Biodegradation (2013) 24:427–435
DOI 10.1007/s10532-012-9599-9
ORIGINAL PAPER
Partial nitrification in a sequencing batch reactor treating
acrylic fiber wastewater
Jin Li • Deshuang Yu • Peiyu Zhang
Received: 2 July 2012 / Accepted: 3 October 2012 / Published online: 10 October 2012
Ó Springer Science+Business Media Dordrecht 2012
Abstract A sequencing batch reactor was employed
to treat the acrylic fiber wastewater. The dissolved
oxygen and mixed liquor suspended solids were 2–3
and 3,500–4,000 mg/L, respectively. The results
showed ammonium oxidizing bacteria (AOB) had
superior growth rate at high temperature than nitrite
oxidizing bacteria (NOB). Partial nitrification could be
obtained with the temperature of 28 °C. When the pH
value was 8.5, the nitrite-N accumulation efficiency
was 82 %. The combined inhibitions of high pH and
free ammonium to NOB devoted to the nitrite-N
buildup. Hydraulic retention time (HRT) was a key
factor in partial nitrification control, and the optimal
HRT was 20 h for nitrite-N buildup in acrylic fiber
wastewater treatment. The ammonium oxidation was
almost complete and the transformation from nitrite to
nitrate could be avoided. AOB and NOB accounted for
2.9 and 4.7 %, respectively, corresponding to the pH
of 7.0. When the pH was 8.5, they were 6.7 and 0.9 %,
respectively. AOB dominated nitrifying bacteria, and
NOB was actually washed out from the system.
Keywords Acrylic fiber wastewater  Partial
nitrification  Fluorescent in situ hybridization (FISH) 
Temperature  Hydraulic retention time (HRT)
J. Li (&)  D. Yu  P. Zhang
School of Chemical and Environmental Engineering,
Qingdao University, Qingdao, People’s Republic of China
e-mail: ljin0532@126.com
Introduction
The fiber industry has continuously developed with the
growth of the economy, accomplishing technological
development for synthesizing and processing several
high valuable polymer materials such as those used for
electrical, electronic and biomedical devices. Acrylic
fiber is one of the major synthetic fibers commonly used
in the mass production of clothing. The chemical
synthesis of acrylic fiber is carried out by polymeriza-
tion of the acrylonitrile (AN) monomers. The quantity
of acrylic fiber manufacturing wastewater is inclined to
increase. Besides, the components of wastewater
discharged are complicated and variable. The biode-
gradability of the acrylic fiber manufacturing waste-
water was very low: the ratio of BOD5/COD was 0.1-
0.2, and both the ammonium-N and organic-N concen-
trations were high in the wastewater (Zhang et al. 2003).
As far as wastewater treatment was concerned, most
acrylic fiber manufacturing companies had adopted a
conventional biological treatment system followed by
physicochemical methods such as neutralization, coag-
ulation and sedimentation (Young et al. 2005). Ultra-
filtration and reverse osmosis were also used to treat
acrylic fiber manufacturing wastewater (Lee et al.
2006). Besides, a combined three-stage process of
thermophilic anaerobic/anoxic denitrification/aerobic
nitrification fluidized bed reactor was used to treat the
wastewater, and the molecular biotechnology was
applied to study the microbial population in the
thermophilic anaerobic fluidized bed reactor (Cheng
123
428 Biodegradation (2013) 24:427–435

et al. 2004). However, to our knowledge, most of the (Sirianuntapiboon et al. 2006) and also for the
processes were devoted to removing the organic degradation of textile effluents in combined chemi-
matters, and little was worked on the nitrogen removal cal-biological systems (Tantak and Chaudhari 2006).
from the acrylic fiber wastewater. In this work, a sequencing batch reactor was
Nitrogen removal from wastewater is critical to employed to treat the acrylic fiber wastewater which
prevent the toxic effect on aquatic life, oxygen had been pretreated by a two phase UASB reactor. The
depletion and eutrophication in receiving water body aim of the work was to achieve the stable partial
(Antonio et al. 2012). Compared with chemical nitrification through studying and regulating the
treatments, biological nitrogen removal (BNR) has concerning factors such as temperature, pH and
been widely adopted in practice due to its efficient hydraulic retention time (HRT). Furthermore, micro-
performance and cost-effective feature (Chu and bial populations like ammonium-oxidizing bacteria
Wang 2011). Nitrite is a common intermediate in at (AOB) and nitrite-oxidizing bacteria (NOB) were
least three different oxidative or reductive biochem- analyzed by the fluorescent in situ hybridization
ical pathways (nitrification, denitrification and dis- (FISH).
similatory or assimilatory nitrate reduction). The
occurrence of high concentrations of nitrite is an
important water quality concern as it is highly toxic to Materials and methods
human, fauna and flora (Sarah et al. 2002). Usually the
presence of nitrite is undesired in wastewater treat- Wastewater characteristics
ment or other domains, but some recent processes
prefer nitrite as an intermediate (Banashri and Ajit The acrylic fiber manufacturing wastewater was
2007). Shortcut nitrogen removal via the nitrite collected from a synthetic-fiber factory located at the
pathway has the potential of reducing the requirements city of Ningbo, China. The wastewater mainly
for aeration consumption and carbon source. Com- consisted of AN monomer, vinyl acetate monomer,
pared with the traditional BNR process, the partial oligomers, dimethyl acetamide (DMAc), ethylene
nitrification could save 25 % of the oxygen consump- diamine tetraacetic acid (EDTA) and sulfate. In order
tion in the nitrification process and 40 % of the carbon to remove organics and sulfates, a two-phase UASB
source requirements in the following denitrification reactor was employed to pretreat the wastewater.
stage (Turk and Mavinic 1989). In recent years, stable However, the ammonium-N in the effluent from the
partial nitrification to nitrite has been achieved UASB reactor increased due to the anaerobic diges-
frequently in the systems treating wastewater contain- tion. As a result, the effluent was fed to the SBR for
ing high-level ammonia (Peng et al. 2008; Hellinga ammonium-N removal. The characteristics of the
et al. 1998). Besides, the co-treatment of landfill acrylic fiber effluent from the UASB reactor were
leachate with municipal wastewater using shortcut shown in the Table 1.
nitrification combined with coagulation was investi-
gated (Ismail et al. 2011). However, partial nitrifica-
tion achieved in the acrylic fiber wastewater has been Table 1 Characteristics of the acrylic fiber effluent from the
UASB reactor
reported little.
The biological treatment may be carried out in a Range Average
sequencing batch reactor (SBR), which presents a Acrylonitrile (mg/L) 1.29–2.15 1.71
great simplicity and flexibility of operation, as well as Vinyl acetate (mg/L) 0.018–0.022 0.020
low cost when compared with other possible config- Oligomers (mg/L) 118.5–152.7 129.9
urations (Carmen et al. 2009). The SBR was operated DMAc 51–77 68
by sequential stages in each treatment cycle, namely,
pH (mg/L) 6.2–7.8 6.9
wastewater feeding, reaction, sedimentation and dis-
COD (mg O2/L) 519–702 587
charge of the clarified effluent and sludge in excess
NH4?-N (mg N/L) 88–105 98
(Tchobanoglous et al. 2003). Concerning their appli-
SO42- (mg S/L) 551–829 699
cability, SBRs had been successfully and widely used
PO43- (mg P/L) 0.021–0.029 0.025
for domestic and industrial wastewater biodegradation

123
Biodegradation (2013) 24:427–435
Experimental set-up and start-up
Figure 1 showed a flow chart of the sequencing batch
reactor (SBR) used in this study. Batch operation was
carried out during the whole experiment. The volume
of the reactor was 25 L. Temperature control was
accomplished by water bath with water recirculation
through the reactor’s double jacket. The seed sludge
was inoculated from a full-scale oxidation ditch
treating textile wastewater. NaOH or HCl was added
to regulate the influent pH value. The dissolved
oxygen (DO) was 2–3 mg/L, and the MLSS concen-
tration in the reactor was 3,500–4,000 mg/L by
extracting excess sludge.
Sample collection and preparation
Samples were withdrawn from the liquid media at the
beginning and end of each treatment period. They
were centrifuged at 6,000 rpm for 30 min to remove
microorganisms from the liquid media. Clear super-
natants were analyzed for COD, ammonium-N, nitrite-
N and nitrate-N contents according to standard
methods (APHA 1999). Samples were analyzed in
triplicate and average values were reported. Oxidation
reduction potential (ORP) and pH measurements were
done by using the relevant probes and analyzers.
Biomass concentrations were determined by filtering
the washed salt-free samples through 0.45 lm mem-
brane filter and drying in an oven at 105 °C to constant
weight.
Fig. 1 Schematic diagram of the SBR treating acrylic fiber
wastewater
429
FISH
The samples were fixed with freshly prepared 3.7 %
paraformaldehyde solution in phosphate buffered
saline (PBS) for 3 h at 4 °C. After centrifugation,
the samples were washed twice with PBS and stored at
-20 °C in a storage buffer consisting of a 1:1 (v/v)
mixture of PBS and 100 % ethanol. Hybridization was
performed according to the standard protocol
described by Amann et al. (Amann et al. 1990). The
oligonucleotide probes used in this study are indicated
in Table 2. For each sample, total microscopic counts
were performed by fixed samples stained with 40 ,60 -
diamino-2-phenylindole (DAPI; Sigma, St. Louis,
MO, USA) at a final concentration of 0.1 mg/L for
10 min in the dark at 4 °C. Cells stained with DAPI
were defined as total cell counts. Dual staining with
DAPI and fluorescent-labelled rRNA probes allowed
estimation of the proportions of bacteria and different
bacterial groups to the total counts. A minimum of
1,000 cells in at least 10 randomly chosen microscopic
fields were scored.
Experimental procedure
Based on the different controlling strategies, the
experiment could be divided into three phases. The
operational conditions of each phase were presented in
the Table 3. In the phase of pH controlling strategy,
microbial populations like AOB and NOB were
analyzed by the FISH. The sludge samples were
extracted when the pH values were 7.0 (fifth week of
the phase) and 8.5 (twentieth week of the phase),
respectively.
Results and discussion
Temperature effects on the performances
of nitritation and nitratation
During the controlling strategy of temperature, nitri-
tation, nitratation and nitrite accumulations were
presented in the Fig. 2. When the temperature was
28 °C, nitrite produced in the effluent was much more
than nitrate. The nitrite accumulation efficiency
arrived at 78 %. Partial nitrification to nitrite was
achieved. Besides, the ammonium-N removal effi-
ciency was as high as 98 % due to the high
123
430 Biodegradation (2013) 24:427–435

Table 2 A list of
Probe Specificity Sequence (50 –30 ) Reference
sequences and hybridization
conditions of EUB338 Most bacteria GCTGCCTCCCGTAGGAGT Amann et al. (1990)
oligonucleotide probes used
in this study Nso1225 Most ammonium- CGCCATTGTATTACGTGTGA Mobarry et al. (1996)
oxidizing
b-Proteobacteria
Ntspa662 Nitrospira GGAATTCCGCGCTCCTCT Loy et al. (2003)
Nit3 Nitrobacter CCTGTGCTCCATGCTCCG Mobarry et al. (1996)

Table 3 Operational conditions of different phase throughout N and nitrate-N were 11 and 52 mg/L, respectively.
the experiment The nitrite-N accumulation efficiency was around
Controlling Operational condition 17 %. Most nitrite-N was oxidized to nitrate-N, and
strategy the complete nitrification occurred.
Temperature pH HRT DO
(oC) (h) (mg/L) Temperature was a key operation parameter, which
had distinct effects on both AOB and NOB (van Hulle
Temperature 18–28 7.8 18 2–3 et al. 2007). The activation energies of AOB and NOB
pH 20–22 7.0–8.5 18 2–3 as well as their sensitivities to temperature variation
HRT 20–22 8.5 12–22 2–3 were distinctly different (Kim et al. 2006). Raising
temperature could promote the growth rates of both
AOB and NOB; however, the differences of specific
temperature. When the temperature dropped, the growth rates between AOB and NOB were enlarged.
ammonium-N removal efficiency decreased. Simulta- AOB could outcompete NOB at the relatively higher
neously, the nitrite-N in the effluent declined and the temperatures. This was due to higher specific growth
effluent nitrate-N grew. The nitrite-N and nitrate-N rate for AOB. The undetected nitrite-N buildup at the
accumulation efficiencies were 45 and 55 %, respec- relatively low temperatures could be attributed to the
tively. The nitrate-N produced in the effluent was greater specific nitrite oxidation rate than the specific
more than nitrite-N. With the temperature decreased ammonium-N oxidation rate at low temperatures.
further, the nitrite-N declined and the nitrate-N grew. When the temperature was 28 °C, the above scenario
When the temperature was 18 °C, the effluent nitrite- began to change conversely. Significant nitrite-N was

Fig. 2 Variations of 120 100

ammonium-N, nitrite-N and 90
nitrate-N with different 100 accumulation efficiency
Ammonium-N removal

80
Concentration (mg/L)

temperatures
70
25 oC o
22 C
or nitrite-N

80 o
18 C 60
(%)

60 50
o 40
28 C
40
30
20
20
10

0 0
1 3 5 7 9 11 13 15 17 19
Time (week)
Influent ammonium-N Effluent ammonium-N
Effluent nitrate-N Ammonium-N removal
Effluent nitrite-N Nitrite-N accumulation

123
Biodegradation (2013) 24:427–435
accumulated. This agreed with the previous findings
that the optimal temperature for expanding the differ-
ences of specific growth rates between AOB and NOB
was recommended to be above 25 °C (Hellinga et al.
1998; Zhu et al. 2008). Temperature affected the
growth rate of both types of nitrifiers, while AOB had
superior growth rate at high temperature than NOB.
When it came to acrylic fiber wastewater, partial
nitrification could be obtained with the temperature of
28 °C.
pH effects on the performances of nitritation
and nitratation
During the controlling strategy of pH, nitritation,
nitratation and nitrite-N accumulations were presented
in the Fig. 3. In general, the ammonium removal
efficiency grew with increasing pH. When the pH
value was 7.0, the effluent ammonium-N and ammo-
nium-N removal were 29 mg/L and 71 %. However,
when the pH was 8.5, they were 5 mg/L and 95 %,
respectively. Alkalinity was consumed during the
nitrification. Higher pH value made the nitrification
performed well and benefited ammonium-N removal.
When the pH was 7.0, the nitrite-N accumulation
efficiency was only 2 %. Almost all nitrite-N was
oxidized to nitrate-N and no nitrite-N buildup
occurred. When the pH grew to 7.5, the effluent
nitrite-N and nitrate-N were 18 and 52 mg/L, respec-
tively. The nitrite accumulation efficiency was 27 %.
It increased to 55 % when the pH value was 8.0. The
effluent nitrite-N was 43 mg/L. It was slightly higher
Fig. 3 Variations of 120
ammonium-N, nitrite-N and
nitrate-N with different pH 100
Concentration (mg/L)
values
80
60
40
20
0 0
1 2
Influent ammonium-N
Effluent nitrate-N
Effluent nitrite-N
431
than the nitrate-N. Partial nitrification was achieved.
However, the nitrite-N buildup was not much. When
the pH value was 8.5, the nitrite-N accumulation
efficiency was 82 %. Both the high ammonium-N
removal and nitrite-N accumulation were obtained.
Fig. 3 Variations of ammonium-N, nitrite-N and
nitrate-N with different pH values.
Both microbial activity and metabolism were
affected by pH value, which in turn affected waste-
water treatment process (Li et al. 2011). The AOB and
NOB coexisted in the same surroundings. However,
the optimal pH values for their growths were different.
The optimal pH value for ammonium oxidizers was
around 8.2 while it was relatively low for nitrite
oxidizers (Park et al. 2007). When the pH value was
7.0, the NOB was quite active. Its growth rate was
faster than AOB. As a result, NOB could outcompete
AOB and dominate in the nitrification process (data
shown in ‘‘Quantification of microbial community
composition’’ section). Nitrite produced by ammo-
nium oxidizers was converted to nitrate by nitrite
oxidizers instantly. Little nitrite-N was built up. When
the pH value was enhanced to 8.5, both the activity and
the metabolism capabilities of AOB were stronger
than NOB. Besides, the free ammonium (FA) content
was higher in the surroundings with greater pH value.
Although the FA was inhibitor for both AOB and
NOB, it inhibited NOB greater than AOB. Conse-
quently, AOB could outcompete NOB and dominate
(data shown in ‘‘Quantification of microbial commu-
nity composition’’ section). High nitrite accumulation
was obtained at the pH value of 8.5. This also agreed
100
90
80
removal or nitrite-N
8.0 70
Ammonium-N
efficiency (%)
accumulation
7.5 60
50
7.0 8.5 40
30
20
10
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Time (week)
Effluent ammonium-N
Ammonium-N removal
Nitrite-N accumulation
123
432 Biodegradation (2013) 24:427–435

with previous study that high nitrite-N accumulations
were commonly observed at pH 8-9 (Chung et al.
2007; Bae et al. 2001). The combined inhibitions of
high pH and FA to NOB devoted to the nitrite buildup.
Nitritation and nitratation with different HRTs
When it came to wastewater treatment, hydraulic
retention time was a key parameter. Not only because
system performance but because reactor volume was
associated it. Nitritation and nitratation with different
HRTs were presented in Fig. 4. When the HRT was
12 h, the effluent ammonium-N, nitrite-N and nitrate-
N were 47, 26 and 16 mg/L, respectively. The ammo-
nium-N removal efficiency was 52 % while the nitrite-
N accumulation was 61 %. When the HRT increased,
the effluent ammonium-N dropped and the effluent
nitrite-N grew. However, the nitrate-N content in the
effluent was affected little. When the HRT was 20 h,
the effluent ammonium-N was below 5 mg/L, and the
ammonium-N removal could arrive at 97 %. Both the
effluent nitrite-N and nitrite-N accumulation peaked at
85 mg/L and 87 %, respectively. When the HRT was
prolonged to 22 h, ammonium-N removal efficiency
increased little. Effluent nitrite-N decreased whereas
the nitrate-N in the effluent rose. As a result, the nitrite-
N accumulation efficiency declined to 65 %.
Microbes which degraded organics belonged to
heterotrophic organisms while microbes which
degraded ammonium belonged to autotrophic ones.
Although the acrylic fiber wastewater used in this
work had already been pretreated by a two-phase
UASB reactor, it still contained lots of organic
matters. The heterotrophic bacteria could outcompete
autotrophic nitrifying bacteria in oxygen acquisition,
and the organics were degraded prior to ammonium-N.
As a result, the effluent ammonium-N was high and the
nitrification was not performed well when the HRT
was 12 h. This was in agreement with Yang’s
observation that high substrate carbon to nitrogen
(C/N) ratio might favor growth of heterotrophic
microbes and hence affect nitrification performance
(Yang et al. 2004). When the degradable organics
were exhausted by heterotrophs, the nitrification was
activated by autotrophs. In order to achieve high
ammonium-N removal efficiency, long aeration time
was necessary.
Long HRT operation was beneficial for the nitrite
accumulation and the dominant growth of AOB over
NOB. However, excessive HRT encouraged the
transition of partial nitrification to complete nitrifica-
tion. Our finding also agreed with the previous studies
that partial nitrification to nitrite was achieved through
the use of HRT control (Guo et al. 2009a; Yang et al.
2007). During the nitrification, alkalinity was con-
sumed both in the nitritation and nitratation. The pH
value dropped greatly with the long HRT operation.
The inhibition to NOB resulting from the high pH
value was alleviated. As a result, the NOB reactivated
and the nitrite-N accumulation efficiency decreased. It

Fig. 4 Variations of 120 100

ammonium-N, nitrite-N and 90
nitrate-N with different 100 or nitrite-N accumulation
Ammonium-N removal
80
Concentration (mg/L)

HRTs
12 h 14 h 70
efficiency (%)
80
60
60 16 h 50
18 h 20 h 22 h 40
40
30
20
20
10
0 0
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29

Time (week)
Influent ammonium-N Effluent ammonium-N
Effluent nitrate-N Ammonium-N removal

Effluent nitrite-N Nitrite-N accumulation

123
Biodegradation (2013) 24:427–435
was demonstrated that HRT was a key factor in partial
nitrification control. The optimal HRT was 20 h for
acrylic fiber wastewater treatment. The ammonium
oxidation was almost complete and the transformation
from nitrite to nitrate could be avoided.
Quantification of microbial community
composition
The key point for the stable nitrite accumulation
during long-term operation depended on achieving the
optimization of nitrifying microorganism community.
This also implied AOB became the dominant nitrify-
ing bacteria while NOB was gradually washed out
from the system. Fluorescence in situ hybridization
(FISH) was employed to quantify the microbial
community composition in the reactor. The AOB
and NOB contents were shown in Fig. 5. The bacteria
dominated the microbial community independent of
pH value. When the pH was 7.0, the AOB accounted
for 2.9 % while the NOB was 4.7 %. When the pH
increased to 8.5, AOB rose to 6.7 % and the NOB
dropped to 0.9 %. In order to carry out stable partial
nitrification via nitrite, it was the critical point to
achieve the enrichment of AOB and the elimination of
NOB. Optimum pH levels for AOB and NOB were
8.2–8.4 and 7.7–7.9, respectively (Park et al. 2007).
Besides, there were indications that NOB was sensi-
tive to pH charges (Park et al. 2010). As a result, AOB
may be selected as the prior nitrifying bacteria, while
NOB was washed out from the system at pH levels
close to or greater than the optimum pH for AOB.
When the stable partial nitrification was achieved, the
100
90 Bacteria
80 AOB
NOB
Abundance (%)
70
60
50
40
30
20
10
0 were high. The combined inhibitions of high pH and
pH=7.0 pH=8.5
Fig. 5 Quantification of microbial community composition by
FISH
433
AOB and NOB abundances in this work were also in
agreement with the previous report (Guo et al. 2009a).
Since the organic matters in influent were available
for the growth of heterotrophic bacteria, the dominant
organisms were common heterotrophic bacteria in this
system. Heterotrophs accounted for around 90 % of
total microbes. The fraction of heterotrophs was
estimated from the remaining relative area other than
those of AOB and NOB. To date, the partial nitrifi-
cation could be grouped into two kinds based on the
characteristics of NOB. For the first kind, NOB was
not washed out from the reactor but remained in the
system. However, the activity of the NOB was
inhibited (Yang and Yang 2011). For the other kind,
NOB was washed out from the reactor (Guo et al.
2009b; Zhang et al. 2009). In this work, the growth
rate of NOB was faster than AOB at a relatively low
pH value, and NOB content was higher than AOB.
Nitrites produced by AOB were converted to nitrates
instantly. Partial nitrification to nitrite was not
achieved. However, when the pH was 8.5, the energy
and growth of NOB was weaker than that of AOB. It
could be inferred that NOB did not have sufficient
growth potentials and opportunities. As a result, they
were gradually washed out from the system. Conse-
quently, the partial nitrification achieved in this work
was of the second kind. Although AOB were not the
predominant bacteria, they dominated nitrifying bac-
teria in the system. The results indicated that the
competition between the AOB and NOB could be
manipulated and nitrifying communities were opti-
mized by the pH control strategy. The FISH analyses
were also in agreement with the macroscopic perfor-
mance presented in ‘‘pH effects on the performances
of nitritation and nitratation’’ section.
Conclusions
Acrylic fiber wastewater was treated in a sequencing
batch reactor. It was concluded that temperature
affected the growth rate of both types of nitrifiers.
AOB had superior growth rate at higher temperature
than NOB. When the pH value was 8.5, both the
ammonium-N removal and nitrite-N accumulation
FA to NOB devoted to the nitrite-N buildup. The
optimal HRT was 20 h for acrylic fiber wastewater
treatment. The ammonium oxidation was almost
123
434
complete and the transformation from nitrite to nitrate
could be avoided. With the pH of 8.5, AOB dominated
nitrifying bacteria while NOB was actually washed
out from the system. The FISH analyses were in
agreement with the macroscopic performance.
Acknowledgment The work was supported by the National
Natural Scientific Foundation (No. 51078191 and No. 51278258).
References
Amann RI, Krumholz L, Stahl DA (1990) Fluorescent-oligo-
nucleotide probing of whole cells for determinative, phy-
logenetic, and environmental studies in microbiology.
J Bacteriol 172:762–770
Antonio A, Jacek M, Krishna P (2012) Impact of aeration
conditions on the removal of low concentrations of nitro-
gen in a tertiary partially aerated biological filter. Ecol Eng
44:44–52
APHA (1999) Standard methods for the examination of water
and wastewater. American Public Health Association,
Washington
Bae W, Baek S, Chung J, Lee Y (2001) Optimal operational
factors for nitrite accumulation in batch reactors. Biodeg-
radation 12:359–366
Banashri S, Ajit PA (2007) Partial nitrification—operational
parameters and microorganisms involved. Rev Environ Sci
Biotechnol 6:285–313
Carmen SD Rodrigues, Luis M Madeira, Rui AR Boaventura
(2009) Treatment of textile effluent by chemical (Fenton’s
reagent) and biological (sequencing batch reactor) oxida-
tion. J Hazard Mater 172:1551–1559
Cheng SS, Chen YN, Wu KL, Chuang HP, Chen SD (2004) Study
of a three-stage fluidized bed process treating acrylic syn-
thetic-fiber manufacturing wastewater containing high-
strength nitrogenous compounds. Water Sci Technol 49:
113–119
Chu L, Wang J (2011) Nitrogen removal using biodegradable
polymers as carbon source and biofilm carriers in a moving
bed biofilm reactor. Chem Eng J 170:220–225
Chung J, Bae W, Lee YW, Rittmann BE (2007) Shortcut bio-
logical nitrogen removal in hybrid biofilm/suspended
growth reactors. Process Biochem 42:320–328
Guo JH, Peng YZ, Wang SY, Zheng YN, Huang HJ, Ge SJ
(2009a) Effective and robust partial nitrification to nitrite
by real-time aeration duration control in an SBR treating
domestic wastewater. Process Biochem 44(9):979–985
Guo J, Peng Y, Wang S, Zheng Y, Huang H, Wang Z (2009b)
Long-term effect of dissolved oxygen on partial nitrifica-
tion performance and microbial community structure. Bi-
oresour Technol 100:2796–2802
Hellinga C, Schellen A, Mulder JW, van Loosdrecht MCM,
Heijnen JJ (1998) The SHARON process: an innovative
method for nitrogen removal from ammonium-rich waste
water. Water Sci Technol 37(9):135–142
Ismail T, Sourour S, Faycal O (2011) Coupling short-time
sequencing batch reactor and coagulation-settling process
123
Biodegradation (2013) 24:427–435
for co-treatment of landfill leachate with raw municipal
wastewater. Arab J Geosci 18:189–197
Kim DJ, Lee DI, Keller J (2006) Effect of temperature and free
ammonia on nitrification and nitrite accumulation in
landfill leachate and analysis of its nitrifying bacterial
community by FISH. Bioresour Technol 97(3):459–468
Lee KH, Kang BC, Lee JB (2006) Acrylic wastewater treatment
and long-term operation using a membrane separation
system. Desalination 191:169–177
Li J, Yu DS, Wang D (2011) Experimental test for high saline
wastewater treatment in a submerged membrane bioreac-
tor. Desalin Water Treat 36:171–177
Loy A, Horn M, Wagner M (2003) Probebase: an online
resource for rRNA-targeted oligonucleotide probes.
Nucleic Acid Res 31(1):514–516
Mobarry BK, Wagner M, Urbain V, Rittmann BE, Stahl DA
(1996) Phylogenetic probes for analyzing abundance and
spatial organization of nitrifying bacteria. Appl Environ
Microb 62(6):2156–2162
Park S, Bae W, Chung J, Baek SC (2007) Empirical model of the
pH dependence of the maximum specific nitrification rate.
Process Biochem 42(12):1671–1676
Park S, Bae W, Rittmann BE (2010) Operational boundaries for
nitrite accumulation in nitrification based on minimum/
maximum substrate concentrations that include effects of
oxygen limitation, pH, and free ammonia and free nitrous
acid inhibition. Environ Sci Technol 44(1):335–342
Peng Y, Zhang S, Zeng W, Zheng S, Mino T, Satoh H (2008)
Organic removal by denitrification and methanogenesis
and nitrogen removal by nitritation from landfill leachate.
Water Res 42(4–5):883–892
Sarah P, Hendrikus JL, Willy V (2002) Origin causes and effects
of increased nitrite concentrations in aquatic environments.
Rev Environ Sci Biotechnol 1(2):115–141
Sirianuntapiboon S, Chairattanawan K, Jungphungsukpanich S
(2006) Some properties of a sequencing batch reactor system
for removal of vat dyes. Bioresour Technol 97:1243–1252
Tantak NP, Chaudhari S (2006) Degradation of azo dyes by
sequencing Fenton’s oxidation and biological treatment.
J Hazard Mater 136:698–705
Tchobanoglous G, Burton FL, Stensel HD (2003) Wastewater
engineering treatment and reuse, 4th edn. McGraw-Hill,
New York
Turk O, Mavinic DS (1989) Maintaining nitrite buildup in a
system acclimated to free ammonia. Water Res 23(11):
1383–1388
van Hulle SWH, Volcke EIP, Teruel JL, Donckels B, van
Loosdrecht MCM, Vanrolleghem PA (2007) Influence of
temperature and pH on the kinetics of the Sharon nitritation
process. J Chem Technol Biotechnol 82(5):471–480
Yang S, Yang F (2011) Nitrogen removal via short-cut simul-
taneous nitrification and denitrification in an intermittently
aerated moving bed membrane bioreactor. J Hazard Mater
195:318–323
Yang SF, Liu QS, Tay JH, Liu Y (2004) Growth kinetics of
aerobic granules developed in sequencing batch reactors.
Lett Appl Microbiol 38:106–112
Yang Q, Peng YZ, Liu XH, Zeng W, Mino T, Satoh H (2007)
Nitrogen removal via nitrite from municipal wastewater at
low temperatures using real-time control to optimize nitri-
fying communities. Environ Sci Technol 41(23):8159–8164
Biodegradation (2013) 24:427–435
Young SN, Chang HL, Tae KL, Song WL, Young SP, You KO,
Sung HP, Seung KS (2005) Photocatalytic decomposition
of nonbiodegradable substances in wastewater from an
acrylic fiber manufacturing process. Korean J Chem Eng
22:246–249
Zhang Y, Zhao J, Gu G (2003) Biodegradation kinetic of organic
compounds of acrylic fiber wastewater in biofilm. J Envi-
ron Sci Chin 15:757–761
435
Zhang Y, Zhou J, Zhang J, Yuan S (2009) An innovative
membrane bioreactor and packed-bed biofilm reactor
combined system for shortcut nitrification-denitrification.
J Environ Sci Chin 21:568–574
Zhu GB, Peng YZ, Li BK, Guo JH, Yang Q, Wang SY (2008)
Biological removal of nitrogen from wastewater. Rev
Environ Contam Toxicol 192:159–195
123