Toxicology Letters 217 (2013) 14–22

Contents lists available at SciVerse ScienceDirect

Toxicology Letters
journal homepage: www.elsevier.com/locate/toxlet

Chlorpyrifos and its metabolites alter gene expression at non-cytotoxic

concentrations in D3 mouse embryonic stem cells under in vitro differentiation:
Considerations for embryotoxic risk assessment
Carmen Estevan ∗ , Eugenio Vilanova, Miguel A. Sogorb
Instituto de Bioingeniería, Universidad Miguel Hernández de Elche, Spain

h i g h l i g h t s

 Chlorpyrifos and its metabolites alter gene expression in mouse embryonic stem cells.
 Chlorpyrifos and its metabolites alter gene expression at non-cytotoxic concentrations.
 Chlorpyrifos and its metabolites alter pluripotency of mouse embryonic stem cells.
 Chlorpyrifos and its metabolites alter differentiation of three embryonal lineages.
 Chlorpyrifos might alter differentiation without detectable maternal toxicity.

a r t i c l e i n f o a b s t r a c t

Article history: The effects of organophosphate insecticide chlorpyrifos (CPF) on development are currently under dis-
Received 26 September 2012 cussion. CPF and its metabolites, chlorpyrifos-oxon (CPO) and 3,5,6-trichloro-2-pyridinol (TClP), were
Received in revised form more cytotoxic for D3 mouse embryonic stem cells than for differentiated fibroblasts 3T3 cells. Exposure
27 November 2012
to 10 ␮M CPF and TClP and 100 ␮M CPO for 12 h significantly altered the in vitro expression of biomark-
Accepted 29 November 2012
ers of differentiation in D3 cells. Similarly, exposure to 20 ␮M CPF and 25 ␮M CPO and TClP for 3 days
Available online 7 December 2012
also altered the expression of the biomarkers in the same model. These exposures caused no significant
reduction in D3 viability with mild inhibition of acetylcholinesterase and neuropathy target esterase by
Keywords:
Chlorpyrifos
CPF and severe inhibition by CPO. We conclude that certain in vivo exposure scenarios are possible, which
Chlorpyrifos-oxon cause inhibition of acetylcholinesterase but without clinical symptoms that reach high enough systemic
Embryonic stem cell CPF concentrations able to alter the expression of genes involved in cellular differentiation with poten-
Differentiation tially hazard effects on development. Conversely, the risk for embryotoxicity by CPO and TClP was very
Risk assessment low because the required exposure would induce severe cholinergic syndrome.
© 2012 Elsevier Ireland Ltd. All rights reserved.

Abbreviations: Ache, acetylcholinesterase (gene); AChE, acetylcholinesterase (protein); Afp, ␣-fetoprotein; CPF, chlorpyrifos (O,O-diethyl O-(3,5,6-trichloro-2-
pyridinyl) phosphorothioate); CPO, chlorpyrifos-oxon (O,O-diethyl O-(3,5,6-trichloro-2-pyridinyl) phosphate); DEPC, diethylpyrocarbonate; DMEM, Dulbecco’s Modified
Eagle’s Medium; ECx, concentration needed to cause a reduction in cell viability of X%; EST, Embryonic Stem cell Test; Flk1, foetal liver kinase 1; IC50, concentration needed
to inhibit the enzymatic activity by 50%; LIF, leukaemia inhibition factor; Mhc, myosin heavy chain; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide;
Nanog, nanog homeobox; Nefm, neurofilament medium polypeptide; Nes, nestin; NTE, neuropathy target esterase; OP, organophosphorus compound; PBS, phosphate buffered
saline; Pnpla6, patatin-like phospholipase domain containing 6; PV, phenyl valerate; qRT-PCR, quantitative real-time PCR; TClP, 3,5,6-trichloro-2-pyridinol; TLV, Threshold
Limit Value.
∗ Corresponding author at: Instituto de Bioingeniería, Universidad Miguel Hernández de Elche, Avenida de la Universidad s/n, 03202 Elche, Spain. Tel.: +34 966658821;
fax: +34 966658511.
E-mail address: cestevan@umh.es (C. Estevan).

0378-4274/$ – see front matter © 2012 Elsevier Ireland Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.toxlet.2012.11.026
 C. Estevan et al. / Toxicology Letters 217 (2013) 14–22
1. Introduction
Chlorpyrifos (CPF) is an organophosphorus compound (OP) used
to control insect pests which has been used for almost 40 years.
CPF is not authorised for household applications by the USEPA
since 2002 (USEPA, 2000) and by the European Commission since
2005 (European Commission, 2005). In the latter case however, it
is included in Annexe I to Directive 91/414/EEC for plant protection
products (European Communities, 1991).
The CPF metabolism consists in the oxidative desulphuration
of the P S group to form chlorpyrifos-oxon (CPO). This reaction is
catalysed by cytochrome P450, mainly in the liver, and the oxidised
form of OPs (in our case CPO) is always more powerful for inhibiting
acetylcholinesterase (AChE)1 and neuropathy target esterase (NTE)
than the reduced form (in our case CPF) (WHO, 1986). CPO can be
further chemically or enzymatically deactivated by hydrolysis with
the release of diethylphosphate and 3,5,6-trichloro-2-pyridinol
(TClP). Furthermore, the oxidative dearylation of CPF to directly
release TClP and diethylthiophosphate can also occur in the liver
and represents an alternative detoxification pathway (Sogorb and
Vilanova, 2010).
CPF is able to induce the well-known cholinergic syndrome,
caused by inhibition of AChE, and organophosphorus-induced
delayed polyneuropathy, caused by inhibition of NTE (Jokanovic
and Kosanovic, 2010). CPF also causes other neurological impair-
ments, such as long-term spatial learning dysfunctions (Cañadas
et al., 2005), which are probably related to loss of dendrite and
spine processes in both the hippocampus and prefrontal cortex
(Ruiz-Muñoz et al., 2011).
There is no consistent evidence for CPF’s capacity to induce ter-
atogenicity with exposures below those required to cause maternal
toxicity (Eaton et al., 2008). However, there is contradictory infor-
mation on the capability of CPF to cause neurodevelopmental
toxicity since many in vivo studies have reported such effects on
exposures causing decreases in brain AChE, while other studies
have indicated effects at dose levels which do not cause any appar-
ent AChE inhibition (Eaton et al., 2008). Indeed, Slotkin et al. (2006)
have suggested that there is a complete dichotomy between the
systemic toxicity of OPs and their capability to cause develop-
mental neurotoxicity. These data suggest that it is necessary to
assess the risk of exposure to CPF during development by espe-
cially considering that exposure occurs in the general (not only in
an occupationally exposed) population as an epidemiological study
has shown that CPF displayed a prevalence of 11% in meconium at
a mean concentration of 53 ppm (Ostrea et al., 2002).
CPF undergoes intensive biotransformation in live organisms,
mainly the liver. Therefore, it remains unclear if the chemi-
cal responsible for the above-stated effects is the same CPF or
some of its metabolites (CPO or TClP). In vitro studies have
demonstrated that oxidised forms of OPs, such as CPO, display
greater capability (up to 1000 times) to disrupt a number of
neurodevelopmental processes such as neuronal proliferation and
differentiation, gliogenesis and apoptosis through direct interfer-
ence with the morphogenic activity of AChE, receptors and cell
signalling molecules and cytoskeletal proteins (Flaskos, 2012).
Embryotoxicity can be studied in vitro using the Embryonic Stem
cell Test (EST). This methodology is successfully validated and,
as endpoints, it employs the relationships between the cytotoxi-
city induced by the assessed compound in 3T3 mouse fibroblasts
1
In this manuscript we quote the abbreviations for the genes italicised with the
first letter in the upper case and all the other letters in the lower case. Therefore,
the term Ache (italicised) is used to quote the gene codifying for the protein acetyl-
cholinesterase, while the term AChE (non-italicised with the upper and lower case in
the word) is used to quote the protein acetylcholinesterase or its enzymatic activity.
15
(used as a differentiated cells model) and in D3 mouse embryonic
stem cells and the capability of the compound to alter the spon-
taneous differentiation of D3 cells into beating cardiomyocytes
(Genschow et al., 2004). Nevertheless, the EST needs to be improved
by using molecular endpoints for studying alterations in differen-
tiation (Spielmann et al., 2006). In this way, gene expression has
proved a good endpoint to be implemented within conventional
EST (Romero et al., 2011). Specifically, ␣-fetoprotein (Afp) (Romero
et al., 2011; Pamies et al., 2010a) and nestin (Nes) have already
been found suitable for testing embryotoxicity by monitoring their
expression, but there are other genes like the patatin-like phospho-
lipase domain containing 6 (Pnpla6), the codifying gene for NTE,
which seem to play a prominent role in the differentiation of D3
cells (Pamies et al., 2010b) and might, therefore, be good candidates
for embryotoxicity testing.
In this work, we studied the effects of CPF and its metabolites,
CPO and TClP, on D3 mouse embryonic stem cells under sponta-
neous differentiation after short- (12 h) and mid- (3 days) term
exposure using the gene expression of biomarkers of differentia-
tion of the three main embryonic lineages and the gene expression
of biomarkers of pluripotency. Most tested genes have previously
proven their capability to predict embryotoxicity (Romero et al.,
2011; Pamies et al., 2010a). Our main aim was to estimate the risk
of embryotoxicity to exposure to CPF and we conclude that in cer-
tain scenarios, exposure to CPF could be enough to become a matter
of concern.
2. Materials and methods
2.1. Chemicals
CPF (O,O-diethyl O-(3,5,6-trichloro-2-pyridinyl) phosphorothioate) and TClP
(3,5,6-trichloro-2-pyridinol) were purchased form Sigma–Aldrich Spain with
purities of 99.5% and 98.8%, respectively. CPO (O,O-diethyl O-(3,5,6-trichloro-2-
pyridinyl) phosphate) was obtained from Dr. Ehrenstorfer with a purity of 98%.
All the other chemicals, materials for cell culture or molecular biology manage-
ments were attained from Sigma–Aldrich Spain, Roche or local suppliers, and were
of analytical grade.
2.2. Cell cultures and exposures
Cells were exposed to all chemicals during either 12 h or 3 days. Twelve hours
was chosen since this is the earliest point were the expression of the biomarkers
genes could be measured with acceptable accuracy. Indeed, the expression of most
of the tested genes could not be detected after only 10 h of differentiation (data not
shown).
2.2.1. D3 mouse embryonic stem cells
D3 mouse embryonic stem cells were obtained from the American Type Cul-
ture Collection (Rockville, MD, USA). These cells were firstly isolated from the inner
cellular mass of a 129/Sv mouse blastocyst on day 4 of gestation. D3 cells were
grown on monolayers in an undifferentiated state on 75-mm plates in Dulbecco’s
Modified Eagle’s Medium (DMEM) supplemented with 15% heat-inactivated foetal
calf serum, 1% non-essential amino acids, 50 units of penicillin/ml, 100 ␮g strepto-
mycin/ml, 0.1 mM ␤-mercaptoethanol and 1000 units of leukaemia inhibition factor
(LIF)/ml. Undifferentiated cells were incubated at 37 ◦ C in an atmosphere with 1.5%
CO2 and 95% humidity. For culturing D3 cells under spontaneous differentiation, LIF
was removed from the medium culture and the CO2 concentration was increased to
5%.
D3 undifferentiated cells were seeded in P100 Petri dishes at a density of
2 × 106 cells/dish (to record gene expression) or in 96-well plates at a density of
2 × 105 cells/well (for cell viability tests and to test the effects on NTE enzymatic
activities). Afterwards, LIF was removed from the media in order to trigger differen-
tiation, and fresh CPF, CPO and TClP ranging between 10 and 1200 ␮M were added to
the media. The exposure performed under differentiation conditions was prolonged
to 12 h.
Similar experiments were performed by prolonging differentiation and expo-
sure for 3 days and by seeding cells at a density of 4 × 105 cells/dish in P100 Petri
dishes (to record gene expression) or 3.5 × 104 cells/well in 96-well plates well (for
cell viability tests and to test the effects on AChE and NTE enzymatic activities). The
CPF, CPO and TClP concentrations ranged between 20 and 300 ␮M, the media of the
cells exposed to CPO and their correspondent controls were renewed daily, and the
media of the cells exposed to CPF and TClP was left unchanged for 3 days.
16 C. Estevan et al. / Toxicology Letters 217 (2013) 14–22
2.2.2. 3T3 fibroblast
Non-tumourigenic 3T3 fibroblast cells Balb/c clon A31 cells were also obtained
from the American Type Culture Collection (Rockville, MD, USA) and were grown on
monolayers on 75-mm plates in DMEM medium supplemented with 10% foetal calf
serum, 50 units of penicillin/ml and 100 ␮g streptomycin/ml. Cells were incubated
at 37 ◦ C in an atmosphere with 5% CO2 and 95% humidity until 95% confluence.
Before starting, exposure cells were seeded on 96-well plates at a density of
2 × 104 cells/well, and CPF, CPO and TClP ranging between 20 and 200 ␮M were
freshly added to the cell media by prolonging exposure to 12 h before testing cell
viability. Similar experiments were done by prolonging exposure to 3 days, and by
seeding cells at a density of 1.5 × 104 cells/well and using CPF, CPO and TClP ranging
between 10 and 700 ␮M. In the case of cells exposed during 3 days the CPO content
was daily refreshed because it is extensively degraded (see Section 3.1). Media of
cells serving as control to CPO-exposed cells was also daily renewed. The media of
TClP- and CPF-exposed cells and their respective controls were not renewed during
the 3 days of exposure.
2.3. Degradation of compounds in the culture system
It is well known that OPs can be degraded in mammal serum; the D3 and 3T3
culture media contained up to 15% of foetal calf serum. Therefore, in order to check
the stability of CPF and CPO in culture media, we prepared solutions of 700, 400 and
200 ␮M CPF in fresh culture media for D3 cells and we incubated the solutions for
72 h at 37 ◦ C by extracting aliquots every 24 h. The same procedure was applied for
CPO, but 700, 500 and 100 ␮M solutions were used and aliquots were extracted at 1,
2, 4, 6, 8 and 24 h. One millilitre of each aliquot was acidified with 0.25 ml of 2 M HCl,
and CPF and CPO were extracted with 2 ml of dichloromethane (containing 20 ␮M
naphthol as an inner standard) for 30 min. At the end of the process, an organic
layer was separated from the watery layer by centrifugation at 3000 rpm for 5 min.
Finally, 2 ␮l of dichloromethane were injected into a GC–MS system for the further
analysis of residual CPF, CPO and TClP.
Chromatographic separation was performed with a ZB-Multiresidue-1 (Zebron)
column with a length of 30 m, and inner diameter of 0.25 mm and a film thickness of
0.25 ␮m. The gas carrier was He, the injector temperature was 250 ◦ C, the total flow
was 24 ml/min and the injections mode was splitless. The temperature programme
included a gradient from 50 to 250 ◦ C with a rate of 40 ◦ C/min and a 2-min final step at
constant temperature. Under these conditions, the elution times for TClP, naphthol,
CPO and CPF were 4.87, 5.09, 6.83 and 6.86 min, respectively (see Supplementary
Data 1 and 2 for examples of chromatograms).
Residual TClP, CPF and CPO was quantified by recording the mass spectrometric
signal in the single ion mode for m/z = 144 (for the inner standard naphthol), 169
and a197 (for TClP), 197 and 270 (for CPO) and 197 and 314 (for CPF). The area of
each peak (normalised against the inner standard area) was compared with the area
of the standard solutions of known concentrations prepared in water, which were
extracted, chromatographed and quantified in exactly the same way as the samples
incubated with the D3 cell culture media. The limits of detection recorded for these
conditions were 12, 10 and 16 ␮M for CPF, CPO and TClP, respectively.
2.4. Cell viability tests
Cell viability and cytotoxicity were assayed with the 3-(4,5-dimethylthiazol-
2-yl)-2,5-diphenyltetrazoliumbromide (MTT) test. The MTT test is based on the
colorimetric determination of the formazan formed in the mitochondria from the
MTT used as a substrate. The amount of formazan formed is directly related to the
amount of viable cells present in the media since it is an indication of both mito-
chondrial integrity and the level of functionality of mitochondrial dehydrogenases.
D3 under differentiation and 3T3 were exposed to CPF, CPO and TClP for 12 h or
3 days, as described in Section 2.2. Afterwards, chemicals were removed and cells
were incubated with 200 ␮l of MTT solution (1 mg/ml) for 3 h. After this period, MTT
was removed and cells were washed with phosphate buffered saline (PBS). Finally,
200 ␮l dimethylsulphoxide/well were added to each well to lysate cells and to solve
the formazan formed in the mitochondria. Formazan absorbance was determined in
a Beckman Coulter AD340 microplate reader by recording absorbance at 540 nm and
by correcting the background absorbance with records at 690 nm. Each condition
was assayed in 12 independent wells. Absence of cytotoxicity (100% viability) was
attributed to the controls, and the results were presented as a percentage of these
controls. EC20 , EC50 and EC80 were estimated as the concentrations of CPF, CPO or
TClP causing reductions in cell viability of 20%, 50% and 80%, respectively.
2.5. Molecular biology
2.5.1. RNA extraction
Cells were exposed to CPF, CPO and TClP for 12 h or 3 days as described in
Section 2.2. Afterwards cells were trypsinised and pelleted by centrifugation in
a 1-ml Eppendorf tube. One millilitre of Tripure isolation solution (guanidinium
thiocyanate) was added to the Eppendorf tube at room temperature with further
shaking for 10 s to detach cells and pipetting to mix all the components. Once the
mixture was homogeneous, it was kept for 5 min at room temperature to favour
the cellular lysate. Afterwards, 200 ␮l of chloroform were added with shaking
until a pink colour appeared. Then after another 10-min rest at room temperature,
centrifugation (12,000 × g, 15 min, 4 ◦ C) was applied to obtain RNA in the upper
(colourless) phase. This phase was collected and transferred to a new Eppendorf
tube for RNA precipitation by adding 500 ␮l of isopropanol at −20 ◦ C, shaking for
20 s and incubating for at least 3 h at −20 ◦ C. After RNA precipitation, the mixture
was centrifuged (12,000 × g, 10 min, 4 ◦ C) and the pellet was washed with 1 ml
ethanol (75%, v/v) at −20 ◦ C centrifuging (12,000 × g, 5 min, 4 ◦ C). The supernatant
was finally discarded and the pellet was dried for 3 min at room temperature with
further homogenisation in 25 ␮l of 0.1% (w/v) diethylpyrocarbonate (DEPC) water.
Finally, the tube containing RNA was incubated at 55–60 ◦ C for 15 min and stored
at −80 ◦ C until use. RNA was quantified and its purity was determined according to
the 260/280 nm optical density ratio by spectrophotometry (Biowave II WPA).
2.5.2. RNA retrotranscription
The extracted RNA was reverse-transcribed using the Expand Reverse Tran-
scriptase kit and oligo-dT primers (Roche) according to the supplier’s indications.
The reaction mixture contained 10 ␮M polydT and 1 ␮g of RNA in a final volume
of 10.5 ␮l of DEPC water. This mixture was heated for 10 min at 65 ◦ C in a Veriti
96-well thermal cycler (Applied Biosystems) to bind polydTs to the tails of polyA
present in messenger RNAs. Afterwards, the following components were added to
the mixture: 2 ␮l of 100 mM dithiothreitol, 2 ␮l of 10 mM dNTPs, 4 ␮l of buffer for
Expand Reverse Transcriptase, 0.5 ␮l of RNAase inhibitor (Roche) and 1 ␮l (50 units)
of RNA Expand Reverse Transcriptase. This resulting mixture was further heated at
37 ◦ C for 60 min with a final 5-min step at 93 ◦ C in the thermal cycler.
The quality of cDNA was checked by amplifying the cDNA for ␤-actin by PCR and
by running the PCR product in the Agilent 2100 bioanalyzer (Agilent Technologies).
It yielded a single DNA fragment of 120 bp corresponding to ␤-actin (Supplementary
Data 3).
2.5.3. Quantitative real-time PCR
Quantitative real-time PCR (qRT-PCR) was used to quantify the expression of
the biomarker genes. All the genes were quantified using the StepOnePlus Real-Time
PCR System (Applied Biosystems) equipment. The Pnpla6 expression was monitored
with the specific Taqman kit, while other genes were quantified with the Power SYBR
Green kit (both supplied by Applied Biosystems) with the primers shown in Table 1.
For the Power SYBR Green analysis, 96-well reaction plates (Applied Biosystem)
were utilised, and the following was added to each well: 10 ␮l of master mix, 0.9 ␮l
of forward primer 25 pmol/␮l, 0.9 ␮l of reverse primer 25 pmol/␮l, 6.2 ␮l of DEPC
water plus 2.0 ␮l of cDNA sample (0.1 ng/ml). The cDNA amplification consisted
in an initial step at 95 ◦ C lasting 10 min, followed by 40 cycles of 15 s denaturing at
95 ◦ C, 60 s at the respective annealing temperature (Table 1), 15 s at 95 ◦ C, plus a final
melting step of 60 s at 60 ◦ C. Table 1 displays the number of cycles (Ct) of each gene
for which the PCR amplification efficiency was considered appropriate. The number
of Ct needed to quantify the expression of all markers genes never exceeded the
number of Ct expressed in Table 1.
The Pnpla6 expression was recorded with 10.0 ␮l of the Taqman master mix,
1.0 ␮l of the Taqman assay mix, 2.0 ␮l of sample, plus 7.0 ␮l of DEPC water. The
procedure for the genes analysed by the specific Taqman kit consisted in an initial
step at 50 ◦ C for 2 min, plus 10 min at 95 ◦ C followed by 40 cycles of 15 s at 95 ◦ C and
60 s at 60 ◦ C.
Quantification was performed using 2−Ct calculations (Livak and Schmittgen,
2001) with the Step-One software, v2.0.1 (Applied Biosystems). ␤-Actin was used
as an invariant internal control for each sample. In all cases, qRT-PCR was run with
three independent biological replicates per condition, and the gene expression was
estimated in relation to the expression of the same gene in the control plate (not
exposed to CPF, CPO or TClP).
2.6. Enzymatic activities
2.6.1. AChE enzymatic activity
The D3 cells under differentiation were exposed for 3 days to CPF, CPO and
TClP, as described in Section 2.2. Afterwards, AChE enzymatic activity was recorded
according to a procedure based on Ellman’s procedure (Ellman et al., 1961). To that
end, chemicals were removed and cells were gently washed with PBS and 200 ␮l
of 1 mM acethylhtiocholine with 0.25 mM 5,5 -dithiobis (2-nitrobenzoic acid) in
0.1 M phosphate buffer, pH 7.4, were added to each well to record increments of
absorbance at 405 nm for 30 min in a Beckman Coulter AD340 microplate reader.
AChE activity was expressed as the percentage of activity recorded in the cells not
exposed to CPF, CPO or TClP. Each condition was assayed with 12 independent bio-
logical replicates. IC50 was estimated as the concentration of CPF, CPO or TClP that
caused a reduction in AChE enzymatic activity by 50%.
2.6.2. NTE enzymatic activity
NTE enzymatic activity was determined as previously described by Pamies
et al. (2010b) as the phenyl valerate (PV) hydrolysing activity resistant to non-
neuropathic OP paraoxon and sensitive to neuropathic OP mipafox. B activity was
defined as the PV hydrolysing activity in the samples pre-incubated for 30 min at
37 ◦ C with 40 ␮M paraoxon. C activity was defined as the PV hydrolysing activity in
the samples pre-incubated with 40 ␮M paraoxon plus 250 ␮M mipafox. Therefore,
NTE activity was calculated as B–C.
 C. Estevan et al. / Toxicology Letters 217 (2013) 14–22 17

Table 1
Primers sequences and annealing temperatures used for qRT-PCR determinations. It is also displayed the maximum number of amplification cycles allowed for appropriate
quantification.

Gene 5 –3 -oligo 3 –5 -oligo T (◦ C) Maximum Ct

ˇ-actin TGGGAATGGGTCAGAAGGAC TGAAGCTGTAGCCACGCTCG 62 25

Afp GCTGCAAAGCTGACAACAAG GCTTGTTGCCTGGAGGTTTC 63 34
Ache TGAACCTGAAGCCCTTAGAGGTG CCAGAGTATCGGTGGCGCTG 61 32
Flk1 CCGAGGCCACAGACTCCCTGCTT CAGCCAGACAGACAGTGGGATGGTC 61 21
Mhc CCAAACAGTGTCTGCTCTCCACCGG TTTCGCTCGTTGGGAATGATGCA 67 29
Nanog TCTCTCAGGCCCAGCTGTGT CTCAGGTTCAGAATGGAGGAGAGT 63 28
Nefm CAGCAGCTACCAGGACACCATC CCAGGGCCATCTTGACGTTA 64 26
Nes GCTTTCCTGACCCCAAGCTG GGCAAGGGGGAAGAGAAGGA 61 32
Oct4 GCCAGACCACCATCTGTCGCTT CACCAGGTCTCCGATTTGCA 62 25

The D3 cells under differentiation were exposed for either 12 h or 3 days to CPF, the cytotoxicity induced by CPF, CPO and TClP. For CPO, cytotoxicity
CPO and TClP, as described in Section 2.2. Afterwards, chemicals were removed and against D3 and 3T3 cells was similar after 3 days of exposure.
cells were gently washed with PBS before exposing cells for 30 min at 37 ◦ C to either
40 ␮M paraoxon or 40 ␮M paraoxon plus 250 ␮M mipafox, both in PBS. Paraoxon
and mipafox were removed and 100 ␮l/well of 7.5 mM PV in PBS were added by 3.3. Changes in the expression of the gene markers of
prolonging the incubation at 37 ◦ C by an additional 60-min period. The reaction was differentiation
stopped by adding 100 ␮l/well of 4% SDS with 6.15 mM 4-aminoantypirine in 50 mM
TRIS–1 mM EDTA buffer (pH 8.0). After 15 min at room temperature, 50 ␮l/well of 1% The D3 cells under differentiation and 3T3 cells were exposed for
(v/v) potassium ferrocyanide in water were added by leaving the mixture for 10 min
at 37 ◦ C. The released phenol was quantified by recording absorbance at 510 nm and
either 12 h or 3 days to several concentrations of CPF, CPO and TClP,
by comparing with the absorbance of the phenol standards. Six independent wells
were used to test each experimental condition. NTE activity was expressed as the
percentage of activity recorded in the cells not exposed to CPF, CPO or TClP. IC50
was estimated as the concentration of CPF, CPO or TClP that reduced NTE enzymatic
activity by 50%.

3. Results

3.1. Degradation of OPs in cell culture media

Certain OPs can be hydrolysed by phosphotriesterases, such as

paraoxonase, and albumin contained in mammal serum, which is
specially probed in the case of CPO (Sogorb et al., 2008). We checked
the stability of CPF and CPO in the D3 cell culture media (the media
with the highest foetal serum concentration) by incubating CPF and
CPO with cell media and by analysing the residual concentrations
of both OPs by gas chromatography with mass spectrometry, as
described in Section 2.3. No significant decreases were noted in the
residual CPF concentration after 72 h of incubation at 37 ◦ C (Fig. 1).
However, the residual CPO concentration lowered over time (Fig. 2)
to become 20%, 10% and 0% of the initial concentration after 8 h
of incubation with 700, 500 and 100 ␮M CPO, and was negligi-
ble in all cases after 24 h of incubation. In all cases, the drop in
the residual CPO correlated with the appearance of a peak of TClP
(Supplementary Material 2), which supports the idea of a hydrolysis
of CPO by paraoxonase and albumin of foetal serum. No TClP peak
was detected after the incubation of CPF (Supplementary Material
1). These data led us to perform further experiments in the cell
media which were changed to therefore refresh the CPO content
every 24 h, which was not considered necessary for CPF.

3.2. Cytotoxicity of CPF, CPO and TClP

The D3 cells under differentiation and 3T3 cells were exposed

for either 12 h or 3 days to several concentrations of CPF, CPO and
TClP, as described in Section 2.2. The viability of the resulting cul-
tures was further assayed by the MTT test, as described in Section
2.4. The results are displayed in Table 2. The cytotoxicity induced
after 12 h of exposure was very low, and the EC50 for both cell lines
was always higher than 600 ␮M. CPF and CPO induced a similar
cytotoxicity to 3T3 cells, although the cytotoxicity of TClP induced
to these cells was lower than that induced by the parental com-
pounds. However, the cytotoxicity of CPO and TClP against D3 cells
was similar and lower than the CPF cytotoxicity against these same
cells. Remarkably, D3 cells were more susceptible than 3T3 cells to
Fig. 1. Residual organophosphorus concentration after incubation with D3 cell cul-
ture media. CPF (upper panel) and CPO (lower panel) were incubated at 37 ◦ C with
D3 culture media for up to 72 h in the case of CPF or 24 h in the case of CPO. The CPF
and CPO residual concentrations were calculated using gas chromatography cou-
pled to mass spectrometry after extracting the compounds with dichloromethane
as described in Section 2.3. It is displayed mean ± s.d. for three independent samples.
Supplementary Materials 1 and 2 display examples of chromatograms. The initial
CPF concentrations (upper panel) were 700 (); 400 () and 200 () ␮M. The initial
CPO concentrations (lower B) were 700 (); 500 () and 100 () ␮M.
18 C. Estevan et al. / Toxicology Letters 217 (2013) 14–22

Table 2
Effect of CPF, CPO and TClP on cellular viability. Cells (12 different biological replicates per each condition) were exposed to different concentrations of each compound as
described in Section 2.2 and afterwards the viability was assayed using the MTT test as described in Section 2.4. It is displayed the effective concentration (EC) needed to
cause viability reductions of 20%, 50% and 80%. The figures in square brackets represent the individual ECs obtained in the different n independent experiments performed
in each case. Each independent experiment was performed assaying twelve biological replicates.

EC20 (␮M) EC50 (␮M) EC80 (␮M)

D3 mouse embryonic stem cells

CPF 12 h 200 [200, 180, 220] 610 [640, 570, 624] 970 [1000, 910, 1010]
3 days 20 [15, 25, 20] 140 [100, 182, 138] 250 [260, 200, 240]
CPO 12 h 820 [860, 770, 874] >1200 [>1200, n = 3] >1200 [>1200, n = 3]
3 days 54 [47, 64, 51] 200 [146, 230, 224] >300 [>300, n = 3]
TClP 12 h >1200 [>1200, n = 3] >1200 [>1200, n = 3] >1200 [>1200, n = 3]
3 days 11 [12, 9, 12] 190 [151, 242, 177] >300 [>300, n = 3]

3T3 mouse fibroblasts

CPF 12 h 390 [400, 380] >1000 [>1000, n = 2] >1000 [>1000, n = 2]
3 days 48 [52, 44] 340 [320, 360] >400 [>400, n = 2]
CPO 12 h 320 [320, n = 2] >2000 [>2000, n = 2] >2000 [>2000, n = 2]
3 days 91 [67, 115] 200 [180, 220] 290 [300, 280]
TClP 12 h 1200 [1230, 1170] >2000 [>2000, n = 2] >2000 [>2000, n = 2]
3 days 260 [290, 230] 620 [610, 630] 970 [1000, 940]

as described in Section 2.2. Afterwards, RNA was extracted, retro-

transcribed to cDNA and the expressions of myosin heavy chain
(Mhc), nanog homeobox (Nanog), neurofilament medium polypep-
tide (Nefm), Nes, Oct4, Pnpla6, acetylcholinesterase (Ache), Afp and
foetal liver kinase 1 (Flk1) were assayed by qRT-PCR, as described
in Section 2.5. The results are displayed in Figs. 2–4. Figs. 2–4 dis-
play the statistically significant alterations (by at least p < 0.05) in
the expression of the biomarker genes together with the grade of
induced variation.

3.3.1. Changes in the CPF-induced gene expression

After a 12-h exposure, all the genes except Afp were down-
regulated, while the 3-day exposure up-regulated Flk1, Mhc, Nefm,
Ache, Oct4 and Nes, with slight variations or slight down-regulations
of Nanog, Afp and Pnpla6 (Fig. 2A). After the 12-h exposure to 10 ␮M
CPF, the expressions of Flk1, Oct4 and Ache statistically reduced
by 40%, 80% and 80%, respectively, while this same concentration
increased the expression of Pnpla6 by 70% (Fig. 2). Higher concen-
trations (100 and 200 ␮M) also caused alterations to the expression
of all the other tested genes (Fig. 2).
The lowest concentration to cause significant alterations in the
expressions of 6 of the 9 tested genes after the 3-day exposure was
20 ␮M, which was able to induce an overexpression of the genes
of a range between 3 and 29 times the expression of the control
cells (Fig. 2). None of the tested concentrations was able to induce
significant changes in the expressions of Nes and Ache (Fig. 2). The
overexpression of the altered genes reached a maximum at 50 ␮M
CPF, while higher concentrations lowered the expression (Fig. 2B).
The 3-day exposure to CPF led to an increased expression of the
pluripotency (Oct4 and Nanog) and mesoderm (Flk1) markers, while
the 12-h exposure caused the opposite effect (Fig. 2).

3.3.2. Changes in the CPO-induced gene expression

Fig. 2. Effect of CPF on the gene expression of biomarkers of differentiation. D3
mouse embryonic stem cells under spontaneous differentiation were exposed dur-
ing 12 h (upper panel) or 3 days (lower panel) to several CPF concentrations. At the
end of the exposure RNA was extracted, retrotranscribed and the expression of the
biomarker genes assayed by qRT-PCR and expressed regarding control non-exposed
cells as described in Section 2.5. It is displayed mean ± s.d. for 3 independent bio-
logical replicates assayed per each condition. Statistical analyses were performed
comparing the expression of each point with expression of control cells by t Student
test.
The lowest CPO concentration capable of causing statistically
significant alterations in some of the tested batteries of genes was
100 ␮M, which was able to increase the expression of Flk1 by 180%
while, at the same time, it reduced the expression of Nes (Fig. 3).
Higher CPO concentrations (300 ␮M) brought about increases in
the expressions of Nefm and Afp, while 600 ␮M and 700 ␮M were
required to statistically alter the expressions of Ache and Oct4,
respectively (Fig. 3).
The expressions of Mhc and Nanog remained unaltered after the
12-h exposure, but the expression of these genes increased by 8 and
6 times, respectively, after the 3-day exposure to 25 ␮M CPO. A sim-
ilar increase (5 times) in the expression of Flk1 was also observed
at this same concentration (Fig. 3).
 C. Estevan et al. / Toxicology Letters 217 (2013) 14–22 19

Fig. 3. Effect of CPO on the gene expression of biomarkers of differentiation. D3
mouse embryonic stem cells under spontaneous differentiation were exposed dur-
ing 12 h (upper panel) or 3 days (lower panel) to several CPO concentrations. At the
end of the exposure RNA was extracted, retrotranscribed and the expression of the
biomarker genes assayed by qRT-PCR and expressed regarding control non-exposed
cells as described in Section 2.5. It is displayed mean ± s.d. for 3 independent bio-
logical replicates assayed per each condition. Statistical analyses were performed
comparing the expression of each point with expression of control cells by t Student
test.
Fig. 4. Effect of TClP on the gene expression of biomarkers of differentiation. D3
mouse embryonic stem cells under spontaneous differentiation were exposed dur-
ing 12 h (upper panel) or 3 days (lower panel) to several TClP concentrations. At the
end of the exposure RNA was extracted, retrotranscribed and the expression of the
biomarker genes assayed by qRT-PCR and expressed regarding control non-exposed
cells as described in Section 2.5. It is displayed mean ± s.d. for 3 independent bio-
logical replicates assayed per each condition. Statistical analyses were performed
comparing the expression of each point with expression of control cells by t Student
test.

3.3.3. Changes in the TClP-induced gene expression

The only gene that was up-regulated after exposure to TClP for
12 h was Afp (Fig. 4). TClP exhibited a potent effect on gene expres-
sion since 10 ␮M was capable of down-regulating the expressions
of Nanog, Nefm, Nes, and Pnpla6 by between 50% and 90% after a
12-h exposure (Fig. 4).
Pnpla6 was the only gene to be underexpressed after exposure
to TClP for 3 days, although the effects noted were statistically sig-
nificant at lower concentrations (25 ␮M) than the concentrations
needed to alter the expression of other overexpressed genes, such
as Flk1, Ache and Mhc, whose expression increased by between 13
and 47 times (Fig. 4).
3.4. Effect of CPF, CPO and TClP on AChE and NTE enzymatic
activities
we studied the alterations on the enzymatic expression caused by
exposure to CPF, CPO and TClP for 3 days. CPO inhibited AChE with
a power of 17 times higher than CPF (Table 3), which was expected
Table 3
Effect of CPF, CPO and TClP on enzymatic activities of target esterases. D3 mouse
embryonic stem cells under differentiation were exposed to CPF, CPO and TClP as
described in Section 2.2 and afterwards the AChE and NTE enzymatic activities were
recorded as described in Section 2.6. It is displayed the concentration needed to
cause an inhibition of 50% of each activity for the indicated time of exposure. AChE
could not be detected in control D3 cells differentiated during 12 h. Each AChE and
NTE determination was assayed with 12 and 6 independent biological replicates,
respectively. The figures in square brackets represent the individual ECs obtained
in the different n independent experiments performed in each case.
AChE (3 days) NTE (12 h) NTE (3 days)
IC50 (␮M) IC50 (␮M) IC50 (␮M)

3.4.1. Effects on AChE CPF 35 [30, 40] 200 [200, 200] >135 [>135, >135]
AChE enzymatic activity was not detected in the control cells CPO 2 [2, 2] 6 [<10, 6] 35 [<50, 35]
TClP >120 [>120, >120] 9 [<10, 9] 280 [270, 290]
by the experimental procedure described in Section 2.6. Therefore,
20 C. Estevan et al. / Toxicology Letters 217 (2013) 14–22
because CPO is more toxic in vivo than CPF. TClP displayed a certain
capability to inhibit AChE, but with the lowest potency.
3.4.2. Effects on NTE enzymatic activity
Once again, CPO was seen to be a more potent inhibitor of NTE
than CPF, although the differences in inhibitory power of CPF and
CPO were lower for 3 days than for 12 h (Table 3). TClP exhibited a
surprising capability to inhibit NTE with a similar power to CPO for
the 12-h exposure, while the inhibitory potency of TClP was similar
to that exhibited by CPF after a 3-day exposure (Table 3). The IC50
for NTE after 3 days of exposure to CPO was 17 times higher than
IC50 for AChE with the same chemical (Table 3).
4. Discussion
In this paper, we demonstrate that CPF and its metabolites, CPO
and TClP, are more cytotoxic for embryonic stem cells than for
fibroblasts cells, and that all three compounds are able to signifi-
cantly alter the in vitro expressions of nine different genes (most of
which have a proven capability to detect exposure to embryotox-
icants) belonging to all three main cellular lineages in D3 mouse
embryonic stem cells after exposures lasting 12 h or 3 days. In addi-
tion, alterations to expressions were detected at concentrations for
which low or no cytotoxicity was expected.
4.1. Cytotoxicity
The substances tested in this study have been shown to be more
cytotoxic for the embryonic D3 stem cells than for the differentiated
3T3 fibroblast cells at the two exposure periods tested (Table 2).
These results are consistent with some in vivo studies (Atterberry
et al., 1997) showing more susceptibility to CPF in young rats than
in adult rats, probably due to the reduced metabolic capacity to
hydrolyse the oxon form of OPs or other mechanisms to detoxify
chemicals.
CPF and other OPs have showed to cause cytotoxicity through
induction of oxidative stress with concurrent DNA damage and
apoptosis (Lu et al., 2012; Lee et al., 2012; Ojha et al., 2011). Never-
theless, in the specific case of CPF other cytotoxicity mechanisms
have been also described, as the extracellular signal-regulated
kinase inhibition in primary rat hippocampal neurons (Tan et al.,
2009) or the up-regulation of protein kinase C in PC12 cells (Slotkin
and Seidler, 2009). Nevertheless, 12 h of exposure is too short time
to develop the cytotoxic effects through the specific mechanisms
and our results are probably the reflection of oxidative stress, while
we cannot refuse the possibility of other effects, as apoptosis, when
cells were exposed during three days.
The cytotoxicity of CPF and TClP was higher for D3 cells (the
embryonic differentiating cells model) than for 3T3 cells (the non-
differentiating cells model) (Table 2). The validation study of the
Embryonic Stem cell Test, sponsored by the European Centre for
Validation of Alternative Methods, classifies the embryotoxicity of
chemicals into three categories according to the following criteria:
(a) strong embryotoxicants are chemicals causing toxic effects to
the embryo of all the tested species with very low, or absence of,
maternal toxicity; (b) weak embryotoxicants are chemicals causing
toxic effects to the embryo of the multiple tested species with very
low, or absence of, maternal toxicity; and (c) non-embryotoxicants
are those chemicals causing toxic effects to the embryo of mul-
tiple tested species with severe maternal toxicity (Brown, 2002).
Therefore, although the main goal of this work was not to set a
classification for CPF, CPO and TClP, our results (more cytotoxic-
ity for embryonic-differentiating cells than for differentiated cells)
suggest that they may match the weak embryotoxicants category,
at least on the basis of comparing relative cytotoxicity to embry-
onic/differentiated cells.
4.2. Expression of biomarkers of differentiation
The battery of genes considered for testing changes in the differ-
entiation of D3 embryonic stem cells include (Figs. 2–4): markers
of mesoderm (Flk1, Mhc and Pnpla6); markers of ectoderm (Nefm,
Nes and Ache), markers of endoderm (Afp) and markers of pluripo-
tency (Oct4 and Nanog). These genes codify for proteins involved
either in the development or maintenance of vascular (Flk1, Ache
and Pnpla6), nervous (Nefm and Nes) and muscular (Mhc) systems
or in the distribution of nutrients (fatty acids) and other factors
(nickel, copper) in the embryo (Afp). The intensity of the induced
changes was also remarkable, ranging between under-expressions
of up to 99 times and over-expressions of up to 400 times the
expressions recorded in the non-exposed control cells. Although
this work did not aim to study embryotoxicity mechanisms of the
analysed chemicals, it is expected that all these changes working
together may potentially cause severe disturbances in differentia-
tion, especially if these alterations are combined with impairments
in placental function, such as pregnancy maintenance, trophoblast
differentiation and membrane drug transport, as recently reported
in vitro (Ridano et al., 2012).
Among all the tested genes, Afp, Nes and Pnpla6 have
already been shown their capacity to discriminate among the
embryotoxicity powers of 5-fluorouracil (strong embryotoxicant),
5,5-diphenylhydantoin (weak embryotoxicant) and saccharin
(non-embryotoxicant) in a modified EST protocol (Romero et al.,
2011). Afp has also been demonstrated to be an extraordinary sen-
sitive biomarker of exposure to 5-fluorouracil since the expression
of this gene was severely altered after exposing differentiating D3
cells at concentrations of several orders of magnitude below those
causing cytotoxicity (Pamies et al., 2010a). Therefore, all these data
support the hypothesis that the detected alterations might actually
entail embryotoxicity in developing embryos exposed to CPF, CPO
or TClP.
Changes in gene expression in cells exposed to CPF for 12 h
always displayed an overexpression or underexpression; however,
while the changes reported in the cells exposed to CPF for 3 days
showed overexpressions for certain genes at low concentrations,
with further decreased expressions at higher concentrations. This
might be explained by the cytotoxicity basis. Indeed, the highest
concentration tested for the 12-h exposure for all three compounds
was expected to cause low or no cytotoxicity, while the highest
concentrations employed in the 3-day exposure experiments came
close to EC50 . Therefore, certain cytotoxicity may be expected for
the mid dose-response curves.
The lowest in vitro CPF concentration to cause statistically sig-
nificant alterations in the expression of the tested genes ranged
between 10 and 200 ␮M for the 12-h exposure (Fig. 2), which is
between 3 and 61 times lower than the estimated EC50 for the
viability of D3 cells. Likewise for the 3-day exposure, the lowest
CPF concentration causing significant alterations in gene expres-
sion ranged between 20 and 50 ␮M, which is between 2.8 and 7
times lower than the estimated EC50 for the viability of D3 cells.
The same analysis showed that CPO is capable of significantly alter-
ing the expression of certain genes at concentrations of between
12 (for 12-h exposure) and 8 (for 3-day exposure) times lower
than the corresponding EC50 records for the viability of D3 cells
(Table 2 and Fig. 3). Similarly, concentrations of TClP of between
12 and 120 times lower than the EC50 for the viability of D3 cells
also significantly altered the expression of several genes included
in the array (Tables 2 and 4). Table 2 and Fig. 4 in conclusion, all
these data suggest that the alterations detected in gene expression
might address alterations in differentiation mechanisms, but not
 C. Estevan et al. / Toxicology Letters 217 (2013) 14–22
the general phenomena relating to severe loss in cell viability of
the culture.
4.3. Alterations in the enzymatic activities of AChE and NTE
Exposure of cells to CPF, CPO and TClP during differentiation led
to severe reductions in the enzymatic activities of AChE and NTE
(Table 3). As expected, CPO was a more potent inhibitor of AChE
and NTE than CPF. It is also remarkable to note than the IC50 for
NTE was always higher than that for AChE, which was expected
given the low capability of CPF to induce delayed polyneuropathy
(Albers et al., 2004). The differences in the IC50 for NTE inhibition
after the 12-h and 3-day exposures were not as high as expected;
even for CPO, the IC50 for the 3-day exposure was higher than for
the 12-h exposure, which is not logical for irreversible time- and
concentration-dependent inhibition (Table 3). We cannot provide
a clear explanation for this phenomenon, but it might be related to
a mixture of effects which simultaneously affect cells, such as the
chemical inhibition caused by CPO through a direct effect on the
protein and the effect of CPO on the expression of Pnpla6.
Surprisingly, TClP also displayed a certain inhibition power of
enzymes. This inhibition cannot be accounted for as it can for CPF
and CPO because this compound has not been reported to be an
irreversible inhibitor of esterases. The observed effects might be
due to a mixture of complex effects ranging between some type
of interaction between the protein and the compound that has not
been described to date and alterations in the level of expression of
both the genes reported in Fig. 4.
In all cases, the greatest effects of CPO and CPF on gene expres-
sion were reached at concentrations at which a high inhibition of
both esterases was expected. With CPF, the lowest concentrations
causing alterations in gene expression were lower than, or in the
same order of magnitude as, IC50 for AChE and NTE (Tables 3 and 4).
However, the lowest CPO concentrations to alter gene expression
were much higher, or in the same order of magnitude as, IC50 for
AChE and NTE (Tables 3 and 4). These findings suggest that alter-
ations in gene expression do not relate to esterase inhibition. It is
also remarkable to note that EC50 for the viability in D3 cells is far
from the IC50 for the inhibition of AChE and NTE, suggesting that
cytotoxicity is not caused by a mechanism mediated by inhibition
of esterases.
4.4. Considerations for the risk assessment of embryotoxicity of
CPF
The correlation found between in vivo exposures and in vitro
doses is always hard to estimate. Nonetheless, Albers et al. (2007)
have suggested that a person occupationally exposed to the Thresh-
old Limit Value (TLV) (200 ␮g/m3 ) at a respiratory rate of 10 m3
air/working day via the inhalatory route, by assuming 100% of
pulmonary absorption, would be exposed to a systemic dose of
2000 ␮g CPF/day. Assuming that CPF is distributed according to a
monocompartimental model, which seems logical since OPs do not
bioaccumulate (WHO, 1986), by contemplating a corporal volume
of 38 l for a person weighing 70 kg (Lehman-McKeeman, 2009), the
expected systemic concentration of CPF would be around 0.2 ␮M.
On the other hand, USEPA estimates that adult exposures to CPF
could be around 11.4 ␮g/kg/day (Cochran, 2002). If we assume
the considerations as above, then the systemic CPF concentra-
tions could be around 0.1 ␮M. To conclude, the estimated systemic
concentration in both cases is still far from the lowest CPF con-
centrations causing significant alterations to gene expressions for
exposures of either 12 h (10 ␮M) or 3 days (20 ␮M).
Other studies have considered that the acute reference dose
for CPF is 0.1 mg/kg, estimated based on inhibition of blood
cholinesterases and by assuming a safety factor of 10 (FAO/WHO,
21
1999). If we use the same toxicokinetic parameters as those above
to estimate the systemic concentration needed to reach the acute
reference dose, we can conclude that it may be around 0.5 ␮M.
It is remarkable that the above-stated reference values (TLV and
acute reference dose) were obtained on the basis of statistically
significant alterations of blood AChE and with a safety factor of
10. However, statistically significant alterations of AChE as regards
controls do not necessarily mean clinical signs since they do not
appear below the 70% inhibition of brain cholinesterase (Clegg and
van Gemert, 1999). Therefore, exposure scenarios where occupa-
tional hygiene is not strictly observed may cause CPF exposures
which, without clinical maternal symptoms because AChE is not
high enough, reach similar systemic concentrations to those dis-
played in Figs. 2–4, and cause significantly altered gene expressions.
The highest urinary excretion of TClP reported for workers
involved in manufacturing CPF was 325 ␮g/day (Chen et al., 2011).
By assuming 1 l of urine/day and the above-stated toxicokinetic
and physiological parameters (70 kg, 38 l of corporal volume and no
bioaccumulation), the estimated systemic TClP concentration could
be around 43 nM. This figure is several orders of magnitude lower
than that which caused significantly altered gene expressions. Thus,
the risk of embryotoxicity due to CPF exposure is not expected
through its metabolite. Regarding CPO, it is also remarkable to note
that gene expressions alter only at concentrations that cause severe
AChE inhibition and, therefore, severe maternal toxicity.
4.5. Final remarks
The information available on the embryotoxicity of CPF is con-
tradictory. Most of the studies performed, which follow the OECD
Guidelines for development or toxicity to reproductions, have
reported embryotoxicity only at doses with high maternal toxic-
ity (Eaton et al., 2008; FAO/WHO, 1999)]. However, other studies
have reported that subcutaneously injections of rats with CPF dur-
ing different gestational periods irreversible reduce the dopamine
contents in both the cerebral cortex and hippocampus, two key
brain regions involved in learning and memory (Chen et al., 2011).
Furthermore, epidemiological studies have not proved conclusive
since Mink et al. (2012) have recently reviewed four independent
epidemiological cohort studies, and found no causal association
between CPF exposures during pregnancy and measures of foetal
growth.
The above-stated discrepancies might be explained on the basis
of the exposure route. Indeed, the OECD Guidelines exclusively con-
sider oral exposure (Estevan et al., 2011), where the first passage of
administered CPF through the liver of the mother would massively
bioactivate CPF to CPO, which is a more powerful AChE inhibitor and
would cause clinical cholinergic signs before reaching embryotoxic
concentrations. However, other animal studies have considered
different routes, such as subcutaneous exposure, where less CPF
reaches the liver and CPO appears more slowly than in oral expo-
sure, which allows, in this case, higher and potentially toxic CPF
concentrations to reach the embryo with no significant maternal
toxicity signs. Similar situations may appear during human occu-
pational exposure, which can essentially be inhalatory or dermal,
therefore entailing greater risk.
Finally, it is remarkable that the reported effect of CPF might
address it, but not its metabolites CPO or TClP, which despite
also displaying embryotoxic hazards, do not appear for compatible
exposures with mother survival.
5. Conclusions
The short- and mid-term exposure of embryonic stem cells
to CPF and its metabolites significantly modify the expression of
22 C. Estevan et al. / Toxicology Letters 217 (2013) 14–22
marker genes of differentiation during early in vitro differentiation
at concentrations that do not affect viability. However, alterations
to marker genes of differentiation occur at concentrations which
cause severe AChE inhibition. Therefore, embryotoxicity is possi-
ble only under exposure scenarios which allow low bioactivation
of CPF to avoid neurotoxicity.
Conflict of interest statement
The authors report no conflicts of interest.
Appendix A. Supplementary data
Supplementary data associated with this article can be
found, in the online version, at http://dx.doi.org/10.1016/
j.toxlet.2012.11.026.
References
Albers, J.W., Garabrant, D.H., Schweitzer, S.J., Garrison, R.P., Richardson, R.J., Berent,
S., 2004. The effects of occupational exposure to chlorpyrifos on the peripheral
nervous system: a prospective cohort study. Occupational and Environmental
Medicine 61, 201–211.
Albers, J.W., Garabrant, D.H., Mattsson, J.L., Burns, C.J., Cohen, S.S., Sima, C., Garrison,
R.P., Richardson, R.J., Berent, S., 2007. Dose-effect analyses of occupational chlor-
pyrifos exposure and peripheral nerve electrophysiology. Toxicological Sciences
97, 196–204.
Atterberry, T.T., Burnett, W.T., Chambers, J.E., 1997. Age-related differences in
parathion and chlorpyrifos toxicity in male rats: target and nontarget esterase
sensitivity and cytochrome P450-mediated metabolism. Toxicology and Applied
Pharmacology 147, 411–418.
Brown, N.A., 2002. Selection of test chemicals for the ECVAM international validation
study on in vitro embryotoxicity tests. European Centre for the Validation of
Alternative Methods. Alternatives to Laboratory Animals 30, 177–198.
Cañadas, F., Cardona, D., Dávila, E., Sánchez-Santed, F., 2005. Long-term neurotox-
icity of chlorpyrifos: spatial learning impairment on repeated acquisition in a
water maze. Toxicological Sciences 85, 944–951.
Chen, X.P., Wang, X., Dong, J.Y., 2011. Different reaction patterns of dopamine con-
tent to prenatal exposure to chlorpyrifos in different periods. Journal of Applied
Toxicology 31, 355–359.
Clegg, D.J., van Gemert, M., 1999. Determination of the reference dose for chlorpyri-
fos: proceedings of an expert panel. Journal of Toxicology and Environmental
Health. Part B: Critical Reviews 2, 211–255.
Cochran, R.C., 2002. Appraisal of risks from nonoccupational exposure to chlorpyri-
fos. Regulatory Toxicology and Pharmacology 35, 105–121.
Council of the European Communities, 1991. Council Directive 91/414/EEC of 15
July 1991 concerning the placing of plant protection products on the market.
Official Journal 230, 1–32, Available from: http://eur-lex.europa.eu/LexUriServ/
LexUriServ.do?uri=CELEX:31991L0414:EN:NOT (last accessed: 20.09.12).
Eaton, D.L., Daroff, R.B., Autrup, H., Bridges, J., Buffler, P., Costa, L.G., Coyle, J., McK-
hann, G., Mobley, W.C., Nadel, L., Neubert, D., Schulte-Hermann, R., Spencer,
P.S., 2008. Review of the toxicology of chlorpyrifos with an emphasis on human
exposure and neurodevelopment. Critical Reviews in Toxicology 38, 1–125.
Ellman, G.L., Courtney, K.D., Andres Jr., V., Featherstone, R.M., 1961. A new and
rapid colorimetric determination of acetylcholinesterase activity. Biochemical
Pharmacology 7, 88–95.
Estevan, C., Pamies, D., Sogorb, M.A., Vilanova, E., 2011. OECD guidelines and vali-
dated methods for in vivo testing of reproductive toxicity. In: Gupta, R.G. (Ed.),
Reproductive and Developmental Toxicology. Elsevier, Burlington, MA. USA, pp.
123–133.
European Commission, 2005. Commission Directive 2005/72/EC of 21 October 2005
amending Council Directive 91/414/EEC to include chlorpyrifos, chlorpyrifos-
methyl, mancozeb, maneb, and metiram as active substances. Official
Journal 279, 0063–0069, Available from: http://eur-lex.europa.eu/LexUriServ/
LexUriServ.do?uri=CELEX:32005L0072:EN:HTML (last accessed: 20.09.12).
Food and Agriculture Organization of the United Nations and World Health Organi-
zation, 1999. Chlorpyrifos. In: Food and Agriculture Organization of the United
Nations and World Health Organization (Eds.), Pesticides Residues in Food.
Available from: http://www.inchem.org/documents/jmpr/jmpmono/v99pr03.
htm
Flaskos, J., 2012. The developmental neurotoxicity of organophosphorus insec-
ticides: a direct role for the oxon metabolites. Toxicology Letters 209,
86–93.
Genschow, E., Spielmann, H., Scholz, G., Pohl, I., Seiler, A., Clemann, N., Bremer, S.,
Becker, K., 2004. Validation of the embryonic stem cell test in the international
ECVAM validation study on three in vitro embryotoxicity tests. Alternatives to
Laboratory Animals 32, 209–244.
Jokanovic, M., Kosanovic, M., 2010. Neurotoxic effects in patients poisoned with
organophosphorus pesticides. Environmental Toxicology and Pharmacology 29,
195–201.
Lee, J.E., Park, J.H., Shin, I.C., Koh, H.C., 2012. Reactive oxygen species regulated
mitochondria-mediated apoptosis in PC12 cells exposed to chlorpyrifos. Tox-
icology and Applied Pharmacology 263 (September (2)), 148–162, http://dx.
doi.org/10.1016/j.taap.2012.06.005 (Epub 2012 June 17).
Lehman-McKeeman, L.D., 2009. Absorption, distribution and excretion of toxicants.
In: Klaassen, K. (Ed.), Casarett & Doull’s Toxicology the Basic Science of Poisons.
McGraw Hill, Kansas. USA, pp. 31–159.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2−CT method. Methods 25, 402–408.
Lu, X.T., Ma, Y., Wang, C., Zhang, X.F., Jin da, Q., Huang, C.J., 2012. Cytotoxicity and
DNA damage of five organophosphorus pesticides mediated by oxidative stress
in PC12 cells and protection by vitamin E. Journal of Environment Science and
Health. Part B: Pesticides 47 (5), 445–454.
Mink, P.J., Kimmel, C.A., Li, A.A., 2012. Potential effects of chlorpyrifos on fetal growth
outcomes: implications for risk assessment. Journal of Toxicology and Environ-
mental Health. Part B: Critical Reviews 15, 281–316.
Ojha, A., Yaduvanshi, S.K., Pant, S.C., Lomash, V., Srivastava, N., 2011. Evaluation of
DNA damage and cytotoxicity induced by three commonly used organophos-
phate pesticides individually and in mixture, in rat tissues. Environmental
Toxicology July, http://dx.doi.org/10.1002/tox.20748.
Ostrea, E.M., Morales, V., Ngoumgna, E., Prescilla, R., Tan, E., Hernandez, E., Ramirez,
G.B., Cifra, H.L., Manlapaz, M.L., 2002. Prevalence of fetal exposure to envi-
ronmental toxin as determined by meconium analysis. Neurotoxicology 23,
329–339.
Pamies, D., Vicente-Salar, N., Sogorb, M.A., Roche, E., Reig, J.A., 2010a. Specific effect
of 5-fluorouracil on alpha-fetoprotein gene expression during the in vitro mouse
embryonic stem cell differentiation. International Journal of Toxicology 29,
297–304.
Pamies, D., Reig, J.A., Vilanova, E., Sogorb, M.A., 2010b. Expression of Neuropathy
Target Esterase (NTE) in mouse embryonic stem cells during differentiation.
Archives of Toxicology 84, 481–491.
Ridano, M.E., Racca, A.C., Flores-Martín, J., Camolotto, S.A., de Potas, G.M., Genti-
Raimondi, S., Panzetta-Dutari, G.M., 2012. Chlorpyrifos modifies the expression
of genes involved in human placental function. Reproductive Toxicology 33,
331–338.
Romero, A.C., Vilanova, E., Sogorb, M.A., 2011. Shortening and improving the embry-
onic stem cell test through the use of gene biomarkers of differentiation. Journal
of Toxicology 2011, 286034.
Ruiz-Muñoz, A.M., Nieto-Escamez, F.A., Aznar, S., Colomina, M.T., Sanchez-Santed,
F., 2011. Cognitive and histological disturbances after chlorpyrifos exposure and
chronic A␤ (1–42) infusions in Wistar rats. Neurotoxicology 32, 836–844.
Slotkin, T.A., Levin, E.D., Seidler, F.J., 2006. Comparative developmental neurotoxicity
of organophosphate insecticides: effects on brain development are separable
from systemic toxicity. Environmental Health Perspectives 114 (5), 746–751.
Slotkin, T.A., Seidler, F.J., 2009. Protein kinase C is a target for diverse developmental
neurotoxicants: transcriptional responses to chlorpyrifos, diazinon, dieldrin and
divalent nickel in PC12 cells. Brain Research 1263 (March), 23–32.
Sogorb, M.A., García-Argüelles, S., Carrera, V., Vilanova, E., 2008. Serum albumin
is as efficient as paraxonase in the detoxication of paraoxon at toxi-
cologically relevant concentrations. Chemical Research in Toxicology 21,
1524–1549.
Sogorb, M.A., Vilanova, E., 2010. Detoxication of anticholinesterase pesticides. In:
Satoh, T., Gupta, R.G. (Eds.), Anticholinesterase Pesticides: Metabolism, Neuro-
toxicity, and Epidemiology. John Wiley & Sons, New Jersey. USA, pp. 121–133.
Spielmann, H., Seiler, A., Bremer, S., Hareng, L., Hartung, T., Ahr, H., Faustman, E., Haas,
U., Moffat, G.J., Nau, H., Vanparys, P., Piersma, A., Sintes, J.R., Stuart, J., 2006. The
practical application of three validated in vitro embryotoxicity tests. The report
and recommendations of an ECVAM/ZEBET workshop (ECVAM workshop 57).
Alternatives to Laboratory Animals 34, 527–538.
Tan, D.H., Peng, S.Q., Wu, Y.L., Wang, Y.M., Lu, C.F., Ding, W., Wang, Q.X., Yan, C.H.,
2009. Chlorpyrifos induces delayed cytotoxicity after withdrawal in primary
hippocampal neurons through extracellular signal-regulated kinase inhibition.
Biological and Pharmaceutical Bulletin 32 (October (10)), 1649–1655.
United States Environmental Protection Agency Administrator Announcement,
2000. Prevention Pesticides and Toxic Substances (7506C): Chlorpyrifos Revised
Risk Assessment and Agreement with Registrants. U.S. Environmental Protec-
tion Agency, Washington, DC, Available from: http://aspcro.ceris.purdue.edu/
htm/pr/chlorpyrifos/riskassessment.htm (last accessed 20.09.12).
World Health Organization, 1986. Organophosphorous insecticides a general intro-
duction. In: World Health Organization (Eds.), Environmental Health Criteria,
vol. 63. Available from: http://www.inchem.org/documents/ehc/ehc/ehc63.htm
(last accessed 20.09.12).