Professional Documents
Culture Documents
Artigo BioMol
Artigo BioMol
https://doi.org/10.1007/s11274-022-03504-0
RESEARCH
Received: 9 September 2022 / Accepted: 19 December 2022 / Published online: 27 December 2022
© The Author(s), under exclusive licence to Springer Nature B.V. 2022
Abstract
Background Targeted gene inactivation (TGI) is a widely used technique for the study of genes’ functions. There are many
different methods for TGI, however, most of them are so complicated and time-consuming. New promising genetic engineer-
ing tools are developing for this purpose. In the present study, for the first time we disrupted a virulence gene from Salmonella
enterica serovar Typhi (S. Typhi), located in the bacterial chromosome using CRISPR/Cas9 system and homology directed
repair (HDR).
Methods For this aim, pCas9 plasmid containing Cas9 enzyme and required proteins for homology directed recombina-
tion was transferred to S. Typhi by electroporation. On the other hand, a specific guide RNA (gRNA) was designed using
CRISPOR online tool. Synthetic gRNA was cloned into pTargetF plasmid. Also, a DNA fragment (HDR fragment) was
designed to incorporate into the bacterial chromosome following the cleavage of the bacterial genome by Cas9 enzyme.
pTargetF containing gRNA and HDR fragment were co-transferred to S. Typhi containing pcas9 plasmid. The transformed
bacteria were screened for recombination using PCR, restriction digestion and sequencing.
Results The results of PCR, restriction digestion and sequencing showed the successful recombination of S. Typhi, in which
the gidA gene is disrupted.
Conclusion In the present study we aimed to develop a rapid and robust method for targeted gene inactivation in a bacte-
rial species, S. Typhi. This procedure can be exploited for disruption of other Salmonella as well as other bacteria’s genes.
Keywords Targeted gene inactivation (TGI) · CRISPR/Cas system · Salmonella Typhi, gidA gene · Live attenuated
vaccines, homologous recombination
Introduction
13
Vol.:(0123456789)
58
Page 2 of 9 World Journal of Microbiology and Biotechnology (2023) 39:58
Although it is a specific and efficient method, however, it Typhimurium, Streptococcus pyogenes, Pseudomonas aer-
provides a temporary inactivation of a gene. uginosa, Aeromonas hydrophila, etc. It is involved in many
The CRISPR/cas system, a part of bacterial adaptive bacterial functions, such as motility, bacterial shape, patho-
immunity, recognizes and degrades exogenous nucleic genicity, etc. (Shippy 2011).
acids, such as plasmids and phages (Horvath et al. 2010; In the present study, we exploited the CRISPR/ Cas9 sys-
Katalani 2020). Robust and specific recognition of a desired tem to disrupt gidA gene by the insertion of a 39 bp DNA
sequence have made CRISPR/Cas a unique tool for genome fragment into the bacterial genome.
modification (Anzalone et al. 2020). In comparison to other
endonuclease-based genome editing tools, such as transcrip-
tion Activator- like Effector Nuclease (TALEN) and zinc Materials and methods
finger nuclease (ZFNs), this system has many advantages.
For example, TALENs and ZFNs are man-made artificial Bacterial strains, plasmids and media
protein-based tools, while, CRISPR is derived from bacteria
and is RNA- based. The CRISPR’s efficiency and specificity Table 1 represents the bacterial strains and plasmids used in
is higher than TALENs and ZFNs, but, at the same time, its the present study. A clinically isolated Salmonella enterica
cost is lower (Gupta and Musunuru 2014; Kim et al. 2014). serovar Typhi (S. Typhi) was used for gene inactivation.
Since its introducing in 2012 for genome editing, Luria Bertani (LB) broth and agar were used for bacterial
CRISPR/Cas system has been exploited for genome manip- growth. When appropriate, 50 µg/mL of kanamycin and/or
ulation in both eukaryotes and prokaryotes, especially in 100 µg/mL of spectinomycin (Sigma Ltd, Germany) were
eukaryotes (Feng et al. 2013; Chen et al. 2019; Platt et al. added. pCas9 and pTargetF plasmids were prepared from
2014; Barrangou et al. 2016). However, the use of the power addgene under the numbers 62,225 and 62,226, respectively.
and advantages of this system in bacterial world is still in All media required for biochemical analysis tests were pur-
the beginning. chased from Gibco (USA).
Salmonella entericaserovar Typhi (S. Typhi) is the aetio-
logic agent of typhoid fever. Causing nearly 10.9 million Generation of salmonella Typhi transformant
illnesses and 116.8 thousand deaths globally, this bacterium carrying pCas9 (STcas9)
is a major health problem particularly in developing coun-
tries (Wierzba and Sanders 2019). Investigating the role of Strain confirmation
genes coding virulence factors is an essential step for the
development of new drugs and vaccines against the infec- Biochemical identification tests as well as molecular test
tious agents. The pathogenicity ofS. Typhi is controlled by were used for the confirmation of S. Typhi isolate. Indeed,
different genes mainly located on Salmonella pathogenic- the pathogenicity of the isolate was approved by bacterial
ity island-1 (SPI-1) and Salmonellapathogenicity island-2 injection to mice.
(SPI-2) (Lee et al. 2000; Cirillo et al. 1998; Lostroh and IMVIC (Indole, Methyl Red, Voges-Proskauer, and Cit-
Lee 2001). Glucose-inhibited divison (GidA) protein is a rate), TSI (Triple Sugar Iron), SIM (Sulfur, Indole, Motil-
tRNA modification enzyme (Shi et al. 2009) which is present ity) and Urease tests were exploited for biochemical iden-
in different bacteria,Escherichia coli (E. coli), Salmonella tification of the strain. For molecular identification of the
13
World Journal of Microbiology and Biotechnology (2023) 39:58 Page 3 of 9 58
bacterium, two different S. Typhi genes were analyzed by sgRNA design and construction of sgRNA plasmid
polymerase chain reaction (PCR): 16 S rRNA and gidA. The
sequences of the primers are listed in Table 2. sgRNA was designed using CRISPOR tool (crispor.tefor.net)
to identify crRNA spacer sequences with the highest speci-
ficity score (> 50). The sequence was sent for the synthesis
Preparation of competent S. Typhi cells to SinaClone Company (Karaj, Iran). Then, this sequence
was cloned into pTargetF plasmid (from addgene under the
S. Typhi cells were competent for transformation using number 62,226) and the transformed clones were confirmed
chemical method as described by McLachlan et al. (MacLa- by PCR and sequencing.
chlan et al. 1985) with a little modification. Briefly, S. Typhi
cells were grown in 5 mL of LB broth till the O D640 of the Construction of HDR oligo fragment
culture reached 0.75. Then, cells were collected by centrifu-
gation at 4000×G for 10 min at 4 °C. The Pellet was resus- An HDR (homology-directed repair) fragment designed and
pended in 1volume (5 mL) of cold 1mM HEPES buffer and constructed to direct the desired sequence to the specific
centrifuged again in the same conditions. The pellet was site in the bacterial genome. The HDR fragment was com-
then resuspended in 1/2 volume of HEPES buffer, and recen- posed of three regions: an upstream arm (50 bp), an inser-
trifuged. The final pellet (competent cells) were resuspended tion segment (39 bp) and a downstream arm (49 bp). The
in 1 mM HEPES buffer containing 10% glycerol. sequences of upstream and downstream arms were the same
as the sequence of upstream and downstream of the PAM
Electro Transformation site, respectively. The insertion segment (39 bp) composed
of a short segment of the beginning of gidA gene (28 bp)
pCas9 plasmid was transferred to the competent cells were and a stop codon. The stop codon was applied to the inser-
via electroporation (MacLachlan et al. 1985). For this aim, 2 tion sequence in order to inhibit the translation of the entire
µL (900 ng) of pcas9 plasmid was added to 40 µL of chilled length of gidA mRNA.
competent cells. The content was transferred to a chilled
electroporation cuvette (Bio Rad). Then, a pulse (200 Ω, Transfer of sgRNA plasmid and HDR fragment
25 µF and 12.5 kv/cm) was applied for 5 ms. Then, 1mL of to STcas9
chilled SOC broth was added to the cuvette and the content
was transferred to a sterile 1.5 mL microtube and incubated Following the construction of sgRNA plasmid and HDR
in 30 °C for 3 h with gentle shaking. After 3 h of incubation, fragment, they were transferred to STCas9 using heat- shock
cells were cultured on a LB agar plate containing 50 µg/mL method (Ebrahimi 2018). Briefly, 3 µL of sgRNA plasmid
of kanamycin. 50 mg/µL) and 5 µL of HDR fragment (200 mg/µL) was
added to competent cells (HDR provides the upstream
and downstream homology arms as well as the insertion
Confirmation of the bacterial transformation: sequence). Stcas9 cells were competent bFIGy chemical
method using C aCl2. The samples were placed on ice for
After 36 h incubation in 30 °C, grown colonies were ana- 0.5 h. Then, the samples were put in a water bath (37 °C)
lyzed for transformation using PCR. For this aim specific for 90 S and then placed on ice for 5 min. After that, 1 mL
primers for pCas9 plasmid were used. The sequence of the of LB broth medium was added to each tube and tubes were
primers was as follows: incubated at 37 °C for 3 h. The cells were collected using
Forward primer: 5′CATAATTCGTGTCGCTCAAG3′; centrifugation at 8000×G for 2 min and cultured on LB Agar
Reverse primer: 5′ACGAAGAATCCATGGGTATG3′. plates containing 50 µg/mL kanamycin and 50 µg/mL spec-
Resulted PCR products with these primers will have tinomycin. The plates were incubated at 30 °C for 24 h and
lengths of 297 bp. grown colonies were tested for recombination.
13
58
Page 4 of 9 World Journal of Microbiology and Biotechnology (2023) 39:58
13
World Journal of Microbiology and Biotechnology (2023) 39:58 Page 5 of 9 58
Following the preparation of S. Typhi competent cells, and Designed gRNA had the following sequence:
the transfer of pCas9 plasmid to these cells, the transfor- Watson strand: 5′-CGCGATGGCCGCAGCGCGTA-3′;
mation of the cells was investigated using PCR. Figure 2A Crick strand: 5′-TACGCGCTGCGGCCATCGCG-3′.
shows the bacterial growth on LB agar plate containing The designed gRNA was synthesized chemically (Sina-
50 µg kanamycin. The grown colonies were analyzed for Clone, Iran) and cloned into pTargetF plasmid. The recom-
the transformation using colony-PCR with specific primers binant plasmid was transferred to E. coli DH5α competent
that amplify a 453 bp segment of gidA gene and a 297 bp cells via heat shock method. Following the growth of the
fragment of pCas 9 plasmid. As can be seen in Fig. 2B, a colonies on LB agar medium, transformed colonies were
297 bp band has been amplified in 3 analyzed colonies, that confirmed via PCR and sequencing. Figure 3A shows the
confirms the entrance of pCas9 plasmid to S. Typhi cells. result of the PCR. Three sets of PCR reactions were carried
out: (1) Internal forward primer of pTargetF plasmid + Crick
strand of gRNA as the reverse primer; (2) Watson strand
as the forward primer and an internal primer of pTargetF
plasmid as the reverse primer; (3) Internal forward primer
of pTargetF plasmid + an internal primer of pTargetF plas-
mid as the reverse primer. As can be seen in Fig. 3A all
three bands were observed following the PCR. The result
of sequencing that can be seen in Fig. 3B further confirmed
that the gRNA has been successfully inserted to pTargetF
plasmid.
13
58
Page 6 of 9 World Journal of Microbiology and Biotechnology (2023) 39:58
sequencing showed that the insert sequence has successfully Investigating the in vivo pathogenicity of ΔgidA S. Typhi
inserted into the bacterial genome in the precise location
(Fig. 5C). LD50 of the recombinant and wild-type S. Typhi was cal-
culated as 7.8 × 108 and 5 × 107, respectively, which shows
about 15 times reduction in the pathogenicity of the recom-
Characterization of the recombinant ΔgidA S. Typhi binant strain.
The bacterial growth curves of the recombinant and wild- In the present study, for the first time, we disrupt a Salmo-
type S. Typhi is presented in Fig. 6. As can be seen in the nella Typhi gene via CRISPR-aided homologous recombina-
figure, gidA knockdown resulted in the reduction of the bac- tion. A 39 bp fragment was inserted into gidA gene, located
terial growth. on the bacterial chromosome.
13
World Journal of Microbiology and Biotechnology (2023) 39:58 Page 7 of 9 58
Fig. 5 Confirmation of the recombination.A PCR amplification of a C Sequencing result. Sequencing wasperformed using the reverse
fragment containing the insert sequence (the 39 bpfragment). From primer. As can be seen, the 39 bp fragment has beeninserted into
seven analyzed colonies only one colony (Clone 2, Lane 2) was- the bacterial genome. Note: Since the sequencing was done usingthe
successfully recombinant. Lane 8: 1 kb DNA ladder. B Restriction reverse primer, the highlighted sequence is the reverse complement of
digestion ofthe amplified fragment by SalI enzymr. Lane 1: Con- theinserted fragment
trol (without SalI enzyme);Lane 2: Test. Lane 3: 1 kb DNA ladder.
gRNA was designed so that the Cas9 enzyme cut the gRNA was designed so that the Cas9 endonuclease
initial part of the gene. Since pCas9 plasmid carries the cleave the initial part of the gene (nucleotides 79 and 80
required genes for homologous recombination, following of the coding sequence) to ensure the inactivation of the
the cleavage with cas9, the desired fragment will be inserted gidA gene᾽s product, GidA protein. Via this strategy the
into the cleaved region. recombinant bacteria can be used in different studies,
Using PCR, we showed that S. Typhi can maintain exog- including use as a live-attenuated vaccine candidate, inves-
enous plasmids for multiple rounds of subcultures of the tigation of the effect of the desired gene on the survival
bacteria.
13
58
Page 8 of 9 World Journal of Microbiology and Biotechnology (2023) 39:58
13
World Journal of Microbiology and Biotechnology (2023) 39:58 Page 9 of 9 58
Barrangou R, van Pijkeren J-P (2016) Exploiting CRISPR–Cas immune Meng X et al (2008) Targeted gene inactivation in zebrafish using
systems for genome editing in bacteria. Curr Opin Biotechnol engineered zinc-finger nucleases. Nat Biotechnol 26(6):695–701
37:61–68 Platt RJ et al (2014) CRISPR-Cas9 knockin mice for genome editing
Behrens B, Karber G (1983) Mathematics for naturalists and agricul- and cancer modeling. Cell 159(2):440–455
turalists. PWN, Warszawa, pp 218–218 Rehl JM et al (2013) GidA expression in Salmonella is modulated under
Chen K et al (2019) CRISPR/Cas genome editing and precision plant certain environmental conditions. Curr Microbiol 67(3):279–285
breeding in agriculture. Annu Rev Plant Biol 70(1):667–697 Setton J et al (2021) Synthetic lethality in cancer therapeutics: the
Cirillo DM et al (1998) Macrophage-dependent induction of the Salmo- next generationsynthetic lethality in cancer therapeutics: emerg-
nella pathogenicity island 2 type III secretion system and its role ing concepts and biomarkers. Cancer Discov 11(7):1626–1635
in intracellular survival. Mol Microbiol 30(1):175–188 Sha J et al (2004) Molecular characterization of a glucose-inhibited
Diallo M et al (2020) Adaptation and application of a two-plasmid division gene, gidA, that regulates cytotoxic enterotoxin of Aero-
inducible CRISPR-Cas9 system in Clostridium beijerinckii. Meth- monas hydrophila. Infect Immun 72(2):1084–1095
ods 172:51–60 Shi R et al (2009) Structure-function analysis of Escherichia coli
Duffy MJ et al (2020) Targeting p53 for the treatment of cancer. Semi- MnmG (GidA), a highly conserved tRNA-modifying enzyme. J
nars in cancer biology, Elsevier, Amsterdam Bacteriol 191(24):7614–7619
Ebrahimi F et al (2018) Designing a Recombinant Vaccine Containing Shippy DC et al (2011) Biological and virulence characteristics of
three bacterial proteins of EHEC, ETEC, and shigella dysentery Salmonella enterica serovar Typhimurium following dele-
antigens in E. coli and evaluation of its Humoral immunity in Mic. tion of glucose-inhibited division (gidA) gene. Microb Pathog
J Mazandaran Univ Med Sci 27(157):1–16 50(6):303–3136
Feng Z et al (2013) Efficient genome editing in plants using a CRISPR/ Singh P et al (2020) RNA interference nanotherapeutics for treatment
Cas system. Cell Res 23(10):1229–1232 of glioblastoma multiforme. Mol Pharm 17(11):4040–4066
Gao T et al (2016) GidA, a tRNA modification enzyme, contributes to Tolonen AC, Chilaka AC, Church GM (2009) Targeted gene inactiva-
the growth, and virulence of Streptococcus suis serotype 2. Front tion in Clostridium phytofermentans shows that cellulose degra-
Cell Infect Microbiol 6:44 dation requires the family 9 hydrolase Cphy3367. Mol Microbiol
Gupta RM, Musunuru K (2014) Expanding the genetic editing 74(6):300–1313
tool kit: ZFNs, TALENs, and CRISPR-Cas9. J Clin Investig von Meyenburg K et al (1982) Promoters of the atp operon coding for
124(10):4154–4161 the membrane-bound ATP synthase of Escherichia coli mapped by
Halloy F et al (2022) Innovative developments and emerging technolo- tn 10 insertion mutations. Mol Gen Genet MGG 188(2):240–248
gies in RNA therapeutics. RNA Biol 19(1):313–332 Wang N et al (2022) Inactivation of a wheat protein kinase
Han H (2018) RNA interference to knock down gene expression. Dis gene confers broad-spectrum resistance to rust fungi. Cell
Gene Identif. https://doi.org/10.1007/978-1-4939-7471-9_16 185(16):2961–2974e19
Horvath P, Barrangou R (2010) CRISPR/Cas, the immune system of Wierzba TF, Sanders JW (2019) The global burden of enteric fevers
bacteria and archaea. Science 327(5962):167–170 in the age of typhoid-conjugate vaccines. Lancet Infect Dis
Hou M et al (2020) Genetic editing of the virulence gene of Escherichia 19(4):340–341
coli using the CRISPR system. PeerJ 8:e8881 Zhang T et al (2019) Removal of antibiotic resistance genes and control
Katalani C et al (2020) CRISPR-based diagnosis of infectious and non- of horizontal transfer risk by UV, chlorination and UV/chlorina-
infectious diseases. Biol procedures online 22(1):1–14 tion treatments of drinking water. Chem Eng J 358:589–597
Kim H, Kim J-S (2014) A guide to genome engineering with program- Zhang N et al (2022) CRISPR/Cas9–Mediated genome editing for
mable nucleases. Nat Rev Genet 15(5):321–334 Pseudomonas fulva, a Novel Pseudomonas Species with Clinical,
Kinscherf TG, Willis DK (2002) Global regulation by gidA in Pseu- Animal, and Plant–Associated isolates. Int J Mol Sci 23(10):5443
domonas syringae. J Bacteriol 184(8):2281–2286
Lee AK, Detweiler CS, Falkow S (2000) OmpR regulates the two- Publisher’s Note Springer Nature remains neutral with regard to
component system SsrA-SsrB in Salmonella pathogenicity island jurisdictional claims in published maps and institutional affiliations.
2. J Bacteriol 182(3):771–781
Levanova A, Poranen MM (2018) RNA interference as a prospective Springer Nature or its licensor (e.g. a society or other partner) holds
tool for the control of human viral infections. Front Microbiol exclusive rights to this article under a publishing agreement with the
9:2151 author(s) or other rightsholder(s); author self-archiving of the accepted
Lostroh CP, Lee CA (2001) The HilA box and sequences outside manuscript version of this article is solely governed by the terms of
it determine the magnitude of HilA-dependent activation of such publishing agreement and applicable law.
P prgH from Salmonella pathogenicity island 1. J Bacteriol
183(16):4876–4885
MacLachlan P, Sanderson K (1985) Transformation of Salmonella
typhimurium with plasmid DNA: differences between rough and
smooth strains. J Bacteriol 161(1):442–445
13