV, HIV-1, HIV-2). The
bibliographic references of the studies that were considered eligible were also hand
searched.
Study selection Studies were selected in a two-stage process (Figure 7.1). First, all
bibliographic references were screened to identify studies for full-text evaluation by one
reviewer Simon Chengo Masha (SCM), on the basis of only the information present in the
title and abstract. Subsequently, the full texts of those articles not excluded in the
screening process were assessed for eligibility, using the aforementioned criteria, by two
authors independently SCM and Piet Cools (PC). Reasons for exclusion were recorded
and categorized, and disagreements were resolved by consensus.
Using all search terms, searches were conducted for relevant papers in the pre-identified
databases (EMBASE, PubMed, and Scopus) and from this we identified 3398 papers.
Once the search was completed, all of the retrieved articles were imported into EndNote
X7.8 for removal of duplicates.
145
Chapter Seven
Data collection process
A predefined data extraction form was pilot-tested and used for data extraction. From the
19 studies included in the systematic review and meta-analysis. The following information
was collected; authors, year of publication, journal, country where the study had been
carried out, study design, sample collection period, study population, mean/median age
of the participants, total number of study participants, total number of samples included
in the analysis, T. vaginalis detection method, assessment of HIV status, relevant
measures of effects or absolute numbers, statistics. This procedure was performed
independently by two authors (SCM and PC) and disagreements were resolved by
discussion between both authors.
Risk of bias in individual studies
To assess the quality and risk of bias of the included studies, we developed a quality
appraisal tool (Supplementary Table 7.2), based on the Newcastle-Ottawa Scale [8]. We
adapted this tool to the content of our meta-analysis. Stars were assigned by SCM for
three broad criteria (representativeness of the study groups, comparability of the study
groups, and quality of the outcome assessment) in order to provide a measure of their
quality.
Studies that scored none or one, two, or three stars for representativeness were classified
as having respectively a high, medium or low risk of bias for this criterion. Studies
assigned none, one, or two stars for comparability or outcome were considered to have
respectively a high, medium or low risk of bias for comparability and outcome.
Data analysis.
The meta-analyses was performed using STATA version 13.1 (Stata- Corp, College
Station, Texas). We reported the results of the meta-analyses obtained after pooling
individual study estimates with random effects model as HRs with 95% confidence
interval (CI). The degree of heterogeneity between the studies was assessed using the I 2
index, with percentages 25%, 50%, and 75% being indicative of low, moderate, and high
heterogeneity, respectively [9].
146
Chapter Seven
7.4 Results
Manuscript and study selection; a total of 1806 unduplicated citations were identified, we
selected 164 abstracts for full text evaluation and (Figure 7.1). There were 19 studies
which met our inclusion criteria to be included in our systematic review.
Figure 7.1 Identification and selection of studies for the systematic-review
Records identified through database

searching
Identification
PubMed n = 801
Embase n = 1028
Scopus n = 1569
Records after duplicates removed

n = 1806
Screening
Screened by title and /or abstract

n = 1806
Records excluded
n = 1642
Eligibility
Full-text articles assessed

n = 164 Exclusions n = 145
Not reporting predefined

outcome/exposure n = 64
Qualitative synthesis n = 19
Included
TV and HIV transmission n = 7

Meta-analysis n = 11 out of 19
TV and HIV co-infection n = 53
TV and HIV shedding n = 14
Treatment of TV during HIV
co-infection n = 7
147
Chapter Seven
Description of selected studies

All studies were conducted in sSA, namely Burkina Faso (n = 1), Democratic Republic of
Congo (n = 2), Ivory Coast (n = 1), Kenya (n = 5), Malawi (n = 1), South Africa (n = 4),
Uganda (n = 4), Zambia (n = 1), and Zimbabwe (n = 3). Some of the studies were
conducted in more than once country. Of the included the 19 studies, 17 were cohorts,
and 2 were nested case-control studies. Generally, all these studies involved a baseline
T. vaginalis test and additional testing performed at varying intervals depending on the
study, with treatment for participants testing positive for T. vaginalis. Thirteen of the
studies found a significant positive association between T. vaginalis infection and HIV
acquisition.
Eleven studies reported hazard ratios (HR) of HIV acquisition in relation to T. vaginalis
infection, three reported rate ratios (RR*) of HIV acquisition in relation to T. vaginalis, two
studies reported risk ratios (RR) of HIV acquisition in relation to T. vaginalis and three
reported odds ratios (OR) of HIV acquisition in relation to T. vaginalis (Table 7.1).
Most studies (63%) had been carried out amongst high-risk individuals, i.e. female sex
workers, and serodiscordant couples. The rest of the studies (37%) had been carried out
amongst low-risk populations, including women attending pre- or postnatal clinics and
family planning clinics and individuals from the general population. Direct microscopy was
the most common method used for detection of T. vaginalis (73%) in the studies.
Detection of HIV antibodies was the most common method used to determine HIV status
(84%) in the studies (Table 7.1).
148
Chapter Seven
Table 7.1 Summary of all studies included in the review

Authors, Study N° of HIV TV Main finding
Year, population participants/ detection detection
Country [Ref.] N° of HIV method method
seroconversions
Delany- HIV-negative 2451/110 Not stated Not stated Baseline TV+ more likely to seroconvert
Moretlwe et women compared with TV–
al., 2011, IRR 2.3 (95% CI, 1.1–4.9)
South Africa
[22]
Ghys et al., FSW HIV 284/26 ELISA + Wet Prep TV+ women more likely to seroconvert
2001, Ivory negative WB than TV–
Coast [23] aRR 2.8 (95% CI, 1.3–6.2)
Hester & Women 90/45 Dot-WB Wet prep HIV acquisition among women TV+
Kennedy, (Serodiscordant baseline compared with TV– baseline
2003, Zambia couples) OR 0.35 ( 95% CI, 0.16–0.76)
[24]
Kinuthia et al., Women at a 1304/25 NAATs Wet Prep HIV acquisition for women with TV
2015, Kenya prenatal clinic aHR 1.14 (95% CI, 0.16–8.16)
[25]
Kleinschmidt Women 551/23 HIV rapid Culture TV+ more likely to acquire HIV-1 than TV-
et al., 2007, attending FP test (Daimonds) aHR 4.79 (95% CI, 1.01–22.78)
South Africa clinics
[26]
Laga et al., FSW HIV 431/68 EIA + WB Wet Prep TV+ women more likely to seroconvert
1993, negative than TV-
Democratic AOR 1.9 (95% CI, 0.9–4.1)
Republic of
Congo [3]
149
Chapter Seven

seroconversions
Laga et al., FSW HIV 531/70 EIA + WB Wet Prep TV+ women more likely to seroconvert
1994, negative than TV–
Democratic RR 1.7 (95% CI, 1.1–2.8)
Republic of
Congo [27]
Martin et al., FSW HIV 799/111 EIA Wet Prep HIV acquisition for FSW with TV
1998, Kenya negative aHR 1.2 (95% CI, 0.7–2.2)
[28]
Masese et al., FSW HIV 1964/325 EIA Wet Prep HIV acquisition for FSW with TV
2015, Kenya negative aHR 1.41 (95% CI, 0.99–2.02).
[29]
Mavedzenge General 4948/309 HIV NAATs HIV acquisition with those with TV
et al., 2010, population Rapids, aHR 2.05 (95% CI, 1.05–4.02)
Zimbabwe & EIA
South Africa
[30]
McClelland et FSW 1215/238 EIA Wet Prep HIV acquisition for FSW with TV
al., 2005, HR 1.3 (95% CI, 1.0–1.7)
Kenya [31]
McClelland et FSWs HIV-1– 1335/261 EIA Wet Prep HIV acquisition for FSW with TV
al., 2007, seronegative aHR 1.52 [95% CI, 1.04–2.24]
Kenya [32]
Myer et al., General 3570/85 Abbott Wet Prep Baseline TV+ more likely to seroconvert
2006, South population HIV 1/2 compared with TV–
Africa [33] Kit cHR 1.84 (95% CI 1.02–3.32)
150
Chapter Seven

seroconversions
Nagot et al., FSW 377/19 EIA Wet Prep HIV acquisition for FSW with TV
2005, Burkina HR 0.71 (95% CI, 0.22–2.29)
Faso [34]
Quinn et al., Serodiscodant 414/90 EIA + WB Culture HIV acquisition when a person has TV
2000, Uganda couples (InPouch) aRR* 1.27(95% CI, 0.65─2.35)
[35]
Taha et al., HIV –ve 1196/124 EIA + WB Wet Prep TV+ women more likely to seroconvert
1998, Malawi Postnatal than TV–
[36] women aRR 1.38 (95% CI, 0.75–2.56)
Van De Wijgert Women at FP 4439/189 ELISA, Wet Prep TV associated with HIV if it is detected in
et al., 2009, and mother- confirmed current & previous visit to HIV
Zimbabwe and child health by Rapid seroconversion
Uganda [37] clinics test or aHR 1.53 (95%CI: 0.21–11.01)
PCR or
WB
Van Der Pol et FP clinic & 4531/213 NAATs Wet Prep & TV+ at previous visit were more likely to
al., 2008, FSW HIV- NAATs seroconvert than women without TV
Uganda & AOR 2.74 (95% CI, 1.25─6.00) FP &FSW
Zimbambwe AOR 3.3 (95% CI, 1.36–7.85) FP only
[10]
Vandepitte et FSW 646/42 HIV Culture TV increase likelihood of HIV acquisition
al., 2013, Rapids, with
Uganda [38] confirmed aHR 2.72 (95%CI: 1.27─5.84)
by ELISA
Legend:, aHR; adjusted hazard ratio, aRR*; adjusted rate ratio, AOR; aRR; adjusted risk ratio, AOR; adjusted odds ratio, EIA; Enzyme
immunoassay, NAATs; Nucleic acid amplification tests, ELISA; Eenzyme-linked immunosorbent assay, FSW; female sex workers, FP; family
planning, IRR; independent risk ratio, WB: Western blot, CI; confidence intervals. All studies were cohort studies, except Hester & Kennedy (2003)
and Laga et al. (1993), which were nested case-control studies. Studies are arranged alphabetically according to the name of the first author and
then the year of publication.
151
Chapter Seven
Risk of bias within studies

The results of the critical appraisals of the included studies are shown in (Figure 7.2).
Fourteen studies were assessed as having a high risk of bias for representativeness,
three as having a medium risk of bias for representativeness and two studies as having
a low risk of bias for representativeness. For the risk of bias for outcome assessment it
was high for one study, medium for 16 studies and low for two studies. Eight out of the
nineteen studies were assessed as having a medium risk of bias for comparability while
11 studies had a low risk of bias for comparability. Individual study appraisals are captured
in (Supplementary Table 3).
Figure 7.2 Quality assessment using an adapted Newcastle-Ottawa Scale for risk
of bias.
Legend: The absolute numbers of studies are shown in the boxes.
152
Chapter Seven
Association of T. vaginalis and HIV acquisition
Eleven of the studies that were reporting HR, provided data for the meta-analysis. The
point estimate for the HR ranged from 0.71 to 4.79 (Table 7.1). Bearing in mind that ORs
and RRs measure only the number of events and take not into account when they occur,
these two measures are appropriate for measuring dichotomous outcomes, but less
appropriate for analyzing time-to-event outcomes which is important when relating T.
vaginalis infection and HIV acquisition. The meta-analysis indicated that individuals
infected with T. vaginalis were 1.5 times more likely to acquire HIV as compared to
individuals not infected with T. vaginalis (HR: 1.5; 95% Confidence Interval (CI), 1.3–1.7;
p < 0.001). There was low heterogeneity of studies included in the meta-analysis as
shown by the I2 = 0.0%, P = 0.510 (Figure 7.3).
153
Chapter Seven
Figure 7.3 Forest plot of estimates of association between trichomoniasis and HIV
acquisition
Studies are plotted starting with the one with the least weight. Each study is represented
by a black circle and a horizontal line, which correspond to the HR and 95% CI,
respectively. The area of the gray box around each study reflects the weight of the study
(determined by random effects analysis) in the meta-analysis. The vertical line in the
middle corresponds to a HR of 1.0. The diamond represent the overall HR with the 95%
CI given by its width. The arrow indicates the study with the highest confidence interval.
7.5 Discussion
In this systematic review and meta-analysis, we assessed the extent to which T. vaginalis
infection is associated with HIV acquisition. There has been a global decline in deaths
from HIV/AIDS-related causes, from a peak of 1.9 million in 2005 to 1.0 million in 2016
[2]. Despite this AIDS-related illnesses remain the leading cause of death among women
of reproductive age (15–49 years) globally [2] and the second leading cause of death for
154
Chapter Seven
young women aged 15–24 years in sSA [2]. The prevalence of T. vaginalis was estimated
to be approximately 11 % in 2012 among women in sSA [1].
Studies included in our meta-analysis had no heterogeneity and thus appropriate to be

combined in a meta-analysis where we demonstrate that individuals infected with T.
vaginalis are at a higher risk of HIV acquisition. T. vaginalis augments the likelihood of
HIV acquisition by 50% (HR, 1.5; 95% CI, 1.3–1.7), the amount of HIV acquisition
attributable to this pathogen (attributable risk) and its contribution to the HIV pandemic
may be substantial due to the high prevalence of T. vaginalis infection, especially in sSA.
In a study where they included both high-risk individuals and low-risk individuals, the
adjusted hazard ratio for HIV acquisition for women with T. vaginalis were higher in the
low-risk individuals, suggesting that for women with less risk from sexual networks,
infection with T. vaginalis infection is a very important risk factor for HIV acquisition [10].
Even though most studies included in this systematic review utilized direct microscopy for
detection of T. vaginalis a diagnostic technique which has been shown to have a low
sensitivity [11]. In a study using both direct microscopy and NAAT, both sets of results
were associated with a higher HIV acquisition although fewer cases were detected by
direct microscopy [10].
Several T. vaginalis pathogenic mechanisms of T. vaginalis may help to explain why

individuals infected with T. vaginalis may be at a higher risk of HIV acquisition. First, T.
vaginalis may damage the epithelial membrane [12] which acts as a barrier to HIV through
several pathogenic mechanisms; its cell-to-cell adhesion [13], hemolysis [14] and/or
excretion of soluble factors [15]. Second, T. vaginalis has been shown to elicit an
inflammatory response among infected individuals this may lead to an increase in the
appearance of HIV target cells [16, 17]. Third, infection with T. vaginalis has been
associated with bacterial vaginosis [18], which, in turn, can increase the risk of HIV
acquisition [19]. All these consequences may facilitate HIV in T. vaginalis infected
individuals.
In cases of HIV and T. vaginalis co-infection, T. vaginalis has been associated with
increased genital shedding of HIV [20]. A previous study showed high prevalence of T.
155
Chapter Seven
vaginalis among HIV serodiscordant African couples [21]. T. vaginalis may be an

important factor for HIV transmission in HIV discordant couples more so if both are
infected with T. vaginalis as there is potential for synergistic effect leading to an even
higher likely hood of HIV acquisition. That is by increased genital HIV shedding and
pathogenic mechanisms of T. vaginalis making the HIV uninfected partner more
susceptible to HIV acquisition.
Both T. vaginalis and HIV are associated with high-risk behavior and one may argue that
the HIV acquisition is as a result of the high-risk behavior and not necessarily due to
pathophysiological mechanisms of T. vaginalis. However, from the studies that reported
odds ratios, the results suggest that exposure to T. vaginalis was associated with a higher
chance of HIV infection acquisition. For instance women attending family planning who
were determined to be T. vaginalis positive at previous visit were more likely to
seroconvert than women without T. vaginalis in a study in Uganda and Zimbabwe AOR
3.3 (95% CI, 1.36–7.85) [10]. Therefore, T. vaginalis infection seems to be a good marker
for predicting those who are at high risk of HIV infection acquisition.
When interpreting the results of the meta-analysis, the following ought to be taken into
consideration. First, most studies included in the review were conducted amongst high-
risk individuals, i.e. female sex workers, and serodiscordant couples. Thus, our result may
not reflect the situation in the general population. Second, only a couple of studies
included in the review had male participants and thus our results are biased towards high-
risk females. Third, most of the studies in the review utilized direct microscopy to detect
T. vaginalis infection, whereby direct microscopy is characterized by low sensitivity and
samples detected through this technique usually have high parasitemia. Although, the
few studies that utilized culture or NAATs for T. vaginalis detection also reported positive
association of T. vaginalis infection and increased likelihood of HIV acquisition, they also
signal the need for further longitudinal research on this area. Four, we only included
studies reported in English and this may in itself constitute a bias. Finally, all studies
included in the review were done in sSA and thus our results may only apply to the sSA
population.
156
Chapter Seven
7.6 Conclusion
T. vaginalis may be used as a biological marker for enhanced risk for HIV acquisition for
both in high-risk and low-risk individuals. T. vaginalis may be an important factor in HIV
acquisition especially in sSA where the prevalence of both T. vaginalis and HIV is high
and this systematic review and meta-analysis provides consolidated evidence that
infection with T. vaginalis augments HIV acquisition. Diagnosis and treatment of T.
vaginalis in both individuals at high-risk and low-risk for HIV may perhaps be a potential
tool to reduce new HIV infections.
7.7 References
reporting. PLoS One. 2015;10(12):e0143304.
2. UNAIDS 2017 reference-
http://www.unaids.org/en/resources/documents/2017/2017_data_book
3. Laga M, et al. Non-ulcerative sexually transmitted diseases as risk factors for HIV-1
transmission in women: results from a cohort study. AIDS. 1993;7(1):95-102.
4. Kissinger P, et al. Trichomonas vaginalis treatment reduces vaginal HIV-1 shedding.
Sex Transm Dis. 2009;36(1):11-16.
5. Masese LN, et al. A prospective study of vaginal trichomoniasis and HIV-1 shedding
in women on antiretroviral therapy. BMC Infect Dis. 2011;11:307.
6. Howe K, & Kissinger PJ. Single-Dose Compared With Multidose Metronidazole for the
Treatment of Trichomoniasis in Women: A Meta-Analysis. Sex Transm Dis.
2017;44(1):29-34.
7. Moher D, et al. Preferred reporting items for systematic reviews and meta-analyses:
the PRISMA statement. PLoS Med. 2009;6(7):e1000097.
8. Zeng X, et al. The methodological quality assessment tools for preclinical and clinical
studies, systematic review and meta-analysis, and clinical practice guideline: a
systematic review. J of evid-based medic. 2015;8(1):2-10.
9. Higgins JPT et al. Measuring inconsistency in meta-analyses. BMJ.
2003;327(7414):557-560.
10. Van Der Pol B, et al. Trichomonas vaginalis infection and human immunodeficiency
virus acquisition in African women. J Infect Dis. 2008;197(4):548-554.
11. Garber GE. The laboratory diagnosis of Trichomonas vaginalis. Canadian J Infect Dis
& Med Microbiol. 2005;16(1):35-8.
12. Gilbert RO, et al. Cytopathogenic effect of Trichomonas vaginalis on human vaginal
epithelial cells cultured in vitro. Infect & immunity. 2000;68(7):4200-6.
13. Alderete JF, Garza GE. Identification and properties of Trichomonas vaginalis proteins
involved in cytadherence. Infect & immunity. 1988;56(1):28-33.
157
Chapter Seven
14. Krieger JN, et al. Beta-hemolytic activity of Trichomonas vaginalis correlates with
virulence. Infect Immun. 1983;41(3):1291-5.
15. Mallinson DJ, et al. Identification and molecular cloning of four cysteine proteinase
genes from the pathogenic protozoon Trichomonas vaginalis. Microbiol. 1994;140 ( Pt
10):2725-35.
16. Fichorova RN, et al. Trichomonas vaginalis lipophosphoglycan triggers a selective
upregulation of cytokines by human female reproductive tract epithelial cells. Infect
Immun. 2006;74(10):5773-9.
17. Levine WC, et al. Increase in endocervical CD4 lymphocytes among women with
nonulcerative sexually transmitted diseases. J Infect Dis. 1998;177(1):167-74.
18. Rathod SD, et al. Bacterial Vaginosis and Risk for Trichomonas vaginalis Infection: A
Longitudinal Analysis. Sex Trans Dis. 2011;38(9):882-6.
19. Masson L, et al. Defining genital tract cytokine signatures of sexually transmitted
infections and bacterial vaginosis in women at high risk of HIV infection: a cross-
sectional study. Sex Trans Infect. 2014;90(8):580-7.
20. Anderson BL, et al. Effect of trichomoniasis therapy on genital HIV viral burden among
African women. Sex Trans Dis. 2012;39(8):638-42.
21. Bochner AF, et al. A cross-sectional analysis of Trichomonas vaginalis infection
among heterosexual HIV-1 serodiscordant African couples. Sex Trans Infect.
2017;93(7):520-9.
22. Delany-Moretlwe S, et al. Risk factors associated with HIV acquisition: A comparative
analysis of older and younger women who participated in the MDP301 trial in
Johannesburg. Sex Trans Infect. 2011;87:A179-A180.
23. Ghys PD, et al. Effect of interventions to control sexually transmitted disease on the
incidence of HIV infection in female sex workers. Aids. 2001;15(11):1421-31.
24. Hester RA, Kennedy SB. Candida infection as a risk factor for HIV transmission. J
women's health. 2003;12(5):487-94.
25. Kinuthia J, et al. HIV acquisition during pregnancy and postpartum is associated with
genital infections and partnership characteristics. Aids. 2015;29(15):2025-33.
26. Kleinschmidt I, et al. Injectable progestin contraceptive use and risk of HIV infection
in a South African family planning cohort. Contraception. 2007;75(6):461-7.
27. Laga M, et al. Condom promotion, sexually transmitted diseases treatment, and
declining incidence of HIV-1 infection in female Zairian sex workers. Lancet. 1994;
344(8917):246-8.
28. Martin HL, Jr., et al. Hormonal contraception, sexually transmitted diseases, and risk
of heterosexual transmission of human immunodeficiency virus type 1. J Infect Dis.
1998;178(4):1053-9.
29. Masese L, et al. Changes in the contribution of genital tract infections to HIV
acquisition among Kenyan high-risk women from 1993 to 2012. AIDS.
2015;29(9):1077-85.
30. Mavedzenge SN, et al. Epidemiological synergy of Trichomonas vaginalis and HIV in
Zimbabwean and South African women. Sex Trans Dis. 2010;37(7):460-6.
31. McClelland RS, et al. Contribution of HIV-1 infection to acquisition of sexually
transmitted disease: a 10-year prospective study. J Infect Dis. 2005;191(3):333-8.
32. McClelland RS, et al. Infection with Trichomonas vaginalis increases the risk of HIV-1
acquisition. J Infect Dis. 2007;195(5):698-702.
158
Chapter Seven
33. Myer L, et al. Distinguishing the temporal association between women's intravaginal
practices and risk of human immunodeficiency virus infection: a prospective study of
South African women. Am J Epidemiol. 2006;163(6):552-60.
34. Nagot N, et al. Is sexually transmitted infection management among sex workers still
able to mitigate the spread of HIV infection in West Africa? J Acquir Immune Defic
Syndr. 2005;39(4):454-8.
35. Quinn TC, et al. Viral load and heterosexual transmission of human immunodeficiency
virus type 1. Rakai Project Study Group. N Engl J Med. 2000; 342(13):921-9.
36. Taha TE, et al. Bacterial vaginosis and disturbances of vaginal flora: association with
increased acquisition of HIV. AIDS. 1998;12(13):1699-1706.
37. Van De Wijgert JHHM, et al. Disentangling contributions of reproductive tract
infections to hiv acquisition in african women. Sex Trans Dis. 2009;36(6):357-64.
38. Vandepitte J, et al. Alcohol use, mycoplasma genitalium, and other STIs associated
with HIV incidence among women at high risk in Kampala, Uganda. J Acquir Immune
Defic Syndr. 2013;62(1):119-26.
Glossary
Hazard ratio: This can be defined as the ratio of [risk of outcome in one group]/[risk of
outcome in another group], occurring at a given interval of time.
Odds ratio: This can be defined as a measure of association between an exposure and
an outcome. The odds ratio represents the odds that an outcome will occur given a
particular exposure, compared to the odds of the outcome occurring in the absence of
that exposure.
Rate ratio: This can be defined as a measure of association that compares the incidence
of events happening at different times.
Relative risk or risk ratio: This can be defined as the ratio of the probability of an event
occurring in an exposed group to the probability of the event occurring in a comparison,
non-exposed group exposed.
159
Chapter Seven
Supplementary Table 7.1. TOOL FOR EVALUATION OF RISK OF BIAS IN

INDIVIDUAL STUDIES
SELECTION
1. Representativeness of the group tested for Trichomonas vaginalis & HIV
a) Truly representative of people in the community ***

b) Somewhat representative of the community **
c) Selected group people *
d) No description
COMPARABILITY
2. The subjects in different comparison groups are comparable, based on

the study design or analysis
a) Controlling for confounding factors (logistic regression or propensity
scoring) **
b) Subjects in different groups are comparable *
c) No reporting on comparability between comparison groups and no control
for confounding
OUTCOME
3. Ascertainment of infection with either Trichomonas vaginalis or HIV
a) Both ascertained by validated, highly specific and sensitive assays

performed for the study ***
b) Either T. vaginalis or HIV ascertained by validated moderate specific and
sensitive assays performed for the study while the other is through
medical records**
c) Both ascertained through medical records *
d) Self-reported without further documentation/ assay not stated
RISK OF BIAS
Selection: 3 stars, low risk of bias; 2 stars, medium risk of bias; 0 or 1 star(s), high risk
of bias
Comparability: 2 stars, low risk of bias; 1 star, medium risk of bias; 0 stars, high risk of
bias
Outcome: 3 stars, low risk of bias; 2 or1 star(s), medium risk of bias; 0 stars, high risk of
bias
160
Chapter Seven
Supplementary Table 7.2: Individual study summary of risk of bias assessment
Author & Year Selection Comparability Outcome

Interpretation Interpretation Interpretation
Delany-Moretlwe et al. (2011) high medium high

Ghys et al. (2001) high low medium
Hester et al. (2003) High medium medium
Kinuthia et al. (2015) High medium medium
Kleinschmidt et al. (2007) medium low medium
Laga et al. (1993) High medium medium
Laga et al. (1994) High low medium
Martin et al. (1998) High medium medium
Masese et al. (2015) High low medium
Mavedzenge et al. (2010) Low low low
McClelland et al. (2005) High medium medium
McClelland et al. (2007) High low medium
Myer et al. (2006) Low medium medium
Nagot et al. (2005) High medium medium
Quinn et al. (2000) High low medium
Taha et al. (1998) medium low medium
van de Wijgert et al. (2009) medium low medium
Van Der Pol et al. (2008) High low low
Vandepitte et al. (2013) High low medium
Legend: Studies are arranged alphabetically according to the first authors name and year.
161
162
Chapter Eight | Summary and future perspectives
163
Chapter Eight
The first objective of this doctoral dissertation was to assess the prevalence and risk
factors associated with curable sexually transmitted infections (STIs) among pregnant
women, attending antenatal care at a rural county hospital in Kilifi, Kenya, for routine
screening of HIV and syphilis.
More details with regard to the assessment of the prevalence and risk factors are outlined
in detail in Chapter 3. In brief, from July to September 2015, we performed a cross-
sectional study, whereby the women had a urine sample tested for Chlamydia
trachomatis/Neisseria gonorrhoeae by GeneXpert® and a vaginal swab for Trichomonas
vaginalis by culture and microscopy. Bacterial vaginosis (BV) was defined as a Nugent
score of 7-10 of the Gram stain of a vaginal smear in combination with self-reported
vaginal discharge. Genital ulcers were screened during collection of vaginal swabs. All
women answered questions with regard to socio-demographics and sexual health and
clinical symptoms of STIs. Predictors for curable STIs were assessed in multivariable
logistic regression.
The main why reason Trichomonas vaginalis was detected by culture was cost and
availability of the testing technique. Furthermore, culture enabled provision of initial same
day results via direct microscopy which was applied on the same test kit (Tv Inpouch).
Moreover, the funding to perform C. trachomatis and N. gonorrhoeae detection was
obtained separately. In addition, culture provides with strains (i.e. full genomes) of T.
vaginalis from which nucleic acids could be extracted for further studies such as the
determination of the actin gene type or the presence of T. vaginalis viruses (TVVs).
Of 202 women included, a total of 20.8% (95% confidence interval (CI):15.4-27.0), i.e.
one in five, had a curable STI. The prevalence was 14.9% for C. trachomatis (95% CI:
10.2-20.5), 1.0% for N. gonorrhoeae (95% CI: 0.1-3.5), 7.4% for T. vaginalis (95% CI:
4.2-12.0), 19.3% for BV (95% CI: 14.1-25.4) and 2.5% for genital ulcers (95% CI: 0.8-5.7)
[1]. Curable STIs have been associated with a number of adverse pregnancy outcomes,
including spontaneous abortion, stillbirth, prematurity, low birth weight, postpartum sepsis
and endometritis, and several sequelae in surviving neonates [2]. Preterm birth and low
birth weight are major determinants of infant morbidity and mortality, especially in
developing countries such as Kenya, where neonatal intensive care facilities are rarely
164
Chapter Eight
available. Mati et al. [3] reported a high incidence of 7.5% for low birth weight (< 2500 g),
and a perinatal mortality of 2.2% in Nairobi, Kenya.
Future perspectives: Investigating the influence of STIs on pregnancy outcome is

complicated. For ethical reasons, it is not possible to prospectively investigate the
influence of an untreated STI upon diagnosis. Therefore, most studies are retrospective,
whereby data on STIs and birth outcomes have been collected at or after delivery, and
whereby it may be difficult to take into account confounding factors, such as nutrition,
malaria, gestational diabetes and/or genetic disorders that may have an effect on the
pregnancy outcome [2].
In resource-constrained settings, as is the case in many developing countries, laboratory

diagnosis to confirm the etiology of an STI is currently not an achievable option. In Kenya,
syndromic management continues to be employed as the general approach in the
management of the bulk of STIs, despite evidence showing that this approach lacks both
sensitivity and specificity [4, 5], also because STIs may be asymptomatic [6] or may
present with non-specific clinical signs and symptoms. Simple and affordable techniques
need to be considered for the diagnosis of some STIs. The diagnosis of T. vaginalis can
be done using wet mount microscopy, whereby the main equipment required is a
microscope, which is available in most hospitals across the country. Despite the low
sensitivity of wet mount microscopy, this approach has high specificity of up to 100%,
depending on the reader [7]. Wet mount microscopy remains one of the best options for
clinicians in resource-constrained countries to quickly and specifically diagnose T.
vaginalis in clinical practice.
It is clear that a policy for testing for T. vaginalis in all women attending ANC could reduce
the burden of T. vaginalis infections, especially in areas with a high prevalence of T.
vaginalis. STI screening programs should be subject to a formal cost-effectiveness
analysis to avoid the ineffective use of resources. The greatest argument against the
general screening of T. vaginalis is that there is little evidence to indicate that treatment
of asymptomatic T. vaginalis–positive individuals prevents any adverse health outcome.
In particular, a randomized controlled trial treatment of T. vaginalis in pregnant women in
sub-Saharan Africa failed to show benefit in relation to preterm births and moreover, no
165
Chapter Eight
difference was observed between the mean birth weight of children from mothers treated
for T. vaginalis and mothers positive but not treated [8]. Results of this study are
inconclusive, as this study was conducted in four resource-limited settings where an
ultrasound was not generally available to determine the estimated due date. Women with
trichomoniasis who did not receive treatment were more likely to deliver a preterm infant
when the symphysis-fundal height was used to estimate gestational age (36% v.
23%; p=0.03), but not when the Ballard score was used (16% v. 21%; p=0.41) [8].
Factors associated with curable STIs including the ones identified in our study (BV, genital
ulcer, early sexual debut, water for cleaning after visiting the toilet) may be used as a first
level of screening to determine individuals who should undergo laboratory testing. Finally,
it has been hypothesized that widespread treatment of T. vaginalis has the potential to
increase metronidazole resistance for a pathogen against which no other class of
antibiotic is effective [9].
In the current climate of sustainable development goals (SDGs) era, as promoted by the
United Nations, there is a unique opportunity to reconsider approaches to health,
including to endemic, long-standing infectious diseases. Sustainable development goal
number 3 (SDG3) is primarily on health: “Ensure healthy lives and promote well-being for
all at all ages”. One of the specific targets set out under SDG3 is: “By 2030, ensure
universal access to sexual and reproductive health-care services, including for family
planning, information and education, and the integration of reproductive health into
national strategies and programmes” [10].
If Kenya is to achieve the ambitious targets as set out under the SDG3, a multidisciplinary
approach has to be in place, as health is determined by multiple factors that often are not
addressed within the health sector alone and require necessarily collaboration and
partnership with different sectors. Within the Kenyan context, setting up and maintenance
of antimicrobial resistance monitoring for STIs such as N. gonorrhoeae which is evolving
into a superbug due to resistance to multiple antibiotics [11] should be set up. Moreover,
a general national surveillance of all STIs ought to be organized in a well-thought-out
manner by the government, as is the case for HIV [12]. The Kenyan government should
consider screening and treatment of pregnant women co-infected with T. vaginalis and
166
Chapter Eight
HIV as this would go a long way in reducing mother-to-child HIV transmission. At present,
the HIV mother-to-child HIV transmission rate in Kilifi is 10% and the target is to reduce
this rate to less than 5% by 2019 [13].
The second objective of this doctoral dissertation was to assess the urogenital pathogen
correlates of T. vaginalis among pregnant women in Kilifi, Kenya.
Since conventional screening of STIs is frequently only aiming at the diagnosis of

chlamydia, gonorrhea, syphilis and trichomoniasis, while pathogens which demonstrate
similar urogenital syndromes, such as Mycoplasma genitalium, remain undiagnosed
and/or untreated. This objective is addressed in Chapter 4 of this PhD dissertation. By
means of a nested case-control approach, vaginal swabs from 79 pregnant women, i.e.,
28 T. vaginalis-positive (cases) and 51 T. vaginalis-negative (controls), were screened by
quantitative PCR for Adenovirus 1 and 2, Cytomegalovirus, Herpes Simplex Virus 1 and
2, C. trachomatis, Escherichia coli, Haemophilus ducreyi, Mycoplasma genitalium, M.
hominis, candidatus M. girerdii, N. gonorrhoeae, Streptococcus agalactiae, Treponema
pallidum, Ureaplasma parvum, U. urealyticum, and Candida albicans. Additionally, we
determined whether women with pathogens highly associated with T. vaginalis had
distinct clinical signs and symptoms compared to women with T. vaginalis mono-infection.
We could demonstrate that women infected with T. vaginalis were significantly co-infected
with M. hominis (adjusted odds ratio = 6.8, 95% CI: 2.3–19.8). Moreover, M. genitalium
and Ca M. girerdii were exclusively detected in women with T. vaginalis (P = 0.002 and P
= 0.001), respectively.
Future perspectives: Our results suggest that although most focus goes to the four most
common prevalent curable STI pathogens, i.e., C. trachomatis, N. gonorrhoeae, T.
pallidum and T. vaginalis, there are co-infections with pathogens that are not routinely
screened for. These co-occurrences may have an impact on the management of the
primary infection. Future studies ought to investigate the co-infections with these less
well-known STIs and assess whether they play a synergistic role in the pathology.
167
Chapter Eight
The third objective was to assess the genetic diversity of T. vaginalis isolates among
pregnant women in Kilifi, Kenya. This objective is addressed in Chapter 5 of this
dissertation. In summary, genotyping was performed on 22 clinical isolates of T. vaginalis,
collected from women attending the antenatal care clinic at Kilifi County Hospital, Kenya,
in 2015. Genotyping followed a previously proposed restriction fragment length
polymorphism (RFLP) scheme [14], which involved in silico cleavage of the actin gene by
HindII, MseI and RsaI restriction enzymes. Phylogenetic analysis of all the sequences
was performed to confirm the results obtained by RFLP-analysis and to assess the
diversity within the RFLP genotypes. Additionally, we determined carriage of the four
different types of TVVs by reverse transcription polymerase chain reaction.
In silico RFLP-analysis revealed five T. vaginalis actin genotypes among women

attending ANC who participated in our cross-sectional study; 50.0% of the isolates were
of actin genotype E, 27.3% of actin genotype N, 13.6% of actin genotype G and 4.5% of
actin genotypes I and P. The prevalence of TVVs was 43.5% (95% confidence interval,
CI: 23.2–65.5). TVV1 was the most prevalent, present in 39.1% of the strains and 90% of
the T. vaginalis isolates which harbored TVVs had more than one type of TVV. None of
the isolates of actin genotype E harbored any TVV.
For the first time, we now know the actin genotypes of T. vaginalis that are in circulation
in Kilifi, Kenya. We can now make comparisons with T. vaginalis genotype that are in
circulation in other places within the country and in other countries. For instance, the most
common actin genotype in our study was genotype E, similar to what was observed in
Congo [14]. In Zambia however, most common actin genotype was genotype G [14].
Mapping the global distribution of the genotypes will lead to better understanding of the
epidemiology of T. vaginalis.
This sequence based genotyping technique is able to produce portable and unambiguous
results when compared to for gel based techniques where interpretation of band patters
is very subjective. Using this sequence based techniques equally have good
reproducibility as different laboratories following the same protocol would almost always
have the same results.
168
Chapter Eight
The target gene (Actin) is a ubiquitous well conserved structural protein in all eukaryotic
cells and has been used to clarify the molecular phylogeny of protists, plants, animals
and fungi.
The choice of doing direct sequencing of PCR products allows immediate and detailed
analysis of the fragments without the extra steps associated with cloning. With the current
availability of the thermostable polymerases and cycle sequencing, doubleǦstranded
sequencing of PCR products is very efficient. In our case we sequenced bidirectional
which enabled assembling of a consensus sequence which was used for genotyping.
Future perspectives: Our work on genotyping T. vaginalis also lays foundation for future
studies that may examine aspects such as genotype replacement or that can identify new
genotypes that may be imported from elsewhere or may be prevalent in a different
population than the one we got our isolates from. Future studies that include both genders
may test the hypothesis that there is no preferential gender infection with particular
genotypes and further on examine whether lack of TVVs among genotype E still persists.
Also, In vitro studies have demonstrated that TVVs can be sensed by the human epithelial
cells via Toll-like receptor 3, upregulating Interferon Regulating Factor-3, interferon type
I and proinflammatory cascades [15]. TVVs are also associated with upregulated levels
of T. vaginalis immunogenic protein P270 [16] and differential qualitative and quantitative
expression of cysteine proteinases [17]. Thus, since TVVs induce various phenotypic
changes that may impact T. vaginalis virulence [17], future studies to better understand
of the role of TVVs in the pathology of T. vaginalis are warranted. These studies may also
determine whether there is an inflammation flare-up upon antibiotic treatment
(metronidazole) which commonly kills the protozoan pathogen but at the same time
releases the TVVs from the killed T. vaginalis cells. This may have an implication of
clinical management especially that of pregnant women as the released TVVs may be
responsible for initiation of the inflammation cascade.
Finally, previous studies have shown that TVVs were associated with significantly higher
minimum lethal concentration of metronidazole. From our study none of the isolates of
actin genotype E harbored any TVVs. Future studies will determine if this actin genotype
has the potential of to predict sensitivity to metronidazole.
169
Chapter Eight
The fourth objective was to describe the vaginal microbiome of pregnant women in
relation to infection with either T. vaginalis or C. trachomatis. This objective is addressed
in Chapter 6. In summary, the vaginal bacterial composition of women with T. vaginalis (
N = 18) was compared to that of women with C. trachomatis (N = 14), and controls (N =
21) (women negative for both T. vaginalis and C. trachomatis). The vaginal bacterial
composition was determined using high throughput sequencing with the Ion 16S
metagenomics kit, of the variable regions 2, 4 and 8 of the bacterial 16S ribosomal RNA
gene from the vaginal swab DNA extract of the women. QIIME and R package “Phyloseq”
were used to assess the α- and β-diversity and absolute abundance of the 16S rRNA
gene per sample in the three groups. Differences in taxa at various levels were
determined using the independent t-test.
We demonstrated bacterial α-diversity by both Simpson’s, and Shannon indices was

significantly higher (p = 0.056) and (p = 0.001) respectively, among women with either T.
vaginalis or C. trachomatis than among controls, with mean α-diversity (T. vaginalis-
infected) > mean α-diversity (C. trachomatis-infected) > mean α-diversity (Controls). At
the genus level, women infected with T. vaginalis had significantly (p < 0.01) higher
abundance of Parvimonas and Prevotella compared to both controls and CT-infected
women, whereas women infected with C. trachomatis had significantly (p < 0.05) higher
abundance of Anaerococcus, Collinsella, Corynebacterium, and Dialister.
Future perspectives: Future studies should determine whether the altered microbiomes
are markers of disease, or whether they actively contribute to the pathology of the two
genital infections. Future longitudinal studies of vaginal microbiome and STIs should
determine temporality and causality of our observations. It will be also important to
determine if clinical presentation i.e. asymptomatic vs symptomatic is associated with a
particular microbiome.
170
Chapter Eight
The fifth and final objective was to better understand interactions between T. vaginalis
and HIV, with particular interest to HIV acquisition. This objective was achieved through
a systematic review and meta-analysis which is addressed in Chapter 7. In brief, we
followed a review protocol we had developed and registered on the International
Prospective Register of Systematic Reviews (PROSPERO) under registration number
CRD42018082702. We searched databases to identify articles reporting on T.
vaginalis and HIV acquisition, which we included in the systematic review and meta-
analysis.
We identified 18 peer-reviewed articles and one conference abstract that were eligible for
inclusion. Upon qualitative synthesis and meta-analysis, we found that infection with T.
vaginalis enhanced the risk of HIV acquisition by a hazard ratio of 1.47 (95% CI, 1.25–
1.72; p < 0.001). T. vaginalis is an important factor in HIV acquisition, especially
in sSA where the prevalence of T. vaginalis is high. Diagnosis and treatment of T.
vaginalis infection in both high-risk and low-risk populations may be a potential tool to
reduce new HIV infections.
Future perspectives: Currently, new tools are being introduced to reduce the number of
new HIV infections, the main one being Pre-Exposure Prophylaxis (PREP) medication for
high-risk individuals [18]. Future studies among individuals on PREP may shed light on
whether infection with T. vaginalis will continue to be a factor associated with increased
likelihood of HIV acquisition. Screening for T. vaginalis may provide a means for
screening high-risk behavior among individuals on PREP. Another emerging field of
interest for future studies will be on whether PREP influences selection of HIV resistant
strains and on the role of diagnosis and treatment of T. vaginalis as a means to reduce
acquisition of these resistant HIV-strains. Also, among individuals infected with HIV,
there have been changes in the treatment. The World Health Organization currently
recommends the ‘test and treat’ approach, which is designed to place anyone who has
been diagnosed with HIV on treatment immediately following diagnosis, targeting to
suppress the HIV viral load as such reducing the probability of infected individuals to
transmit HIV [18].
171
Chapter Eight
In this new context of most individuals with HIV being on treatment, future studies may
explore genital viral shedding of HIV among individuals co-infected with T. vaginalis. Last
but not least, future studies may also evaluate whether there will be a need for special
dosage for treatment of T. vaginalis among individuals put early on HIV treatment as
currently there is a suggestion that 2 g single oral dose of metronidazole is not as effective
as 500 mg of metronidazole twice daily for 7 days among HIV-infected women [19], and
this is possibly influenced by the time at which individuals were put on HIV treatment.
172
Chapter Eight
8 References
1. Masha SC, et al. High prevalence of curable sexually transmitted infections among pregnant
women in a rural county hospital in Kilifi, Kenya. PloS One. 2017; 12(3):e0175166.
2. Mullick S, et al. Sexually transmitted infections in pregnancy: prevalence, impact on
pregnancy outcomes, and approach to treatment in developing countries. Sex Transm Infect.
2005;81(4):294-302.
3. Mati JK, et al. The Nairobi birth survey 1. the study design, the population and outline results.
J Obst Gynaec East Centr Afr. 1982;1(4):132-9.
4. Pettifor A, et al. How effective is syndromic management of STDs?: A review of current
studies. Sex Transm Dis. 2000;27(7):371-85.
5. Fonck K, et al. Validity of the vaginal discharge algorithm among pregnant and non-pregnant
women in Nairobi, Kenya. Sex Transm Infect. 2000;76(1):33-8.
6. Mudau M, et al. High prevalence of asymptomatic sexually transmitted infections among
human immunodeficiency virus-infected pregnant women in a low-income South African
community. Int J STD & AIDS. 2018;29(4):324-33.
7. Garber GE. The laboratory diagnosis of Trichomonas vaginalis. Can J Infect Dis Med
Microbiol. 2005;16(1):35-8.
8. Stringer E, et al. Treatment of trichomoniasis in pregnancy in sub-Saharan Africa does not
appear to be associated with low birth weight or preterm birth. South African Med J.
2010;100(1):58-64.
9. Klebanoff MA. Counterpoint: Screening for trichomoniasis-where's the evidence of benefit?
Clin Chem. 2014;60(1):155-7.
10. Brolan CE, et al. Did the right to health get across the line? Examining the United Nations
resolution on the Sustainable Development Goals. BMJ Global Health. 2017;2(3):e000353.
11. Unemo M, and Shafer WM. Antimicrobial Resistance in Neisseria gonorrhoeae in the 21st
Century: Past, Evolution, and Future. Clin Microb Rev. 2014;27(3):587-613.
12. Waruiru W, et al. The Kenya AIDS Indicator Survey 2012: rationale, methods, description of
participants, and response rates. J Acq Imm Def Synd. 2014;66 Suppl 1:S3-12.
13. Kenya AIDS response progress report 2016 [cited 2018 22 June ]; Available from:
http://nacc.or.ke/wp-content/uploads/2016/11/Kenya-AIDS-Progress-Report_web.pdf.
14. Crucitti T, et al. Molecular typing of the actin gene of Trichomonas vaginalis isolates by PCR-
restriction fragment length polymorphism. Clin Microb Infect. 2008;14(9):844-52.
15. Fichorova RN, et al. Endobiont viruses sensed by the human host - beyond conventional
antiparasitic therapy. PloS One. 2012;7(11):e48418.
16. Khoshnan A, Alderete JF: Trichomonas vaginalis with a double-stranded RNA virus has
upregulated levels of phenotypically variable immunogen mRNA. J Virol. 1994;68(6):4035-38.
17. Provenzano D, et al. Involvement of dsRNA virus in the protein composition and growth
kinetics of host Trichomonas vaginalis. Arch Virol. 1997;142(5):939-52.
18. Guideline on When to Start Antiretroviral Therapy and on Pre-Exposure Prophylaxis for HIV.
World Health Organization. 2015.
Available at http://www.who.int/hiv/pub/guidelines/earlyrelease-arv/en/
19. Kissinger, P., et al. A randomized treatment trial: single versus 7-day dose of metronidazole
for the treatment of Trichomonas vaginalis among HIV-infected women. J Acquir Immune
Defic Syndr. 2010;55(5):565-71
173
174
Chapter Nine | Samenvatting en toekomstperspectieven
175
Chapter Nine
De eerste doelstelling van dit doctoraal proefschrift betrof het beoordelen van de
prevalentie en risicofactoren die verband houden met geneesbare seksueel
overdraagbare aandoeningen (SOAs) bij zwangere vrouwen die op visite kwamen voor
antenatale zorg in een landelijk provinciaal ziekenhuis in Kilifi, Kenia, in verband met
routinematige screening voor HIV en syfilis. Meer details met betrekking tot de
beoordeling van de prevalentie en risicofactoren worden gedetailleerd beschreven in
Hoofdstuk 3. Samengevat werd, van juli tot september 2015, een cross-sectioneel
onderzoek uitgevoerd, waarbij van de vrouwen een urinemonster werd getest op
Chlamydia trachomatis / Neisseria gonorrhoeae (door middel van GeneXpert®) en een
vaginale swab werd getest voor Trichomonas vaginalis (door middel van kweek en
microscopie).
Bacteriële vaginose (BV) werd gedefinieerd als een Nugent-score van 7-10 van de Gram-
kleuring van een vaginaal uitstrijkje in combinatie met zelfgerapporteerde vaginale
afscheiding. Tijdens het verzamelen van vaginale uitstrijkjes werd nagegaan of er genitale
ulcers aanwezig waren. Alle vrouwen beantwoordden vragen over socio-demografie en
seksuele gezondheid en klinische symptomen van SOAs. Prognostische merkers voor
geneesbare SOAs werden beoordeeld door middel van multivariabele logistische
regressie.
De belangrijkste redenen waarom Trichomonas vaginalis door middel van kweek (cultuur
via de Tv Inpouch kit) werd gedetecteerd, waren de kosten en beschikbaarheid van de
kweektechniek. Daarenboven liet kweek toe om op dezelfde dag resultaten via directe
microscopie te bekomen, omdat deze techniek kon worden toegepast op dezelfde testkit.
Bovendien werd de financiering voor de moleculaire detectie van C. trachomatis en N.
gonorrhoeae later afzonderlijk verkregen. Bovendien voorziet cultuur in stammen (d.w.z.
volledige genomen) van T. vaginalis waaruit nucleïnezuren kunnen worden geëxtraheerd
voor verdere studies zoals de bepaling van het actine gentype of de aanwezigheid van
T. vaginalis virussen (TVVs).
Van de 202 vrouwen die deelnamen aan de studie, had een totaal van 20.8% (95%
confidentie-interval (CI): 15.4-27.0), d.w.z. één op de vijf, een geneesbare SOA. De
prevalentie was 14.9% voor C. trachomatis (95% CI: 10.2-20.5), 1.0% voor N.
176
Chapter Nine
gonorrhoeae (95% CI: 0.1-3.5), 7.4% voor T. vaginalis (95% CI: 4.2-12.0) 19.3% voor BV
(95% CI: 14.1-25.4) en 2.5% voor genitale ulcera (95% CI: 0.8-5.7) [1]. Geneesbare
SOAs zijn in verband gebracht met een aantal ongunstige zwangerschapsuitkomsten,
waaronder spontane abortus, doodgeboorte, prematuriteit, laag geboortegewicht,
postpartum sepsis en endometritis en met verschillende sequellen voor de overlevende
neonaten [2]. Vroeggeboorte en laag geboortegewicht zijn belangrijke bepalende
factoren voor kindermorbiditeit en -mortaliteit, vooral in ontwikkelingslanden zoals Kenia,
waar neonatale intensive care-faciliteiten zelden beschikbaar zijn. Mati et al. [3] meldden
een hoge incidentie van 7.5% voor een laag geboortegewicht (< 2500 g) en een perinatale
mortaliteit van 2.2% in Nairobi, Kenia.
Toekomstperspectieven: Het bepalen van de invloed van SOAs op de uitkomst van de

zwangerschap is niet eenvoudig. Om ethische redenen is het niet mogelijk om prospectief
de invloed van een onbehandelde SOA te onderzoeken bij het stellen van de diagnose
van SOA. Daarom zijn de meeste studies retrospectief, waarbij gegevens over SOAs en
geboorte-uitkomsten bij of na de bevalling zijn verzameld en waardoor het moeilijk is om
rekening te houden met andere verstorende factoren, zoals voeding, malaria,
zwangerschapsdiabetes en/of genetische afwijkingen, die mogelijk een effect hebben op
de zwangerschapsuitkomst [2].
In een omgeving met beperkte middelen, zoals in veel ontwikkelingslanden, is een
laboratoriumdiagnose om de etiologie van een SOA te bevestigen momenteel geen
haalbare optie. In Kenia blijft syndromisch management de algemene benadering bij het
beheer van de meeste SOAs, ondanks het feit dat er aanwijzingen zijn dat deze aanpak
tekortschiet zowel wat betreft gevoeligheid als specificiteit [4, 5], ook omdat SOAs
asymptomatisch kunnen zijn [6] of kunnen voorkomen met aspecifieke klinische
symptomen. Eenvoudige en betaalbare technieken moeten worden overwogen voor de
diagnose van sommige SOAs. De diagnose van T. vaginalis kan bijvoorbeeld worden
gedaan met behulp van microscopie op verse uitstrijkjes (‘wet mount’), waarbij de vereiste
uitrusting beperkt is tot een microscoop, die beschikbaar is in de meeste ziekenhuizen in
het hele land. Ondanks de lage gevoeligheid van wet mount microscopie, heeft deze
techniek een hoge specificiteit, tot 100%, afhankelijk van de waarnemer [7]. Wet mount
177
Chapter Nine
microscopie blijft één van de beste opties voor clinici in landen met beperkte middelen
om T. vaginalis snel en specifiek te diagnosticeren in hun klinische praktijk.
Het is duidelijk dat een beleid, waarbij systematisch getest wordt voor T. vaginalis bij alle
vrouwen die antenatale zorg zoeken, de prevalentie van deze infectie sterk kan
reduceren, zeker in gebieden met een hoge prevalentie van T. vaginalis. SOA-
screeningsprogramma's moeten worden onderworpen aan een formele kosten-
batenanalyse om het niet-effectieve gebruik van middelen te voorkomen. Het grootste
argument tegen de algemene screening van T. vaginalis is dat er weinig aanwijzingen
zijn dat de behandeling van asymptomatische T. vaginalis-positieve personen nadelige
gevolgen voor de gezondheid voorkomt. Zo was er bij een gerandomiseerde
gecontroleerde klinische trial over behandeling van T. vaginalis bij zwangere vrouwen in
sub-Sahara Afrika geen voordeel te zien met betrekking tot premature geboorten, en werd
evenmin een verschil waargenomen in het gemiddelde geboortegewicht bij kinderen van
vrouwen die werden behandeld voor T. vaginalis en van vrouwen die positief waren, maar
niet behandeld [8]. De resultaten van deze studie zijn echter niet doorslaggevend, omdat
deze studie werd uitgevoerd in vier sites met beperkte middelen waar een echografie niet
algemeen beschikbaar was om de geschatte bevallingsdatum te bepalen. Vrouwen met
trichomoniasis die geen behandeling kregen, hadden een grotere kans op vroeggeboorte
wanneer de symfysis-fundal-hoogte werd gebruikt om de zwangerschapsduur te schatten
(36% versus 23%; p = 0,03), maar niet toen de Ballard-score werd gebruikt (16% versus
21%, p = 0,41) [8].
Factoren die samenhangen met geneesbare SOA's, inclusief de in onze studie
geïdentificeerde genen (BV, genitale ulceratie, vroeg seksueel debuut, water voor
reiniging na een bezoek aan het toilet), kunnen worden gebruikt als eerste niveau van
screening om personen te bepalen die een laboratoriumtest moeten ondergaan.
Daarnaast bestaat de bezorgdheid dat een wijdverspreide behandeling van T. vaginalis
kan leiden tot toegenomen metronidazole-resistentie bij een pathogeen waarvoor geen
enkele andere klasse van antibiotica effectief is [9].
Kaderend in het huidige klimaat van duurzame ontwikkeling (sustainable development
goals: SDGs), zoals gepromoot door de Verenigde Naties, doet zich een unieke
gelegenheid voor om de aanpak van de volksgezondheid te heroverwegen, inclusief de
178
Chapter Nine
aanpak van endemische, langbestaande besmettelijke ziekten. Duurzame ontwikkeling

doel nummer 3 (SDG3) is vooral gericht op gezondheid: "Zorg voor een gezond leven en
bevorder het welzijn voor iedereen op alle leeftijden". Eén van de concrete doelstellingen
van SDG3 bestaat erin: "Tegen 2030 zorgen voor universele toegang tot diensten op het
gebied van seksuele en reproductieve gezondheidszorg, inclusief voor gezinsplanning,
informatie en onderwijs, en de integratie van reproductieve gezondheid in nationale
strategieën en programma's" [10].
Als Kenia de ambitieuze doelen wil bereiken die zijn vastgelegd in SDG3, dan zal dit via
een multidisciplinaire aanpak dienen te gebeuren, omdat gezondheid wordt bepaald door
meerdere factoren die vaak niet alleen binnen de gezondheidssector worden aangepakt
en die noodzakelijkerwijs samenwerking tussen en partnerschap met verschillende
sectoren vereisen. Eén van de andere doelstellingen binnen de Keniaanse context zou
het opzetten en onderhouden van antimicrobiële resistentiemonitoring voor SOAs
moeten zijn, vooral in verband met N. gonorrhoeae, die evolueert tot een superbacterie
als gevolg van resistentie tegen meerdere antibiotica [11]. Bovendien zou een algemene
nationale surveillance van alle SOAs goed doordacht moeten worden opgezet door de
overheid, zoals het geval is voor HIV [12]. De Keniaanse overheid zou screening en
behandeling van zwangere vrouwen met gelijktijdige infectie met T. vaginalis en HIV
moeten overwegen, omdat dit een belangrijke impact zou kunnen hebben op het
verminderen van HIV-overdracht van moeder op kind. Op dit moment is de HIV-
overdracht van moeder op kind in Kilifi 10% en het doel is om dit percentage in 2019 terug
te brengen tot minder dan 5% [13].
De tweede doelstelling van dit proefschrift bestond erin te bepalen welke urogenitale
pathogenen gecorreleerd zijn met het voorkomen van T. vaginalis bij zwangere vrouwen
in Kilifi, Kenia, omdat conventionele screening van SOAs vaak alleen gericht is op de
diagnose van chlamydia, gonorroe, syfilis en trichomoniasis, terwijl pathogenen die
vergelijkbare urogenitale syndromen vertonen, zoals bijvoorbeeld Mycoplasma
genitalium, niet gediagnosticeerd worden en/of onbehandeld blijven. Deze doelstelling
wordt behandeld in Hoofdstuk 4 van dit proefschrift. Door middel van een geneste case-
control benadering werden vaginale swabs van 79 zwangere vrouwen, d.w.z. 28 T.
179
Chapter Nine
vaginalis-positieven (cases/gevallen) en 51 T. vaginalis-negatieven (controles),

gescreend met kwantitatieve PCR voor Adenovirus 1 en 2, Cytomegalovirus, Herpes
Simplex Virus 1 en 2, C. trachomatis, Escherichia coli, Haemophilus ducreyi, M.
genitalium, M. hominis, candidatus M. girerdii, N. gonorrhoeae, Streptococcus agalactiae,
Treponema pallidum, Ureaplasma parvum, U. urealyticum, en Candida albicans.
Daarnaast gingen we na of vrouwen met pathogenen die sterk geassocieerd zijn met T.
vaginalis duidelijk verschillende klinische symptomen hadden in vergelijking met vrouwen
met T. vaginalis mono-infectie.
We konden aantonen dat vrouwen die geïnfecteerd waren met T. vaginalis significant
geassocieerd waren met M. hominis (aangepaste odds ratio (AOR) = 6.8, 95% CI: 2.3-
19.8). Bovendien werden M. genitalium en Ca M. girerdii uitsluitend gedetecteerd bij
vrouwen met T. vaginalis (respectieveljk P = 0.002 en P = 0.001).
Toekomstperspectieven: Onze resultaten suggereren dat, hoewel er veel aandacht is

voor de vier meest voorkomende overwegend geneesbare STI-pathogenen, d.w.z. C.
trachomatis, N. gonorrhoeae, T. pallidum en T. vaginalis, er co-infecties zijn met
pathogenen waarvoor niet routinematig wordt gescreend. Deze co-infecties kunnen van
invloed zijn op het beheer van de primaire infectie. Toekomstige studies zouden de co-
infecties met deze minder gekende SOAs moeten onderzoeken, en ook bepalen of ze
een synergetische rol spelen in de pathologie.
De derde doelstelling betrof het in kaart brengen van de genetische diversiteit van T.
vaginalis isolaten bij zwangere vrouwen in Kilifi, Kenia. Deze doelstelling wordt behandeld
in Hoofdstuk 5 van dit proefschrift. Genotypering werd uitgevoerd op 22 klinische isolaten
van T. vaginalis, die waren verzameld bij vrouwen die op consultatie kwamen in de kliniek
voor prenatale zorg in Kilifi County Hospital, Kenia, in 2015. Hiertoe werd een eerder
voorgesteld schema gevolgd voor bepaling van restrictiefragmentlengte-polymorfisme
(RFLP) [14], waarbij we ons baseerden op in silico-analyse van restrictie van het actine-
gen d.m.v. HindII, MseI en RsaI-restrictie-enzymen.
Fylogenetische analyse van alle sequenties werd uitgevoerd om de resultaten verkregen
door RFLP-analyse te bevestigen en om de diversiteit binnen de RFLP-genotypen te
180
Chapter Nine
beoordelen. Daarnaast bepaalden we de overdracht van de vier verschillende soorten

TVVs d.m.v. reverse transciptie-PCR (polymerasekettingreactie).
In silico RFLP-analyse toonde vijf T. vaginalis actine-genotypes aan onder vrouwen die
de antenatale gezondheidszorg consulteerden en deelnamen aan onze cross-sectionele
studie: 50.0% van de isolaten was van actine genotype E, 27.3% van actine genotype N,
13.6% van actine genotype G en 4.5% van actine genotypes I en P. De prevalentie van
TVVs was 43.5% (95% CI: 23.2-65.5). TVV1 was de meest voorkomende, aanwezig in
39.1% van de stammen, en 90% van de T. vaginalis-isolaten die TVVs herbergen hadden
meer dan één type TVV. Geen van de isolaten van actine-genotype E was met TVV
geïnfecteerd.
Voor het eerst kennen we nu de actine-genotypes van T. vaginalis die in Kilifi, Kenia, in
omloop zijn. We kunnen nu vergelijkingen maken met de T. vaginalis-genotypes die in
andere delen van het land en in andere landen in omloop zijn. Het meest voorkomende
actine-genotype was bijvoorbeeld genotype E in onze studie, vergelijkbaar met wat werd
waargenomen in Congo [14], maar in Zambia was genotype G het meest voorkomend
[14]. Het in kaart brengen van de wereldwijde verspreiding van de genotypen zal leiden
tot een beter begrip van de epidemiologie van T. vaginalis.
De op sequentie gebaseerde genotyperingstechnieken zijn in staat om draagbare en
ondubbelzinnige resultaten te produceren in vergelijking met op gel gebaseerde
technieken waarbij de interpretatie van bandpatronen zeer subjectief is. Het gebruik van
op sequenties gebaseerde technieken heeft eveneens een goede reproduceerbaarheid
omdat verschillende laboratoria die hetzelfde protocol volgen vrijwel altijd dezelfde
resultaten zullen hebben.
Het doelwitgen (Actine) is een alomtegenwoordig goed geconserveerd structureel eiwit
in alle eukaryote cellen en is gebruikt om de moleculaire fylogenie van protisten, planten,
dieren en schimmels te verduidelijken.
De keuze om directe PCR-producten te sequeneren, maakt directe en gedetailleerde
analyse van de fragmenten mogelijk zonder de extra stappen die met klonen zijn
geassocieerd. Met de huidige beschikbaarheid van de thermostabiele polymerasen en
cycle-sequentiebepaling is dubbelstrengs sequencing van PCR-producten zeer efficiënt.
181
Chapter Nine
In ons geval sequeneerden we bidirectioneel, wat de assemblage van een

consensussequentie mogelijk maakte die werd gebruikt voor genotypering.
Toekomstperspectieven: Ons werk rond genotypering van T. vaginalis legt ook de

grondslag voor toekomstige studies die aspecten zoals genotype-vervanging kunnen
onderzoeken of nieuwe genotypen kunnen identificeren die mogelijk van elders
geïmporteerd worden of die voorkomen in een andere populatie dan die waar we onze
isolaten vandaan hebben. Toekomstige studies die beide geslachten omvatten, kunnen
de hypothese testen dat er geen preferentiële geslachtsinfectie is met bepaalde
genotypen en verder onderzoeken of de bevinding dat TVVs ontbreken bij genotype E
geldig blijft.
In vitro-onderzoek heeft aangetoond dat TVVs kunnen worden waargenomen door de
menselijke epitheelcellen via Toll-like receptor 3, opregulerende interferon regulerende
factor (IRF)-3, interferon type I en pro-inflammatoire cascades [15]. TVVs zijn ook
geassocieerd geworden met T. vaginalis immunogeen proteïne P270 [16] met
differentiële kwantitatieve en kwantitatieve expressie van cysteïne-proteïnasen [17].
Aangezien TVVs verschillende fenotypische veranderingen kunnen induceren die de
virulentie van T. vaginalis kunnen beïnvloeden [17], lijken meer gedetailleerde studies
over de rol van TVVs in de pathologie van T. vaginalis aangewezen. Bovendien kunnen
toekomstige studies ook bepalen of er ontsteking optreedt na behandeling met antibiotica
- zoals metronidazole - die het pathogeen doden, maar waarbij de TVVs uit de T.
vaginalis-cellen worden vrijgesteld.
Tenslotte hebben eerdere studies aangetoond dat TVVs geassocieerd waren met een
significant verhoogde minimum lethale concentratie van metronidazol. In onze studie
bevatte geen van de isolaten van actine genotype E TVV's. Toekomstige studies kunnen
aantonen of dit actine-genotype een betere gevoeligheid voor metronidazole heeft.
182
Chapter Nine
De vierde doelstelling betrof de karakterisatie van het vaginale microbioom van

zwangere vrouwen in relatie tot infectie met T. vaginalis, respectievelijk C. trachomatis.
Deze doelstelling wordt behandeld in Hoofdstuk 6. Samengevat werd het vaginale
microbioom van vrouwen met T. vaginalis (n = 18) vergeleken met dat van vrouwen met
C. trachomatis (n = 14) en van controles, d.w.z. vrouwen negatief voor zowel T. vaginalis
als C. trachomatis (n = 21). De samenstelling van het vaginale microbioom werd bepaald
op basis van het DNA-extract van het vaginale uitstrijkje van de vrouwen, met behulp van
high throughput sequencing, met de Ion 16S metagenomics kit, van de variabele regio's
2, 4 en 8 van het bacteriële 16S ribosomale RNA-gen. QIIME en R-pakket "Phyloseq"
werden gebruikt om de α- en β-diversiteit en de absolute abundantie van het 16S-rRNA-
gen per monster in de drie groepen te bepalen. Verschillen in taxa op verschillende
niveaus werden bepaald met behulp van de onafhankelijke T-test. We konden aantonen
dat bacteriële α-diversiteit zowel op basis van Simpson's en Shannon-indices significant
hoger waren (p = 0.056, respectievelijk p = 0.001) bij vrouwen met T. vaginalis,
respectievelijk C. trachomatis in vergelijking met de controles, met gemiddelde α-
diversiteit (T. vaginalis-geïnfecteerd) > gemiddelde α-diversiteit (C. trachomatis
geïnfecteerd) > gemiddelde α-diversiteit (Controles)). Op genusniveau hadden vrouwen
die geïnfecteerd waren met T. vaginalis significant (p < 0.01) een hogere abundantie van
Parvimonas en Prevotella dan zowel controles als met C. trachomatis-geïnfecteerde
vrouwen, terwijl vrouwen die met C. trachomatis waren geïnfecteerd een significant (p <
0.05) hogere abundantie hadden van Anaerococcus, Collinsella, Corynebacterium en
Dialister.
Toekomstperspectieven: Verdere studies moeten uitwijzen of de gewijzigde

microbiomen alleen maar merkers van de infecties zijn dan wel bijdragen aan de
pathologie van de twee genitale infecties. Toekomstige longitudinale onderzoeken van
vaginaal microbioom en SOAs zijn hiervoor aangewezen. Het is ook belangrijk om te
bepalen of de klinische presentatie van deze genitale infecties, asymptomatisch vs.
symptomatisch, geassocieerd is met een bepaald microbioom.
183
Chapter Nine
De vijfde doelstelling beoogde de interacties tussen T. vaginalis en HIV beter te

begrijpen, met bijzondere aandacht voor HIV-verwerving. Deze doelstelling werd bereikt
door het uitvoeren van een systematische review en meta-analyse die in Hoofdstuk 7
wordt behandeld. Kort samengevat hebben we een reviewprotocol gevolgd dat we
hadden ontwikkeld en geregistreerd op het International Prospective Register of
Systematic Reviews (PROSPERO) onder registratienummer CRD42018082702. We
hebben databases doorzocht om artikelen te identificeren die rapporteren over T.
vaginalis en HIV-infectie, die we hebben opgenomen in de systematische review en meta-
analyse.
We identificeerden 18 peer-reviewed publicaties en één conferentie-abstract die in
aanmerking kwamen voor opname. Bij kwalitatieve synthese en meta-analyse vonden we
dat infectie met T. vaginalis de kans op HIV-infectie verhoogde met een hazard ratio van
1.47 (95% CI, 1.25-1.72; p < 0.001). T. vaginalis is een belangrijke factor bij de verwerving
van HIV, vooral in sub-Sahara Afrika, waar de prevalentie van T. vaginalis hoog is.
Diagnose en behandeling van T. vaginalis-infecties bij zowel hoog-risico en laag-risico
populaties kunnen een mogelijk hulpmiddel zijn om het aantal nieuwe HIV-infecties te
verminderen.
Toekomstperspectieven: Momenteel worden er nieuwe hulpmiddelen geïntroduceerd

om nieuwe HIV-infecties te verminderen, waarvan de belangrijkste bestaat uit Pre-
Exposure Profylaxe (PREP)-medicatie bij personen met een hoog risico [18].
Toekomstige studies, voornamelijk onder individuen op PREP-medicatie, kunnen licht
werpen op de vraag of infectie met T. vaginalis een factor blijft die geassocieerd is met
een verhoogde kans op HIV-verwerving. Een ander opkomend interessegebied voor
toekomstige studies is de mogelijke invloed van PREP op de selectie van resistente HIV-
stammen en de rol van diagnose en behandeling van T. vaginalis als middel om de
verwerving van deze resistente HIV-stammen te verminderen. Ook zijn er voor individuen
die met HIV zijn geïnfecteerd, veranderingen in de behandeling. De
Wereldgezondheidsorganisatie beveelt momenteel de ‘testen behandel’ aanpak aan,
die erin bestaat om iedereen die gediagnosticeerd is met HIV onmiddellijk na de diagnose
184
Chapter Nine
te behandelen, en die gericht is op het onderdrukken van de virale lading van het HIV-
virus, waardoor de kans kleiner wordt dat geïnfecteerde personen HIV doorgeven [18] .
In een nieuwe context waarbij de meeste mensen met HIV onder behandeling staan,
kunnen toekomstige studies de genitale virale shedding van HIV onderzoeken bij
individuen die tegelijkertijd geïnfecteerd zijn met T. vaginalis en die al vroeg HIV-
behandeling krijgen.
Tenslotte, maar niet in het minst, kunnen toekomstige studies ook evalueren of er
behoefte is aan een speciale dosering voor de behandeling van T. vaginalis bij individuen
die vroeg op HIV-behandeling worden gezet, aangezien er momenteel een suggestie is
dat 2 g enkelvoudige orale dosis metronidazole niet zo effectief is als 500 mg
metronidazol tweemaal daags gedurende 7 dagen bij met HIV-geïnfecteerde vrouwen
[19], iets wat mogelijk wordt beïnvloed door het tijdstip waarop personen met een HIV-
behandeling starten.
185
Chapter Nine
9 References
1. Masha SC, et al. High prevalence of curable sexually transmitted infections among pregnant
women in a rural county hospital in Kilifi, Kenya. PloS One. 2017; 12(3):e0175166.
2. Mullick S, et al. Sexually transmitted infections in pregnancy: prevalence, impact on
pregnancy outcomes, and approach to treatment in developing countries. Sex Transm Infect.
2005;81(4):294-302.
3. Mati JK, et al. The Nairobi birth survey 1. the study design, the population and outline results.
J Obst Gynaec East Centr Afr. 1982;1(4):132-9.
4. Pettifor A, et al. How effective is syndromic management of STDs?: A review of current
studies. Sex Transm Dis. 2000;27(7):371-85.
5. Fonck K, et al. Validity of the vaginal discharge algorithm among pregnant and non-pregnant
women in Nairobi, Kenya. Sex Transm Infect. 2000;76(1):33-8.
6. Mudau M, et al. High prevalence of asymptomatic sexually transmitted infections among
human immunodeficiency virus-infected pregnant women in a low-income South African
community. Int J STD & AIDS. 2018;29(4):324-33.
7. Garber GE. The laboratory diagnosis of Trichomonas vaginalis. Can J Infect Dis Med
Microbiol. 2005;16(1):35-8.
8. Stringer E, et al. Treatment of trichomoniasis in pregnancy in sub-Saharan Africa does not
appear to be associated with low birth weight or preterm birth. South African Med J.
2010;100(1):58-64.
9. Klebanoff MA. Counterpoint: Screening for trichomoniasis-where's the evidence of benefit?
Clin Chem. 2014;60(1):155-7.
10. Brolan CE, et al. Did the right to health get across the line? Examining the United Nations
resolution on the Sustainable Development Goals. BMJ Global Health. 2017;2(3):e000353.
11. Unemo M, and Shafer WM. Antimicrobial Resistance in Neisseria gonorrhoeae in the 21st
Century: Past, Evolution, and Future. Clin Microb Rev. 2014;27(3):587-613.
12. Waruiru W, et al. The Kenya AIDS Indicator Survey 2012: rationale, methods, description of
participants, and response rates. J Acq Imm Def Synd. 2014;66 Suppl 1:S3-12.
13. Kenya AIDS response progress report 2016 [cited 2018 22 June ]; Available from:
http://nacc.or.ke/wp-content/uploads/2016/11/Kenya-AIDS-Progress-Report_web.pdf.
14. Crucitti T, et al. Molecular typing of the actin gene of Trichomonas vaginalis isolates by PCR-
restriction fragment length polymorphism. Clin Microb Infect. 2008;14(9):844-52.
15. Fichorova RN, et al. Endobiont viruses sensed by the human host - beyond conventional
antiparasitic therapy. PloS One. 2012;7(11):e48418.
16. Khoshnan A, Alderete JF: Trichomonas vaginalis with a double-stranded RNA virus has
upregulated levels of phenotypically variable immunogen mRNA. J Virol. 1994;68(6):4035-38.
17. Provenzano D, et al. Involvement of dsRNA virus in the protein composition and growth
kinetics of host Trichomonas vaginalis. Arch Virol. 1997;142(5):939-52.
18. Guideline on When to Start Antiretroviral Therapy and on Pre-Exposure Prophylaxis for HIV.
World Health Organization. 2015.
Available at http://www.who.int/hiv/pub/guidelines/earlyrelease-arv/en/
19. Kissinger, P., et al. A randomized treatment trial: single versus 7-day dose of metronidazole
for the treatment of Trichomonas vaginalis among HIV-infected women. J Acquir Immune
Defic Syndr. 2010;55(5):565-71
186
Curriculum vitae
187
Curriculum vitae
SIMON CHENGO MASHA

Mobile phone no: +254723750847
Email: schengo@gmail.com
PERSONAL INFORMATION
Nationality: Kenyan
Date and place of birth: 15-October-1983, Nairobi, Kenya
Gender: Male
Personal statement
Highly motivated and enthusiastic researcher with specific focus on sexual and
reproductive health research. Currently finalizing my doctorate studies in the lab of
Prof. Dr. Mario Vaneechoutte at Ghent University. My research interest are in the
epidemiology of sexually transmitted infections and use of molecular tools to better
understand host pathogen interactions.
Education
Doctor of Philosophy in Health Sciences 2014 up to now
Trichomonas vaginalis infection among pregnant women in Kilifi, Kenya
Master of Science - Molecular Biology - Human health option 2011 - 2013

Free university of Brussels, Belgium
Dissertation on application of real-time PCR for the detection of macrolide resistance
Mycoplasma pneumoniae in Belgian isolates.
Bachelor of Science - Medical Laboratory Science

2004 - 2008
Jomo Kenyatta University of Agriculture and Technology, Kenya
Ghent University Doctoral School Courses

x Cochrane systematic review (Chochrane Belgium) 2017
x Advanced Academic English: Writing Skills &Conference Skills 2016
x Dealing with the media as a researcher 2015
x Leadership Foundation Course 2015
Additional training
x Teaching and Pedagogy (KWTRP/Oxford University) 2016
x MSM Sensitivity Training Course (MARPs Africa) 2015
x Protection of Human Research Participants (NIH) 2014
x Research with Data/Laboratory Specimens(CITI) 2010
188
Curriculum vitae
Professional experience
Visiting doctoral researcher - KEMRI-Wellcome Trust Kilifi 2014 up to now
x Principal investigator for a study on sexually transmitted infections among
pregnant women in Kilifi, Kenya.
x Key responsibilities include, research team leader, proposal development, grant
application, study design, data collection, analysis, and dissemination of results
Assistant lecturer - Pwani University, Kilifi Kenya 2016 up to now

x Teaching and accessing the following courses: Introduction to epidemiology,
bacteriology, microbial genetics, and medical microbiology
x Supervising bachelors (6) and masters (1) research theses.
Research projects
2010 International center for reproductive health - Laboratory personnel
2009 Population Service International ‘Tunza” - Family planning survey
2009 Mildmay International - Evaluation of acceptance of the HIV basic care kit
2009 African Population Health Research Center- Early childhood education evaluation
2009 Population Services International - HIV survey
2008 Family Health International- survey on orphans and vulnerable children
Hard skills
x Proficiency in both English and Kiswahili
x Advanced data analysis skills using STATA
x Advanced scientific writing
x Intermediate competence on Review Manager
Fellowships and Awards

2018 Winner, I am a scientist get me out of here (Kilifi, Kenya)
2017 Research grant (5,000 $) - Pwani University
2016 Travel grant to present at the 17th International union against sexually transmitted
infections world congress
2014 Research grant (12,000 $) - International AIDS Vaccine Initiative-USAID
2014 PhD scholarship awarded by the Belgian government through VLIR-UOS
2011 Masters in scholarship awarded by the Belgian government through VLIR-UOS
Presentations at conferences and scientific meetings

2018 International union against sexually transmitted infections World & European
Congress, Dublin, Ireland
2017 University of Washington Annual STI Collaborators Meeting Mombasa, Kenya.
2016 ION World Clinical Solutions, Nairobi, Kenya.
2016 17th International union against sexually transmitted infections world congress in
Marrakech, Morocco.
189
Curriculum vitae
Selected articles in-peer review/published
x Masha SC, Owuor C, Ngoi JM, Cools P, Sanders EJ, Vaneechoutte M, Crucitti T, de
Villiers EP. Comparative analysis of the vaginal microbiome of pregnant women with
either Trichomonas vaginalis or Chlamydia trachomatis (In review BMC Microbiome).
x Masha SC, Cools P, Sanders EJ, Vaneechoutte M, Crucitti T. Trichomonas vaginalis

and HIV infection acquisition. A systematic review and meta-analysis (In review BMJ
STI).
x Masha SC, Cools P, Descheemaeker P, Reynders M, Sanders EJ, Vaneechoutte M.

Urogenital pathogen correlates of Trichomonas vaginalis among pregnant women in
Kilifi, Kenya (In review; BMC Infectious diseases).
x Masha, SC, Wahome, E. Vaneechoutte, M., Cools, P., Crucitti, T., Sanders, E. J.
High prevalence of curable sexually transmitted infections among pregnant women
in a rural county hospital in Kilifi, Kenya. PloS One. 2017; 12:e0175166.
x Masha SC, Cools P, Crucitti T, Sanders EJ, Vaneechoutte M: Molecular typing of

Trichomonas vaginalis isolates by actin gene sequence analysis and carriage of T.
vaginalis viruses. Parasites & Vectors. 2017;10(1):537.
Current membership
x Rotary Club of Kilifi
x Friends of Kilifi District Hospital Trust
x International Union against Sexually Transmitted Infections
Hobbies: Basketball, Football, Dancing

Referees available upon request
190
Acknowledgments
“If I have seen further than others, it is by standing upon the shoulders of giants”
Isaac Newton
191
Acknowledgments
Undertaking this Ph.D. has been a truly life-changing experience for me, and it would not
have been possible to accomplish without the support and guidance that I received from
many brilliant people.
I am much indebted to Dr. Piet Cools; you were God sent, part of the reason I decided to
make an application for a Masters in Molecular Biology in Belgium, a country I knew
nothing about, was from our interactions at the lab in Mombasa. The masters laid the
foundation for this enormous opportunity to further my education. Thanks for all the
collaborations we have had and the mentorship.
I remember you introducing me to Prof. Mario in 2012 a Prof full of humor who would go
on to be my Ph.D promotor.I will forever remain grateful to you Mario for granting me the
opportunity to carry out my doctoral work under your promotorship at your lab. Thanks for
the chance to pursue my interest and to support me in this, thanks for the many moments
of reflection and the help with analysis and discussions, thanks for the possibility of many
publications. Thanks for the inspiration and for sharing your extensive and critical
knowledge about bacteria. But notably, thanks for creating an excellent atmosphere at
the lab and making Ghent and LBR in particular feel like at home.
Many thanks to Prof. Eduard a real blessing, for when the light on this candle was almost
being blown out earlier on in this Ph.D. journey you stepped in and covered me from the
strong winds and sheltered me in your research stable. Agreed to be my local promotor,
shared with me your epidemiological knowledge and mentorship.
I am immensely grateful to Dr. Tania for the promotorship, thanks for sharing your
immense knowledge and literature on Trichomonas and the mentorship.
My sincere appreciation goes out to my research team members in Kilifi: Asante sana
Scholastica Kioko, Peris Kopulo, Margaret Nafuna Makhisa, Racheal Mwarumba Dama,
Emmah Bahati, Beatrice Moraa Obwoge, Emily Bochaberi Ongwae, Hella Mnyazi and
Christine Mwanake. Equally, I would like to heartily thank all study participants without
whom this dissertation would not have been possible.
Laboratory Bacteriology Research Merci to Mario, Piet, Maia, Hans, Jonas, Tessa,
Antonio, Aliona, and Abel for the excellent atmosphere at the lab and beyond. Special
192
Acknowledgments
thanks to Leen, for taking your time to help with various aspects of my work. Thank you
all for lunches, drinks both at the office and out of the office, and the friendship. Yes, I
said at the office-.
I sincerely thank both Dr. Patrick Descheemaeker and Dr. Marijke Reynders for the
collaboration and co-authorship.
Shukran zangu za thati kwa wafuatao kutoka shirika la KEMRI Wellcome Trust Kilifi
wakiongozwa na mkurugenzi wa idara ya mafunzo Shukran sana; Dr. Sam Kinyanjui,
Prof. Dr. Eduard J. Sanders, Caroline Ngetsa, John Mwambi, Lucie Ikumi, Keith Kipoto,
Elizabeth Wahome, Dr. Jimmy Shangala, Dr. Murugi Micheni, Collins David, Dr. Etienne
P. de Villiers, Joyce Mwongeli, Rita Baya, Elizabeth Murabu, Moses Kiti Chapa, Alex
Mutuku and the entire IAVI group. My sincere gratitude to my mentor Prof. Olubayi
Olubayi.
I would also like to say a heartfelt thank you to my mum, sister, brothers, cousins,
grandmothers, workmates, and friends for always believing in me and encouraging me to
follow my dreams.
To my funders VLIR-UOS (Belgian Government) this dissertation would not have been
possible without the Ph.D. scholarship funding from you and for that I will always remain
grateful. Thanks to Micheline D'hooge who has been administering this scholarship. I am
equally grateful to USAID for the funding I received through the International AIDS
Vaccine Initiative, for GeneXpert® test for chlamydia and gonorrhea.
I acknowledge the several friends and well-wishers, whom I have not mentioned above
and whose best wishes have always encouraged me.
In keeping with the tradition save the best for last: My lovely wife, “Kichuna,” my ever-
present member in my think tank, you have been by my side throughout this Ph.D., living
every single minute of it, how would this have been possible without you? Thanks for all
the reminders, discussions and consolations!
Above all, I thank the almighty God who has been with me and showers his blessings and
grace towards me in all walks of my life.
193

Simon C Masha - PHD Dissertation

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Simon C Masha - PHD Dissertation

Uploaded by

Copyright:

Available Formats

Trichomonas vaginalis infection among pregnant women

Simon Chengo Masha

Dissertation submitted in partial fulfilment of the requirements

Academic year: 2017 – 2018

To the loving memory of my father

Simon Chengo Masha was supported with a PhD Scholarship

Cover image: iStock by Getty Images

Prof. Dr. Mario Vaneechoutte

Prof. Dr. Eduard J. Sanders

Dr. Tania Crucitti

Prof. Dr. Joris Delanghe (president)

Prof. Dr. Bruno Levecke (secretary)

Dr. Jaco J. Verweij

Prof. Steven Callens

Prof. Dr. An De Sutter

Dr. Stefan Heytens

aHR Adjusted hazard ratio

1 Curable sexually transmitted infections

1.1 Scope of the problem

Reprinted from reference [1].

1.2 Trichomonas vaginalis

Trichomonas vaginalis is a parasitic protozoan and the causative agent of trichomoniasis,

1.2.2 Taxonomic classification

x Domain: Eukarya – larger, more complex cells with a nucleus.

Figure 1.1 Morphology of Trichomonas vaginalis

Table 1. 3 Summary of Trichomonas vaginalis typing techniques and main results

Authors year [Ref.] Basis of typing technique Main results

Authors year [ref] Basis of typing technique Main results

Alternative gel-based methods, such as the restriction fragment length polymorphism

1.2.5 Life cycle and transmission

Sexual transmission is the main mode of transmission, although non-sexual transmission

Other possibilities of non-sexual transmission have been suggested to occur through

1.2.6 Pathogenesis and clinical manifestations

Many mechanisms are thought to be involved in T. vaginalis pathogenesis and these

T. vaginalis is a free-living protozoan that can colonize mucosal epithelial surfaces.

trichomoniasis [6]. Vaginal infections including T. vaginalis were reported to be significant

1.2.7 Diagnosis and detection

Diagnosis of T. vaginalis infection may be achieved by clinical syndromic diagnosis and/or

positivity is assessed by microscopy of a slide prepared from a drop of the culture

D. Nucleic acid amplification tests (NAATs)

A growing strength of NAATs is ability to multiplex enabling a single specimen to be

N. gonorrhoeae, Mycobacterium tuberculosis, further sharing the instrumentation costs.

Table 1.4 Current recommended regimens for treatment of Trichomonas vaginalis

Regimen ASHA_2017 BASHH_2014 CDC_2015 WHO_2001

1.2.9 Prevalence of T. vaginalis

To generate a brief overview of the current prevalence of T. vaginalis infection in various

Table 1.5 Current prevalence of Trichomonas vaginalis

Ref. Authors & Year of Study population TV Prevalence of

[81] Garrett et al. 2016-2017 Women attending Immunologic 3.0

Ref Authors & Year of Study population TV Prevalence of

Some professions, such as military personnel, bar-maids/waiters, commercial sex

Objective 2. Classical screening of STIs is frequently only oriented towards the

Objective 5. Individuals infected with T. vaginalis are thought to be at an increased risk

High prevalence of curable sexually

23(1 $&&(66 Abstract

Received: December 16, 2016 Methods

Data Availability Statement: All relevant data are Results

PLOS ONE | https://doi.org/10.1371/journal.pone.0175166 March 31, 2017 1 / 16

Competing interests: The authors have declared Conclusion

PLOS ONE | https://doi.org/10.1371/journal.pone.0175166 March 31, 2017 2 / 16

PLOS ONE | https://doi.org/10.1371/journal.pone.0175166 March 31, 2017 3 / 16

Characteristics of the study population

Prevalence of curable STIs, BV, HIV and syphilis