Biochemical and Biophysical Research Communications 514 (2019) 301e307

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier.com/locate/ybbrc

Simultaneous enhancement of barley b-amylase thermostability and

catalytic activity by R115 and T387 residue sites mutation
Xueliang Wang a, Chengtuo Niu a, Min Bao a, Yongxian Li a, Chunfeng Liu a, Zhengfei Yun a,
Qi Li a, b, Jingjing Wang a, *
a
Key Laboratory of Industrial Biotechnology, Ministry of Education, School of Biotechnology, Jiangnan University, Wuxi, 214122, China
b
Collaborative Innovation Center of Jiangsu Modern Industrial Fermentation, Jiangnan University, Wuxi, 214122, China

a r t i c l e i n f o a b s t r a c t

Article history: Objective: To simultaneously increase the thermostability and catalytic activity of barley b-amylase.
Received 1 April 2019 Methods: The amino acid sequences of various barley b-amylases with different enzyme properties were
Accepted 13 April 2019 aligned, two amino acid residues R115 and T387 were identified to be important for barley b-amylase
Available online 25 April 2019
properties. R115C and T387V were then generated using site-directed and saturation mutagenesis.
Results: R115C and T387V mutants increased the enzyme catalytic activity and thermostability,
Keywords:
respectively. After combinational mutagenesis, the T50 value and to(1/2,60C) value of R115C/T387V mutant
Barley b-amylases
reached 59.4
C and 48.8 min, which were 3.6
C higher and 29.5 min longer than those of wild-type. The
Sequence alignment
Thermostability
kcat/Km value of mutant R115C/T387V were 59.82/s$mM, which were 54.7% higher than that of wild-type.
Catalytic activity The increased surface hydrophobicity and newly formed strong hydrogen bonds and salt bridges might
Hydrophobicity be responsible for the enzyme thermostability improvement while the two additional hydrogen bonds
formed in the active center may lead to the catalytic property enhancement.
Conclusions: The mutant R115C/T387V showed high catalytic activity and thermostability indicating
great potential for application in industry.
© 2019 Elsevier Inc. All rights reserved.

1. Introduction Protein engineering is a useful tool to improve the enzyme

b-Amylases (a-1,4-glucan maltohydrolase, EC 3.2.1.2) could hy-
drolyze a-1,4-glucosidic linkages of starch from the non-reducing
end and break down starch into b-maltose and b-limit-dextrins.
Barley b-amylases usually have better thermostability than those
from microbes, thus attracting attention from researchers. How-
ever, b-amylase activity is insuffcient in most commercial malts and
appears to be rate-limiting for starch hydrolysis during mashing
[1]. Besides, b-amylase is thermal sensitive and can be easily
inactivated in the high temperature environment, which inhibit its
further application. In the brewing industry, b-amylase is usually
added in the mashing process which temperature was raised from
48
C to 78
C. Therefore, high thermostability and catalytic activity
are of great significance for the application of b-amylase in in-
dustries [2].
properties [3]. Different factors influencing the b-amylase ther-
mostability and catalytic activity were evaluated in previous re-
searches, including random mutantion [4], site-directed
mutagenesis by comparison of three allelic forms of baley b-
Amylase [5,6], removal of C-terminal [7], analysis of the active site
[8] and substrate docking [9]. Although efforts on b-amylase engi-
neering have been made, the thermostability and catalytic activity
of barley b-amylase were still insufficient for industrial application.
In this study, the amino acid sequences of various b-amylases
with different enzyme properties were aligned and two amino acid
residues R115 and T387 were identified and proposed to be
important for b-amylase catalytic activity and thermostability. To
gain insights into the roles of these two residues, site-directed
mutagenesis and saturation mutagenesis were adopted. Then,
positive mutantions were combined and the inner mechanism of
improvement in b-amylase enzyme properties at the structural
level was elaborated.

* Corresponding author. School of Biotechnology, Jiangnan University, 1800 Lihu

Avenue, Wuxi, Jiangsu, 214122, China
E-mail address: jjwang@jiangnan.edu.cn (J. Wang).

https://doi.org/10.1016/j.bbrc.2019.04.095
0006-291X/© 2019 Elsevier Inc. All rights reserved.
302 X. Wang et al. / Biochemical and Biophysical Research Communications 514 (2019) 301e307
2. Materials and methods
2.1. Strains, plasmids and culture media
The barley b-amylase gene Bmy1 DNA sequence was obtained
from NCBI (GenBank: D49999). The pET-28a(þ)-Bmy1 was con-
structed in our laboratory. Terrific-Broth (TB) media was used for
protein production (supplemented with 50 mg kanamycin/ml or
0.16 mM isopropyl b-D-thiogalactoside (IPTG) and 8 mM a-lactose
when necessary).
2.2. Mutagenesis
The recombinant plasmid pET28a(þ)-Bmy1 was used as tem-
plate for site-directed mutagenesis. Mutated enzymes were
generated by QuickChange mutagenesis strategy as described by
Sambrook et al. [10]. The PCR primer for R115C was
GAGACGTGGGCACATGCGATCCGGACATC while that for T387A was
CCGAGATACGACCCTGCAGCGTACAACACG (Mutated sites were
underlined). NNK degenerate codons were used to generated
different amino acids at T387 residue site. The PCR products were
digested with DpnI at 37
C for 2 h and then transformed into E. coli
BL21(DE3) competent cells.
2.3. High throughput screening
The enzyme activity of wild-type Bmy1 and various mutants
were firstly measured. The mutants which contained lower cata-
lytic activity than that of the wild-type were then removed. After
that, the 96-well microplates were heated at 60
C in microplate
reader for 20 min and then cooled on ice. The enzyme activity of
wild-type Bmy1 and mutants were measured and the relative ac-
tivity was defined as Uheat/Uori (Uheat and Uori were the activities of
enzymes with or without heat treatment).
2.4. Expression and purification
Protein expression was induced by IPTG and a-lactosex and
cultivation at 20
C for 10 h, the cells were harvested by centrifu-
gation at 6000 rpm for 10 min at 4
C and then disrupted by ultra-
sonication. The supernatant was then loaded into HiTrap Q HP
anion exchange column (Amersham Biosciences, Uppsala, Sweden).
The elution liquid was concentrated using a Ultrafiltration con-
centration tube with a 10 kDa cutoff membrane (Biopeony, Beijing,
China). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) and Bradford method were employed to analyze the
protein purity and the total protein concentration.
2.5. Enzyme activity and kinetic parameters assay
The b-amylase activity was determined using a K-BETA3-
AMYLASE b-amylase assay kit obtained from Megazyme with mi-
nor modification. One Unit of activity is defined as the amount of
enzyme required to release 1 mM of p-nitrophenol from PNPG5 in
1 min under the defined assay conditions.
Kinetic parameters of the enzymes were derived from the re-
actions with 0.125e10 mg/mL soluble starch. Initial velocities were
derived from the determination of reducing sugar content using the
Somogyi-Nelson method [11]. The amount of enzyme that catalyzes
the release of 1 mmol of reducing sugar/min is defined as one unit of
enzymatic activity. The kinetic parameters (Km and kcat) were
calculated using the Eadie-Hoftee plots.
2.6. Thermostability assay
The optimal enzymatic temperature were determined by
measuring the enzymatic activities at a temperature range of
40e70
C. The protein half-inactivation temperature (T50) value is
defined as the temperature at which the enzyme lost 50% of initial
enzymatic activity after heat treatment. The experiment was per-
formed by measuring the remaining enzymatic activities after in-
cubation at temperatures from 50 to 65
C for 20 min and then
immediately cooling on ice for 10min. To obtain the enzyme decay
condition at high temperatures, the enzyme solution was incubated
at 50
C and 60
C over time and the remaining enzymatic activity
was measured at a series of time-points. The to(1/2,XC) value was
derived from the inactivation curve when the b-Amylase lost 50% of
its activity at selected temperatures.
2.7. Molecular structure analysis
The wild type barley b-amylase protein structure was generated
using SWISS-MODEL online program (https://www.swissmodel.
expasy.org/). Structure visualization was performed using Pymol
software (https://pymol.org/2/). Salt bridges were calculated online
by submitting the coordinate files to ESBRI (http://bioinformatica.
isa.cnr.it/ESBRI/) [12] and the distance between the two atoms of
opposite charge was set at less than 4 Å. Calculation of hydrogen
bonds were accomplished using HBAT tool (https://sourceforge.
net/projects/hbat/).
3. Results
3.1. Amino acid sequence alignment
To improve the enzyme properties of b-amylase, the amino acid
sequences of b-amylases from barley Haruna nijo and 9 other barley
strains with different enzymatic activities were aligned. As shown
in Fig. 1 and 12 different amino acid sites were identified. Among
them, 7 residue sites were obtained from barley b-amylases vari-
eties with low enzyme activity (NO.165, NO.211, NO.233, NO.347,
NO.410, NO.430 and NO.527); 3 amino acid residues (NO.453,
NO.488 and NO.518) were obtained from barley L48, which only
possessed moderate enzyme activity. Two amino acids residue sites
were considered worth engineering. In residue site 115, C115 was
found in two barley varieties with high enzyme activity, and two
barley varieties with low enzyme activity also posses C115, while
the corresponding amino acid was Arg in b-amylases with low
catalytic activity, so it is interesting to know if the differences of
enzyme activity between barley varieties is due to 115 site. Inter-
estingly, T387A mutation was found in b-amylase from barley
W127 which showed the highest enzymatic activity. Thus, R115 and
T387 residues were subjected to further analysis.
3.2. Enzymology properties of site-directed mutagenesis
The expressed mutants were purified by HiTrap QHP anion ex-
change column and verified by SDS-PAGE analysis(Supplementary
Fig. S1). The thermostability and kinetic parameters are given in
Tables 1 and 2 and further details are shown in Fig. 2, The specific
activity of R115C mutant was 30% higher than that of wild-type. Its
Km value was lower than that of wild-type while the kcat value of
mutant R115C reached 390.34/s, which was 22.9% higher than that
of wild-type. The to(1/2,60C) value of mutant T387A reached 41.2 min,
which was 113% higher than wild-type(Fig. 1d). These results
indicated that R115C improved catalytic efficiency and the sub-
strate binding affinity of b-amylase while T387A enhanced the
thermostability of b-amylase. The improved catalytic efficiency of
 X. Wang et al. / Biochemical and Biophysical Research Communications 514 (2019) 301e307 303

Fig. 1. Amino acid sequences alignment of 10 barley b-amylases with various enzyme activity (Except for Haruna Nijo as a template, the other varieties are listed based on the
enzyme activity from high to low. Numbers represent enzyme activity, the unit is U/g flour, the signal peptide sequences were not included). GeneBank accessions numbers are as
follows: Haruna Nijo (D49999), W127(KF302669), Ashqelon(FJ161078), L48 (KF302674), PI296897 (AF061204), L35 (KF302671), L47 (KF302673), m279 (KF302670), z043
(KF302668), Harrington (FJ161079). The conserved residue sites in all barley b-amylases were shown in filled color, while the different residue sites were displayed in unfilled color.
The sequence alignment results were generated by BioEdit software (https://www.bioedit.com/). (For interpretation of the references to color in this figure legend, the reader is
referred to the Web version of this article.)

Table 1 R115C also indicated that at 115 site, C115 seems has positive effect
Thermostability parameters of wild-type Bmy1 and its mutants. on the activity of barley b-amylase, the reasons for the barley
Protein samples t(1/2,60
C) (min) T50 (oC) varieties(Fig. 1) that posses C115 with low enzyme activity may be
amino acids differences at other sites.
WT 19.3 55.8
R115C 16.2 55.4
T387A 41.2 57.3 3.3. Saturation mutagenesis
T387V 54.3 60.1
T387I 44.7 59.2
T387P 9.8 53.3 T387 is highly conserved in majority barley Varieties and
R115C/T387V 48.8 59.4 mutating T387 residue site could significantly influence the ther-
mostability of barley b-amylase. To get more information about the
role of this residue site on enzyme thermostability, saturation
mutagenesis in T387 was conducted. Two mutants with better
thermostability were isolated and identified to be T387V and T387I.

Table 2
Specific activities and kinetic parameters of wild-type Bmy1 and various mutants.

Protein samples Specific activity (U/mg) Km (mM) Kcat (/s) Kcat/Km (/s$mM)

WT 106.2 ± 9.3 8.21 ± 0.35 317.38 38.67

R115C 137.5 ± 14.2 5.84 ± 0.23 390.34 66.84
T387A 117.1 ± 11.3 7.73 ± 0.37 338.89 43.84
T387V 104.9 ± 13.5 7.91 ± 0.41 319.63 40.41
T387I 112.0 ± 10.4 8.14 ± 0.21 333.24 40.94
T387P 91.1 ± 7.7 8.36 ± 0.39 287.92 34.50
R115C/T387V 135.3 ± 9.8 6.12 ± 0.28 366.07 59.82
304 X. Wang et al. / Biochemical and Biophysical Research Communications 514 (2019) 301e307

Fig. 2. Analysis of thermostability of wild-type Bmy1 and the mutant enzymes, each individual. determination was carried out three times (a) Optimal temperature; (b) The kinetic
stability curves; (c) The inactivation curve at 50
C; (d) The inactivation curve at 60
C.

The Uheat/Uori of wild-type Bmy1, T387A, T387V and T387I were
67.9%, 85.1%, 91.4% and 83.7% respectively, Mutant T387P with
markedly decreased thermostability was selected as control.
3.4. Enzymatic properties of mutants
The kinetic stability parameters of T387V, T387I and T387P were
characterized and shown in Table 1and Fig. 2, The T50 values for
T387V and T387I mutants were 4.3
C and 3.4
C higher than that of
wild-type. The relative activities of T387V and T387I mutants
decreased at much slower rates compared to that of wild-type at
50
C and 60
C and The to(1/2,60C) values of T387V and T387I mutants
were 181.3% and 131.6% longer than that of wild-type Bmy1. As for
T387P, its thermostability was obviously decreased compared to
wild-type Bmy1.
The kinetic parameters were shown in Table 2, The kcat and kcat/
Km values of T387A, T387V and T387I mutants were higher than
that of wild type enzyme, indicating the enhancement of enzyme
catalytic efficiency. The Kcat and kcat/Km values for T387P were
lower than that of wild-type, which means the catalytic efficiency
of T387P was decreased.
3.5. Combinational mutagenesis
R115C mutant showed the higher catalytic efficiency while
T387V mutant showed the better thermostability, double mutant
R115C/T387V was constructed since combined positive mutants
was reported to be able to further enhance the enzyme property
[13]. The kinetic stability parameters of the double mutant were
similar to that of T387V. The t(1/2,60
C) of R115C/T387V was
48.8 min, which was 5.5 min shorter than that of T387V but
29.5 min longer than that of wild-type. Its kcat and kcat/Km values
were 15.3% and 54.7% higher than that of wild-type. This indicated
that higher catalytic activity and better thermostability were ach-
ieved in the R115C/T387V mutant.
3.6. Structural analysis between wild-type Bmy1 and double
mutant
To reveal the inner mechanism of the enhancement of catalytic
activity and thermostability by the double mutation, the 3D
structures of wild type and R115C/T387V mutant were generated
(Supplementary File S1) and shown in Fig. 3a and Fig. 3b. The two
mutation sites R115C and T387V were both located at the enzyme
surface. When R115 was mutated to C115, an additional hydrogen
bond was formed between Cys115 and Asp111 (Fig. 3c). Residue site
T387 was located at the edge of an a-helix (Fig. 3a) which is
completely exposed to the solvent and the residue has little inter-
action with neighboring residues. Though no obvious changes in
the mutant region occurred when T387 was mutated into V387 in
the double mutant, changes in the catalytic active center were
observed (Fig. 3d). In the wild-type Bmy1, E378 was located in a
 X. Wang et al. / Biochemical and Biophysical Research Communications 514 (2019) 301e307 305

Fig. 3. Comparison of the 3D structures of wild-type Bmy1 and the R115C/T387V mutant (the double mutant sites were shown in sticks); (a): the 3D structures of wild-type Bmy1;
(b): the 3D structures of the double mutant R115C/T387V; (c): Comparison of the hydrogen bonds in R115C mutant region formed by Arg115; (d): Comparison of active center of
wild-type Bmy1 and the R115C/T387V mutant in Glu378 region; (e): Comparison of the hydrogen bonds between Glu378 and other residues. The helix, b-sheet, loop and substrate
were shown in red, yellow, green and blue, respectively. The hydrogen bonds were depicted as dash in yellow. Structure visualization was performed using software pymol. (For
interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

loop region and four hydrogen bonds were observed between E378, number of different hydrogen bonds types and the total salt bridges
K293, N338, F339 and the substrate. In the double mutant, E378 of wild-type Bmy1 and the double mutant were calculated and
was located in a b-sheet and two more hydrogen bonds were listed in Table 3. As shown in Table 3, the total hydrogen bonds
formed between E378, A342 and K293(Fig. 3e). In addition, the number of R115C/T387V was less than that of wild-type Bmy1. As
306 X. Wang et al. / Biochemical and Biophysical Research Communications 514 (2019) 301e307
Table 3
Comparison of interactions between wild-type Bmy1 and the double mutant.
Interactions WT R115C/T387V
NeH..O 608 600
OeH..O 37 41
NeH..N 294 280
OeH..N 7 8
CeH..O 1181 1195
CeH..N 350 322
NeH..S 2 3
OeH..S 1 1
CeH..S 24 20
Total salt bridges number 37 40
for different hydrogen bonds types, hydrogen bonds types like
NeH..N and CeH..N were remarkedly decreased in R115C/T387V
mutant, while the types of OeH..O and CeH..O bonds were
increased. The total salt bridges number of wild-type Bmy1 and the
R115C/T387V were 37 and 40, respectively, indicating three more
salt bridges were formed in the R115C/T387V mutant.
4. Discussion
The thermostability of the obtained T387A, T387I and T387V
mutants were all higher than that of wild-type. Interestingly, we
found that Alanine, Isoleucine and Valine were all hydrophobic
while Threonine was hydrophile. The hydrophobic parameters of
Thr, Ala, Val and IIe were 0.7, 1.8, 4.2 and 4.5, respectively. Hy-
drophobic interactions mainly affect the conformational entropy of
protein and played key roles in the formation and stability of pro-
tein three-dimensional structure. The stability of thermophiles is
correlated to their hydrophobic properties, especially the in-
teractions between protein surfaces and the surrounding water
[14]. Hydrophobic amino acids have also been found to improve the
enzyme thermostability by replacing polar amino acids on the
protein surface [15]. Besides, residue site No.387 is located at the
edge of an a-helix, which was easily influenced by the hydrophobic
effect [16]. The a-helix would be induced to make protein structure
more compact by strengthening the hydrogen bonds and inter-
molecular forces. Moreover, higher percentage of aliphatic amino
acid was reported in thermophilic enzyme than mesophilic
enzyme, especially isoleucine and valine [17]. It was proposed that
serine and threonine on the protein surface could interact with
water molecules (usually through hydrogen bonds) and the boun-
ded water molecules would be released at high temperature,
causing instability of the local structure of protein-water binding,
which finally leading to structural instability of the entire protein
[18].
The total salt bridges number of R115C/T387V mutant was larger
than that of wild-type Bmy1. More salt bridges make protein
structure more rigid and the salt bridge network could rigidify
protein structure at high temperatures [19]. Despite the total
hydrogen bonds number were decreased in R115C/T387V mutant,
the proportion of strong hydrogen bonds were significantly
increased. Trp and Tyr are mainly involved in the formation of
OeH..O hydrogen bond type in R115C/T387V mutant. Main chain-
main chain hydrogen bond numbers and uncharged-uncharged
hydrogen bond numbers decreased dramatically in thermophilic
proteins while the conventional hydrogen bond category (such as
OeH..O and OeH..N) were the strongest among all hydrogen bond
types. The strengths of amino acid in forming hydrogen bonds were
His > Tyr > Trp [20,21]. Therefore, the newly formed strong
hydrogen bonds and salt bridges and the surface hydrophobicity
might be responsible for the thermostability improvement of
barley b-amylase. As for T387P, it was reported that Pro would block
the formation of helix structure [22] and this might be the reason
for the significant decreased catalytic properties and
thermostability.
The catalytic activity of b-amylase was also enhanced in the
double mutant. As shown in Fig. 3e, Glu378 formed a hydrogen
bond with substrate in the wild-type enzyme. In the double
mutant, two additional hydrogen bonds (E378 with A342 and E378
with K293) were formed in this region. Glu378 was locate in the
active site pocket of soybean b-amylase and closely to the key
catalytic residue Glu380 [23]. The additional formation of hydrogen
bond would decreased the substrate binding pocket, thus makes
the binding of enzyme-substrate more tightly [24]. In the region
around residue site No.115, one more hydrogen bond (Cys115 with
Asp111) was formed in the double mutant. Therefore, the newly
formed hydrogen bonds in these two regions might be the reason
for the enhancement of catalytic activity.
5. Conclusion
In this study, a b-amylase with better thermostability and cat-
alytic property was obtained through double mutation of R115C/
T387V. The optimal enzymatic temperature and T50 values of the
double mutant was increased by 5
C and 3.6
C while the half-life
values at 50
C and 60
C were also largely extended. The double
mutant R115C/T387V also enhanced the catalytic properties of b-
amylase. The changes in surface hydrophobicity and the newly
formation of strong type hydrogen bonds and salt bridges were
speculated to be the main reason for the thermostability
enhancement. The improvement in enzyme catalytic property
might result from the compact catalytic pocket induced by the
formation of new hydrogen bonds.
Conflicts of interest
The authors declare that they have no conflict of interest.
Acknowledgements
The authors appreciated the support from Collaborative Inno-
vation Center of Jiangsu Modern Industrial Fermentation in Jian-
gnan University. This study was funded by the National Science
Foundation (No.31571942, No.31601558 & No.31771963), Program
of Introducing Talents of Discipline to Universities (No.111-2-06)
and the Fundamental Research Funds for the Central Universities
(No.JUSRP11841).
Appendix A. Supplementary data
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.bbrc.2019.04.095.
References
[1] Y.F. Ma, D.E. Evans, S.J. Logue, P. Langridge, Mutations of barley beta-amylase
that improve substrate-binding affinity and thermostability, Mol. Genet.
Genom. 266 (2001) 345e352.
[2] P.V. Aiyer, Amylases and their applications, Afr. J. Biotechnol. 4 (2013)
1525e1529.
[3] K. Kurosawa, T. Hosaka, N. Tamehiro, T. Inaoka, K. Ochi, Improvement of
alpha-amylase production by modulation of ribosomal component protein
S12 in Bacillus subtilis 168, Appl. Environ. Microbiol. 72 (2006) 71e77.
[4] Y. Okada, N. Yoshigi, H. Sahara, S. Koshino, Increase in thermostability of re-
combinant barley beta-amylase by random mutagenesis, Biosci. Biotechnol.
Biochem. 59 (1995) 1152e1153.
[5] N. Yoshigi, Y. Okada, H. Maeba, H. Sahara, T. Tamaki, Construction of a plasmid
used for the expression of a sevenfold-mutant barley beta-amylase with
increased thermostability in Escherichia coli and properties of the sevenfold-
mutant beta-amylase, J. Biochem. 118 (1995) 562e567.
 X. Wang et al. / Biochemical and Biophysical Research Communications 514 (2019) 301e307
[6] M. YF, E. DE, L. SJ, L. P, Mutations of barley beta-amylase that improve
substrate-binding affinity and thermostability, Mol. Genet. Genom. 266 (2001)
345e352.
[7] Y.F. Ma, J.K. Eglinton, D.E. Evans, S.J. Logue, P. Langridge, Removal of the four
C-terminal glycine-rich repeats enhances the thermostability and substrate
binding affinity of barley beta-amylase, Biochemistry 39 (2000) 13350.
[8] A. Totsuka, Functional analysis of Glu380 and Leu383 of soybean b-amylase: a
proposed action mechan-ism, FEBS J. 240 (1996) 655e659.
[9] W.M. Rockey, A. Laederach, P.J. Reilly, Automated docking of a-(1/4)- and a-
(1/6)-linked glucosyl trisaccharides and maltopentaose into the soybean b-
amylase active site, Proteins Struct. Funct. Bioinformat. 40 (2015) 299e309.
[10] G.A. Reid, Molecular Cloning: A Laboratory Manual, second ed., vol. 9, 1991,
pp. 213e214. Trends in Biotechnology.
[11] L. JM, F. LE, A. P, Structure of plant cell walls. Purification and characterization
of a beta-1,4-galactanase which degrades a structural component of the pri-
mary cell walls of dicots, J. Biol. Chem. 251 (1976) 5904e5910.
[12] W. Bai, C. Zhou, Y. Zhao, Q. Wang, Y. Ma, Structural insight into and mutational
analysis of family 11 xylanases: implications for mechanisms of higher pH
catalytic adaptation, PLoS One 10 (2015), e0132834.
[13] Z.G. Zhang, Z.L. Yi, X.Q. Pei, Z.L. Wu, Improving the thermostability of Geo-
bacillus stearothermophilus xylanase XT6 by directed evolution and site-
directed mutagenesis, Bioresour. Technol. 101 (2010) 9272e9278.
[14] G. Vogt, S. Woell, P. Argos, Protein thermal stability, hydrogen bonds, and ion
pairs, J. Mol. Biol. 269 (1997) 631e643.
[15] S. Spector, M. Wang Sa, J. Robblee, Z. Hendsch, R. Fairman, B. Tidor, D. Raleigh,
307
Rational modification of protein stability by the mutation of charged surface
residues, Biochemistry 39 (2000) 872e879.
[16] M. Blaber, X.J. Zhang, B.W. Matthews, Structural basis of amino acid alpha
helix propensity, Science 260 (1993) 1637e1640.
[17] J.T. Kellis, K. Nyberg, D. Breveail, S. brevea, A.R. Fersht, Contribution of hy-
drophobic interactions to protein stability, J. Mol. Biol. 408 (1988) 514e528.
[18] H.G. Nagendra, N. Sukumar, M. Vijayan, Role of water in plasticity, stability,
and action of proteins: the crystal structures of lysozyme at very low levels of
hydration, Proteins Struc. Funct. Bioinformat. 32 (2015) 229e240.
[19] Chung-JungTsai SandeepKumar, RuthNussinov BuyongMa, Contribution of
salt bridges toward protein thermostability, J. Biomol. Struct. Dyn. 17 (2000)
79e85.
[20] S. Scheiner, A. Tapas Kar, J. Pattanayak, Comparison of various types of
hydrogen bonds involving aromatic amino acids, J. Am. Chem. Soc. 124 (2002)
13257e13264.
[21] Y. Ding, Y. Cai, W. Xu, The study on the relationship between hydrogen bond
and protein thermostability, Comput. Appl. Chem. (2007-05).
[22] S. Kumar, C.J. Tsai, R. Nussinov, Factors enhancing protein thermostability,
Protein Eng. 13 (2000) 179e191.
[23] Y.N. Kang, M. Adachi, S. Utsumi, B. Mikami, The roles of Glu186 and Glu380 in
the catalytic reaction of soybean beta-amylase, J. Mol. Biol. 339 (2004)
1129e1140.
[24] R. Miao, H. Xie, F. Ho, P. Lindblad, Protein engineering of a-ketoisovalerate
decarboxylase for improved isobutanol production in Synechocystis PCC
6803, Metab. Eng. 47 (2018).