Methods in Molecular Biology 2210 Keiji Nagano Editor, Yoshiaki

Methods in
Molecular Biology 2210
Keiji Nagano
Yoshiaki Hasegawa Editors
Periodontal
Pathogens
Methods and Protocols
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK
For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
Periodontal Pathogens
Methods and Protocols
Edited by
Keiji Nagano
Division of Microbiology, Department of Oral Biology, School of Dentistry, Health Sciences
University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan
Yoshiaki Hasegawa
Department of Microbiology, School of Dentistry, Aichi Gakuin University, Nisshin, Aichi, Japan
Editors
Keiji Nagano Yoshiaki Hasegawa
Division of Microbiology Department of Microbiology
Department of Oral Biology School of Dentistry
School of Dentistry Aichi Gakuin University
Health Sciences University Nisshin, Aichi, Japan
of Hokkaido
Ishikari-Tobetsu, Hokkaido, Japan
ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-0938-5 ISBN 978-1-0716-0939-2 (eBook)
https://doi.org/10.1007/978-1-0716-0939-2
© Springer Science+Business Media, LLC, part of Springer Nature 2021

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Preface
Periodontal disease is characterized by chronic inflammation of periodontal tissue, often

leading to tooth loss. The disease is prevalent among humans, affecting approximately 50%
of all adults in most countries. In addition, periodontal disease adversely affects various
systemic diseases including diabetes, arteriosclerosis, and rheumatoid arthritis. Periodontal
disease is caused by multispecies bacterial biofilms in periodontal tissue. Several reports have
listed bacteria that act as periodontal pathogens, but the specific causal bacteria of periodon-
tal disease have not been definitively elucidated. This book addresses the major periodontal
pathogens implicated as causal agents including Porphyromonas gingivalis, Tannerella for-
sythia, Treponema denticola, Fusobacterium nucleatum, Aggregatibacter actinomycetemcomi-
tans, and Prevotella spp. The authors of this book first focus on a method for bacterial
genetic manipulation, which is of great importance because of the difficulty in generating
mutant periodontal pathogens with gene deletions. Next, the authors cover experimental
methods for studying type-V fimbriae, the type-IX secretion system, and the surface layer of
gram-negative bacteria (relatively new research areas developed by studying periodontal
pathogens). Additionally, the authors describe experimental methods for examining peri-
odontal pathogen-virulence factors (such as gingipain, dentilisin, leukotoxin, OmpA-like
proteins, butyric acid, lipoproteins, and membrane vesicles) and their interactions with other
pathogenic microorganisms (i.e., human immunodeficiency virus activation) and host cells
(i.e., gingival epithelial cells and vascular endothelial cells). Finally, a mouse model of
periodontitis is detailed. This book will serve as an extensive and useful reference for
researchers studying periodontal pathogens and will help elucidate the causes of periodontal
disease and the systemic diseases related with it.
Hokkaido, Japan Keiji Nagano

Aichi, Japan Yoshiaki Hasegawa
v
Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
PART I METHODS FOR BACTERIAL GENETIC MANIPULATION
1 Site-Directed and Random Mutagenesis in Porphyromonas gingivalis:

Construction of Fimbriae-Related-Gene Mutant . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
So-ichiro Nishiyama, Yoshiaki Hasegawa, and Keiji Nagano
2 Genetic Manipulations of Oral Spirochete Treponema denticola . . . . . . . . . . . . . . . 15
Kurni Kurniyati and Chunhao Li
3 Construction of a Gene-Deletion Mutant in Tannerella forsythia . . . . . . . . . . . . . 25
Keiji Nagano and Yoshiaki Hasegawa
4 Construction of a Mutant in Prevotella melaninogenica
Using the Conjugation Transfer Method with Escherichia coli . . . . . . . . . . . . . . . . 33
Yoshio Kondo
5 Genetic Transformation of Fusobacterium nucleatum . . . . . . . . . . . . . . . . . . . . . . . . 43
Akihiro Yoshida and Akihiko Ikegami
PART II EXPERIMENTAL METHODS TO EXAMINE VIRULENCE FACTORS
6 Genotyping of Porphyromonas gingivalis in Relationship to Virulence . . . . . . . . . 53

Atsuo Amano, Youn-Hee Choi, and Hiroki Takeuchi
7 Transport and Polymerization of Porphyromonas gingivalis Type V Pili . . . . . . . . 61
Mikio Shoji, Satoshi Shibata, Mariko Naito, and Koji Nakayama
8 Purification of Native Mfa1 Fimbriae from Porphyromonas gingivalis . . . . . . . . . . 75
Yoshiaki Hasegawa, Keiji Nagano, Yukitaka Murakami,
and Richard J. Lamont
9 Crystallization of Recombinant Fimbrial Proteins
of Porphyromonas gingivalis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Thomas Heidler and Karina Persson
10 Enzymatic Characteristics and Activities of Gingipains
from Porphyromonas gingivalis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
Tomoko Kadowaki
11 Structural Characterization of the Type IX Secretion System
in Porphyromonas gingivalis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113
Dhana G. Gorasia, Eric Hanssen, Paul D. Veith,
and Eric C. Reynolds
vii
viii Contents
12 Methods for Functional Characterization of the Type IX Secretion

System of Porphyromonas gingivalis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 123
Keiko Sato
13 Purification of Tannerella forsythia Surface-Layer (S-Layer) Proteins . . . . . . . . . . 135
Sreedevi Chinthamani, Prasad R. Settem, Kiyonobu Honma,
Takuma Nakajima, and Ashu Sharma
14 Separation of Glycosylated OmpA-Like Proteins from
Porphyromonas gingivalis and Tannerella forsythia. . . . . . . . . . . . . . . . . . . . . . . . . . . 143
Yukitaka Murakami, Keiji Nagano, and Yoshiaki Hasegawa
15 Intranasal Vaccine Study Using Porphyromonas gingivalis Membrane
Vesicles: Isolation Method and Application to a Mouse Model . . . . . . . . . . . . . . . 157
Satoru Hirayama and Ryoma Nakao
16 Analysis of the Butyrate-Producing Pathway in Porphyromonas gingivalis . . . . . . 167
Yasuo Yoshida
17 Characterization of the Treponema denticola Virulence Factor Dentilisin. . . . . . . 173
Yuichiro Kikuchi and Kazuyuki Ishihara
18 Evaluation of the Virulence of Aggregatibacter actinomycetemcomitans
Through the Analysis of Leukotoxin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185
Toshiyuki Nagasawa, Satsuki Kato, and Yasushi Furuichi
19 Lipoprotein Extraction from Microbial Membrane
and Lipoprotein/Lipopeptide Transfection into
Mammalian Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195
Akira Hasebe, Ayumi Saeki, and Ken-ichiro Shibata
PART III INTERACTIONS WITH OTHER PATHOGENIC MICROORGANISM

AND HOST CELLS
20 Analysis of the Interaction Between HIV and Periodontopathic

Bacteria That Reactivates HIV Replication in Latently Infected Cells . . . . . . . . . . 207
Kenichi Imai
21 Invasion of Gingival Epithelial Cells by Porphyromonas gingivalis . . . . . . . . . . . . . 215
Hiroki Takeuchi and Atsuo Amano
22 Analysis of Interaction Between Porphyromonas gingivalis
and Endothelial Cells In Vitro . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225
Kenji Matsushita
PART IV ANIMAL MODEL OF PERIODONTITIS

23 Analysis of Experimental Ligature-Induced Periodontitis
Model in Mice. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237
Hikaru Tamura, Tomoki Maekawa, Takumi Hiyoshi,
and Yutaka Terao
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251
Contributors
ATSUO AMANO • Department of Preventive Dentistry, Graduate School of Dentistry, Osaka

University, Suita, Osaka, Japan
SREEDEVI CHINTHAMANI • Department of Oral Biology, School of Dental Medicine, University
at Buffalo, State University of New York, Buffalo, NY, USA
YOUN-HEE CHOI • Department of Preventive Dentistry, School of Dentistry, Kyungpook
National University, Daegu, South Korea
YASUSHI FURUICHI • Division of Periodontology and Endodontology, Department of Oral
Rehabilitation, School of Dentistry, Health Sciences University of Hokkaido, Ishikari-gun,
Hokkaido, Japan
DHANA G. GORASIA • Oral Health Cooperative Centre, Melbourne Dental School, Bio21
Institute, The University of Melbourne, Parkville, VIC, Australia
ERIC HANSSEN • Department of Biochemistry and Molecular Biology, Bio21 Molecular
Science and Biotechnology Institute, University of Melbourne, Parkville, VIC, Australia;
Advanced Microscopy Facility, Bio21 Molecular Science and Biotechnology Institute,
University of Melbourne, Parkville, VIC, Australia
AKIRA HASEBE • Department of Oral Molecular Microbiology, Faculty of Dental Medicine
and Graduate School of Dental Medicine, Hokkaido University, Sapporo, Japan
YOSHIAKI HASEGAWA • Department of Microbiology, School of Dentistry, Aichi Gakuin
University, Nisshin, Aichi, Japan
THOMAS HEIDLER • Department of Chemistry, Umeå University, Umeå, Sweden
SATORU HIRAYAMA • Niigata University Graduate School of Medical and Dental Sciences,
Niigata, Japan; Department of Bacteriology I, National Institute of Infectious Diseases,
Tokyo, Japan
TAKUMI HIYOSHI • Division of Microbiology and Infectious Diseases, Graduate School of
Medical and Dental Sciences, Niigata University, Niigata, Japan; Division of
Periodontology, Graduate School of Medical and Dental Sciences, Niigata University,
Niigata, Japan
KIYONOBU HONMA • Department of Oral Biology, School of Dental Medicine, University at
Buffalo, State University of New York, Buffalo, NY, USA
AKIHIKO IKEGAMI • Department of Environmental and Preventive Medicine, Jichi Medical
University, Shimotsuke, Tochigi, Japan
KENICHI IMAI • Department of Microbiology, Nihon University School of Dentistry, Tokyo,
Japan; Division of Immunology and Pathobiology, Dental Research Center, Nihon
University School of Dentistry, Tokyo, Japan
KAZUYUKI ISHIHARA • Department of Microbiology, Tokyo Dental College, Tokyo, Japan; Oral
Health Science Center, Tokyo Dental College, Tokyo, Japan
TOMOKO KADOWAKI • Department of Frontier Life Science, Graduate School of Biomedical
Sciences, Nagasaki University, Nagasaki, Japan
SATSUKI KATO • Division of Periodontology and Endodontology, Department of Oral
Rehabilitation, School of Dentistry, Health Sciences University of Hokkaido, Ishikari-gun,
Hokkaido, Japan
YUICHIRO KIKUCHI • Department of Microbiology, Tokyo Dental College, Tokyo, Japan; Oral
Health Science Center, Tokyo Dental College, Tokyo, Japan
ix
x Contributors
YOSHIO KONDO • Department of Pediatric Dentistry, Nagasaki University Graduate School

of Biomedical Sciences, Nagasaki, Japan
KURNI KURNIYATI • Department of Oral and Craniofacial Molecular Biology, Philips
Institute for Oral Health Research, Virginia Commonwealth University, Richmond, VA,
USA
RICHARD J. LAMONT • Department of Oral Immunology and Infectious Diseases, University
of Louisville School of Dentistry, Louisville, KY, USA
CHUNHAO LI • Department of Oral and Craniofacial Molecular Biology, Philips Institute for
Oral Health Research, Virginia Commonwealth University, Richmond, VA, USA
TOMOKI MAEKAWA • Division of Microbiology and Infectious Diseases, Graduate School of
Medical and Dental Sciences, Niigata University, Niigata, Japan; Research Center for
Advanced Oral Science, Graduate School of Medical and Dental Sciences, Niigata
University, Niigata, Japan
KENJI MATSUSHITA • Department of Oral Disease Research, National Center for Geriatrics
and Gerontology, Obu, Aichi, Japan
YUKITAKA MURAKAMI • Department of Dental Basic Education (Biology), Asahi University
School of Dentistry, Mizuho, Gifu, Japan
KEIJI NAGANO • Division of Microbiology, Department of Oral Biology, School of Dentistry,
Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan
TOSHIYUKI NAGASAWA • Division of Advanced Clinical Education, Department of Integrated
Dental Education, School of Dentistry, Health Sciences University of Hokkaido, Ishikarih-
gun, Hokkaido, Japan
MARIKO NAITO • Department of Microbiology and Oral Infection, Graduate School of
Biomedical Sciences, Nagasaki University, Nagasaki, Japan
TAKUMA NAKAJIMA • Center for Medical Education, Faculty of Health Sciences, Ryotokuji
University, Chiba, Japan
RYOMA NAKAO • Department of Bacteriology I, National Institute of Infectious Diseases,
Tokyo, Japan
KOJI NAKAYAMA • Department of Microbiology and Oral Infection, Graduate School of
SO-ICHIRO NISHIYAMA • Faculty of Applied Life Sciences, Niigata University of Pharmacy
and Applied Life Sciences, Niigata, Japan
KARINA PERSSON • Department of Chemistry, Umeå University, Umeå, Sweden
ERIC C. REYNOLDS • Oral Health Cooperative Centre, Melbourne Dental School, Bio21
Institute, The University of Melbourne, Parkville, VIC, Australia
AYUMI SAEKI • Department of Oral Molecular Microbiology, Faculty of Dental Medicine and
Graduate School of Dental Medicine, Hokkaido University, Sapporo, Japan
KEIKO SATO • Department of Pediatric Dentistry, Nagasaki University Graduate School of
Biomedical Sciences, Nagasaki, Japan
PRASAD R. SETTEM • Department of Oral Biology, School of Dental Medicine, University at
ASHU SHARMA • Department of Oral Biology, School of Dental Medicine, University at
KEN-ICHIRO SHIBATA • Department of Oral Molecular Microbiology, Faculty of Dental
Medicine and Graduate School of Dental Medicine, Hokkaido University, Sapporo, Japan
SATOSHI SHIBATA • Molecular Cryo-Electron Microscopy Unit, Okinawa Institute of Science
and Technology Graduate University, Onna, Okinawa, Japan
Contributors xi
MIKIO SHOJI • Department of Microbiology and Oral Infection, Graduate School of

HIROKI TAKEUCHI • Department of Preventive Dentistry, Graduate School of Dentistry,
Osaka University, Suita, Osaka, Japan
HIKARU TAMURA • Division of Microbiology and Infectious Diseases, Graduate School of
University, Niigata, Japan; Division of Periodontology, Graduate School of Medical and
Dental Sciences, Niigata University, Niigata, Japan
YUTAKA TERAO • Division of Microbiology and Infectious Diseases, Graduate School of
University, Niigata, Japan
PAUL D. VEITH • Oral Health Cooperative Centre, Melbourne Dental School, Bio21 Institute,
The University of Melbourne, Parkville, VIC, Australia
AKIHIRO YOSHIDA • Department of Oral Microbiology, Matsumoto Dental University,
Shiojiri, Nagano, Japan
YASUO YOSHIDA • Department of Microbiology, School of Dentistry, Aichi Gakuin University,
Nagoya, Japan
Part I
Methods for Bacterial Genetic Manipulation

Chapter 1
Site-Directed and Random Mutagenesis in Porphyromonas

gingivalis: Construction of Fimbriae-Related-Gene Mutant
So-ichiro Nishiyama, Yoshiaki Hasegawa, and Keiji Nagano
Abstract
Porphyromonas gingivalis, an etiological agent of chronic periodontitis, is an asaccharolytic anaerobic
gram-negative coccobacillus. Genetic approaches greatly facilitate research on organisms at the
molecular level. Although with some challenges, the use of genetic techniques (such as constructing
knockout mutants) in P. gingivalis are feasible. In this chapter, we describe detailed methods for
site-directed and random mutagenesis through the construction of fimbriae-related gene mutants of
P. gingivalis.
Key words Porphyromonas gingivalis, Gene replacement, Site-directed mutagenesis, Homologous

recombination, Transposon mutagenesis
1 Introduction
Porphyromonas gingivalis, a gram-negative anaerobe, is a causative

agent of adult chronic periodontitis, which expresses a variety of
virulence factors, such as fimbriae/pili, lipopolysaccharide (LPS),
and gingipains [1, 2]. Large amounts of information on virulence
factors in this organism have accumulated through studies at
the physiological and molecular level. One example concerns type V
fimbriae and type IX secretion system for the secretion of
gingipains [3, 4].
P. gingivalis possesses two types of fimbriae, FimA and Mfa1
fimbriae, which are involved in host–bacterial adhesion, auto-
aggregation, coaggregation with other bacteria, and biofilm
formation [5, 6]. The gene fimA, which encodes the major compo-
nent of FimA fimbriae, forms an operon with downstream elements
fimB-fimE (Fig. 1). The products of the downstream genes, FimC-
FimE, appear to be accessory proteins of FimA fimbriae [6, 7].
Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology,
vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021
3
4 So-ichiro Nishiyama et al.
fimA fimB fimC fimD fimE
mfa1 mfa2 mfa3 mfa4 mfa5
Fig. 1 Schematic diagram of fimA and mfa1 gene clusters in the P. gingivalis ATCC 33277 strain. The cross in
fimB indicates the point of a nonsense mutation (TAA) in the strain. In some other strains, such as HW24D1,
fimB is intact and functions properly [8]
FimB (encoded by fimB, located immediately downstream of

fimA) plays a major role in regulating the number, length, and
biogenesis of FimA fimbriae [8], although the protein functions
unproperly in some type strains, including ATCC 33277 or
381, due to a nonsense mutation (Fig. 1). FimC and FimD may
play roles in the adhesive function of FimA fimbriae as a lack of
these components results in the loss of autoaggregation and
binding to extracellular matrices [7]. The fimbriae devoid of these
minor components (DAP fimbriae) showed a weakened virulence
and potentiated immune responses of host cells [9–11]. Our previ-
ous studies also suggested that FimE may function as an adaptor
protein connecting FimC and FimD [7, 10]. Similar to the gene
architectures and functions of FimA fimbriae, the mfa1–5
(PGN_0287-0291 [12]) genes also form a gene cluster (Fig. 1).
The Mfa1 protein is the major component of Mfa1 fimbriae. Mfa2
functions as a fimbrial anchor and length regulator [13]. Mfa3,
Mfa4, and Mfa5 are integrated into the fimbriae as minor
accessory proteins [14–16]. These studies have been performed
using genetic and biochemical techniques, including the construc-
tion of mutants that lack specific genes of interest. In the case of
FimA fimbriae, transposon mutagenesis and screening for fimbriae
mutants resulted in the identification of a two-component system
(FimS/R) that plays a role in the expression of the fimbriae
[17, 18].
For P. gingivalis, it is possible to replace the targeted gene(s)
(“reverse genetics”) with an erythromycin (Em)-resistance cassette,
ermF-ermAM (Fig. 2) [7, 19, 20]. For finding genes involved in the
function of interest, random mutagenesis by transposon insertion
(“forward genetics”) is also possible [17, 18]. A screening method
for the mutants has also been established. These methods will be
described in this chapter (see Note 1).
P. gingivalis Mutagenesis 5
a b target gene c d
P. gingivalis
chromosomal DNA
PCR with primers a-b
e
A
ermM-ermAF
PCR with primers c-d
a
2.1 kbp
PCR with primers a-e
d
B
C
a
PCR with primers a-d
Cloned into a plasmid vector
digestion
Linearization of the plasmid

using a restriction enzyme
Electroporation
ermM-ermAF
target gene
P. gingivalis
chromosomal DNA
Gene replacement
by homologous recombination
ermM-ermAF
P. gingivalis
chromosomal DNA
Fig. 2 Gene replacement in P. gingivalis by homologous recombination. The detailed procedures are described
in the text
2 Materials
2.1 Site-Directed 1. Strains: E. coli (DH5α, HB101, or BW19851) and P. gingivalis

Mutagenesis (ATCC 33277; see Note 1).
2.1.1 Culture Media 2. LB liquid medium or agar plate (for E. coli): 1% tryptone, 0.5%
and Antibiotics yeast extract, and 0.5% NaCl. Add 1.5% agar when necessary.
for Escherichia coli Antibiotics: add kanamycin (Km; 50 μg/mL), erythromycin
and P. gingivalis (Em; 20 μg/mL), chloramphenicol (Cm; 20 μg/mL), or tet-
racycline (Tc; 10 μg/mL) to LB medium when necessary.
3. sTSB liquid medium (for P. gingivalis): trypticase soy broth
supplemented with 0.25% (w/v) yeast extract, 2.5 μg/mL
hemin, 5.0 μg/mL menadione, and 0.01% (w/v) dithiothreitol
(see Note 2). sBHI liquid medium: 3.7% (w/v) Brain Heart
Infusion supplemented with 2.5 μg/mL hemin, 5.0 μg/mL
menadione, and 0.01% (w/v) dithiothreitol (see Note 2).
4. LRBB plates (for P. gingivalis): Brucella HK agar (Kyokuto)
supplemented with 5% (w/v) laked rabbit blood, 2.5 μg/mL
hemin, 5.0 μg/mL menadione, and 0.01% (w/v) DTT. Anti-
biotics: add gentamicin (Gm; 200 μg/mL, see Note 3) or
erythromycin (Em; 20 μg/mL) to sTSB or LRBB plates
when necessary.
5. Anaerobic culture instruments (for P. gingivalis): gas ratio at
10% CO2, 10% H2, and 80% N2.
2.1.2 Preparation of DNA 1. Chromosomal DNA of P. gingivalis (see Note 4).

Constructs 2. pVA2198 carrying the ermF-ermAM cassette [19].
3. Primers used for PCR reactions.
4. Thermal cycler for PCR reactions.
5. An apparatus for agarose gel electrophoresis.
2.1.3 Preparation 1. sBHI medium (see Subheading 2.1.1).

of P. gingivalis 2. EP buffer: 10% (w/v) glycerol and 1 mM MgCl2. Sterilize this
Competent Cells buffer by filtration (e.g., by Millipore 0.2 μm syringe filter).
3. Refrigerated centrifuge.
2.1.4 Electroporation 1. sTSB medium (see Subheading 2.1.1).

of P. gingivalis Cells 2. LRBB plate with Em (see Subheading 2.1.1).
3. Glass test tubes.
4. Electroporator (e.g., Bio-Rad MicroPulser or Gene Pulser).
2.2 Random 1. E. coli (HB101/R751::*Ω4 [18, 21] or BW19851/pEP4351

Mutagenesis [22]).
2.2.1 Transposon 2. P. gingivalis (ATCC 33277).
Mutagenesis 3. sTSB medium (see Subheading 2.1.1).
of P. gingivalis by 4. LB medium (see Subheading 2.1.1).
Conjugation
5. LRBB plates with Em (see Subheading 2.1.1).
6. 1.5 mL microtubes.
7. Spectrophotometer.
8. Microcentrifuge.
2.2.2 Colony 1. sTSB medium (see Subheading 2.1.1).

Immunoblotting 2. LRBB plates (see Subheading 2.1.1).
3. TBS buffer: 20 mM Tris–HCl, pH 7.4, 0.5 M NaCl.
4. TBS with 0.05% (w/v) Tween 20.
5. TBS with 1% bovine serum albumin (BSA).
6. Primary antibody against the target protein.
7. Enzyme-linked secondary antibody: for example, HRP (horse-
radish peroxidase)-labeled anti-rabbit goat antibody.
8. Visualization solution: For HRP-labeled secondary antibody,
25 mL TBS with 5 μL of 4-chloro-1-naphthol solution (15 μg/
mL, dissolved in methanol), and 15 μL of H2O2.
9. Circular nitrocellulose membranes fitting the diameter of the
petri dish.
10. Paintbrushes with soft bristles.
3 Methods
3.1 Site-Directed 1. Inoculate P. gingivalis cells with a toothpick from a single

Mutagenesis colony on a plate and culture in sTSB or sBHI anaerobically
at 37 C for 2 days (up to 48 h). Add gentamicin (see Subhead-
3.1.1 Culture Conditions
ing 2.1.1) if required (see Note 5).
for P. gingivalis and E. coli
2. Inoculate E. coli cells with a toothpick from a single colony on a
plate and culture overnight in LB with vigorous shaking at
37 C. Add antibiotics (see Subheading 2.1.1) if required.
3.1.2 Preparation of DNA Any nonessential genes of P. gingivalis can be deleted by replace-
Constructs ment with an ermF-ermAM cassette [19] via primer-extension and
homologous recombination [7, 20] (see Note 6). Site-directed
mutagenesis or restoration of a gene is also possible [8]. The steps
for gene replacement are schematically illustrated in Fig. 2. Briefly,
the upstream and downstream regions of the targeted gene are
PCR-amplified and merged with the ermF-ermAM cassette using
multistep PCR. The “hybrid” DNA fragment is then cloned into a

vector plasmid. The resultant plasmid is then digested using a
restriction enzyme for linearization and used for electroporation.
Occasionally, the linearized DNA fragment is incorporated into the
P. gingivalis chromosomal DNA by double-crossover
recombination.
1. Design primers as shown in Fig. 2a–e. The sequences of primer
a and reverse primer d should completely match the chromo-
somal sequence of P. gingivalis. The sequence of reverse primer
e should match the 30 end of the ermF-ermAM cassette. The
overlapping primers b and c have hybrid sequences of matching
P. gingivalis chromosomal DNA and the ermF-ermAM cas-
sette. Overlapping sequences should be approximately
20 bases in length. For efficient recombination, the length of
homologous sequences (i.e., the lengths between primers a–b
and c–d in Fig. 2) should be at least 500 base pairs in length (see
Note 7).
2. Amplify the DNA fragments with primers a and b using
P. gingivalis chromosomal DNA as a template for PCR (the
amplified fragment is designated as fragment “A” in Fig. 2).
3. Amplify the DNA fragments with primers a and e using frag-
ment A and the ermF-ermAM cassette as templates for PCR
(the amplified fragment is designated as fragment “B” in
Fig. 2).
4. Amplify the DNA fragments with primers c and d using
P. gingivalis chromosomal DNA as a template for PCR (the
amplified fragment is designated as fragment “C” in Fig. 2).
5. Amplify the DNA fragments with primers a and d using frag-
ments B and C as templates for PCR (the amplified fragment is
designated as fragment “D” in Fig. 2).
6. Clone the amplified DNA fragment D to a vector plasmid (see
Note 8).
7. Linearize the plasmid DNA by treatment with a restriction
enzyme to make a single cut at a unique site (see Note 9).
8. Desalinize the linearized DNA (up to 10 μg) using ethanol
precipitation or desalting spin columns.
3.1.3 Competent Cell 1. Inoculate a single colony of P. gingivalis into 3 mL of sBHI and
Preparation of P. gingivalis incubate anaerobically at 37 C overnight (see Notes 10
and 11).
2. Inoculate the overnight culture (1.0 mL) into 10 mL of sBHI
and incubate anaerobically at 37 C overnight (see Note 11).
3. Inoculate the culture (1.0 mL) into 90 mL of sBHI and incu-
bate anaerobically at 37 C for approximately 10–11 h (see
Note 11). The optical density at 600 nm (OD600) of the
culture should be approximately 0.35.
4. Harvest cells by centrifugation (2600 g) at 4 C for 10 min.

5. Resuspend the cells in 60 mL of EP buffer by gentle pipetting.
6. Collect the cells by centrifugation (2600 g) at 4 C for
10 min.
7. Resuspend the cells in 1 mL of EP buffer by gentle pipetting.
8. Distribute the samples into aliquots (100 μL each) and freeze
immediately (see Note 12).
9. Store the samples at 80 C (see Note 13).
3.1.4 Electroporation 1. Gently thaw the competent cells (100 μL) on ice.
of P. gingivalis 2. Add desalinized DNA solution (up to 10 μg).
3. Perform electroporation out at 2.5 kV (see Note 14).
4. Add TSB (1.0 mL) and transfer the samples into a glass
test tube.
5. Incubate the samples anaerobically at 37 C overnight.
6. Collect the cells by centrifugation.
7. Spread the cells onto LRBB plates containing Gm (200 μg/
mL) and Em (20 μg/mL). Incubate the plates anaerobically at
37 C for 7–10 days (see Note 15).
3.2 Random 1. Inoculate a single colony of P. gingivalis into 3 mL of sTSB and

Mutagenesis incubate anaerobically at 37 C overnight.
3.2.1 Transposon 2. Inoculate the culture (0.1 mL) into 5 mL of sTSB and incubate
Mutagenesis anaerobically at 37 C overnight. On the same day, add a single
of P. gingivalis colony of E. coli HB101/R751::*Ω4 or BW19851/pEP4351
by Conjugation (see Note 16) to 5 mL of LB containing Cm (20 μg/mL) and
Tc (10 μg/mL) and cultivate aerobically at 37 C overnight
with vigorous shaking.
3. Inoculate 30 μL of E. coli culture into 3 mL of LB and cultivate
aerobically at 37 C for approximately 2 h with vigorous shak-
ing (see Note 17).
4. Transfer 0.2 mL of E. coli culture to a microtube. Collect the
cells by centrifugation and remove the supernatant. Resuspend
the pellet in 0.5 mL of LB.
5. Add 1.0 mL of P. gingivalis culture (seestep 2 in Subheading
3.2.1) to the tube. Collect the cells by centrifugation and
remove the supernatant completely.
6. Resuspend the pellet in 50 μL of sTSB.
7. Spot the suspension on an LRBB plate without antibiotics (see
Note 18).
8. Incubate the LRBB plate anaerobically at 37 C for 15 to 20 h.
9. Scrape the cells from the spot using an inoculating loop and
suspend in 1 mL of sTSB.
10. Spread the cell suspension (0.2 mL) onto an LRBB plate con-
taining Gm (200 μg/mL) and Em (20 μg/mL) (see Note 19).
11. Incubate the LRBB plates anaerobically at 37 C for about
7–10 days to form conjugant colonies.
3.2.2 Screening The method described below was primarily developed for the
of Mutants (e.g., Lacking screening of FimA fimbriae mutants of P. gingivalis (Fig. 3) [18],
Outer Membrane Proteins): and allows for the identification of a two-component system
Colony Immunoblotting (FimS/R) involved in fimbriae synthesis [17]. We believe it can
also be used to screen for mutants lacking other outer membrane
proteins, with minor modifications.
1. Use toothpicks to create patches of conjugants on the LRBB
plates containing Em (20 μg/mL). Create up to 50 patches per
plate (Fig. 3) (see Note 20).
2. Incubate the plates anaerobically at 37 C for two nights.
Fig. 3 Screening for fimbriae-deficient mutants by colony immunoblotting. The

arrowhead at the top indicates positive (a fimbriate conjugant, patched as
“plus”) and a negative (a fimbriae-deficient mutant, patched as “minus”)
reactions of the control strains. The arrowhead in the middle indicates a
candidate for fimbriae-deficient conjugant. (Taken from Watanabe-Kato et al.
[18] with permission from Elsevier)
3. Transfer the cells to nitrocellulose membranes (one membrane

per plate).
4. After transferring, store the plates anaerobically at room tem-
perature until further use.
5. Wash each membrane with TBS at room temperature for
30 min.
6. Remove cells and any debris using a paintbrush (see Note 21).
7. Wash each membrane with TBS at room temperature for
5 min.
8. Wash each membrane with TBS with 0.05% (w/v) Tween 20 at
room temperature for 5 min.
9. Place each membrane on an empty petri dish.
10. Add TBS (20 mL) supplemented with 1% BSA and 10 μL of
primary antiserum to each dish (see Note 22).
11. Shake the dishes gently at room temperature for 2 h (see Note
23).
12. Wash the membranes twice with TBS containing 0.05% (w/v)
Tween 20 at room temperature for 5 min.
13. Wash the membranes twice with TBS at room temperature for
5 min.
14. Add TBS (20 mL) supplemented with 1% BSA and 10 μL of
enzyme-linked secondary antiserum (see Note 24).
15. Wash the membranes twice with TBS containing 0.05% (w/v)
Tween 20 at room temperature for 5 min.
16. Wash the membranes twice with TBS at room temperature for
5 min.
17. While washing, prepare the visualizing solution (see Subhead-
ing 2.2.2).
18. Rinse the membranes with distilled water (discard the water
immediately).
19. Add the visualizing solution under shaking at room tempera-
ture and allow to react for 5 min.
20. To stop the reaction, wash the membranes with tap water for
30 min, then dry.
21. Select the positive conjugants and identify the insertion regions
using pulse-field gel electrophoresis [22] or direct sequencing.
4 Notes
1. All of the methods described in this section were developed for

the ATCC 33277 strain and its derivatives. Therefore, we
cannot confirm that our methods can be successfully applied
to other P. gingivalis strains. For example, we have recognized
that it is difficult to construct gene-disrupted mutants of a
strain HW24D1 using the methods described in this chapter
(Nishiyama, unpublished data). The optimization of condi-
tions may be necessary to extend these methods to
P. gingivalis strains other than ATCC 33277.
2. It is very important to preincubate aliquots of liquid medium
anaerobically before inoculation (typically from 8 h to over-
night). This preincubation facilitates oxygen purging to ensure
the growth of P. gingivalis, which is an obligate anaerobe.
3. P. gingivalis is naturally resistant to gentamicin.
4. The chromosomal DNA of P. gingivalis can be acquired using a
purification kit for gram-negative bacteria (e.g., MasterPure
Complete DNA and RNA Purification Kit, Lucigen), accord-
ing to the manufacturer’s instructions.
5. To avoid contamination, gentamicin can be added to the
medium (see Note 3). If the P. gingivalis strain already carries
antibiotic-resistance gene(s) via primary mutagenesis, add the
corresponding antibiotics to the medium.
6. To create a double mutant, a chloramphenicol-resistance cas-
sette (cat) can be used as the secondary selection marker [20].
However, it will be more difficult to construct it because the
minimum inhibitory concentration (MIC) of chloramphenicol
for P. gingivalis is relatively low. Moreover, the MIC can be
influenced by the promoter activity of the target gene.
7. Typical examples of such primers have been described in the
literature [7, 20].
8. The cloning vector is arbitrary (e.g., zero-blunt TOPO,
Thermo Fisher Scientific) but must possess at least one unique
restriction site for linearization.
9. The complete digestion of the plasmid DNA will need to be
confirmed (typically by agarose gel electrophoresis of a sam-
ple). Residual circular plasmid DNA may result in the incor-
poration of an intact plasmid into the P. gingivalis
chromosome by a single crossover.
10. sTSB can be used instead of sBHI. However, in this case, the
growth rate is altered, such that culture dilution and incubation
time need to be adjusted.
11. sBHI (or sTSB) should be preincubated at 37 C in anaerobic

conditions for at least 8 h or longer to purge oxygen to allow
for the proper growth of P. gingivalis.
12. The use of dry ice is recommended for quick freezing.
13. Competent cells can remain stable for at least 3 months if
stored at 80 C.
14. In the case of the Bio-Rad MicroPulser, a 0.2 cm wide electro-
cuvette can be used with the program “Ec2” for
electroporation.
15. Typically, it takes about 7–10 days for the colonies to become
visible.
16. Plasmid R751::*Ω4 or pEP4351 is a suicide vector carrying
Tn4351 [18, 22].
17. For efficient conjugation, the growth stage of the E. coli donor
is very important. The optimum culture OD600 should be
limited from 0.2 to 0.3. Multiple independent cultures
enhance success. On the other hand, the growth stage for the
donor P. gingivalis is less critical (OD600 ¼ 0.5–1.0).
18. The cell suspension should be spotted at two or three places on
each LRBB plate.
19. Both antibiotics are needed to kill E. coli and unconjugated
P. gingivalis.
20. Alternatively, modified GAM agar plates (Nissui Pharmaceuti-
cal) can be used to reduce background signals, since the black
pigmentation of P. gingivalis does not occur on GAM plates.
However, the post-incubation of the plates at 37 C for several
days is necessary for additional growth after the transfer proce-
dure, since most of the cells adhere to the membranes.
21. This operation is very important for reducing noise.
22. The dilution rates of the primary antibody can vary depending
on the one you apply. Here, we describe the anti-FimA (poly-
mer) antibody as an example.
23. After this procedure, the membranes can be kept at 4 C
overnight optionally.
24. The dilution rates of the secondary antibody can vary depend-
ing on the antibody used. Here, we described the HRP-labeled
anti-rabbit goat antibody (Merck Millipore) as an example.
Acknowledgments
We would like to thank Professor John S. Parkinson (University of

Utah) for his critical reading of the manuscript.
References
1. Lamont RJ, Jenkinson HF (1998) Life below W83 revealed extensive genome rearrange-
the gum line: pathogenic mechanisms of Por- ments in P. gingivalis. DNA Res 15
phyromonas gingivalis. Microbiol Mol Biol Rev (4):215–225
62(4):1244–1263 13. Hasegawa Y, Iwami J, Sato K et al (2009)
2. How KY, Song KP, Chan KG (2016) Porphyr- Anchoring and length regulation of Porphyro-
omonas gingivalis: an overview of periodonto- monas gingivalis Mfa1 fimbriae by the down-
pathic pathogen below the gum line. Front stream gene product Mfa2. Microbiology 155
Microbiol 7:53 (Pt 10):3333–3347
3. Hospenthal MK, Costa TRD, Waksman G 14. Hasegawa Y, Iijima Y, Persson K et al (2016)
(2017) A comprehensive guide to pilus bio- Role of Mfa5 in expression of Mfa1 fimbriae in
genesis in Gram-negative bacteria. Nat Rev Porphyromonas gingivalis. J Dent Res 95
Microbiol 15(6):365–379 (11):1291–1297
4. Lasica AM, Ksiazek M, Madej M et al (2017) 15. Hasegawa Y, Nagano K, Ikai R et al (2013)
The Type IX secretion system (T9SS): high- Localization and function of the accessory pro-
lights and recent insights into its structure tein Mfa3 in Porphyromonas gingivalis Mfa1
and function. Front Cell Infect Microbiol fimbriae. Mol Oral Microbiol 28(6):467–480
7:215 16. Ikai R, Hasegawa Y, Izumigawa M et al (2015)
5. Enersen M, Nakano K, Amano A (2013) Por- Mfa4, an accessory protein of Mfa1 fimbriae,
phyromonas gingivalis fimbriae. J Oral Micro- modulates fimbrial biogenesis, cell auto-
biol 5:1–10 aggregation, and biofilm formation in Porphyr-
6. Yoshimura F, Murakami Y, Nishikawa K et al omonas gingivalis. PLoS One 10(10):
(2009) Surface components of Porphyromonas e0139454
gingivalis. J Periodontal Res 44(1):1–12 17. Hayashi J, Nishikawa K, Hirano R et al (2000)
7. Nishiyama S, Murakami Y, Nagata H et al Identification of a two-component signal trans-
(2007) Involvement of minor components duction system involved in fimbriation of Por-
associated with the FimA fimbriae of Porphyr- phyromonas gingivalis. Microbiol Immunol 44
omonas gingivalis in adhesive functions. Micro- (4):279–282
biology 153(Pt 6):1916–1925 18. Watanabe-Kato T, Hayashi JI, Terazawa Y et al
8. Nagano K, Hasegawa Y, Murakami Y et al (1998) Isolation and characterization of
(2010) FimB regulates FimA fimbriation in transposon-induced mutants of Porphyromonas
Porphyromonas gingivalis. J Dent Res 89 gingivalis deficient in fimbriation. Microb
(9):903–908 Pathog 24(1):25–35
9. Hajishengallis G, McIntosh ML, Nishiyama S 19. Fletcher HM, Schenkein HA, Morgan RM et al
et al (2013) Mechanism and implications of (1995) Virulence of a Porphyromonas gingivalis
CXCR4-mediated integrin activation by Por- W83 mutant defective in the prtH gene. Infect
phyromonas gingivalis. Mol Oral Microbiol 28 Immun 63(4):1521–1528
(4):239–249 20. Nagano K, Read EK, Murakami Y et al (2005)
10. Pierce DL, Nishiyama S, Liang S et al (2009) Trimeric structure of major outer membrane
Host adhesive activities and virulence of novel proteins homologous to OmpA in Porphyromo-
fimbrial proteins of Porphyromonas gingivalis. nas gingivalis. J Bacteriol 187(3):902–911
Infect Immun 77(8):3294–3301 21. Shoemaker NB, Getty C, Gardner JF et al
11. Wang M, Shakhatreh MA, James D et al (2007) (1986) Tn4351 transposes in Bacteroides spp.
Fimbrial proteins of Porphyromonas gingivalis and mediates the integration of plasmid R751
mediate in vivo virulence and exploit TLR2 and into the Bacteroides chromosome. J Bacteriol
complement receptor 3 to persist in macro- 165(3):929–936
phages. J Immunol 179(4):2349–2358 22. Alvarez B, Secades P, McBride MJ et al (2004)
12. Naito M, Hirakawa H, Yamashita A et al Development of genetic techniques for the
(2008) Determination of the genome sequence psychrotrophic fish pathogen Flavobacterium
of Porphyromonas gingivalis strain ATCC psychrophilum. Appl Environ Microbiol 70
33277 and genomic comparison with strain (1):581–587
Chapter 2
Genetic Manipulations of Oral Spirochete Treponema

denticola
Kurni Kurniyati and Chunhao Li
Abstract
There have been more than 60 different oral Treponema species identified in the oral cavity; however, only
few species can be cultivated in vitro reliably. Among those cultivable species, due to its medical importance
and genetic tractability, Treponema denticola, one of the keystone pathogens associated with human
periodontitis, has emerged as a paradigm model organism to understanding the genetics, etiology, and
pathophysiology of oral Treponema species. During the last two decades, several genetic tools have been
developed, which have played an instrumental role in the study of T. denticola. This chapter describes the
experimental design and procedure of genetic manipulations of T. denticola.
Key words Periodontal disease, Spirochete, Treponema denticola, Genetic manipulation
1 Introduction
Treponema denticola is an obligate anaerobic and highly motile

bacterium that is associated with human periodontitis (for a review,
see refs. 1–3). It is understudied mainly due to its fastidious growth
requirements and recalcitrance to genetic manipulations (for a
review, see refs. 4, 5). The first genetic transformation of
T. denticola was published in 1996 [6, 7]. Since then, several new
genetic tools have been developed, including transposon mutagen-
esis (Fig. 1a), antibiotics resistance markers, shuttle vectors, and a
counterselectable marker (Fig. 1b) [7–15]. The commonly used
genetic transformation method in T. denticola is electroporation
(electrotransformation), which is based on a high-voltage electric
pulse causing the cellular membrane to be transiently permeabi-
lized, subsequently allowing DNA to enter the cells [6, 7]. The
other method is chemically induced transformation, which is based
on the treatment of bacterial cells with divalent cations including
CaCl2, MgCl2, or RuCl2 and followed by heat shock [14, 16]. The
heat shock step depolarizes the cell membrane, facilitating DNA
entry into the cells. Compared to the electro-transformation, to
15
16 Kurni Kurniyati and Chunhao Li
Fig. 1 Diagrams illustrating strategies for gene deletion and complementation in T. denticola. (a) A modified
Himar1 vector for transposon mutagenesis of T. denticola. (b) A pyrF-based counterselectable knockout
system using the pPOPin vector to construct marker free deletion mutants. (c) Targeted gene deletion by
two-step PCR. (d) Cis-complementation of a gene by replacing the antibiotic cassette with a gene of interest
and a different antibiotic resistance cassette. Both constructs are generated by PCR. The arrows represent the
relative positions and orientations of the PCR primers. ORF open reading frame of a gene of interest, US‘
upstream region of a gene of interest, DS‘ downstream of a gene of interest
our experience, the chemically induced transformation method is

more efficient. This method has been regularly used in our labora-
tory for DNA transformation in T. denticola. By using this method,
numerous mutants have been successfully generated. To our expe-
rience, the key factor that affects the transformation success and
efficacy in T. denticola includes: (1) growth phase of cell cultures for
competent cell preparations, (2) growth media, and (3) exposure
time of the cells to oxygen. In this chapter, we describe the detail
methodologies in genetic manipulations, which will help other
laboratories to construct T. denticola mutants.
Genetic manipulation and Treponema denticola 17
2 Materials
1. T. denticola ATCC 35405 and ATCC 33520 are two com-

monly used lab strains, which are available from ATCC
(http://www.atcc.org) (see Note 1).
2. Escherichia coli strain DH5α (New England BioLabs) is used
for DNA cloning and plasmid amplifications.
3. T. denticola is cultured at 37 C in an anaerobic chamber
(Anaerobe Systems) in the presence of 85% nitrogen, 10% car-
bon dioxide, and 5% hydrogen. E. coli is cultured in incubators
and shakers at 37 C.
4. Tryptone-yeast extract-gelatin-volatile fatty acids-serum
(TYGVS) medium [17]: three solutions are separately
prepared. To prepare the first solution (800 mL), dissolve the
following items in ~600 mL of distilled H2O (dH2O), includ-
ing 10 g of tryptone, 5 g of brain heart infusion broth, 10 g of
yeast extract, 10 g of gelatin, 0.5 g of (NH4)2SO4, 0.1 g of
MgSO4∙7H2O, 1.13 g of K2HPO4, 0.9 g of KH2PO4, and 1 g
of NaCl. Stir until dissolve, adjust pH to 7.2 with 4 M KOH,
adjust the volume to 800 mL with dH2O, autoclave the
medium, and allow it to cool to room temperature. To prepare
the second solution (100 mL), dissolve the following items in
~50 mL of dH2O, including 1 g of glucose, 1 g of cysteine
hydrochloride, 0.0125 g of thiamine pyrophosphate, 0.25 g of
sodium pyruvate, 0.27 mL of acetic acid, 0.1 mL of propionic
acid, 0.064 mL of n-butyric acid, 0.016 mL of n-valeric acid,
0.016 mL of isobutyric acid, 0.016 mL of isovaleric acid, and
0.016 mL of DL-methylbutyric acid. Stir until dissolve, adjust
pH to 7.2 with 4 M KOH, adjust the volume to 100 mL with
dH2O, and sterilize by filtration (0.22 μm). To prepare the
third solution, 100 mL rabbit serum will be heat-inactivated
by in 55 C water bath for 30 min and allow it to cool to room
temperature. Mix all the three solutions and store at 4 C (see
Note 2).
5. Electroporation solution (EPS): 15% (v/v) glycerol solution,
sterilized by autoclave, and stored at 4 C.
6. Chemically induced transformation solution (CTS): 15% (v/v)
glycerol and 50 mM CaCl2 solution, sterilized by autoclave,
and stored at 4 C.
7. Low melting temperature agarose [SeaPlaque agarose].
8. Antibiotic stock solutions (for selection of transformants):
100 mg/mL ampicillin; 20 mg/mL gentamicin; 25 mg/mL
kanamycin (all dissolved in dH2O and filter-sterilized—
0.22 μm); 50 mg/mL erythromycin; 50 mg/mL
chloramphenicol (all dissolved in ethanol and filter-sterilized—

0.22 μm); and 10 mg/mL coumermycin A1 (dissolved in
dimethyl sulfoxide and filter-sterilized—0.22 μm) (see Note 3).
3 Methods
3.1 Designing 1. We typically use two-step PCR to create a construct for tar-
Constructs for Gene geted gene deletion. Design six primers to amplify two flanking
Deletion by Allelic regions of a targeted gene and an antibiotic resistance cassette
Exchange (Fig. 1c) (see Note 4). PCR-amplify the upstream flanking
region and an antibiotic resistance cassette using primer pairs
P1–P2 and P3–P4, respectively, and then fuse two fragments
using primers P1 and P4, generating fragment 1. PCR-amplify
the downstream flanking region using primers P5 and P6, and
then fuse it to the fragment 1 by PCR using primers P1 and P6.
2. Clone the obtained PCR product into a cloning vector, gen-
erating the deletion construct. Confirm the construct by DNA
sequencing.
3. Prepare plasmid DNA from E. coli and suspend the plasmid
DNA pellet in dH2O (see Note 5). Measure plasmid DNA
concentrations and proceed to either electrotransformation or
heat shock transformation.
3.2 Designing 1. Design four primers to amplify two regions flanking the
Construct for Gene sequence to be deleted (Fig. 1b) (see Note 4). PCR-amplify
Deletion by the upstream and downstream flanking regions using primer
Counterselectable pairs P1–P2 and P3–P4, respectively, and then fuse two frag-
Maker ments using primers P1 and P4.
2. Clone the obtained PCR product into pCounter [14], gener-
ating pPOPin construct. Confirm the construct by DNA
sequencing.
3. Prepare plasmid DNA from E. coli and dissolve the plasmid
DNA pellet in dH2O (see Note 5). Measure plasmid DNA
concentrations and proceed to either electrotransformation or
heat shock transformation.
3.3 Preparing 1. Inoculate 50 mL of TYGVS medium in a 250-mL flask with

Electrocompetent Cells 50 μL of a late-log-phase T. denticola culture (see Note 2).
Incubate at 37 C in anaerobic chamber (without agitation)
until the culture reaches mid-log phase (5 108 cells/mL).
2. Transfer the culture to a sterile 50-mL screw-top centrifuge
tube. Centrifuge at 4800 g for 10 min at 4 C.
3. Decant the supernatant and resuspend the cell pellet in 25 mL
of cold EPS. Centrifuge at 4800 g for 10 min at 4 C.
4. Repeat step 3 for three more times (a total wash is four times).
5. Decant the supernatant and resuspend the cell pellet in 500 μL

of cold EPS.
6. Aliquot 100 μL of the cell suspension into sterile 1.5-mL
Eppendorf tubes prechilled on ice (see Note 6).
7. Proceed to Subheading 3.4 or quickly freeze the cells in liquid
nitrogen and store at 80 C.
3.4 Electro- 1. Cool electroporation cuvettes (0.2 cm electrode gap) to 4 C

transformation (see Note 7).
2. Transfer 10 μL of DNA (approximately 5 μg of DNA) (see Note
5) to the competent cell, mix gently, and incubate on ice for
5 min.
3. Transfer the cell–DNA mixture to a chilled electroporation
cuvette. Cap the cuvette and gently tap the cell–DNA mixture
to the bottom of the cuvette. Avoid introducing bubbles.
Incubate the cuvette on ice for 5 min.
4. Place the cuvette in the pulse generator and deliver a single
pulse of 2.5 kV, 25 μF, and 200 Ω producing a time constant of
5–5.8 ms.
5. Immediately (within 1 min) add 1 mL of TYGVS medium
(prewarmed to 37 C in anaerobic chamber overnight) without
antibiotics.
6. Transfer the mixture to a sterile 15-mL snap cap tube that
contains an additional 9 mL of TYGVS medium (prewarmed
to 37 C in anaerobic chamber overnight) and incubate (with-
out agitation) at 37 C in anaerobic chamber for 48 h.
3.5 Preparing 1. Inoculate 50 mL of TYGVS medium in a 250-mL flask with

Chemically Induced 50 μL of a late-log-phase culture. Incubate at 37 C in anaero-
Competent Cells bic chamber (without agitation) until the culture reaches
mid-log phase (5 108 cells/mL).
2. Transfer the culture to a sterile 50-mL screw-top centrifuge
tube. Centrifuge at 4800 g for 10 min at 4 C.
3. Decant the supernatant fraction and resuspend the cell pellet in
25 mL of cold CTS. Centrifuge at 4800 g for 10 min at 4 C.
4. Repeat step 3 for three more times (a total wash is four times).
5. Decant the supernatant and resuspend the cell pellet in 500 μL
of cold CTS.
6. Aliquot 100 μL of the cell suspension into sterile 1.5-mL tubes
prechilled on ice (see Note 6).
7. Proceed to Subheading 3.6 or quickly freeze the cells in liquid
nitrogen and store at 80 C.
3.6 Heat Shock 1. Transfer 10 μL of DNA (approximately 5 μg) (see Note 5) to

Transformation the cell suspension, mix gently, and incubate on ice for 10 min.
2. Incubate at 50 C for 1 min and then incubate on ice for 5 min.
3. Add 1 mL of TYGVS medium (prewarmed to 37 C in anaero-
bic chamber overnight) without antibiotics.
4. Transfer the mixture to a sterile 15-mL snap cap tube that
contains an additional 9 mL of TYGVS medium (prewarmed
to 37 C in anaerobic chamber overnight) and incubate (with-
out agitation) at 37 C in anaerobic chamber for 48 h.
3.7 Selection 1. Autoclave 3% SeaPlaque low melting temperature agarose and

of Transformants by equilibrate at 50 C in water bath.
Plating 2. Transfer 22.5 mL of TYGVS medium to a sterile 50-mL screw-
top centrifuge tube, equilibrate the medium at 50 C in water
bath, and combine with 7.5 mL of 3% low melting temperature
agarose and an appropriate antibiotic (see Note 3).
3. Transfer the mixture to two 100-mm petri dishes and allow
them to solidify at room temperature.
4. Meanwhile, transfer 12.5 mL of TYGVS medium to a sterile
50-mL screw-top centrifuge tube. Relocate the medium and
the dishes into anaerobic chamber to equilibrate overnight.
5. The following day, autoclave 3% SeaPlaque low melting tem-
perature agarose and equilibrate at 50 C in water bath.
6. Equilibrate the transferred medium at 37 C incubator, and
combine with 7.5 mL of 3% SeaPlaque low melting tempera-
ture agarose, 10 mL of either the electroporated cells or the
heat shocked cells, and an appropriate antibiotic.
7. Transfer the mixture to two 100-mm petri dishes from the
previous day and allow them to solidify at room temperature.
8. Incubate the plates at 37 C in anaerobic chamber. Colonies
will appear in 5–10 days.
9. Pick up antibiotic resistant colonies using sterile micropipettes.
Transfer colonies into 1.5 mL of TYGVS medium in the pres-
ence of an appropriate antibiotic. Incubate the cultures at
37 C in anaerobic chamber until the culture reaching late-
log phase.
10. Transfer 200 μL of the culture into 1.5 mL of TYGVS medium
in the presence of an appropriate antibiotic. Incubate the cul-
tures at 37 C in anaerobic chamber until the culture reaching
late-log phase.
11. Screen colonies for the targeted deletion by PCR (see Note 8).
3.8 Cis-Complemen- 1. Design six primers to amplify two regions flanking the
tation via Genetic sequence to be complemented (one of which includes the
Reconstitution gene to be complemented) and an antibiotic resistance cassette
(Fig. 1d). PCR-amplified the downstream flanking region
including the gene to be complemented and an antibiotic
resistance cassette using primer pairs P1–P2 and P3–P4,
respectively, and then fuse the fragments using primers P1
and P4, generating fragment 1. PCR-amplify the downstream
flanking region using primers P5 and P6, and then fuse the
resulting fragments to fragment 1 by PCR using primers P1
and P6.
2. Clone the obtained PCR product into a cloning vector, gen-
erating the complementing construct. Confirm the construct
by DNA sequencing.
3. Prepare plasmid DNA from E. coli and resuspend the plasmid
pellet in dH2O (see Note 5). Measure the plasmid concentra-
tion and proceed to either electrotransformation or heat shock
transformation.
3.9 Trans- 1. Search the DNA sequence of a gene to be complemented and

Complementation the shuttle vector for appropriate restriction enzyme cut sites.
Using a Shuttle Vector 2. Choose a shuttle vector containing a selectable marker different
( See Note 9) from what was used to generate the deletion mutant.
3. Design two primers to amplify the complementing gene with
an appropriate restriction sites at both ends.
4. Clone the complementing gene into a shuttle vector. Confirm
the complementing construct by DNA sequencing.
5. Prepare plasmid DNA from E. coli and suspend the plasmid
pellet in dH2O (see Note 5). Measure the plasmid concentra-
tion and proceed to either electrotransformation or heat shock
transformation.
4 Notes
1. T. denticola ATCC 35405 and ATCC33520 are two most

commonly used lab strains. The genome of ATCC 35405 was
sequenced [18].
2. Other media are also available; however, TYGVS medium is
relatively easy to be prepared and promotes better growth
[17, 19]. T. denticola is anaerobic and unable to withstand
exposure of oxygen for a long period of time. While working
with T. denticola outside anaerobic chamber, we suggest to
work as fast as possible to limit oxygen exposure and aseptically.
All the media and plates have to be equilibrated in an anaerobic
chamber for at least 24 h to remove oxygen in the medium and
agar plates.
3. The original antibiotic for genetic manipulation is erythromy-

cin cassette, which contains both ermF and ermAM (ermB)
[6, 10]. This cassette has been widely in T. denticola and
other oral pathogens as well. Other selection markers include
gentamicin, kanamycin, chloramphenicol, and coumermycin
A1 [9, 11, 13, 15]. Chloramphenicol and coumermycin are
the least used due to higher rate of spontaneous mutations.
The final concentrations of antibiotics used in T. denticola is as
follow: 50 μg/mL erythromycin, 20 μg/mL gentamicin,
25 μg/mL kanamycin, 10 μg/mL chloramphenicol, and
10 μg/mL coumermycin A1.
4. We typically make deletion or complementation constructs by
using two-step PCR [20]. Our approach of generating mutant
is to replace the entire open reading frame (ORF) with an
antibiotic resistance cassette to avoid truncated gene products
to be expressed and potential polar effect on the downstream
genes [14].
5. DNA is resuspended in dH2O to reduce the interference of salt
contaminants in the electroporation process. High salt concen-
tration in DNA solution might cause electrical discharge, which
will kill bacterial cells. We are able to obtain transformants with
circular DNA, linearized DNA, and PCR products. However,
the transformation efficiency using different types of DNA has
yet to be assessed.
6. Competent cells can be stored at 80 C for a long time.
Freezing cells only slightly decreases transformation efficiency.
Frozen competent cells can be thaw on ice for 10 min and
proceed with either electroporation or heat shock step.
7. The originally used protocol for T. denticola transformation is
to use 0.1 cm electrode gap cuvette with a pulse generator set
to 1.8 kV, 25 μF, and 200 Ω [7]. We discovered that using
0.2 cm electrode gap increases transformation efficiency
(Unpublished data).
8. Characterizations of transformants by PCR. We typically use six
primers including two primers outside the flanking regions,
two primers for targeted gene, and two primers for the antibi-
otic resistance cassette. PCR analysis is performed with the
combination of primers outside the flanking regions and either
gene of interest or the antibiotic resistance cassette. Character-
ization of transformants for counterselectable knockout
mutants is performed according to the previous
publication [14].
9. Several shuttle vectors have been successfully transformed into
ATCC 33520 including pKT210 (confers chloramphenicol
resistance and highly unstable), pKMR4PE (confers erythro-
mycin resistance), pKMCou (confers chloramphenicol
resistance), and pBFC (confers chloramphenicol resistance)

[7, 11, 12, 15, 21]. Compared to ATCC 33520, T. denticola
ATCC 35405 is less amenable to those vectors, most likely due
to its unique DNA modification systems [21, 22].
References
1. Ellen RP, Galimanas VB (2005) Spirochetes at 13. Bian J, Fenno JC, Li C (2012) Development of
the forefront of periodontal infections. Period- a modified gentamicin resistance cassette for
ontol 2000 38:13–32 genetic manipulation of the oral spirochete
2. Holt SC, Ebersole JL (2005) Porphyromonas Treponema denticola. Appl Environ Microbiol
gingivalis, Treponema denticola, and Tanner- 78:2059–2062
ella forsythia: the “red complex”, a prototype 14. Kurniyati K, Li C (2016) pyrF as a counter-
polybacterial pathogenic consortium in peri- selectable marker for unmarked genetic manip-
odontitis. Periodontol 2000 38:72–122 ulations in Treponema denticola. Appl Environ
3. Darveau RP (2010) Periodontitis: a polymicro- Microbiol 82:1346–1352
bial disruption of host homeostasis. Nat Rev 15. Slivienski-Gebhardt LL, Izard J, Samsonoff
Microbiol 8:481–490 WA et al (2004) Development of a novel chlor-
4. Dashper SG, Seers CA, Tan KH et al (2011) amphenicol resistance expression plasmid used
Virulence factors of the oral spirochete Trepo- for genetic complementation of a fliG deletion
nema denticola. J Dent Res 90:691–703 mutant in Treponema denticola. Infect Immun
5. Fenno JC, McBride BC (1998) Virulence fac- 72:5493–5497
tors of oral treponemes. Anaerobe 4:1–17 16. Asif A, Mohsin H, Tanvir R et al (2017) Revi-
6. Li H, Ruby J, Charon N et al (1996) Gene siting the mechanisms involved in calcium
inactivation in the oral spirochete Treponema chloride induced bacterial transformation.
denticola: construction of an flgE mutant. J Front Microbiol 8:2169
Bacteriol 178:3664–3667 17. Ohta K, Makinen KK, Loesche WJ (1986)
7. Li H, Kuramitsu HK (1996) Development of a Purification and characterization of an enzyme
gene transfer system in Treponema denticola by produced by Treponema denticola capable of
electroporation. Oral Microbiol Immunol hydrolyzing synthetic trypsin substrates. Infect
11:161–165 Immun 53:213–220
8. Yang Y, Stewart PE, Shi X et al (2008) Devel- 18. Seshadri R, Myers GS, Tettelin H et al (2004)
opment of a transposon mutagenesis system in Comparison of the genome of the oral patho-
the oral spirochete Treponema denticola. Appl gen Treponema denticola with other spirochete
Environ Microbiol 74:6461–6464 genomes. Proc Natl Acad Sci U S A
101:5646–5651
9. Li Y, Ruby J, Wu H (2015) Kanamycin resis-
tance cassette for the genetic manipulation of 19. Orth R, O’Brien-Simpson N, Dashper S et al
Treponema denticola. Appl Environ Microbiol (2010) An efficient method for enumerating
13:4329–4338 oral spirochetes using flow cytometry. J Micro-
biol Methods 80:123–128
10. Goetting-Minesky MP, Fenno JC (2010) A
simplified erythromycin resistance cassette for 20. Cha-Aim K, Hoshida H, Fukunaga T et al
Treponema denticola mutagenesis. J Microbiol (2012) Fusion PCR via novel overlap
Methods 83:66–68 sequences. Methods Mol Biol 852:97–110
11. Chi B, Limberger RJ, Kuramitsu HK (2002) 21. Godovikova V, Goetting-Minesky MP, Shin
Complementation of a Treponema denticola JM et al (2015) A modified shuttle plasmid
flgE mutant with a novel coumermycin facilitates expression of a flavin
A1-resistant T. denticola shuttle vector system. mononucleotide-based fluorescent protein in
Infect Immun 70:2233–2237 Treponema denticola ATCC 35405. Appl Envi-
ron Microbiol 81:6496–6504
12. Chi B, Chauhan S, Kuramitsu H (1999) Devel-
opment of a system for expressing heterolo- 22. Bian J, Li C (2011) Disruption of a type II
gous genes in the oral spirochete Treponema endonuclease (TDE0911) enables Treponema
denticola and its use in expression of the Trepo- denticola ATCC 35405 to accept an unmethy-
nema pallidum flaA gene. Infect Immun lated shuttle vector. Appl Environ Microbiol
67:3653–3656 77:4573–4578
Chapter 3
Construction of a Gene-Deletion Mutant in Tannerella

forsythia
Keiji Nagano and Yoshiaki Hasegawa
Abstract
Tannerella forsythia, a gram-negative anaerobic bacterium, is one of the most important pathogens in
periodontal disease. However, it has been difficult to construct a gene-deletion mutant in this organism,
which may serve as a useful tool in microbiological research. We reported a highly efficient method to
construct a gene-deletion mutant of T. forsythia in 2007, and it was accomplished by preparing competent
cells from a colony grown on an agar medium instead of a broth culture. Here, we describe the same
method with some improvements.
Key words Tannerella forsythia, Mutant, Electroporation, Colony, Agar medium
1 Introduction
In 1979, Tanner et al. reported the presence of slow-growing,

fusiform-shaped, gram-negative, anaerobic bacteria of the genus
Bacteroides, which were predominantly isolated from subgingival
plaque in periodontitis sites [1]. They designated the organism as
Bacteroides forsythus in 1986 [2]; however, it is now called Tanner-
ella forsythia [3], which is a member of the red complex bacteria in
periodontal pathogens [4]. Although this bacterium shows slow
growth even in a rich medium supplemented with animal blood, it
has been observed that the addition of N-acetylmuramic acid
(NAM), a component of the bacterial cell wall, improves their
growth rates [5].
A gene-deletion mutant is a useful tool in microbiological
research. However, it has been difficult to construct such a mutant
in T. forsythia. In 2001, Honma et al. was the first to report the
construction of a mutant in T. forsythia through the triparental
mating procedure with a suicide vector [6]. However, to the best
of our knowledge, no further studies have reported the use of this
method. In 2007, Honma et al. again published a research paper
describing the construction of a mutant in T. forsythia through
25
26 Keiji Nagano and Yoshiaki Hasegawa
allelic gene recombination by electroporation method [7]. Further-

more, the authors published additional studies by constructing a
mutant with the same method [8, 9]. Notably, they prepared the
competent cells from a broth culture at an early logarithmic phase.
At around the same time in 2007, we also reported a method
for the construction of a gene-deletion mutant in T. forsythia
[10]. A mutant with high efficiency was successfully produced by
preparing competent cells from a colony grown on an agar-
solidified medium. However, we could not obtain any mutants by
using competent cells from a broth culture in our previous study. In
addition, other research groups suggested that the construction
efficiency for preparing competent cells from a broth culture was
very low, although a couple of transformants could be obtained
(personal communication). Therefore, we believe that the colony
cells have a higher competence potential for transformation
through allelic gene recombination. Here, we describe our previ-
ously published method with some improvements [10].
2 Materials
2.1 Bacterial Culture 1. Bacterial strain: T. forsythia ATCC 43037, a type strain in
American Type Culture Collection.
2. Brucella HK Agar (Kyokuto Pharmaceutical Industrial Co.,
Ltd.): (formula per liter of water) 10.0 g of peptic digest of
animal tissue, 10.0 g of pancreatic digest of casein, 5.0 g of
yeast extract, 1.0 g of glucose, 0.1 g of sodium bisulfite, 5.0 g
of sodium chloride, 0.01 g of hemin, 0.01 g of vitamin K, 1.0 g
of sodium pyruvate, 1.0 g of arginine, 0.3 g of cysteine hydro-
chloride, 15.0 g of agar, pH 7.0 0.2 (see Note 1).
3. Blood (sheep or rabbit), defibrinated, sterile: Transfer an ali-
quot aseptically into a sterile tube. Store at 20 C.
4. Stock solution of NAM: Dissolve 100 mg of NAM in 10 mL of
distilled water (10 mg/mL) and sterilize it by filtration. Store
the aliquots at 20 C.
5. Stock solution of erythromycin and chloramphenicol: Dissolve
100 mg of each antibiotic in 10 mL of ethanol. Store at
20 C.
6. Anaerobic incubator: A general anaerobic incubator is used.
Periodically inject a mixture of gases comprising 80% N2, 10%
H2, and 10% CO2 into a hermetically sealed incubator. In
addition, place a catalyst that consumes residual O2 by reacting
with H2 in the incubator (see Note 2).
Mutant Construction in T. forsythia 27
2.2 Inactivation 1. Wash buffer—glycerol (10% (w/v)): Dissolve 10 g of glycerol

of the Target Gene in 80 mL of distilled water. Make up the volume to 100 mL
with distilled water. Sterilize it by autoclaving. Store at 4 C.
2. pVA2198 plasmid: It harbors an erythromycin-resistance gene
(ermF), which contains a promoter functioning in genus
Bacteroides [11].
3. pACYC184 plasmid: a popular plasmid for cloning that carries
chloramphenicol-resistance gene (cat).
4. Polymerase chain reaction (PCR) reagent: A high-fidelity DNA
polymerase, available for long amplicons (see Note 3).
5. Electroporation (see Note 4).
3 Methods
3.1 Blood Agar 1. Add the prescribed amount of Brucella HK Agar powder to
Medium with NAM distilled water in a bottle.
2. Autoclave it at 115 C (see Note 5).
3. Thaw and warm the blood at 37 C when the medium is being
autoclaved.
4. After autoclaving, mix the medium gently to dispense the
components in the bottle uniformly.
5. Cool the medium and warm in a water bath at 52 C.
6. After incubating the medium in the water bath, add
one-thousandth part of 10 mg/mL of NAM to the medium
(10 μg/mL of NAM as final concentration).
7. Add antibiotics to the medium when needed (see below for
details).
8. Add blood to the medium (5% blood as final concentration),
and immediately mix well but gently.
9. Pour the medium into petri dish plates.
10. Solidify the medium by leaving the plate at room temperature
and let the surface dry for a while.
11. The agar plates are sealed in a plastic bag and stored (see Note
6).
3.2 Preparation 1. Streak T. forsythia cells (parental strain, usually wild type) on
of Electrocompetent the NAM-containing blood agar (without antibiotics).
Cells of T. forsythia 2. Cultivate at 37 C under anaerobic conditions for a week
(subculture).
3. Select a single colony and spread it on another
NAM-containing blood agar (without antibiotics) using a ster-
ile swab (see Note 7).
4. Cultivate at 37 C under anaerobic conditions for 5 days.

5. Collect and suspend the bacterial cells in 30 mL of 10% chilled
glycerol in a 50-mL sterile tube using a sterile swab.
6. Centrifuge at 4000 g for 20 min at 4 C.
7. Discard the supernatant.
8. Spin down the cells at 4000 g for 2 min at 4 C.
9. Remove the residual supernatant with a pipette.
10. Add 20 mL of 10% chilled glycerol (do not suspend).
12. Discard the supernatant.
13. Spin down the cells at 4000 g for 2 min at 4 C.
14. Remove the residual supernatant with a pipette.
15. Gently suspend in 0.1–1 mL of 10% chilled glycerol (see Note
8).
16. Measure the turbidity of the bacterial suspension at a wave-
length of 600 nm (OD600) with a spectrophotometer.
17. Adjust the bacterial concentration to 10 at OD600.
18. Store aliquots (100 μL/tube) at 80 C (see Note 9).
3.3 Preparation We have only briefly described a preparation method of the DNA
of DNA Construct construct for allelic exchange mutagenesis because various methods
for Allelic Exchange are already known.
Mutagenesis 1. The most commonly used selectable marker conferring antibi-
otic resistance in T. forsythia is the ermF gene [11]. The gene
contains a promoter functioning in the genus Bacteroides. We
have also used the cat gene [10]. However, the cat gene does
not contain a promoter functioning in T. forsythia; hence, this
gene has to be appended with any functional promoter in T.
forsythia (see Note 10).
2. The antibiotic-resistant genes are inserted inside the target
gene to inactivate the target gene (Fig. 1). We usually prepare
the DNA construct such that the antibiotic-resistant gene is
flanked by 500 to 1000 bp of DNA fragments that are imme-
diately upstream and downstream of the target gene using the
overlap PCR method to delete the target gene completely [12].
3. It is possible to construct a gene-deletion mutant by directly
introducing the PCR product of the DNA construct into T.
forsythia. However, we usually clone the DNA construct into a
plasmid vector and Escherichia coli strain. After cloning in E.
coli, we sequence the DNA construct to confirm that there are
no errors introduced during PCR amplification. Next, the
T. forsythia cell
Chromosome
Primer Target gene
Primer
Upper region Lower region

Antibiotic-resistance
(> 500 bp) (> 500 bp)
gene
DNA construct
Fig. 1 Schematic diagram of the construction of a gene-deletion mutant in T.

forsythia. The target gene is to be replaced with an antibiotic-resistance gene by
allelic exchange mutagenesis. The antibiotic-resistance gene is flanked by DNA
fragments homologous to the upstream and downstream regions of the target
gene. More than 500-bp DNA fragments should be cloned for efficient
recombination. A primer set, annealing outside the DNA construct and inside
the antibiotic-resistant gene, is used for confirmation of the gene replacement.
White, shaded, and two small arrows indicate the target gene in T. forsythia
chromosome, antibiotic-resistance gene, and primers for confirmation of
transformation, respectively
plasmid is linearized by digestion with restriction enzymes that

do not cleave within the DNA construct, and introduced into
the electro-competent cells of T. forsythia (see Note 11).
3.4 Transformation 1. Thaw 100 μL of electrocompetent cells of T. forsythia and

50 μL of DNA construct (1 μg) on ice.
2. Add both to an electroporation cuvette with 0.2-cm gap width.
3. Mix once quickly by inverting the cuvette.
4. Pulse once at 2.5 kV (see Note 12).
5. Transfer the pulsed sample onto NAM-containing blood agar
plate (without antibiotics).
6. Incubate the plate at 37 C under anaerobic conditions for
1–3 days (see Note 13).
7. Collect the bacterial cells with a sterile swab and spread them
on the NAM-containing blood agar plate supplemented with
different concentrations of antibiotics (see Note 14).
8. Cultivate the plates at 37 C under anaerobic conditions for
5–7 days.
9. Restreak single colonies on the NAM-containing blood agar
plates supplemented with antibiotics (see Note 15).
10. Confirm the gene replacement by PCR with a primer set that
anneals outside the DNA construct (e.g., further upstream of
the DNA construct) and inside the antibiotic-resistance gene
(Fig. 1).
4 Notes
1. Brucella agar medium is used as a general medium for anaero-

bic bacteria [13]. Brucella HK Agar is based on the brucella
medium and presupplemented with hemin and vitamin K.
2. In addition to an anaerobic incubator, Anoxomat (Advanced
Instruments, Norwood, MA, USA) and AnaeroPack (Mitsu-
bishi Gas Chemical Company, Inc.) are also used for anaerobic
culture in our laboratory.
3. We usually use the PrimeSTAR DNA polymerase kit series of
Takara or the KOD kit series of Toyobo Co., Ltd. as they are
high-fidelity polymerases.
4. We use the electroporation apparatus and cuvette (0.2-cm gap
width) provided by Bio-Rad Laboratories.
5. We autoclave 200 mL of medium for 20 min.
6. The agar plates in a plastic bag can be stored at 4 C for a
month.
7. We would recommend preincubating this plate under anaero-
bic conditions for a couple of days.
8. Maintain the bacterial suspension at 4 C or place it on ice.
9. The efficiency of transformation is likely to be higher when the
competent cells are immediately used without freezing. This
may be attempted if there is a difficultly in creating the mutant.
10. When designing the DNA construct that expresses the cat
gene, depending on the promoter of the target gene, there
seems to be no polar effect on the downstream genes of the cat
gene after it replaces the target gene [14, 15].
11. The linearization of plasmid circumvents the rest of the target
genes after the DNA construct is integrated into the bacterial
chromosomal DNA.
12. We use the program name “Ec2” of MicroPulser Electropora-
tor (Bio-Rad).
13. We incubate the plate only till a slight bacterial growth is
observed on the plate. During this incubation, the selectable
marker gene is integrated into the chromosome, and the
enzyme that inactivates the antibiotics is induced.
14. Since it is not possible to determine the likelihood of an

increase in the antibiotic resistance of the transformants, it is
recommended to prepare some agar plates containing various
concentrations of antibiotics. For example, we prepare the
NAM-containing blood agar medium by supplementing with
0 (as a control), 2, 4, 8, and 10 μg/mL of erythromycin or
chloramphenicol.
15. This procedure is performed to exclude the contamination of
nontransformants.
Acknowledgments
We would like to thank Editage (www.editage.com) for English

language editing.
References
1. Tanner ACR, Haffer C, Bratthall GT et al 8. Honma K, Mishima E, Inagaki S et al (2009)
(1979) A study of the bacteria associated with The OxyR homologue in Tannerella forsythia
advancing periodontitis in man. J Clin Period- regulates expression of oxidative stress
ontol 6(5):278–307 responses and biofilm formation. Microbiology
2. Tanner ACR, Listgarten MA, Ebersole JL et al 155(Pt 6):1912–1922
(1986) Bacteroides forsythus sp. nov. , a slow- 9. Honma K, Mishima E, Sharma A (2011) Role
growing, fusiform Bacteroides sp. from the of Tannerella forsythia NanH sialidase in epi-
human oral cavity. Int J Syst Evol Microbiol thelial cell attachment. Infect Immun 79
36(2):213–221 (1):393–401
3. Maiden MF, Cohee P, Tanner AC (2003) Pro- 10. Sakakibara J, Nagano K, Murakami Y et al
posal to conserve the adjectival form of the (2007) Loss of adherence ability to human
specific epithet in the reclassification of Bacter- gingival epithelial cells in S-layer protein-defi-
oides forsythus Tanner et al. 1986 to the genus cient mutants of Tannerella forsythensis. Micro-
Tannerella Sakamoto et al. 2002 as Tannerella biology 153(Pt 3):866–876
forsythia corrig., gen. nov., comb. nov. Request 11. Fletcher HM, Schenkein HA, Morgan RM et al
for an opinion. Int J Syst Evol Microbiol 53 (1995) Virulence of a Porphyromonas gingivalis
(Pt 6):2111–2112 W83 mutant defective in the prtH gene. Infect
4. Socransky SS, Haffajee AD (2005) Periodontal Immun 63(4):1521–1528
microbial ecology. Periodontol 2000 12. Horton RM, Ho SN, Pullen JK et al (1993)
38:135–187 Gene splicing by overlap extension. Methods
5. Wyss C (1989) Dependence of proliferation of Enzymol 217:270–279
Bacteroides forsythus on exogenous 13. Murray PR, Baron EJ, American Society for
N-acetylmuramic acid. Infect Immun 57 Microbiology (2003) Manual of clinical micro-
(6):1757–1759 biology, 8th edn. ASM Press, Washington, DC
6. Honma K, Kuramitsu HK, Genco RJ et al 14. Nagano K, Read EK, Murakami Y et al (2005)
(2001) Development of a gene inactivation Trimeric structure of major outer membrane
system for Bacteroides forsythus: construction proteins homologous to OmpA in Porphyromo-
and characterization of a BspA mutant. Infect nas gingivalis. J Bacteriol 187(3):902–911
Immun 69(7):4686–4690 15. Komatsu T, Nagano K, Sugiura S et al (2012)
7. Honma K, Inagaki S, Okuda K et al (2007) E-selectin mediates Porphyromonas gingivalis
Role of a Tannerella forsythia exopolysacchar- adherence to human endothelial cells. Infect
ide synthesis operon in biofilm development. Immun 80(7):2570–2576
Microb Pathog 42(4):156–166
Chapter 4
Construction of a Mutant in Prevotella melaninogenica

Using the Conjugation Transfer Method with Escherichia
coli
Yoshio Kondo
Abstract
Prevotella melaninogenica is a bacterium that is resident in the oral cavity and upper respiratory tract and is
associated with periodontal disease and aspiration pneumonia. Prevotella mutants are difficult to produce
and only few reports have been reported. We examined several methods and many strains and succeeded in
producing mutants in Prevotella melaninogenica GAI 07411. In this chapter, we will describe how to create
a mutation of a target gene by carrying out conjugation transfer using Escherichia coli S17-1 as a donor and
introducing a plasmid into P. melaninogenica.
Key words Prevotella melaninogenica, Gene mutation, Transconjugation, Escherichia coli, Bacteroi-
detes phylum
1 Introduction
It has recently been recognized that oral biofilms cause not only
caries and periodontal disease but also systemic diseases such as
aspiration pneumonia [1, 2]. Prevotella bacteria are commonly
detected in patients with aspiration pneumonia and are often refrac-
tory because they are resistant to antibacterial agents as a result of
lactamase productivity and biofilm formation [3–5]. Prevotella mel-
aninogenica is a black-pigment–producing anaerobic gram-
negative bacillus of the Bacteroidetes phylum. P. melaninogenica
is a member of normal human oral flora and can be grown from the
tongue, gingival crevices, saliva and plaque of healthy individuals
[6–9]. It is considered a potential pathogen [10–13] because it is
commonly cultured as the sole infectious agent in extraoral
abscesses that occur in spondylitis, osteomyelitis, and pyomyositis,
and in peritoneal abscesses and vaginal mesh infections [14–
17]. P. melaninogenica is also frequently cultured in the context
of polymicrobial diseases including brain abscesses,
33
34 Yoshio Kondo
pleuropulmonary infections, endocarditis, illicit drug injection

sites, intra-abdominal infections, wound infections, necrotizing
fasciitis, pyogenic infections, decubitus and diabetic ulcers [17–
22]. Stimulation of total cell lysates from P. melaninogenica report-
edly stimulates weak cytokine responses (IL-1α, IL-6, and TNF-α
in human monocytes and human gingival fibroblasts) via the TLR2
signaling pathway, but not via the TLR4 pathway [23, 24]. There-
fore, P. melaninogenica may have TLR2 agonist properties.
Another study reported that P. melaninogenica supernatants
impaired phagocytosis by polymorphonuclear leukocytes
[25]. Despite being associated with a wide variety of infectious
diseases and cellular responses, little is known about the contribu-
tion of P. melaninogenica to disease progression, perhaps because
molecular genetic methods such as mutation of the target gene
have not been developed. Genetic and molecular biological analysis
of many pathogenic bacteria has played a major role in identifying
their virulence factors. The role of various pathogenic factors in the
periodontopathic bacterium Porphyromonas gingivalis has been
clarified by genetic and molecular biological techniques [26]. The
author and coworkers attempted to create a mutant of
P. melaninogenica, and succeeded in creating a mutant with one
clinical isolate using the conjugation transfer method [27]. Further,
the genome sequence of the strain was decoded and registered
(DDBJ/EMBL/GenBank database accession numbers;
AP018049-51).
Bacterial conjugation is a horizontal gene transfer process from
donor cells with one or more conjugating plasmids to recipient
cells. Most bacterial conjugation plasmids are transferred to distant
or even unrelated microorganisms. Transfer of the conjugated plas-
mid requires close physical contact between the conjugated cells
and is usually mediated by a plasmid-encoded protein that provides
a transfer (tra) function [28]. Conjugation involves a special type of
replication in which plasmid DNA molecules replicate during con-
jugation, with one copy remaining in the donor cell and another
copy transferred to the recipient. In most cases, replication is
initiated by creating a single-stranded nick at the transcription
origin (oriT) of the plasmid. A single strand of nickless DNA is
replicated in the donor cell, and the 50 ends of the nicked DNA are
actively transported linearly to the recipient cell through the donor
and recipient cell envelopes into the recipient cell. Here, it is
replicated and the double-stranded DNA is circularized. The entire
process requires many proteins encoded by plasmid genes, includ-
ing those needed to form mating pairs between donor and recipient
[28–32]. In constructing a mutant strain, double recombination
occurs between the plasmid introduced into the recipient cell and
the chromosome of the recipient cell, resulting in mutation of the
target gene. In this chapter, we will describe how to construct a
Gene Mutation of Prevotella melaninogenica 35
mutant strain of P. melaninogenica using E. coli S17-1 as a donor

host. Here, we introduce a protocol we used to construct a porK
mutant in P. melaninogenica GAI 07411 [27].
2 Materials
2.1 A porK-Deletion 1. Freeze Throw Buffer (FTB): Dissolve 0.6 g of PIPES (final
Mutant concentration 10 mM), 0.44 g of CaCl2∙2H2O (final concen-
of P. melaninogenica tration 15 mM), 3.72 g of KCl (final concentration 250 mM)
in 190 mL of water. Adjust pH between 6.7 and 6.8 using
KOH. After adding 2.18 g of MnCl2∙4H2O (final concentra-
tion 55 mM), make up to 200 mL with water. Sterilize by the
filter (0.22 μm).
2. Competent cells of E. coli S17-1: Culture E. coli S17-1 (ΔrecA,
endA1, hsdR17, supE44, thi-1, tra +) [33] in LB broth. Collect
the E. coli S17-1 cells by centrifugation at 1000 g for 10 min
at 4 C. Suspend the bacterial pellet in FTB and cenrifuge
again. Suspend the cells in FTB, and store aliquots at 80 C.
3. Recipient strain: P. melaninogenica GAI07411 [27] (see Note
1).
4. LB medium: For the selection of ampicillin-resistant E. coli
strains, add ampicillin to the molten agar at the concentration
of 100 μg/mL.
5. Tryptic soy broth supplemented with 5 mg/mL hemin (TSH):
Add about 10 mL of 0.1 M NaOH to a glass bottle. Weigh
50 mg of hemin and transfer to the bottle. Completely dissolve
hemin, and make up to 100 mL with water (0.5 mg/mL hemin
at final concentration). Sterilize by autoclaving. Dissolve 3.7 g
of tryptic soy broth in 100 mL of water and sterilize by auto-
claving. After cooling to room temperature, add 1 mL of
0.5 mg/mL hemin to the broth. Store it anaerobically.
6. TSH agar plate: Dissolve 4.0 g of tryptic soy broth agar in
100 mL of water and sterilize by autoclaving. After cooling to
45–50 C, add 1 mL of 0.5 mg/mL hemin to the molten agar.
For the selection and maintenance of erythromycin-resistant
P. melaninogenica strain, add erythromycin to the molten agar
at a concentration of 5 μg/mL. After the solidity of the
medium, store it anaerobically.
7. Blood agar plate: Dissolve 4.0 g of tryptic soy broth agar in
100 mL of water and sterilize by autoclaving. After cooling to
45–50 C, add 1 mL of 0.5 mg/mL hemin and 5 mL of rabbit
blood to the molten agar. For the selection of
P. melaninogenica from the mixture of E. coli and
P. melaninogenica, add gentamicin to the molten agar at a
concentration of 100 μg/mL. For the selection and
36 Yoshio Kondo
maintenance of erythromycin-resistant P. melaninogenica

strain, add erythromycin to the molten agar at a concentration
of 5 μg/mL. After the solidity of the medium, store it
anaerobically.
8. Anaerobic incubator: consists of 10% CO2, 10% H2, and 80%
N 2.
9. Advantage-HF 2 PCR kit (Takara Bio): A high-fidelity PCR kit.
10. pGEM-T Easy (Promega): a cloning plasmid vector which
linearized with a single 30 -terminal thymidine at both ends.
11. pBluescript II SK(): a cloning plasmid vector.
12. Restriction enzymes: XhoI, BamHI, and NotI.
13. pTCB: Bacteroides–E. coli shuttle vector, carrying antibiotic
resistance gene [34].
14. MasterPure Complete DNA and RNA Purification Kit (Epi-
centre): A Genomic DNA purification kit.
2.2 Hemaggluti- 1. Phosphate-buffered saline (PBS), pH 7.4.

nation Test 2. Rabbit erythrocyte.
3. Round bottom microtiter plate.
3 Methods
3.1 Construction of a 1. A 1.0 kb upstream region of porK was amplified by PCR from
porK-Deletion Mutant the chromosomal DNA of P. melaninogenica using Advantage-
of P. melaninogenica HF 2 PCR kit. The amplified DNA was then cloned into
pGEM-T Easy and digested with XhoI and BamHI. The result-
3.1.1 Construction ing DNA fragment was then inserted into the XhoI and BamHI
of Suicide Vector Plasmid sites of pBluescript II SK() to generate pML001 (see Note 2).
2. A 1.0-kb downstream region of porK was amplified from the
chromosomal DNA of P. melaninogenica. The amplified DNA
was cloned into pGEM-T Easy and digested with BamHI and
NotI. The resulting fragment was then inserted into the
BamHI and NotI sites of pML001 to generate pML002.
3. The 1.1 kb BamHI ermF DNA cassette was inserted into the
BamHI site of pML002, resulting in pML003.
4. pML003 was digested with XhoI and NotI and inserted into
the XhoI–NotI site of pTCB plasmid, resulting in pML004
(Fig. 1).
3.1.2 Introduce 1. Mix 1–5 μl of pML004 (usually 10 pg–100 ng) into 20–50 μL
the Suicide Vector Plasmid of competent E. coli S17-1 in a tube.
into E. coli 2. Incubate the mixture of competent E. coli S17-1 and the
plasmid on ice for 20–30 min.
(a)
Prevotella melaninogenica GAI 07411
chromosomal DNA
porK
upstream of porK (1.0 kb) downstream of porK (1.0 kb)
(b)
Ampr
XhoI upstream of
porK (1.0 kb)
pML004 BamHI
BamHI ermF
NotI
downstream of
tetQ
porK (1.0 kb)
Fig. 1 Construction of suicide plasmid vector. (a) The upstream and downstream 1.0 kb of the porK gene is
amplified by PCR, and each is inserted into a T-vector, respectively. (b) The DNA fragment of 1.0 kb upstream
of porK-erythromycin resistance cassette-1.0 kb downstream of porK is inserted into the Bacteroides-E. coli
shuttle vector
3. Heat shock the mixture by placing the bottom half to

two-thirds of the tube into a 42 C water bath for 30–60 s.
4. Put the tubes back on ice for 2 min.
5. Add 250–1000 μL of LB medium (without antibiotic) to the
bacteria and grow in 37 C shaking incubator for 45 min.
6. Plate some or all of the culture onto an LB agar plate contain-
ing 100 μg/mL ampicillin.
7. Incubate plates at 37 C overnight.
3.1.3 Conjugative 1. Culture E. coli S17-1 retaining the plasmid in 3 mL of LB

Transfer medium containing 100 μg/mL ampicillin for 12 h. Culture
200 μL of this solution in 20 mL of fresh LB medium without
antibiotics for 3 h.
2. Culture P. melaninogenica GAI07411 in 2 mL of TSH broth
for 12 h in anaerobic incubator, then add 10 mL of fresh TSH
broth to the culture, and culture anaerobically for 3 h.
3. Mix the cultures of plasmid-retained E. coli S17-1 and the
P. melaninogenica.
4. Centrifuge the mixture at 1000 g for 10 min.
38 Yoshio Kondo
hypothetical porK porL porM porN
wild type
Primer set A (partial porK)
ΔporK
ermF
Primer set B (ermF)

Primer set C (hypothetical-ermF)
Fig. 2 Chromosomal structure at the porK locus of the porK deletion mutant. The deletion of the porK gene was
occurred by the replacement of the porK gene with erythromycin (ermF) cassette. The regions amplified to
confirm the deletion of porK are shown
5. Spot the concentrated mixture on TSH agar plate, culture at

37 C for 15 min under aerobic conditions, and then coculture
for 12 h under anaerobic conditions (see Note 3).
6. Suspend the bacteria in the TSH medium, and seed on blood
agar medium containing 100 μg/mL gentamicin and 5 μg/mL
erythromycin.
7. Culture for 5–8 days under anaerobic conditions to form bac-
terial colonies.
3.1.4 Confirm that 1. Subculture the colonies grown onto TSH agar plates contain-
the Target Gene Has Been ing 5 μg/mL erythromycin and culture them anaerobically for
Replaced with ermF 5–8 days.
2. Purified the genome from the bacterial isolates using Master-
Pure Complete DNA and RNA Purification Kit.
3. Perform the PCR using the purified genome as a template to
confirm the mutation. See the Fig. 2 for primer design.
3.2 Hemaggluti- The porK mutant forms white colonies on blood agar. Therefore, a
nation Test hemagglutination test was performed. The method is introduced
below.
1. Culture P. melaninogenica in TSH medium anaerobically
overnight.
2. Centrifuge the P. melaninogenica cells at 1000 g for 10 min,
wash them with PBS, and resuspend them to OD550 of 0.4
with PBS.
3. Dilute the bacterial suspensions in a twofold series with PBS.
4. Mix a 100-μl aliquot of each suspension with an equal volume
of rabbit erythrocyte suspension (1.0–2.0% in PBS) (see
Note 4).
5. Incubate in a round bottom microtiter plate at room tempera-
ture for 3 h (Fig. 3).
Dilution rate of
bacterial solution 20 21 22 23 24 25 26 27
ΔporK
WT
Fig. 3 Hemagglutination test. P. melaninogenica cells were grown in TSH broth, washed with PBS, and
resuspended in PBS at an OD550 of 0.4. The suspension and its dilutions in a twofold series were applied to the
wells of a microtiter plate and mixed with 2.0% rabbit erythrocyte suspension. When hemagglutination
occurred, red blood cells did not settle and spread throughout the wells, whereas when hemagglutination did
not occur, sedimented red blood cells became small spots
4 Notes
1. We acquired P. melaninogenica ATCC 25845 and clinical iso-

lates from the Division of Anaerobic Research, Life Science
Research Center, Gifu University (GAI 96524, GAI 00278,
GAI 00319, GAI 07400, GAI 07402, GAI 07404, GAI
07406, GAI 07408, and GAI 07410). We used these to try
to make a gene mutant in the same way, but this was unsuc-
cessful. The gene mutant could only be obtained with GAI
07411. We believe that the exogenous DNA-exclusion mecha-
nism of the recipient strain affected the mutant construction.
The basis for this is that GAI 07411 does not have many genes
related to restriction modification systems. Additionally,
GAI07411 has a foreign plasmid. This indicates that GAI
07411 is tolerant to foreign DNA [27].
2. Homologous recombination requires the insertion of 1000 bp
of upstream and downstream regions of the target gene into
the target plasmid.
3. Transfer of plasmids between bacteria by conjugative transfer
requires cell contact and DNA metabolism between donor and
recipient cells. When E. coli and P. melaninogenica are cocul-
tured on an agar plate, the bacterial pellet forms a spot in one
place instead of seeding.
4. Rabbit blood was used to confirm black pigment production
on blood agar. There are other strains that do not produce a
black pigment in animal blood. We also recommend using
rabbit blood for the hemagglutination test.
40 Yoshio Kondo
References
1. Haffajee AD, Socransky SS, Patel MR et al 15. Bowler PG, Duerden BI, Armstrong DG
(2008) Microbial complexes in supragingival (2001) Wound microbiology and associated
plaque. Oral Microbiol Immunol 23:196–205 approaches to wound management. Clin
2. Kuriyama T, Karasawa T, Nakagawa K et al Microbiol Rev 14:244–269
(2000) Bacteriologic features and antimicro- 16. Odeh M, Oliven A, Potasman I et al (2000)
bial susceptibility in isolates from orofacial Pyomyositis of the thigh due to Prevotella mel-
odontogenic infections. Oral Surg Oral Med aninogenica. Infection 28:49–50
Oral Pathol Oral Radiol Endod 90:600–608 17. Jousimies-Somer H, Savolainen S, M€akitie A
3. Behra-Miellet J, Calvet L, Mory F et al (2003) et al (1993) Bacteriologic findings in periton-
Antibiotic resistance among anaerobic Gram- sillar abscesses in young adults. Clin Infect Dis
negative bacilli: lessons from a French multi- 16(Suppl 4):S292–S298
centric survey. Anaerobe 9:105–111 18. Hsiao WW, Li KL, Liu Z et al (2012) Microbial
4. Hecht DW (2006) Anaerobes: antibiotic resis- transformation from normal oral microbiota to
tance, clinical significance, and the role of sus- acute endodontic infections. BMC Genomics
ceptibility testing. Anaerobe 12:115–121 13:345
5. Wybo I, Piérard D, Verschraegen I et al (2007) 19. Talan DA, Abrahamian FM, Moran GJ et al
Third Belgian multicentre survey of antibiotic (2003) Clinical presentation and bacteriologic
susceptibility of anaerobic bacteria. J Antimi- analysis of infected human bites in patients pre-
crob Chemother 59:132–139 senting to emergency departments. Clin Infect
6. Duerden BI (1980) The isolation and identifi- Dis 37:1481–1489
cation of Bacteroides spp. from the normal 20. De A, Varaiya A, Mathur M (2002) Anaerobes
human gingival flora. J Med Microbiol in pleuropulmonary infections. Indian J Med
13:89–101 Microbiol 20:150–152
7. Bik EM, Long CD, Armitage GC et al (2010) 21. Brook I (1995) Prevotella and Porphyromonas
Bacterial diversity in the oral cavity of infections in children. J Med Microbiol
10 healthy individuals. ISME J 4:962–974 42:340–347
8. Papaioannou W, Gizani S, Haffajee AD et al 22. Sibley CD, Grinwis ME, Field TR et al (2011)
(2009) The microbiota on different oral sur- Culture enriched molecular profiling of the
faces in healthy children. Oral Microbiol cystic fibrosis airway microbiome. PLoS One
Immunol 24:183–189 6:e22702
9. Könönen E (1993) Pigmented Prevotella spe- 23. Rossano F, Rizzo A, Sanges MR et al (1993)
cies in the periodontally healthy oral cavity. Human monocytes and gingival fibroblasts
FEMS Immunol Med Microbiol 6:201–205 release tumor necrosis factor-alpha, interleu-
10. Ogrendik M, Kokino S, Ozdemir F et al (2005) kin-1 alpha and interleukin-6 in response to
Serum antibodies to oral anaerobic bacteria in particulate and soluble fractions of Prevotella
patients with rheumatoid arthritis. Med- melaninogenica and Fusobacterium nucleatum.
GenMed 7:2 Int J Clin Lab Res 23:165–168
11. Rogers GB, Carroll MP, Serisier DJ et al 24. Ahmed N, Hayashi T, Hasegawa A et al (2010)
(2004) Characterization of bacterial commu- Suppression of human immunodeficiency virus
nity diversity in cystic fibrosis lung infections type 1 replication in macrophages by commen-
by use of 16s ribosomal DNA terminal restric- sal bacteria preferentially stimulating Toll-like
tion fragment length polymorphism profiling. J receptor 4. J Gen Virol 91:2804–2813
Clin Microbiol 42:5176–5183 25. Jones GR, Gemmell CG (1982) Impairment by
12. Robert R, Grollier G, Frat JP et al (2003) Bacteroides species of opsonisation and phago-
Colonization of lower respiratory tract with cytosis of enterobacteria. J Med Microbiol
anaerobic bacteria in mechanically ventilated 15:351–361
patients. Intensive Care Med 29:1062–1068 26. Bélanger M, Rodrigues P, Progulske-Fox A
13. Falagas ME, Siakavellas E (2000) Bacteroides, (2007) Genetic manipulation of Porphyromo-
Prevotella, and Porphyromonas species: a review nas gingivalis. Curr Protoc Microbiol.
of antibiotic resistance and therapeutic options. Chapter 13:Unit13C.2
Int J Antimicrob Agents 15:1–9 27. Kondo Y, Sato K, Nagano K et al (2018)
14. Mukhopadhyay S, Rose F, Frechette V (2005) Involvement of PorK, a component of the
Vertebral osteomyelitis caused by Prevotella type IX secretion system, in Prevotella melani-
(Bacteroides) melaninogenicus. South Med J nogenica pathogenicity. Microbiol Immunol
98:226–228 62:554–566
28. Errington J, Bath J, Wu LJ (2001) DNA trans- Streptomyces: kinetics and mode of conjugal
port in bacteria. Nat Rev Mol Cell Biol transfer. Mol Microbiol 42:159–166
2:538–545 33. Simon R, Priefer UB, Pühler A (1983) A broad
29. Llosa M, de la Cruz F (2005) Bacterial conju- host range mobilization system for in vivo
gation: a potential tool for genomic engineer- genetic engineering: transposon mutagenesis
ing. Res Microbiol 156:1–6 in Gram negative bacteria. Bio/Technology
30. Sprague GF (1991) Genetic exchange between 1:784–791
kingdoms. Curr Opin Genet Dev 1:530–533 34. Nagano K, Murakami Y, Nishikawa K et al
31. Grohmann E, Muth G, Espinosa M (2003) (2007) Characterization of RagA and RagB in
Conjugative plasmid transfer in gram-positive Porphyromonas gingivalis: study using gene-
bacteria. Microbiol Mol Biol Rev 67:277–301, deletion mutants. J Med Microbiol
table of contents 56:1536–1548
32. Possoz C, Ribard C, Gagnat J et al (2001) The
integrative element pSAM2 from
Chapter 5
Genetic Transformation of Fusobacterium nucleatum

Akihiro Yoshida and Akihiko Ikegami
Abstract
Fusobacterium nucleatum is a human periodontal pathogen that causes opportunistic infections. It has been
implicated in preterm birth and has as a pathogen of colorectal cancer. However, it is a common member of
the oral microbiota and can have a symbiotic relationship with its hosts. To date, studies of F. nucleatum
have been hindered by a lack of effective genetic tools, and the transformation of F. nucleatum has not been
investigated. In this chapter, protocols for the transformation of F. nucleatum strain 12230 using sono-
poration are presented. We also include a genetic complementation protocol for a F. nucleatum knockout
mutant.
Key words Fusobacterium nucleatum, Transformation, Sonoporation
1 Introduction
Fusobacterium nucleatum is a gram-negative anaerobic oral and

gastrointestinal commensal. It is a periodontal pathogen that has
been associated with a wide spectrum of human diseases [1–3], and
it is implicated in various forms of periodontitis and opportunistic
infections. F. nucleatum is highly prevalent in intrauterine infec-
tions associated with preterm birth and other adverse pregnancy
outcomes [4–7]. Recently, F. nucleatum has been implicated as a
cancer-associated microorganism known to influence cancer devel-
opment and progression, most notably in colorectal cancer [7–
14]. Genomic analysis revealed F. nucleatum enrichment in
human colon cancers and adenomas relative to noncancerous
colon tissues [15]. These observations have been reported in mul-
tiple colorectal cancer cohorts [16]. Thus, this organism is asso-
ciated with various infectious diseases and colon cancer; however, it
is also a common member of the oral microflora.
A lack of effective genetic tools has hindered studies of
F. nucleatum. Genetic manipulation is difficult, presumably due in
part to its diversified restriction endonuclease systems, which differ
between strains and cleave DNA irrespective of the extent of
43
44 Akihiro Yoshida and Akihiko Ikegami
methylation [17]. Several mobile genetic elements have been iden-

tified, and several shuttle plasmids have been constructed [18–22],
but these shuttle plasmids have only produced two strains,
F. nucleatum ATCC 10953 and ATCC 23726 [20, 21].
This chapter describes transformation protocols for
F. nucleatum. Previous studies failed to employ electroporation
and conjugation to F. nucleatum. Han et al. successfully employed
sonoporation techniques and constructed a FadA adhesin-null
mutant (ΔfadA::ermF–ermAM) using ultrasound (US) [23]. This
was the first allelic exchange mutant in F. nucleatum 12230. US is a
type of mechanical energy generated in a medium as oscillating
pressure in space and time at frequencies above 20 kHz, beyond
the audible range. US exposure generates bioeffects resulting in
tissue heating, shear stress, and cavitation. Cavitation has been used
for the intracellular delivery of drugs and genes. Cavitation can
cause drastic local physical and chemical changes, and the genera-
tion of free radicals [24, 25]. Cell membranes can be damaged or
disrupted locally, allowing for the entry of extracellular agents into
the cytoplasm. This process is termed sonoporation. Sonoporation
can be classified into two categories: (1) reparable sonoporation, in
which temporary pores are induced in the cell membrane and then
resealed, leading to cell survival; and (2) irreversible sonoporation,
in which the cell membrane is irreversibly damaged or the cell is
lysed, leading to cell death. Reparable sonoporation is an emerging
technology for intracellular delivery of genes or other agents and
has been used in mammalian cells. The use of sonoporation to
construct the F. nucleatum mutant was its first application in bac-
teria [23]. All transformants obtained by sonoporation were
double-crossover allelic exchange mutants using an intact suicide
plasmid [26]. This was the first study to use double-crossover allelic
exchange with an intact suicide plasmid in gram-negative bacteria
[26]. In this chapter, we describe the construction of a
F. nucleatum fadA double-crossover mutant and complementation
of this strain, as one sample of knockout mutant and genetic
complementation of this bacteria.
2 Materials
Prepare all solutions using distilled water and analytical grade

reagents. Prepare and store all reagents at room temperature
(unless indicated otherwise).
2.1 Plasmid DNA Oligonucleotide primers are listed in Table 1. Plasmids and bacte-
Construct for rial strain used in this study are listed in Table 2.
Transformation 1. pCR2.1: (Invitrogen) for the cloning vector.
2. pVA2198: containing the ermF–ermAM cassette [27].
Transformation of Fusobacterium nucleatum 45
Table 1
Primers used in this study
Primer Sequencea (50 ! 30 ) Gene targeted

fadA1f AGGTCAAGAAGCAAAAGG upfadA
fadA1r TTTTTGGTACCCTTGCTGCATCAGTTGC upfadA
fadA2f TTTTTGGATCCTCAAGCTTTAAGAGCTGG downfadA
fadA2r AGGGTTACTTGATTCAGG downfadA
fadASDF TTTGGATCCTAAATAAATAATTTGGGAGG The fadA gene with a Shine–Dalgarno
TAACAAAAATG sequence
fadASDR TTTGTCGACTTAGTTACCAGCTCTTAAAGC The fadA gene with a Shine–Dalgarno
sequence
fadAfor TTAGCTGTTTCTGCTTCAGC fadA
fadArev TTACCAGCTCTTAAAGCTTG fadA
erm1F TGCATACCTTTGTTCCTCGG ermF-ermAM cassette
erm1R TTTTTTGGATCCGAAGGACAATGGAACC ermF-ermAM cassette
TCCC
erm2F TTTTTTGTCGACAAATTGGAACAGG ermF-ermAM cassette
TAAAGGGC
erm2R CTCATAGAATTATTTCCTCCCG ermF-ermAM cassette
a
Endonuclease restriction sites are underlined
3. pJIR418: carrying catP, confers thiamphenicol resistance [28].

4. pYH1378: pCR2.1 carrying ΔfadA::ermF–ermAM and flank-
ing regions of fadA; 7.1 kb [23].
5. pYH1426: pYH1378 containing sacB; 9.2 kb [23].
6. pYH1479: carrying the ermF–fadA–ermAM fragment with the
SalI site between fadA and ermAM [29].
7. pYH1480: catP from pJIR418 cloned into the SalI site in
pYH1479, carrying thiamphenicol-resistance gene, used for
sonoporation to generate a fadA-complementing clone [29].
8. Restriction enzymes: KpnI, BamHI, SalI, and EcoRV.
9. Ligation kit: Ligase, Ligation buffer.
10. Escherichia coli TOP10: A cloning host strain for plasmid con-
struction. Maintain E. coli TOP10 strain in Luria–Bertani
(LB) broth 25 g/L or on LB agar (add 15 g/L agar to LB
broth) and incubate at 37 C.
Table 2
Bacterial strains and plasmids used in this study
Strains or plasmid Description Source or reference

Strains
Fusobacterium nucleatum Oral commensal [26]
12230
Fusobacterium nucleatum fadA deletion mutant [23]
US1 (12230 ΔfadA::ermF–ermAM)
Fusobacterium nucleatum fadA complementing strain [29]
USF81 (12230 US1 ermF–ermAM::fadA-catP)
Escherichia coli TOP10 Cloning host Invitrogen
Plasmids
pCR2.1 Cloning vector Invitrogen
pVA2198 Source of ermF–ermAM cassette [27]
pJIR418 Carrying catP, confers thiamphenicol resistance [28]
pYH1378 pCR2.1 carrying ΔfadA::ermF–ermAM [23]
and flanking regions of fadA
pYH1426 pYH1378 containing sacB [23]
pYH1479 Carrying the ermF–fadA–ermAM fragment [29]
with the SalI site between fadA and ermAM
pYH1480 catP from pJIR418 cloned into the SalI site [29]
in pYH1479
2.2 Transformation Bacterial strains used in this study are listed in Table 2.
of F. nucleatum
1. F. nucleatum 12230 (see Note 1).
2.2.1 Bacterial 2. Clindamycin: 0.4 mg/mL stock solution in water.
Preparation
3. Thiamphenicol: 5 mg/mL stock solution in ethanol.
4. Columbia blood agar: Autoclaved 39 g/L of Columbia blood
agar base. Add 5 μg/mL hemin, 1 μg/mL menadione (vitamin
K1), and 5% defibrinated sheep blood once it cools to below
60 C. For selective plates, add the appropriate antibiotics
(clindamycin or thiamphenicol) (see Note 2).
5. Tryptic soy (TS) broth or brain heart infusion (BHI) broth/
agar plates supplemented with hemin and menadione.
6. Anaerobic chamber: Maintain at 37 C with 5% CO2, 10% H2,
and 85% N2.
7. 0.1 M CaCl2: Dissolve 1.47 g of CaCl2∙2H2O in water and
make up to 100 mL with water. Store at room temperature.
8. 0.1 M MgCl2: Dissolve 2.03 g of MgCl2∙6H2O in water and

make up to 100 mL with water. Store at room temperature.
9. 20 stock of phosphate-buffered saline (PBS) pH 7.3: Dissolve
320 g of NaCl, 8 g of KH2PO4, 46 g of Na2HPO4, and 8 g of
KCl in distilled H2O. Adjust the pH at pH 7.3 with HCl
(or NaOH) and make up to 2 L with distilled H2O (or water).
Store at room temperature.
10. Sonoporation buffer: Add 0.1 mL of 0.1 M CaCl2, 0.1 mL of
0.1 M MgCl2, and 5 mL of 20 PBS in 20 mL of water. After
mixing, make up to 100 mL. Sterilize by autoclaving. Store at
room temperature.
2.2.2 Sonoporation 1. Definity contrast agent: Ultrasound contrast agent consisting

of octafluoropropane gas bubbles encapsulated in a lipid and
dispersed solution.
2. Nunc eight-well immunomodule (0.4-ml wells).
3. US transducer: a regular planar piezoelectric lead–zirconate–
titanate US transducer with a circular aperture 5.1 cm in diam-
eter (center frequency of 0.96 MHz).
4. Use a signal generator (33250A; Agilent Technologies).
5. 75 W power amplifier (75A250; Amplifier Research).
6. Calibrated hydrophone system (HPM04/1; Precision
Acoustics).
7. US power meter (UPM-DT-10; Ohmic Instrument Co).
8. Perflutren lipid microsphere (Bristol-Myers Squibb).
3 Methods
3.1 Construction of a 1. To construct plasmids pYH1378 and pYH1426, amplify a

fadA-Deletion Mutant 526-bp fragment, “upfadA,” and a 510-bp fragment, “down-
in F. nucleatum fadA,” corresponding to the upstream and downstream
regions flanking the fadA gene, respectively, using the follow-
3.1.1 DNA Construct
ing primer sets: fadA1f–fadA1r and fadA2f–fadA2r (Table 2).
This generates a KpnI site in “upfadA” and a BamHI site in
“downfadA” at the ends adjacent to fadA [23].
2. Ligate the KpnI–BamHI fragment containing the ermF–
ermAM cassette from pVA2198 with the “upfadA” and the
“downfadA” fragments, and then clone the fragment into
pCR2.1. The resulting plasmid is designated as pYH1378.
3. Transform E. coli TOP10 with pYH1378.
4. Purify and digest pYH1378 with EcoRV to linearize [23].
3.1.2 Transformation 1. Culture F. nucleatum 12230 overnight at 37 C under anaero-

Using Sonoporation bic conditions in BHI broth supplemented with hemin and
menadione.
2. Harvest the log-phase F. nucleatum 12230 culture and then
wash and resuspend the culture in PBS supplemented with
0.1 mM CaCl2 and 0.1 mM MgCl2.
3. Mix 100 μL (approximately 1 109 CFU) of the bacterial
suspension with 50 μg of plasmid and 50 μL of Definity (con-
trast agent) in the Nunc eight-well immunomodule.
4. Direct a regular planar piezoelectric lead–zirconate–titanate US
transducer with a circular aperture 5.1 cm in diameter (center
frequency of 0.96 MHz) upward to irradiate the bacteria in the
96-well plate.
5. Use a signal generator to control the duty cycle and initial
amplitude of the input signal, and amplify the signal using a
75 W power amplifier. Connect the amplified signal to the US
transducer to generate the desired US field. Use pulsed US
exposures at a duty cycle of 50% and a pulse repetition fre-
quency of 1 Hz for a total duration of 90 s. Measure the US
beam profile using a calibrated hydrophone system, and cali-
brate the effective US output powers using a US power meter.
The acoustic pressure of US exposure should be 0.5 MPa
(corresponding to an initial input signal at 130 mV).
6. Plate the suspension onto Columbia blood agar plates and
incubate the suspension under anaerobic conditions at 37 C
for 24 h. Subculture the bacteria on Columbia blood agar
plates containing 0.4 μg/μL clindamycin and incubate for
3 additional days. Purify the clindamycin-resistant colonies on
plates before inoculating them in Columbia broth containing
0.4 μg/μL clindamycin. Verify the genetic composition of the
mutants by PCR using fadAfor and fadArev primers (Table 1)
to obtain the resulting fadA deletion mutant, F. nucleatum
12230 US1.
3.2 Construction of a 1. Amplify the fadA gene with a Shine–Dalgarno sequence using
fadA-Complemented fadASDF and fadASDR primers to create a 436-bp fragment
Mutant in F. nucleatum with a BamHI site at the 50 end and a SalI site at the 30 end.
3.2.1 DNA Construct 2. Amplify the ermF gene using erm1F and erm1R primers to
create a 622-bp fragment with a BamHI site at the 30 end [29].
3. Amplify the ermAM gene using erm2F and erm2R primers to
create a 643-bp fragment with a SalI site at the 50 end [29].
4. Following digestion with BamHI and/or SalI, ligate these
three fragments. Amplify the ermF–fadA–ermAM fragment
using erm1F and erm2R primers and clone the fragment into
pCR2.1. Digest the resulting plasmid, pYH1479, with SalI,

and then insert the catP gene from plasmid pJIR418 [28] into
this site to generate pYH1480 [29].
3.2.2 Transformation 1. Culture, wash and resuspend F. nucleatum US1 cells in PBS
Using Sonoporation supplemented with 0.1 mM CaCl2 and 0.1 mM MgCl2 (see
steps 1 and 2 in Subheading 3.1.2).
2. Mix the bacterial suspension (approximately 1 109 cells) with
50 μg of plasmid pYH1480 and 50 μL of Definity in 0.4-mL
wells of an eight-well flat-bottomed immunomodule with a
frame.
3. Treat the mixture by sonoporation as previously described (see
steps 4 and 5 in Subheading 3.1.2). Plate the sonoporated
suspension onto Columbia blood agar plates and incubate
without selection for 24 h at 37 C under anaerobic conditions,
followed by replication on Columbia blood agar plates contain-
ing 5 μg/mL thiamphenicol.
4. Incubate the plates for 3–5 days at 37 C. Isolate the thiam-
phenicol-resistant colonies and inoculate the bacteria in
Columbia broth containing 5 μg/mL thiamphenicol.
4 Notes
1. F. nucleatum 12230: also referred to F. nucleatum subsp. poly-

morphum, strain F0401 (Oral Clone BS019) was isolated from
a transtracheal biofilm from a healthy patient. Strain F0401
(HMP ID 9369) is a reference genome for The Human Micro-
biome Project (HMP).
2. Alternatively, TS broth 30 g/L or BHI 37 g/L, supplemented
with 5 μg/mL hemin and 1 μg/mL menadione, is available for
inoculation of F. nucleatum. Add 15 g/L agar to the medium
and autoclave at 121 C for 15 min. Gifu Anaerobic Broth
medium 59 g/L (Nissui Pharmaceutical Co., Ltd., Tokyo,
Japan) supplemented with hemin and menadione is also
available.
References
1. Jenkins HC, Baker HA (1951) Fermentative 4. Han YW, Shen T, Chung P et al (2009) Uncul-
process of the fusiform bacteria. J Bacteriol tivated bacteria as etiologic agents of intra-
61:101–114 amniotic inflammation leading to preterm
2. Moore WF, Moore LV (1994) The bacteria of birth. J Clin Microbiol 47:38–47
periodontal diseases. Periodontol 2000 5. Hill GB (1998) Preterm birth: associations
5:66–77 with genital and possibly oral microflora. Ann
3. Brennan CA, Garrett WS (2019) Fusobacter- Periodontol 3:222–232
ium nucleatum-symbiont, opportunist and 6. Coppenhagen-Glazer S, Sol A, Abed J et al
oncobacterium. Nat Rev Microbiol (2015) Fap2 of Fusobacterium nucleatum is a
17:156–166 galactose-inhibitable adhesin involved in
coaggregation, cell adhesion, and preterm 19. Claypool BM, Yoder SC, Citron DM et al
birth. Infect Immun 83:1104–1113 (2010) Mobilization and prevalence of a Fuso-
7. Han YW (2015) Fusobacterium nucleatum: a bacterial plasmid. Plasmid 63:11–19
commensal-turned pathogen. Curr Opin 20. Bachrach G, Haake SK, Glick A et al (2004)
Microbiol 23:141–147 Characterization of the novel Fusobacterium
8. Wong SH, Yu J (2019) Gut microbiota in colo- nucleatum plasmid pKH9 and evidence of an
rectal cancer: mechanisms of action and clinical addiction system. Appl Environ Microbiol
applications. Nat Rev Gastroenterol Hepatol 70:6957–6962
16:690–704 21. Haake SK, Yoder SC, Attarian G et al (2000)
9. Rubinstein MR, Baik JE, Lagana SM et al Native plasmids of Fusobacterium nucleatum:
(2019) Fusobacterium nucleatum promotes characterization and use in development of
colorectal cancer by inducing Wnt/β-catenin genetic systems. J Bacteriol 182:1176–1180
modulator Annexin A1. EMBO Rep 20: 22. Kinder Haake S, Yoder S, Gerardo SH (2006)
e47638 Efficient gene transfer and targeted mutagene-
10. Komiya Y, Shimomura Y, Higurashi T et al sis in Fusobacterium nucleatum. Plasmid
(2019) Patients with colorectal cancer have 55:27–38
identical strains of Fusobacterium nucleatum 23. Han YW, Ikegami A, Rajanna C et al (2005)
in their colorectal cancer and oral cavity. Gut Identification and characterization of a novel
68:1335–1337 adhesin unique to oral fusobacteria. J Bacteriol
11. Bullman S, Pedamallu CS, Sicinska E et al 187:5330–5340
(2017) Analysis of Fusobacterium persistence 24. Ward M, Wu J, Chiu JF (2000) Experimental
and antibiotic response in colorectal cancer. study of the effects of Optison concentration
Science 358:1443–1448 on sonoporation in vitro. Ultrasound Med Biol
12. Yu T, Guo F, Yu Y et al (2017) Fusobacterium 26:1169–1175
nucleatum promotes chemoresistance to colo- 25. Miller DL, Pislaru SV, Greenleaf JE (2002)
rectal cancer by modulating autophagy. Cell Sonoporation: mechanical DNA delivery by
170:548–563 ultrasonic cavitation. Somat Cell Mol Genet
13. Ramos A, Hemann MT (2017) Drugs, bugs, 27:115–134
and cancer: Fusobacterium nucleatum pro- 26. Han YW, Ikegami A, Chung P et al (2007)
motes chemoresistance in colorectal cancer. Sonoporation is an efficient tool for intracellu-
Cell 170:411–413 lar fluorescent dextran delivery and one-step
14. Rubinstein MR, Wang X, Liu W et al (2013) double-crossover mutant construction in Fuso-
Fusobacterium nucleatum promotes colorectal bacterium nucleatum. Appl Environ Microbiol
carcinogenesis by modulating E-cadher- 73:3677–3683
in/β-catenin signaling via its FadA adhesin. 27. Fletcher HM, Schenkein HA, Morgan RM et al
Cell Host Microbe 14:195–206 (1995) Virulence of a Porphyromonas gingivalis
15. Castellarin M, Warren RL, Freeman JD et al W83 mutant defective in the prtH gene. Infect
(2012) Fusobacterium nucleatum infection is Immun 63:1521–1528
prevalent in human colorectal carcinoma. 28. Sloan J, Warner TA, Scott PT et al (1992)
Genome Res 22:299–306 Construction of a sequenced Clostridium
16. Mima K, Nishihara R, Qian ZR et al (2016) perfringens-Escherichia coli shuttle plasmid.
Fusobacterium nucleatum in colorectal carci- Plasmid 27:207–219
noma tissue and patient prognosis. Gut 29. Ikegami A, Chung P, Han YW (2009) Comple-
65:1973–1980 mentation of the fadA mutation in Fusobacter-
17. Lui AC, McBride BC, Vovis GF et al (1979) ium nucleatum demonstrates that the surface-
Site specific endonuclease from Fusobacterium exposed adhesin promotes cellular invasion and
nucleatum. Nucleic Acids Res 6:1–15 placental colonization. Infect Immun
18. McKay TL, Ko J, Bilalis Y et al (1995) Mobile 77:3075–3079
genetic elements of Fusobacterium nucleatum.
Plasmid 33:15–25
Part II
Experimental Methods to Examine Virulence Factors

Chapter 6
Genotyping of Porphyromonas gingivalis in Relationship

to Virulence
Atsuo Amano, Youn-Hee Choi, and Hiroki Takeuchi
Abstract
Porphyromonas gingivalis, a significant periodontal pathogen, is known to possess genetic variations in
relation to its virulence. Furthermore, fimbriae encoded by the fimA gene are involved in bacterial
adherence to and invasion of host cells, and a known virulence factor of the bacterium. The fimA gene is
classified into six variants (types I–V and Ib) and has been shown to be related to microbial virulence.
Polymerase chain reaction (PCR) assay results are helpful to differentiate the genotypes, with fimA type-
specific primer sets used for that have been developed by several researchers. Although room for improve-
ment remains, fimA genotyping is expected to become a useful technique for periodontal examinations and
diagnosis. In this chapter, currently available PCR methods to classify fimA genotypic variations of
P. gingivalis are described.
Key words Periodontitis, Periodontal bacteria, fimA, Genotyping, Porphyromonas gingivalis,

Fimbriae, Polymerase chain reaction, PCR
1 Introduction
Porphyromonas gingivalis, associated with various forms of marginal

periodontitis, resides in periodontal pockets undergoing destruc-
tion as well as healthy gingival margins. Research findings have
strongly suggested clonal heterogeneity among harbored organ-
isms, thus specific clones of P. gingivalis have been investigated to
determine their relationship to bacterial virulence [1–4].
Genetic variations of P. gingivalis can be distinguished by a
variety of methods, including polymerase chain reaction (PCR)
assays, heteroduplex analysis, microarray-based comparative geno-
mic hybridization, multiple locus sequence typing, multiple-loci
variable number of tandem repeats analysis, pattern-based technol-
ogies, and comparative whole-genome analysis. Among those, PCR
results are useful to classify genotypes of P. gingivalis in relationship
to microbial virulence [1–4].
53
54 Atsuo Amano et al.
Fimbriae are thin, filamentous, proteinaceous surface appen-

dages (hairlike organelles) on bacterial surfaces, and a critical factor
for colonization of P. gingivalis in subgingival regions, as they
promote both bacterial adhesion to and invasion of targeted sites.
The fimA gene is monocistronic and exists as a single copy in the
chromosome of P. gingivalis, and has been classified into six var-
iants (types I–V and Ib) on the basis of the nucleotide sequence
[1, 2, 4]. Previous studies have strongly suggested that type II is the
most virulent fimA genotype, followed by types Ib and IV. The
odds ratio for the association of each fimA type with periodontitis
has been reported to be 0.198 for type I, 6.51 for type Ib, 77.8 for
type II, 2.51 for type III, 7.54 for type IV, or 1.05 for type V [4].
fimA type-specific primer sets used for differentiation analysis
have been developed and improved by researchers [5, 6]. However,
untypable fimA genes other than the 6 known genotypes have also
been observed [2, 6, 7]. The methods for fimA genotyping will
require further development; however, they are expected to be
useful for periodontal examinations and diagnosis. This chapter
describes currently available PCR methods to classify fimA geno-
typic variations of P. gingivalis.
2 Materials
All polypropylene tubes and water should be nuclease and pyrogen

free. All solutions and reaction mixtures should be prepared on ice,
unless indicated otherwise.
2.1 Samples 1. Subgingival plaque.

and P. gingivalis 2. Sterile Gracy curette.
Culture
3. Dulbecco’s phosphate buffered saline (PBS: NaCl; 8 g/L, KCl;
0.2 g/L; Na2HPO4; 1.15 g/L, KH2PO4; 0.2 g/L), pH 7.4,
sterilized.
4. 1.5 mL sample tubes.
5. 15 mL centrifuge tubes.
6. Standard reference strains: P. gingivalis ATCC 33277, TDC60,
6/26, W50, HNA-99, and HG1691.
7. Anaerobe blood agar plates (BD).
8. Trypticase soy broth (TSB) medium: 30 mg/mL TSB in water
supplemented with 1 mg/mL yeast extract, 5 μg/mL hemin,
1 μg/mL menadione, and 1 mg/mL L-cysteine hydrochloride.
Autoclave TSB medium in a glass bottle 121 C for 15 min,
cool down to room temperature, and set TSB in anaerobic jar
until use.
9. Anaerobic jar.
Genotyping of Porphyromonas gingivalis in Relationship to Virulence 55
10. Gas generators for anaerobic culture (Mitsubishi Gas

Chemical).
12. UV-transparent cuvettes.
13. Incubator for incubation at 37 C.
14. Centrifuge.
2.2 PCR 1. Genomic DNA purification kit (Promega).

2. 0.2 μL PCR tubes.
3. PCR master mix.
4. Thermal cycler.
2.3 Electrophoresis 1. Tris–acetate–EDTA (TAE) buffer, pH 8.3.

2. Agarose.
3. Gel casting set.
4. Molecular size standard.
5. Nucleic acid staining solution.
6. Agarose electrophoresis unit (Mupid-exU).
7. Gel and PCR Clean-Up System (Promega).
8. UV illumination.
3 Methods
3.1 Clinical Sample 1. Remove supragingival plaque and collect plaque samples from
Collection subgingival sites with a sterile Gracy curette (see Note 1).
2. Place each sample into sterile 1.5-mL tube containing 1 mL of
sterile PBS (pH 7.4) and place on ice.
3.2 DNA Extraction 1. Gently vortex the sample tube for 10 s, then centrifuge at
3300 g for 5 min. Carefully discard the supernatant.
2. For a positive control, streak P. gingivalis from frozen glycerol
stocks onto blood agar plates and grow for 3 days at 37 C in
anaerobic conditions. Pipet 5 mL of TSB medium into 15 mL
tube and steak out P. gingivalis on blood agar plates into TSB
medium. Incubate bacteria in culture medium at 37 C in
anaerobic conditions for 24–48 h until bacteria reach peak
infectivity (final OD600 ¼ 2.0). Centrifuge sample tubes con-
taining 1 mL of bacterial culture and carefully discard the
supernatant.
3. Purify genomic DNA from the clinical sample and positive

control with a genomic DNA purification kit.
4. Determine DNA amount with a spectrophotometer and adjust
to 10 ng/μL. Store immediately at 80 C.
3.3 Confirm 1. Prepare 1 ng of sample DNA and 16S rRNA primer set in PCR
Existence of Bacterial tube (Table 1).
DNA Using PCR 2. Perform an amplification reaction using PCR Master Mix. The
thermal cycle is as follows: after initial denaturation at 95 C for
15 min, perform 30 cycles consisting of 95 C for 15 s, 55 C
for 15 s, and 72 C for 40 s, and a final extension at 72 C for
7 min (Table 1).
3. Include positive and negative controls in each PCR set, as well
as when processing all samples.
4. Confirm PCR products with electrophoresis in 2% agarose gel
with TAE buffer. Use a 100-bp DNA ladder as the molecular
size standard.
5. Stain the gel with nucleic acid staining solution and obtain
photographs under UV illumination (Fig. 1).
3.4 Confirm 1. Prepare 1 ng of sample DNA and P. gingivalis 16S rRNA

Existence primer set in PCR tubes (Table 1).
of P. gingivalis DNA 2. Perform amplification reaction with PCR Master Mix. The
Using PCR thermal cycle is as follows: following initial denaturation at
95 C for 15 min, perform 30 cycles consisting of 95 C for
15 s, 58 C for 15 s, and 72 C for 15 s, and a final extension at
72 C for 7 min (Table 1).
3. Confirm the PCR products (seesteps 4 and 5 in Subheading
3.3) (Fig. 1).
3.5 Determine fimA 1. Prepare 1 ng of sample DNA and fimA type primer set in PCR
Genotypes tubes (Table 1).
of P. gingivalis- 2. Perform amplification reaction with PCR Master Mix. The
Positive Specimens thermal cycle is as follows: following initial denaturation at
Using PCR 95 C for 15 min, perform 35 cycles consisting of 95 C for
15 s, then 60 C (type V) or 58 C (other types) for 15 s, and
72 C for 15 s, and a final extension at 72 C for 7 min
(Table 1).
3.3) (Fig. 1).
Table 1
fimA type- and 16S rRNA-specific primers
Length Ta Elongation
Primer Set Sequence (50 –30 ) (bp) ( C) period (s) Reference
16S rRNA GGATTAGAGTTTGATCCTGGCTACC 728 55 40 Lyons et al.
TTGTTACGACTT [8]
Pg 16S TGTAGATGACTGATGGTGAAAACCACG 198 58 15 Amano et al.
rRNA TCATCCCCACCTTCCTC [1]
fimA AAGTTTTTCTTGTTGGGAC 1219 58 45 Shimoyama
universal TTGCAACCCCGCTCCCTGTATTCCGA et al. [6]
fimA type I CTGTGTGTTTATGGCAAACCTTCTTA 173 58 15 Shimoyama
TTCTTAGGCGTATAATTGC et al. [6]
fimA type CTGTGTGTTTATGGCAAACTTCTTATTC 173 58 15 Shimoyama
Ib TTAGGCGTATAACCAT et al. [6]
fimA type GCATGATGGTACTCCTTTGAC 292 58 15 Moon et al.
II TGACCAACGAGAACCCACT [5]
fimA type ATTACACCTACACAGG 253 58 15 Amano et al.
III TGAGGCAACCCCGCTCCCTGTA [1]
TTCCGA
fimA type CTATTCAGGTGCTA 249 58 15 Amano et al.
IV TTACCCAAAACCCCGCTCCCTGTA [1]
TTCCGA
fimA type TGGAACGAATACGCC 166 60 15 Shimoyama
V TGAAGGAAACCCCGCTCCCTGTA et al. [6]
TTCCGA
3.6 Second PCR When an fimA genotype is not identified by the first PCR assay
for fimA despite positive findings for the P. gingivalis 16S rRNA gene,
Type-Unidentified nested PCR is applied, as previously described [6].
Specimens Obtained 1. Amplify DNA fragment with a set of fimA universal primers
in First PCR Assay designed for common sequences among the 6 fimA genes
(Nested PCR) (Table 1). The thermal cycle is as follows: following initial
denaturation at 95 C for 15 min, perform 30 cycles consisting
of 95 C for 15 s, 58 C for 15 s, and 72 C for 45 s, and a final
extension at 72 C for 7 min (Table 1).
2. Purify the PCR products using a Gel and PCR Clean-Up
System.
3. Perform fimA-specific PCR with aliquot (1 μL) of
purified DNA.
3.3) (Fig. 1).
Fig. 1 PCR assay for detection of fimA types of P. gingivalis. The assay is
performed with DNA purified from cultures of P. gingivalis with the six different
fimA types (type I: ATCC 33277, type II: TDC60, type III: 6/26, type IV: W50, type
V: HNA-99, type Ib: HG1691) or no template. PCR is performed with a set of fimA
type-specific primers, P. gingivalis 16S rRNA, or 16S rRNA, as shown in Table 1
4 Note
1. The amount of the samples should be more than half of the

curette blade area. When the sample amount is not enough,
collect from other periodontal pockets.
References
1. Amano A, Nakagawa I, Kataoka K et al (1999) Porphyromonas gingivalis carrying a new type of
Distribution of Porphyromonas gingivalis strains fimA gene. J Clin Microbiol 38(5):1909–1914
with fimA genotypes in periodontal patients. J 4. Nakagawa I, Amano A, Ohara-Nemoto Y et al
Clin Microbiol 37(5):1426–1430 (2002) Identification of a new variant of fimA
2. Amano A, Kuboniwa M, Nakagawa I et al gene of Porphyromonas gingivalis and its distri-
(2000) Prevalence of specific genotypes of Por- bution in adults and disabled populations with
phyromonas gingivalis fimA and periodontal periodontitis. J Periodontal Res 37(6):425–432
health status. J Dent Res 79(9):1664–1668 5. Moon JH, Shin SI, Chung JH et al (2012)
3. Nakagawa I, Amano A, Kimura RK et al (2000) Development and evaluation of new primers
Distribution and molecular characterization of for PCR-based identification of type II fimA of
Porphyromonas gingivalis. FEMS Immunol Med of Porphyromonas gingivalis from patients with
Microbiol 64(3):425–428 periodontitis. J Clin Microbiol 46(1):31–42
6. Shimoyama Y, Ohara-Nemoto Y, Kimura M et al 8. Lyons SR, Griffen AL, Leys EJ (2000) Quanti-
(2017) Dominant prevalence of Porphyromonas tative real-time PCR for Porphyromonas gingiva-
gingivalis fimA types I and IV in healthy Japa- lis and total bacteria. J Clin Microbiol 38
nese children. J Dent Sci 12(3):213–219 (6):2362–2365
7. Enersen M, Olsen I, Kvalheim Ø et al (2008)
fimA genotypes and multilocus sequence types
Chapter 7
Transport and Polymerization of Porphyromonas gingivalis

Type V Pili
Mikio Shoji, Satoshi Shibata, Mariko Naito, and Koji Nakayama
Abstract
Adhesive pili (or fimbriae) in bacteria are classified into five types, among which type V pili have been most
recently described. Type V pili differ from other pili types with respect to transport mechanism, structure,
and pilin synthesis. Genes of type V pili are restricted to the phylum Bacteroidetes. Protein subunits that
compose type V pili are transported to the cell surface as lipoprotein precursors and then polymerized into a
pilus through a strand-exchange mechanism, which is demonstrated by several experiments, including
palmitic acid labeling and Cys-Cys cross-linking analysis. Here, we describe the use of these methods to
analyze type V pili.
Key words Type V pili, Fimbriae, Immunoblot, Globomycin treatment, Palmitic acid labeling, Dot
blot, Cys-Cys cross-linking, Electron microscopy
1 Introduction
Periodontal diseases including chronic periodontitis are caused by

bacterial infection. Chronic periodontitis has been reported to have
many epidemiological associations with metabolic syndrome dis-
ease states such as diabetes, coronary heart disease, hypertension,
and dyslipidemia [1]. Therefore, chronic periodontitis is consid-
ered to be of particular importance among periodontal diseases.
The bacterium, Porphyromonas gingivalis, is known to be one of the
primary causative agents of chronic periodontitis. Its pathogenicity
and the inflammatory responses it induces in its host have been well
studied [2].
P. gingivalis is a gram-negative anaerobic bacterium that pro-
duces highly active proteases called gingipains to promote its sur-
vival in the periodontal pocket [3]. Gingipains are divided into two
groups: arginine-specific gingipains (RgpA and RgpB) and a lysine-
specific gingipain (Kgp). Gingipains are transported via the type IX
secretion system, a recently described system that is restricted to the
phylum Bacteroidetes [4, 5]. Much attention is focused on
61
62 Mikio Shoji et al.
gingipains, not only due to their virulent activities against the host
but also their contribution to the maturation of extracellular pro-
teins of P. gingivalis.
P. gingivalis produces pili (or fimbriae) that allow it to adhere
to host cells or other bacterial cells. P. gingivalis expresses Fim and
Mfa fimbriae, both of which are type V pili [6, 7]. Fim and Mfa
fimbriae–encoding genes each occur in clusters that are located
distantly in the P. gingivalis genome. The protein subunits of
these fimbriae (except for Mfa5) are transported as lipoprotein
precursors; N-terminal prosequences of the protein subunits are
then processed by arginine-specific gingipains on the cell surface
[8–12]. The processed protein subunits such as FimA and Mfa1
polymerize to form the shaft of the fimbriae on the cell surface.
Crystal structure analysis of the type V pili-related proteins suggests
that the C-terminal portion of shaft proteins act as linkers necessary
for the polymerization [13]. Compared to other types of pili
studied, such as chaperone-usher pili, type IV pili, and curli in
gram-negative bacteria, and sortase-dependent pili in gram-positive
bacteria, the type V pili have unique characteristics concerning
transport, structures and mechanism of polymerization
[14]. Genes of the type V pili are only found in the phylum
Bacteroidetes. As P. gingivalis fimbriae are the most studied of
the type V pili, we describe experimental protocols using this
species. Bacterial lipoproteins contain an N-terminal signal
sequence, the lipobox, that enables them to pass through the Sec
apparatus; the lipobox is located approximately 20 amino acid
residues from the first methionine residue of the lipoprotein
[15]. A cysteine residue of the lipobox is lipidated by a diacylgly-
cerol transferase (Lgt) in the inner membrane [16]. Fim or Mfa
fimbriae-related proteins contain such lipoboxes, thus we carried
out lipoprotein detection experiments including treatment with the
signal peptidase II inhibitor globomycin and palmitic acid-labeling
experiments [10, 17]. Next, we describe a dot blot analysis to
determine whether fimbriae-related proteins are present on the
cell surface and then perform Cys-Cys cross-linking analysis to
determine whether the C-terminal portion of shaft proteins acts
as a donor strand for subunit polymerization. Furthermore, we
describe electron microscopy using the negative staining method
to observe fimbriae on the cell surface or purified fimbriae.
2 Materials
Deionized water (DIW) should be used to prepare growth media.

Use ultrapure water (prepared by purifying DIW to attain a sensi-
tivity of 18 MΩ cm at 25 C) and analytical grade reagents should
be used to prepare all other solutions. All reagents are to be
prepared and stored at room temperature unless indicated
Experimental Protocol for Analyzing Type V Pili 63
otherwise. Follow waste disposable regulations strictly when dis-

posing of waste materials. Strains of P. gingivalis ATCC 33277, its
mutants, complemented strains, and W83 are used in this protocol.
2.1 Bacterial Culture 1. Brain–heart infusion (BHI) liquid medium for P. gingivalis
growth: Weigh 3.7 g BHI, 0.5 g yeast extract, and 0.1 g L-
cysteine into a 100 mL glass bottle. Add DIW to a final volume
of 100 mL. Mix well and autoclave. Store at room temperature
for up to 1 day, otherwise, store at 4 C, or at 37 C in an
anaerobic box. Prior to inoculation with P. gingivalis cells,
supplement the autoclaved liquid medium with 5 μg/mL
hemin and 1 μg/mL menadione. Grow P. gingivalis cells
under anaerobic conditions (80% N2, 10% CO2, 10% H2).
2. Hemin stock solution (0.5 mg/mL): Thoroughly dissolve
hemin (50 mg) in 1 mL of 1 N NaOH and add to 99 mL of
ultrapure water in a glass bottle. Autoclave and store at 4 C.
When preparing 100 mL BHI liquid medium, 1 mL of hemin
stock solution should be added.
3. Menadione (Vitamin K) stock solution (5 mg/mL): Dissolve
25 mg of vitamin K thoroughly in 5 mL of pure ethanol. Stored
at 4 C. When preparing 100 mL BHI liquid medium, 20 μL of
menadione stock solution should be added.
4. Tryptic soy (TS) agar solid medium for P. gingivalis growth:
Weigh 4 g TS agar, 0.5 g BHI, and 0.05 g L-cysteine into a
100 mL glass bottle. Add DIW to a final volume of 100 mL.
Mix well and autoclave. Prior to pouring into plates, supple-
ment the autoclaved solid medium with 5 μg/mL hemin and
0. 5 μg/mL menadione. When preparing100 mL TS agar plate,
1 mL of hemin stock solution and 10 μL of menadione stock
solution should be added. Pour into plates and store at 4 C.
Grow P. gingivalis cells on TS agar plates under anaerobic
conditions (see Note 1). Passage the cells to fresh TS agar plates
approximately every 7 days.
5. Skim milk stock solution for P. gingivalis strains: Weigh 10 g
skim milk into a 100 mL glass bottle. Add DIW to a final
volume of 100 mL. Mix well and autoclave. Pour into the
Cryotube with 1.6 mL. Scrape P. gingivalis cells from colonies
on TS agar plates using a sterile plastic inoculation loop and
transfer the cells into the skim milk solution. Stored at 80 or
20 C.
2.2 Sodium Dodecyl 1. Separating gel buffer: 1.5 M Tris–HCl, pH 8.8. Weigh 181.7 g
Sulfate (SDS)– Tris–HCl into a 1 L glass beaker. Add ultrapure water to a
Polyacrylamide Gel volume of 0.9 L. Mix well and adjust the pH with HCl. Add
ultrapure water to a final volume of 1 L. Store at 4 C.
2. Stacking gel buffer: 0.5 M Tris–HCl, pH 6.8. Weigh 60.6 g

Tris–HCl into a 1 L glass beaker. Add ultrapure water to a
volume of 0.9 L. Mix well and adjust the pH with HCl. Add
ultrapure water to a final volume of 1 L. Store at 4 C.
3. 30% acrylamide–bisacrylamide solution (acrylamide–bisacryla-
mide 29.2:0.8): Weigh 29.2 g of acrylamide monomer and
0.8 g bisacrylamide (cross-linker) into a 100 mL glass beaker.
Add ultrapure water to a final volume of 100 mL. Transfer to
an amber bottle. Store at 4 C.
4. 10% ammonium persulfate solution in sterile ultrapure water
prior to use.
5. N,N,N,N0 -Tetramethyl ethylenediamine: Store at 4 C.
6. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis
(SDS-PAGE) running buffer: 0.025 M Tris, 0.2 M glycine,
0.1% SDS.
7. SDS lysis buffer stock solution (4): 0.25 M Tris–HCl,
pH 6.8, 8% SDS, 40% glycerol. Mix well and heat to 100 C
to dissolve thoroughly. Store 1 mL aliquots of the solution at
20 C (see Note 2).
8. PBS stock solution (10): 1.37 M NaCl, 0.027 M KCl,
0.081 M Na2HPO4, 0.015 M KH2PO4, pH 7.4. Autoclave
and store at room temperature.
9. Proteinase inhibitors: Tosyl-L-lysyl-chloromethane hydrochlo-
ride (TLCK) and leupeptin.
10. Phosphate buffered saline (PBS) with proteinase inhibitors:
Add 0.1 mM TLCK and 0.1 mM leupeptin to PBS (pH 7.4),
to avoid autoproteolysis (see Note 3).
2.3 Immunoblotting 1. Glass plates, clips, and a comb for a mini-slab gel.
2. Plastic container.
3. Polyvinylidene difluoride (PVDF) membranes.
4. Mini-gel wet-transfer module.
5. Whatman filter paper.
6. Western blot transfer buffer: 0.02 M Tris, 0.15 M glycine,
0.02% SDS, 20% methanol. Weigh 7.3 g Tris, 33.8 g glycine,
and 0.6 g SDS into a 5 L plastic beaker. Add 2.4 L of DIW and
0.6 L of methanol to the beaker and mixed well. Stored at
room temperature.
7. Washing solution: PBS containing 0.05% Tween 20 (PBST).
8. Blocking solution: 3% skim milk in PBST (see Note 4).
9. Diluent solution: 3% skim milk in PBST.
10. Antibodies: Antiserum raised against recombinant (r) FimA,

rMfa1, and rMfa2 proteins, obtained from strain P. gingivalis
ATCC 33277, and rFimB protein, obtained from strain W83,
is used as a source of primary antibodies.
11. Horseradish peroxidase (HRP)-conjugated secondary
antibodies.
12. Enhanced chemiluminescence prime detection reagent. Mix
equal volumes of solution A and solution B.
13. Autoradiography film.
14. Developing, stop, and fixing solutions.
2.4 Globomycin 1. Globomycin: a signal peptidase II inhibitor (kindly provided

Treatment from Sankyo Co., Ltd.).
2.5 Palmitic Acid 1. Palmitic acid, [1-14C]-, 2.5 μCi (14C-palmitic acid henceforth,
Labeling Experiment for the sake of brevity).
2. BugBuster® protein extraction reagent.
3. Antibodies: Antiserum raised against rFimB protein, obtained
from strain W83, and rMfa2 protein, obtained from strain
ATCC 33277, is used for immunoprecipitation.
4. Protein G agarose beads.
5. Plastic container.
7. Wrap.
8. Gel dryer.
9. Cassette used for autoradiography.
10. Imaging plate.
11. Fluorescent-image analyzer, FLA-5100.
2.6 Dot Blot Analysis 1. Multimode microplate reader.

2. Nylon membranes.
3. Immunoblotting system as described (see Subheading 2.3).
2.7 Cys-Cys Cross- 1. Hydrogen peroxide.

Linking Analysis 2. Cross-linkers: bismaleimidoethane (BMOE) or bismaleimido-
hexane (BMH).
3. Immunoblotting system as described (see Subheading 2.3).
2.8 Electron 1. 1% (w/v) ammonium acetate prepared in ultrapure water.

Micrography 2. Carbon-coated cupper 200 mesh electron microscopy
(EM) grid.
3. 1% (w/v) uranyl acetate solution prepared in ultrapure water.

5. Glow discharge equipment: HDT-400 (JEOL, Japan).
6. JEM-1200EX transmission electron microscope (JEOL,
Japan).
7. ImageJ: Image processing program (see http://rsb.info.nih.
gov/ij) [18].
2.9 Preparation of 1. Fim fimbriae: Prepared from the Mfa1-deficient mutant. Fim
Fim Fimbriae fimbriae from KDP225 cells (mfa1::cepA) [13] are prepared
using the method of vesicle-depleted supernatant fraction, as
described [19]. Briefly, colonies from TS agar plates are sus-
pended in 1 mL of PBS, vortexed vigorously, and then centri-
fuged at 6000 g for 15 min at 4 C. The supernatant fraction,
which contains soluble extracellular proteins and outer mem-
brane vesicles, is transferred to centrifuge tube for use in a
Beckman Coulter TLA100.3 fixed-angle rotor. The vesicle-
depleted supernatant fraction is obtained by a further centrifu-
gation of the wash supernatant at 100,000 g for 1 h at 4 C.
The supernatant fraction containing Fim fimbriae is used for
electron microscopy with negative staining.
3 Methods
3.1 Globomycin 1. Inoculate P. gingivalis cells in 2 mL of BHI liquid medium and

Treatment incubate overnight.
2. Inoculate 0.2 mL of the overnight culture to 1.8 mL of fresh
BHI medium. Incubate for 3 h in an anaerobic box.
3. Add the signal peptidase II inhibitor, globomycin, to the cul-
ture to obtain a final concentration of 50 μg/mL or 100 μg/
mL, as desired. Incubate samples in an anaerobic box.
4. After 1 or 3 h, harvest the cells from 0.1 mL globomycin-
treated culture by centrifugation at 20,400 g for 1 min.
5. Dissolve the resulting precipitates in 60 μL of PBS with inhi-
bitors and then mix with 20 μL of SDS lysis buffer (4).
6. Heat-denature samples at 100 C for 10 min.
7. Apply 10 μL of each sample per well, for separation by
SDS-PAGE.
8. After electrophoresis, transfer proteins from the gel to a PVDF
membrane using western blot transfer buffer (see Note 5).
9. After the transfer, rinse the blotted membrane first with 100%
methanol and then ultrapure water.
10. Block the membrane with blocking buffer for 1 h.
A B
Globomycin (μg/ml) 0 100 Globomycin (μg/ml) 0 50 100
Prepro-form
Pro-form Prepro-form
Matured-form Pro-form
Matured-form
Anti-FimA Anti-Mfa1
Fig. 1 Globomycin treatment of P. gingivalis. P. gingivalis was grown in BHI liquid medium with or without
globomycin for 3 h. Cell lysates were subjected to SDS-PAGE, followed by immunoblot analysis with (a)
α-FimA or (b) α-Mfa1 antiserum. Notably, preproteins (Prepro-form) of FimA or Mfa1 were only detected in
samples treated with globomycin
11. After blocking, gently agitate the membrane with PBST

including primary antiserum of the target protein at room
temperature for 1 h or at 4 C overnight. Next, wash the
membrane with washing buffer for 10 min. Repeat this wash
step twice more, replacing the buffer each time, for a total wash
time of 30 min.
12. Then, gently agitate the membrane with PBST including HRP
conjugated secondary antibody at room temperature for 1 h.
Next, wash the membrane with washing buffer for 10 min.
Repeat this wash step twice more, replacing the buffer each
time, for a total wash time of 30 min.
13. Perform chemiluminescent immunodetection using the
enhanced chemiluminescence prime detection reagent.
14. Cover the membrane with an autoradiography film for an
appropriate amount of time. Then, immerse the film in the
order of developing solution, stopping solution, and fixing
solution (Fig. 1).
3.2 Palmitic Acid 1. Inoculate P. gingivalis cells in 2 mL of BHI liquid medium and
Labeling Experiment incubate overnight.
2. Inoculate 0.5 mL of the overnight culture to 4.5 mL of fresh
BHI medium. Incubate for 3 h in an anaerobic jar.
3. Add 14C-palmitic acid to the culture to obtain a final concen-
tration of 2.5 μCi/mL. Incubate the culture in an anaerobic jar
for 24 h.
4. Harvest cells from 1 mL of the culture by centrifugation at
20,400 g for 1 min.
5. To eliminate unincorporated 14C-palmitic acid, wash the cells
with PBS buffer and centrifuge at 20,400 g for 5 min. Repeat
this wash step/centrifugation twice more, replacing the buffer
each time, for a total wash time/centrifugation of 15 min.
6. Dissolve the washed cells in 1 mL of BugBuster® protein
extraction reagent with 0.1 mM TLCK and 0.1 mM leupeptin.
7. Immunoprecipitate the target protein using protein G agarose

beads and the appropriate antiserum (see Note 6).
8. Dissolve the resulting precipitates in 60 μL of PBS with inhi-
bitors and then mix with 20 μL of SDS lysis buffer (4).
9. Heat-denature samples at 100 C for 10 min.
10. Load 10 μL of each sample per well for separation by
SDS-PAGE.
11. After the electrophoresis, wash the SDS-PAGE gel with ultra-
pure water for 5 min. Repeat this wash step twice more, repla-
cing the ultrapure water each time, for a total wash time of
15 min.
12. Subsequently, place the gels on the Whatman filter paper and
dry with a gel dryer.
13. Wrap the dried gels and place them in a cassette with an
imaging plate on top. After securely closing the cassette, store
it in appropriate box for a minimum of 4 days.
14. Perform detection using a fluorescent-image analyzer,
FLA-5100 (Fig. 2).
A 33277 33277 B
33277 /pFimB WT /pFimB C23A
kDa
Heat temperature (°C) - 60 100 - 60 100 - 60 100
140
100
55
47 70
37 55
27
47
37
16 *
27
19
IP: α-FimB
16
IP: α-Mfa2
Fig. 2 Palmitic acid labeling analysis. 14C-palmitic acid-labeled cells of P. gingivalis strains were lysed and
then immunoprecipitated with α-FimB or α-Mfa2 antiserum. The immunoprecipitated samples were subjected
to SDS-PAGE, followed by autoradiography. (a) The immunoprecipitated samples were heat-denatured at the
temperatures indicated for 10 min. Red arrows indicate palmitic acid-labeled FimB proteins. (b) The
immunoprecipitated samples were heat-denatured at 100 C for 10 min. Red arrows indicate palmitic acid-
labeled Mfa2 proteins. An asterisk indicates a nonspecific band. (Reproduced from Xu et al. [13] with
permission from Elsevier Inc.)
3.3 Dot Blot Analysis 1. Wash P. gingivalis cells, grown in BHI liquid medium, once
with PBS buffer and then resuspend them in PBS.
2. Adjust the cell suspension to an optical density (OD) of 0.5 or
1.0 at 595 nm.
3. Blot 3 μL of the suspension directly onto a nylon membrane
and allow to air-dry.
4. Perform immunodetection using the appropriate antiserum
(see Note 7).
3.4 Cys-Cys Cross- 1. To detect the Cys-Cys disulfide bridges of the mutated FimA
Linking Analysis protein in which three endogenous cysteine residues are
mutated to alanine residues and two residues to be checked
for their proximity are mutated to cysteine residues (see
Note 8), collect cells from 0.1 mL of overnight cell cultures
by centrifugation at 20,400 g for 1 min.
2. Resuspend the samples gently in one of the following: 0.1 mL
of ultrapure water, 0.1 mL of 0.5 mM hydrogen peroxide in
ultrapure water, or 0.1 mL of 2 mM hydrogen peroxide in in
ultrapure water and incubate them at room temperature for
1 h. A disulfide bridge can form between two cysteine residues
less than 5 Å apart (see Note 9).
3. Collect cells by centrifugation and then suspend them in 60 μL
of PBS with inhibitors. Mix the suspension with 20 μL of SDS
lysis buffer (4) alone or SDS lysis buffer (4) with bME.
Heat-denature all samples at 100 C for 10 min. If there are
disulfide bridges in FimA, FimA ladder bands will appear in
samples treated with anti-FimA antiserum. As a positive con-
trol, monomer FimA protein is observed in samples treated
with anti-FimA antiserum and treated with bME (Fig. 3).
3.5 Electron 1. Grow P. gingivalis cells in BHI liquid medium. Collect cells
Microscopy from overnight cultures and wash them once with 1% (w/v)
ammonium acetate.
2. Resuspend the cells in 1% ammonium acetate. Alternatively,
prepare a Fim fimbriae sample.
3. Glow discharge the carbon-coated copper size 200 mesh
EM grid.
4. Apply a 1–5 μL sample to the glow discharged EM grid and
retain it on the grid for 10 s.
5. Remove approximately 80% of the liquid with filter paper by
blotting from the edge of grid.
6. Apply 5–10 μL of 0.5% uranyl acetate solution (1% uranyl
acetate for FimA fimbriae samples) to the grid and retain for
1 min.
7. Repeat steps 5 and 6.
Fig. 3 Cys-Cys cross-linking analysis. (a) Formation of disulfide bonds between cysteine pairs are predicted on
the A10 strand with D1 or G1 beta strands. The A10 strand is an invading FimA C-terminal beta-strand. D1 and
G1 beta strands are in the N-terminal domain of the preceding FimA protein in the polymer. (b) P. gingivalis
cells expressing two mutated cysteines of FimA protein in the fimA mfa1 null mutant were grown in BHI liquid
medium. Cell pellets were either untreated (0) or treated with the indicated concentration of hydrogen peroxide
(0.5 or 2 mM H2O2). The lysed SDS samples with (+) or without () bME, were heat-denatured at 100 C for
10 min and then subjected to SDS-PAGE, followed by immunoblot analyses with α-FimA antiserum. Cys-Cys
cross-linked FimA ladder is visible in samples untreated with bME suggesting that C-terminal beta strands of
FimA are required linkers for polymerization. (Reproduced from Xu et al. [13] with permission from Elsevier
Inc.)
8. Remove liquid completely with filter paper by blotting from

the edge of grid and allow the grid to air-dry.
9. Observe the stained samples with a JEM-1200EX transmission
electron microscope at 80 kV.
10. Process micrographs with the image processing program Ima-
geJ (Fig. 4).
11. Measure filament lengths using the “Measure” function in
ImageJ.
4 Notes
1. Although P. gingivalis can be grown in an anaerobic jar, anaer-

obic pouch, or anaerobic box, it is optimal, when performing
palmitic acid labeling, to inoculate P. gingivalis in a 15 mL
plastic tube and then incubate the culture in an anaerobic box.
An anaerobic jar and anaerobic pouch are cheaper than anaero-
bic box and easy to use for scientists not accustomed to anaer-
obic culture. However, when constructing gene-deficient
mutants, an anaerobic pouch is preferable for growth.
Fig. 4 Electron microscopy. (a) Electron micrograph of P. gingivalis ATCC 33277 with negative staining.
P. gingivalis ATCC 33277 has a nonsense mutation in the fimB gene, resulting in many long Fim fimbriae.
Scale bar ¼ 0.5 μm. (b) Electron micrograph of vesicle-depleted culture supernatants from the P. gingivalis
mfa1 mutant with negative staining. Fim fimbriae are clearly observed in the vesicle-depleted fraction. Scale
bar ¼ 0.2 μm
2. In preparation for lysing samples, leave one aliquot of SDS lysis

buffer (4) at room temperature and warm to dissolve SDS
thoroughly. Add 4% β-mercaptoethanol (bME), 0.1% bromo-
phenol blue prior to use.
3. PBS with proteinase inhibitors should be prepared fresh for
immediate use.
4. Blocking solution should be prepared fresh for immediate use.
5. Prior to transfer, PVDF membranes should be activated in
methanol for a minimum of 2 min. And then, PVDF mem-
branes and Whatman filter paper are soaked in transfer buffer.
6. Immunoprecipitation is performed as follows. IgG agarose
beads are washed three times with PBS. Then, the IgG agarose
beads ae dissolved with PBS and appropriate amount of antise-
rum and then rotated at room temperature for 1 h. After that,
the IgG agarose beads are collected by centrifugation and
washed three times with PBS. Washed IgG agarose beads are
kept on ice. Cell pellet is collected from 1 mL of fully grown
culture and washed once with PBS. The washed cell pellet is
solubilized in 1 mL of BugBuster® protein extraction reagent
with 0.1 mM TLCK and 0.1 mM leupeptin by pipetting and
stored at room temperature for 10 min. The solubilized frac-
tion is collected by centrifugation and then poured into the
washed IgG agarose beads as mentioned above and then
rotated at room temperature for 1 h. After that, the IgG

agarose beads which include antibody and target protein are
collected by centrifugation and washed three times with PBS.
Washed IgG agarose beads which include antibody and target
protein are solubilized by PBS with inhibitors and SDS lysis
buffer (4).
7. When performing a dot blot analysis, PBS is normally used as
the washing solution. Detergent should not be used because it
may destroy the bacterial cell membranes.
8. In this analysis, the three endogenous cysteine residues are
changed to alanine residues to prevent internal or unexpected
disulfide bridges. Site-directed mutagenesis is performed to
convert all cysteine residues encoded by the fimA gene to
alanine residues. To create fimA genes with the desired
sequence alterations, PCR primers are designed to incorporate
a 15 bp overlap at each end of the amplified fragment. DNA
fragments are amplified from pTCB-fimA+ with the FimA-Fw/
mutant-R and mutant-L/FimA-Rv, as described [13]. Ampli-
fied fragments are fused with SalI-XbaI–linearized pTCB-fimA+
(Tetr) using the In-Fusion® HD Cloning Kit. Each mutated
fimA gene in the pTCB vector is introduced into Escherichia
coli S17-1 [20]; each E. coli transformant is then conjugated
with the fimA::ermF (Emr) mfa1::cepA (Apr) mutant.
9. When the distance between cysteine residues is greater than
5 Å, it is preferable to use a cross-linker, such as BMOE or
BMH, instead of hydrogen peroxide. If this is the case, resus-
pend the cells in 0.1 mL of PBS, 0.1 mL of 0.5 mM BMOE
(or BMH) in PBS, or 0.1 mL of 2 mM BMOE (or BMH)
in PBS.
Acknowledgments
We thank Editage (www.editage.com) and Matthews MM (Okinawa

Institute of Science and Technology Graduate University) for
English language editing.
References
1. Bourgeois D, Inquimbert C, Ottolenghi L et al 3. Imamura T (2003) The role of gingipains in
(2019) Periodontal pathogens as risk factors of the pathogenesis of periodontal disease. J Per-
cardiovascular diseases, diabetes, rheumatoid iodontol 74(1):111–118
arthritis, cancer, and chronic obstructive pul- 4. Sato K, Naito M, Yukitake H et al (2010) A
monary disease-is there cause for consider- protein secretion system linked to bacteroidete
ation? Microorganisms 7(10). pii: E424 gliding motility and pathogenesis. Proc Natl
2. Jia L, Han N, Du J et al (2019) Pathogenesis of Acad Sci U S A 107(1):276–281
important virulence factors of Porphyromonas 5. Nakayama K (2015) Porphyromonas gingivalis
gingivalis via Toll-like receptors. Front Cell and related bacteria: from colonial
Infect Microbiol 9:262
pigmentation to the type IX secretion system Porphyromonas gingivalis. J Dent Res 95

and gliding motility. J Periodontal Res 50 (11):1291–1297
(1):1–8 13. Xu Q, Shoji M, Shibata S et al (2016) A distinct
6. Yoshimura F, Takahashi K, Nodasaka Y et al type of pilus from the human microbiome. Cell
(1984) Purification and characterization of a 165(3):690–703
novel type of fimbriae from the oral anaerobe 14. Hospenthal MK, Costa TRD, Waksman G
Bacteroides gingivalis. J Bacteriol 160 (2017) A comprehensive guide to pilus biogen-
(3):949–957 esis in Gram-negative bacteria. Nat Rev Micro-
7. Hamada N, Sojar HT, Cho MI et al (1996) biol 15(6):365–379
Isolation and characterization of a minor fim- 15. Okuda S, Tokuda H (2011) Lipoprotein sort-
bria from Porphyromonas gingivalis. Infect ing in bacteria. Annu Rev Microbiol
Immun 64(11):4788–4794 65:239–259
8. Nakayama K, Yoshimura F, Kadowaki T et al 16. Narita SI, Tokuda H (2017) Bacterial lipopro-
(1996) Involvement of arginine-specific cyste- teins; biogenesis, sorting and quality control.
ine proteinase (Arg-gingipain) in fimbriation of Biochim Biophys Acta Mol Cell Biol Lipids
Porphyromonas gingivalis. J Bacteriol 178 1862(11):1414–1423
(10):2818–2824 17. Inukai M, Ghrayeb J, Nakamura K et al (1984)
9. Kadowaki T, Nakayama K, Yoshimura F et al Apolipoprotein, an intermediate in the proces-
(1998) Arg-gingipain acts as a major processing of the major lipoprotein of the Escherichia
sing enzyme for various cell surface proteins in coli outer membrane. J Biol Chem 259
Porphyromonas gingivalis. J Biol Chem 273 (2):757–760
(44):29072–29076 18. Schneider CA, Rasband WS, Eliceiri KW
10. Shoji M, Naito M, Yukitake H et al (2004) The (2012) NIH image to ImageJ: 25 years of
major structural components of two cell sur- image analysis. Nat Methods 9(7):671–675
face filaments of Porphyromonas gingivalis are 19. Chen T, Nakayama K, Belliveau L et al (2001)
matured through lipoprotein precursors. Mol Porphyromonas gingivalis gingipains and adhe-
Microbiol 52(5):1513–1525 sion to epithelial cells. Infect Immun 69
11. Shoji M, Yoshimura A, Yoshioka H et al (2010) (5):3048–3056
Recombinant Porphyromonas gingivalis FimA 20. Simon R, Priefer U, Puhler A (1983) A broad
preproprotein expressed in Escherichia coli is host range mobilization system for in vivo
lipidated and the mature or processed recom- genetic engineering: transposon mutagenesis
binant FimA protein forms a short filament in Gram negative bacteria. Biotechnology
in vitro. Can J Microbiol 56(11):959–967 (NY) 1:784–791
12. Hasegawa Y, Iijima Y, Persson K et al (2016)
Role of Mfa5 in expression of Mfa1 fimbriae in
Chapter 8
Purification of Native Mfa1 Fimbriae from Porphyromonas

gingivalis
Yoshiaki Hasegawa, Keiji Nagano, Yukitaka Murakami,
and Richard J. Lamont
Abstract
Fimbriae of the periodontal pathogen Porphyromonas gingivalis mediate its colonization through associa-
tions with other bacteria and host tissues. P. gingivalis generally expresses two distinct fimbrial types, FimA
and Mfa1. In P. gingivalis ATCC 33277, FimA fimbriae are present as long filaments easily detached from
cells, whereas Mfa1 fimbriae are short filaments compactly bound to the cell surface. Because of this unique
characteristic, FimA fimbriae have been selectively and easily isolated from the bacterial cell surface through
mechanical shearing such as by pipetting and stirring. However, P. gingivalis ATCC 33277 harbors a
mutation in the gene encode the fimbrial length regulator, FimB, and thus produces unusually long FimA
fimbriae length. Hence, mechanical shearing to remove FimA is potentially applicable only for this type
strain. Here we present protocols to purify intact Mfa1 fimbriae from a fimA-deficient mutant strain. Mfa1
fimbriae are purified from cell lysates, using a French pressure cell and through ion-exchange chromatogra-
phy. The purity of Mfa1 fimbriae can be confirmed through sodium dodecyl sulfate–polyacrylamide gel
electrophoresis, immunoblotting, and electron microscopy.
Key words Periodontal pathogen, Porphyromonas gingivalis, Mfa1 fimbriae, Ion-exchange

chromatography
1 Introduction
Porphyromonas gingivalis, a gram-negative anaerobe, is a primary

pathogen in periodontal diseases [1]. Colonization by P. gingivalis
can induce microbiota dysbiosis, and result in a non-resolving and
destructive inflammatory response [2, 3].
Fimbriae are effectors of colonization and prominent virulence
factors in P. gingivalis. They are effective organelles of attachment
through their association with other bacteria and with host tissues.
P. gingivalis expresses at least two types of fimbriae known as FimA
and Mfa1. While they are both type V fimbriae [4, 5], they are
genetically distinct from each other and are encoded at different
chromosomal locations [6]. FimA fimbriae are primarily composed
75
76 Yoshiaki Hasegawa et al.
of polymers of FimA, encoded by fimA [7, 8], whereas Mfa1

fimbriae are predominantly composed of Mfa1, encoded by mfa1
[9]. Along with structural proteins FimA and Mfa1, several minor
accessory components including FimC-E and Mfa3–5 are present
in the respective fimbriae [10–15].
In P. gingivalis type ATCC 33277, FimA fimbriae are long
filaments (more than 1 μm in length) that are easily detached
from the cells [8], whereas Mfa1 fimbriae are short filaments (rang-
ing 60–500 nm in length) [9, 16] and are more tightly bound to
the cell surface. We previously reported that Mfa1 fimbriae are
elongated and easily detached from the cell surface when mfa2,
located immediately downstream of mfa1 and in the same operon,
is deficient [10]. Mfa2 thus functions as an anchor and an assembly
and elongation terminator. This finding prompted us to analyze the
fim cluster, since we hypothesized that FimA fimbriae of ATCC
33277, having long filaments that are easily detached from cells,
may contain nonsense mutations in a short ORF sequence
(of 357 bp), “orf1” immediately downstream of fimA [17]. We
restored the potential nonsense mutation in orf1, called fimB, via
site-directed mutagenesis. Restoration of fimB resulted in the pro-
duction of shortened fimbriae of approximately 150 nm. Together,
our previous findings indicate that ATCC 33277 harbors a fimB
mutation that leads to the production of unusual FimA fimbriae, at
least with regard to length and cell anchoring ability. Because of this
unique characteristic, FimA fimbriae of ATCC 33277 and its deri-
vatives have been selectively and easily isolated from the bacterial
cell surface through mechanical shearing such as pipetting and
stirring without disrupting the bacterial cells [8, 18]. However,
this method is applicable only for this type strain.
Here we present modified protocols for purifying intact Mfa1
fimbriae. Mfa1 fimbriae can be purified via ion-exchange chroma-
tography from cells lysed using a French pressure cell [10–13, 15,
16]. This may help purify Mfa1 fimbriae from most P. gingivalis
strains. The purity of Mfa1 fimbriae can be confirmed through
sodium dodecyl sulfate–polyacrylamide gel electrophoresis
(SDS-PAGE), immunoblotting, and electron microscopy.
2 Materials
Prepare all solutions using ultrapure water and analytical-grade

reagents. Prepare all reagents at ambient temperature, unless indi-
cated otherwise. Before preparing any materials, carefully read the
safety guidelines for chemical material and wear appropriate safety
equipment. Diligently follow all waste disposal regulations when
disposing of waste materials.
Purification of Mfa1 Fimbriae from P. gingivlis 77
2.1 Cultivation 1. P. gingivalis JI-1 (see Note 1) [10].

of P. gingivalis 2. Blood agar plate: Dissolve 9.4 g of Brucella HK Agar powder
(Kyokuto) in 200 mL of distilled water, and sterilize at 115 C
in an autoclave. Place the medium in a water bath at 52 C and
add 10 mL of laked rabbit blood, 5 μg/mL hemin, 1 μg/mL
menadione, and 5 μg/mL chloramphenicol. Pour the medium
into petri dishes. Seal the agar plates in a plastic bag and store
(see Note 2).
3. Trypticase soy broth (TSB) medium: Dissolve 60 g of TSB
powder and 5 g of yeast extract in 2 L of distilled water.
Dispense the solution in 1-L glass bottles. Autoclave at
121 C. Add 5 μg/mL hemin, 1 μg/mL menadione, and
chloramphenicol to the liquid medium prior to inoculation
with P. gingivalis (see Note 3).
4. Anaerobic incubator: Periodically inject a mixture of gases
comprising 80% N2, 10% H2, and 10% CO2 into a hermetically
sealed incubator.
5. Phosphate-buffered saline (PBS): Mix 137 mM NaCl,
2.68 mM KCl, 10 mM Na2HPO4, and 2 mM KH2PO4 at
pH 7.4.
2.2 Preparation 1. P. gingivalis cells (see Subheading 3.1.1).

and Isolation 2. Centrifuge.
of Fimbriae
3. French pressure cell (Ohtake Works) (see Note 4).
2.2.1 Preparation 4. 10 mM HEPES-NaOH (pH 7.4).
of the Soluble Fraction from
5. Nα-p-tosyl-L-lysine chloromethyl ketone (TLCK): 10 mM
P. gingivalis Cells
stock solution in ethanol. Store at 20 C.
6. Phenylmethyl sulfonyl fluoride (PMSF): 20 mM stock solution
in ethanol. Store at 20 C.
7. Leupeptin: 10 mM stock solution in water. Store at 20 C.
8. 10 mM HEPES–NaOH (pH 7.4) containing protease inhibi-
tors: 10 mM HEPES–NaOH (pH 7.4) containing protease
inhibitors (0.1 mM TLCK, 0.2 mM PMSF and 0.1 mM
leupeptin).
9. Ammonium sulfate.
10. 20 mM Tris–HCl (pH 8.0).
11. Ultracentrifuge.
12. Ultracentrifuge rotor.
13. Teflon homogenizer.
14. Dialysis tubing.
2.2.2 Isolation 1. The soluble fraction of P. gingivalis cells (see Subheading

and Purification of Fimbriae 3.1.2).
2. Diethylaminoethyl (DEAE) Sepharose Fast Flow anion
exchange chromatography resin (GE Healthcare).
3. Chromatography column (2 20 cm).
4. Ring stand.
5. Peristaltic pump.
7. 20 mM Tris–HCl (pH 8.0).
8. 0.3 M NaCl in 20 mM Tris–HCl (pH 8.0).
9. Ammonium sulfate.
10. Dialysis tubing (molecular weight cutoff of 12–14 kDa).
11. Centrifuge.
12. Bradford protein assay kit (Pierce BCA Protein Assay Kit,
Thermo Fisher Scientific).
2.3 SDS-PAGE 1. Purified Mfa1 fimbriae (see Subheading 3.1.3).

2. SDS-PAGE sample loading buffer with 2-mercaptoethanol
(2-ME).
3. Electrophoresis buffer: 25 mM Tris–192 mM glycine–0.1%
SDS (pH 8.3).
4. 12% polyacrylamide gels.
5. SDS-PAGE apparatus.
6. Heat block.
7. Molecular markers.
8. Coomassie brilliant blue (CBB) R-250.
2.4 Immunoblotting 1. Purified Mfa1 fimbriae (see Subheading 3.1.3).

2. SDS-PAGE sample loading buffer with 2-ME.
3. Electrophoresis buffer: 25 mM Tris–192 mM glycine–0.1%
SDS (pH 8.3).
4. 12% polyacrylamide gels.
5. SDS-PAGE apparatus.
6. Transfer buffer: 20 mM Tris, 150 mM glycine, 0.02% SDS, and
20% methanol.
7. Polyvinylidene difluoride (PVDF) membrane.
8. Blotting apparatus: Wet system.
9. Tris-buffered sodium chloride solution (TBS): 20 mM Tris–
HCl (pH 7.5) containing 0.5 M NaCl.
10. TBS-T: TBS containing 0.05% Tween 20.
11. 1% skim milk in TBS-T: TBS containing 1% skim milk.

12. Anti-Mfa1 fimbriae antibody [12, 13].
13. HRP-conjugated goat anti-rabbit IgG.
14. ECL Prime western blotting detection system
(GE Healthcare).
2.5 Electron 1. Purified Mfa1 fimbriae (see Subheading 3.1.3).

Microscopy 2. Nickel grid with formvar carbon support or grid coated with
formvar carbon (see Note 5).
3. 1% ammonium molybdate, pH 7.0.
4. Transmission electron microscope (TEM, Hitachi H-600).
3 Methods
3.1 Preparation 1. Culture P. gingivalis for 1 week on a blood agar plate in an

and Isolation anaerobic chamber at 37 C.
of Fimbriae 2. Pick a few colonies from the agar plate and inoculate them in
3.1.1 Culturing 5 mL of fresh TSB medium. Incubate the culture in an anaero-
of P. gingivalis bic chamber at 37 C for 1 day.
3. Inoculate the 5-mL P. gingivalis culture into 100 mL of fresh
TSB medium. Incubate in an anaerobic chamber at 37 C for
2 days.
4. Inoculate the 100-mL P. gingivalis culture into 2 L of fresh
TSB medium. Incubate in an anaerobic chamber at 37 C for
2 days (see Note 6).
5. Centrifuge the bacterial culture at 5000 g for 15 min at 4 C.
Discard the supernatant. Suspend the bacterial cells with
500 mL of PBS.
6. Centrifuge bacterial suspension at 5000 g for 15 min at 4 C.
Discard the supernatant. Suspend the bacterial cells with
200 mL of PBS.
7. Centrifuge bacterial suspension at 5000 g for 15 min at 4 C.
Discard the supernatant (see Note 7).
3.1.2 Preparation 1. Resuspend the pellet in 30 mL of 10 mM HEPES-NaOH

of the Soluble Fraction (pH 7.4) containing protease inhibitors. Disrupt bacterial
cells in a French pressure cell through three passes at
100 MPa at 4 C.
2. Centrifuge at 1000 g for 15 min at 4 C to eliminate residual
intact bacterial cells.
3. Harvest the supernatant containing bacterial lysates.
4. Ultracentrifuge the bacterial lysates at 100,000 g for 1 h at

4 C to eliminate the insoluble (membrane) fraction (see
Note 8).
5. Harvest the supernatant as the soluble fraction.
6. Wash the insoluble (membrane) fraction with 10 mL of 10 mM
HEPES-NaOH (pH 7.4) containing protease inhibitors, using
a Teflon homogenizer (see Note 9).
7. Ultracentrifuge the suspension at 100,000 g for 1 h at 4 C
to eliminate the insoluble fraction.
8. Harvest the supernatant and mix it with the soluble fraction.
9. Precipitate proteins by addition of ammonium sulfate to 50%
saturation into the soluble fraction. Stir for 3 h at 4 C (see
Note 10).
10. Centrifuge the mixture at 14,000 g for 30 min at 4 C.
Eliminate the supernatant and dissolve the pellet in 5 mL of
20 mM Tris–HCl (pH 8.0).
11. Dialyze the mixture, using dialysis tubing, against 2 L of
20 mM Tris–HCl (pH 8.0) for 24 h at 4 C.
3.1.3 Isolation 1. Clamp the chromatography column onto a ring stand to ensure
and Purification of Fimbriae that it is upright.
2. Pour the slurry for the DEAE Fast Flow anion exchange chro-
matography resin into the chromatography column and wait
for 1 h to allow resin to settle.
3. Equilibrate the affinity chromatography column with 10-bed
volume of 20 mM Tris–HCl (pH 8.0). Set the flow rate of
peristaltic pump at approximately 0.5 mL/min.
4. Carefully load the protein sample onto the top of the chroma-
tography column.
5. Wash the column with 10-bed volume of 20 mM Tris–HCl
(pH 8.0).
6. Elute the proteins through a linear salt gradient from 0 to
0.3 M NaCl in 20 mM Tris–HCl (pH 8.0) with a total volume
of 400 mL. Monitor the absorbance at 280 nm (A280) using a
spectrophotometer (Fig. 1).
7. Subject peak fractions and its margins at A280 to SDS-PAGE
analysis (see Notes 11 and 12).
8. Collect fractions showing a band of Mfa1 monomer protein
(at ~70 kDa).
9. Precipitate proteins by addition of ammonium sulfate to 50%
saturation into the soluble fraction. Stir for 3 h at 4 C (see
Note 10).
A 0.3 C
Fraction #
NaCl (M)㸦…㸧
0.2
㸧
50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
A280㸦
kDa
0.1
150
0 100
Fraction # 75
50
B 0.3 37
25
NaCl (M)㸦…㸧
20
㸧
0.2
10
A280 㸦
0.1
0
Fraction #
Fig. 1 Isolation of Mfa1 fimbriae. (a) Elution profile of the first ion-exchange chromatography (see steps 4–8 in
Subheading 3.1.3). Each fraction was collected at a flow rate of approximately 0.5 mL/min (5 mL/tube). (b)
Elution profile of the second ion-exchange chromatography (see step 12 in Subheading 3.1.3). Each fraction
was collected at a flow rate of approximately 0.5 mL/min (5 mL/tube). (c) Sodium dodecyl sulfate–polyacry-
lamide gel electrophoresis (SDS-PAGE) and Coomassie Brilliant Blue (CBB) staining of the fraction containing
Mfa1 fimbriae. Fractions 50–65 (10 μL each) from the second elution corresponding to the peak were
subjected to SDS-PAGE, followed by CBB staining

Eliminate the supernatant and dissolve the pellet in 10 mL of
20 mM Tris–HCl (pH 8.0).
11. Dialyze using dialysis tubing against 2 L of 20 mM Tris–HCl
(pH 8.0) for 24 h at 4 C.
12. Repeat steps 4–9.
Harvest the pellet and dissolve it in 2 mL of 20 mM Tris–
HCl (pH 8.0).
14. Dialyze using dialysis tubing against 2 L of 20 mM Tris–HCl
(pH 8.0) for 24 h at 4 C.
15. Determine the protein concentration of the sample, using a
Bradford protein assay kit in accordance with the manufac-
turer’s instructions.
3.2 Assays Check the purity of the sample via SDS-PAGE, immunoblotting,
for the Purity and electron microscopy.
of Fimbriae
kDa
150
100 Mfa5
75
Mfa1
50
37 Mfa3
25 Mfa4
20
10
Fig. 2 Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE)

and Coomassie brilliant blue (CBB) staining of the purified Mfa1 fimbriae (5 μg/
lane). The Mfa1 band indicated with a bold arrow was clearly detected. Mfa3,
Mfa4, and Mfa5 are indicated with thin arrows as the accessory proteins of Mfa1
fimbriae [10–13, 15]
3.2.1 SDS-PAGE 1. Mix a sample of the purified Mfa1 fimbriae (5 μg/lane) with
SDS-PAGE sample loading buffer containing 2-ME.
2. Denature the samples at 100 C for 5 min.
3. Apply the sample and perform SDS-PAGE under constant
voltage at 100 V.
4. Visualize the proteins by CBB staining (Fig. 2).
3.2.2 Immunoblotting 1. Mix a sample of the purified Mfa1 fimbriae (1 μg/lane) with
SDS-PAGE sample loading buffer containing 2-ME.
2. Denature the samples through heating (see Note 13).
3. Apply the sample and perform SDS-PAGE under constant
voltage at 100 V.
4. Transfer proteins from gels onto PVDF membranes with trans-
fer buffer at 100 V for 1 h (see Note 14).
5. Wash the membranes with TBS-T for 15 min.
6. Block the membranes with 1% skim milk in TBS-T for 30 min.
7. Incubate the membranes with primary antibody (anti-Mfa1
fimbriae, 1:4000) in 1% skim milk in TBS-T for 5 h.
8. Wash the membranes thrice with TBS-T for 15 min each.
1 2 3 4 5
kDa
220
120
100
80
60
50
40
30
20
Fig. 3 Immunoblotting with anti-Mfa1 antibody. Mfa1 fimbriae (1 μg/lane) in

SDS-containing buffer was heated at 100 C for 5 min (1), 100 C for 1 min (2),
80 C for 15 min (3), 80 C for 10 min (4), or 80 C for 5 min (5), and subjected to
SDS-PAGE. Thereafter, immunoblotting was performed using anti-Mfa1
antibody. Mfa1 fimbriae were denatured by heating at 80 C for 5 min, which
resulted in a ladderlike pattern, whereas denaturation via heating at 100 C for
5 min resulted in a single band at the sizes corresponding to the monomer
[12, 19, 20]
9. Incubate the membranes with the secondary antibody

(HRP-conjugated goat anti-rabbit IgG, 1:4000) in 1% skim
milk in TBS-T for 5 h.
10. Wash the membranes twice with TBS-T for 15 min each time,
then once with TBS for 15 min.
11. Develop the membrane with ECL Prime western blotting
detection system in accordance with the manufacturer’s
instructions (Fig. 3).
3.2.3 Electron 1. Apply 10 μL of the purified fimbriae onto the nickel grid with
Microscopy formvar carbon support and hold for 30 s (see Note 15).
2. Absorb the excess sample using filter paper from the edge of the
grid (see Note 16).
Fig. 4 Electron micrograph of the purified Mfa1 fimbriae. Mfa1 fimbriae were
negatively stained with 1% ammonium molybdate. Scale bar, 100 nm. Most
fibers of Mfa1 fimbriae are approximately 100 nm long
3. Apply 10 μL of 1% ammonium molybdate on the grid and hold

for 1 min.
4. Repeat steps 2 and 3.
5. Completely absorb the excess, using filter paper from the edge
of the grid. Then, air-dry the grid for 10 min before viewing it
using a TEM (Fig. 4).
4 Notes
1. In our laboratory, this procedure is used to obtain native Mfa1

fimbriae from the fimA-deficient strain named JI-1 [10], which
is derived from P. gingivalis ATCC 33277, to prevent contam-
ination with FimA fimbriae.
2. The agar plates in a plastic bag can be stored at 4 C for a
month.
3. Place the aliquots of TSB medium in anaerobic conditions
3 days before use to eliminate oxygen.
4. To prevent damage to fimbriae, bacterial cells should be dis-
rupted using a French pressure cell. Sonication should be
avoided during the isolation process to minimize shearing of
the fimbrial structures.
5. We usually use a commercially available hydrophilized TEM

grid (Okenshoji).
6. Monitor bacterial growth using a spectrophotometer to mea-
sure optical density (OD) at 600 nm (OD600). The OD600
usually exceeds 2.0 in 2 days.
7. Proceed with preparation of the soluble fraction or otherwise
store it at 20 C until further use.
8. A brown, jellylike pellet precipitate should be obtained at the
bottom of the tube.
9. Transfer the entire brown, jellylike pellet to a Teflon homoge-
nizer, using a spatula. This step can increase the recovery of
solubilized Mfa1 fimbriae from the pellet.
10. Ammonium sulfate should be added gradually over 1 h with
gentle stirring.
11. Mfa1 fimbriae are usually eluted between 0.17 and 0.22 M
NaCl (Fig. 1).
12. We recommend confirming the fraction corresponding to the
peak via SDS-PAGE. Briefly, mix up to three volumes of the
samples from ion-exchange chromatography with one volume
of SDS-PAGE sample loading buffer containing 2-ME. Dena-
ture the samples at 100 C for 5 min. Thereafter, perform
SDS-PAGE and CBB staining (see Subheading 3.2.1).
13. Denaturation of Mfa1 fimbriae by heating at 80 C results in a
ladderlike pattern owing to partial dissociation of the Mfa1
polymers during SDS-PAGE, whereas denaturation by heating
at 100 C results in a single band at the size corresponding to
the monomer [12, 19, 20].
14. It is necessary to treat the PVDF membrane in methanol before
immunoblotting.
15. It is necessary to dilute the sample of the purified Mfa1 fimbriae
approximately tenfold with 20 mM Tris–HCl (pH 8.0).
16. Avoid completely drying the grid in order to avoid artifacts.
Acknowledgments
This study was supported, in part, by JSPS KAKENHI Grant

Numbers 16K11466 (Y.H.) and Furukawa funding, Aichi Gakuin
University (Y.H.). We thank Fuminobu Yoshimura for helpful
advice and technical assistance at the initial stage of this study. We
would like to thank Editage (www.editage.com) for English lan-
guage editing.
References
1. Lamont RJ, Jenkinson HF (1998) Life below 11. Hasegawa Y, Nagano K, Ikai R et al (2013)
the gum line: pathogenic mechanisms of Por- Localization and function of the accessory pro-
phyromonas gingivalis. Microbiol Mol Biol Rev tein Mfa3 in Porphyromonas gingivalis Mfa1
62:1244–1263 fimbriae. Mol Oral Microbiol 28:467–480
2. Hajishengallis G, Lamont RJ (2016) Dancing 12. Ikai R, Hasegawa Y, Izumigawa M et al (2015)
with the stars: how choreographed bacterial Mfa4, an accessory protein of Mfa1 fimbriae,
interactions dictate nososymbiocity and give modulates fimbrial biogenesis, cell auto-
rise to keystone pathogens, accessory patho- aggregation, and biofilm formation in Porphyr-
gens, and pathobionts. Trends Microbiol omonas gingivalis. PLoS One 10(10):
24:477–489 e0139454
3. Hajishengallis G, Lamont RJ (2012) Beyond 13. Hasegawa Y, Iijima Y, Persson K et al (2016)
the red complex and into more complexity: the Role of Mfa5 in expression of Mfa1 fimbriae in
polymicrobial synergy and dysbiosis (PSD) Porphyromonas gingivalis. J Dent Res
model of periodontal disease etiology. Mol 95:1291–1297
Oral Microbiol 27:409–419 14. Nishiyama SI, Murakami Y, Nagata H et al
4. Xu Q, Shoji M, Shibata S et al (2016) Distinct (2007) Involvement of minor components
type of pilus from the human microbiome. Cell associated with the FimA fimbriae of Porphyr-
165:690–703 omonas gingivalis in adhesive functions. Micro-
5. Hospenthal MK, Costa TRD, Waksman G biology 153:1916–1925
(2017) A comprehensive guide to pilus bio- 15. Kloppsteck P, Hall M, Hasegawa Y et al (2016)
genesis in Gram-negative bacteria. Nat Rev Structure of the fimbrial protein Mfa4 from
Microbiol 15(6):365–379 Porphyromonas gingivalis in its precursor
6. Yoshimura F, Murakami Y, Nishikawa K et al form: implications for a donor-strand comple-
(2009) Surface components of Porphyromonas mentation mechanism. Sci Rep 6:22945
gingivalis. J Periodontal Res 44:1–12 16. Park Y, Simionato MR, Sekiya K et al (2005)
7. Dickinson DP, Kubiniec MA, Yoshimura F et al Short fimbriae of Porphyromonas gingivalis and
(1988) Molecular cloning and sequencing of their role in coadhesion with Streptococcus gor-
the gene encoding the fimbrial subunit protein donii. Infect Immun 73:3983–3989
of Bacteroides gingivalis. J Bacteriol 170 17. Nagano K, Hasegawa Y, Murakami Y et al
(4):1658–1665 (2010) FimB regulates FimA fimbriation in
8. Yoshimura F, Takahashi K, Nodasaka Y et al Porphyromonas gingivalis. J Dent Res
(1984) Purification and characterization of a 89:903–908
novel type of fimbriae from the oral anaerobe 18. Shoji M, Shibata S, Naito M et al (2020) Trans-
Bacteroides gingivalis. J Bacteriol 160:949–957 port and polymerization of Porphyromonas gin-
9. Hamada N, Sojar HT, Cho MI et al (1996) givalis type V pili. Methods Mol Biol 2210:
Isolation and characterization of a minor fim- 61–75
bria from Porphyromonas gingivalis. Infect 19. Hall M, Hasegawa Y, Yoshimura F et al (2018)
Immun 64:4788–4794 Structural and functional characterization of
10. Hasegawa Y, Iwami J, Sato K et al (2009) shaft, anchor, and tip proteins of the Mfa1
Anchoring and length regulation of Porphyro- fimbria from the periodontal pathogen Por-
monas gingivalis Mfa1 fimbriae by the down- phyromonas gingivalis. Sci Rep 8(1):1793
stream gene product Mfa2. Microbiology 20. Nagano K, Hasegawa Y, Yoshida Y et al (2017)
155:3333–3347 Novel fimbrilin PGN_1808 in Porphyromonas
gingivalis. PLoS One 12(3):e0173541
Chapter 9
Crystallization of Recombinant Fimbrial Proteins

of Porphyromonas gingivalis
Thomas Heidler and Karina Persson
Abstract
Porphyromonas gingivalis fimbriae play a critical role in colonization. Elucidation of the fimbrial structure in
atomic detail is important for understanding the colonization mechanism and to provide means to combat
periodontitis. X-ray crystallography is a technique that is used to obtain detailed information of proteins
along with bound ligands and ions. Crystallization of the protein of interest is the first step toward structure
determination. Unfortunately it is not possible to predict the crystallization condition of a certain protein
or even if the protein can be crystallized. Protein crystallization is, on the contrary, a matter of trial and
error. However, the best strategy for success is to focus on the protein purification step to obtain a sample
that is pure, stable, homogeneous and of high concentration. This chapter addresses general methods for
crystallization of fimbrial proteins.
Key words Protein purification, Crystallization, Optimization, Fimbriae
1 Introduction
Fimbriae are extracellular proteins or protein polymers that bacteria

use for attachment to other bacteria, surfaces, or host cells. Por-
phyromonas gingivalis is periodontal pathogen that causes chronic
inflammation and tooth loss [1] but is also associated with other
systemic diseases [2, 3]. The presence of its two fimbriae, FimA and
Mfa1, is essential for its adhesive function and virulence. Conse-
quently, both P. gingivalis fimbriae constitute promising targets for
the development of antiadhesive substances in order to combat
periodontal disease.
Fimbrial proteins are in general a very diverse group of pro-
teins, and their structure and polymerization mechanism depend
firstly on if they are expressed by gram-positive or gram-negative
bacteria. Many of the gram-positive bacteria use intermolecular
isopeptide bonds (amide bonds between the side chain of a lysine
to the side chain of an aspartic acid or an asparagine) to attach
fimbrial proteins to each other during polymerization [4]. These
87
88 Thomas Heidler and Karina Persson
fimbrial proteins may be further stabilized by intramolecular iso-

peptide bonds, and in some organisms such as Actinomyces and
Corynebacteria, but not streptococci, also by several disulfide
bonds [5–7]. The presence of intramolecular isopeptide bonds
makes the proteins stable and can therefore have a positive effect
on crystallization, whereas a large number of cysteines can be
detrimental for crystallization due to incorrect disulfide pairing.
Gram-positive fimbrial proteins are often built up from several
domains and the motion between these domains may be unfavor-
able for crystal formation [8]. Therefore, it can be fruitful to clone
and express the individual domains separately.
Some of the fimbriae expressed by gram-negative bacteria may
depend on a donor-strand exchange mechanism during polymeri-
zation, for instance for the assembly of type-I fimbria [9]. This
means that the fimbrial proteins fold with an incomplete β-sheet
where one strand is missing. This void in the β-sheet is to be filled
by the N-terminal strand from another subunit during polymeriza-
tion, but before that, the empty position in the sheet is filled by a
β-strand from a chaperone. These fimbrial proteins cannot be
expressed in soluble forms, unless they are coexpressed with their
chaperone or in an engineered form where an extra strand has been
introduced to fill the gap [10]. Both fimbriae expressed by the
gram-negative P. gingivalis are fimbriae of type-V and form poly-
mers comprised of five different proteins, FimA–E and Mfa1–5,
respectively. Type-V fimbriae are also likely to use a donor-strand
exchange mechanism for polymerization; however, instead of a
chaperone donor strand, the protein is expressed with a complete
β-sheet from which the first strand is cleaved off and replaced with a
strand from a neighboring subunit during polymerization. The
assembly mechanism of type-V fimbriae is still poorly understood
[11, 12].
In order to study the structure of fimbriae in their native
polymerized forms cryo-electron microscopy techniques are
recommended. However, for characterization of fimbrial proteins
in atomic detail it is advisable to express the individual proteins in
recombinant form, and study them using X-ray crystallography
methods. For that, high-quality protein crystals are needed. Prepa-
ration of a protein sample suitable for structure determination
starts with a careful bioinformatics examination of the protein
sequence in order to design the optimal construct for expression.
An ideal expression construct lays ground for high protein expres-
sion and a stable product. In short, purity, stability, and homoge-
neity of the protein sample are parameters that are crucial for the
start of a successful crystallization project.
Crystallization 89
2 Materials
Use commercial crystallization kits for initial screening. For opti-

mization use analytical grade chemicals. Filter all solutions
(0.22 μm) to avoid uncontrolled nucleation due to dust particles
or aggregates. Filtration also hinders microbial contamination. Use
fresh ultrapure water for crystallization setups.
2.1 Initial Screening 1. Premade crystallization kits (see Note 1).

2. 96-well sitting-drop crystallization plates (see Note 2).
3. An eight-channel pipette.
4. Automatic pipette, or a crystallization robot.
5. Optically clear tape (Hampton Research or Molecular
Dimensions).
6. A stereomicroscope with zoom.
7. A tabletop centrifuge.
2.2 Optimization 1. A set of buffers with a wide range of pH values (see Note 3).
2. Stock solutions of polymeric or organic precipitants: polyethyl-
ene glycols (PEG), ethylene glycol, 2-methyl-2,4-pentanediol.
Store at 4 C in the dark.
3. Stock solutions of salt precipitants: ammonium sulfate, ammo-
nium chloride, sodium formate, and other salts.
4. Chemicals that can be used as additives (see Note 4).
5. 48-well or 24-well crystallization plates (see Note 2).
6. Optically clear tape (Hampton Research or Molecular
Dimensions).
7. Siliconized glass cover slides or plastic cover slides (Hampton
Research, Molecular Dimensions or Jena Bioscience).
8. Seeding tools (Hampton Research, Molecular Dimensions or
Jena Bioscience) or actual cat whiskers.
9. α-chymotrypsin: 1 mg/mL stock solution in water (Sigma).
Store at 80 C.
10. SYPRO Orange (Invitrogen Molecular Probes): Stock solution
(200) in water or buffer. Diluted samples are not stable for
longer periods.
11. Chemicals for lysine methylation: Dimethylamine-borane
complex (Fluka), formaldehyde. Alternatively, a Methylation
kit (Jena Biosciences).
2.3 Cryo 1. A set of cryo loops with diameters ranging from 0.025 to
Crystallography 1.0 mm (Molecular Dimensions, Hampton Research or Jena
Bioscience).
2. Cryoprotecting solutions: glycerol, PEG 400, ethylene glycol,

or oils like Perfluoropolyether Cryo Oil or Parabar 10312
(Hampton Research).
3. Liquid nitrogen.
4. Cryo container (see Note 5).
3 Methods
Carry out all procedures at room temperature, unless other tem-

peratures are specified.
3.1 Protein 1. Make sure that the protein sample is pure and monodisperse
Crystallization (see Notes 6 and 7).
2. Start with a protein concentration of 10 mg/mL in a low
concentration buffer (see Note 8).
3. Spin the protein at high speed for 2 min in a tabletop centrifuge
to avoid uncontrolled nucleation due to aggregated protein.
4. Transfer approximately 80 μL of premade crystallization solu-
tion from the deep well block to each of the 96 wells of the
crystallization plate using the multichannel pipette.
5. Mix equal volumes of crystallization solution and protein. This
can be performed manually or by using a crystallization robot
(see Note 9).
6. Seal the plate with optically clear tape.
7. Store the plates at room temperature, alternatively at 4 C, in a
room without vibrations or temperature fluctuations.
8. Inspect the crystallization plates regularly using a stereomicro-
scope (make notes if crystals or precipitate appear) (Fig. 1).
3.2 Optimization 1. If only precipitate, low quality crystals, intergrown or very

small crystals are obtained, larger and better crystals may be
obtained by varying the concentrations of the chemicals of the
initial condition (see Note 10).
2. Crystal growth may also be obtained by seeding clear drops
with microseeds obtained from initial crystals. This can be done
manually or by dispensing seeds using the crystallization robot
(see Note 11).
3. The probability of obtaining crystals is higher if the protein is in
a buffer that keeps the protein stable. Protein stability is corre-
lated to its melting temperature, which is a parameter that can
be measured (see Note 12). The optimal buffer and sometimes
the appropriate additive (see Note 4) can be identified by
measuring the melting temperature of the protein.
Crystallization 91
Fig. 1 Crystallization drops of a fimbrial protein from Porphyromonas gingvalis.

(a) A clear drop (without nucleation sites), (b) a drop with brown precipitate (not a
promising condition) and (c) a drop with thin needles (optimization is needed). (d)
A drop with single thin crystals in precipitate (optimization is needed). (e) A
cluster of crystals where optimization is needed to obtain single crystals, (f) a
single well diffracting crystal obtained after α-chymotrypsin treatment
4. Flexible parts of the protein, such as N- and C-termini or loops

may hinder crystal packing. In order to facilitate crystal growth,
the proteins may be treated with small amounts of proteases in
situ to trim off these parts (see Note 13 and Fig. 1).
5. The motion of side chains on the protein surface may also
hinder crystal growth. One of these amino acids, lysine, has a
long and positively charged side chain that can interfere with
crystal growth. In order to lower the entropy of the protein
surface and facilitate crystal growth it has been proven useful to
methylate the lysines [13] which makes them more rigid and
prone to participate in crystal packing (see Note 14).
3.3 Cryoprotection X-ray diffraction data is generally collected at synchrotrons using

of Crystals high energy X-ray radiation. Due to the high intensity of the X-rays
the crystals are quickly destroyed by radiation damage. In order to
preserve the crystal during data collection the crystals are kept at
100 K in a stream of liquid nitrogen. The crystal should be frozen in
a vitreous amorphous glasslike state and not in crystalline ice, since
ice crystals will destroy the well-ordered crystal lattice. In order to
obtain the glasslike structure it is generally necessary to replace the
water content in and around the crystal with a cryoprotectant
solution
1. Prepare a cryoprotectant solution (see Note 15).
2. Quickly transfer the crystal to the cryoprotectant solution
using a cryo loop.
3. Pick up the cryoprotected crystal using the same loop.
4. Quickly transfer the loop with the crystal to a liquid
nitrogen bath.
5. Store the crystal, and the loop, in a cryogenic container until
the crystals can be shipped to a synchrotron for data collection.
4 Notes
1. Premade crystallization screens are available from several com-

panies. For example Hampton Research, Molecular Dimen-
sions, Jena Bioscience, Triana Sci&Tech, Emerald
BioSystems, and Qiagen. The solutions can be dispensed into
deep-well blocks or purchased in predispensed deep-well
blocks. The crystallization solutions are generally mixtures of
buffers, precipitants, and other additives. Since many different
combinations of solutions may need to be screened it is advan-
tageous to use a commercial kit. Initial screening usually starts
by using a sparse-matrix screen that covers a large number of
different conditions. If enough protein is available, the screen-
ing can be extended to cover grid screens where pH and the
concentration of a fixed precipitant are systematically varied
(e.g., ammonium sulfate or polyethylene glycol). When using
a robot, protein and precipitant volumes of 50–200 nL per
drop are generally used.
2. Crystallization plates for screening and optimization can be
obtained in several forms but 96, 48, or 24-well plates are
most common. In addition both sitting-drop and hanging-
drop plates are available. Importantly these plates can be used
both manually or by pipetting robots.
Crystallization 93
3. The pH of the crystallization solution but also the buffer

composition is important for obtaining crystals. For the initial
optimization, prepare stock solutions (1 M) of sodium acetate
pH 4.6, trisodium citrate pH 5.6, MES pH 6.5, sodium
HEPES pH 7.5, Tris–HCl pH 8.5, and bicine pH 9.0. Keep
in mind that other buffers or pH values may be optimal for
your particular protein.
4. Additives are small molecules that can be added to the crystal-
lization solution to improve the chances of crystal formation.
The functions of these molecules are to stabilize the protein or
to introduce contacts between the macromolecules. The addi-
tives could be purchased from companies supplying crystalliza-
tion reagents, for instance Additive or Silver bullet screens
(Hampton Research). It is also possible to try any chemical
available in your lab.
5. Cryo containers are used for storage and transport of cryopro-
tected crystals. Cryogenic Dewar flasks are produced by Taylor
and Worthington Industries and can be ordered from Molecu-
lar Dimensions.
6. Protein purity is one of the most important parameters for
obtaining crystals; thus, care has to be taken during purifica-
tion. However, if starting with an overexpressed protein the
chance of obtaining pure protein in sufficient amounts is large.
Pure protein should preferably be flash-frozen in small aliquots
(20–50 μL) and stored at 80 C. Avoid repeated freeze–thaw
cycles.
7. Dispersity is a measure of if the protein exists in one or several
polymeric forms (e.g., monomeric, dimeric, oligomeric, or a
mixture of different forms). It is recommended to use gel
filtration as the final step of purification; it functions both as a
purification step and as an analytical step making it possible to
judge if the protein is homogeneous. A homogeneous protein
elutes as a single peak from the gel filtration column; however,
if the elution profile shows several peaks, a protein solution
with different oligomeric forms should be considered. If the
protein elutes in the void it is a sign that the protein forms very
large complexes or aggregates, then the chances of obtaining
crystals are small. The order of dispersity can be analyzed more
exactly with a dynamic light scattering instrument.
8. If possible, change to a low concentration storage buffer (such
as 20 mM Tris–HCl or HEPES) with no or only low salt
concentration after the final gel filtration step. It is important
to avoid phosphate buffers since phosphate ions often form
inorganic crystals when mixed with the crystallization solution.
It is not possible to predict at what protein concentration to
start crystallization screening. Depending on the protein,
crystallization can occur from 0.5 mg/mL to several hundred

mg/mL. It is recommended to aim for a protein concentration
of 10 mg/mL for the initial sparse matrix screen. If only clear
drops are obtained the concentration should be increased, and
if dark heavy precipitate is observed in a majority of the drops
the protein concentration should be lowered. If light precipi-
tate is found in approximately 30–60% of the drops the protein
concentration is in a suitable range for crystal growth.
9. Crystal growth can be obtained by preparing a drop of equal
volumes of protein and crystallization solution. The drop is
allowed to equilibrate, by vapor diffusion, against a larger
volume of the same crystallization solution in a sealed system.
During equilibration the concentration of protein and precipi-
tant slowly increase which can induce nucleation if the condi-
tions are favorable. If nucleation occurs, growth of crystals can
follow. If enough material is available it is advisable to also
screen other protein–precipitant ratios in order to vary the
speed of equilibration.
10. When crystals, or a promising precipitate (Fig. 1) are found in
the initial screens the conditions may be optimized by chang-
ing parameters that influence nucleation and crystal growth;
protein concentration, pH, precipitant concentration, temper-
ature, and the presence of additives. For optimization crystalli-
zation plates holding larger volumes, such as 48- or 24-well
plates can be used. Then it is also possible to use larger pro-
tein/precipitant volumes, 0.5–5 μL.
11. There are numerous forms of seeding, for instance streak seed-
ing and micro seeding. Seeding should be performed on clear
drops where protein and crystallization solutions are mixed and
equilibrated. Use protein concentration lower than in the
original drop to avoid spontaneous nucleation. In streak seed-
ing a crystal is touched with a probe, for instance a cat whisker.
Seeds are attached to the whisker and transferred to the empty
drop as the whisker is drawn across the surface of the drop. In
micro seeding, a seed stock is prepared by manually crushing a
crystal, for example, with a pipette tip or a needle, and resus-
pending it in crystallization solution (100–500 μL). The solu-
tion is briefly vortexed and spun. Next, the cat whisker is
dipped into the seed solution followed by streaking the surface
of the new drop. A seed stock can also be obtained with seed
beads from companies that provide crystallization reagents.
12. It is advisable to explore the effect that different buffers or
additives have on the protein. A useful method is to perform a
thermal shift assay. The melting curve of the protein is
measured in different conditions, and the more stabilizing
effect the buffer or additive has on the protein, the higher the
Crystallization 95
melting temperature gets. Protein melting curves can be mon-

itored by adding a dye, SYPRO Orange, and measuring the
change in fluorescence using a Real Time PCR instrument
[14]. This method is more reliable for soluble proteins than
for membrane proteins.
13. The protein solution is prepared as described above. Immedi-
ately before mixing with the crystallization solution a small
amount of α-chymotrypsin, trypsin, or another protease of
choice is added [11, 15, 16]. The final amount of protease
can be 1% (w/w).
14. For lysine methylation two chemicals are needed,
dimethylamine-borane complex and formaldehyde. A detailed
protocol can be obtained from Protein Production UK
[17]. Alternatively, the chemicals can be purchased as a ready-
to-use kit.
15. Cryoprotection of crystals is obtained by transferring the crys-
tal to crystallization solution supplemented with appropriate
concentration of cryoprotective solution, such as 20% PEG
400 or ethylene glycol. The preferred cryoprotective solution
is unique for each crystal system. The preferred transfer of
crystals to the cryoprotective solution may also be unique.
Some crystals can be transferred immediately from the original
drop to a drop of cryoprotective solution and then flash-cooled
in liquid nitrogen. Other crystals are more sensitive and the
cryoprotective need to be added stepwise.
References
1. Bostanci N, Belibasakis GN (2012) Porphyro- 6. Kang HJ, Paterson NG, Gaspar AH et al

monas gingivalis: an invasive and evasive (2009) The Corynebacterium diphtheriae
opportunistic oral pathogen. FEMS Microbiol shaft pilin SpaA is built of tandem Ig-like mod-
Lett 333(1):1–9 ules with stabilizing isopeptide and disulfide
2. Michaud DS, Izard J, Wilhelm-Benartzi CS bonds. Proc Natl Acad Sci U S A 106
et al (2013) Plasma antibodies to oral bacteria (40):16967–16971
and risk of pancreatic cancer in a large 7. Daniels R, Mellroth P, Bernsel A et al (2010)
European prospective cohort study. Gut 62 Disulfide bond formation and cysteine exclu-
(12):1764–1770 sion in gram-positive bacteria. J Biol Chem 285
3. Leech MT, Bartold PM (2015) The association (5):3300–3309
between rheumatoid arthritis and periodonti- 8. Mishra A, Devarajan B, Reardon ME et al
tis. Best Pract Res Clin Rheumatol 29 (2011) Two autonomous structural modules
(2):189–201 in the fimbrial shaft adhesin FimA mediate
4. Baker EN, Squire CJ, Young PG (2015) Self- Actinomyces interactions with streptococci and
generated covalent cross-links in the cell- host cells during oral biofilm development.
surface adhesins of Gram-positive bacteria. Mol Microbiol 81(5):1205–1220
Biochem Soc Trans 43(5):787–794 9. Hospenthal MK, Costa TRD, Waksman G
5. Persson K, Esberg A, Claesson R et al (2012) (2017) A comprehensive guide to pilus bio-
The pilin protein FimP from Actinomyces oris: genesis in Gram-negative bacteria. Nat Rev
crystal structure and sequence analyses. PLoS Microbiol 15(6):365–379
One 7(10):e48364
10. Roy SP, Rahman MM, Yu XD et al (2012) 14. Ericsson UB, Hallberg BM, Detitta GT et al
Crystal structure of enterotoxigenic Escherichia (2006) Thermofluor-based high-throughput
coli colonization factor CS6 reveals a novel type stability optimization of proteins for structural
of functional assembly. Mol Microbiol 86 studies. Anal Biochem 357(2):289–298
(5):1100–1115 15. Dong A, Xu X, Edwards AM et al (2007) In
11. Hall M, Hasegawa Y, Yoshimura F et al (2018) situ proteolysis for protein crystallization and
Structural and functional characterization of structure determination. Nat Methods 4
shaft, anchor, and tip proteins of the Mfa1 (12):1019–1021
fimbria from the periodontal pathogen Por- 16. Kloppsteck P, Hall M, Hasegawa Y et al (2016)
phyromonas gingivalis. Sci Rep 8(1):1793 Structure of the fimbrial protein Mfa4 from
12. Xu Q, Shoji M, Shibata S et al (2016) A distinct Porphyromonas gingivalis in its precursor
type of pilus from the human microbiome. Cell form: implications for a donor-strand comple-
165(3):690–703 mentation mechanism. Sci Rep 6:22945
13. Forsgren N, Lamont RJ, Persson K (2009) 17. Walter TS, Meier C, Assenberg R et al (2006)
Crystal structure of the variable domain of the Lysine methylation as a routine rescue strategy
Streptococcus gordonii surface protein SspB. for protein crystallization. Structure (Camb)
Protein Sci 18(9):1896–1905 14(11):1617–1622
Chapter 10
Enzymatic Characteristics and Activities of Gingipains

from Porphyromonas gingivalis
Tomoko Kadowaki
Abstract
Porphyromonas gingivalis is a gram-negative, rod-shaped, nonmotile bacterium belonging to the phylum
Bacteroidetes. It produces abundant amounts of proteases in both cell-associated and secretory forms,
including a group of cysteine proteases referred to as gingipains, which have attracted much attention due
to their high proteolytic activity associated with pathogenicity. Gingipains are grouped into arginine (R)-
specific (RgpA and RgpB) and lysine (K)-specific (Kgp) types. Both Rgp (collective term for RgpA and
RgpB) and Kgp gingipains play crucial roles in the virulence of P. gingivalis, including the degradation of
host periodontal tissues, disruption of host defense mechanisms, and loss of viability in host cells, such as
fibroblasts and endothelial cells. In addition to their function in virulence, gingipains are also essential for
the growth and survival of P. gingivalis in periodontal pockets through the acquisition of amino acids and
heme groups. Furthermore, Rgp and Kgp gingipains are critical in processing fimbriae and several bacterial
proteins that contribute to hemagglutination, coaggregation, and hemoglobin binding. This chapter
describes the methods used to analyze gingipains.
Key words Gingipain, Rgp, Kgp, Protease inhibitors, Virulence, Vascular permeability
1 Introduction
Periodontal diseases are chronic inflammatory diseases occurring in

approximately 60% of adult humans [1]. Typically found in the oral
cavity, Porphyromonas gingivalis is a gram-negative bacterium that
is implicated in adult chronic periodontitis. P. gingivalis produces
several virulence factors, including proteases, lipopolysaccharide,
hemagglutinins, and fimbriae [2, 3]. Among these virulence fac-
tors, a unique class of cysteine proteinases, referred to as gingipains,
is responsible for a wide range of pathophysiological processes of
P. gingivalis [4]. Gingipains are grouped into arginine-specific
(Rgp) and lysine-specific (Kgp) subtypes. There are two types of
Rgp, namely RgpA, which contains proteolytic and adhesin
domains at its C-terminus, and RgpB, which only contains a pro-
teolytic domain [5, 6]. However, there is only one type of Kgp, and
97
98 Tomoko Kadowaki
it contains both proteolytic and adhesin domains [7]. It is worth

mentioning that there are similarities between the adhesin domain
sequences of Kgp and RgpA. Our previous studies using gingipain-
deficient mutants [8–11] and proteinase inhibitors specific for Rgp
(KYT-1) and Kgp (KYT-36) [12–14] revealed several functions of
gingipains, for example, destruction of periodontal tissues, disrup-
tion of host defense mechanisms, processing of bacterial cell-
surface and secretory proteins, and acquisition of heme groups
and amino acids. Rgp degrades immunoglobulin G (IgG) [15],
collagen types I and IV [15, 16], cytokines, and adhesion molecules
on gingival fibroblasts [17] and Kgp degrades IgG [18, 19]. In
terms of proteolytic processing of bacterial proteins necessary for
maturation, Rgp processes fimbrilin (FimA), a vital component of
fimbriae [10]. Furthermore, hemagglutinins and hemoglobin-
binding proteins encoded by internal regions of rgpA and kgp
genes are converted to functional molecules by autoproteolytic
processing by Rgp and Kgp [8, 20, 21]. Recent studies have
reported the association of gingipains with various systemic dis-
eases, such as cardiovascular diseases [9, 22], rheumatoid arthritis
[23], preterm birth and low birth weight [11], and Alzheimer’s
disease [24, 25]. Consequently, gingipains have received consider-
able attention, not only due to their high degree of virulence
against the host, but also because of their contribution to the
survival, virulence, and maturation of extracellular proteins of
P. gingivalis. Here, the methods for measuring the activities of
gingipains, analyzing their cytotoxicity, and enhancing their vascu-
lar permeability are described.
2 Materials
In this protocol, the use of ultrapure water (prepared by purifying

deionized water to attain a sensitivity of 18 MΩ cm at 25 C) and
analytical grade reagents is vital for preparing all solutions. Addi-
tionally, all reagents should be stored at 25 C unless indicated
otherwise.
2.1 Gingipain 1. 0.5 mg/mL hemin stock solution: Dissolve 50 mg of hemin in

Sample Preparation 1 mL of 1 N NaOH, and add this solution to 99 mL of water in
a glass bottle. Autoclave and store at 4 C.
2. 5 mg/mL menadione (vitamin K) stock solution: Dissolve
25 mg of vitamin K in 5 mL of pure ethanol. Stored at 4 C.
3. Brain-heart infusion (BHI) liquid medium: Weigh 3.7 g of
BHI, 0.5 g of yeast extract, and 0.1 g of L-cysteine into a
100 mL glass bottle. Add water to adjust the final volume of
the solution to 100 mL. Mix well and autoclave. Before inocu-
lation with P. gingivalis, supplement the autoclaved liquid
medium with 5 μg/mL hemin and 1 μg/mL menadione.
Experimental Protocol for Analyzing Gingipain Characteristics and Activities 99
4. Phosphate-buffered saline (PBS): Prepare a stock solution

(10) as follows. 1.37 M NaCl, 0.027 M KCl, 0.081 M
Na2HPO4, and 0.015 M KH2PO4; pH 7.4. Dilute ten times
with water and sterilize by autoclaving. Store at room
temperature.
5. Lysis buffer for measurement of proteolytic activities: PBS
containing 0.1% Triton X100.
6. Lysis buffer for sodium dodecyl sulfate–polyacrylamide gel
electrophoresis (SDS-PAGE): Add 1 μL of each of the
10 mM stock solutions of the protease inhibitors TLCK
(DMSO solution), TPCK (DMSO solution), and leupeptin
(ultrapure water solution) to 100 μL of PBS containing 0.1%
Triton X-100.
7. Anaerobic incubator.
8. Centrifuge.
9. Ultrasonic disruptor or French pressure cell press.
2.2 Substrates 1. Carbobenzoxy-L-phenylalanyl-L-arginine-4-methylcoumaryl-

for Rgp 7-amide (Z-Phe-Arg-MCA): Prepare a 1 mM stock solution in
dimethyl sulfoxide (DMSO) and store in the dark at 20 C.
Just before use, dilute the stock solution with cold water to
make a 20 μM working solution. Keep the working solution in
the dark at 4 C.
2. t-Butyloxycarbonyl-L-phenylalanyl-L-seryl-L-arginine-4-
methylcoumaryl-7-amide (Boc-Phe-Ser-Arg-MCA): Prepare a
1 mM stock solution in DMSO, and store it in the dark at
20 C. Just before use, dilute the stock solution with cold
water to make a 20 μM working solution. Keep the working
solution in the dark at 4 C.
3. Nα-Benzoyl-DL-arginine 4-nitroanilide (BApNA): Prepare a
100 mM stock solution with DMSO and store it in the dark
at 20 C. Just before use, dilute the stock solution with cold
water to make a 4 mM working solution. Keep the working
2.3 Substrates 1. t-Butyloxycarbonyl-L-valyl-L-leucyl-L-lysine-4-methylcou-

for Kgp maryl-7-amide (Boc-Val-Leu-Lys-MCA): Prepare a 1 mM
stock solution in DMSO, and store it in the dark at 20 C.
Just before use, dilute the stock solution with cold water to
make a 20 μM working solution. Keep the working solution in
the dark at 4 C.
2. Carbobenzoxy-L-histidyl-L-glutamyl-L-lysine-4-methylcou-
maryl-7-amide (Z-His-Glu-Lys-MCA): Prepare a 1 mM stock
solution in DMSO, and store it in the dark at 20 C. Just
before use, dilute the stock solution with cold water to make a
20 μM working solution. Keep the working solution in the dark
at 4 C.
100 Tomoko Kadowaki
3. L-Lysine-p-nitroanilide dihydrobromide: Prepare a 100 mM

stock solution with DMSO, and store it in the dark at
20 C. Just before use, dilute the stock solution with cold
water to make a 4 mM working solution. Keep the working
2.4 Protein 1. 5% hemoglobin solution: Dissolve 5 g of bovine hemoglobin in

Substrates water, and adjust the final volume to 100 mL. Remove undis-
solved residue by filtration using a qualitative filter paper.
2. 2% casein solution: Dissolve 2 g casein in approximately 90 mL
of water; adjust the pH to 10 using NaOH. Completely dis-
solve casein and then adjust the pH to 7.5 using HCl. Adjust
the final volume to 100 mL. Remove undissolved residue by
filtration using a qualitative filter paper.
3. 10% trichloroacetic acid (TCA): Dissolve 10 g TCA in 100 mL
water.
2.5 Measurement of 1. Gingipain sample (see Subheading 3.1).

Gingipain Activity 2. Phosphate buffer: 0.2 M sodium phosphate buffer, pH 7.5.
Using MCA Substrates Dissolve 27.8 g of NaH2PO4 in 1 L of water (solution A).
Dissolve 71.7 g of Na2HPO4·12H2O in 1 mL of water (solu-
tion B). Mix solutions A and B at volume ratio of 1:5.25.
Adjust the pH to 7.5 by adding the appropriate amount of
solution A (acidic solution) or solution B (basic solution).
3. L-cysteine: 50 mM solution. Dissolve 60.6 mg L-cysteine in
10 mL water.
4. MCA substrate solution: 20 μM MCA working solutions for
Z-Phe-Arg-MCA, Boc-Phe-Ser-Arg-MCA, Boc-Val-Leu-Lys-
MCA, and Z-His-Glu-Lys-MCA.
5. 7-Amino-4-methylcoumarin (AMC) standard solution: Pre-
pare a 1 mM stock solution in DMSO, and store it in the
dark at 20 C. Just before use, dilute the stock solution
with water at 4 C, to make a 0.1–5.0 μM solutions.
6. 0.1 M sodium acetate buffer, pH 5.0: Prepare a 1 M stock
solution. Dilute 11.55 mL of acetic acid with water to obtain a
volume of 200 mL (solution A). Dissolve 41.0 g of CH3COO-
Na·3H2O in 500 mL water (solution B). Mix solutions A and B
at an volume ratio of 1:2.4. Adjust the pH to 5.0 by adding the
appropriate amount of solution A (acidic solution) or solution
B (basic solution). Dilute the 1 M stock solution with water to
make a 0.1 M solution.
7. Iodoacetic acid: 10 mM iodoacetic acid in 0.1 M sodium
acetate buffer, pH 5.0. Dissolve 186 mg of iodoacetic acid in
100 mL of 0.1 M sodium acetate buffer, pH 5.0.
8. Test tube: 13 100 mm glass test tube.
9. Vortex.
10. Water bath with gentle shaking.
11. Fluorescence spectrophotometer (Hitachi F-2500).

Gingipain Activity 2. 1 M Tris–HCl buffer, pH 7.5: Make a 1 M stock solution.
Using p-Nitroanilide Dissolve 121.1 g of Tris (hydroxymethyl) aminomethane in
Substrates 900 mL of water. Adjust the pH to 7.5 using HCl. Finally,
adjust the volume to 1 L.
3. 1 M CaCl2: Dissolve 1.47 g of CaCl2·2H2O in 10 mL water.
4. 50 mM L-cysteine (see item 3 in Subheading 2.5).
5. Assay buffer for BApNA (2): Mix 100 μL of 1 M Tris–HCl,
pH 7.5, 4 μL of 1 M CaCl2, 200 μL of 50 mM cysteine, and
696 μL water.
6. Substrate solution: 4 mM BApNA (see item 3 in Subheading
2.2).
7. 50% acetic acid: Mix equal volumes of acetic acid and water.
8. 96-well plate: Transparent bottom microplates.
9. Incubator.
10. Microplate reader: For absorbance measurement.

Hemoglobin- 2. Phosphate buffer (see item 2 in Subheading 2.5).
Hydrolyzing Activity
4. 5% hemoglobin solution (see item 1 in Subheading 2.4).
5. Tyrosine standard solution: 10–100 μg/mL tyrosine solution.
Dissolve 1 mg of tyrosine in water to make a 1 mg/mL stock
solution. Dilute the stock solution with water to make 10, 20,
40, 60, 80, and 100 μg/mL tyrosine standard solutions.
6. 10% TCA (see item 3 in Subheading 2.4).
7. Lowry–Folin Mixture: Add 1 mL of 1% CuSO4·5H2O in water,
1 mL of 2% sodium or potassium tartrate to 100 mL of 2%
Na2CO3 in 0.1 N NaOH (see Note 1).
8. Folin and Ciocalteu’s phenol reagent (see Note 2).
9. Test tube (see item 8 in Subheading 2.5).
10. Vortex mixer.
11. Centrifuge.
12. Incubator or Water bath with shaking.
102 Tomoko Kadowaki

Caseinolytic Activity 2. Phosphate buffer (see item 2 in Subheading 2.5).
4. 2% Casein solution: Dissolve 2 g of casein in approximately
90 mL of water; adjust the pH to 10 using NaOH. Completely
dissolve casein and then adjust the pH to 7.5 using HCl. Adjust
the final volume to 100 mL. Remove undissolved residue by
filtration using a qualitative filter paper.
5. Tyrosine standard solution: 10–100 μg/mL tyrosine solution
(see item 5 in Subheading 2.7).
6. 10% TCA (see item 3 in Subheading 2.4).
7. Lowry–Folin mixture (see item 7 in Subheading 2.7).
8. Folin and Ciocalteu’s phenol reagent (see item 8 in Subheading
2.7).
9. Test tube (see item 8 in Subheading 2.5).
10. 1.5-mL tube.
11. Vortex mixer.
12. Centrifuge.
13. Incubator or water bath with shaking.
2.9 Gelatin 1. Fairbanks solubilizing buffer (5): 50% sucrose, 5 mM ethyle-

Zymography nediaminetetraacetic acid (EDTA), 50 mM Tris–HCl, pH 8.0,
10% sodium dodecyl sulfate (SDS), and 20%
β-mercaptoethanol.
2. 0.1% bromophenol blue (BPB): Dissolve 0.1 g of BPB in
100 mL of water. Store at room temperature.
3. Separating gel buffer: 1.5 M Tris–HCl, pH 8.8: Dissolve
181.7 g Tris–HCl into 0.9 L water. Mix well and adjust the
pH with HCl to 8.8. Add water to a final volume of 1 L. Store
at 4 C.
4. Stacking gel buffer: 0.5 M Tris–HCl, pH 6.8: Dissolve 60.6 g
Tris–HCl in 0.9 L water. Mix well and adjust the pH with HCl
to 6.8. Add water to adjust the final volume to 1 L. Store at
4 C.
5. 30% acrylamide–bisacrylamide solution (acrylamide–bisacryla-
mide 29.2:0.8): Dissolve 29.2 g of acrylamide monomer and
0.8 g bisacrylamide (cross-linker) in water, and adjust the final
volume to 100 mL. Store at 4 C in the dark.
6. 10% ammonium persulfate: Prepare in water before use.
7. 4 mg/mL gelatin: Dissolve 40 mg of gelatin (from porcine
skin) in 10 mL of water.
8. N,N,N,N0 -Tetramethyl ethylenediamine: Store at 4 C.

9. SDS-PAGE running buffer: 0.025 M Tris, 0.2 M glycine,
0.1% SDS.
10. Separating gel: 10% SDS-PAGE gel. Mix 3.75 mL of separating
gel buffer, 5 mL of 30% acrylamide–bisacrylamide solution,
0.75 mL of 4 mg/mL gelatin (200 μg/mL at final concentra-
tion), and 4.83 mL of water in a 50 mL conical flask. Add
0.31 mL of 10% SDS, 0.36 mL of 10% ammonium persulfate,
and 10 μL of TEMED, and cast gel within a gel cassette. Allow
space for stacking gel and gently overlay with isobutanol or
water.
11. Stacking gel: Prepare the stacking gel by mixing 1.25 mL of
stacking gel buffer, 1.0 mL of 30% acrylamide–bisacrylamide
solution, and 2.45 mL of water in a 50 mL conical flask. Add
200 μL of SDS, 200 μL of 10% ammonium persulfate, and 5 μL
of TEMED. Insert a 10-well gel comb immediately without
introducing air bubbles.
12. Staining solution: 0.1% Coomassie Brilliant Blue (R-250) in a
solution consisting of 30% methanol and 7% acetic acid in
water.
13. De-staining solution I: 40% methanol and 10% acetic acid in
water.
14. De-staining solution II: 25% ethanol and 8% acetic acid in
water.
15. 2% Triton X-100: Mix 10 mL of 0.2 M phosphate buffer,
pH 7.5 (see item 4 in Subheading 2.1), 2 mL of Triton
X-100, and 88 mL of water.
16. 20 mM phosphate buffer: Dilute 0.2 M phosphate buffer,
pH 7.5, ten times with water.
17. 10 mM dithiothreitol (DTT): Dissolve 15.4 mg DTT in
20 mM phosphate buffer.
18. Incubator.
19. Electrophoresis apparatus.
2.10 Luminol- 1. 0.9% NaCl: Dissolve 0.9 g of NaCl in 100 mL of water.

Dependent 2. Oyster glycogen: 0.2% solution in 0.9% NaCl. Sterilize by
Chemiluminescence autoclaving.
(CL) Response of
3. Hanks’ Balanced Salt Solution (HBSS): 140 mg/mL CaCl2,
Neutrophils 100 mg/mL MgCl2·6H2O, 100 mg/mL MgSO4·7H2O,
400 mg/mL KCl, 60 mg/L KH2PO4, 350 mM NaHCO3,
8000 mg/mL NaCl, 48 mg/mL Na2HPO4, and 1000 mg/
mL D-glucose (see Note 2).
104 Tomoko Kadowaki
4. Guinea pig neutrophils (see Note 3): Intraperitoneally inject

20 mL of oyster glycogen into a female Hartley guinea pig
(bodyweight approximately 400 g). Collect the peritoneal exu-
dates at 14 h after injection. Wash the cells with HBSS twice (see
Note 4).
5. Zymosan A: 20 mg/mL suspension in 0.9% NaCl. Weigh
20 mg of zymosan A, and suspend it in 1 mL of 0.9% NaCl.
6. Guinea pig serum: Blood sample is obtained from a guinea pig
by cardiac puncture and left for about 20 min to form a clot.
The sample is centrifuged at 2000 g for 15 min, and the
supernatant is collected and used as serum.
7. Luminol: Prepare a 10 mM stock solution by dissolving
1.77 mg of luminol in 1 mL ice-cold ultrapure water, and
store it in the dark at 20 C. Just before use, dilute the
stock solution with water at 4 C to make a 0.2 mM solution.
8. Hemocytometer.
9. Luminometer: Berthold Microlumat LB 96V.
10. Centrifuge.
11. Incubator.
12. 96-well white plate.
2.11 Measurement of 1. Guinea pig: Female Hartley guinea pig with a bodyweight of
Vascular Permeability approximately 300–400 g.
In Vivo 2. 5% Evans Blue Dye (EBD): Dissolve 50 mg of EBD in 1 mL of
PBS (see item 2 in Subheading 2.1).
3 Methods
3.1 Gingipain 1. Inoculate a colony of P. gingivalis in 10 mL of BHI liquid

Sample Preparation medium, and allow the bacterium to grow anaerobically until
the medium gets cloudy.
2. Make a tenfold dilution of the P. gingivalis culture in fresh BHI
liquid medium and grow the bacteria overnight (see Note 5).
3. Collect the bacterial cells by centrifugation at 6000 g for
15 min at 4 C, and wash twice with ice-cold PBS.
4. Resuspend the bacterial cells in an ice-cold lysis buffer.
5. Lyse the bacterial cells by ultrasonic disruptor or French pres-
sure cell press on ice.
6. Centrifuge the lysate at 25,000 g for 10 min to remove
insoluble materials.
7. Collect the resultant supernatant as a cell extract.
100 Rgp
% Maximum activity
Kgp
80
60
40
20
0
2 3 4 5 6 7 8 9 10 11 12 13
pH
Fig. 1 Optimal pH of Rgp and Kgp. Degradative activities of gingipains toward

synthetic substrate (Z-Phe-Arg-MCA for Rgp and Boc-Val-Leu-Lys-MCA for Kgp)
were measured at different pH values. Both Rgp and Kgp showed enzymatic
activity between pH 5 and 10. Their optimal pH was approximately 7.5 [15, 26]
3.2 Measurement of 1. Add 100 μL of phosphate buffer, 100 μL of L-cysteine, gingi-

Gingipain Activity pain sample (x μL), and water (300 x μL) to the test tube (see
Using MCA Substrates Note 6).
3.2.1 Gingipain Activity in 2. Add 500 μL of MCA substrate solution (20 μM) into the tube.
Sample 3. Mix well by vortexing and incubate at 40 C for 10 min in a
water bath, with gentle shaking.
4. Add 1 mL of iodoacetic acid and mix well by vortexing to stop
the reaction (see Note 7).
5. Measure the fluorescence of AMC at an excitation wavelength
of 380 nm and an emission wavelength of 460 nm (Fig. 1).
6. Calculate the concentration of released AMC using the AMC
standard curve.
7. Determine the enzymatic activity as the amount of AMC
released under the conditions.
3.2.2 Standard Curve 1. Add 500 μL of 0.1–5.0 μM AMC standard solutions, 100 μL of
sodium phosphate buffer (pH 7.5), 100 μL of L-cysteine, 1 mL
of 10 mM iodoacetic acid, and 300 μL of water to a test tube.
2. Measure the fluorescence at an excitation wavelength of
380 nm and an emission wavelength of 460 nm, and make
the AMC standard curve.
3.3 Measurement of 1. Load 100 μL of the 2 assay buffer for BApNA and 90 μL of
Gingipain Activity the gingipain sample into a well of a 96-well plate (see Note 6).
Using p-Nitroanilide 2. Add 10 μL of the substrate solution (4 mM) to each well.
Substrates
3. Incubate the plate at 37 C for 10–30 min.
106 Tomoko Kadowaki
4. Stop the reaction by adding 50 μL of 50% acetic acid to

each well.
5. Measure absorbance at a 410 nm wavelength.
6. Determine the enzyme activity as the amount of pNA
(OD value at 410 nm) released under the conditions.
3.4 Measurement of 1. Add 50 μL of phosphate buffer, 50 μL of L-cysteine, 125 μL of

Hemoglobin- hemoglobin solution, appropriate amount of gingipain sample
Hydrolyzing Activity (x μL), and (275 x) μL of water into the test tube (see Note
6).
3.4.1 Gingipain Activity in
Sample 2. Mix well by vortex and incubate at 40 C for 40 min.
3. Stop the reaction by adding 0.5 mL of ice-cold 10% TCA.
4. Incubate on ice for 10 min (see Note 8).
6. Transfer 200 μL of the supernatant to another new test tube.
7. Add 1 mL of Lowry–Folin mixture to the tube and mix well by
vortex.
8. Incubate the mixture at 25 C for 10 min.
9. Add 100 μL of Folin and Ciocalteu’s phenol reagent, immedi-
ately mix well, and incubate at 25 C for 30 min.
10. Measure absorbance at 660 nm wavelength.
11. Calculate the concentration of released amino acids from the
standard curve.
3.4.2 Standard Curve 1. Mix the following reagents in test tube: 200 μL of 10–100 μg/
mL tyrosine standard solution, 1 mL of Lowry–Folin mixture,
and 100 μL of Folin and Ciocalteu’s phenol reagent.
2. Incubate the mixture at 25 C for 30 min, measure absorbance
at 660 nm wavelength, and make the tyrosine standard curve.
3.5 Measurement of 1. Add 50 μL of phosphate buffer, 50 μL of L-cysteine, 250 μL of

Caseinolytic Activity casein solution, an appropriate amount (up to 150 μL) of the
gingipain sample, and water to obtain a total volume of 0.5 mL
3.5.1 Gingipain Activity in
in test tube.
Sample
2. Mix well and incubate at 40 C for 40 min.
3. Stop the reaction by adding 0.5 mL of ice-cold 10% TCA.
4. Incubate on ice for 10 min (see Note 8).
6. Collect the supernatant in a fresh tube.
7. Transfer 200 μL of supernatant to another new tube.
8. Add 1 mL of Lowry–Folin mixture to the tube and mix well by
vortexing.
9. Incubate the mixture at 25 C for 10 min.

10. Add 100 μL of Folin and Ciocalteu’s phenol reagent, immedi-
ately mix well, and incubate at 25 C for 30 min.
11. Measure absorbance at a 660 nm wavelength.
3.5.2 Standard Curve 1. Mix the following reagents in a tube: 200 μL of 10–100 μg/
mL tyrosine standard solution, 1 mL of Lowry–Folin mixture,
and 100 μL of Folin and Ciocalteu’s phenol reagent.
2. Incubate the mixture at 25 C for 30 min, measure absorbance
at 660 nm wavelength, and make the tyrosine standard curve.
3. Calculate the concentration of amino acids released using the
standard curve.
3.6 Gelatin 1. Mix 30 μL of the gingipain samples with 7.5 μL of 5 Fair-

Zymography banks solubilizing buffer and incubate at 37 C for 30 min.
2. Add 2 μL of 0.1% BPB to the mixture.
3. Load the samples into the gel and perform electrophoresis (see
Note 9).
4. After electrophoresis, wash the gel three times with 2% Triton
X-100 and twice with 20 mM phosphate buffer.
5. Soak the gel in 10 mM DTT, and incubate at 37 C for 2 h.
6. Wash the gel with distilled water, stain with staining solution
for an hour or more, and then wash with destaining solutions I
and II for several hours until the proteolytic band appears white
(Fig. 2).
Fig. 2 Gelatin zymography of gingipain. Partially purified Rgp from the

P. gingivalis culture supernatant was subjected to gelatin zymography. The
band corresponding to Rgp appears white due to degradation
108 Tomoko Kadowaki
3.7 Luminol- 1. Incubate guinea pig neutrophils (107 cells/mL) with the gin-
Dependent gipain sample at 37 C for 60 min.
Chemiluminescence 2. Centrifuge at 300 g for 5 min and remove the supernatant.
(CL) Response of
3. Wash the cells with HBSS twice by repeating the centrifugation
Neutrophils and suspending.
3.7.1 Neutrophil 4. Resuspend the washed cells in some HBSS, and adjust the cell
Preparation density to 107 cells/mL using hemocytometer.
3.7.2 Opsonization of 1. Boil zymosan A for 5 min.

Zymozan A 2. Centrifuge the suspension at 300 g for 5 min, and remove
the supernatant.
3. Suspend the sedimentary zymosan A in the same volume of
guinea pig serum.
4. Incubate the suspension at 37 C for 30 min to opsonize the
zymosan A.
5. Centrifuge at 300 g for 5 min, and remove the supernatant.
6. Suspend the sedimentary zymosan A in a 0.9% NaCl (about
20 mg/mL zymosan A solution).
3.7.3 Chemilumine- 1. Mix 100 μL of neutrophils, 100 μL of opsonized zymosan, and

scence Assay 100 μL of luminol in a well of 96-well plate.
2. Measure luminol-dependent CL continuously for 30 min using
a luminometer (Fig. 3).
3.8 Measurement of 1. Remove the hair on dorsal trunk of anesthetized guinea pigs by
Vascular Permeability clippers.
In Vivo 2. Inject the gingipain samples (50 μL each) intradermally into
back skin of a guinea pig.
3. Inject EBD intravenously into the lateral saphenous vein
30 min after the gingipain injection.
4. Sacrifice the guinea pig and remove the skin in one lump of
epidermis and dermis with scissors in the subcutaneous layer.
5. Observe the skin from dermis and measure the area of intra-
dermally extravasated dye (Fig. 4, see Note 10).
4 Notes
1. The product should be strictly used within a day.

2. A commercial product is used.
3. Neutrophils from other animals, such as humans and mice, can
be used. In this case, use serum for the opsonization of zymo-
san obtained from the same type of animal as the neutrophils.
A Zymosan
C3bR
neutrophil
rophil
FcR
NADPH oxidase
O2 O2-
CL
HO䞉䞉 H2O2
myeloperoxidase
HOCl luminol
Fig. 3 Inhibition of the chemiluminescence (CL) response of neutrophils by

gingipains. (a) Schematic representation of Luminol-dependent CL response. (b)
Effects of P. gingivalis culture supernatant and gingipain inhibitors on CL response.
Treatment with selective inhibitors KYT-1 (107 M, for Rgp) and KYT-36 (107 M,
for Kgp) recovered the suppressive activity of the P. gingivalis culture supernatant
on the neutrophil CL response [12] (see Note 11)
4. More than 90% of cells obtained by this method are

neutrophils.
5. For the preparation of P. gingivalis cell extract samples, a long
incubation period of bacteria in BHI liquid medium should be
avoided in order to prevent cell lysis.
6. Since gingipain activity is substantially high, the reaction mix-
ture should be kept cold (i.e., on ice) before and after incuba-
tion to avoid autoproteolysis.
7. The inhibitor added to the stop solution can be substituted
with leupeptin (100 μM), TLCK (1 mM), TPCK (1 mM), or
iodoacetamide (10 mM) (Table 1).
110 Tomoko Kadowaki
1
4
2
5
3
6
1
4
2
5
3
6
Fig. 4 Enhanced vascular permeability by Gingipains. (a) Schematic

representation of intradermal injection of gingipain samples into a guinea pig.
(b) Dye leakage is observed in vascular hyperpermeability sites. (1) phosphate-
buffered saline (PBS). (2) P. gingivalis culture supernatant. (3) KYT-1 alone.
(4) P. gingivalis culture supernatant supplemented with KYT-1 (106 M).
(5) P. gingivalis culture supernatant supplemented with KYT-36 (106 M).
(6) P. gingivalis culture supernatant supplemented with KYT-1 and 36 (106 M
each). Inhibitors of Rgp and Kgp apparently inhibited their vascular permeability-
enhancement activity
8. Acid-soluble amino acids/peptides formed by degradation can

be extracted at this step.
9. The voltage should be kept reasonably low (e.g., 50 V) in order
to avoid autoproteolysis during electrophoresis.
10. Quantification of the extent of permeability can be performed
by measuring the diameter of the region colored with dye or
the absorbance of the dye extracted from the colored region.
Table 1
Inhibition of gingipain activity by compounds
Remaining activity (%)
Inhibitor Concentration Rgpa Kgpb

None 100 100
Leupeptin 100 μM 0 17
E-64 140 μM 10 88
Iodoacetic acid 1 mM 33 24
Iodoacetamide 10 mM 0 0
TLCK 1 mM 20 4
TPCK 1 mM 5 1
PMSF 1 mM 76 94
EDTA 1 mM 18 110
CaCl2 1 mM 133 98
a
Data from [15]
b
Data from [26]
11. KYT-1 and KYT-36 are selective synthetic inhibitors of Rgp

and Kgp, respectively, based on the cleavage sites of histatins by
the enzyme. The two inhibitors are currently not commercially
available.
References
1. Albandar JM, Rams TE (2002) Global epide- contribution of Arg-gingipain to virulence. J

miology of periodontal diseases: an overview. Biol Chem 270(40):23619–23626
Periodontol 2000 29:7–10 6. Nakayama K (1997) Domain-specific rear-
2. Mysak J, Podzimek S, Sommerova P et al rangement between the two Arg-gingipain-
(2014) Porphyromonas gingivalis: major peri- encoding genes in Porphyromonas gingivalis:
odontopathic pathogen overview. J Immunol possible involvement of nonreciprocal recom-
Res 2014:476068 bination. Microbiol Immunol 41(3):185–196
3. Bostanci N, Belibasakis GN (2012) Porphyro- 7. Okamoto K, Kadowaki T, Nakayama K et al
monas gingivalis: an invasive and evasive (1996) Cloning and sequencing of the gene
opportunistic oral pathogen. FEMS Microbiol encoding a novel lysine-specific cysteine pro-
Lett 333(1):1–9 teinase (Lys-gingipain) in Porphyromonas gin-
4. Kadowaki T, Takii R, Yamatake K et al (2007) givalis: structural relationship with the
A role for gingipains in cellular responses and arginine-specific cysteine proteinase
bacterial survival in Porphyromonas gingivalis- (Arg-gingipain). J Biochem 120(2):398–406
infected cells. Front Biosci 12:4800–4809 8. Shi Y, Ratnayake DB, Okamoto K et al (1999)
5. Nakayama K, Kadowaki T, Okamoto K et al Genetic analyses of proteolysis, hemoglobin
(1995) Construction and characterization of binding, and hemagglutination of Porphyromo-
arginine-specific cysteine proteinase (Arg-gin- nas gingivalis. Construction of mutants with a
gipain)-deficient mutants of Porphyromonas combination of rgpA, rgpB, kgp, and hagA. J
gingivalis. Evidence for significant Biol Chem 274(25):17955–17960
112 Tomoko Kadowaki
9. Hashimoto M, Kadowaki T, Tsukuba T et al gingipain K from Porphyromonas gingivalis

(2006) Selective proteolysis of apolipoprotein may compromise host defense in progressive
B-100 by Arg-gingipain mediates atherosclero- periodontitis. FASEB J 25(10):3741–3750
sis progression accelerated by bacterial expo- 19. Guentsch A, Hirsch C, Pfister W et al (2013)
sure. J Biochem 140(5):713–723 Cleavage of IgG1 in gingival crevicular fluid is
10. Kadowaki T, Nakayama K, Yoshimura F et al associated with the presence of Porphyromonas
(1998) Arg-gingipain acts as a major proces- gingivalis. J Periodontal Res 48(4):458–465
sing enzyme for various cell surface proteins in 20. Nakayama K, Ratnayake DB, Tsukuba T et al
Porphyromonas gingivalis. J Biol Chem 273 (1998) Haemoglobin receptor protein is intra-
(44):29072–29076 genically encoded by the cysteine proteinase-
11. Takii R, Kadowaki T, Tsukuba T et al (2018) encoding genes and the haemagglutinin-
Inhibition of gingipains prevents Porphyromo- encoding gene of Porphyromonas gingivalis.
nas gingivalis-induced preterm birth and fetal Mol Microbiol 27(1):51–61
death in pregnant mice. Eur J Pharmacol 21. Sakai E, Naito M, Sato K et al (2007) Con-
824:48–56 struction of recombinant hemagglutinin
12. Kadowaki T, Baba A, Abe N et al (2004) Sup- derived from the gingipain-encoding gene of
pression of pathogenicity of Porphyromonas Porphyromonas gingivalis, identification of its
gingivalis by newly developed gingipain inhibi- target protein on erythrocytes, and inhibition
tors. Mol Pharmacol 66(6):1599–1606 of hemagglutination by an interdomain
13. Kadowaki T, Kitano S, Baba A et al (2003) regional peptide. J Bacteriol 189
Isolation and characterization of a novel and (11):3977–3986
potent inhibitor of Arg-gingipain from Strep- 22. Naito M, Sakai E, Shi Y et al (2006) Porphyr-
tomyces sp. strain FA-70. Biol Chem 384 omonas gingivalis-induced platelet aggregation
(6):911–920 in plasma depends on Hgp44 adhesin but not
14. Kadowaki T, Yamamoto K (2003) Suppression Rgp proteinase. Mol Microbiol 59
of virulence of Porphyromonas gingivalis by (1):152–167
potent inhibitors specific for gingipains. Curr 23. Kharlamova N, Jiang X, Sherina N et al (2016)
Protein Pept Sci 4(6):451–458 Antibodies to Porphyromonas gingivalis indi-
15. Kadowaki T, Yoneda M, Okamoto K et al cate interaction between oral infection, smok-
(1994) Purification and characterization of a ing, and risk genes in rheumatoid arthritis
novel arginine-specific cysteine proteinase etiology. Arthritis Rheumatol 68(3):604–613
(argingipain) involved in the pathogenesis of 24. Dominy SS, Lynch C, Ermini F et al (2019)
periodontal disease from the culture superna- Porphyromonas gingivalis in Alzheimer’s dis-
tant of Porphyromonas gingivalis. J Biol Chem ease brains: evidence for disease causation and
269(33):21371–21378 treatment with small-molecule inhibitors. Sci
16. Houle MA, Grenier D, Plamondon P et al Adv 5(1):eaau3333
(2003) The collagenase activity of Porphyromo- 25. Nie R, Wu Z, Ni J et al (2019) Porphyromonas
nas gingivalis is due to Arg-gingipain. FEMS gingivalis infection induces amyloid-beta accu-
Microbiol Lett 221(2):181–185 mulation in monocytes/macrophages. J Alz-
17. Baba A, Abe N, Kadowaki T et al (2001) heimers Dis 72(2):479–494
Arg-gingipain is responsible for the degrada- 26. Abe N, Kadowaki T, Okamoto K et al (1998)
tion of cell adhesion molecules of human gin- Biochemical and functional properties of
gival fibroblasts and their death induced by lysine-specific cysteine proteinase
Porphyromonas gingivalis. Biol Chem 382 (Lys-gingipain) as a virulence factor of Porphyr-
(5):817–824 omonas gingivalis in periodontal disease. J Bio-
18. Vincents B, Guentsch A, Kostolowska D et al chem 123(2):305–312
(2011) Cleavage of IgG1 and IgG3 by
Chapter 11
Structural Characterization of the Type IX Secretion System

in Porphyromonas gingivalis
Dhana G. Gorasia, Eric Hanssen, Paul D. Veith, and Eric C. Reynolds
Abstract
The type IX secretion system (T9SS) is the most recently discovered secretion system in the gram-negative
bacteria and is specific to the Bacteroidetes phylum. It is comprised of at least 19 proteins, which together
allows for the secretion and cell surface attachment of a specific group of proteins (T9SS substrates), that
harbor a signal sequence at the C-terminus. Here we describe the structural characterization of the PorK,
PorN and PorG components of the Porphyromonas gingivalis T9SS using electron microscopy and cross-
linking mass spectrometry.
Key words Type IX secretion system (T9SS), Porphyromonas gingivalis, Electron microscopy, PorK,
PorN, PorG, Cross-linking, Mass spectrometry, Protein complexes, Gradient centrifugation
1 Introduction
Many pathogens use dedicated protein secretion systems to trans-

port virulence factors across the cell envelope. Porphyromonas gin-
givalis uses the type IX secretion system (T9SS) to transport its
virulence factors (gingipains) across the outer membrane and attach
them onto the cell surface [1–3]. Proteins secreted by the T9SS
have an N-terminal signal peptide that facilitates export across the
inner membrane by the Sec system and have a conserved
C-terminal domain referred to as the CTD signal, that enables
them to pass through the outer membrane via the T9SS [4–
6]. Once on the surface, the CTD signals are removed by the
sortase PorU and replaced with anionic-LPS, anchoring the pro-
teins to the cell surface [7, 8]. The T9SS is composed of at least
19 proteins, namely, PorK, PorL, PorM, PorN, PorP, PorG, Sov,
PorQ, PorV, PorU, PorZ, PorT, PorE, PorW, Plug, PorF, and the
three transcription regulators, PorX, PorY, and SigP [1, 9–
14]. Sato et al. showed that PorK, PorL, PorM, and PorN form a
complex greater than 1.2 MDa [1]. Previously, the Type III secre-
tion system was isolated using CsCl density centrifugation [15] and
113
114 Dhana G. Gorasia et al.
therefore we adapted and modified their protocol in an attempt to

isolate the T9SS. With this protocol we successfully purified a
complex containing the PorK, PorN, and PorG components of
the T9SS. Using electron microscopy, we showed that PorK and
PorN form large ring-shaped structures that measured 50 nm in
diameter [16]. Cross-linking mass spectrometry revealed that PorG
is also associated with PorK and PorN in the ring structure
[16]. Here, we provide a detailed protocol for the purification of
the PorK/N/G complex and cross-linking of the purified complex.
2 Materials
Prepare all solutions using ultrapure water (prepared by purifying

deionized water to attain a sensitivity of 18 MΩ cm at 25 C).
2.1 PorK/N Complex 1. Phosphate-buffered saline (PBS): Dissolve 8 g of NaCl, 0.2 g of

Purification KCl, 1.44 g of anhydrous Na2HPO4, and 0.24 g of anhydrous
KH2PO4 in 800 mL of water. Adjust the pH to 7.4 with HCl
and make up to 1 L with water. Filter PBS with 0.2 μm filter or
autoclave it.
2. 1 M Tris–HCl: For 50 mL, Dissolve 6.05 g of Tris–HCl in
30 mL of water, adjust pH to 7.5 with HCl. Make up to 50 mL
with water.
3. 1.5 M sucrose: Dissolve 51.34 g of sucrose in water and make
up to 100 mL with water.
4. 2.5 M NaCl: Dissolve 7.3 g of NaCl in water and make up to
50 mL with water.
5. 1 M MgCl2: Dissolve 4.8 g of anhydrous MgCl2 in water and
make up to 50 mL with water.
6. 10% n-dodecyl β-D-maltoside (DDM): Dissolve 1 g of DDM in
water and make up to 10 mL with water.
7. 0.5 M EDTA: Dissolve 18.6 g of EDTA sodium salt in 80 mL
of water. Adjust the pH to 8.0 with NaOH and make up to
100 mL with water.
8. Tosyl-L-lysine chloromethyl ketone hydrochloride (TLCK):
Make 50 mM stock in water. Needs to be fresh, prepare just
before use.
9. 250 U/μL benzonase.
10. Protease inhibitor cocktail (PIC) (Roche): Dissolve one tablet
in 2 mL of water to make 25 stock solution.
11. Lysozyme: 10 mg/mL stock solution. Dissolve 10 mg of
lysozyme in 1 mL of water.
Isolation and Characterisation of the PorK/N Complex 115
12. Lysis buffer: 50 mM Tris (pH 7.5), 150 mM NaCl, 0.5 M

sucrose, 5 mM MgCl2, 1% DDM, 250 U of benzonase, 1
PIC, 5 mM TLCK.
13. Resuspension buffer A: 50 mM Tris pH 7.5, 500 mM NaCl,
1% DDM, 5 mM EDTA, 0.5 mg/mL lysozyme, and 1 PIC.
14. Resuspension buffer B: 10 mM Tris pH 7.5, 500 mM NaCl, 1%
DDM, 5 mM EDTA.
15. Diluting buffer: 10 mM Tris pH 7.5, 500 mM NaCl, 0.5%
DDM, 5 mM EDTA.
16. Resuspension buffer C: 10 mM Tris pH 7.5, 500 mM NaCl,
0.5% DDM.
17. Hemin: 5 mg/mL stock solution. Dissolve 625 mg of hemin in
4 mL of 1 N NaOH then add 96 mL of water. Autoclave at
121 C for 20 min. Store at 4 C.
18. Cysteine: 0.5 mg/mL stock solution. Dissolve 12.5 g of L-
cysteine hydrochloride monohydrate in 25 mL of water and
filter-sterilize. Store in 2 mL aliquots at 20 C.
19. Menadione: 5 mg/mL stock solution. Dissolve 125 mg of
menadione in 25 mL of 100% ethanol and filter-sterilize.
20. P. gingivalis growth media: Dissolve 25 g of Trypticase Soy
Broth and 30 g of Brain heart infusion in 1 L of water. Auto-
clave for 25 min at 121 C. Prior to bacterial inoculation add
1 mL of hemin, cysteine, and menadione.
21. Ultracentrifuge.
22. Beckman Coulter ultracentrifuge tubes: Ultra Clear centrifuge
tube, 2.2 mL; thick wall polycarbonate tube, 1 mL; thick wall
polycarbonate tube, 30 mL (seeNote 1).
23. TLS-55 rotor (Beckman Coulter, Inc.): a swinging-bucket
rotor of centrifuge.
24. MLA-130 rotor (Beckman Coulter, Inc.): a fixed angle rotor of
centrifuge.
2.2 Electron 1. 400 mesh carbon-coated copper grids (ProScitech).

Microscopy 2. QUANTIFOIL R2/2 copper grids (ProScitech).
3. 1% Uranyl acetate: Dissolve 1 g of uranyl acetate in 100 mL of
water (seeNote 2).
4. Ethane gas.
5. Liquid nitrogen.
6. Glow discharge unit (Pelco EasyGlow).
7. Transmission electron microscope (TEM Tecnai F30, FEI).
Operates at 300 kV accelerating voltage and is equipped with
field emission gun, BioTWIN objective lens (Cs 3.0), high-
angle annular dark field detector, and Gatan imaging energy
filter.
2.3 Cross-Linking 1. PBS containing 0.5% DDM.

2. Bis(sulfosuccinimidyl)suberate (BS3) (Thermo Fisher Scien-
tific): 1 M solution in water.
3. 50 mM Ammonium bicarbonate: Dissolve 3.96 g of ammo-
nium bicarbonate in 1 L of water. Aliquot in 50 mL tubes and
store it at 20 C.
4. Iodoacetamide.
5. 1 M Dithiothreitol (DTT): Dissolve 154.5 mg of DTT in 1 mL
of water. Aliquot and store at 20 C.
6. Sequencing grade trypsin.
7. Urea.
8. C18 Zip-tips (Millipore).
9. 10% trifluoroacetic acid (TFA).
10. SpeedVac (Thermo Fisher Scientific): vacuum concentrator.
11. Mass spectrometer.
3 Methods
3.1 Isolation of PorK/ 1. Cultivate P. gingivalis anaerobically in P. gingivalis growth

N Protein Complex media.
2. Centrifuge 50 mL of P. gingivalis culture (OD650nm 0.8–1.2)
at 10,000 g for 10 min at 4 C.
3. Remove the supernatant (seeNote 3) and wash the cell pellet
with ice cold PBS (seeNote 4) and centrifuge again as in step 1
(seeNote 5).
4. Prepare the lysis buffer (seeNotes 6 and 7).
5. Resuspend the cell pellet in 5 mL of lysis buffer and incubate in
ice for 45 min (seeNote 8).
6. Centrifuge at 10,000 g for 25 min at 4 C to remove any
cellular debris.
7. Transfer the supernatant into the thick wall polycarbonate
tube, 30 mL centrifuge and centrifuge at 142,000 g for
40 min at 12 C in an ultracentrifuge.
8. Remove the supernatant (seeNote 9) and resuspend the pellet
in 5 mL of Resuspension buffer A.
9. Incubate the sample at 37 C for 15 min (seeNote 10) and
centrifuge again at 142,000 g for 40 min at 12 C.
10. Remove supernatant and resuspend the pellet in 500 μL of
Resuspension buffer B.
11. Centrifuge at 10,000 g for 10 min to remove insoluble

material and load the supernatant on 1.5 mL of 30% w/v
CsCl in Ultra Clear centrifuge tube, 2.2 mL (seeNote 11).
12. Centrifuge at 214,200 g for 17 h in a TLS-55 rotor at 20 C
(seeNote 12).
13. Collect eight fractions of 250 μL each using a needle syringe
(seeNote 13).
14. Add 1.25 mL of diluting buffer to each fraction mix and
transfer in thick wall polycarbonate tube, 1 mL and centrifuge
at 543,200 g for 30 min in MLA-130 rotor (seeNote 14).
15. Remove the supernatant and resuspend the pellet containing
PorK/N complex in resuspension buffer C. The PorK/N
complex pellet is observed in fraction 6. The sample can be
stored at 4 C.
16. Check the purity of sample by SDS-PAGE analysis (seeNote 15)
(Fig. 1a).
Fig. 1 SDS-PAGE and electron micrographs of negatively stained PorK/N complex. (a) Fraction 6 from CsCl
density gradient was resolved by SDS-PAGE and visualized by Coomassie Brilliant Blue stain. (b) Complexes
were stained with uranyl acetate and observed under TEM. Homogenous ring-shaped structures of PorK/N
complex were observed. Reproduced from Gorasia et al. (2016) with permission from PLOS Pathogens [16]
3.2 Electron 1. Using forceps place an EM grid (Fomvar-carbon films sup-

Microscopy ported on 200 mesh copper grids) in a glow discharge unit
for 15 s at 25 mA.
3.2.1 Negative Staining
2. Prepare a piece of parafilm with a 5 μL drop of sample, a 30 μL
drop of water and a 10 μL drop of 1% uranyl acetate.
3. Place the grid on the drop of sample for 30 s. The carbon side
of the grid needs to be in contact with the sample (seeNote 16).
4. Remove the grid from the sample and blot the excess on a piece
of filter paper (seeNote 17).
5. Touch the grid on the drop of water for 1 s and blot the excess
water on the filter paper.
6. Place the grid on top of the 1% uranyl acetate drop and incu-
bate for 30 s.
7. Pick up the grid, touch the filter paper and let air dry for 10 min
before viewing it with Tecnai F30 electron microscope (TEM)
(Fig. 1b).
3.2.2 Cryo-Electron 1. Glow discharge the QUANTIFOIL grid for 15 s at 25 mA.

Microscopy 2. Prepare the liquid ethane bath.
3. Load a grid on the Vitrobot (80% humidity, 20 C).
4. Apply 3 μL of sample to the grid and wait for 5 s.
5. Blot for 2 s with a filter paper.
6. Plunge in liquid ethane and store in liquid nitrogen until
imaging session.
3.3 Cross-Linking 1. Prepare the PorK/N sample as detailed in Subheading 3.1 until
Mass Spectrometry step 12.
2. Add 1.25 mL of PBS to each fraction and centrifuge as in step
13, Subheading 3.1.
3. Resuspend the pellet containing PorK/N with ~30 μL PBS
containing 0.5% DDM.
4. Estimate the protein concentration using NanoDrop (seeNote
18).
5. Take ~12 μg of sample and to that add 1 mM (final concentra-
tion) of BS3 cross-linker (seeNote 19).
6. Incubate at room temperature for 15 min with rotation.
7. Stop the reaction by adding 1 M Tris–HCl pH 7.5 to a final
concentration of 20 mM and let it stand for 10 min.
8. Make the total volume to 50 μL with 20 mM Tris–HCl if it is
not 50 μL already.
9. Add solid urea (~24 mg) to the sample to obtain a final con-
centration of 8 M.
10. Add 1 M DTT to a final concentration of 10 mM and incubate

at 37 C for 1 h.
11. Add Iodoacetamide to a final concentration of 25 mM and
incubate for 30 min at room temperature in dark (seeNote 20).
12. Dilute the sample with 25 mM NH4HCO3 to a final urea
concentration of 1 M (~400 μL).
13. Add sequencing grade modified trypsin to a final concentration
of 10 ng/μL to the sample and incubate overnight at 37 C.
14. Add 10% TFA to a final concentration of 0.1%. Use C18
Zip-Tips according to the manufacturer’s instructions to desalt
and concentrate the samples in SpeedVac (seeNote 21) before
analysis with Orbitrap mass spectrometer.
15. Set the mass spectrometer to exclude 2+ charged ions and
include 3+ and 4+ charged ions. Choose higher energy collision
dissociation type of fragmentation with longer gradient. See ref.
16 for more details on the mass spectrometry conditions.
16. Generate mgf file using raw converter (fields.scripps.edu/raw-
conv/). Analyze the mgf file generated by the mass spectrome-
ter using P-Link software (download from http://pfind.ict.ac.
cn/software/pLink).
17. Use the following settings after uploading the file:
Enzyme ¼ Trypsin, missed cleavage ¼ 3, MS tolerance ¼ 5 ppm,
cross-linker ¼ BS3, spectra format ¼ mgf, fixed modifica-
tion ¼ carbamidomethyl_C, variable modification ¼ oxida-
tion_M, spectra type ¼ HCD.
18. The result file will contain an Excel sheet with the identified
cross-linked peptides between PorK, PorN, and PorG.
Another result file will contain mass spectra showing the iden-
tified cross-linked peptides.
4 Notes
1. Ensure the rotor is balanced by weighing the tubes containing

the sample and balance tubes. The difference in weight needs
to be within 0.1 g.
2. Uranyl acetate is very toxic in powder form. Prepare 1% uranyl
acetate in the fume hood.
3. Be careful when tipping out the supernatant as the pellet may
be loose.
4. We usually prepare the day before and store it in the fridge.
5. The cell pellet can be frozen at this stage or proceed with the
purification protocol.
6. TLCK is only required if wild-type or gingipain-expressing

P. gingivalis cells are used.
7. Prepare the stock solution of each reagent in advance and add
the reagents together to make the lysis buffer on the day.
8. After 45 min, check whether all bacteria have lysed by looking
at the turbidity of the lysate. If it is not clear, then add more
lysis buffer and incubate for further 10 min.
9. The pellet will look glassy. Remove the supernatant with a
pipette rather than tipping out as the pellet comes off easily.
10. We usually incubate in a water bath.
11. The total volume needs to be 2 mL if using TLS-55 rotor:
1.5 mL of 30% CsCl and 0.5 mL of the sample on the top.
12. Do not centrifuge at 4 C as it can cause CsCl to precipitate and
therefore cause rotor balance issue. Also, if using balance tube,
then make it with CsCl and not just water.
13. Wash the syringe with buffer containing Tris and 0.2% DDM
between fractions.
14. We use thick walled tubes and we add 750 μL of sample in
each tube.
15. Pellets from all fractions can be analyzed on SDS-PAGE.
16. Carbon side is darker and shinier.
17. Complete drying of grids before staining will cause staining
artifacts.
18. Use the same buffer for blanking the NanoDrop.
19. Always prepare BS3 immediately before usage. Since BS3
cross-linker links amines, no amine containing chemicals
should be included in the solution (e.g., no Tris).
20. Make highly concentrated iodoacetamide stock solution
(~1 M) so that only small volume needs to be added to the
sample.
21. When using Zip-Tip ensure no bubbles are created in the resin,
and the resin is not dried up during the procedure.
Acknowledgments
This work was supported by the Australian Government Depart-

ment of Industry, Innovation and Science Grant ID 20080108, the
National Health and Medical Research Council Grant ID
1123866.
References
1. Sato K, Naito M, Yukitake H et al (2010) A 9. Lasica AM, Goulas T, Mizgalska D et al (2016)
protein secretion system linked to bacteroidete Structural and functional probing of PorZ, an
gliding motility and pathogenesis. Proc Natl essential bacterial surface component of the
Acad Sci U S A 107(1):276–281 type-IX secretion system of human oral-
2. Lasica AM, Ksiazek M, Madej M et al (2017) microbiomic Porphyromonas gingivalis. Sci
The type IX secretion system (T9SS): high- Rep 6:37708
lights and recent insights into its structure 10. Heath JE, Seers CA, Veith PD et al (2016)
and function. Front Cell Infect Microbiol PG1058 is a novel multidomain protein com-
7:215 ponent of the bacterial type IX secretion sys-
3. Veith PD, Glew MD, Gorasia DG et al (2017) tem. PLoS One 11(10):e0164313
Type IX secretion: the generation of bacterial 11. Saiki K, Konishi K (2010) Identification of a
cell surface coatings involved in virulence, glid- novel Porphyromonas gingivalis outer mem-
ing motility and the degradation of complex brane protein, PG534, required for the pro-
biopolymers. Mol Microbiol 106(1):35–53 duction of active gingipains. FEMS Microbiol
4. Seers CA, Slakeski N, Veith PD et al (2006) Lett 310(2):168–174
The RgpB C-terminal domain has a role in 12. Naito M, Tominaga T, Shoji M et al (2019)
attachment of RgpB to the outer membrane PGN_0297 is an essential component of the
and belongs to a novel C-terminal-domain type IX secretion system (T9SS) in Porphyromo-
family found in Porphyromonas gingivalis. J nas gingivalis: Tn-seq analysis for exhaustive
Bacteriol 188(17):6376–6386 identification of T9SS-related genes. Microbiol
5. Veith PD, Nor Muhammad NA, Dashper SG Immunol 63(1):11–20
et al (2013) Protein substrates of a novel secre- 13. Kadowaki T, Yukitake H, Naito M et al (2016)
tion system are numerous in the Bacteroidetes A two-component system regulates gene
phylum and have in common a cleavable expression of the type IX secretion component
C-terminal secretion signal, extensive post- proteins via an ECF sigma factor. Sci Rep
translational modification, and cell-surface 6:23288
attachment. J Proteome Res 12 14. Lauber F, Deme JC, Lea SM et al (2018) Type
(10):4449–4461 9 secretion system structures reveal a new pro-
6. Shoji M, Sato K, Yukitake H et al (2011) Por tein transport mechanism. Nature 564
secretion system-dependent secretion and gly- (7734):77–82
cosylation of Porphyromonas gingivalis hemin- 15. Marlovits TC, Kubori T, Sukhan A et al (2004)
binding protein 35. PLoS One 6(6):e21372 Structural insights into the assembly of the type
7. Glew MD, Veith PD, Peng B et al (2012) III secretion needle complex. Science 306
PG0026 is the C-terminal signal peptidase of (5698):1040–1042
a novel secretion system of Porphyromonas gin- 16. Gorasia DG, Veith PD, Hanssen EG et al
givalis. J Biol Chem 287(29):24605–24617 (2016) Structural insights into the PorK and
8. Gorasia DG, Veith PD, Chen D et al (2015) PorN components of the Porphyromonas gingi-
Porphyromonas gingivalis type IX secretion valis type IX secretion system. PLoS Pathog 12
substrates are cleaved and modified by a (8):e1005820
sortase-like mechanism. PLoS Pathog 11(9):
e1005152
Chapter 12
Methods for Functional Characterization of the Type IX

Secretion System of Porphyromonas gingivalis
Keiko Sato
Abstract
The type IX secretion system (T9SS) is a protein secretion system for gingipain proteases and is found on
the cell surface of Porphyromonas gingivalis. Proteins secreted by T9SS contain a signal peptide, functional
domains, an immunoglobulin (Ig)-like domain, and a C-terminal domain (CTD). Thirty genes on the P.
gingivalis chromosome encode proteins that possess the CTD, which is important for T9SS-mediated
translocation to the cell surface across the outer membrane. In T9SS mutant strains, proteins accumulate as
precursors in the cell and therefore exhibit a phenotype similar to that of secreted protein-deficient mutants.
Black pigment productivity and hemagglutination are phenotypic features of P. gingivalis associated with
the activity of gingipains. In P. gingivalis T9SS mutants, unprocessed gingipains with high molecular
weights accumulate in the cell, and colony pigmentation and hemagglutination are not observed in the
same phenotype as a gingipain null mutant.
Key words Type IX secretion system (T9SS), Protein secretion, Virulence factors, Gingipain, Bacter-
oidetes phylum
1 Introduction
Porphyromonas gingivalis is a major pathogen that causes periodon-

tal disease and possesses a number of virulence factors, including
hemagglutinins, lipopolysaccharides and proteases called gingi-
pains. The type IX secretion system (T9SS) is a protein secretion
system for gingipains. In P. gingivalis, cell surface proteins of the
C-terminal domain (CTD) family, which includes gingipains,
metallocarboxypeptidase CPG70, TapA, HBP35, PepK, and bacte-
rial peptidylarginine deaminase, are secreted by the T9SS [1–
6]. Tannerella forsythia, Prevotella intermedia, and Prevotella mel-
aninogenica are human pathogens that also use the T9SS to secrete
virulence factors to these cell surface [7, 8]. The 30, 30, 54, and
30 genes encoding CTD-containing proteins are found on the
chromosome of P. gingivalis, T. forsythia, P. intermedia, and
P. melaninogenica, respectively. The T9SS is also a part of the
123
124 Keiko Sato
motility machinery found in many gliding bacteria of the Bacter-

oidetes phylum [9, 10].
The T9SS includes the PorK, PorL, PorM, PorN, PorP, PorQ,
PorT, PorU, PorV, PorW, PorZ, Sov, PGN_0297, PGN_1296, and
PGN_1437 proteins with regulatory proteins PorX, PorY, and SigP
[11–16]. T9SS-deficient P. gingivalis mutants accumulate unpro-
cessed, high molecular weight gingipains in the periplasmic space
and have significantly reduced gingipain proteolytic activity.
Three separate genes on the chromosome encode for gingi-
pains. The rgpA and rgpB genes encode the Arg-specific cysteine
proteases RgpA and RgpB, respectively, while kgp encodes the
Lys-specific cysteine protease Kgp.
Wild-type P. gingivalis strains form black-pigmented colonies,
which is caused by the accumulation of oxidized heme on the cell
surface [17, 18]. Because gingipains function in processing the
release of heme from hemoglobin and the synthesis of the oxidized
form of heme, Kgp-null mutants exhibit reduced pigmentation and
Kgp/Rgp-null mutants show no pigmentation [19, 20].
The hemagglutinin/adhesin (HA) regions of gingipains are
proteolytically processed into three or four putative HA domains
(Kgp is processed to Kgp39, Kgp15, and Kgp44, and RgpA is
processed to Rgp44, Rgp15, Rgp17, and Rgp27) in the outer
membrane. Rgp44 and Kgp39 possess hemagglutinating activity.
In this chapter, we provide a detailed protocol for functional
characterization of the Type IX secretion system focused on func-
tion and localization of gingipains of Porphyromonas gingivalis.
2 Materials
2.1 A T9SS-Deficient 1. P. gingivalis ATCC 33277.

Mutant of P. gingivalis 2. Ap-LB agar: For the selection of ampicillin-resistant Escherichia
coli strains, add ampicillin to the molten agar at the concentra-
tion of 100 μg/mL.
3. Tryptic soy broth supplemented with 5 mg/mL hemin (TSH):
Add about 10 mL of 0.1 M NaOH to a glass bottle. Weigh
50 mg of hemin and transfer to the bottle. Completely dissolve
hemin, and make up to 100 mL with water (0.5 mg/mL hemin
at final concentration). Sterilize by autoclaving. Dissolve 3.7 g
of tryptic soy broth in 100 mL of water and sterilize by auto-
claving. After cooling to room temperature, add 1 mL of
0.5 mg/mL hemin to the broth. Store it anaerobically.
4. TSH agar plate: Dissolve 4.0 g of tryptic soy agar in 100 mL of
water and sterilize by autoclaving. After cooling to 45–50 C,
add 1 mL of 0.5 mg/mL hemin to the molten agar.
Functional Characterization of T9SS of P. gingivalis 125
5. Blood agar plate: Dissolve 4.0 g of tryptic soy agar in 100 mL

of water and sterilize by autoclaving. After cooling to
45–50 C, add 1 mL of 0.5 mg/mL hemin and 5 mL of rabbit
blood to the molten agar. For the selection and maintenance of
erythromycin-resistant P. gingivalis strain, add erythromycin to
the molten agar at a concentration of 10 μg/mL. Store it
anaerobically.
6. Anaerobic incubator: Consist of 10% CO2, 10% H2, and 80%
N 2.
7. 0.3 M sucrose solution: Dissolve 10.3 g of sucrose (3 M at final
concentration) in 100 mL of water. Sterilize by the a filter
(0.22 μm).
8. Advantage-HF 2 PCR kit (Takara Bio): A high-fidelity PCR kit.
9. pGEM-T Easy (Promega): A cloning plasmid vector which
linearized with a single 30 -terminal thymidine at both ends.
10. pBlueScript II SK(): A cloning plasmid vector.
11. Chloramphenicol-resistant cassette (cat): Cloned from
pACYC184 [19].
12. β-Lactam-resistant cassette (cepA): Cloned from pSC22 [21].
13. Tetracycline-resistant cassette (tetQ): Cloned from
pT-COW [22].
14. Erythromycin-resistant cassette (ermF): Cloned from
pVA2198 [23].
15. Restriction enzymes: KpnI, BamHI, and NotI.
16. Electroporator.
17. Cuvette.
2.2 T9SS 1. Porphyromonas gulae VPB3492.

Complemented Strains 2. Freeze Throw Buffer (FTB): 10 mM PIPES, 15 mM CaCl2,
of P. gingivalis 250 mM KCl, 55 mM MnCl2. Dissolve 0.6 g of PIPES, 0.44 g
of CaCl2∙2H2O, 3.72 g of KCl in 190 mL of water. Adjust pH
between 6.7 and 6.8 using KOH. After adding 2.18 g of
MnCl2.4H2O, make up to 200 mL with water. Sterilize by
the filter (0.22 μm).
3. Competent cells of E. coli S17-1: Culture E. coli S17-1 (ΔrecA,
endA1, hsdR17, supE44, thi-1, tra +) [24] in LB broth. Collect
the E. coli S17-1 cells by centrifugation at 1000 g for 10 min
at 4 C. Suspend the bacterial pellet in FTB and cenrifuge
again. Suspend the cells in FTB, and store aliquots at 80 C.
4. Recipient strain: P. gingivalis ATCC 33277.
5. LB broth.
6. Ap-LB broth.
7. TSH (see item 3 in Subheading 2.1).
126 Keiko Sato
8. TSH agar plate: For maintenance of tetracycline-resistant

P. gingivalis strain, add tetracycline to the molten agar at a
concentration of 1 μg/mL (see item 4 in Subheading 2.1).
9. Blood agar plate: For the selection of P. gingivalis from the
mixture of E. coli and P. gingivalis, add gentamicin to the
molten agar at a concentration of 100 μg/mL. For the selec-
tion and maintenance of tetracycline-resistant P. gingivalis
strain, add tetracycline to the molten agar at a concentration
of 1 μg/mL (see item 5 in Subheading 2.1).
10. Anaerobic incubator (see item 6 in Subheading 2.1).
11. Advantage-HF 2 PCR kit (see item 8 in Subheading 2.1).
12. pGEM-T Easy (see item 9 in Subheading 2.1).
13. pBluesript II SK() (see item 10 in Subheading 2.1).
14. Restriction enzymes: KpnI, BamHI, BglII, and NotI.
15. pTCB: Bacteroides–E. coli shuttle vector.
2.3 Colony 1. Blood agar plate: Blood agar plate (see item 5 in Subheading
Pigmentation 2.1) without antibiotics.
2.4 Analysis of 1. Phosphate-buffered saline (PBS), pH 7.4 containing 0.1 mM

Progingipains Na-p-tosyl-L-lysine chloromethyl ketone (TLCK) and 0.1 mM
leupeptin, 0.5 mM EDTA, pH 8.0, 25 μg/mL DNase I, and
25 μg/mL RNase A.
2. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis
(SDS-PAGE): 25 mM Tris base, 192 mM glycine, 0.1% SDS.
3. Western blot transfer buffer: 0.02 M Tris–HCl, 0.15 M glycine,
20% methanol.
4. Polyvinylidene fluoride (PVDF) membrane.
5. XCell II™ Blot Module (Thermo Fisher Scientific): A wet
transfer device.
6. Tris-buffered saline (TBS): 0.15 M NaCl, 20 mM Tris–HCl,
pH 7.4.
7. TBS containing 0.5% Tween 20 and 5% skim milk.
8. TBS containing 0.5% Tween 20 and 1% skim milk.
9. Polyclonal antisera against RgpB and Kgp (see Note 1).
10. Swine anti-rabbit immunoglobulins/HRP (DAKO).
11. Goat anti-mouse immunoglobulins immunoglobulins/HRP
(DAKO).
12. Western blotting detection kit.
2.5 Hemaggluti- 1. P. gingivalis strains.

nation Test 2. TSH (see item 3 in Subheading 2.1).
3. PBS, pH 7.4.
4. Defibrinated sheep blood.
5. Round bottom microtiter 96-well plate.
2.6 Subcellular 1. P. gingivalis strains.

Fractionation 2. TSH (see item 3 in Subheading 2.1).
3. PBS, pH 7.4 containing 0.1 mM TLCK, 0.1 mM leupeptin,
0.5 mM EDTA, 25 μg/mL DNase I and 25 μg/mL RNase A.
4. French pressure cell.
5. Centrifugation.
6. Ultracentrifugation.
7. 1% Triton X-100 in PBS containing 20 mM MgCl2.
8. Two-dimensional (2D) gel electrophoresis: first dimensional
isoelectric focusing, IEF) and second dimension (SDS-PAGE)
electrophoreses. Buffers, IEF strips and SDS-PAGE gels, and
devises (see Note 2).
9. Coomassie Brilliant Blue R250 (CBB).
2.7 Analysis of the 1. P. gingivalis strains.

Supernatant Protein 2. TSH (see item 3 in Subheading 2.1).
3. Ultracentrifugation.
4. PBS, pH 7.4 containing 0.1 mM TLCK, 0.1 mM leupeptin,
0.5 mM EDTA pH 8.0, 25 μg/mL DNase I and 25 μg/mL
RNase A.
5. 10% Trichloroacetic acid (TCA). 10% (w/v) aqueous solution.
6. Diethyl ether, chilled.
7. Cell lysis solution: 7 M urea, 2 M thiourea, 4% CHAPS, 1 mM
EDTA pH 8.0 and 5 mM tributyl phosphine.
8. 2D gel electrophoresis (see item 8 in Subheading 2.6).
9. CBB.
3 Methods
3.1 Construction of a 1. PCR-amplify DNA regions upstream and downstream of a

T9SS Deficient Mutant gene from the chromosomal DNA of P. gingivalis ATCC
of P. gingivalis 33277 using primer pairs (PGN gene number-U-F-KpnI plus
PGN gene number-U-R and PGN gene number-D-F plus
3.1.1 Construction of PGN gene number-D-R-NotI), where “U” indicates upstream,
Targeting Vector Plasmid “F” indicates forward, “D” indicates downstream, and “R”
indicates reverse (see Note 3).
128 Keiko Sato
2. Double-digest the amplified DNA fragments upstream of each

gene with KpnI plus a corresponding restriction enzyme
(BamHI or BglII). Digest the DNA fragments downstream of
each gene with NotI plus a corresponding restriction enzyme
(BamHI or BglII). Ligate both digested products into a pBlue-
script II SK() vector that has been digested with NotI and
KpnI to yield pMG01.
3. Insert the antibiotic resistance DNA fragment into the BamHI
or BglII site of pMG01 to yield pMG02 for mutagenesis.
4. Digest the plasmids with NotI (or KpnI) to linearize (see Note
4).
3.1.2 Construction of a P. 1. Culture P. gingivalis ATCC 33277 in 2 mL of TSH broth for

gingivalis Drug Resistant 12 h in anaerobic incubator, then add 10 mL of fresh TSH
Mutant Strain broth to the culture, and culture anaerobically for 3 h.
3. Suspend the bacteria in the 10 mL of the 0.3 M sucrose
solution.
5. Resuspend the bacteria in the 1 mL of the 0.3 M sucrose
solution.
6. Mix pMG02 into 400 μL of washed P. gingivalis in a cuvette.
7. Store for 5 min on ice.
8. Electroporation (Pulse once at 2.5 kV).
9. Culture the bacteria in 3 mL of TSH broth overnight.
10. Seed on blood agar medium containing antibiotics.
11. Culture for 5–8 days under anaerobic conditions to form non-
pigmented colonies.
3.1.3 Construction of a P. 1. For the construction of quadruple mutants, multiple mutants

gingivalis Multidrug- can be easily obtained by adding drug resistance mutations in
Resistant Mutant Strain the order of the chloramphenicol-resistant cassette (cat), beta-
lactam-resistant cassette (cepA), tetracycline-resistant cassette
(tetQ), and erythromycin-resistant cassette (ermF).
3.2 Construction of a 1. PCR-amplify the promoter region of the P. gulae catalase gene
T9SS Complemented (accession number AB083039) from P. gulae VPB3492 chro-
Strain of P. gingivalis mosomal DNA using primer pairs (Pgu- F-KpnI and Pgu-R-
BamHI) (see Note 5).
3.2.1 Construction of
Targeting Vector Plasmid 2. Digest the amplified DNA with KpnI plus BamHI and insert
into the corresponding restriction enzyme region of a pTCB to
yield pCG001.
3. PCR-amplify the entire T9SS gene region from the
chromosomal DNA.
4. Digest the amplified DNA with BamHI plus NotI and insert
into the corresponding restriction enzyme region of pCG001
to yield pCG02.
3.2.2 Introduction of the 1. Mix pCG02 (usually 100 ng) into 100 μL of competent E. coli
Targeting Vector Plasmid S17-1 in a tube.
into E. coli 2. Incubate the mixture on ice for 10 min.
3. Heat shock the mixture at 42 C for 60 s.
4. Put the tubes back on ice for 2 min.
5. Plate all of the culture onto Ap-LB agar.
6. Incubate plates at 37 C overnight.
3.2.3 Conjugative 1. Culture E. coli S17-1 retaining the plasmid in 3 mL of Ap-LB

Transfer broth for 12 h. Culture 400 μL of this solution in 20 mL of
fresh LB broth without antibiotics for 3 h.
2. Culture P. gingivalis T9SS deficient mutant in 2 mL of TSH
broth for 12 h in anaerobic incubator, then add 10 mL of fresh
TSH broth to the culture, and culture anaerobically for 3 h.
3. Mix the cultures of 20 mL of plasmid-retained E. coli S17-1 and
10 mL of the P. gingivalis mutant.
5. Spot the concentrated mixture on TSH agar plate, culture at
37 C for 30 min under aerobic conditions, and then coculture
for 12 h under anaerobic conditions (see Note 6).
6. Suspend the bacteria in the TSH broth, and seed on blood agar
medium containing 100 μg/mL gentamicin and 5 μg/mL
tetracycline.
7. Culture for 5–8 days under anaerobic conditions to form black-
pigmented colonies.
3.3 Colony Wild-type P. gingivalis strains form black-pigmented colonies,

Pigmentation whereas the T9SS mutants exhibit no pigmentation on blood agar
plates.
1. Streak the bacteria on blood agar medium.
2. Culture for 5–7 days under anaerobic conditions.
3. Determine the colony pigmentation; black or white colony.
3.4 Analysis of T9SS-deficient P. gingivalis mutants accumulate unprocessed, high

Progingipains molecular weight gingipains and have significantly reduced gingi-
pain proteolytic activity.
1. Culture P. gingivalis in TSH medium anaerobically overnight,
and harvest by centrifugation.
130 Keiko Sato
2. Resuspend the cells in PBS containing 0.1 mM TLCK, 0.1 mM

leupeptin, 0.5 mM EDTA, pH 8.0, 25 μg/mL DNase I, and
25 μg/mL RNase A.
3. Separate proteins by SDS-PAGE analysis.
4. Transfer proteins onto PVDF membranes in the western blot
transfer buffer using XCell II™ Blot Module.
5. Block the membrane in TBS containing 0.5% Tween 20 and 5%
skim milk for 1 h at room temperature.
6. Incubate the membrane with polyclonal antisera against RgpB
or Kgp as primary antibodies in TBS containing 0.5% Tween
20 and 5% skim milk.
7. Wash the membrane three times with TBS containing 0.5%
Tween 20 and 1% skim milk, 5 min each.
8. Incubate the membrane with the swine anti-rabbit or goat anti-
mouse immunoglobulins/HRP in TBS containing 0.5%
Tween 20 and 5% skim milk.
9. Wash the membrane three times with TBS containing 0.5%
Tween 20 and 1% skim milk, 5 min each.
10. Develop the membrane with a Western blotting detection kit
according to the manufacturer’s instructions.
3.5 Hemaggluti- Wild-type P. gingivalis strains aggregate with erythrocytes, whereas

nation Test the T9SS mutants exhibit no hemagglutination.
1. Culture P. gingivalis in TSH medium anaerobically overnight.
2. Harvest the bacteria by centrifugation at 1500 g for 20 min
at 20 C, and discard the supernatant.
3. Wash the bacterial cells with PBS and resuspend them to optical
density (OD) at 550 nm wave length of 0.4 with PBS.
4. Harvest defibrinated sheep blood by centrifugation at 400 g
for 5 min, and discard the supernatant.
5. Add the sheep erythrocyte to PBS, centrifuge at 400 g for
5 min, and discard the supernatant. This step is repeated 2–3
times.
6. Add PBS to give a 2% (v/v) solution of erythrocytes.
7. Prepare twofold dilution series with the bacterial cells in a
round bottom 96-well plate (100 μL/well).
8. Add 100 μL of the 2% erythrocyte solution to each well.
9. Incubate the plate at room temperature for 3 h.
10. Determine the lowest concentration of bacteria that show
visible hemagglutination.
3.6 Subcellular Separation of the inner and outer membrane proteins of

Fractionation P. gingivalis. Subcellular fractionation of P. gingivalis cells is per-
formed, as described previously [25].
1. Harvest P. gingivalis cells from a 200-mL culture by centrifu-
gation at 10,000 g for 30 min at 4 C.
2. Resuspend the cells in 100 mL of PBS containing 0.1 mM
TLCK, 0.1 mM leupeptin, 0.5 mM EDTA, 25 μg/mL DNa-
se I, and 25 μg/mL RNase A.
3. Disrupt cells using a French pressure cell with two passes at
100 MPa.
4. To remove the remaining intact bacterial cells, centrifuge at
2400 g for 10 min at 4 C.
5. Ultracentrifuge the supernatant at 100,000 g for 60 min.
6. Treat the pellets with 1% Triton X-100 in PBS containing
20 mM MgCl2 for 30 min at 20 C to solubilize the cytoplas-
mic membrane.
7. Recover the outer membrane fraction as a precipitate by ultra-
centrifugation at 100,000 g for 60 min at 4 C. The super-
natant containing the cytoplasmic membrane fraction is
retained.
8. Apply to 2D electrophoresis analysis.
9. Detect all major proteins by CBB and specific proteins by
Western blotting.
3.7 Analysis of the Most of the secreted proteins are anchored to the cell surface, but
Supernatant Protein some are released into the culture supernatant. Because gingipains
are responsible for the processing/maturation of P. gingivalis
secreted proteins, including hemagglutinins and pili, it is preferable
to use a mutant strain based on a gingipain null mutant. Particle-
free culture supernatant and vesicle fractions are obtained, as
described previously [26].
1. Centrifuge P. gingivalis cell cultures at 6000 g for 30 min
and 4 C, and harvest the culture supernatant.
2. To remove vesicles, ultracentrifuge the culture supernatant at
100,000 g for 60 min at 4 C, and harvest the particle-free
culture supernatant.
3. Precipitate the proteins in this fraction with 10% TCA at 4 C,
and harvest the precipitated proteins by centrifugation at 4 C
for 20 min.
4. Wash the pellet three times with cold diethyl ether.
5. Suspend the pellet in cell lysis solution.
6. Apply to 2D electrophoresis analysis (see step 8 in Subheading
3.6).
132 Keiko Sato
7. Stain the gel with CBB.

8. Protein identification of proteins by peptide-mass
fingerprinting.
4 Notes
1. Polyclonal antisera against RgpB and Kgp were prepared by

immunizing rabbits with peptides derived from the amino acid
sequences E361RNITTEDKWLGQAL375 and W705DAPSAK-
KAEASRE718, respectively [27].
2. 2D gel electrophoresis is performed by a general protocol [1].
3. Homologous recombination requires the insertion of
300–500 bp of upstream and downstream regions of the target
gene into the target plasmid.
4. Double recombination resulted in deletion of the target gene
and acquisition of antibiotic-resistance.
5. The promoter region of the P. gulae catalase gene works in
E. coli and P. gingivalis.
6. Transfer of plasmids between bacteria by conjugative transfer
requires cell contact and DNA metabolism between donor and
recipient cells. When E. coli and P. gingivalis are cocultured on
an agar plate, the bacterial pellet forms a spot in one place
instead of seeding.
References
1. Sato K, Yukitake H, Narita Y et al (2013) Iden- translational modification, and cell-surface

tification of Porphyromonas gingivalis proteins attachment. J Proteome Res 12:4449–4461
secreted by the Por secretion system. FEMS 6. Seers CA, Slakeski N, Veith PD et al (2006)
Microbiol Lett 338:68–76 The RgpB C-terminal domain has a role in
2. Kondo Y, Ohara N, Sato K et al (2010) Tetra- attachment of RgpB to the outer membrane
tricopeptide repeat protein-associated proteins and belongs to a novel C-terminal-domain
contribute to the virulence of Porphyromonas family found in Porphyromonas gingivalis. J
gingivalis. Infect Immun 78:2846–2856 Bacteriol 188:6376–6386
3. Shoji M, Sato K, Yukitake H et al (2011) Por 7. Narita Y, Sato K, Yukitake H et al (2014) Lack
secretion system-dependent secretion and gly- of a surface layer in Tannerella forsythia
cosylation of Porphyromonas gingivalis hemin- mutants deficient in the type IX secretion sys-
binding protein 35. PLoS One 6:e21372 tem. Microbiology 160:2295–2303
4. Nonaka M, Shoji M, Kadowaki T et al (2014) 8. Kondo Y, Sato K, Nagano K et al (2018)
Analysis of a Lys-specific serine endopeptidase Involvement of PorK, a component of the
secreted via the type IX secretion system in type IX secretion system, in Prevotella melani-
Porphyromonas gingivalis. FEMS Microbiol nogenica pathogenicity. Microbiol Immunol
Lett 354:60–68 62:554–566
5. Veith PD, Nor Muhammad NA, Dashper SG 9. McBride MJ, Zhu Y (2013) Gliding motility
et al (2013) Protein substrates of a novel secre- and Por secretion system genes are widespread
tion system are numerous in the Bacteroidetes among members of the phylum Bacteroidetes. J
phylum and have in common a cleavable Bacteriol 195:270–278
C-terminal secretion signal, extensive post-
10. Nakane D, Sato K, Wada H et al (2013) Helical combination of rgpA, rgpB, kgp, and hagA. J
flow of surface protein required for bacterial Biol Chem 274:17955–17960
gliding motility. Proc Natl Acad Sci U S A 20. Okamoto K, Nakayama K, Kadowaki T et al
110:11145–11150 (1998) Involvement of a lysine-specific cysteine
11. Sato K, Sakai E, Veith PD et al (2005) Identifi- proteinase in hemoglobin adsorption and heme
cation of a new membrane-associated protein accumulation by Porphyromonas gingivalis. J
that influences transport/maturation of gingi- Biol Chem 273:21225–21231
pains and adhesins of Porphyromonas gingivalis. 21. Haruyama K, Yoshimura A, Naito M et al
J Biol Chem 280:8668–8677 (2009) Identification of a gingipain-sensitive
12. Sato K, Naito M, Yukitake H et al (2010) A surface ligand of Porphyromonas gingivalis
protein secretion system linked to bacteroidete that induces Toll-like receptor 2- and
gliding motility and pathogenesis. Proc Natl 4-independent NF-κB activation in CHO
Acad Sci U S A 107:276–281 cells. Infect Immun 77:4414–4420
13. Saiki K, Konishi K (2007) Identification of a 22. Gardner RG, Russell JB, Wilson DB et al
Porphyromonas gingivalis novel protein sov (1996) Use of a modified Bacteroides-
required for the secretion of gingipains. Micro- Prevotella shuttle vector to transfer a recon-
biol Immunol 51:483–491 structed beta-1,4-D-endoglucanase gene into
14. Lasica AM, Ksiazek M, Madej M et al (2017) Bacteroides uniformis and Prevotella rumini-
The type IX secretion system (T9SS): high- cola B(1)4. Appl Environ Microbiol
lights and recent insights into its structure 62:196–202
and function. Front Cell Infect Microbiol 23. Fletcher HM, Schenkein HA, Morgan RM et al
7:215 (1995) Virulence of a Porphyromonas gingivalis
15. Veith PD, Glew MD, Gorasia DG et al (2017) W83 mutant defective in the prtH gene. Infect
Type IX secretion: the generation of bacterial Immun 63:1521–1528
cell surface coatings involved in virulence, glid- 24. Simon R, Priefer U, Puhler A (1983) A broad
ing motility and the degradation of complex host range mobilization system for in vivo
biopolymers. Mol Microbiol 106:35–53 genetic engineering: transposon mutagenesis
16. Kadowaki T, Yukitake H, Naito M et al (2016) in gram negative bacteria. Biotechnology
A two-component system regulates gene 1:784–791
expression of the type IX secretion component 25. Murakami Y, Imai M, Nakamura H et al (2002)
proteins via an ECF sigma factor. Sci Rep Separation of the outer membrane and identi-
6:23288 fication of major outer membrane proteins
17. Shah HN, Gharbia SE (1989) Lysis of erythro- from Porphyromonas gingivalis. Eur J Oral Sci
cytes by the secreted cysteine proteinase of Por- 110:157–162
phyromonas gingivalis W83. FEMS Microbiol 26. Potempa J, Pike R, Travis J (1995) The multi-
Lett 52:213–217 ple forms of trypsin-like activity present in vari-
18. Smalley JW, Silver J, Marsh PJ et al (1998) The ous strains of Porphyromonas gingivalis are due
periodontopathogen Porphyromonas gingivalis to the presence of either Arg-gingipain or
binds iron protoporphyrin IX in the mu-oxo Lys-gingipain. Infect Immun 63:1176–1182
dimeric form: an oxidative buffer and possible 27. Sato K, Kakuda S, Yukitake H et al (2018)
pathogenic mechanism. Biochem J 331 Immunoglobulin-like domains of the cargo
(Pt 3):681–685 proteins are essential for protein stability dur-
19. Shi Y, Ratnayake DB, Okamoto K et al (1999) ing secretion by the type IX secretion system.
Genetic analyses of proteolysis, hemoglobin Mol Microbiol 110:64–81
binding, and hemagglutination of Porphyromo-
nas gingivalis. Construction of mutants with a
Chapter 13
Purification of Tannerella forsythia Surface-Layer (S-Layer)

Proteins
Sreedevi Chinthamani, Prasad R. Settem, Kiyonobu Honma,
Takuma Nakajima, and Ashu Sharma
Abstract
The objective of this chapter is to provide a detailed purification protocol for the surface-layer (S-layer)
glycoproteins of the periodontal pathogen Tannerella forsythia. The procedure involves detergent based
solubilization of the bacterial S-layer followed by cesium chloride gradient centrifugation and gel perme-
ation chromatography. The protocol is suitable for the isolation of S-layer glycoproteins from T. forsythia
strains with diverse O-glycan structures, and aid in understanding the biochemical basis and the role of
protein O-glycosylation in bacterial pathogenesis.
Key words Tannerella forsythia, Surface-layer, Bacterial glycoproteins, O-glycosylation, Periodontitis
1 Introduction
Tannerella forsythia is a gram-negative periodontal pathogen impli-

cated in the development of periodontitis, an inflammatory disease
of the tooth supporting tissues that often leads to tooth loss
[1]. T. forsythia possesses a number of virulence factors, among
them the bacterium’s surface-layer proteins play critical roles in
pathogenesis [2]. Many bacterial species are covered with a crystal-
line protein lattice known as the surface layer (S-layer). S-layers are
formed naturally on the surfaces of these bacteria via the
self-assembly of proteins (glycoproteins) into symmetrical lattices,
typically with center-to-center spacings of ~10–25 nm [3]. It is
generally thought that S-layers provide bacteria selective advan-
tages in their natural habitat with different functions such as serving
as protective coats against host or environmental factors and acting
as molecular traps for biomolecules with adhesion and immunolog-
ical functions [4]. Under experimental conditions the isolated
S-layer proteins can self-assemble into porous supramolecular
materials in suspension or as nanoarrays on biomaterials. This
135
136 Sreedevi Chinthamani et al.
property has been exploited for nanobiotechnology research and

applications, such as for the delivery of drug and vaccine [5–8].
The S-layer-of T. forsythia is quite unique—to the best of our
knowledge it is the only glycosylated S-layer found in gram-
negative bacteria, and moreover it is formed by the self-assembly
of two glycosylated proteins rather than one as is usually the case in
other bacteria [9, 10]. The T. forsythia S-layer plays roles in bacte-
rial adhesion [11], biofilm formation [12], serum resistance [13],
and immunomodulation [14–16]. The T. forsythia S-layer is com-
prised of two high molecular mass proteins, TfsA (134.5 kDa) and
TfsB (152.4 kDa), which on SDS-PAGE gels migrate at apparent
masses of ~230 and 250 kDa, respectively, due to glycosylation.
TfsA and TfsB proteins are linked via Ser/Thr residues within the D
(S/T)(A/I/L/M/T/V) motif to an O-linked decasaccharide
complex [17] with a terminal nonulosonic acid (sialic acid-like)
residue. Depending on the strain, the nonulosonic acid can either
be a pseudaminic acid residue (as in ATCC 43037-type strain) or a
legionaminic acid residue (as in UB4 strain) [18]. The terminal
pseudaminic acid containing trisaccharide branch of the O-linked
glycan complex is thought to be responsible for S-layer’s immuno-
suppressive role via blocking Th17 response [15, 16]. Besides the
nonulosonic acid residues, other unique S-layer glycan sugars
present in the T. forsythia O-glycan are fucose, digitoxose, xylose,
N-acetyl mannosaminuronic acid, and N-acetyl mannosaminuro-
namide. The T. forsythia ATCC 43037 S-layer can bind
macrophage-inducible C-type lectin (MINCLE, a pathogen
recognition receptor with suggested mannose/fucose/N-acetyl
glucosamine/glucose specificity [19]), and induce pro- as well as
anti-inflammatory cytokine expression in macrophages [20].
2 Materials
Prepare all solutions using ultrapure water (prepared by purifying

deionized water, to attain a sensitivity of 18 MΩ cm at 25 C) and
analytical grade reagents. Prepare and store all reagents at 4 C
(unless indicated otherwise). Tannerella forsythia ATCC 43037
strain used in this protocol can be obtained from American Type
Culture Collection (ATCC.org) or the author A. Sharma on
request. Follow all waste disposal regulations diligently when dis-
posing of waste materials and perform bacterial manipulation under
Biosafety Level-2 regulation.
2.1 T. forsythia 1. Hemin: Dissolve 50 mg of hemin into 1 mL of 1 N sodium

Culturing hydroxide and then add 99 mL of water. Store at 4 C.
2. Vitamin K1: Dissolve 50 mg of vitamin K1 into 10 mL of 95%
ethanol. Store at 4 C protected from light.
T. forsythia Surface-layer Glycoprotein Isolation 137
3. N-Acetylmuramic acid (NAM): Dissolve 100 mg of NAM

(Sigma Chemicals) in 100 mL of water, filter (0.2 μm)-sterilize,
and store in small aliquots at 80 C.
4. Broth and agar plates: In 470 mL of water in a 2-L Erlenmeyer
flask add and dissolve 15 g of brain heart infusion broth (along
with 7.5 g of agar if preparing agar plates), 0.5 g of yeast
extract, 0.5 g of L-cysteine, 5 mL of hemin stock, and 0.1 mL
of vitamin K1 stock. Adjust pH to 7.2 and autoclave at 121 C
for 15 min. Transfer autoclaved flask to a 45 C water bath and
leave the flask in the water bath for 2–3 h to cool (see Note 1).
Then, inside a biological hood sterilely add 30 mL of room
temperature equilibrated sheep or horse blood (Gibco-BRL)
and 5 mL of NAM stock solution into the medium. Shake the
contents gently and pour the agar medium into petri dishes
(approx. 30 mL in 10 cm plates) and after the agar hardens,
turn the plates upside down and leave plates at room tempera-
ture to dry and next day wrap plates and store at 4 C. Broth
can be aliquoted into smaller fractions in appropriate sterile
containers and stored at 4 C. Plates or broth can be used
within 1 month after storage.
5. Anaerobic chamber: Set at 37 C, equilibrated with an atmo-
sphere of 85% N2, 10% H2, 5% CO2.
7. 1 mL glass cuvettes.
8. 250 mL polypropylene centrifuge bottles.
9. Centrifuge rotor for 250 mL bottles (e.g., Sorvall GSA rotor).
10. Centrifuge (e.g., Sorvall RC5).
2.2 Extraction and 1. 50 mM Tris–HCl, pH 7. 4: Dissolve 6.06 g of Tris–HCl in

Partial Purification of 800 mL of water and adjust pH to 7.4 with HCl. Make up to
T. forsythia 1 L with water.
Surface Layer 2. 2% sodium deoxycholate (NaDoc): Dissolve 2 g of NaDoc in
100 mL of 50 mM Tris–HCl, pH 7.4.
3. High-speed refrigerated centrifuge (e.g., Sorvall RC5).
4. Centrifuge rotor (e.g., Sorvall SS-34).
5. Centrifuge tubes: Polypropylene 50 mL, 29 103 mm.
6. 50% Cesium chloride (CsCl): 50% solution in 50 mM Tris–
HCl, pH 7.4.
7. Ultracentrifuge bottles and tubes: Beckman polycarbonate
355618 (26.3 mL, 25 89 mm) bottles with cap assembly
and Beckman-Coulter Quick-Seal 342413 (16 76 mm)
tubes with metal spacers.
8. Ultracentrifuge tube sealer: Beckman-Coulter 342420 Tube
Sealer.
9. Ultracentrifuge rotors: Beckman 70Ti and Beckman 75Ti.

10. Ultracentrifuge (e.g., Beckman-Coulter Optima XE-90).
11. Syringe needles: 13, 22, and 26 G.
12. 3-mL insulin syringe.
2.3 Size Exclusion 1. 0.5 M ethylenediaminetetraacetic acid (EDTA): Add 18.6 g of

Chromatography disodium ethylenediaminetetraacetate dihydrate into 80 mL of
water and bring the pH to 8.0 by adding NaOH pellets (appx.
2 g). Once the solution becomes clear, bring the volume to
100 mL and autoclave the solution at liquid cycle.
2. 1 M DL-dithiothreitol (DTT): Dissolve 1.5 g of DTT in 8 mL
of deionized or distilled H2O. Adjust volume to 10 mL, dis-
pense into 1-mL aliquots, and store in the dark at 20 C.
3. Chromatography buffer (CB): 50 mM ethanolamine, 8 M
urea, 0.15 M NaCl, 2 mM EDTA, and 5 mM DTT. Add
3.1 mL of ethanolamine into 750 mL of water followed by
addition of 480.48 g of urea and 8.77 g of NaCl. Once the urea
and NaCl are completely dissolved, add 4 mL of 0.5 M EDTA
and 5 mL of 1 M DTT, adjust the pH to 9.6 with HCl and
bring the final volume to 1 L with water.
4. Chromatography column: size: 50 1.0 cm I.D., Vt ¼ 39 mL.
5. Resin: Sephacryl S-200 HR (GE Health Sciences).
6. Reducing sodium dodecyl sulfate–polyacrylamide gel electro-
phoresis (SDS-PAGE).
7. Coomassie Brilliant Blue R-250 stain.
8. Glycoprotein specific stain (Pierce GelCode Glycoprotein
Staining Kit; Thermo Fisher Scientific).
9. Dialysis tubing: molecular weight cutoff (MWCO) 10,000 Da.
10. 20 mM ammonium bicarbonate buffer: Dissolve 1.58 g of
NH4HCO3 in 1 L of water. The pH should be between 8.2
and 8.5.
3 Methods
3.1 T. forsythia 1. Inoculation, growth and bacteria harvesting. Streak an agar

Culturing plate with a glycerol stock of T. forsythia cells and incubate
the plate at 37 C in the anaerobic chamber (see Note 2). It
may take 4–5 days for colonies to appear. With the help of a
sterile bacterial loop transfer a loopful of colonies from the
plate into a culture medium (10 mL) dispensed in a screwcap
glass tube; rub the loop on the walls of the tube to dislodge and
suspend the colonies into the medium (see Note 3). Incubate
the tube at 37 C in the anaerobic chamber. When the culture
reaches an absorbance at 600 nm of 0.6 (it may take 2–3 days)

(see Note 4), transfer the bacterial suspension into 500 mL of
fresh broth and incubate for 5 days in the anaerobic chamber at
37 C as above. At the end of the incubation the bacterial
suspension should reach at least an absorbance of 1.0. Pellet
bacterial suspension by centrifugation at 8000 g for 10 min
at 4 C.
3.2 Extraction and 1. Wash the T. forsythia cell pellet three times with 50 mM Tris–
Partial Purification of HCl, pH 7. 4. Pellet cells each time by centrifugation at
T. forsythia 8000 g for 10 min at 4 C.
Surface Layer 2. Resuspend the cell pellet in 30 mL of 2% NaDoc and stir for 3 h
at 4 C.
3. Centrifuge the bacterial suspension at 12,000 g for 15 min at
4 C and save the supernatant (extract) in an appropriate
container.
4. Resuspend the cell debris in 15 mL of ice-cold 50 mM Tris–
HCl, pH 7. 4 and stir for 10 min in the cold room (6–8 C).
Centrifuge the suspension at 12,000 g for 10 min at 4 C,
collect the supernatant (cell debris wash) and pool it with the
extract saved above.
5. Centrifuge the pooled solution (extract + cell debris wash) at
80,000 g for 1 h at 4 C and resuspend the pellet in 20 mL of
50% CsCl.
6. Transfer the CsCl suspension into the Quick-Seal tubes using a
syringe with a 13-G or smaller needle. A small air bubble no
larger than 3 mm can be left in the tube neck. Leaving a larger
air space can cause deformation or collapsing of tube during
centrifugation. Heat seal tubes using the Beckman-Coulter
tube sealer as per the instructions provided in the manual.
Prior to sealing, make sure that the tube neck is dry. After
sealing, place tubes in the ultracentrifuge rotor and place
metal spacers over each tube.
7. Centrifuge the tubes at 100,000 g for 18 h with breaks set to
the OFF setting to prevent dispersion of protein bands during
stoppage of the run.
8. After centrifugation, carefully remove each tube and look for
two translucent white protein bands. The second band from
the top contains the S-layer fraction (Fig. 1).
9. To remove the S-layer protein band, first insert a 26-G needle
into the top of the tube and then insert a 22-G needle attached
to a 3-mL insulin syringe just below the band of the S-layer
fraction, and carefully aspirate the protein band.
10. Transfer the contents into a fresh ultracentrifuge tube, and
centrifuge at 80,000 g for 1 h at 4 C.
Fig. 1 Protein banding after CsCl ultracentrifugation. The second band from the
top (indicated with an arrow) contains the S-layer protein faction
11. Wash the S-layer protein pellet twice in 30 mL of 50 mM Tris–

HCl, pH 7.4 by repeated resuspension and centrifugation as
above. Finally, resuspend pellet in 5 mL of 50 mM Tris–HCl,
pH 7.4 (see Note 5).
12. Centrifuge the S-layer fraction as above and store the protein
pellet at 80 C until further purification by size exclusion
chromatography.
3.3 Size Exclusion 1. Resuspend the S-layer protein pellet in 4 mL of CB. Let the
Chromatography pellet incubate and shake in the buffer for 1–2 h at 8–10 C.
2. Centrifuge the S-layer solution at 15,000 g for 15 min at
8 C to remove any insoluble material and collect the clear
supernatant.
3. Apply up to 1 mL of the clear supernatant on a chromatogra-
phy column packed with the Sephacryl S-200 HR resin and
equilibrated with CB in a cold room.
4. Elute the proteins from the column at a flow rate of
12–15 mL/h. Monitor the absorbance at 280 nm and collect
1 mL of fractions.
5. Analyze the protein fractions by reducing SDS-PAGE. Visua-
lize proteins by staining with Coomassie Brilliant Blue R-250
stain or glycoprotein specific stain (see Note 6).
6. Pool fractions containing S-layer proteins and dialyze exten-

sively against 20 mM ammonium bicarbonate buffer, lyophi-
lize, and store at 20 C.
4 Notes
1. For preparing broth or agar plates, bring the temperature of the

medium to 45 C before adding blood to avoid lysis.
2. T. forsythia is a fastidious organism and a strict anaerobe. The
quality of the horse serum and the correct composition of
anaerobic gas mix is very important to obtain optimal growth.
Prior to inoculation, broth should be well equilibrated to the
anaerobic environment.
3. Bacterial cells should be harvested from broth cultures inocu-
lated with freshly streaked plates inoculated from lower pas-
saged frozen stocks.
4. To monitor the bacterial growth, take 1 mL of culture, pellet
bacteria by centrifugation, wash cells once with water by sus-
pending and pelleting cells by centrifugation. Finally, resus-
pend cells in 1 mL of water, transfer cell suspension into a
glass cuvette and read absorbance at 600 nm.
5. The CsCl purified S-layer fraction after washing is generally
milky in appearance but this should not cause any alarm.
6. A typical separation profile of S-layer proteins on a Sephacryl-
S200 and the analysis of purified proteins by SDS-PAGE are
shown in Fig. 2.
A. B. 1 2 3 4
Vt = 40 ml
kDa
Flow rate :15 ml/h
Fraction volume = 1 ml 245
0.4
S-layer
Absorbance (280 nm)
180
Proteins
0.3
100
0.2
40
0.1
0.0
Coom Glyc
0 5 10 15 20 25 30 35 40
Fraction
Fig. 2 (a) Sephacryl S-200 chromatographic profile of S-layer fraction from cesium chloride ultracentrifuga-
tion. (b) SDS-PAGE analysis of purified S-layer fraction purified by Sephacryl S-200 chromatography. Gels
were either stained with Coomassie (Coom) or Glycostain (Gly); lanes 1 and 3 each contain 5 μg and lanes
2 and 4 each contain 10 μg of total protein
References
1. Tanner AC, Izard J (2006) Tannerella for- their cell surface mutants in multispecies oral
sythia, a periodontal pathogen entering the biofilms. Mol Oral Microbiol 32(5):404–418
genomic era. Periodontol 2000(42):88–113 13. Shimotahira N, Oogai Y, Kawada-Matsuo M
2. Sharma A (2010) Virulence mechanisms of et al (2013) The S-layer of Tannerella forsythia
Tannerella forsythia. Periodontol 2000 54 contributes to serum resistance and oral bacte-
(1):106–116 rial co-aggregation. Infect Immun 81
3. Sleytr UB, Beveridge TJ (1999) Bacterial (4):1198–1206
S-layers. Trends Microbiol 7(6):253–260 14. Sekot G, Posch G, Messner P et al (2011)
4. Sleytr UB, Schuster B, Egelseer EM et al Potential of the Tannerella forsythia S-layer to
(2014) S-layers: principles and applications. delay the immune response. J Dent Res 90
FEMS Microbiol Rev 38(5):823–864 (1):109–114
5. Sara M, Pum D, Schuster B et al (2005) 15. Settem RP, Honma K, Sharma A (2014) Neu-
S-layers as patterning elements for application trophil mobilization by surface-glycan altered
in nanobiotechnology. J Nanosci Nanotechnol th17-skewing bacteria mitigates periodontal
5(12):1939–1953 pathogen persistence and associated alveolar
6. Ucisik MH, Sleytr UB, Schuster B (2015) bone loss. PLoS One 9(9):e108030
Emulsomes meet S-layer proteins: an emerging 16. Settem RP, Honma K, Nakajima T et al (2012)
targeted drug delivery system. Curr Pharm A bacterial glycan core linked to surface (S)-
Biotechnol 16(4):392–405 layer proteins modulates host immunity
7. Sara M, Sleytr UB (2000) S-layer proteins. J through Th17 suppression. Mucosal Immunol
Bacteriol 182(4):859–868 6:415–426
8. Sleytr UB, Schuster B, Egelseer EM et al 17. Posch G, Pabst M, Brecker L et al (2011)
(2011) Nanobiotechnology with S-layer pro- Characterization and scope of S-layer protein
teins as building blocks. Prog Mol Biol Transl O-glycosylation in Tannerella forsythia. J Biol
Sci 103:277–352 Chem 286:38714–38724
9. Kerosuo E (1988) Ultrastructure of the cell 18. Friedrich V, Janesch B, Windwarder M et al
envelope of Bacteroides forsythus strain ATCC (2017) Tannerella forsythia strains display dif-
430377T. Oral Microbiol Immunol 3 ferent cell-surface nonulosonic acids: biosyn-
(3):134–137 thetic pathway characterization and first
insight into biological implications. Glycobiol-
10. Sabet M, Lee SW, Nauman RK et al (2003) ogy 27(4):342–357
The surface (S-) layer is a virulence factor of
Bacteroides forsythus. Microbiology 149 19. Richardson MB, Williams SJ (2014) MCL and
(Pt 12):3617–3627 Mincle: C-type lectin receptors that sense dam-
aged self and pathogen-associated molecular
11. Sakakibara J, Nagano K, Murakami Y et al patterns. Front Immunol 5:288
(2007) Loss of adherence ability to human
gingival epithelial cells in S-layer protein-defi- 20. Chinthamani S, Settem RP, Honma K et al
cient mutants of Tannerella forsythensis. Micro- (2017) Macrophage inducible C-type lectin
biology 153(Pt 3):866–876 (Mincle) recognizes glycosylated surface (S)-
layer of the periodontal pathogen Tannerella
12. Bloch S, Thurnheer T, Murakami Y et al (2017) forsythia. PLoS One 12(3):e0173394
Behavior of two Tannerella forsythia strains and
Chapter 14
Separation of Glycosylated OmpA-Like Proteins from

Porphyromonas gingivalis and Tannerella forsythia
Yukitaka Murakami, Keiji Nagano, and Yoshiaki Hasegawa
Abstract
OmpA-like proteins located in the outer bacterial membrane are potential virulence factors from the major
periodontal pathogens Porphyromonas gingivalis and Tannerella forsythia. Our previous studies have shown
that OmpA-like proteins are glycosylated by O-linked N-acetylglucosamine (O-GlcNAc) and are strongly
reactive to wheat germ agglutinin (WGA) lectin, which shows sugar specificity to GlcNAc. Utilizing this
property, we have developed a separation method for OmpA-like proteins by affinity chromatography using
WGA lectin-agarose. The purity of enriched native OmpA-like proteins were confirmed by sodium dodecyl
sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie Brilliant Blue (CBB) staining.
More importantly, the purified OmpA-like proteins formed a unique trimeric structure keeping their
bioactivity intact. In this chapter, we describe a detailed procedure to separate OmpA-like proteins,
which may be used to further progress the biological studies of OmpA-like proteins.
Key words Glycoproteins, OmpA-like proteins, Porphyromonas gingivalis, Tannerella forsythia,

Wheat germ agglutinin lectin, Affinity chromatography, O-linked N-acetylglucosamine
1 Introduction
A majority of people suffer from periodontal disease [1–3], which is

currently thought to be associated with several systemic diseases,
such as cardiovascular disease, diabetes, and rheumatoid arthritis
[4, 5]. The gram-negative bacteria Porphyromonas gingivalis, Tan-
nerella forsythia, and Treponema denticola are the major periodontal
pathogens, well-known as “red complex” [6]. Among them,
P. gingivalis is a keystone pathogen which leads the periodontal
community to the dysbiotic microbiota [7–9]. Virulence factors
from P. gingivalis and T. forsythia have been extensively studied
thus far. Major virulence factors reported in P. gingivalis include
the fimbriae, gingipain proteases, and lipopolysaccharide, while
those in T. forsythia include the S-layer and BspA protein [6, 10–
12]. In addition, outer membrane proteins, which locate in the
bacterial cell wall, possess potential virulence factors. Therefore, we
143
144 Yukitaka Murakami et al.
have focused on outer membrane proteins from P. gingivalis and

T. forsythia (Table 1), especially OmpA-like proteins [13–18],
which are homologous to the OmpA protein in Escherichia coli
[19–21].
The separation of virulence factors is usually a prerequisite
procedure to characterize their virulence-related properties. We
have tried to purify the native OmpA-like proteins while keeping
their bioactivity intact by using conventional gel filtration and ion
exchange chromatography after the fractionation of the
P. gingivalis and T. forsythia outer membrane. However, this
attempt was unsuccessful. We could only purify the denatured
OmpA-like proteins from the excised protein bands after staining
of sodium dodecyl sulfate–polyacrylamide gel electrophoresis
(SDS-PAGE) gel with Coomassie brilliant blue (CBB) by electro-
elution. However, the bioactivity of OmpA-like proteins purified
through this method was questionable, because outer membrane
protein materials were boiled prior to loading into the SDS-PAGE
gel. The difficulty in obtaining purified proteins has hindered the
detailed analysis of the OmpA-like proteins, such as the analyses of
their structure and their functions as porin. Therefore, we exam-
ined the biological properties of OmpA-like proteins by using
mutant strains [14, 16, 18].
Protein glycosylation is recently known to exist in both eukar-
yotes and prokaryotes [22, 23]. Several glycoproteins in periodon-
tal pathogens, such as P. gingivalis and T. forsythia, have been
studied until now. Gingipains, Mfa1 fimbriae and other proteins
were reported as glycoproteins in P. gingivalis [24–28], whereas
S-layer proteins, BspA and others were reported in T. forsythia
[29, 30]. To search for novel glycoproteins from P. gingivalis, we
performed a glycoproteomic study by combining glycoprotein
staining with two-dimensional gel electrophoresis and mass spec-
trometry. As a result, we have shown that OmpA-like proteins are
glycosylated [31]. In addition, OmpA-like proteins are shown to
have a high affinity to several lectins by lectin blot analysis, espe-
cially to wheat germ agglutinin (WGA) lectin. Furthermore,
OmpA-like proteins have an O-linked N-acetylglucosamine
(O-GlcNAc) modification, suggested being derived from the
sugar specificity of WGA lectin, shown in western blot analysis by
using an anti-O-GlcNAc antibody [32].
Next, we tried to purify OmpA-like proteins solubilized with
1% dodecyl maltoside (DDM) from the periodontal pathogen
P. gingivalis by affinity chromatography using WGA lectin-agarose.
We successfully separated OmpA-like proteins by using a one-step
chromatography procedure with preserved binding abilities to the
extracellular matrix proteins, such as fibronectin, laminin, and col-
lagen type I [32]. This separation method is also effective for
OmpA-like protein from another periodontal pathogen, that is,
T. forsythia [33]. OmpA-like proteins purified from P. gingivalis
Isolation of Glycosylated OmpA-Like Proteins from Periodontal Pathogens 145
Table 1
OmpA-like proteins from representative strains of P. gingivalis and T. forsythia
Apparent molecular
Strain Locus tag mass (kDa)
P. gingivalisa ATCC 33277 PGN_0728 40
PGN_0729 41
W50 HMPREF1322_0632 41
HMPREF1322_0633 40
b
T. forsythia ATCC 43037 Tanf_10935 40
92A2 BFO_0311 40
a
OmpA-like proteins from P. gingivalis consist of heterotrimeric structure of 40- and 41-kDa proteins [13, 14]. Identities
between PGN_0728 and HMPREF1322_0633, and those between PGN_0729 and HMPREF1322_0632 are both 99%
b
OmpA-like protein from T. forsythia consists of homodimeric or homotrimeric structure of 40-kDa protein
[18, 29]. Identities between Tanf_10935 and BFO_0311 are 100%
and T. forsythia by WGA lectin-agarose show apparent molecular

masses of about 40 kDa and 120 kDa under reducing and nonre-
ducing conditions, respectively, by SDS-PAGE (Table 1). Thus, the
trimeric form of native OmpA-like proteins is obtained by using the
WGA column [32, 33]. Since WGA lectin is popular and cost-
effective, this separation method may be applicable to OmpA-like
proteins from other gram-negative bacteria.
Here, we present a detailed method for the separation of gly-
cosylated OmpA-like proteins from representative periodontal
pathogens P. gingivalis and T. forsythia by WGA lectinaffinity chro-
matography. We think this method may be highly useful to further
study OmpA-like proteins and their biological activity.
2 Materials
Prepare all solutions using ultrapure water and analytical grade

reagents. Prepare and store all reagents at room temperature, unless
indicated otherwise. Diligently follow all waste disposal regulations
when disposing of waste materials.
2.1 Growth 1. Bacterial strains: Porphyromonas gingivalis ATCC 33277, W50;

of Bacterial Cells Tannerella forsythia ATCC 43037, 92A2.
2. Growth medium for P. gingivalis: Dissolve 6 g of trypticase soy
broth and 0.5 g of yeast extract in 197 mL of water. Autoclave
for 20 min at 121 C. Prior to bacterial inoculation add 1 mL of
hemin, 0.2 mL of menadione, and 2 mL of dithiothreitol.
3. Growth medium for T. forsythia: Dissolve 6 g of trypticase soy
broth and 0.5 g of yeast extract in 187 mL of water. Autoclave
for 20 min at 121 C. Prior to bacterial inoculation add 1 mL of
hemin, 0.2 mL of menadione, 2 mL of dithiothreitol, 0.2 mL

of N-acetyl muramic acid, and 10 mL of Fildes extract or
10 mL of fetal bovine serum.
4. Hemin stock (0.5 mg/mL): Dissolve 50 mg of hemin in 1 mL
of 1 N NaOH and add 99 mL of water. Autoclave at 121 C for
20 min. Store at 4 C.
5. Menadione stock (5 mg/mL): Dissolve 50 mg of menadione in
10 mL of 100% ethanol and filter sterilize. Store at 4 C.
6. Dithiothreitol stock (10 mg/mL): Dissolve 100 mg of dithio-
threitol in 10 mL of water and sterilize by filtration. Store at
4 C.
7. N-Acetyl muramic acid stock (10 mg/mL): Dissolve 100 mg of
N-acetyl muramic acid in 10 mL of water and sterilize by
filtration. Store at 4 C.
8. Fildes extract (Thermo Fisher Scientific).
9. Fetal bovine serum.
10. Anaerobic chamber (seeNote 1): 10% (v/v) CO2, 10% (v/v)
H2, 80% (v/v) N2 atmosphere. Anaerobox (Hirasawa Works).
11. Spectrophotometer (Shimadzu UV1240).
2.2 Preparation 1. Centrifuge and appropriate rotor (Kubota 7000 and

of Bacterial Whole-Cell A-6512C).
Lysates 2. HEPES buffer (seeNote 2): 10 mM HEPES–NaOH (pH 7.4)
containing 0.15 M NaCl.
3. Nα-p-tosyl-L-lysine chloromethyl ketone (TLCK): 10 mM
stock solution in ethanol. Store at 20 C.
4. Phenylmethyl sulfonyl fluoride (PMSF): 20 mM stock solution
in ethanol. Store at 20 C.
5. Leupeptin: 10 mM stock solution in water. Store at 20 C.
6. HEPES buffer containing protease inhibitors: 10 mM
HEPES–NaOH (pH 7.4) containing protease inhibitors
(0.1 mM TLCK, 0.2 mM PMSF, and 0.1 mM leupeptin).
7. French pressure cell press (Ohtake Works) or sonicator (Bior-
uptor UCD-300, Cosmo Bio) (seeNote 3).
2.3 Solubilization 1. DDM solution: 20% stock solution in water.

of Bacterial Whole-Cell 2. 1% DDM: Add 1 mL of DDM solution to 19 mL of 10 mM
Lysates Tris–HCl (pH 7.4) containing protease inhibitors (0.1 mM
TLCK, 0.2 mM PMSF, and 0.1 mM leupeptin).
3. Tabletop ultracentrifuge (Optima TLX, Beckman).
4. Ultracentrifuge rotor (TLA-100.2, Beckman).
5. Ultracentrifugation tube (1.5 mL).
6. Shaker or rocker.
2.4 Lectin Affinity 1. Tris buffer: 10 mM Tris–HCl (pH 7.4).

Chromatography 2. Tris buffer containing protease inhibitors: 10 mM Tris–HCl
(pH 7.4) with protease inhibitors (0.1 mM TLCK, 0.2 mM
PMSF, and 0.1 mM leupeptin).
3. WGA agarose (J-Chemicals).
4. Empty column: Poly-prep column (Bio-Rad) or Muromac
mini-column (Muromachi Chemicals).
5. Inhibitory sugar: GlcNAc.
6. Cellulose dialysis tubing: Molecular weight cut-off (MWCO)
12–14 kDa.
7. Ficoll PM400 (GE Healthcare) (seeNote 4).
8. Centrifuge filter unit (10 kDa MWCO): Amicon ultra
(Millipore).
9. Wash buffer: 20 mM Tris–HCl (pH 7.4) containing 0.15 M
NaCl and 0.03% DDM and protease inhibitors (1 μM TLCK,
2 μM PMSF, and 1 μM leupeptin).
10. Elution buffer: 20 mM Tris–HCl (pH 7.4) containing 0.15 M
NaCl, 0.03% DDM, protease inhibitors (1 μM TLCK, 2 μM
PMSF, and 1 μM leupeptin), and 0.2 M GlcNAc.
11. Spectrophotometer (Shimadzu UV1240).
2.5 SDS-PAGE 1. SDS-PAGE apparatus: Mini-PROTEAN Tetra Cell (Bio-Rad).

2. Polyacrylamide gels (seeNote 5): 12% polyacrylamide gel, 0.75-
mm thick [34, 35].
3. Electrophoresis buffer: 25 mM Tris, 192 mM glycine, 0.1%
SDS (pH 8.3).
4. SDS-buffer: Mix 2.5 mL of 0.5 M Tris–HCl (pH 6.8), 4.0 mL
of 10% SDS, 2.0 mL of glycerol, and an appropriate amount of
bromophenol blue (BPB). When needed, add 1.0 mL of
2-mercaptoethanol (2-ME) just before use.
5. Heat block.
6. Tabletop mini centrifuge.
7. Molecular marker: Precision Plus Protein Standards (Bio-Rad).
8. Molecular marker for glycoprotein (seeNote 6): CandyCane
glycoprotein molecular weight standards (Thermo Fisher
Scientific).
2.6 Detection 1. CBB R-250.

of Proteins 2. SYPRO Ruby protein gel stain (Thermo Fisher).
3. UV illuminator or gel imaging device (e.g., FluoroPhoreStar
3000 image capture system, Anatech).
4. Filters imaging for SYPRO Ruby protein gel stain: Excitation/
Emission (nm) are 280 and 450/610, respectively.
2.7 Detection 1. Pro-Q Emerald 300 Glycoprotein Gel and Blot Stain Kit
of Glycosylated (Thermo Fisher Scientific; seeNote 7).
Proteins Using 2. Pro-Q Emerald 300 solution: Prepare according to the manu-
Glycoprotein Stain facturer’s instructions.
3. Fix solution: 50% methanol and 5% acetic acid in water.
4. Wash solution: 3% glacial acetic acid in water.
5. Oxidizing solution: Prepare according to the manufacturer’s
instructions of Pro-Q Emerald 300.
6. UV illuminator or gel imaging device (e.g., FluoroPhoreStar
3000 image capture system, Anatech).
7. Filters for imaging Pro-Q Emerald 300 glycoprotein stain:
Excitation/Emission (nm) are 280/530, respectively.
2.8 Western Blotting 1. Blotting apparatus (Mini Trans-Blot Cell, Bio-Rad): Wet (tank)
system.
2. Membranes: Polyvinylidene difluoride (PVDF) or
nitrocellulose.
3. Methanol.
4. Transfer buffer (seeNote 8): Tris–Glycine transfer buffer
(25 mM Tris, 192 mM Glycine, pH 8.3, 20% methanol; [34]).
5. Filter paper.
2.8.1 Confirmation 1. TBS: 20 mM Tris–HCl (pH 7.5) containing 0.5 M NaCl.

of OmpA-Like Proteins 2. 1% bovine serum albumin (BSA)–TBS: TBS containing
Using Specific Antibody 1% BSA.
(SeeNote 9)
3. TBS-T: TBS containing 0.05% Tween 20.
4. Anti-Pgm6/7 antibody (seeNote 10): Rabbit polyclonal anti-
serum specific for the Pgm6/7 proteins (OmpA-like proteins)
from P. gingivalis ATCC 33277 [14, 15].
5. Secondary antibody: Horseradish peroxidase (HRP)-
conjugated goat anti-rabbit IgG (MP Bio Medicals).
6. 0.05% 4-chloro-1-naphtol in TBS.
7. 30% hydrogen peroxide.
2.8.2 Detection 1. BSA-TBS (seeitem 2 in Subheading 2.8.1).

of O-GlcNAc Modification 2. TBS-T (seeitem 3 in Subheading 2.8.1).
Using Anti-O-GlcNAc
3. Mouse monoclonal anti-O-GlcNAc (CTD110.6; Cell Signal-
Antibody
ing Technology).
4. Secondary antibody: HRP conjugated goat anti-mouse IgM
(Dako).
5. ECL Prime western blotting detection system (GE Healthcare
Life Sciences): A chemiluminescence detection reagent.
6. Digital imager (Light-Capture II system, Atto).
2.8.3 Confirmation 1. Tris buffer: 10 mM Tris–HCl (pH 7.4) containing

of WGA Reactivity by Lectin 0.15 M NaCl.
Blotting 2. Buffer-T: 10 mM Tris–HCl (pH 7.4) containing 0.15 M NaCl
and 0.05% Tween 20.
3. HRP-conjugated WGA lectin (Vector Laboratories or EY
Laboratories; seeNote 11): Dilute 200 times with Buffer-T.
4. Rinsing buffer: 10 mM Tris–HCl (pH 7.4) containing
0.15 M NaCl.
5. 0.05% 3,30 -diamino benzidine (DAB) in TBS.
6. 30% hydrogen peroxide.
3 Methods
3.1 Growth 1. Grow P. gingivalis in growth media under anaerobic conditions

of Anaerobic at 37 C for 48 h.
Bacterial Cells 2. Grow T. forsythia in growth media under anaerobic conditions
at 37 C for 120 h.
3. Monitor bacterial growth using a spectrophotometer by mea-
suring optical density (OD) at a wavelength of 600 nm
(OD600).
3.2 Preparation All procedures should be done at 4 C.

of Bacterial Whole-Cell
1. Harvest bacterial cells from 200 mL of culture by centrifuging
Lysates
at 10,000 g for 20 min.
2. Wash bacterial cells twice with 10 mM HEPES–NaOH
(pH 7.4) containing 0.15 M NaCl.
3. Resuspend with 20 mL of 10 mM HEPES–NaOH (pH 7.4)
containing protease inhibitors.
4. Disrupt cells in a French pressure cell press by three passes at
100 MPa, or in a sonicator repeating 30 s bursts and 30 s
intervals for 15 min.
5. Remove the remaining undisrupted bacterial cells and large
debris by centrifugation at 1000 g for 10 min.
6. Collect the supernatant as the bacterial whole-cell lysates.
3.3 Solubilization All procedures should be done at 4 C.

of Bacterial Whole-Cell
1. Solubilize the whole-cell lysates with 1% DDM for 2 h by using
Lysates
rotator or rocker.
2. Remove the insoluble materials by ultracentrifugation at
100,000 g for 1 h.
3. Collect the supernatant as the solubilized material.
3.4 Lectin Affinity All procedures should be done at 4 C.

Chromatography
1. Suspend 1 mL of settled WGA-agarose in 10 mM Tris–HCl
(SeeNote 12)
(pH 7.4) to make a slurry.
2. Pour the slurry into the column.
3. Pack 1 mL of WGA–agarose slurry to an empty mini-column
until the desired level is reached (seeNote 13).
4. Equilibrate the column with ten bed volumes of wash buffer.
5. Apply solubilized materials (about 5 mg of protein) to a
WGA-agarose column. Leave column overnight to increase
binding of glycoproteins.
6. Wash with ten bed volumes of the wash buffer.
7. Elute the bound proteins with five bed volumes of the elution
buffer (seeNote 14).
8. Transfer the eluted samples to the cellulose dialysis tubing.
9. Dialyze the eluted samples extensively against 10 mM Tris–
HCl (pH 7.4).
10. Concentrate the sample in the dialysis tubing by Ficoll PM400.
11. Recover materials from the dialysis tubing by rinsing out the
tubing with a small volume of 10 mM Tris–HCl (pH 7.4)
containing inhibitors.
12. Concentrate again using a centrifuge filter unit when needed.
13. Determine the concentration of protein samples using a spec-
trophotometer by measuring the OD at 280 nm.
3.5 SDS-PAGE 1. Mix up to three volumes of the samples from lectin affinity
chromatography (approximately 30 μg) and one volume of
SDS-buffer with 2-ME.
2. Denature the samples at 100 C for 5 min.
3. Perform SDS-PAGE under constant voltage at 100 V. Usually
run SDS-PAGE until the BPB dye front reaches the bottom.
3.6 Detection 1. Perform SDS-PAGE (see Subheading 3.5).

of Proteins 2. For protein detection, stain gels with CBB R-250 (Fig. 1) or
SYPRO Ruby protein gel stain according to the manufacturer’s
instructions. When SYPRO Ruby protein gel is used, acquire
images by UV illuminator or gel imaging device.
3.7 Detection 1. Perform SDS-PAGE (see Subheading 3.5).

of Glycosylated 2. Fix the gel with the fix solution at room temperature (RT) for
Proteins (SeeNote 15) 30 min. Wash the gel with the wash solution twice at RT for
10–20 min.
3. Oxidize the carbohydrates with the oxidizing solution at RT
for 30 min.
P. g ingivalis P. g ingivalis T. forsythia

W50 ATCC 33277 ATCC 43037
kDa M P B kDa M P B kDa M P B
250 250
250 150 150
150 100 100
100 75 75
75
50 50
50 *
37 * 37
*
37
25 25
25 20 20
20
M, molecular marker;
P, whole- cell lysates prior to loading into the WGA column;
B, proteins bound to the WGA column;
*, enriched OmpA - like proteins
Fig. 1 Example of the separation of OmpA-like proteins by WGA lectin affinity

chromatography. Whole-cell lysates from P. gingivalis W50, P. gingivalis ATCC
33277, and T. forsythia ATCC 43037 were solubilized with 1% DDM and applied
to a WGA lectin-agarose column. The bound proteins were eluted with 0.2 M
GlcNAc. The obtained fractions were dialyzed, concentrated, and subjected to
SDS-PAGE. The gels were stained with CBB R-250. Lane M, molecular marker;
Lane P, whole-cell lysates prior to loading into to the WGA column; Lane B,
proteins bound to the WGA column; *, enriched OmpA-like proteins
4. Stain the gel with the Pro-Q Emerald 300 solution at RT for
90 min in the dark.
5. Wash the gel with the wash solution twice at RT for 15 min.
6. Visualize stained glycoproteins using a UV illuminator or gel
imaging device.
3.8 Western Blotting After SDS-PAGE, transfer proteins from gels onto nitrocellulose or
PVDF membranes with the transfer buffer at 30 V overnight.
PVDF membranes should be used for the ECL detection system.
Wet PVDF membranes in methanol before performing blotting.
3.8.1 Detection 1. Block the transferred membranes with 1% BSA-TBS at RT for

of OmpA-Like Proteins 30 min.
2. Incubate the membranes with primary antibody (anti-Pgm6/7
antibody, 1:3000–1:10,000) in 1% BSA-TBS at RT for 5 h.
3. Wash the membranes with TBS-T three times at RT for 15 min
each time.
4. Incubate the membranes with secondary antibody (HRP con-
jugated goat anti-rabbit IgG, 1:3000) in 1% BSA-TBS at RT
for 5 h.
5. Wash the membranes twice with TBS-T at RT for 15 min each

time, then once with TBS at RT for 15 min.
6. Soak the membranes with 30 mL of 0.05% 4-chloro-1-naph-
thol in TBS and 15 μL of 30% hydrogen peroxide to visualize
the OmpA-like proteins.
7. Wash the membranes with water.
3.8.2 Detection 1. Block the transferred PVDF membranes with 1% BSA-TBS at

of O-GlcNAc Modification RT for 3 h.
(SeeNote 16) 2. Incubate the membranes with primary antibody (anti-O-
GlcNAc, 1:10,000) in TBS-T at 4 C, overnight.
3. Wash the membranes with TBS-T at RT, twice for 2 min each
time, once for 15 min, and then three times for 5 min
each time.
4. Incubate the membranes with secondary antibody (HRP con-
jugated anti-mouse IgM, 1:30,000) in TBS-T at RT for 3 h.
5. Wash the membranes with TBS-T at RT, twice for 2 min each
time, once for 15 min, and then three times for 5 min
each time.
6. Develop the membrane with ECL Prime western blotting
detection system according to the manufacturer’s instructions.
7. Acquire the respective image on an appropriate digital imager.
3.8.3 Lectin Blotting 1. Block the transferred membranes with Buffer-T at 4 C for 1 h.
2. Incubate the membranes with HRP-conjugated WGA lectin
(1:200 dilution) in Buffer-T at RT for 3 h.
3. Wash the membranes twice with Buffer-T at RT for 10 min
each time.
4. Rinse the membranes once with 10 mM Tris–HCl (pH 7.4)
containing 0.15 M NaCl at RT for 10 min.
5. Soak the membranes with 30 mL of 0.05% DAB in TBS and
15 μL of 30% hydrogen peroxide to visualize the binding of the
OmpA-like proteins to WGA lectin.
6. Wash the membrane with water.
4 Notes
1. Alternatively, anaerobic cultivation sets (e.g., Anaero Pack

(Mitsubishi Gas Chemical)) can be used.
2. Alternatively, 10 mM Tris–HCl (pH 7.4) containing 0.15 M
NaCl can be used.
3. The French pressure cell press (French press) must be chilled

before use. The French press allows for steady disruption and is
suitable for relatively large number of samples. In contrast, the
sonicator is used for a small number of samples; however, the
temperature tends to become higher and disruption is not
stable.
4. The Ficoll PM400 is useful for concentrating solutions by
dialysis. Osmotic pressure draws water across the membrane
into the solution of Ficoll PM400.
5. We prefer method of Lugtenberg et al. [35] rather than the
conventional method of Laemmli [36], because the former
shows better separation for bacterial membrane proteins. We
usually make handcast gels.
6. When Pro-Q Emerald is used to detect glycoproteins, Candy-
Cane glycoprotein molecular standards must be loaded to the
SDS-PAGE gel to distinguish between specifically and nonspe-
cifically stained bands. CandyCane glycoprotein molecular
standards consist of mixture of glycoproteins and nonglycosy-
lated proteins.
7. Pro-Q Emerald is more sensitive than the traditional periodic
acid-Shiff base method using fuchsin dye. Instead of Pro-Q
Emerald 300 stain, Pro-Q Emerald 488 stain for visible light
excitation is alternatively used (excitation maximum at
510 nm, emission maximum at 520 nm).
8. Alternatively, a carbonate–bicarbonate transfer buffer (3 mM
Na2CO3, 10 mM NaHCO3, pH 9.9, with 20% methanol) can
be used.
9. We usually use 4-chloro-1-naphthol for detection of proteins
(see Subheading 2.8.1), and DAB for glycosylation detection
(see Subheading 2.8.3). Because these chromogenic substrates
have somewhat low sensitivity, the chemiluminescence system
is required for the detection of O-GlcNAc modification (see
Subheading 2.8.2).
10. The anti-Pgm6/7 antibody described previously [14, 15] is
reactive to OmpA-like proteins from most P. gingivalis strains
tested. In addition, this antibody shows cross-reactivity to
OmpA-like protein from T. forsythia [18].
11. The HRP-conjugated WGA from J-Chemicals (formerly J-Oil
Mills) is discontinued.
12. For the separation of OmpA-like proteins by WGA-agarose,
the addition of metal ions, such as Ca2+ and Mg2+, for wash
and elution buffers is not necessary.
13. As column volume is small, we often use several columns at the
same time. Generally, 1 mL of lectin agarose gel should be
enough to bind 1–2 mg of glycoproteins.
14. After using the WGA column, regenerate it by washing it with

ten volumes of 10 mM Tris–HCl (pH 7.4) containing 0.5 M
NaCl to remove nonspecifically bound particles to the agarose
gel. Store at 4 C in 10 mM phosphate-buffered saline
(pH 7.2) containing 0.02% (w/v) sodium azide.
15. After glycoprotein staining using Pro-Q Emerald, subsequent
protein staining using CBB or SYPRO Ruby is possible. How-
ever, sequential staining in the reverse order is not possible.
16. When the O-GlcNAc modification is detected by Western
blotting, α-crystallin, which contains O-GlcNAc, should be
included as a positive control protein.
References
1. Kinane DF, Stathopoulou PG, Papapanou PN 12. Sharma A (2010) Virulence mechanisms of
(2017) Periodontal disease. Nat Rev Dis Pri- Tannerella forsythia. Periodontol 2000
mers 3:17038 54:106–116
2. Michaud DS, Fu Z, Shi J et al (2017) Peri- 13. Murakami Y, Imai M, Nakamura H et al (2002)
odontal disease, tooth loss, and cancer risk. Separation of the outer membrane and identi-
Epidemiol Rev 39:49–58 fication of major outer membrane proteins
3. Eke PI, Borgnakke WS, Genco RJ (2020) from Porphyromonas gingivalis. Eur J Oral Sci
Recent epidemiologic trends in periodontitis 110:157–162
in the USA. Periodontol 2000 82:257–267 14. Nagano K, Read EK, Murakami Y et al (2005)
4. Kumar PS (2013) Oral microbiota and sys- Trimeric structure of major outer membrane
temic disease. Anaerobe 24:90–93 proteins homologous to OmpA in Porphyromo-
5. Maddi A, Scannapieco FA (2013) Oral bio- nas gingivalis. J Bacteriol 187:902–911
films, oral and periodontal infections, and sys- 15. Imai M, Murakami Y, Nagano K et al (2005)
temic disease. Am J Dent 26:249–254 Major outer membrane proteins from Porphyr-
6. Holt SC, Ebersole JL (2005) Porphyromonas omonas gingivalis: strain variation, distribution,
gingivalis, Treponema denticola, and Tanner- and clinical significance in periradicular lesions.
ella forsythia: the “red complex”, a prototype Eur J Oral Sci 113:391–399
polybacterial pathogenic consortium in peri- 16. Iwami J, Murakami Y, Nagano K et al (2007)
odontitis. Periodontol 2000 38:72–122 Further evidence that major outer membrane
7. Darveau RP, Hajishengallis G, Curtis MA proteins homologous to OmpA in Porphyromo-
(2012) Porphyromonas gingivalis as a potential nas gingivalis stabilize bacterial cells. Oral
community activist for disease. J Dent Res Microbiol Immunol 22:356–360
91:816–820 17. Yoshimura F, Murakami Y, Nishikawa K et al
8. Hagishengallis G, Lamont RJ (2012) Beyond (2009) Surface components of Porphyromonas
the red complex and into more complexity: the gingivalis. J Periodontal Res 44:1–12
polymicrobial synergy and dysbiosis (PSD) 18. Abe T, Murakami Y, Nagano K et al (2011)
model of periodontal disease etiology. Mol OmpA-like protein influences cell shape and
Oral Microbiol 27:409–419 adhesive activity of Tannerella forsythia. Mol
9. Lamont RJ, Hajishengallis G (2015) Polymi- Oral Microbiol 26:374–387
crobial synergy and dysbiosis in inflammatory 19. Smith SG, Mahon V, Lambert MA et al (2007)
disease. Trends Mol Med 21:172–183 A molecular Swiss army knife: OmpA structure,
10. Lamont RJ, Jenkinson HF (1998) Life below function and expression. FEMS Microbiol Lett
the gum line: pathogenic mechanisms of Por- 273:1–11
phyromonas gingivalis. Microbiol Mol Biol Rev 20. Krishnan S, Parasadarao NV (2012) Outer
62:1244–1263 membrane protein A and OprF – versatile
11. Pathirana RD, O’Brien-Simpson NM, Rey- roles in Gram-negative bacterial infections.
nolds EC (2010) Host immune responses to FEBS J 279:919–931
Porphyromonas gingivalis antigens. Periodon-
tol 2000 52:218–237
21. Confer AW, Ayalew S (2013) The OmpA fam- antigens of Tannerella forsythia. J Proteome
ily of proteins: roles in bacterial pathogenesis Res 8:4279–4292
and immunity. Vet Microbiol 163:207–222 30. Posch G, Pabst M, Brecker L et al (2011)
22. Nothaft H, Szymanski CM (2010) Protein gly- Characterization and scope of S-layer protein
cosylation in bacteria: sweeter than ever. Nat O-glycosylation in Tannerella forsythia. J Biol
Rev Microbiol 8:765–778 Chem 286:38714–38724
23. Eichler J, Koomey M (2017) Sweet new roles 31. Kishi M, Hasegawa Y, Nagano K et al (2012)
for protein glycosylation in prokaryotes. Identification and characterization of novel
Trends Microbiol 25:662–672 glycoproteins involved in growth and biofilm
24. Curtis MA, Thickett A, Slaney JM et al (1999) formation by Porphyromonas gingivalis. Mol
Variable carbohydrate modification to the cata- Oral Microbiol 27:458–470
lytic chains of the RgpA and RgpB proteases of 32. Murakami Y, Hasegawa Y, Nagano K et al
Porphyromonas gingivalis. Infect Immun (2014) Characterization of wheat germ agglu-
67:3816–3823 tinin lectin-reactive glycosylated OmpA-like
25. Nakao R, Tashiro Y, Nomura N et al (2008) proteins derived from Porphyromonas gingiva-
Glycosylation of the OMP85 homolog of Por- lis. Infect Immun 82:4563–4571
phyromonas gingivalis and its involvement in 33. Horie T, Inomata M, Into T et al (2016) Iden-
biofilm formation. Biochem Biophys Res Com- tification of OmpA-like protein of Tannerella
mun 365:784–789 forsythia as an O-linked glycoprotein and its
26. Zeituni AE, McCaig W, Scisci E et al (2010) binding capability to lectins. PLoS One 11:
The native 67-kilodalton minor fimbria of Por- e0163974
phyromonas gingivalis is a novel glycoprotein 34. Towbin H, Staehelin T, Gordon J (1979) Elec-
with DC-SIGN-targeting motifs. J Bacteriol trophoretic transfer of proteins from polyacryl-
192:4103–4110 amide gels to nitrocellulose sheets: procedure
27. Shoji M, Sato K, Yukitake H et al (2011) Por and some applications. Proc Natl Acad Sci U S
secretion system-dependent secretion and gly- A 76:4350–4354
cosylation of Porphyromonas gingivalis hemin- 35. Lugtenberg B, Meijers J, Peters R et al (1975)
binding protein 35. PLoS One 6:e21372 Electrophoretic resolution of the ‘major outer
28. Shoji M, Nakayama K (2016) Glycobiology of membrane protein’ of Escherichia coli K12 into
the oral pathogen Porphyromonas gingivalis four bands. FEBS Lett 58:254–258
and related species. Microb Pathog 94:35–41 36. Laemmli UK (1970) Cleavage of structural
29. Veith PD, O’Brien-Simpson NM, Tan Y et al proteins during the assembly of the head of
(2009) Outer membrane proteome and bacteriophage T4. Nature 227:680–685
Chapter 15
Intranasal Vaccine Study Using Porphyromonas gingivalis

Membrane Vesicles: Isolation Method and Application
to a Mouse Model
Satoru Hirayama and Ryoma Nakao
Abstract
Bacteria release spherical nanobodies, known as membrane vesicles (MVs), during various growth phases.
MVs have been gaining recognition as structurally stable vehicles in the last two decades because they
deliver a wide range of antigens, virulence factors, and immunomodulators to the host. These functions
suggest not only the possible contribution of MVs to pathogenicity but also the potential applicability of
low-dose MVs for use as vaccines. Here, we describe a series of methods for isolating MVs of Porphyromonas
gingivalis, which is an important species among periodontopathic bacteria. The present chapter also
introduces a mouse model of intranasal immunization using MVs from P. gingivalis.
Key words Porphyromonas gingivalis, Membrane vesicles (MVs), Ultracentrifugation, Density gradi-
ent centrifugation, Lipid quantification, Intranasal immunization
1 Introduction
A wide variety of bacteria, regardless of species, produce spherical

structures during various phases of growth. These structures, called
membrane vesicles (MVs), range in size from tens to hundreds of
nanometers in diameter, and contain much of the biological con-
tent derived from their parent bacterial cells, such as phospholipids,
peptidoglycans, lipopolysaccharides (LPS), proteins, enzymes, tox-
ins, and nucleic acids [1, 2]. MVs therefore have versatile functions
in bacteria-host interactions, serving as structurally stable transfer
vehicles carrying virulence factors, antigens, immunomodulatory
molecules, and signals for communication [3–5].
Porphyromonas gingivalis is a black-pigmented, gram-negative,
anaerobic bacterium that resides in periodontal pockets as a com-
ponent of biofilms. P. gingivalis is thought to contribute to peri-
odontal diseases by turning a benign microbial community into a
dysbiotic one, and thus is well-known as one of the “keystone
157
158 Satoru Hirayama and Ryoma Nakao
pathogens” of periodontal diseases [6, 7]. Notably, P. gingiva-

lis MVs contain large amounts of various virulence factors, includ-
ing gingipains (cysteine proteases consisting of lysine-gingipain
Kgp, arginine-gingipain RgpA and RgpB), pili, CPG70, peptidy-
larginine deiminase, and HBP35 [8, 9], which could be responsible
for the initiation and progression of periodontal diseases. On the
other hand, attempts have been made to use a low dose of
P. gingivalis MVs as a vaccine antigen [9, 10], taking advantage of
the fact that MVs can be relatively thermostable vehicles carrying
immunodominant antigens and natural adjuvants.
In the present chapter, we describe the isolation method of
MVs from P. gingivalis culture supernatant. The chapter also intro-
duces a mouse model of intranasal immunization using P. gingivalis
MVs. We are convinced that these general methods could be
adapted to MV studies in other bacterial species as well by imple-
menting some modifications.
2 Materials
2.1 Cultivation 1. 0.5 mg/mL hemin solution: Weigh and dissolve 50 mg of

of P. gingivalis for MV hemin in 1 mL of 1 N NaOH. Make up to 100 mL with
Preparation distilled water and autoclave. Store at 4 C.
2. 10 mg/mL menadione solution: Weigh and dissolve 50 mg of
menadione in 5 mL of ethanol. After filtration through a 0.22-
μm filter, store at 4 C.
3. 100HM solution: Mix 0.5 mg/mL hemin solution and
10 mg/mL menadione solution at a ratio of 100:1 (v/v).
Store at 4 C.
4. BHI + HM blood agar plate: Brain heart infusion (BHI) broth
supplemented with 5 mg/L hemin, 1 mg/L menadione, 5%
defibrinated sheep blood, and 1.5% agar. After mixing BHI
broth and agar, and autoclaving, add 1/100 volume of
100HM solution and 1/20 volume of defibrinated sheep
blood, and pour into petri dishes. Store at 4 C.
5. BHI + HM broth: BHI broth supplemented with 5 mg/L
hemin, 1 mg/L menadione. After dissolving BHI broth and
autoclaving, add 1/100 volume of 100HM solution. Store at
4 C.
6. Anaerobic chamber: Incubator filled with 80% N2, 10% H2,
and 10% CO2 gas at 37 C (see Note 1).
2.2 MV Preparation 1. Centrifuge.

2. Centrifuge tubes.
3. PVDF membrane filters with pore sizes of 0.45 and 0.22 μm.
Intranasal Vaccine Study Using Porphyromonas gingivalis Membrane. . . 159
4. Aspirator.
5. Ultracentrifuge.
6. Ultracentrifuge rotor: Fixed-angle ultracentrifugation rotor
that can accommodate six bottles at maximum.
7. Ultracentrifuge bottles: Polycarbonate bottles with each
70-mL capacity.
8. Aluminum caps for the ultracentrifuge bottles.
9. 20 mM Tris–HCl buffer (pH 8.0): Autoclave 1 M Tris–HCl
buffer (pH 8.0), and dilute 1/50 with distilled water. Filter
with a 0.22-μm PVDF membrane filter (see Note 2).
10. Phosphate-buffered saline (PBS): Dissolve 8 g of NaCl,
200 mg of KCl, 1.44 g of Na2HPO4 and 240 mg of
KH2PO4 in 800 mL of distilled water in a suitable container.
Confirm pH to be at 7.4 (adjust pH if necessary). Make up to
1 L with distilled water. Filter with a 0.22-μm PVDF mem-
brane filter (see Note 2).
2.3 Purification 1. Iodixanol stock solution: Purchase or prepare 60% (w/v) iodix-
of MVs by Density anol solution dissolved with double distilled water.
Gradient 2. Iodixanol standard solution: Dilute iodixanol stock solution to
Centrifugation different concentrations; 16, 20, 24, 28, 32, 36, and 40%
(See Note 3) (w/v). Use the solvent in which MV is dissolved (20 mM
Tris–HCl, pH 8.0, and PBS, pH 7.4).
3. Ultracentrifuge.
4. Ultracentrifuge rotor.
5. 13.2-mL ultraclear centrifuge tubes.
6. 12.5% (w/v) polyacrylamide gel for sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE).
7. SDS-PAGE equipment.
8. Reagents for silver staining.
2.4 Quantification 1. Linoleic acid solution: Dissolve linoleic acid (water-soluble) in

of Lipids Contained distilled water to obtain 1 mg/mL solution. Dispense into
in MVs (See Note 4) microtubes and store at 20 C. Just before use, serially dilute
1 mg/mL linoleic acid stock solution with distilled water to make
a series of linoleic acid standard solutions (0.5–500 μg/mL).
2. FM4-64 dye solution: Dissolve FM4-64 dye (N-(3-triethylam-
moniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl)
pyridinium dibromide) in distilled water to prepare a
0.5 mg/mL solution. Dispense into microtubes and store at
20 C protected from light. Just before use, dilute 0.5 mg/
mL FM4-64 dye solution to 1/100 with distilled water (5 μg/
mL at final concentration).
3. 96-well black microtiter plate.

4. Fluorescence microplate reader.
2.5 Intranasal 1. 5-week-old female BALB/c mice: Purchase at least 1 week

Immunization of MVs before starting experiments.
to Mice 2. Cages for breeding animals.
3. Feed and water for mice.
4. 10 mg/mL polyinosinic-polycytidylic acid [poly(I:C)]: Dis-
solve poly(I:C) sodium salt in endotoxin-free water to obtain
10 mg/mL solution. Dispense into microtubes and store at
20 C (see Note 5).
5. Isoflurane.
6. Inhalation anesthesia device (see Note 6).
7. PBS (see item 10 in Subheading 2.2).
8. Parasympathetic stimulant solution: Mix 0.8 mg/mL isopro-
terenol in PBS and 0.2 mg/mL pilocarpine in PBS in equal
volumes, and filter the solution through a 0.22-μm filter
(see Note 7).
9. 1-mL syringe.
10. 26 G needle.
11. 21 G nonbeveled needle (see Note 8).
12. Scissors and tweezers.
13. PBS containing 0.1% bovine serum albumin (BSA): Dissolve
BSA at 0.1% concentration (w/v) in PBS.
14. 1.5-mL tube.
3 Methods
Carry out all procedures at room temperature, unless specified

otherwise.
3.1 MV Preparation 1. Take a cryopreservation of P. gingivalis and streak on a

and Quantification BHI + HM blood agar plate. Incubate in the anaerobic cham-
ber at 37 C for 4–5 days.
3.1.1 MV Preparation
2. Pick up a small amount of bacteria from colonies on the agar
plate and suspend in 12–15 mL of BHI + HM broth (see Note
9). Incubate in an anaerobic chamber at 37 C for 2 days.
3. Inoculate 1/40 volume of P. gingivalis culture into
450–500 mL of BHI + HM broth. Incubate in the anaerobic
chamber at 37 C for 2 days (see Note 9).
4. Centrifuge 450 mL of the bacterial culture at 7,190 g for
30 min at 4 C to obtain the culture supernatant (see Note 10).
5. Filter the culture supernatant with a 0.45-μm filter and then

with a 0.22-μm filter using an aspirator to completely remove
the remaining bacterial cells (see Note 11).
6. Ultracentrifuge the 420-mL culture supernatant at 103,800 g
for 2 h at 4 C to obtain an MV pellet (seeNote 12).
7. Suspend the MV pellet in 20 mM Tris-HCl (pH 8.0) or PBS
(see Notes 13–16).
8. Mix iodixanol stock solution and MV suspension to obtain
400 μL of 45% iodixanol solution containing MVs.
9. Pipette 400 μL of 45% iodixanol solution containing MVs into
the bottom of 13.2-mL ultraclear centrifuge tube.
10. Carefully layer 1.5 mL of serially diluted iodixanol solutions in
the order of concentration from highest (40%) to lowest (16%)
(Fig. 1).
11. Ultracentrifuge the tube at 151,000 g for 16 h at 4 C.
12. Carefully collect a 1-mL fraction from the surface of the solu-
tion. This process can be repeated for each successive fraction.
13. Subject an aliquot of each fraction to SDS-PAGE and visualize
the proteins using silver staining (see Notes 17 and 18)
(Fig. 2).
14. Pick up the fractions containing the MVs.
16% 1.5 mL
20% 1.5 mL
24% 1.5 mL
28% 1.5 mL
32% 1.5 mL
36% 1.5 mL
40% 1.5 mL
45% 0.4 mL
(including MVs)
Fig. 1 The schematic diagram of the ultracentrifuge tube before density gradient
centrifugation. Pipette the MV preparation containing 45% iodixanol into the
bottom of the tube, then layer down with decreasing iodixanol density
Top Fraction number Bottom
1 2 3 4 5 6 7 8 9 10 11 㸨
Fraction 5
Purified MV fraction
Fig. 2 (Left) After fractionating the MVs of P. gingivalis ATCC 33277 strain using iodixanol, each fraction was
subjected to 12.5% SDS-PAGE and silver-stained. Fractions 4–6 contain the purified MVs. An asterisk
indicates MVs before subjecting to density gradient centrifugation. (Right) MVs contained in fraction 5 observed
by negative staining with a transmission electron microscope. The scale bar indicates 200 nm
15. The fractions are diluted with the solvent that was used to
dissolve MVs at step 7 (20 mM Tris–HCl or PBS) (see Note
19).
16. Ultracentrifuge the diluted samples at 151,000 g for 2–3 h at
4 C.
17. Resuspend the MV pellet with the solvent that was used to
dissolve MVs at step 7 (see Note 19).
3.1.2 Quantification 1. Set a series of linoleic acid standard solutions (e.g.,

of Lipids Contained in MVs 0.5–500 μg/mL).
2. Serially dilute MV samples by two- to tenfold in distilled water.
3. Add 100 μL of 5 μg/mL FM4-64 dye to the standards and
samples (5 μL each) in the 96-well black plate (see Note 20).
4. Incubate the plate protected from light for 10 min at room
temperature.
5. Detect fluorescence from FM4-64 dye (excitation at 535 nm
and emission at 625 nm) with a fluorescence plate reader
(see Note 21).
6. Estimate the amount of lipid contained in the MV sample from
the calibration curve created by the standard.
Intranasal
Immunization
6-week-old female mice 1st 2nd
(BALB/c)
0 3 5 (weeks)
Saliva
Sera
Nasal wash
Fig. 3 Immunization timeline. Immunize mice first at 6 weeks of age and again
2 weeks later. Collect various samples (saliva, sera, and nasal wash) 2 weeks
after the last immunization.
3.2 Intranasal Figure 3 shows the immunization schedule.

Immunization of MVs
1. Keep 5-week-old female BALB/c mice for 1 week to acclimate
to Mice
to the environment.
3.2.1 Immunization 2. Adjust MV and MV + poly(I:C) suspension to desired concen-
tration with PBS (see Note 22).
3. Anesthetize mice with isoflurane by inhalation (see Note 23).
4. At day 0 (6-week-old), inoculate both nostrils with 5 μL each
(total 10 μL) of PBS (mock, negative control) or MV, or
MV + poly(I:C) suspension using pipette (see Note 24).
5. At 21 days after first immunization (at 9 weeks old), nasal
immunization is performed again as in step 4 in this section
(see Note 25).
6. At 14 days after the second immunization (at 11 weeks old),
collect specimens such as saliva, sera, and nasal washes.
3.2.2 Collection 1. Saliva: Inject 200 μL of the parasympathetic stimulant solution

of Mouse Specimens into the abdominal cavity. When saliva secretion is induced,
and Antibody Detection collect saliva from the mouth with a pipette. Store at 80 C
(seeNote 26).
2. Serum: Collect whole blood samples from anesthetized mice by
cardiac puncture through the diaphragm with 1-mL syringe
and 26 G needle (seeNotes 27 and 28). Centrifuge blood
samples at 300 g for 10 min to precipitate blood cells, collect
the supernatant. Store at 20 C.
3. Nasal wash: Remove the head of the deceased mouse after
exsanguination, and dissect out the lower jaw. Insert a syringe
needle (21 G nonbeveled) into the nasal cavity from the poste-
rior opening, and flush with 1 mL of PBS containing 0.1% BSA.
Collect the outflow from the nostrils in 1.5-mL tube. Repeat
the flushing step three times (seeNote 29).
4. Proceed to techniques such as enzyme-linked immunosorbent
assay (ELISA) to confirm antibody production against the
antigen.
4 Notes
1. Anaerobic jar and gas pack system for anaerobiosis can be used
instead.
2. Filtration is recommended to remove contaminants in the
buffers.
3. The MV preparations following simply ultracentrifuging the
culture supernatant usually contain various impurities such as
pili. Further purification by density gradient centrifugation can
be a powerful option to improve the purity of MV preparations.
4. The Bradford method [11] and/or the BCA method [12] have
also been widely used for protein quantification of MVs. An
alternative method for quantifying MVs is to quantify the total
lipid amounts of the MVs using the amphiphilic styryl dye
FM4-64. The principle of the assay is based on the property
of FM4-64, which primarily stains the lipid bilayer of MVs.
5. Prior to intranasally administrating poly(I:C) to mice, poly(I:
C) must be denatured at 65 C for 10 min, then slowly chilled
at room temperature. The proper annealing step will ensure
formation of double-stranded RNA.
6. An anesthesia bottle can be used instead.
7. Prepare and mix the solutions of isoproterenol and pilocarpine
just prior to intraperitoneally administrating the mixture
to mice.
8. It is also possible to cut the tip of the 21 G beveled needle to
make it nonbeveled.
9. It is not enough to pick a single colony of bacteria. Approxi-
mately one platinum loop is required. Preliminary experiments
should be performed to optimize the culture conditions, as MV
production level is depend on the strains used for testing. In
P. gingivalis, 2 days of culture at 37 C usually results in the
production of MVs at maximum yield.
10. Collect the culture supernatant quickly because the pellet of
P. gingivalis cells is easily disintegrated.
11. The proper size or material of the filtration membranes to be
used depends on the bacterial species or strain that is used in
assay. Suitable filtration conditions must be established in pre-
liminary experiments.
12. Usually, brownish pellets are clearly formed.
13. As a solvent for suspending the MV pellets, distilled water,
PBS, or another buffer can be used depending on the purpose
of the individual study.
14. Usually, 100–200 μL of buffer is enough to dissolve the MV

pellet when a 70-mL culture supernatant is ultracentrifuged.
15. As much as possible, be careful not to create a foam when
suspending the MV. Due to the lipophilic characteristics of
MVs, it is very easy to generate bubbles.
16. Perform further purification, if purer MVs are needed, such as
washing or density gradient centrifugation.
17. Coomassie brilliant blue staining can be performed instead, but
silver staining is recommended because of its high sensitivity.
Scanning or transmission electron microscopy analysis is a
reliable way to confirm both the purity and structural integrity
of MVs.
18. Most of pili can be removed from the crude MV preparations
by density gradient centrifugation (Fig. 2).
19. To precipitate MVs as a pellet after ultracentrifugation, the
collected fractions should be sufficiently diluted with as much
the used solvent as possible.
20. We recommend measuring standards and samples in duplicate
or triplicate.
21. FM4-64 dye has a maximum excitation of 515 nm and a
maximum emission of 640 nm.
22. In the case of P. gingivalis MVs, the MVs alone are not suffi-
cient for immunity induction; it is necessary to use poly(I:C) as
a mucosal adjuvant. One microgram of MV (as protein
amount) and 10 μg of poly(I:C) per mouse are sufficient.
Mucosal adjuvants may not be needed depending on the strain
used to prepare the MVs.
23. For isoflurane, a concentration of 2% and a flow rate of 2 L/
min are sufficient. The use of isoflurane is preferable to that of
sevoflurane for inhalation anesthesia of mice to reduce the risk
of accidental death. Note that induction of and recovery from
inhalation anesthesia is much quicker with sevoflurane than
isoflurane.
24. Insufficient anesthesia may cause sneezing in mice. It is safer to
wait ca. 1 min after inoculating one nasal cavity before inocu-
lating the other so that the first inoculation does not block the
airway. The mouse is less likely to sneeze.
25. An additional booster after the second vaccination may further
enhance humoral immune responses.
26. Storage at 80 C is recommended to easily handle saliva
samples, as it reduces the viscosity of saliva.
27. Slowly drain the blood to prevent heart collapse.

28. Approximately 1 mL can be collected.
29. Centrifuging the nasal wash is recommended to remove cell
debris.
Acknowledgments
We would like to thank Michiyo Kataoka and Naomi Nojiri for their
technical assistance. This study was supported by JSPS KAKENHI
(JP16K11537, JP18K15160, JP19H02920, JP19K22644,
JP20K09943,and JP20H03861).
References
1. Schooling SR, Beveridge TJ (2006) Membrane 8. Veith PD, Chen YY, Gorasia DG et al (2014)
vesicles: an overlooked component of the Porphyromonas gingivalis outer membrane
matrices of biofilms. J Bacteriol 188 vesicles exclusively contain outer membrane
(16):5945–5957. https://doi.org/10.1128/ and periplasmic proteins and carry a cargo
JB.00257-06 enriched with virulence factors. J Proteome
2. Orench-Rivera N, Kuehn MJ (2016) Environ- Res 13(5):2420–2432. https://doi.org/10.
mentally controlled bacterial vesicle-mediated 1021/pr401227e
export. Cell Microbiol 18(11):1525–1536. 9. Bai D, Nakao R, Ito A et al (2015) Immunore-
https://doi.org/10.1111/cmi.12676 active antigens recognized in serum samples
3. Kaparakis-Liaskos M, Ferrero RL (2015) from mice intranasally immunized with Por-
Immune modulation by bacterial outer mem- phyromonas gingivalis outer membrane vesi-
brane vesicles. Nat Rev Immunol 15 cles. Pathog Dis 73(3):ftu006. https://doi.
(6):375–387. https://doi.org/10.1038/ org/10.1093/femspd/ftu006
nri3837 10. Nakao R, Hasegawa H, Dongying B et al
4. Schwechheimer C, Kuehn MJ (2015) Outer- (2016) Assessment of outer membrane vesicles
membrane vesicles from Gram-negative bacte- of periodontopathic bacterium Porphyromonas
ria: biogenesis and functions. Nat Rev Micro- gingivalis as possible mucosal immunogen.
biol 13(10):605–619. https://doi.org/10. Vaccine 34(38):4626–4634. https://doi.org/
1038/nrmicro3525 10.1016/j.vaccine.2016.06.016
5. Toyofuku M, Nomura N, Eberl L (2019) 11. Bradford MM (1976) A rapid and sensitive
Types and origins of bacterial membrane vesi- method for the quantitation of microgram
cles. Nat Rev Microbiol 17(1):13–24. https:// quantities of protein utilizing the principle of
doi.org/10.1038/s41579-018-0112-2 protein-dye binding. Anal Biochem
6. Lamont RJ, Hajishengallis G, Koo H et al 72:248–254. https://doi.org/10.1006/abio.
(2019) Oral microbiology and immunology. 1976.9999
ASM Press, Washington, DC 12. Smith PK, Krohn RI, Hermanson GT et al
7. Hajishengallis G (2015) Periodontitis: from (1985) Measurement of protein using bicinch-
microbial immune subversion to systemic oninic acid. Anal Biochem 150(1):76–85.
inflammation. Nat Rev Immunol 15 https://doi.org/10.1016/0003-2697(85)
(1):30–44. https://doi.org/10.1038/nri3785 90442-7
Chapter 16
Analysis of the Butyrate-Producing Pathway in

Porphyromonas gingivalis
Yasuo Yoshida
Abstract
Butyrate is one of the most harmful metabolic end products found in the oral cavity. Thus, it would be
important to characterize the enzymes responsible for production of this metabolite to elucidate the
pathogenicity of periodontogenic bacteria. Here, a spectrophotometric assay for butyryl-CoA:acetate
CoA transferase activity and gas chromatography–mass spectrometry measurement of butyrate and other
short chain fatty acids such as acetate, propionate, isobutyrate, and isovalerate are described.
Key words Short chain fatty acid, Butyrate, Porphyromonas gingivalis, Periodontopathogenic bacte-
ria, GC-MS
1 Introduction
Porphyromonas gingivalis possesses and produces a variety of viru-

lence factors, including fimbriae, proteases, hemagglutinins, lipo-
polysaccharides, capsule polysaccharides, major outer membrane
proteins, and cytotoxic metabolic end products [1, 2]. One of the
most harmful metabolic end products found in the oral cavity is
butyrate [3], which induces apoptosis in gingival fibroblasts and
immune cells such as T- and B-cells [4–6], and increases production
of reactive oxygen species, affecting cell cycle progression, in
human gingival fibroblasts [7]. Interestingly, the concentration of
butyrate in the periodontal pockets positively correlates with clini-
cal measures of inflammation and disease severity [3, 8].
The metabolic pathway for butyrate production, which occurs
in a limited number of bacterial species in the oral cavity, including
Porphyromonas gingivalis, Fusobacterium nucleatum, and Tanner-
ella forsythia, has recently been reported [9–12]. In P. gingivalis,
three butyryl-CoA:acetate CoA transferases (PGN_0725,
PGN_1341, and PGN_1888) transfer the CoA moiety from
butyryl-CoA to an exogenous acetate molecule, forming acetyl-
CoA and butyrate in the last step of butyrate production [11].
167
168 Yasuo Yoshida
In this chapter, two approaches for analyzing the enzymatic

activity of butyryl-CoA:acetate CoA transferase are discussed,
including a colorimetric assay and a gas chromatography–mass
spectrometry (GC-MS) assay, the latter of which can be used for
analysis of multiple short chain fatty acids (SCFAs) in saliva, includ-
ing acetate, butyrate, propionate, isobutyrate, and isovalerate.
2 Materials
Prepare all solutions using ultrapure water and analytical grade

reagents. When used for GC-MS analysis, use MS grade waters
and reagents. Prepare and store all reagents at room temperature,
unless otherwise indicated. Diligently follow all waste disposal
regulations when disposing of waste materials.
2.1 Colorimetric 1. Reaction mixture: 40 mM potassium phosphate buffer

Assay for Butyryl-CoA: (pH 8.0), 20–250 mM sodium acetate, and 0.5–5 mM
Acetate CoA butyryl-CoA or propionyl-CoA.
Transferase Activity 2. Block incubator.
3. 100 μg/mL crude enzyme extracts: Lyse P. gingivalis cells in
40 mM potassium phosphate buffer (pH 8.0) by ultrasonica-
tion in the presence of the following protease inhibitors,
0.1 mM Nα-tosyl-L-lysine chloromethyl ketone, 0.2 mM phe-
nylmethylsulfonyl fluoride, and 0.1 mM leupeptin. Protein
concentrations are determined using a Pierce BCA Protein
Assay Kit.
4. Purified enzyme (500 ng/mL PGN_0725, 50 μg/mL
PGN_1341, or 500 ng/mL PGN_1888). The recombinant
proteins are obtained using the expression vector pGEX-6P-
1, as described previously [9]. The coding sequences are
PCR-amplified from the genomic DNA of P. gingivalis
(ATCC 33277). Protein concentrations are determined as
described previously [13], and protein purity is assessed by
SDS-PAGE.
5. Trichloroacetic acid: 4.5% (W/V) solution in water.
6. 400 mM potassium phosphate buffer (pH 8.0). The solution
pH is adjusted by mixing 400 mM KH2PO4 and 400 mM
K2HPO4.
7. Assay mixture: 4 mM oxaloacetate, 4 mM 5,50 -dithiobis-2-
nitrobenzoic acid, and 36.8 μg/mL citrate synthase.
9. Crystal cuvette.
10. Acetyl-CoA.
Analysis of the Butyrate-Producing Pathway in Porphyromonas gingivalis 169
2.2 GC-MS Assay for 1. Brucella HK agar supplemented with 5% rabbit blood.
Detection of SCFAs 2. Modified GAM broth.
3. Anaerobic chamber (80% N2, 10% H2, 10% CO2).
5. Crystal cuvette.
6. Tabletop microcentrifuge.
7. Acetone.
8. Gas chromatograph–mass spectrometer (TQ8040 GC-MS,
Shimadzu).
9. InertCap Pure-WAX + T.L. column (length 32 m; diameter
0.25 mm; film thickness 0.25 μm).
3 Methods
3.1 Colorimetric The enzymatic activity of butyryl-CoA:acetate CoA transferases in

Assay for Butyryl-CoA: P. gingivalis is determined by measuring the amount of acetyl-CoA,
Acetate CoA which is produced as a by-product of the reaction. Next, CoA-SH
Transferase and citrate are produced from acetyl-CoA and oxaloacetate by
citrate synthase. CoA-SH reacts with 5,50 -dithiobis-2-nitrobenzoic
acid, and can be detected spectrophotometrically.
1. Prewarm a 1.5 mL tube containing 40 μL of reaction mixture
(see Note 1) at 37 C for approximately 5 min in a block
incubator (see Note 2).
2. After prewarming, add 10 μL of enzyme (crude enzyme
extracts, PGN_0725, PGN_1341, or PGN_1888) (see Note
3) to initiate the reactions, and then incubate at 37 C for
precisely 5 min.
3. Terminate the reaction by adding 10 μL of 4.5%
trichloroacetic acid.
4. Add 25 μL of 400 mM potassium phosphate buffer (pH 8.0) to
neutralize the solution.
5. To quantify acetyl-CoA, add 25 μL of assay mixture to the
reaction mixture.
6. Incubate the reaction mixture at 37 C for 30 min, and then
spectrophotometrically measure the samples at 412 nm.
7. Calculate sample acetyl-CoA concentrations using a standard
curve that has been generated in advance.
8. Compute the parameters from the Lineweaver–Burk transfor-
mation (V1 versus S1) of the Michaelis–Menten equation.
Calculate kcat values from Vmax and protein molecular weights.
9. In addition to the general reaction conditions described above,
use varying concentrations of sodium acetate (20–250 mM)
and butyryl-CoA (0.5–5.0 mM) to determine the kinetic para-
meters of each recombinant protein (see Note 4).
170 Yasuo Yoshida
Fig. 1 GC-MS chromatograph of the supernatant from P. gingivalis ATCC33277.

Data were obtained using the total ion chromatograph mode
3.2 GC-MS Analysis The GS-MS analysis used to quantify SCFAs in bacterial culture,
including acetate, butyrate, propionate, isobutyrate, and isovalerate
is illustrated in Fig. 1 and described below. Instead of laboratory
samples, clinical samples, such as human saliva can be also used as
specimens.
1. Inoculate a colony of P. gingivalis ATCC 33277 (or its deriva-
tive strains) on Brucella HK agar supplemented with 5% rabbit
blood into 2 mL of Modified GAM broth, and culture the
bacteria anaerobically for 24 h.
2. Add 8 mL of fresh Modified GAM broth, which has been
anaerobically prewarmed, to the bacterial culture, and incubate
the culture anaerobically for 24 h.
3. Dilute a portion of the bacterial culture with fresh Modified
GAM broth and culture to an OD600 of 0.375 0.025,
corresponding to approximately 1.5 105 CFU/μL, to nor-
malize the concentration of cultured cells (see Note 5).
Analysis of the Butyrate-Producing Pathway in Porphyromonas gingivalis 171
4. Remove cells from bacterial cultures by centrifugation at

approximately 20,000 g for 10 min.
5. Add 500 μL of acetone to 100 μL of the supernatant, incubate
samples at 20 C for 2 h, and subsequently centrifuge the
mixture at approximately 20,000 g for 10 min to remove
proteins (see Notes 6 and 7).
6. Inject 1.0 μL of sample in splitless mode into a GC-MS instru-
ment equipped with an InertCap Pure-WAX + T.L. column.
7. Use helium as the carrier gas, with a linear velocity of 50 cm/
s (see Note 8).
8. Set the injection port temperature to 200 C.
9. Hold the oven temperature at 40 C for 5 min, and then
increase the temperature to 240 C at a rate of 10 C/min,
and maintain the temperature at 240 C for 5 min.
10. For MS, the ionization source temperature is 200 C.
11. Characterize the components in full-scan mode, and identify
them by comparing the mass fragmentation patterns with those
of the corresponding reference substances.
12. Obtain ion-monitoring data to quantify the concentrations of
SCFAs.
13. Analyze samples at least in triplicate.
4 Notes
1. Propionyl-CoA can be used for the propionyl-CoA:acetate

CoA transferase assay.
2. The temperature control accuracy at 37 C should ideally be
less than 0.5 C.
3. Determine the optimal enzyme concentration to maintain the
initial velocity at 5 min.
4. The double-reciprocal plots to determine whether the reaction
catalyzed by the enzyme follows a ternary complex mechanism
or a biphasic mechanism.
5. As long as the OD600 value is almost the same between sam-
ples, it is not necessary to set the value at 0.375 0.025. The
value of the stationary phase depends on the gene inactivated in
P. gingivalis. The ordinary value of the wild-type strain incu-
bated overnight is more than 1.0.
6. Removal of unevaporated materials is one of the most impor-
tant steps for preparation of GC-MS specimens.
7. When clinical samples such as saliva are used, start from
this step.
8. The concentration of helium should be greater than 99.995%.
172 Yasuo Yoshida
Acknowledgments
This study was supported in part by JSPS KAKENHI Grant Num-

ber JP17K11634 from the Ministry of Education, Culture, Sports,
Science and Technology of Japan.
References
1. Holt SC, Kesavalu L, Walker S et al (1999) 8. Qiqiang L, Huanxin M, Xuejun G (2012) Lon-
Virulence factors of Porphyromonas gingivalis. gitudinal study of volatile fatty acids in the
Periodontol 2000 20:168–238 gingival crevicular fluid of patients with peri-
2. Lamont RJ, Koo H, Hajishengallis G (2018) odontitis before and after nonsurgical therapy.
The oral microbiota: dynamic communities J Periodontal Res 47:740–749
and host interactions. Nat Rev Microbiol 9. Yoshida Y, Sato M, Nagano K et al (2015)
16:745–759 Production of 4-hydroxybutyrate from succi-
3. Niederman R, Zhang J, Kashket S (1997) nate semialdehyde in butyrate biosynthesis in
Short-chain carboxylic-acid-stimulated, Porphyromonas gingivalis. Biochim Biophys
PMN-mediated gingival inflammation. Crit Acta 1850:2582–2591
Rev Oral Biol Med 8:269–290 10. Yoshida Y, Sato M, Kezuka Y et al (2016) Acyl-
4. Kurita-Ochiai T, Fukushima K, Ochiai K CoA reductase PGN_0723 utilizes succinyl-
(1995) Volatile fatty acids, metabolic CoA to generate succinate semialdehyde in a
by-products of periodontopathic bacteria, butyrate-producing pathway of Porphyromonas
inhibit lymphocyte proliferation and cytokine gingivalis. Arch Biochem Biophys
production. J Dent Res 74:1367–1373 596:138–148
5. Kurita-Ochiai T, Ochiai K, Fukushima K 11. Sato M, Yoshida Y, Nagano K et al (2016)
(2000) Butyric-acid-induced apoptosis in Three CoA transferases involved in the produc-
murine thymocytes and splenic T- and B-cells tion of short chain fatty acids in Porphyromonas
occurs in the absence of p53. J Dent Res gingivalis. Front Microbiol 7:1146
79:1948–1954 12. Yoshida Y, Sato M, Nonaka T et al (2019)
6. Kurita-Ochiai T, Seto S, Suzuki N et al (2008) Characterization of the
Butyric acid induces apoptosis in inflamed phosphotransacetylase-acetate kinase pathway
fibroblasts. J Dent Res 87:51–55 for ATP production in Porphyromonas gingiva-
7. Chang MC, Tsai YL, Chen YW et al (2013) lis. J Oral Microbiol 11:1588086
Butyrate induces reactive oxygen species pro- 13. Pace CN, Vajdos F, Fee L et al (1995) How to
duction and affects cell cycle progression in measure and predict the molar absorption coef-
human gingival fibroblasts. J Periodontal Res ficient of a protein. Protein Sci 4:2411–2423
48:66–73
Chapter 17
Characterization of the Treponema denticola Virulence

Factor Dentilisin
Yuichiro Kikuchi and Kazuyuki Ishihara
Abstract
Treponema denticola is a potent periodontal pathogen that forms a red complex with Porphyromonas
gingivalis and Tannerella forsythia. It has many virulence factors, yet there are only a few reports detailing
these factors. Among them, dentilisin is a well-documented surface protease. Dentilisin is reported to be
involved in nutrient uptake, bacterial coaggregation, complement activation, evasion of the host immune
system, inhibition of the hemostasis system, and cell invasion as a result of its action, in addition to its
original proteolysis function. Therefore, characterization of dentilisin, and clarifying the relationship
between T. denticola and the onset of periodontal disease will be important to better understanding this
disease. In this chapter, we explain the methods for analysis of dentilisin activity and pathogenicity.
Key words Treponema denticola, Dentilisin, Prolyl-phenylalanine-specific protease, prtP
1 Introduction
Treponema denticola is a gram-negative, motile, anaerobic spiro-

chete frequently isolated, together with Porphyromonas gingivalis
and Tannerella forsythia, from human chronic periodontal lesions
[1, 2]. This microorganism expresses numerous virulence factors,
such an outer membrane-associated prolyl-phenylalanine-specific
protease (dentilisin; also called chymotrypsin-like protease) [3, 4],
cysteine proteases (IdeS) [5], major surface protein (Msp) [6],
adherence to fibronectin and plasminogen (OppA) [7], and adher-
ence to FH and FHL-1 (FhbB) [8, 9]. Dentilisin in particular has
been reported to be involved in the degradation of host proteins
[3, 4, 10, 11] and coaggregation with other bacteria [12, 13],
which is a very important factor in elucidating the pathogenicity
of T. denticola.
Dentilisin is a proryl-phenylalanine-specific protease located on
the surface of T. denticola and coded by three genes (prcB, prcA,
and prtP). After transcription, PrcA is cleaved into a 38 kDa protein
and a 43 kDa protein and organized into a complex with PrtP
173
174 Yuichiro Kikuchi and Kazuyuki Ishihara
[3, 14, 15]. PrcB plays an important role in complex formation and
expression of dentilisin activity [16]. Dentilisin activity is required
for the expression of major surface protein, Msp, of T. denticola,
which is an adherence factor of this microorganism [14, 17]. Denti-
lisin degrades host proteins, such as transferrin, gelatin, laminin,
fibrinogen, fibronectin, IgG, IgA, alpha1-antitrypsin, type IV col-
lagen, and human complement 3 [3, 4, 11], and is also involved in
adherence of the microorganism via coaggregation to T. forsythia
and P. gingivalis, as well as adherence to fibrinogen [12, 13,
18]. Dentilisin is also involved in the migration of epithelial cells
and invasion of epithelial cells by T. denticola [19]. Abscess forming
activity in mice by this microorganism attenuated by inactivation of
prtP [17]. These phenomena demonstrate the virulence of dentili-
sin at the periodontal lesion. This chapter describes the protocols
used for the purification, inactivation, and characterization of viru-
lence of dentilisin.
2 Materials
2.1 Purification 1. T. denticola ATCC 35405 (seeNote 1).

of Dentilisin 2. Tryptone–yeast extract–gelatin–volatile fatty acids–serum
(TYGVS) medium [20]: three solutions are separately
prepared. To prepare the first solution (Solution A), dissolve
5 g of heart infusion broth, 10 g of tryptone, 10 g of yeast
extract, 10 g of gelatin, 2 g of K2HPO4, 1 g of NaCl, 0.1 g of
MgSO4, and 0.5 g of (NH4)2SO4 in 800 mL of deionized
water. Sterilize at 121 C for 20 min and store at 4 C. Volatile
fatty acid (VFA) solution: Dissolve 1.7 mL of acetic acid,
0.6 mL of propionic acid, 0.4 mL of n-butyric acid,
0.1 mL of n-valeric acid, 0.1 mL of isobutyric acid, 0.1 mL of
isovaleric acid, 0.1 mL of DL-methylbutyric acid in 27.9 mL of
deionized water. Cocarboxylase solution: Dissolve 0.25 g of
cocarboxylase in 100 mL of deionized water. To prepare the
second solution (Solution B), dissolve 1 g of L-cysteine hydro-
chloride, 1 g of glucose, 0.25 g of sodium pyruvate, 5 mL of
VFA solution, 5 mL of cocarboxylase solution in 90 mL of
deionized water. Mix and adjust pH 7.2–7.4 with
KOH and sterilized by filtration. To prepare the third solution
(Rabbit serum), inactivate rabbit serum at 56 C for 30 min.
Mix the 800 mL of solution A, 100 mL of solution B and
100 mL of inactivated rabbit serum. Store at 4 C.
3. Anaerobic glove box (10% CO2, 10% H2, and 80% N2).
4. Column equilibration buffer: 20 mM Tris–HCl, pH 8.0 con-
taining 1% zwitterionic detergent 3-[(3-cholamidopropyl)-
Characterization of the Treponema denticola Virulence Factor Dentilisin 175
dimethyl-ammonio]-1-propane sulfonate (CHAPS). Weigh

2.42 g of Tris and 10 g of CHAPS and transfer to the cylinder.
Add deionized water to a volume of 900 mL. Mix and adjusted
pH with HCl. Make up to 1 L with deionized water. Store at
4 C.
5. Sonicator.
6. Ultracentrifuge.
7. Q-Sepharose fast-flow column (2.6 cm diameter, 10 cm high).
8. Sodium chloride: 110, 200 and 300 mM solution in water.
9. Dilution buffer: Distilled water containing 1% CHAPS.
10. Centriprep Centrifugal Filter Unit: 15 mL, 50,000-molecular-
weight-cutoff membrane.
11. Rotofor cell running buffer: 1 mM Tris–HCl buffer (pH 8.0)
containing 10 mM NaCl, 1% (wt/vol) CHAPS, 2% (wt/vol)
ampholytes (pH 5–7).
12. Rotofor isoelectric focusing cell: The electrolytes in the anode
and cathode chambers are 100 mM H3PO4 and 100 mM
NaOH, respectively.
13. G3000SWXL gel filtration column equilibration buffer: Phos-
phate buffered saline (PBS), pH 7.2, 1% CHAPS. Weigh 8 g
NaCl, 0.2 g KCl, 1.44 g Na2HPO4, and 0.24 g KH2PO4 and
transfer to a 900 mL water. Mix and adjust pH with HCl. Add
10 mL CHAPS and make up to 1 L with water.
14. G3000SWXL gel filtration column (7.5 mm inner diameter,
30 cm high).
15. Dialysate buffer: 10 mM Tris–HCl, pH 8.5, 0.8% n-octyl-β-D-
glucopyranoside (octylglucoside).
16. An anion-exchange column (7.5 mm inner diameter,
7.5 cm high).
17. TSKgel DEAE-5PW.
18. Reverse-phase chromatography phenyl-5PW-RP column
(4.6 mm inner diameter, 7.5 cm high).
19. HPLC solvent A: 0.02% trifluoroacetic acid in water.
20. HPLC solvent B: 0.02% trifluoroacetic acid in acetonitrile.
2.2 Measurement 1. T. denticola ATCC 35405 (seeNote 1).

of Dentilisin Activity 2. TYGVS medium (seeitem 2 in Subheading 2.1).
4. PBS (pH 7.2).
5. Sonicator.
6. DC Protein Assay Kit.
7. SAAPNA hydrolyzing activity buffer: 100 mM Tris–HCl,

pH 8.0, 1.0 mM N-succinyl-L-alanyl–L-alanyl–L-prolyl–L-phe-
nylalanine p-nitroanilide (SAAPNA).
8. Incubator.
9. Acetic acid: 20% solution in water.
10. 96-well transparent microplate.
11. Microplate reader.
2.3 Evaluation 1. T. denticola ATCC 35405 (seeNote 1).

of Pathogenicity 2. TYGVS medium (seeitem 2 in Subheading 2.1).
of T. denticola
4. PBS (pH 7.2).
5. C-chip: Disposable hemocytometer.
6. Dark-field microscope.
7. BALB/c mice (6–8 weeks old, male or female).
8. Caliper gauge.
2.4 Construction 1. T. denticola ATCC 35405 genome.

of T. denticola 2. Synthetic oligonucleotide primers: prtP forward primer, 5-
Dentilisin Mutant 0
-CGGTCTGACAGACGGAAATTATTTGG-30 , prtP reverse
(Electroporation primer, 50 -ACGGATCCCCTGTAAACCGTAACTC-30 )
Protocol) (Fig. 1a).
3. PCR polymerase kit.
4. pCR II vector.
5. Restriction enzyme: EcoRI, BamHI, KpnI, PstI, and BglII.
6. Ligation kit.
7. pMCL191 [17].
8. ermF-ermAM cassette [21] from plasmid pVA2198.
9. T. denticola ATCC 35405 (seeNote 1).
10. TYGVS medium (seeitem 2 in Subheading 2.1): If necessary,
add 40 μg/mL erythromycin at final concentration.
12. Ice.
13. Wash buffer: Ice-cold distilled water.
14. Electroporation buffer: Ice-cold 10% glycerol in distilled water.
15. Electroporator.
16. Capillary pipette.
17. Selection agar medium: TYGVS medium, 0.8% agarose,
40 μg/mL erythromycin. Keep melting at 45 C.
18. Plate: 10-cm petri dish plate, sterile.
Fig. 1 Diagrams of plasmid constructs for the prtP mutant. (a) Chromosomal structure around prtP. Arrows
show the primer oligonucleotides for PCR fragments of prtP. (b) Construction of pDLCK3 and the ermF-ermAM
fragment to pKO3
2.5 Construction 1. T. denticola ATCC 35405 (seeNote 1).

of T. denticola 2. TYGVS medium (seeitem 2 in Subheading 2.1): If necessary,
Dentilisin Mutant (Heat add 40 μg/mL erythromycin at final concentration.
Shock Protocol)
3. Anaerobic globe box (10% CO2, 10% H2, and 80% N2).
4. Ice.
5. Heat shock buffer: Ice-cold water containing 15% glycerol and
50 mM CaCl2.
6. Incubator.
7. Selection SeaPlaque agarose medium: TYGVS medium con-
taining 0.75% SeaPlaque agarose and the appropriate antibio-
tics for positive selection.
8. Capillary pipette.
2.6 Coaggregation 1. T. denticola ATCC 35405 (seeNote 1).

Assay 2. TYGVS medium (seeitem 2 in Subheading 2.1).
4. Coaggregation buffer: Various buffers are used for each exper-
iment, so select the solution that is appropriate for your exper-
imental conditions (seeNote 2).
5. Vortex.
2.7 Measurement 1. T. denticola ATCC 35405 (seeNote 1).

of the Invasion 2. TYGVS medium (seeitem 2 in Subheading 2.1).
Potential
of T. denticola
(Antibiotic Protection 4. 10 μCi/ml [3H]uridine.
Assay) 5. Ca9-22 cell (seeNote 3).
6. Antibiotic free medium: Eagle’s minimal essential medium
(MEM) supplemented with 0.6 mg/mL glutamine and heat-
inactivated 10% fetal calf serum.
7. Antibiotic containing medium: MEM supplemented with
0.6 mg/mL glutamine, heat-inactivated 10% fetal calf serum,
300 μg/mL gentamicin, and 200 μg/mL metronidazole.
8. PBS (pH 7.2).
9. Liquid scintillation counter.
3 Methods
3.1 Purification 1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and
of Dentilisin [3] 80% N2) in 4 L of TYGVS medium at 37 C.
2. Harvest T. denticola cells by centrifugation at 8000 g for

20 min at 4 C and wash twice with the column equilibration
buffer.
3. Disrupt the cells by sonication at 100 W for 5 min on ice.
4. Ultracentrifuge at 105,000 g for 1 h and transfer the upper
aqueous phase to a new tube.
5. Equilibrate the Q-Sepharose fast-flow column with the column
equilibration buffer.
6. Absorb the aqueous phase containing the dentilisin to the
Q-Sepharose fast-flow column and wash with the column
equilibration buffer.
7. Elute the column with a linear concentration gradient of NaCl
from 0 to 300 mM and dentilisin may elute fractions with
approximately 200 mM NaCl.
8. Pool the enzymatically active fractions (see Subheading 3.2)
and dilute with the dilution buffer.
9. Concentrate by ultrafiltration at 1500 g for 30 min through
Centriprep Centrifugal Filter Unit.
10. Bring the fraction to 50 mL with Rotofor cell running buffer.
11. Apply this sample to Rotofor isoelectric focusing cell.
12. Do the isoelectric focusing in the Rotofor cell at 12 W of
constant power at an initial voltage of 500 V at 4 C for 4 h.
13. Continue the focusing until the voltage had been stabilized
(1200 V) for 30 min. Dentilisin activity may detected in the
fraction at a pH of about 5.
14. Concentrate the active enzyme fractions and apply to a
G3000SWXL gel filtration column equilibrated with
G3000SWXL gel filtration column equilibration buffer.
15. Wash the column at a rate of 0.8 mL/min and collect the
0.5 mL of fractions.
16. Dialyzed the fraction with dentilisin activity against the dialy-
sate buffer and concentrate it with Centriprep Centrifugal
Filter Unit.
17. Apply this fraction to an anion-exchange column containing
TSKgel DEAE-5PW equilibrated with the dialysate buffer and
then elute it with 110 mM NaCl.
18. Analyze the enzyme preparation from the gel filtration column
by HPLC.
19. Use a reverse-phase chromatography phenyl-5PW-RP column
with the following HPLC parameters. The flow rate was 1 mL/
min with a linear gradient of 5–80% acetonitrile (HPLC solvent
B) over 40 min.
20. Detect the protein absorbance at 220 nm.
3.2 Measurement 1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and
of Dentilisin Activity 80% N2) in TYGVS medium at 37 C.
[3] 2. Harvest T. denticola cells by centrifugation at 8000 g for
10 min at 4 C, wash and suspend in PBS (pH 7.2).
3. Disrupt the cells by sonication at 100 W for 5 min on ice.
4. Centrifuge at 8000 g for 20 min and transfer the upper
aqueous phase to a new tube.
5. Analyze the concentration of the protein solution by Lowry
assay.
6. Mix the 5 μL of sonicated solution with 150 μL of SAAPNA
hydrolyzing activity buffer in a well of a 96-well transparent
microplate.
7. Incubate at 37 C for 15 min.
8. Stop the reaction by adding the 50 μL of 20% acetic acid.
9. Measure its absorbance at 405 nm (seeNote 1).
3.3 Evaluation 1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and
of Pathogenicity 80% N2) in TYGVS medium at 37 C for 72 h.
of T. denticola [17] 2. Harvest T. denticola cells and suspend in PBS (pH 7.2).
3. Quantitate the cell number of T. denticola with the C-chip
using a dark-field microscope. Adjust the bacterial concentra-
tion to 1.5 1010 cells/mL.
4. Challenge subcutaneously on the posterior dorsolateral surface
of BALB/c mice with 200 μL (3 109 cells) of T. denticola cell
suspension.
5. Measure the size of each lesion with a caliper gauge at 3, 6,
9 and 12 days after subcutaneously challenge.
3.4 Construction 1. Amplify the sequence of matureprtP by PCR with synthetic

of T. denticola oligonucleotide primers (prtP forward primer, 5-
0
Dentilisin Mutant -CGGTCTGACAGACGGAAATTATTTGG-30 ; prtP reverse
(Electroporation primer, 50 -ACGGATCCCCTGTAAACCGTAACTC-30 )
Protocol) [22] (Fig. 1a).
2. Insert the amplified fragment into pCR II vector using a
3.4.1 Construction
ligation kit.
of DNA Construct
3. Isolate the EcoRI–BamHI fragment containing the prtP from
the resulting plasmid, ligate it to pMCL191 [17] and designate
the vector pDLCK3.
4. Isolate an ermF–ermAM cassette [21] from plasmid pVA2198
by digesting with KpnI–PstI and insert the cassette inside the
prtP sequence in pDLCK3 (Fig. 1b) (seeNote 4).
5. Name the resulting plasmid pKO3 and linearize it by digesting
with EcoRI and BglII (Fig. 1b).
3.4.2 Preparation 1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and
of Competent Cells 80% N2) in 100 mL of TYGVS medium at 37 C and incubate
for 3 days.
2. Place the cells on ice for 15 min, wash it twice with 100 mL of
the wash buffer, and centrifuged at 4000 g for 10 min. Resus-
pend the cells with 50 mL of the wash buffer, and centrifuged
at 4000 g for 10 min.
3. Resuspend the cells in 2 mL of ice-cold distilled water contain-
ing 10% glycerol.
4. Centrifugate the cells and suspend them in 500 μL of 10%
glycerol.
3.4.3 Transformation 1. Mix 80 μL of competent cells (approximately 5 1010 cells)

of T. denticola with 10 μg of linearized pKO3.
2. Electroporate the competent cells in a 1.0-mm gap cuvette
with the pulse controller set as 1.8 kV, 25 μF and 200 Ω.
3. Mix it with 2 mL of TYGVS medium.
4. Incubate the cells for 24 h under anaerobic conditions.
5. Mix 1 mL of the culture with 35 mL of the selection agar
medium at 45 C and pour in a plate.
6. Incubate the plates for 4–8 days under anaerobic conditions.
7. Isolate the individual colonies with a capillary pipette and
reinoculate into TYGVS medium containing 40 μg/mL
erythromycin.
3.5 Construction 1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and
of T. denticola Mutant 80% N2) in 50 mL of TYGVS medium at 37 C.
(Heat Shock Protocol) 2. Harvest T. denticola cells (approximately 108 cells/mL) at the
[23] late-logarithmic phase by centrifugation at 8000 g for 10 min
3.5.1 Preparation
at 4 C and wash four times with the heat shock buffer.
of Competent Cells 3. Resuspend the cells in 0.5 mL of the heat shock buffer.
3.5.2 Transformation 1. Mix the 80 μL of competent cells with 10 μg of either linearized

of T. denticola targeting vector (see Subheading 3.4.1).
2. Incubate on ice for 10 min, at 50 C for 1 min, and on ice again
for 5 min.
3. Inoculate the cells immediately into 10 mL of TYGVS medium.
4. Incubate the cells for 2 days, and plate on Selection SeaPlaque
agarose medium with the appropriate antibiotics for positive
selection.
5. Pick up the bacterial colonies on the plates after 5–7 days of
incubation.
3.6 Coaggregation Coaggregation assay for T. denticola is performed with a variety of oral
Assay [13] bacteria such as T. forsythia [13], P. gingivalis [24], and Fusobacterium
nucleatum [25]. Use them as a paired bacterium in this assay.
1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and
80% N2) in TYGVS medium at 37 C and the paired bacteria in
appropriate culture conditions.
2. Harvest cells by centrifugation at 8000 g for 10 min at 4 C,
wash and suspend in a coaggregation buffer (seeNote 2).
3. Mix equal volumes of T. denticola and its coaggregation part-
ner suspension and vortex them for 10 s.
4. Evaluate the OD660 with the spectrophotometer at room tem-
perature for 60 min.
5. Calculate the coaggregation percentage using the following
equation: coaggregation (%) ¼ [(OD660 at 0 min OD660 at
60 min)/OD660 at 0 min] 100.
3.7 Measurement 1. Label the T. denticola following incubation in TYGVS medium

of the Invasion containing 10 μCi/mL [3H]uridine for 5 days.
Potential 2. Calculate the multiplicity of infection (MOI) based on the
of T. denticola number of cells per well at confluence.
(Antibiotic Protection 3. Add the labeled bacteria (1 107) to the Ca9-22 monolayers
Assay) [19] (1 105) grown in the MEM without antibiotics and incubate
for 2 h under 5% CO2 at 37 C.
4. Wash the monolayers twice with sterile PBS, and add the fresh
medium containing 300 μg/mL gentamicin and 200 μg/mL
metronidazole for an additional 1 h to kill extracellular
treponemes.
5. Wash the adherent cells with PBS and lyse with sterile water.
6. Count the internalized bacteria using a liquid scintillation
counter.
7. Calculate the invasion potential of T. denticola to Ca9-22 as
follows: Invasion potential ¼ (intracellular T. denticola at indi-
cated time)/(T. denticola immediately after infection) 100.
4 Notes
1. The dentilisin activity of T. denticola ATCC 35405 and 33520

were high, whereas T. denticola ATCC 35404 and 33521
showed very low activity [26]. Nevertheless, the expression of
prtP by qRT-PCR showed that the level of ATCC 33521 was
very low, whereas the level of other three strains was almost
the same.
2. Coaggregation buffers used in past papers are as follows:

(a) 1 mM sodium phosphate buffer, pH 8.0. (b) PBS,
pH 8.0. (c) 10 mM Tris–HCl, pH 8.0. (d) Coaggregation
reactions between T. denticola and T. forsythia have been
reported in a previous study [13]: 1 mM sodium phosphate
buffer (pH 8.0) containing 0.1 mM CaCl2, 0.1 mM MgCl2,
and 150 mM NaCl. (e) Coaggregation reactions between
T. denticola and P. gingivalis have been reported in a previous
study [24]: PBS (pH 8.0) containing 0.02% NaN3. (g) Coag-
gregation reactions between T. denticola and F. nucleatum have
been reported in a previous study [25]: 10 mM Tris–HCl,
pH 8.0, 1 mM CaCl2, 1 mM MgCl2, 150 mM NaCl, and
0.02% NaN3.
3. Ca9-22 cells are the cell line of a human squamous cell carci-
noma gingival-derived cell line bearing a mutant p53 [27].
4. Erythromycin resistance methylase genes ermF-ermAM [21] or
ermB (ermAM) [23], kanamycin resistance gene aphA2 [28],
and gentamicin resistance gene aacC1 [29] have been reported
as drug resistance markers used to create T. denticola mutant or
complement strains.
Acknowledgments
This research has been supported, in part, by JSPS KAKENHI

Grant Numbers 15K11023 (to K.I.).
References
1. Holt SC, Ebersole JL (2005) Porphyromonas 5. Ishihara K, Wawrzonek K, Shaw LN et al

gingivalis, Treponema denticola, and Tanner- (2010) Dentipain, a Streptococcus pyogenes
ella forsythia: the “red complex”, a prototype IdeS protease homolog, is a novel virulence
polybacterial pathogenic consortium in peri- factor of Treponema denticola. Biol Chem
odontitis. Periodontol 2000 38:72–122. 391:1047–1055. https://doi.org/10.1515/
https://doi.org/10.1111/j.1600-0757.2005. BC.2010.113
00113.x 6. Fenno JC, Muller KH, McBride BC (1996)
2. Socransky SS, Haffajee AD, Cugini MA et al Sequence analysis, expression, and binding
(1998) Microbial complexes in subgingival activity of recombinant major outer sheath pro-
plaque. J Clin Periodontol 25:134–144. tein (Msp) of Treponema denticola. J Bacteriol
https://doi.org/10.1111/j.1600-051x.1998. 178:2489–2497
tb02419.x 7. Fenno JC, Tamura M, Hannam PM et al
3. Ishihara K, Miura T, Kuramitsu HK et al (2000) Identification of a Treponema denticola
(1996) Characterization of the Treponema den- OppA homologue that binds host proteins
ticola prtP gene encoding a prolyl- present in the subgingival environment. Infect
phenylalanine-specific protease (dentilisin). Immun 68:1884–1892
Infect Immun 64:5178–5186 8. McDowell JV, Frederick J, Miller DP et al
4. Uitto VJ, Grenier D, Chan EC et al (1988) (2011) Identification of the primary mecha-
Isolation of a chymotrypsinlike enzyme from nism of complement evasion by the periodon-
Treponema denticola. Infect Immun tal pathogen, Treponema denticola. Mol Oral
56:2717–2722 Microbiol 26:140–149. https://doi.org/10.
1111/j.2041-1014.2010.00598.x
9. McDowell JV, Lankford J, Stamm L et al gingival epithelial cells. Microb Pathog

(2005) Demonstration of factor H-like protein 94:104–111. https://doi.org/10.1016/j.
1 binding to Treponema denticola, a pathogen micpath.2016.01.010
associated with periodontal disease in humans. 20. Ohta K, Makinen KK, Loesche WJ (1986)
Infect Immun 73:7126–7132. https://doi. Purification and characterization of an enzyme
org/10.1128/IAI.73.11.7126-7132.2005 produced by Treponema denticola capable of
10. Miyamoto M, Ishihara K, Okuda K (2006) The hydrolyzing synthetic trypsin substrates. Infect
Treponema denticola surface protease dentilisin Immun 53:213–220
degrades interleukin-1 beta (IL-1 beta), IL-6, 21. Fletcher HM, Schenkein HA, Macrina FL
and tumor necrosis factor alpha. Infect Immun (1994) Cloning and characterization of a new
74:2462–2467. https://doi.org/10.1128/ protease gene (prtH) from Porphyromonas gin-
IAI.74.4.2462-2467.2006 givalis. Infect Immun 62:4279–4286
11. Yamazaki T, Miyamoto M, Yamada S et al 22. Li H, Ruby J, Charon N et al (1996) Gene
(2006) Surface protease of Treponema denti- inactivation in the oral spirochete Treponema
cola hydrolyzes C3 and influences function of denticola: construction of an flgE mutant. J
polymorphonuclear leukocytes. Microbes Bacteriol 178:3664–3667
Infect 8:1758–1763. https://doi.org/10. 23. Kurniyati K, Li C (2015) pyrF as a counter-
1016/j.micinf.2006.02.013 selectable marker for unmarked genetic manip-
12. Hashimoto M, Ogawa S, Asai Y et al (2003) ulations in Treponema denticola. Appl Environ
Binding of Porphyromonas gingivalis fimbriae Microbiol 82:1346–1352. https://doi.org/
to Treponema denticola dentilisin. FEMS 10.1128/AEM.03704-15
Microbiol Lett 226:267–271. https://doi. 24. Grenier D (1992) Demonstration of a bimodal
org/10.1016/S0378-1097(03)00615-3 coaggregation reaction between Porphyromo-
13. Sano Y, Okamoto-Shibayama K, Tanaka K et al nas gingivalis and Treponema denticola. Oral
(2014) Dentilisin involvement in coaggrega- Microbiol Immunol 7:280–284. https://doi.
tion between Treponema denticola and Tanner- org/10.1111/j.1399-302x.1992.tb00589.x
ella forsythia. Anaerobe 30:45–50. https://doi. 25. Rosen G, Genzler T, Sela MN (2008) Coag-
org/10.1016/j.anaerobe.2014.08.008 gregation of Treponema denticola with Porphyr-
14. Bian XL, Wang HT, Ning Y et al (2005) Muta- omonas gingivalis and Fusobacterium
genesis of a novel gene in the prcA-prtP prote- nucleatum is mediated by the major outer
ase locus affects expression of Treponema sheath protein of Treponema denticola. FEMS
denticola membrane complexes. Infect Microbiol Lett 289:59–66. https://doi.org/
Immun 73:1252–1255 10.1111/j.1574-6968.2008.01373.x
15. Lee SY, Bian XL, Wong GW et al (2002) Cleav- 26. Nagano K, Hasegawa Y, Yoshida Y et al (2017)
age of Treponema denticola PrcA polypeptide Comparative analysis of motility and other
to yield protease complex-associated proteins properties of Treponema denticola strains.
Prca1 and Prca2 is dependent on PrtP. J Bac- Microb Pathog 102:82–88. https://doi.org/
teriol 184:3864–3870 10.1016/j.micpath.2016.11.021
16. Godovikova V, Wang HT, Goetting-Minesky 27. Horikoshi M, Kimura Y, Nagura H et al (1974)
MP et al (2010) Treponema denticola PrcB is A new human cell line derived from human
required for expression and activity of the carcinoma of the gingiva. I. Its establishment
PrcA-PrtP (dentilisin) complex. J Bacteriol and morphological studies. Nihon Koku Geka
192:3337–3344. https://doi.org/10.1128/ Gakkai Zasshi 20:100–106. https://doi.org/
JB.00274-10 10.5794/jjoms.20.100
17. Ishihara K, Kuramitsu HK, Miura T et al 28. Li Y, Ruby J, Wu H (2015) Kanamycin resis-
(1998) Dentilisin activity affects the organiza- tance cassette for genetic manipulation of Trep-
tion of the outer sheath of Treponema denti- onema denticola. Appl Environ Microbiol
cola. J Bacteriol 180:3837–3844 81:4329–4338. https://doi.org/10.1128/
18. Bamford CV, Fenno JC, Jenkinson HF et al AEM.00478-15
(2007) The chymotrypsin-like protease com- 29. Bian J, Fenno JC, Li C (2012) Development of
plex of Treponema denticola ATCC 35405 a modified gentamicin resistance cassette for
mediates fibrinogen adherence and degrada- genetic manipulation of the oral spirochete
tion. Infect Immun 75:4364–4372. https:// Treponema denticola. Appl Environ Microbiol
doi.org/10.1128/IAI.00258-07 78:2059–2062. https://doi.org/10.1128/
19. Inagaki S, Kimizuka R, Kokubu E et al (2016) AEM.07461-11
Treponema denticola invasion into human
Chapter 18
Evaluation of the Virulence of Aggregatibacter

actinomycetemcomitans Through the Analysis
of Leukotoxin
Toshiyuki Nagasawa, Satsuki Kato, and Yasushi Furuichi
Abstract
Aggregatibacter actinomycetemcomitans is frequently isolated from localized aggressive periodontitis and
periodontitis associated with systemic diseases. A. actinomycetemcomitans produces a leukotoxin, which
induces apoptosis in human leukocytes. The leukotoxin expression is dependent on the upstream sequence,
likely including the promoter, of the gene encoding leukotoxin; strains with the truncated/short upstream
sequence express more leukotoxin than strains with the general/long upstream. This chapter addresses the
determination of the type of the leukotoxin promoter by PCR analysis, and detection of the apoptosis in the
coculture of human monocyte cell line (THP-1) with A. actinomycetemcomitans by the DNA ladder
formation, membrane perturbation, and lactate dehydrogenase release.
Key words Aggregatibacter actinomycetemcomitans, Leukotoxin, Apoptosis
1 Introduction
Aggregatibacter actinomycetemcomitans is frequently isolated from

localized aggressive periodontitis or periodontitis associated with
systemic diseases [1]. A. actinomycetemcomitans produces a leuko-
toxin which induces apoptosis in human leukocytes [2]. It is known
that the leukotoxin expression is dependent on the upstream
sequence, probably including the promoter, of the gene encoding
leukotoxin [3]. A. actinomycetemcomitans strain JP2 has a trunca-
tion in the upstream sequence (short type), and highly produces
leukotoxin compare to the general strains which have the full-
length long upstream sequence (long type). Many reports indicate
that high virulent strains are originated from JP2 [4]. Thus, the
examination of the type of upstream sequence of the leukotoxin
gene can predict the pathogenicity of A. actinomycetemcomitans. In
the first part of this chapter, we address the determination of the
185
186 Toshiyuki Nagasawa et al.
type of the upstream sequence of the leukotoxin gene by PCR

analysis.
For the examination of leukotoxic activity by A. actinomyce-
temcomitans, human monocyte cell line THP-1 is used for the
target cells. Apoptosis induced by A. actinomycetemcomitans is
examined by general assays as follows. An internucleosomal DNA
fragmentation is detected as a DNA ladder in electrophoresis
[5]. Plasma membrane perturbation as known phospholipid flip-
flop is detected by annexin V and quantification is performed using
a flow cytometer [6]. Additionally, we describe quantification of
lactate dehydrogenase (LDH) release. Although LDH in culture
supernatant is often used for an indicator of necrosis, it may also be
useful to detect apoptosis at late stage [7–9].
2 Materials
2.1 Determination of 1. Paper point, sterile.

Leukotoxin 2. Saline, sterile: Autoclave 0.9% NaCl in water.
Promoter Type
3. 1.5-mL Eppendorf Safe-Lock tube.
2.1.1 Dental Plaque 4. Vortex mixer.
Preparation
5. Centrifuge.
6. Water, sterile: Autoclave ultrapure water.
7. Boiling water or heat block.
2.1.2 Polymerase Chain 1. PCR tube.

Reaction (PCR) 2. Primer sets for the promoter of A. actinomycetemcomitans
leukotoxin [10] (see Note 1).
Ltx3: 50 -GCCG ACACCAAAGACAAAGTCT-30 .
Ltx4: 50 -GCCCATAA CCAAGCCACATAC-30 .
3. Ready-To-Go PCR Beads (Amersham Biosciences).
4. Thermal Cycler.
5. Agarose gel electrophoresis equipment: Use a Tris–acetate–
EDTA (TAE) buffer.
6. 1% agarose gel.
7. Ethidium bromide (EtBr): 0.5 μg/mL solution.
8. UV light.
2.2 Apoptosis Assay 1. A. actinomycetemcomitans: JP2 (ATCC 700685), Y4 and

NCTC 9710 strains are obtained from Dr. Donald
2.2.1 Infection of
R. Demuth and Dr. Tatsuji Nishimura, respectively.
Leukocytes with A.
actinomycetemcomitans 2. Todd-Hewitt broth with yeast extract (THY): Dissolve 30 g of
Todd-Hewitt broth and 10 g of yeast extract in 1 L of water,
and autoclave at 121 C for 15 min. Store at room
temperature.
Analysis of Aggregatibacter actinomycetemcomitans Leukotoxin 187
3. THP-1 cell: Obtain from Japanese Collection of Research

Bioresources Cell Bank (JCRB 0112.1). Maintain and grow
THP-1 cells in RPMI-1640 medium supplemented with 10%
heat-inactivated fetal bovine serum (FBS), 100 U/mL penicil-
lin G, and 100 μg/mL streptomycin.
4. RPMI-1640 w/o antibiotics: RPMI-1640 medium supple-
mented with 5% FBS. Store at 4 C.
5. RPMI-1640 w/o antibiotics: RPMI-1640 medium supple-
mented with 5% FBS, 100 U/mL penicillin G, 100 μg/mL
streptomycin, and 200 mg/mL gentamicin. Store at 4 C.
6. CO2 incubator: 5% CO2 in air with humidity.
7. 15-mL centrifuge tube, sterile.
8. Centrifuge.
10. 6-well culture plates.
2.2.2 DNA Laddering 1. 1.5-mL tube.

2. 2.0-mL tube.
3. Centrifuge.
4. Cell lysis buffer: 10 mM Tris–HCl buffer, pH 7.4, 10 mM
EDTA, pH 8.0, and 0.5% Triton X-100. Mix 0.1 mL of 1 M
Tris–HCl buffer, pH 7.4, 0.2 mL of 0.5 M EDTA, pH 8.0, and
0.5 mL of 10% Triton X-100, and make up to 10 mL with
water.
5. RNase: 0.5 mg/mL solution (DNase free).
6. Proteinase K: 10 mg/mL solution.
7. Phenol–chloroform–isoamyl alcohol: phenol–chloroform/iso-
amyl alcohol (25/24/1 v/v), saturated with 10 mM Tris,
pH 8.0, 1 mM EDTA.
8. Chloroform.
9. Vortex mixer.
10. Sodium acetate: 3 M solution, pH 5.2.
11. Pure ethanol: 99.5% ethanol, chilled.
12. 70% ethanol: 70% solution in water, chilled.
13. TE buffer: 10 mM Tris–HCl, pH 8.0, and 1 mM EDTA,
pH 8.0.
14. Agarose gel electrophoresis equipment: Use a TAE buffer.
15. 2% agarose gel.
16. EtBr.
17. UV light.
2.2.3 Annexin V 1. 2.0-mL tube.

Apoptosis Detection Assay 2. Centrifuge.
3. BD Annexin V: FITC Apoptosis Detection Kit I
(BD Biosciences): FITC-labeled annexin V and propidium
iodide (PI) are contained.
4. BD FACSVerse system.
5. BD FACSuite software.
2.2.4 Determination of 1. 2.0-mL tube.

LDH Release 2. Centrifuge.
3. 96-well transparent plate.
4. Cytotoxicity Detection kit (LDH) (Roche) (see Note 2).
5. Microplate reader: Measure optical density (OD) at 490 nm
wave length (OD490).
3 Methods
3.1 Determination of For the determination of the type of leukotoxin promoter of

Leukotoxin A. actinomycetemcomitans, the PCR method is available for the
Promoter Type dental plaque samples as well as clinical isolates [10]. Here we
describe the case using dental plaque samples.
3.1.1 Dental Plaque 1. Place the paper point in the periodontal pocket of a patient
Preparation with periodontitis.
2. Transfer the paper point in 200 μL of saline in 1.5-mL Eppen-
dorf Safe-Lock tube.
3. Mix vigorously by vortex mixer for a second, and remove the
paper point.
4. Centrifuge at 20,000 g at 4 C for 30 min, and discard the
supernatant.
5. Suspend the pellet in 100 μL of water.
6. Heat for 5 min in a boiling water bath or heat block at 100 C.
3.1.2 PCR 1. Prepare PCR mixture in a PCR tube: Add 23 μL of template

(sample, see Subheading 3.1.2) and 1 μL (10 pmol) of each of
two primers (Ltx3 and Ltx4) to the Ready-To-Go PCR Beads.
2. Set PCR program of a thermal cycler as follows: denaturation
for 5 min at 94 C, and 30 cycles of 94 C for 1 min, 60 C for
1 min, and 72 C for 2 min, followed by a final extension at
72 C for 8 min.
bp
2,000
1,500
1,000
750
500
JP2 Y4 9710
Fig. 1 PCR amplification of the upstream region of the leukotoxin gene of A.

actinomycetemcomitans strains. PCR using primers of Ltx3 and Ltx4 amplifies
the short (686 bp, strain JP2) and long (1216 bp, strains Y4 and 9710) type
upstream sequences of the leukotoxin gene
3. Load the PCR product on 1% agarose gel, and electrophorese.

4. After staining the gel with EtBr, detect the band by UV light
(Fig. 1) (see Note 3).
3.2 Apoptosis Assay 1. Grow A. actinomycetemcomitans strains in THY in CO2 incu-

bator at 37 C for 2 days.
3.2.1 Infection of THP-1
with A. 2. Harvest A. actinomycetemcomitans, and suspended in RPMI-
actinomycetemcomitans 1640 w/o antibiotics. Then, adjust the bacterial concentration
to an OD of 0.55 at 550 nm, corresponding to approximately
5 109 bacteria/mL, with RPMI-1640 w/o antibiotics.
3. Harvest THP-1 cells, and suspend in RPMI-1640 w/o anti-
biotics. Then, adjust the cell concentration to 2 107 cells/
mL.
4. Mix 0.4 mL of 2 107 cells/mL THP-1 cells with 1.6 mL of
5 109 bacteria/mL A. actinomycetemcomitans in 15-mL
sterile centrifuge tube (cell-to-bacteria ratio of 1:1000).
6. Suspend the cell–bacteria pellet in 2 mL of RPMI-1640 w/o
antibiotics.
7. Incubate in CO2 incubator at 37 C for 30 min (see Note 4).
8. Harvest the infected cells by centrifugation at 1000 g for
10 min, and suspend in 2 mL of RPMI-1640 w/o antibiotics
to kill noninvaded bacteria.
9. Transfer the cell suspension to 6-well culture plates (2 mL/

well).
10. Incubate in CO2 incubator at 37 C in for 0–24 h.
3.2.2 DNA Use THP-1 cells infected with A. actinomycetemcomitans for 24 h

Laddering Assay (see step 10 in Subheading 3.2.1) for this assay to detect internu-
cleosomal DNA fragmentation which is induced by apoptosis.
1. Collect the infected THP-1 cells (about 2 mL) in 2.0-mL tube
by centrifugation at 1000 g for 10 min.
2. Suspend the cell pellet in 1 mL of the cell lysis buffer.
3. Centrifuge the lysate at 15,000 g for 20 min at 4 C to
remove intact nuclei, and transfer the supernatant to 2.0-
mL tube.
4. Add 10 μL of RNase to the supernatants, and incubate for 1 h
at 37 C.
5. Add 10 μL of proteinase K, and incubate for 1 h at 50 C.
6. Add 500 μL phenol–chloroform–isoamyl alcohol, and incubate
with shaking for 30 min at room temperature.
7. Centrifuge at 15,000 g for 20 min at room temperature, and
transfer 350 μL of the supernatant to a new 1.5-mL tube.
8. Add 450 μL of chloroform to the supernatant, and mix well by
vortexing.
9. Centrifuge at 15,000 g for 10 min at room temperature, and
transfer 300 μL of the supernatant to a new 1.5-mL tube.
10. Add 30 μL of 3 M sodium acetate and 750 μL of pure ethanol
to the supernatant, and incubate for overnight at 20 C.
11. Centrifuge at 15,000 g for 20 min at 4 C, and remove the
supernatant.
12. Add 1 mL of 70% ethanol, centrifuge at 15,000 g for 20 min
at 4 C, remove the supernatant, and dry.
13. Dissolve in 30 μL of TE buffer.
14. Electrophorese in 2% agarose gel, stain with EtBr, and detect
the DNA ladder with UV light (Fig. 2).
3.2.3 Annexin V Assay Use THP-1 cells infected with A. actinomycetemcomitans for 0 h
(for negative control) and 3 h (see step 10 in Subheading 3.2.1) for
this assay to detect the cell membrane perturbation which is
induced by apoptosis.
2. Treat the cell pellet with the BD Annexin V: FITC Apoptosis
Detection Kit I according to the manufacturer’s instructions.
bp
1230
1107
984
861
738
615
492
369
246
123
Fig. 2 A nucleosome ladder pattern of DNA degradation in THP-1 cells infected

with or without A. actinomycetemcomitans Y4
3. Apply the sample to BD FACSVerse system.

4. Analyze the data using BD FACSuite software using the
Annexin V FITC assay (see Note 5).
3.2.4 LDH Release Assay Use THP-1 cells infected with A. actinomycetemcomitans for 0 h
(for negative control) to 24 h (see step 10 in Subheading 3.2.1) for
this assay to detect the loss of membrane integrity which is induced
by apoptosis.
2. Transfer 100 μL of the supernatant to a 96-well plate.
3. Perform experiment using the LDH release using Cytotoxicity
Detection kit according to the manufacturer’s instructions.
4. Measure OD490 by a microplate reader.
4 Notes
1. The type of A. actinomycetemcomitans leukotoxin promoter

region is usually determined by PCR analysis, and several pri-
mers specific for the leukotoxin promoter are reported.
Although most of the primers are available for the cultured
A. actinomycetemcomitans strains, some of the primers are not
suited for the plaque samples. The primer pairs reported by
Poulsen et al. [10], are designed for the clinical plaque samples.
Other than JP2, most of the reported strain has the same
length as Y4, but A. actinomycetemcomitans with insertion
sequence of the region was reported in Japan, and the clone
was also high producer of leukotoxin [11].
2. Colorimetric assay for the quantification of cell death and cell
lysis, based on the measurement of LDH activity released from
the cytosol of damaged cells into the supernatant [7].
3. Sensitivity of the PCR analysis is approximately 1 103 cells/
ml. The Ready-To-Go PCR Beads does not contain buffers in
the kit, and 25 μL of deionized water containing template and
primers is needed. Accordingly, the protocol at Subheading
3.1, step 3 uses 23 μL of the samples. The amount of the
samples can be adjusted according to the number of the bacte-
ria in the samples. In addition, if contaminants in the samples
interfere with the PCR reaction, purification of the DNA might
improve the reaction. The other PCR kits are also available in
this assay, but volume of the sample solution is limited in PCR
analysis (usually less than 10 μL), and number of the A. actino-
mycetemcomitans in the sample solution should be more than
1 103 cells/ml (1 cell/μL).
4. A. actinomycetemcomitans invades into THP-1 cells during this
incubation.
5. Flow cytometry can measure the percentages of the apoptotic
cells within the A. actinomycetemcomitans-infected leukocytes.
The gates are set based on the forward and side scatters. The
report generated from the apoptosis assay includes the number
of the cells stained with Annexin V and/or PI (Fig. 3). The
PI-positive cells are dead cells, and Annexin V-positive cells are
apoptotic cells, indicating that the apoptotic cell death is quan-
titated by the both Annexin V- and PI-positive cells. It should
be noted that culture condition might affect the results, and
viability of the cells is checked by the PI-positive dead cells in
the control staining. Incubation time and number of A. acti-
nomycetemcomitans might affect the results, and reference
strains are needed to measure the leukotoxic activity of
unknown strains.
A. actinomycetemcomitans
Control
infection
0.21 10.97
0.23 4.84
10 5 105
104 104
PI
103
PI
103
102 102
101 101
88.13 6.80 78.43 10.39
101 102 103 104 105 101 102 103 104 105
Specimen_001_3h0.fcs FITC Specimen_001_3hY.fcs FITC
Count: 9606 Count: 9560
FSC-A, SSC-A subset FSC-A, SSC-A subset
Annexin-FITC Annexin-FITC
Fig. 3 Staining pattern of Annexin V-FITC and PI in THP-1 cells infected with or without
A. actinomycetemcomitans Y4 for 3 h. Apoptotic and dead cells are stained with Annexin V and PI,
respectively. Viable and nonapoptotic cells are Annexin/PI. Early apoptotic cells are Annexin V+/PI,
whereas the late apoptotic or dead cells are Annexin V+/PI+
References
1. Nagasawa T, Shimizu S, Kato S et al (2014) on an apoptosis detection system based on
Host–microbial co-evolution in periodontitis phosphatidylserine exposure. Cytometry 31
associated with Aggregatibacter actinomyce- (1):1–9
temcomitans infection. J Oral Biol 56(1):11–17 7. Smith SM, Wunder MB, Norris DA et al
2. Taichman NS, Dean RT, Sanderson CJ (1980) (2011) A simple protocol for using a
Biochemical and morphological characteriza- LDH-based cytotoxicity assay to assess the
tion of the killing of human monocytes by a effects of death and growth inhibition at the
leukotoxin derived from Actinobacillus actino- same time. PLoS One 6(11):e26908
mycetemcomitans. Infect Immun 28 8. Kato S, Muro M, Akifusa S et al (1995) Evi-
(1):258–268 dence for apoptosis of murine macrophages by
3. Brogan JM, Lally ET, Poulsen K et al (1994) Actinobacillus actinomycetemcomitans infec-
Regulation of Actinobacillus actinomycetemco- tion. Infect Immun 63(10):3914–3919
mitans leukotoxin expression: analysis of the 9. Kato S, Sugimura N, Nakashima K et al (2005)
promoter regions of leukotoxic and minimally Actinobacillus actinomycetemcomitans induces
leukotoxic strains. Infect Immun 62 apoptosis in human monocytic THP-1 cells. J
(2):501–508 Clin Microbiol 54(Pt 3):293–298
4. Haubek D, Ennibi OK, Poulsen K et al (2008) 10. Poulsen K, Ennibi OK, Haubek D (2003)
Risk of aggressive periodontitis in adolescent Improved PCR for detection of the highly leu-
carriers of the JP2 clone of Aggregatibacter kotoxic JP2 clone of Actinobacillus actinomyce-
(Actinobacillus) actinomycetemcomitans in temcomitans in subgingival plaque samples. J
Morocco: a prospective longitudinal cohort Clin Microbiol 41(10):4829–4832
study. Lancet 371(9608):237–242 11. He T, Nishihara T, Demuth DR et al (1999) A
5. Majtnerova P, Rousar T (2018) An overview of novel insertion sequence increases the expres-
apoptosis assays detecting DNA fragmentation. sion of leukotoxicity in Actinobacillus actino-
Mol Biol Rep 45(5):1469–1478 mycetemcomitans clinical isolates. J Periodontol
6. van Engeland M, Nieland LJ, Ramaekers FC 70(11):1261–1268
et al (1998) Annexin V-affinity assay: a review
Chapter 19
Lipoprotein Extraction from Microbial Membrane

and Lipoprotein/Lipopeptide Transfection into Mammalian
Cells
Akira Hasebe, Ayumi Saeki, and Ken-ichiro Shibata
Abstract
Microbial lipoproteins/lipopeptides are important virulence factors for periodontal diseases. The mem-
brane lipoproteins from Mycoplasma salivarium or Tannerella forsythia can be easily extracted by exploiting
a characteristic feature of Triton X-114: its aqueous nature at low temperatures (0–4 C), which is absent at
room temperature (25–37 C). Transfection of these lipopeptides into macrophages was performed using
the protein transfection reagent, PULSin.
Key words Microbial lipoprotein, Triton X-114, Mycoplasma salivarium, Tannerella forsythia,
Interleukin-1β, Lipopeptide transfection
1 Introduction
Bacterial surface lipoproteins or mycoplasmal membrane lipopro-

teins/lipopeptides are important virulence factors for periodontal
diseases [1]. Lipoproteins from Tannerella forsythia, a member of
the Red Complex [2], have been reported to induce inflammatory
cytokine production or apoptosis in immune cells [3]. Many studies
reported the biological activities of mycoplasmal lipoproteins, such
as host cell adhesion, cytokine induction, and apoptosis induction
[4–7]. Not only the gram-negative bacteria but also mycoplasmas
may be involved in the pathogenesis of periodontal diseases. Myco-
plasma salivarium was isolated from the periodontal pockets of
diseased subjects at a significantly higher rate than from the gingival
sulci of healthy subjects [8]. Also, the antibody response to Myco-
plasma species is significantly higher in diseased subjects than
healthy subjects [9].
In this study, we introduce the methods to extract membrane
lipoproteins from M. salivarium and T. forsythia using the phase
separation technique of Triton X (TX)-114. This technique exploits
195
196 Akira Hasebe et al.
the property of TX-114 to remain in aqueous state at low tempera-

tures (0–4 C) but promote microcondensation of micelles at
higher temperatures (25–37 C) [10]. Therefore, lipoproteins
extracted using TX-114 at 4 C are separated by the formation of
microcondensed micelles at 25–37 C. To examine stimulatory
activity of these lipoproteins/lipopeptides, they are then trans-
fected into macrophages using an amphipathic transfection reagent
that can transfect proteins and peptides. The reagent contains a
cationic amphiphilic molecule that forms noncovalent complexes
with proteins, which are then internalized via the anionic cell-
adhesion receptors and released into the cytoplasm, where they
disassemble. This method is used to analyze the mechanism of
interleukin-1β (IL-1β) induction by lipoproteins and a synthetic
mycoplasmal lipopeptide [11] since IL-1β is also known to play a
key role in the pathogenesis of periodontal diseases [12].
2 Materials
Prepare all the solution using ultrapure water, such as MilliQ water
and analytical grade reagents.
2.1 M. salivarium 1. M. salivarium ATCC 23064.

and T. forsythia 2. Heat-inactivated horse serum and fetal bovine serum (FBS):
Cultures Heat horse serum and FBS for 30 min at 56 C in a water bath
to inactivate the complement proteins.
3. PPLO broth with supplements: PPLO broth supplemented
with 15% (v/v) heat-inactivated horse serum, 1.5% yeast
extract (w/v), 1% (w/v) L-arginine HCl, 0.05% (w/v) thallium
acetate, and 1000 U/mL penicillin G. Add 850 mL of water to
a glass vial. Weigh 21 g of PPLO broth powder, 15 g of yeast
extract, 10 g of L-arginine hydrochloride, and 0.5 g of thallium
acetate and then add them to water in a glass vial. Autoclave
this base broth. When it has cooled to room temperature,
transfer 10 mL of base broth to a vial of 100,000 U injectable
penicillin G, and mixed well. Return 10 mL of this penicillin G
solution to the base broth and then add 150 mL of heat-
inactivated horse serum.
4. T. forsythia ATCC 43037.
5. Hemin: 50 mg/mL solution. Add 1 g of hemin to 20 mL of
0.1 N NaOH, mix well and store in the dark at 4 C.
6. Menadione: 10 mg/mL solution. Add 0.1 g of menadione to
10 mL of ethanol, mix well and store in the dark at 4 C.
7. Brain heart infusion (BHI) broth with supplements: BHI con-
taining 0.5% (w/v) yeast extract, 5 μg/mL hemin, 0.5 μg/mL
menadione, 0.001% (w/v) N-acetylneuraminic acid, and 0.1%
Lipoprotein Extraction from Microbial Membrane and Lipoprotein/Lipopeptide. . . 197
(w/v) L-cysteine and 5% (v/v) FBS. Add 950 mL of water to a

glass vial. Weigh 37 g of BHI broth powder, 5 g of yeast
extract, 0.01 g of N-acetylneuraminic acid, and 1 g of
L-cysteine, and then add them to 950 mL of water. Add
100 μL of hemin solution and 50 μL of menadione solution.
Autoclave this base broth. After cooling down to room tem-
perature, add 50 mL of heat-inactivated FBS (seeNote 1).
8. Sterile 15-mL tube.
9. Autoclavable 250-mL plastic bottle.
10. Temperature-controlled high-speed centrifuge.
11. TS buffer: 154 mM NaCl, 10 mM Tris–HCl, pH 7.4 contain-
ing 1 mM phenylmethylsulfonyl fluoride (PMSF). Add about
900 mL of water to a glass beaker. Weigh 1.21 g of Tris
(hydroxymethyl)aminomethane and 9 g of sodium chloride,
and then add them to 900 mL of water. Add 10 mL of 100 mM
PMSF and mix to dissolve them completely. Adjust its pH to
7.4 with HCl. Transfer the solution to a cylinder and make up
to 1 L with water. Store at 4 C.
13. Modified Lowry protein assay kit.
14. GasPak and airtight jar.
2.2 Lipoprotein 1. PMSF stock solution: 100 mM PMSF. Add 0.174 g of PMSF
Extraction in 10 mL of dimethyl sulfoxide (DMSO) or isopropanol. Dis-
solve PMSF in DMSO or isopropanol due to its low solubility
in water (seeNote 2).
2. Phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl,
8.1 mM Na2HPO4, 1.5 mM KH2PO4. Add about 900 mL of
water to a glass beaker. Weigh 8 g of NaCl, 0.2 g of KCl, 1.15 g
of Na2HPO4, and 0.2 g of KH2PO4, and then add them to
900 mL of water. Transfer the solution to a cylinder and make
up to 1 L with water.
3. PBS containing 10 mM n-octyl-β-D-glucopyranoside (OG):
Dissolve 1 g of n-octyl-β-D-glucopyranoside in 34.2 mL of
PBS to prepare a 100 mM stock solution, and dilute ten
times with PBS as needed. Store at 4 C.
4. Microcentrifuge (seeNote 3).
5. 20% TX-114: Add 40 mL of TS buffer and 10 mL of TX-114 in
a glass beaker and mix thoroughly with a magnetic stirrer while
maintaining the temperature at 0–4 C (seeNote 4). Store
at 4 C.
6. Ice-cold methanol.
7. Modified Lowry protein assay kit (seeNote 5).
8. Constant-temperature water bath.
9. Ultrasonicator (for T. forsythia).

10. Vortex mixer.
2.3 Lipopeptide 1. Murinebone marrow-derived macrophages (BMMs).

Transfection into 2. PULSin (Polyplus-Transfection, store at 4 C).
Macrophages
3. 20 mM HEPES buffer (store at 4 C).
4. 10 μM FSL-1 (a synthetic lipopeptide derived from M. salivar-
ium) (InvivoGen, in water, store at 20 C).
5. 100 μg/mL Ultrapure Escherichia coli LPS (InvivoGen, in
water, store at 20 C) (seeNote 6).
6. RPMI 1640 medium (Thermo Fisher Scientific).
7. RPMI 1640 medium (Thermo Fisher Scientific) containing
10% (v/v) FBS.
8. 37 C, 5% CO2, cell culture incubator.
9. Cell culture centrifuge with swinging buckets to hold 24-well
cell plates.
10. 24-well cell culture plate.
11. 96-well cell culture plate.
12. Pipette with a volume of 1–500 μL.
13. ELISA kit for IL-1β (e.g., BD Biosciences).
3 Methods
3.1 Bacterial 1. Transfer 10 mL of PPLO broth to a sterile 15-mL tube.

Cultures 2. For preculture, inoculate 1 mL of M. salivarium culture stock
3.1.1 M. salivarium to the broth under aerobic conditions at 37 C and incubate for
Culture 24 h.
3. Add the precultured M. salivarium to 990 mL of PPLO broth.
Culture M. salivarium in aerobic condition at 37 C for
48–72 h.
4. Harvest the M. salivarium cells in an autoclavable 250-mL
plastic bottle by centrifuging at 8000 g for 30 min at 4 C.
5. After discarding the supernatants, add 40 mL of ice-cold TS
buffer to the plastic bottle and suspend the cell pellet with
pipetting (seeNote 7).
6. Transfer the suspension to a 50-mL centrifuge tube and harvest
the M. salivarium cells by centrifuging at 15,000 g for
15 min at 4 C.
7. Repeat steps 5 and 6 twice to remove any leftover suspended
debris from the broth.
8. Suspend the cell pellet in 10 mL of TS buffer and determine the
protein concentration by modified Lowry method. The protein
concentration of the cell suspensions should be adjusted to

2 mg/mL with TS buffer. Store the suspension at 80 C
until further use.
3.1.2 T. forsythia Culture 1. Transfer 10 mL of the BHI broth with supplements to a sterile
15-mL tube.
2. For preculture, inoculate T. forsythia culture into the broth
with a platinum loop for a few times. Immediately start culture
under anaerobic conditions using GasPak and an airtight jar at
37 C and incubated for 2 days.
3. Add the precultured T. forsythia to 990 mL of BHI broth with
supplements. Immediately start preculture under anaerobic
conditions using GasPak and an airtight jar at 37 C for
5–7 days.
4. Harvest the T. forsythia cells in an autoclavable 250-mL plastic
bottle by centrifuging at 8000 g for 15 min at 4 C.
5. After discarding the supernatants, add 40 mL of ice-cold TS
buffer and suspend the cell pellet with pipetting (seeNote 7).
6. Transfer the suspension to a 50-mL centrifuge tube and harvest
the T. forsythia cells by centrifuging at 8000 g for 10 min at
4 C.
7. Repeat step 5 and 6 twice to remove any leftover suspended
debris from the broth.
8. Suspend the cell pellet in 10 mL of TS buffer and determine the
protein concentration by modified Lowry method. The protein
concentration of the cell suspensions should be adjusted to
2 mg/mL with TS buffer. Store the suspension at 80 C
until further use.
3.2 Lipoprotein Lipoprotein extraction by TX-114 phase separation technique

Extraction by TX-114 exploits the characteristic feature of TX-114 to be present as an
Phase Separation aqueous solution at low temperatures (0–4 C), but promote
Method (SeeNote 8) microcondensation of micelles at a higher temperature
(25–37 C). Therefore, it is important to control the temperature
for the extraction of microbial lipoproteins. The procedure is illu-
strated in Fig. 1.
1. In a chilled small glass container (e.g., 20-mL container), add
4.5 mL of mycoplasma or T. forsythia suspension of which
protein concentration adjusted to 2 mg/mL with TS buffer.
For T. forsythia, ultrasonicate the 2 mg/mL suspension by
three sets of 30 s sonication cycles. Keep chilling the container
and sonicate by placing the tip of the sonicator into the cell
suspension.
2. Add 0.5 mL of 20% TX-114 to this container and stir for 2 h
with the help of a magnetic stirrer bar. To maintain the
Transfer Increase
supernatants temperature
Centrifuge
room temperature
Discard AQ -80 ֯C
Add MeOH overnight
Centrifuge
Dsicard AQ Centrifuge
Add TS buffer room temperature
WASH
Increase
temperature
Fig. 1 Flow diagram of TX-114 phase separation for lipoprotein extraction from
M. salivarium or T. forsythia
temperature of the mixture at 0–4 C, put the glass container in

a plastic container filled with ice. Keep mixing for 2 h on ice.
3. Dispense 1 mL of this mixture to chilled microtubes.
4. Centrifuge the tubes at 4 C for 10 min at 15,000 g. Transfer
the supernatants to fresh tubes to remove the sediments.
5. Incubate the tubes at 37 C for 5 min. During incubation, the
clear supernatants turn cloudy, thus indicating the condensa-
tion of detergent micelles.
6. Centrifuge the tubes at room temperature for 10 min at
10,000 g. The upper aqueous (AQ) phase and the viscous
lower detergent (TX) phase are separated into two distinct
layers in the tubes. Since lipoproteins exist in the TX phase,

discard the AQ phase and wash the TX phase as follows.
7. Add 0.8 mL of ice-cold TS buffer to the remaining TX phase in
the microtube kept on ice and mix well with a vortex mixer.
8. Chill the microtube on ice for 5 min. Repeat steps 5 and 6 to
remove any leftover hydrophilic components.
9. After discarding the upper AQ phase, add 0.9 mL of ice-cold
methanol to the TX phase and mix well.
10. Store the microtubes in a deep freezer at 80 C for more than
1 h to precipitate the lipoproteins (seeNote 9).
11. Centrifuge the tubes at 4 C for 10 min at 15,000 g and then
discard supernatants. The sediments contain the desired lipo-
proteins (seeNote 10).
12. Dissolve the sediments with PBS or PBS containing 10 mM
OG, and determine the protein concentration using modified
Lowry method [13].
3.3 Transfection This protocol describes a method for transfection of M. salivarium-

of the Lipopeptide derived lipopeptide FSL-1 into BMMs with the protein transfection
FSL-1 into reagent PULSin to assess the release of IL-1β.
the Macrophages 1. Count the cells and adjust them to 8 105 cells/mL in RPMI
1640 containing 10% FBS.
2. Seed 500 μL/well of cell suspension in a 24-well plate and
incubate at 37 C for 2 h.
3. Add 5 μL of ultrapure E. coli LPS (1 μg/mL) to each well (final
LPS concentration of 10 ng/mL) to prime the cells (seeNote
11).
4. Incubate the plate at 37 C for 4 h.
5. Add 10 μL of FSL-1 (10 μM) to 90 μL of 20 mM HEPES
buffer in a microcentrifuge tube, vortex gently and spin down
briefly.
6. Add 1 μL of the PULSin reagent to this tube, vortex immedi-
ately, spin down briefly and then incubate for 15 min at room
temperature (seeNote 12).
7. Wash cells once with RPMI 1640 basal medium (pre-warmed
at 37 C) and resuspended in 270 μL of the same medium
(seeNote 13).
8. Add 30 μL of FSL-1/PULSin mix to the cells (final FSL-1
concentration of 100 nM) and homogenize by gently swirling
the plate and incubate at 37 C (seeNote 14).
9. At the end of the incubation period, centrifuge the plate at 4 C
for 10 min at 300 g, and carefully transfer 200 μL of the cell
culture supernatant to a fresh 96-well plate (seeNote 15). Store
this plate with the cell culture supernatants at 20 or 70 C

until further use.
10. Analyze the cell culture supernatants by ELISA for IL-1β
according to the manufacturer’s instructions.
4 Notes
1. To keep the broth anaerobic, inoculate T. forsythia immediately

after the addition of heat-inactivated FBS, or store the broth in
an airtight jar with GasPak until further use.
2. Be sure to wear gloves and mask during the treatment of PMSF
due to its harmful nature.
3. Using a microcentrifuge with a swing rotor is recommended
during centrifugation process for lipoprotein extraction. In
another centrifugation, a microcentrifuge with angle rotor
can be used. For centrifugation at 4 C, a temperature-
controlled microcentrifuge is needed.
4. Prepare a large-pore pipette to measure and gently pipet out
TX-114 due to its viscous nature.
5. You can also use any reagents to determine protein
concentrations.
6. The standard LPS preparations extracted by classical methods
are contaminated by other bacterial components, such as lipo-
proteins. The ultrapure LPS is extracted by successive enzy-
matic hydrolysis steps and purified by the phenol-
triethylamine-deoxycholate extraction protocol to remove con-
taminating lipoproteins [14].
7. Discarded supernatants should be sterilized.
8. This method of membrane lipoprotein extraction is applicable
to other mycoplasmas, such as M. pneumoniae and
M. fermentans, and other gram-negative bacteria, such as
E. coli and Porphyromonas gingivalis also.
9. Overnight storage of the microtubes in a deep freezer is
recommended.
10. During the extraction of lipoproteins from gram-negative bac-
teria, it is difficult to avoid contamination with LPS. We use
polymyxin B to decrease the effects of LPS contamination.
11. IL-1β is generally produced extracellularly through two steps.
The first step is the transcription of pro-IL-1β triggered by
pattern recognition receptors such as toll like receptors,
which is referred to as “priming” (e.g., LPS pre-stimulation).
The second step is the maturation of pro-IL-1β by caspase-1 to
Fig. 2 Transfection of FSL-1-Fluorescein (FSL-1-FITC, EMC Microcollections)

with PULSin into the cytosol of BMMs. BMMs were primed with LPS (10 ng/mL)
for 4 h and then transfected with 2 μg/mL of FSL-1-FITC with PULSin. After
incubation for 4 h, the cells were fixed and observed using a confocal
microscope
be activated by the intracellular multiprotein complex,

inflammasome [15].
12. Vortex PULSin reagent for 5 s and spin down before use.
13. The washing step is critical to remove all traces of serum, which
leads to low transfection efficiency.
14. Figure 2 shows the delivery of FITC-labeled FSL-1 with PUL-
Sin to the cytosol of LPS primed-BMMs 4 h after transfection.
15. We measure IL-1β at 4–24 h after transfection [11].
Acknowledgments
This work was supported by JSPS KAKENHI grant numbers

JP19K10066 and JP16H06280. We would like to thank the
Nikon Imaging Center at Hokkaido University for technical
support.
References
1. Kovacs-Simon A, Titball RW, Michell SL 2. Rôças IN, Siqueira JF, Santos KRN, Coelho
(2011) Lipoproteins of bacterial pathogens. AMA (2001) “Red complex” (Bacteroides for-
Infect Immun 79:548–561. https://doi.org/ sythus, Porphyromonas gingivalis, and Trepo-
10.1128/IAI.00682-10 nema denticola) in endodontic infections: a
molecular approach. Oral Surg Oral Med Oral
Pathol Oral Radiol Endod 91:468–471. Mycoplasma species in the mouth. J Infect Dis
https://doi.org/10.1067/moe.2001.114379 123:16–21
3. Hasebe A, Yoshimura A, Into T et al (2004) 10. Wise KS, Kim MF, Watson-McKown R (1995)
Biological activities of Bacteroides forsythus Variant membrane proteins. In: Razin S, Tully
lipoproteins and their possible pathological JG (eds) Molecular and diagnostic procedures
roles in periodontal disease. Infect Immun in mycoplasmology. Elsevier, Amsterdam, pp
72:1318–1325 227–241
4. Hasebe A, Pennock ND, Mu HH et al (2006) 11. Saeki A, Sugiyama M, Hasebe A et al (2018)
A microbial TLR2 agonist imparts Activation of NLRP3 inflammasome in macro-
macrophage-activating ability to apolipopro- phages by mycoplasmal lipoproteins and lipo-
tein A-1. J Immunol 177:4826–4832. peptides. Mol Oral Microbiol 33. https://doi.
https://doi.org/10.4049/jimmunol.177.7. org/10.1111/omi.12225
4826 12. Shibata K (2018) Historical aspects of studies
5. Hasebe A, Mu HH, Cole BC (2014) A poten- on roles of the inflammasome in the pathogen-
tial pathogenic factor from Mycoplasma hominis esis of periodontal diseases. Mol Oral Micro-
is a TLR2-dependent, macrophage-activating, biol 33:203–211. https://doi.org/10.1111/
P50-related adhesin. Am J Reprod Immunol omi.12217
72:285–295. https://doi.org/10.1111/aji. 13. Dulley JR, Grieve PA (1975) A simple tech-
12279 nique for eliminating interference by deter-
6. Into T, Nodasaka Y, Hasebe A et al (2002) gents in the Lowry method of protein
Mycoplasmal lipoproteins induce toll-like determination. Anal Biochem 64:136–141.
receptor 2- and caspases-mediated cell death https://doi.org/10.1016/0003-2697(75)
in lymphocytes and monocytes. Microbiol 90415-7
Immunol 46:265–276 14. Hirschfeld M, Ma Y, Weis JH et al (2000)
7. Shibata K, Hasebe A, Into T et al (2000) The Cutting edge: repurification of lipopolysac-
N-terminal lipopeptide of a 44-kDa mem- charide eliminates signaling through both
brane-bound lipoprotein of Mycoplasma sali- human and murine Toll-like receptor 2. J
varium is responsible for the expression of Immunol 165:618–622. https://doi.org/10.
intercellular adhesion molecule-1 on the cell 4049/jimmunol.165.2.618
surface of normal human gingival fibroblasts. 15. Mariathasan S, Monack DM (2007) Inflamma-
J Immunol 165:6538–6544 some adaptors and sensors: Intracellular regu-
8. Engel L, Kenny G (1970) Mycoplasma salivar- lators of infection and inflammation. Nat Rev
ium in human gingival sulci. J Periodontal Res Immunol 7:31–40. https://doi.org/10.1038/
5:163–171 nri1997
9. Kumagai K, Iwabuchi T, Hinuma Y et al
(1971) Incidence, species, and significance of
Part III
Interactions with Other Pathogenic Microorganism and Host

Cells
Chapter 20
Analysis of the Interaction Between HIV

and Periodontopathic Bacteria That Reactivates
HIV Replication in Latently Infected Cells
Kenichi Imai
Abstract
The acquired immunodeficiency syndrome (AIDS) pandemic caused by the human immunodeficiency virus
(HIV) is a major global health concern affecting 38 million people worldwide. HIV gene expression is the
major determinant of the rate of viral replication leading to the progression of AIDS. The persistence of
cellular reservoirs of HIV proviruses, despite prolonged treatment with antiretroviral drugs, represents the
main obstacle preventing the eradication of HIV. Epigenetic silencing by histone deacetylase (HDAC)
contributes to maintaining HIV transcriptional latency. However, the mechanism of the switch from latency
to full HIV replication is unknown. HIV infection and antiretroviral treatment or a combination of both
contribute to a higher incidence and severity of periodontitis. Periodontopathic bacteria such as Porphyr-
omonas gingivalis and Fusobacterium nucleatum produce high concentrations of butyric acid, which
strongly inhibit HDAC, indicating that periodontitis may mediate the reactivation of HIV replication.
Here we describe a stepwise protocol for analyzing HIV reactivation by periodontal pathogens. However,
the experiments using HIV requires BSL3 containment, making it difficult to handle HIV in dentistry.
Therefore, we present an experimental method using cell lines latently infected with HIV.
Key words HIV, Latent HIV infection, Reactivation, Periodontopathic bacteria
1 Introduction
The cytopathic retrovirus human immunodeficiency virus (HIV) is

the primary cause of acquired immunodeficiency syndrome (AIDS)
and associated disorders. Despite the discovery of HIV-1 in 1983,
we are unable to eliminate the virus from infected patients. The
HIV genome, the prototype human lentivirus, has been found to
encode the virion proteins Gag (p24, p41, and p55), Env, and Pol.
Gag codes for the structural proteins such as capsid, matrix, and
nucleocapsid, Env encodes the glycoproteins gp41 and gp120, and
Pol encodes reverse transcriptase, integrase, and protease. In addi-
tion, HIV has six regulatory genes: tat, rev, nef, vif, vpr, and
vpu [1].
207
208 Kenichi Imai
The transcription of the HIV provirus is the major determinant

of the viral replication rate leading to disease progression. HIV
transcription, which is directed by the promoter located in the
50 -long terminal repeat (LTR) of the integrated provirus, is con-
trolled by cellular factors that bind to the LTR as well as the viral
transactivator Tat [1]. Tat protein is a virus-encoded 86–101 amino
acid regulatory protein that is essential for the replication and
pathogenicity of the virus. HIV-1 gene expression is induced by
extracellular factors such as cytokines and inhibitors of histone
deacetylase (HDAC), including trichostatin A and butyric acid. In
contrast to productively infected cells, transcriptionally silent pro-
viral HIV genomes integrated into heterochromatin persist in
infected cells [1].
Although there is no effective HIV vaccine, antiretroviral ther-
apy (ART) greatly lengthens the survival of patients with AIDS.
However, despite the potency of ART, resting CD4+ T cells remain
latently infected with HIV, allowing the virus to escape the host’s
immune responses [1]. Therefore, viral latency prevents eradication
of HIV. Thus, identifying the molecular mechanisms that maintain
viral latency and reactivation is required to understand the patho-
physiology of HIV infection, which will likely lead to novel preven-
tion and treatment strategies.
Chronic immune activation associated with coinfection by HIV
with other pathogens may represent a critical factor that contri-
butes to the severity and progression of AIDS, which increases the
risk of HIV transmission from infected individuals [2]. A positive
association between HIV infection and chronic periodontitis has
been reported. For example, more periodontopathic bacteria are
present in HIV-positive individuals compared with those of healthy
controls [3, 4]. There is a significant correlation between the stage
of periodontitis and the HIV RNA viral load in plasma and saliva as
well as the HIV proviral DNA load in gingival crevicular fluid
[5, 6]. Moreover, expression of HIV receptors and coreceptors is
increased in association with chronic periodontitis [7]. We have
previously demonstrated that Porphyromonas gingivalis and Fuso-
bacterium nucleatum produce butyric acid, which may induce the
reactivation of latent HIV through inhibition of HDAC [8–
10]. Interestingly, Das et al. reported that butyric acid in the saliva
of patients with chronic periodontitis induces the reactivation of
HIV [11]. Further, P. gingivalis upregulates C-C chemokine recep-
tor type 5 (CCR5) expression by oral keratinocytes to facilitate
subsequent infection by HIV of permissive cells such as macro-
phages in a CCR5-dependent manner [12]. Moreover, the interac-
tion between HIV and the outer membrane vesicles (OMVs) of
P. gingivalis leads to OMV-dependent entry of HIV into oral
epithelial cells [13]. Although additional basic and clinical studies
Reactivation of Latent HIV by Periodontopathic Bacteria 209
of HIV-infected individuals are required, these observations sug-

gest that periodontitis affects HIV activation and the ensuing pro-
gression of AIDS.
This chapter describes the analysis of HIV reactivation
mediated by periodontopathic bacteria.
2 Materials
2.1 Preparation of 1. P. gingivalis strains (FDC381, W83, and ATCC 33277): Cul-
Culture Supernatant ture P. gingivalis strains in brain heart infusion (BHI) broth
and Bacterial Cells supplemented with 5% fetal bovine serum (FBS), 5 μg/mL
hemin, and 0.4 μg/mL menadione in an anaerobic chamber
at 37 C for 48 h.
2. F. nucleatum ATCC 25586: Culture F. nucleatum ATCC
25586 in BHI broth supplemented with 5% FBS, 5 μg/mL
hemin, and 0.4 μg/mL menadione in an anaerobic chamber at
37 C for 48 h.
3. Anaerobic chamber (5% CO2, 10% H2, and 85% N2).
4. 0.22-μm pore size sterilized membrane filter.
5. Phosphate-buffered saline (PBS), pH 7.4.
2.2 Cell Culture (See 1. Human CD4+ T lymphocyte (ACH-2) cell line (National
Note 1) Institute of Allergy and Infectious Diseases, National Institutes
of Health): Maintain at 37 C in RPMI 1640 with 10% FBS,
100 units/mL penicillin, 100 mg/mL streptomycin, and
20 μM azidothymidine (AZT) (see Note 2).
2. Macrophage/monocyte cell line OM10.1 harboring
replication-competent latent HIV-1 (National Institute of
Allergy and Infectious Diseases, National Institutes of Health):
Maintain at 37 C in RPMI 1640 with 10% FBS, 100 units/mL
penicillin, 100 mg/mL streptomycin, and 20 μM AZT (see
Note 2).
3. Human embryonic kidney 293T cell line (American Type Cul-
ture Collection) (see Note 3): Maintain at 37 C in Dulbecco’s
modified Eagle’s medium (DMEM) with 10% FBS.
4. 12-well plate.
5. 0.22-μm pore size sterilized membrane filter.
6. PBS, pH 7.4.
2.3 Stimulation 1. ACH-2 cells (see Subheading 3.2).

Experiments 2. OM10.1 cells (see Subheading 3.2).
3. Culture supernatant (see step 2 in Subheading 3.1).
4. Bacterial cells (see step 4 Subheading 3.1).
210 Kenichi Imai
5. Butyric acid.
6. TNF-α (R&D).
7. Lysis buffer.
2.4 Immunoblotting 1. Cell lysate (see step 3 in Subheading 3.2).

Analysis of HIV 2. 12.5% sodium dodecyl sulfate-polyacrylamide gel electropho-
Antigens resis (SDS-PAGE) gel.
3. SDS-PAGE equipment set.
4. Nitrocellulose membrane.
5. Anti-HIV antibody (see Note 4).
6. Blocking buffer.
7. Wash buffer.
8. Secondary antibody.
9. Kit for detection of chemiluminescence.
2.5 Polymerase 1. Cell lysate (see step 3 in Subheading 3.2).

Chain Reaction (PCR) 2. Kit for extract total RNA.
Analysis of HIV RNA
3. Reverse transcriptase.
Expression
4. DNA polymerase.
5. 1.5% agarose gels.
2.6 Enzyme-linked 1. Cell lysate (see step 3 in Subheading 3.2).

Immunosorbent Assay 2. HIV p24 ELISA kit (Zepto Metrix).
(ELISA) for Detection of
the HIV Core
Protein p24
2.7 Analysis of HIV 1. Human embryonic kidney 293T cell.

Transcription Activity 2. 12-well plate.
by Luciferase Assay
3. The luciferase assay system (Promega).
4. HIV LTR reporter plasmid (CD12-Luc containing wild-type
HIV-1 LTR).
5. Transfection reagent (see Note 5).
6. Lysis buffer (Promega).
7. Luciferase assay system (Promega).
3 Methods
1. Collect the culture supernatant from culture of P. gingivalis

strains or F. nucleatum by centrifugation at 10,000 g for
20 min at 4 C.
3.1 Preparation of 2. Filter the culture supernatant through a 0.22-μm pore size
Culture Supernatant sterilized membrane filter (use as the culture supernatant).
and Bacterial Cells 3. Wash the bacterial suspension three times with PBS.
from Periodontal
4. Standardize the bacterial suspension to 2 106 CFU/mL in
Pathogens 100 μL of RPMI 1640 (use as the bacterial cells) (see Note 6).
3.2 Stimulation Cell lysates prepared in this section are used for detections of HIV
Experiments (Fig. 1) by immunoblotting, PCR and ELISA.
1. Prepare ACH-2 or OM10.1 cells (0.5 106 cells/mL) in
12-well plates (see Note 7).
2. Treat the cells for 48 h with culture supernatant (25–100 μL/
mL of cell culture medium), bacterial cells (0.2 106 CFU),
1–2 mM butyric acid, or 1–2 ng/mL TNF-α for 24 h (see
Note 8).
3. Harvest the cells using the lysis buffer.
3.3 Viral 1. Centrifuge the lysates at 15,000 g for 20 min at 4 C.

Replication Assay 2. Separate the supernatant proteins using SDS-PAGE.
3.3.1 Immunoblotting 3. Transfer the proteins to a nitrocellulose membrane.
Analysis of HIV Antigens 4. Block and wash the membrane according to the usual protocol.
5. Treat the membrane overnight at 4 C with sera from a patient
with AIDS.
6. Treat the washed membrane with secondary antibody for 1 h at
room temperature.
7. Visualize the immune complexes using enhanced chemilumi-
nescence (Fig. 2).
3.3.2 PCR Analysis of HIV 1. Extract total RNA from the lysate according to the manufac-
RNA Expression turer’s instructions.
2. Reverse transcribe 1 μg of total RNA using random primers.
3. Amplify gag and env sequences encoded by the cDNA using
Taq polymerase and specific primers (see Note 9).
4. Electrophorese the PCR products through 1.5% agarose gels.
3.3.3 ELISA for Detection The stimulatory effect of periodontopathic bacteria on cells latently
of the HIV Core Protein p24 infected with HIV are evaluated according to the levels of HIV-1
p 24 produced by ACH-2 and OM10.1 cells.
Measure the p24 levels in cell culture supernatants using a
commercially available p24 antigen-capture ELISA assay according
to the manufacturer’s instructions.
212 Kenichi Imai
Culture supernatant or bacterial cells of

periodontopathic bacteria
Positive control䠖Butyric acid or TNF-a
Stimulation
HIV-latently infected cells HIV-LTR transfected

䠄ACH-2 and OM10.1 ) 293 T cells
Cell lysate Culture

supernatant Cell lysate
䞉Detection of HIV antigen 䞉 Measurement of 䞉 Measurement of

by immunoblot HIV p24 by ELISA transcriptional activity
(See 3.3.1) (See 3.3.3) by luciferase assay
䞉Analysis of HIV RNA (See 3.3.4)
expression by PCR
(See 3.3.2)
Fig. 1 Flowchart of experiments using cells latently infected with HIV-1
p55
p41
p24
Fig. 2 P. gingivalis facilitates the reactivation of HIV replications (Immunoblot

assay). Latent HIV-1–infected ACH-2 cells was incubated with or without TNF-α
(1 ng/mL) or culture supernatants of P. gingivalis (10% v/v) for 48 h. Detection of
various viral proteins in the cell lysate was performed by immunoblotting with
collected sera of AIDS patients. Control bacterial culture medium was added as a
control (“C”). Positions of HIV-1 proteins are indicated from the right. CSP culture
supernatant of P. gingivalis
3.3.4 Analysis of HIV 1. Prepare 293T cells (2 105 cells/mL) in 12-well plates.
Transcription Activity by 2. Insert 10 ng of HIV LTR reporter plasmid into the cells using a
Luciferase Assay transfection reagent.
3. Treat the cells after 24 h with culture supernatant, bacterial
cells, butyric acid, or TNF-α for 24 h.
4. Harvest the cells using the lysis buffer for the luciferase assay.
5. Use a luciferase assay system to measure the transcriptional
activity level of the HIV LTR according to the manufacturer’s
instructions (see Note 10).
4 Notes
1. The ACH-2T cell line, which is chronically infected with

HIV-1, was derived from the parental cell line A3.01 and is
defective for activation of the Tat-TAR axis. HIV Tat-mediated
activation occurs through cytokine-induced activation of
HIV-1 transcription through the host transcription factor
nuclear factor-κB [14]. The OM10.1 cell line, which is chroni-
cally infected with HIV-1, was derived from the HL-60 mye-
lomonocytic leukemic cell line containing a single integrated
copy of HIV-1LAV provirus with an intact Tat-TAR axis
[15, 16]. The cell lines express low levels of viral mRNA,
presumably because of inhibition of transcriptional initiation.
2. To maintain the latency of HIV-1 in the cells, 20 μM AZT are
added in the culture medium but was excluded prior to con-
ducting the experiments.
3. The human embryonic kidney 293T cells used to test the
transcriptional activity of the HIV-1 LTR.
4. An antibody specific for acetylated histones or sera from a
patient with AIDS are used.
5. FUGENE 6 (Promega) and Lipofectamine 2000 (Thermo
Fisher Scientific) are used for transfection of 293T cells.
6. The culture supernatant and bacterial cell samples are stored at
80 C until use.
7. Use a culture medium that does not contain AZT.
8. 1–2 ng/mL TNF-α and 1–2 mM butyric acid are used as
indicators of HIV reactivation, which is observed approxi-
mately 12 h after stimulation. Butyric acid, which inhibits
HDAC activity by competing with the HDAC substrate at
the catalytic center [17, 18], stimulates the transcription of
certain genes including those of HIV. P. gingivalis and
F. nucleatum produce high amounts of butyric acid that inhibit
HDACs [8, 9].
214 Kenichi Imai
9. The primer sequences for gag and env were as follows: gag,
forward (50 -TTG CCA AAG AGT GAC CTG AGG GAA-30 )
and reverse (50 -GGG GGG ACA TCA AGC AGC CAT GC-30 );
env, forward (50 -CTT GCT CTC CAC CTT CTT CTT C-30 )
and reverse (50 -CCA ATT CCC ATA CAT TAT TGT G-30 ) [8].
10. The data are presented as the fold-increases in luciferase activ-
ities (means S.D.) relative to the control of three indepen-
dent transfections.
References
1. Pace MJ, Agosto L, Graf EH et al (2011) HIV 10. Imai K, Okamoto T, Ochiai K (2015) Involve-
reservoirs and latency models. Virology ment of Sp1 in butyric acid-induced HIV-1
411:344–354 gene expression. Cell Physiol Biochem
2. Mbopi-Kéou FX, Bélec L, Teo CG et al (2002) 37:853–865
Synergism between HIV and other viruses in 11. Das B, Dobrowolski C, Shahir AM et al (2015)
the mouth. Lancet Infect Dis 2:416–424 Short chain fatty acids potently induce latent
3. Chattin BR, Ishihara K, Okuda K et al (1999) HIV-1 in T-cells by activating P-TEFb and
Specific microbial colonizations in the peri- multiple histone modifications. Virology
odontal sites of HIV-infected subjects. Micro- 474:65–81
biol Immunol 43:847–852 12. Giacaman RA, Asrani AC, Gebhard KH et al
4. Scully C, Porter SR, Mutlu S et al (1999) Per- (2008) Porphyromonas gingivalis induces
iodontopathic bacteria in English CCR5-dependent transfer of infectious HIV-1
HIV-seropositive persons. AIDS Patient Care from oral keratinocytes to permissive cells. Ret-
STDs 13:369–374 rovirology 5:1–14
5. Maticic M, Poljak M, Kramar B et al (2000) 13. Dong XH, Ho MH, Liu B et al (2018) Role of
Proviral HIV-1 DNA in gingival crevicular Porphyromonas gingivalis outer membrane
fluid of HIV-1-infected patients in various vesicles in oral mucosal transmission of HIV.
stages of HIV disease. J Dent Res Sci Rep 8:8812
79:1496–1501 14. Folks TM, Powell DM, Lightfoote MM et al
6. Shugars DC, Slade GD, Patton LL et al (2000) (1986) Induction of HTLV-III/LAV from a
Oral and systemic factors associated with nonvirus-producing T-cell line: implications
increased levels of human immunodeficiency for latency. Science 231:600–602
virus type 1 RNA in saliva. Oral Surg Oral 15. Clouse KA, Powell D, Washington I et al
Med Oral Pathol Oral Radiol Endod (1989) Monokine regulation of human immu-
89:432–440 nodeficiency virus-1 expression in a chronically
7. Jotwani R, Muthukuru M, Cutler CW (2004) infected human T cell clone. J Immunol
Increase in HIV receptors/co-recep- 142:431–438
tors/α-defensins in inflamed human gingiva. J 16. Butera ST, Perez VL, Wu B-Y et al (1991)
Dent Res 83:371–377 Oscillation of the human immunodeficiency
8. Imai K, Ochiai K, Okamoto T (2009) Reacti- virus surface receptor is regulated by the state
vation of latent HIV-1 infection by the period- of viral activation in a CD4+ cell model of
ontopathic bacterium Porphyromonas chronic infection. J Virol 65:46–55
gingivalis involves histone modification. J 17. Riggs MG, Whittaker RG, Neumann JR et al
Immunol 182:3688–3695 (1977) n-Butyrate causes histone modification
9. Imai K, Yamada K, Tamura M et al (2012) in HeLa and Friend erythroleukaemia cells.
Reactivation of latent HIV-1 by a wide variety Nature 268:462–464
of butyric acid-producing bacteria. Cell Mol 18. Sealy L, Chalkley R (1978) The effect of
Life Sci 69:2583–2592 sodium butyrate on histone modification. Cell
14:115–121
Chapter 21
Invasion of Gingival Epithelial Cells by Porphyromonas

gingivalis
Hiroki Takeuchi and Atsuo Amano
Abstract
Porphyromonas gingivalis is a major pathogen responsible for severe and chronic manifestations of peri-
odontal disease, which is one of the most common infectious disorders of humans. Although human
gingival epithelium prevents intrusions by periodontal bacteria, P. gingivalis is able to invade gingival
epithelial cells. To study the dynamics and the fate of intracellular P. gingivalis, confocal laser scanning
microscopy (CLSM) is a method of choice. Information gained with CLSM contains not only the number
of P. gingivalis associated with gingival epithelial cells but also the bacterial localization on/inside the host
cells, morphological change of host cells, and physical interaction between the bacteria and host organelle.
In this chapter, we describe the protocols for microscopy techniques to morphologically study gingival
epithelial cells infected by P. gingivalis.
Key words Morphology, Confocal microscopy, Porphyromonas gingivalis, Gingival epithelial cell
1 Introduction
Porphyromonas gingivalis is a major pathogen responsible for severe

and chronic manifestations of periodontal disease, one of the most
common infectious disorders occurring in humans. Although
human gingival epithelium prevents intrusions by periodontal bac-
teria, P. gingivalis can invade gingival epithelial cells. To monitor
the localization of P. gingivalis inside gingival epithelial cells, we
often employ indirect fluorescence stain using fixed gingival epithe-
lial cells infected with the bacteria. Because the size of P. gingivalis
is approximately 1 μm in diameter, we generally use confocal
microscopy, by which we are able to acquire high-resolution
images.
We use paraformaldehyde (PFA) to fix three dimensional asso-
ciation of the bacteria with cytoskeletal components and organelle
of gingival epithelial cells (Fig. 1). In the case of fixation by organic
solvents, morphologic changes such as host cells getting “flat”
should be taken into consideration.
215
216 Hiroki Takeuchi and Atsuo Amano
Fig. 1 Confocal microscopic images of PFA-fixed IHGE cells infected with P. gingivalis. (A) IHGE cells stably
expressing monomeric Cherry (mCherry)-tagged FYVE (magenta, early endosome marker) were infected with
P. gingivalis at an MOI of 100 for 1 h. The cells were then fixed with PFA, stained with DAPI (cyan), and
analyzed by confocal microscopy. Higher magnification of the areas indicated by the white boxes in the left
panel are shown at right. Scale bar, 10 μm. Arrow, P. gingivalis in early endosome. (B) IHGE cells stably
expressing enhanced green fluorescent protein (EGFP)-tagged FYVE (yellow) were infected with P. gingivalis at
an MOI of 100 for 1 h. The cells were then fixed with paraformaldehyde, stained with DAPI (cyan), and
analyzed by confocal microscopy. Cross-sectional higher magnification of P. gingivalis in early endosomes in
the left panel are shown at right
40 ,6-diamidino-2-phenylindole (DAPI) is used to confirm the

bacterial localization inside the host cells to stain bacterial DNA
[1, 2]. In order to distinguish the DAPI-stained signal intensities
by detecting the difference between P. gingivalis and host cytosolic
components, the detectors should have high sensitivity and a
dynamic range. One hour after infection, P. gingivalis stained
with DAPI is confirmed in the cytosolic space of gingival epithelial
cells (Fig. 2). Host cell nucleus is also stained with DAPI; however,
DAPI-stained bacteria can be distinguished by their size, that is, the
diameter of the rod-shaped bacteria is about 1 μm, markedly smal-
ler than cell nucleus. In the case of staining bacteria by antibodies
against P. gingivalis, false-positive signals due to nonspecific
Invasion of Gingival Epithelial Cells by Porphyromonas gingivalis 217
Fig. 2 Phalloidin staining of IHGE cells infected with P. gingivalis. IHGE cells were infected with P. gingivalis at
an MOI of 100 for 1 h. The cells were then fixed, stained with DAPI (cyan) and Alexa Fluor 568-Phalloidin
(magenta), and analyzed by confocal microscopy. Higher magnification of the areas indicated by the white
boxes (a, b) in the upper panel are shown in the lower panel. Scale bar, 10 μm. White arrow, invading
P. gingivalis. Red arrow, not invading P. gingivalis
interactions of antibodies with host cellular proteins should be

taken into consideration.
To discriminate intracellular P. gingivalis from the bacteria on
cell surface, we basically employ the following three methods to
label host cells. Phalloidin, a toxin found in Amanita phalloides, can
be used to stain actin, a cytoskeletal component of cells (Fig. 2)

[3]. The merit of phalloidin is that we can easily utilize fluorescent
dye–conjugated peptides. Second, fluorescent protein–expressing
host cells can be used to distinguish cytosol of host cells from
extracellular spaces (Fig. 3) [2]. The merit of this method is that
Fig. 3 Confocal microscopic images of EGFP-expressing IHGE cells infected with P. gingivalis. IHGE cells
expressing EGFP (yellow) were infected with P. gingivalis at an MOI of 100 for 1 h. The cells were then fixed,
stained with DAPI (cyan), and analyzed by confocal microscopy. Higher magnification of the areas indicated by
the white boxes (a, b) in the upper panel are shown in the lower panel. Scale bar, 10 μm. White arrow,
invading P. gingivalis. Red arrow, not invading P. gingivalis
Fig. 4 Confocal microscopic images of biotin-labeled IHGE cells infected with P. gingivalis. IHGE cells were
infected with P. gingivalis for 1 h. The cells were then fixed, labeled with biotin, stained with DAPI (cyan) and
fluorescein isothiocyanate (FITC)-streptavidin (green), and analyzed by confocal microscopy. Higher magnifi-
cation of the area indicated by the white box in the upper panel are shown in the lower panel. Scale bar,
10 μm. White arrow, invading P. gingivalis. Red arrow, not invading P. gingivalis
we do not need to perform further labeling of host cells. To analyze

the distribution of intracellular P. gingivalis in these two methods,
we manually count the bacteria located on the inside 1 μm distant
from the outermost fluorescent signal expressed by host cells.
Third, biotin, a water-soluble B vitamin, can be used to label the
perimeter of host cells in combination with fluorescent-conjugated
streptavidin (Fig. 4) [4, 5]. The merit of this method is to easily
detect extracellular bacteria by colocalization of fluorescent signals.
In this chapter, we describe the protocols using gingival epithelial
cells stably expressing green fluorescent protein (EGFP) to view
invading P. gingivalis in host cells.
2 Materials
Prepare all solutions using deionized and distilled water and analyt-
ical grade reagents.
2.1 P. gingivalis 1. Bacterial strain: P. gingivalis ATCC 33277, a type strain in

American Type Culture Collection (seeNote 1).
2. Blood agar plates.
3. Trypticase soy broth (TSB) medium: 30 mg/mL TSB in water
supplemented with 1 mg/mL yeast extract, 5 μg/mL hemin,
1 μg/mL menadione, and 1 mg/mL L-cysteine hydrochloride.
Autoclave TSB medium in a glass bottle 121 C for 15 min,
cool down to room temperature, and set TSB in anaerobic jar
until just before use.
5. 1.5 mL sampling tubes.
6. Anaerobic jar.
7. Gas generators for anaerobic culture (Mitsubishi Gas
Chemical).
9. UV-transparent cuvettes.
10. Incubator: Use at 37 C.
11. Centrifuge.
2.2 Gingival 1. Immortalized human gingival epithelial (IHGE) cells (epi 4)

Epithelial Cells are kindly provided by Shinya Murakami (Osaka University)
[6] (seeNotes 2 and 3).
2. HuMedia-KG2 (Kurabo).
3. 1.5 mL sampling tubes.
6. 10 cm cell culture dish.
7. 12-well culture plates.
8. Cover glass.
9. Dulbecco’s phosphate buffered saline (PBS), pH 7.4,
sterilized.
10. 0.05% (w/v) trypsin–0.53 mM EDTA∙4Na solution.
11. 0.1% gelatin in PBS.
12. pEGFP-C1 (Clontech).
13. FuGENE6 (Promega).
15. Inverted microscope.

16. Cell counting chambers.
17. Constant temperature bath.
18. CO2 incubator.
19. Clean bench.
20. Centrifuge.
2.3 Confocal 1. Confocal laser scanning inverted microscope system (TCS SP8;
Microscopy Leica Microsystems).
2. Application Suite X software (Leica Microsystems).
3. Immersion liquid.
2.4 Cell Staining 1. PBS, pH 7.4, sterilized.

2. 0.1% gelatin in PBS.
3. 4% PFA in PBS.
4. 0.1% Triton X-100 in PBS.
5. DAPI.
6. Mounting medium for fluorescence.
7. Micro slide glass.
8. Incubation chamber.
3 Methods
3.1 Culturing 1. Streak out P. gingivalis from frozen glycerol stocks onto blood
of P. gingivalis agar plates and grow for 3 days at 37 C under anaerobic
conditions.
2. Pipet 5 mL of TSB medium into 15 mL tube and streak out
P. gingivalis on blood agar plates into TSB medium.
3. Incubate bacteria in culture medium at 37 C under anaerobic
conditions for 24–48 h until bacteria reach their peak infectivity
(final OD600 ¼ 2.0).
3.2 Culturing of IHGE 1. Maintain IHGE cells in HuMedia KG-2 in 10 cm cell culture
Cells dishes.
2. For preparation of bacterial infection, remove spent medium
from a growing culture, wash cells with PBS, and add 1 mL of
trypsin.
3. Once the cells appear detached, add 2 mL of HuMedia KG-2 to
inactivate trypsin.
4. Transfer the cell suspension to the 15 mL tube and gently
centrifuge at 300 g for 5 min.
5. After removing the supernatant, gently resuspend the cell pellet

in HuMedia KG-2.
6. Set a cover glass in the wells of a 12-well plate and coat the glass
with 0.1% gelatin in PBS for 20 min at room temperature.
7. Remove 0.1% gelatin in PBS and seed approximately 8 104
IHGE cells on cover glass.
8. Twenty-four hours after seeding, transfect IHGE cells with
pEGFP-C1 plasmid using FuGENE 6 according to the manu-
facturer’s protocol.
3.3 Infection of Cells 1. 48–72 h after transfection, infect IHGE cells with P. gingivalis
with P. gingivalis at a multiplicity of infection (MOI) of 100 in 12-well culture
plates for 1 h at 37 C in 5% CO2 (seeNote 4).
2. One hour after infection, wash IHGE cells twice with PBS to
remove external nonadherent bacteria.
3.4 Analysis Using 1. Fix IHGE cells with 4% PFA in PBS for 10 min at room
Confocal Microscopy temperature, permeabilize cells with 0.1% Triton X-100 in
PBS for 5 min at room temperature, and block cells with
0.1% gelatin in PBS for 20 min at room temperature (seeNote
5).
2. Dilute DAPI 1:400 in PBS. Incubate cells with dye for 1 h at
room temperature, followed by washes twice in PBS.
3. Mount cells onto glass slides using mounting medium for
fluorescence to label the bacterial and cellular DNA.
4. Acquire images with a confocal laser microscope using a 64
oil-immersion object lens with a numerical aperture of 1.4.
Analyze images using the Application Suite X software (seeNote
6).
4 Notes
1. We confirmed that KDP133 (P. gingivalis ΔrgpA ΔrgpB [7])

almost lacks the ability to invade IHGE cells (Fig. 5). We also
confirmed that KDP129 (P. gingivalis Δkgp [8]) is capable of
invading IHGE cells. These results suggest that P. gingivalis
ΔrgpA ΔrgpB, but not Δkgp, can be used for negative control
for assays of P. gingivalis invasion into gingival epithelial cells.
2. To analyze the effect of your target gene of gingival epithelial
cells on bacterial invasion, knockdown and knockout systems
are well worth considering. IHGE cells are useful in that we are
able to transfect cells with exogenous genes, including protein
expressing vector, small interfering RNA, and small hairpin
RNA [9]. We confirmed that CRISPER-Cas9 system can also
be used with IHGE cells.
Fig. 5 Confocal microscopic images of IHGE cells infected with P. gingivalis WT, Δkgp, or ΔrgpA ΔrgpB
mutant. IHGE cells expressing EGFP (yellow) were infected with P. gingivalis WT, Δkgp, or ΔrgpA ΔrgpB
mutant at an MOI of 100 for 1 h. The cells were then fixed, stained with DAPI (cyan), and analyzed by confocal
microscopy. Scale bar, 10 μm. White arrow, invading P. gingivalis. Red arrow, not invading P. gingivalis
3. The telomerase immortalized human gingival keratinocyte

(hTERT TIGKs, CVCL_M095, ATCC) can also be used to
analyze the intracellular localization of P. gingivalis [1, 10].
4. IHGE cells not infected with P. gingivalis should also be
prepared to adjust the laser power and to set the condition of
the detector. We confirmed that gingival epithelial cells have
autofluorescence but much weaker than the fluorescence of
DAPI-stained P. gingivalis. A comparison between infection
and no infection is needed to acquire appropriate images.
5. We confirmed that necessary and sufficient treatment of fixed

cells by detergents is needed to eliminate background fluores-
cent signal in cytosolic space and to acquire a sharp image of
DAPI-stained P. gingivalis.
6. To confirm our observations of bacterial invasion, scan a
z series with 0.4 μm intervals. To detect intracellular P. gingi-
valis in, change the contrast of confocal microscopic images as
described previously [2]. Briefly, count bacteria located inside
of IHGE cells as intracellular P. gingivalis, but do not count
bacteria on the marginal region or outside of IHGE cells
(Fig. 3).
Acknowledgments
We thank the Center for Oral Science, Graduate School of Den-

tistry, Osaka University for technical support with confocal laser
microscopy. This research was supported by Scientific Research
(C) Grant Number 19K10085 (to H.T.) and Scientific Research
(A), Grant Number 18H04068 (to A.A.) from the Japan Society
for the Promotion of Science.
References
1. Takeuchi H, Hirano T, Whitmore SE et al enhanced iNOS mRNA expression by gingival
(2013) The serine phosphatase SerB of Por- epithelial cells. J Dent Res 81(4):236–240
phyromonas gingivalis suppresses IL-8 produc- 7. Nakayama K, Kadowaki T, Okamoto K et al
tion by dephosphorylation of NF-κB RelA/ (1995) Construction and characterization of
p65. PLoS Pathog 9(4):e1003326 arginine-specific cysteine proteinase (Arg-gin-
2. Nakagawa I, Amano A, Mizushima N et al gipain)-deficient mutants of Porphyromonas
(2004) Autophagy defends cells against invad- gingivalis. Evidence for significant contribu-
ing group A Streptococcus. Science 306 tion of Arg-gingipain to virulence. J Biol
(5698):1037–1040 Chem 270(40):23619–23626
3. Furuta N, Takeuchi H, Amano A (2009) Entry 8. Okamoto K, Nakayama K, Kadowaki T et al
of Porphyromonas gingivalis outer membrane (1998) Involvement of a lysine-specific cysteine
vesicles into epithelial cells causes cellular func- proteinase in hemoglobin adsorption and heme
tional impairment. Infect Immun 77 accumulation by Porphyromonas gingivalis. J
(11):4761–4770 Biol Chem 273(33):21225–21231
4. Tsuda K, Amano A, Umebayashi K et al (2005) 9. Takeuchi H, Sasaki N, Yamaga S et al (2019)
Molecular dissection of internalization of Por- Porphyromonas gingivalis induces penetration
phyromonas gingivalis by cells using fluorescent of lipopolysaccharide and peptidoglycan
beads coated with bacterial membrane vesicle. through the gingival epithelium via degrada-
Cell Struct Funct 30(2):81–91 tion of junctional adhesion molecule 1. PLoS
5. Furuta N, Tsuda K, Omori H et al (2009) Pathog 15(11):e1008124
Porphyromonas gingivalis outer membrane 10. Moffatt-Jauregui CE, Robinson B, de Moya
vesicles enter human epithelial cells via an AV et al (2013) Establishment and characteri-
endocytic pathway and are sorted to lysosomal zation of a telomerase immortalized human
compartments. Infect Immun 77 gingival epithelial cell line. J Periodontal Res
(10):4187–4196 48(6):713–721
6. Murakami S, Yoshimura N, Koide H et al
(2002) Activation of adenosine-receptor-
Chapter 22
Analysis of Interaction Between Porphyromonas gingivalis

and Endothelial Cells In Vitro
Kenji Matsushita
Abstract
Chronic periodontitis is the most common periodontitis observed in adults. Recently, its association with
systemic diseases such as ischemic heart–brain disease and diabetes has been pointed out. Porphyromonas
gingivalis, a major causative bacterium of chronic periodontitis, has properties of adhering to blood vessels
and inducing inflammation, and those properties are involved in the induction of vascular inflammation and
promotion of atherosclerosis. Therefore, analysis of the interaction of P. gingivalis with vascular endothelial
cells will contribute to an understanding of the link between periodontitis and vascular lesions.
Key words Periodontitis, Porphyromonas gingivalis, E-Selectin, Exocytosis, Nitric oxide, von
Willebrand factor
1 Introduction
Pathogenic bacteria exhibit virulence by attaching to and invading

and parasitizing host cells. Bacteria that enter cells have resistance
to the host’s immune system and antibiotics [1, 2]. They can also
use the nutrients in cells and survive there. Thus, bacterial invasion
into host cells is an important process for bacterial survival. There
are two major processes in the invasion process: attachment to the
host cell and subsequent internalization into the host cell. In the
process of attachment, it is important that the ligand and its recep-
tor are present on the bacterial side and the host cell side, and the
increase or decrease of these molecules greatly affects the adhesion
between the bacterium and the host cell.
Porphyromonas gingivalis is considered to be a major pathogen
of adult periodontitis. It has also been pointed out that it is related
to systemic diseases such as ischemic diseases [3, 4]. This bacterium
is frequently detected in atherosclerotic plaques of the arterial wall
[5, 6]. The bacterium also is frequently detected in a sample of a
limb occluded artery in patients with Buerger disease [7]. P. gingi-
valis specifically binds to E-selectin expressed on the surface of
225
226 Kenji Matsushita
vascular endothelial cells and attaches to vascular endothelial cells

[8]. It has been suggested that this leads to the colonization of
P. gingivalis on the blood vessel wall and the subsequent induction
of an inflammatory response. An in vitro analysis of P. gingivalis and
vascular endothelial cells, their attachment and invasion, and the
induction of vascular inflammation are outlined in this chapter.
2 Materials
2.1 Bacterial Strains 1. Bacteria: P. gingivalis ATCC 33277 and P. gingivalis W83
and Growth Conditions (ATCC BAA-308) from American Type Culture Collection.
2. Brucella HK agar with blood (BHK-Blood agar): Brucella HK
agar (Kyokuto Pharmaceutical Industrial Co., Ltd.) supple-
mented with 5% laked rabbit blood, degassed (see Note 1).
3. Trypticase soy broth (TSB): Trypticase soy broth
(BD) supplemented with 2.5 mg/mL yeast extract, 2.5 μg/
mL hemin, 5 μg/mL menadione, and 0.1 mg/mL
dithiothreitol.
4. Anaerobic jar and anaerobic bag (Mitsubishi Gas Chemical).
5. Incubator.
6. 50-mL centrifuge tube.
7. Centrifuge.
8. Phosphate buffered saline (PBS), pH 7.4: Store at 4 C.
9. Phenol red-free Dulbecco’s Modified Eagle’s Medium
(DMEM).
2.2 Cells and Culture 1. Human umbilical vein endothelial cells (HUVECs)
Conditions (Cambrex).
2. Human aortic endothelial cells (HAECs) (Cambrex).
3. Endothelial Growth Medium 2 (EGM-2) with a Bullet kit
supplements: Provided from Lonza, which is supplemented
with a Bullet kit supplement containing growth factors and
cytokines (Lonza) and with 2% fetal bovine serum (FBS). Gen-
tamicin and amphotericin-B are also added.
4. Phenol red-free DMEM.
5. Cell dissociation solution: PBS containing 0.25% trypsin and
1 mM ethylenediaminetetraacetic acid (EDTA), pH 7.4.
6. 100-mm tissue culture dish.
7. CO2 incubator.
2.3 P. gingivalis 1. Tumor necrosis factor-α (TNF-α) stock: recombinant human

Adherence to TNF-α (PeproTech Inc.). Store at 80 C (see Note 2).
Endothelial Cells
Analysis of Interaction Between Porphyromonas gingivalis. . . 227
2. Lab-Tek II chamber slide (Nalge Nunc International).

3. Cell coating buffer: PBS supplemented with 50 μg/mL rat tail
collagen (BD).
4. 4% (w/v) paraformaldehyde.
5. Permeabilizing buffer: PBS containing 0.05% Triton X-100.
6. PBS containing 5% (w/v) bovine serum albumin (BSA).
7. Antiserum to P. gingivalis whole cells.
8. Alexa Fluor 488-conjugated goat anti-rabbit IgG
(Invitrogen Co.).
9. Alexa Fluor 568-conjugated phalloidin (Invitrogen Co.).
10. ProLong Gold antifade reagent (Invitrogen Co.).
11. Fluorescence microscopy (Keyence Co.).
2.4 P. gingivalis 1. 12-well flat-bottom culture plate.

Invasion into 2. Phenol red–free DMEM containing 200 mg/mL metronida-
Endothelial Cells zole and 300 mg/mL gentamicin (see Note 3).
3. Sterile distilled water.
4. BHK-Blood agar (see item 2 in Subheading 2.1).
2.5 P. gingivalis- 1. 12-well flat-bottom culture plate.

Induced NO Production 2. 96-well plate.
3. 2,3-diaminonapthalene (DAN) reagent (Sigma Chemical),
which is dissolved in 0.62 N HCl at a concentration of
0.05 mg/mL just before conducting the experiment.
4. Sodium nitrite.
5. Luminescence spectrometer.
2.6 P. gingivalis- 1. 24-well plate.

Induced vWF Release 2. 50 ng/mL TNF-α (see item 1 in Subheading 2.3).
3. von Willebrand factor (VWF) ELISA kit (American Diagnostic
Inc.).
3 Methods
3.1 Bacterial Cell 1. Inoculate P. gingivalis on BHK-Blood agar into TSB and grow
Culture for 2 days in an anaerobic jar until OD 660 nm reaches 1.0.
2. Transfer the bacterial culture to a 50-mL centrifuge tube and
centrifuge at 3000 g for 10 min at 4 C.
3. Aspirate the supernatant.
4. Resuspend gently with cold PBS.
5. Repeat steps 5–7 three times.

6. Resuspend bacterial cells in phenol red-free DMEM.
3.2 Endothelial Cell 1. Culture HUVECs or HAECs in EGM-2 medium with the
Culture Bullet kit supplements in 100-mm tissue culture dish in CO2
incubator.
2. Change the growth medium the day after seeding and then
every other day.
3. Passage the cells using cell dissociation solution. The cells are
used usually between five and ten passages in all experiments.
4. Phenol red-free DMEM (without antibiotics) is added to
HUVECs or HAECs before they are treated with P. gingivalis.
3.3 Analysis of P. 1. Add the cell coating buffer to Lab-Tek II chamber to coat the
gingivalis Adhesion to chamber with a collagen.
Endothelial Cells 2. After discarding the cell coating buffer, seed 100 μL of
HUVECs or HAECs (2 106 cells) in the Lab-Tek II
chamber.
3. Incubate for 24 h in a CO2 incubator. Confirm that the cells
have grown to almost full confluency in each well.
4. Add 25 μL of 50 ng/mL TNF-α to the wells (see Note 4).
5. Incubate for 3 h in a CO2 incubator.
6. Add P. gingivalis cells (108 cells/mL) to the HUVEC mono-
layer cells at an MOI of 1:100.
7. Incubate the cells for 0.5–3 h in a CO2 incubator.
8. Wash each well with 100 μL of PBS three times by gentle
rinsing for 5 min at room temperature.
9. Fix the cells with 50 μL of 4% (w/v) paraformaldehyde at 4 C
overnight.
10. Gently wash the cells three times with PBS.
11. Permeabilize the cells with 100 μL of permeabilizing buffer at
room temperature for 30 min.
12. Wash the cells once with 100 μL of PBS.
13. Block with 100 μL of PBS containing 5% (w/v) BSA at room
temperature for 30 min.
14. Add an antiserum for P. gingivalis whole cells (1:1000 dilution
with PBS) in each well for 60 min at room temperature.
15. Wash the cells five times with 100 μL of PBS.
16. Incubate with Alexa Fluor 488–conjugated goat anti-rabbit
IgG (1:1000 dilution with PBS) and 1 μg/mL Alexa Fluor
568-conjugated phalloidin for 60 min at room temperature in
the dark.
A B
P. gingivalis Actin Overlay
6000 TNF-a (-) *
Number of P. gingivalis cells

TNF-a (+)
TNF-a (-) 5000
0.5 h
TNF-a (+) 4000 *

0.5 h
3000
TNF-a (-)
2000
1h *
TNF-a (+)
1000
1h
0
30 min
0.5 1h
1 33h
TNF-a (-)
Time after addition (h)
3h
TNF-a (+)
3h
Fig. 1 Adherence of P. gingivalis to HUVECs is enhanced by stimulation with TNF-α. (a) HUVECs were
incubated with TNF-α (10 ng/mL) for 0.5–3 h. P. gingivalis ATCC 33277 cells (108 cells/mL in each well)
were then added to the culture medium for 0.5–3 h. Cells were then washed, and attachment of P. gingivalis
to the cells was observed by fluorescence microscopy. P. gingivalis was stained with Alexa Fluor 488 (green),
and actin of endothelial cells was visualized with Alexa Fluor 568 (red). (b) HUVECs were incubated with TNF-α
(10 ng/mL) for 0.5–3 h. P. gingivalis ATCC 33277 cells (108 cells/mL in each well) were then added to the
culture medium for 0.5–3 h. Cells were then washed, and attachment of P. gingivalis to the cells was observed
by fluorescence microscopy. The attachment levels are expressed as numbers of P. gingivalis cells per
60,430 mm2 (means standard deviations [SD] [n ¼ 3]). *P < 0.01 versus no TNF-α (Modified from Ref. 6)
17. Gently wash ten times with 100 μL of PBS.

18. Mount chamber slides onto a slide containing ProLong Gold
antifade reagent.
19. Photograph adherent bacteria (stained with Alexa 488) on the
cell surface in three or selected fields of view in each well by
fluorescent microscopy. (An example of fluorescent microscopy
to detect bacterial adhesion to endothelial cells is shown in
Fig. 1.)
3.4 P. gingivalis 1. Seed HUVECs or HAECs in a 12-well flat-bottom culture

Invasion into plate at a cell density of 2.0 105 cells/well.
Endothelial Cells 2. Incubate overnight. Confirm that the cells have grown to
almost full confluency in each well.
3. Add a P. gingivalis suspension (2.0 107 cells/ well) to each

well (MOI ¼ 1:100).
4. Incubate at 37 C in a CO2 incubator for 2 h.
5. Wash gently with PBS three times to remove unattached
bacteria.
6. Add phenol red-free DMEM containing 200 mg/mL of met-
ronidazole and 300 mg/mL of gentamicin.
7. Incubate in a CO2 incubator for 1 h.
8. Wash gently with PBS twice.
9. Add 1 mL of sterile distilled water per well (see Note 5).
10. Repeat pipetting for 1 min under an aerobic condition.
11. Dilute lysates and plate on BHK-Blood agar and then incubate
anaerobically at 37 C for 10 days.
12. Count the number of bacterial colonies on BHK-Blood agar.
13. Express invasion efficiency as the percentage of the initial inoc-
ulum recovered after antibiotic treatment and endothelial cell
lysis.
3.5 P. gingivalis- 1. Seed HUVECs or HAECs in a 12-well flat-bottom culture

Induced NO Production plate with 500 μL of phenol red–free DMEM (see Note 5) at
a cell density of 3.5 105 cells/well.
2. Incubate overnight. Confirm that the cells have grown to
almost full confluency in each well.
3. Add a P. gingivalis suspension to each well (MOI ¼ 1:100).
4. Incubate at 37 C in a CO2 incubator for 30 min.
5. Collect 100 μL of the culture supernatant in each well and
apply to a 96-well plate in triplicate.
6. Add 10 μL of DAN reagent to each well.
7. Leave at room temperature for 10 min.
8. Read the plate on a luminescence spectrometer (excitation
360 nm, emission 440 nm) (see Notes 6 and 7).
9. Make standard curves daily with sodium nitrite ranging from
0.04 to 10 μM in phenol red-free DMEM. (An example of
using ELISA to measure NO production is shown in Fig. 2.)
3.6 P. gingivalis- 1. Plate HUVECs or HAECs in a 24-well plate with 250 μL

Induced vWF Release medium per well.
2. Grow overnight.
3. Make sure the cells are confluent the next morning.
4. Change the medium to prewarmed EGM-2 medium without
serum and without Bullet kit supplements (see Notes 8 and 9).
25 TNF-a (-)
*
TNF-a (+)
20
NO2- (mmol/l)
15
10
0
P. gingivalis -1 +2 +3 -4
Anti-E-selectin Abs - - + +
Fig. 2 P. gingivalis–induced nitric oxide release from activated endothelial cells is mediated by E-selectin.
HUVECs were incubated with TNF-α (10 ng/mL) for 3 h. Cells were then washed and incubated with
P. gingivalis ATCC 33277 (108 cells/mL in each well) for 30 min in the presence or absence of an antibody
for E-selectin. The release of nitric oxide into the medium was measured by a DAN assay. Data are
means standard deviations [SD] [n ¼ 3]. *P < 0.01 versus no TNF-α (Reprinted from Ref. 6)
5. Add 25 μL of 50 ng/mL TNF-α and incubate for 3 h in a CO2

incubator (see Note 4).
6. Add a suspension of P. gingivalis to each well of TNF-α-treated
endothelial cells at an MOI of 100.
7. Incubate for 30–60 min.
8. Harvest the supernatant.
9. Add the supernatant to VWF ELISA kit and add cell media
standards. Watch the assay carefully; the moment the color of
any sample turns blue, stop the entire assay with a stop buffer.
10. Measure the OD at 450 nm in a spectrophotometer. (An ex-
ample of using ELISA to measure VWF release is shown in
Fig. 3.)
4 Notes
1. Degassing: Use a hardened agar medium that has been left for
one day in an anaerobic environment such as in an
anaerobic jar.
2. TNF-α stocks are defrosted, and then the excess is discarded.
The defrosted stocks never refrozen or rethawed.
3. This concentration of the antibiotic was sufficient to
completely kill 108 bacteria/mL in 1 h.
4. TNF-α induces E-selectin expression on endothelial cells and
increases adherence of P. gingivalis to endothelial cells [8].
4
TNF-a (-)
+TNF-a (+)
3
vWF (mU/ml)
2
0
0 0.5 1
Time (h)
Fig. 3 Endothelial VWF exocytosis in response to P. gingivalis is augmented by

pretreatment with TNF-α. HUVECs were incubated with TNF-α (10 ng/mL) for
3 h. Cells were then washed and incubated with P. gingivalis ATCC 33277 (108
cells/mL in each well) for 0–1 h. The release of VWF into the medium was
measured by ELISA. Data are means SD (n ¼ 3) (Reprinted from Ref. 6)
5. This process is for lysing endothelial cells.

6. The production level of NO varies depending on the cell lot or
passage number. Therefore, preliminary experiments need to
be performed to determine the conditions that produce a
higher level of NO.
7. If you want to measure both NO2 and NO3 concentrations,
reduce NO3 in the culture medium to NO2 with nitrate
reductase (14 mU) and NADPH (40 μM) at room temperature
for 5 min [9]. Collect media and perform the DAN assay as
described in text.
8. Media were void of any interfering components such as dithio-
threitol, protein, FBS, phenol red, and hemoglobin.
9. Do not shake cells or move plates quickly because sudden
movements will cause VWF release.
References
1. Finlay BB, Falkow S (1989) Common themes in 3. Garcia RI, Henshaw MM, Krall EA (2001) Rela-
microbial pathogenicity. Microbiol Rev 53 tionship between periodontal disease and sys-
(2):210–230 temic health. Periodontology 25:21–36
2. Isberg RR (1991) Discrimination between intra- 4. Seymour GJ, Ford PJ, Cullinan MP et al (2009)
cellular uptake and surface adhesion of bacterial Infection or inflammation: the link between
pathogens. Science 252(5008):934–938
periodontal and cardiovascular diseases. Futur 7. Iwai T, Inoue Y, Umeda M et al (2005) Oral
Cardiol 5(1):5–9 bacteria in the occluded arteries of patients with
5. Kozarov EV, Dorn BR, Shelburne CE et al Buerger disease. J Vasc Surg 42(1):107–115.
(2005) Human atherosclerotic plaque contains https://doi.org/10.1016/j.jvs.2005.03.016
viable invasive Actinobacillus actinomycetemco- 8. Komatsu T, Nagano K, Sugiura S et al (2012)
mitans and Porphyromonas gingivalis. Arterios- E-selectin mediates Porphyromonas gingivalis
cler Thromb Vasc Biol 25(3):e17–e18 adherence to human endothelial cells. Infect
6. Mougeot JC, Stevens CB, Paster BJ et al (2017) Immun 80(7):2570–2576
Porphyromonas gingivalis is the most abundant 9. Kleinhenz DJ, Fan X, Rubin J et al (2003)
species detected in coronary and femoral Detection of endothelial nitric oxide release
arteries. J Oral Microbiol 9(1):1281562 with the 2,3-diaminonapthalene assay. Free
Radic Biol Med 34(7):856–861
Part IV
Animal Model of Periodontitis

Chapter 23
Analysis of Experimental Ligature-Induced Periodontitis

Model in Mice
Hikaru Tamura, Tomoki Maekawa, Takumi Hiyoshi, and Yutaka Terao
Abstract
Periodontitis is one of the most prevalent chronic inflammatory diseases in humans. However, the disease
has been hard to study, majorly because it has been difficult to establish a reproducible animal model.
Nonetheless, the ligature-induced periodontitis model in rodent has shown some promise. Here we
describe a simplified systematic method to analyze periodontal pathogenesis using quantitative polymerase
chain reaction, immunohistochemistry, and bone phenotype in ligature-induced periodontitis murine
model. We provide detailed experimental methods and also provide notes that will help to carry out the
procedure successfully.
Key words Periodontitis, Ligature-induced periodontitis, Inflammation, Animal model, Bone

resorption
1 Introduction
Periodontitis is the most prevalent chronic inflammatory disease in

humans. Although gram-negative anaerobic bacteria have been
related to clinical periodontal disease, particularly pocket depth
and bleeding on probing [1], it has been difficult to establish a
reproducible animal model, largely because these bacteria exert
pathogenicity only in humans. Furthermore, the concept of micro-
bial specificity in the etiology of periodontal diseases has been
widely suggested, and different forms of periodontal disease have
been associated with qualitatively distinct dental plaques [2]. None-
theless, several animal models for periodontal disease have been
used in the study of periodontal pathogenesis and potential thera-
peutic approaches. Oral inoculation periodontitis model estab-
lished by Baker et al. [3] was widely used in mice study. However,
oral gavage model needs at least 24 weeks to initiate bone loss
induced by periodontitis [4]. In this regard, the ligature-induced
periodontitis model causes bone loss within a few days. Inoculation
of oral bacteria can affect not only local gingiva, but also change the
237
238 Hikaru Tamura et al.
gut microbiota composition, which is associated with impaired gut

barrier function [5]. Such oral bacteria have been suggested to
become systemic via periodontitis and directly affect other organs
[6, 7]. The ligature model also exhibits systemic dissemination of
oral bacteria. Bacterial colony formation was found in a culture of
liver and spleen cells after persistent ligature placement. Interest-
ingly, the extractions of those infected tooth inhibited systemic
dissemination of oral bacteria and local inflammation in oral
mucosa [8]. Therefore, it is considered that the ligature-model
could mimic human periodontitis as well as oral inoculation
model in mouse. In addition, tooth ligation models can also be
used to investigate the influence on systemic diseases such as ath-
erosclerosis, diabetes and rheumatoid arthritis. It has been devel-
oped in rodent [9] (mice and rat) or nonhuman primate
[6, 10]. Here, we show a simplified and systematic method to
analyze periodontal pathogenesis using quantitative polymerase
chain reaction (qPCR), immunohistochemistry, and bone pheno-
type in ligature-induced periodontitis model in mice.
2 Materials
2.1 Animals 1. BALB/c mice, male or female, 6- to 12-week-old:

Nihon CLEA.
2. C57BL/6NCrl mice male or female, 6- to 12-week-old:
Charles river.
2.2 Ligation 1. A 5–0 silk suture.

2. Forceps Perry 13 cm, curved.
3. Micro forceps 11.5 cm, No. 5 angle.
4. Suture-tying forceps.
5. Dumont Mini Forceps.
6. Vannas scissors (spring type) (Fig. 1).
7. Flexible-arm dissection light.
8. Needle (26-G).
9. A 3–0 silk suture.
10. Rubber band.
11. Styrene foam 30 cm 20 cm.
12. Isoflurane.
13. NARCOBIT-E type II (inhalation anesthesia apparatus): Nat-
sume Seisakusho (Fig. 2a).
14. Dedicated inhalation anesthesia basket (Fig. 2b).
Ligature-Induced Periodontitis Mice Model 239
Fig. 1 Tools for ligature model in mice. From left to right, 5–0 Silk suture, forceps (Perry) Curved, micro
forceps, Suture-tying forceps, Dumont Mini Forceps, Vannas shears (spring type)
Fig. 2 (a) Inhalation anesthesia device. NARCOBIT-E type II: Natsume Seisakusho (Tokyo, Japan). (b)
Dedicated inhalation anesthesia basket for induction of anesthesia
2.3 Microinjection 1. Hamilton micro syringe 701RN (Fig. 3).

2. Forceps (Perry) 13 cm curved: Bioresearch Center (Fig. 3).
3. Flexible-arm dissection light.
4. Isoflurane.
Fig. 3 (a) Tools for microinjection. From left to right, forceps (Perry) Curved, Hamilton micro syringe 701RN. (b)
Enlarged view of the needle tip of Hamilton micro syringe 701RN
5. NARCOBIT-E type II (inhalation anesthesia apparatus): Nat-

sume Seisakusho.
6. Dedicated inhalation anesthesia basket.
2.4 Bone Analysis 1. Micro forceps 11.5 cm No. 5 angle.

2. Dumont mini forceps.
3. Scissors.
4. Centrifuge tube.
5. Autoclave.
6. Hydrogen peroxide.
7. Ultrasonic cleaning.
8. Clay (see Note 1).
9. Leica EZ4W (Stereoscopic microscope): Leica Microsystems.
10. Methylene Blue Hydrate.
11. CosmoScan GX (high-resolution micro scanner): Rigaku Cor-
poration (Fig. 4).
2.5 Tissue Analysis 1. 4% paraformaldehyde (PFA, pH 7.4).

2. Decalcifying solution B (EDTA, pH 7.5).
3. Optimal cutting temperature compound.
Fig. 4 High-resolution micro scanner CosmoScan GX (Rigaku Corporation,

Tokyo, Japan)
4. Cryostat.
5. Dumont mini forceps.
6. Microtome blade (C35 type).
7. Liquid nitrogen.
8. Aluminum foil (see Note 2).
2.6 Molecular 1. 15C scalpel blades.

Analysis 2. Dish (internal diameter 8.5 cm).
3. All Prep DNA/RNA Mini Kit: Qiagen.
4. SuperScript VILO IV Mastermix: Thermo Fisher scientific,
store at 20 C.
5. 1.5 mL tube.
6. Spectrometer.
2.7 Bacteria Analysis 1. Phosphate buffered saline (PBS).

2. 1.5 mL tube.
3. Vortex mixer.
4. Blood agar plate (Sheep).
5. Bacteria spreader.
6. AnaeroPack Kenki: SUGIYAMA-GEN CO., LTD.
7. AnaeroPack square jar: SUGIYAMA-GEN CO., LTD.
3 Methods
3.1 Breeding C57BL/6NCrl mice or BALB/c mice are maintained in individu-

ally ventilated cages and provided sterile food and water ad libitum
under specific pathogen-free conditions. It is recommended to use
male BALB/c mice because the alveolar bone resorption response
is most obvious in it [11–13]. All animal experiments are approved
by the Institutional Animal Care and Use Committee of each
University.
3.2 Ligation 1. NARCOBIT-E type II is used according to the instructions. In

short, add the isoflurane, turn on the machine, and set the flow
rate. Place the mouse in a dedicated inhalation anesthesia bas-
ket filled with isoflurane for 5 min.
2. After the anesthesia, mount the mouse for ligation. For mount-
ing, place the mouse on the styrene foam on the back and stick
a 26-G needle in both ears for fixing. Subsequently, switch the
inflow of inhalation anesthetic to the tube, and apply the tube
to the mouse’s nose (see Note 3).
3. Hook the maxillary anterior teeth with a rubber band applied
to styrene foam. Attach the 3–0 silk suture to the hand of the
two needles and hook the suture on the mandibular anterior
teeth. One needle is stuck at ~1 cm from the mouse neck, and
the other needle is stuck at ~2 cm from tip of the tail, while
pulling the mandibular anterior teeth firmly with a silk suture
until the mouth is fully opened (Fig. 5).
4. Cut the 5–0 suture in 10 cm and hold at 1 cm from the end
using the tip of forceps. Press the tip of the forceps against the
interdental region of the third molar and the second molar, and
hold and press the suture into the interdental region using the
other forceps (see Note 4) (Fig. 6b).
5. Hold the suture with the tip of forceps and press against the
interdental region of the second molar and the first molar, and
hold and press the suture into the interdental region using the
other forceps (see Note 5) (Fig. 6c).
Fig. 5 Picture of mouse mounted for ligation. Stick a needle in both ears and put
a rubber band on the upper front teeth. Pull and fix the mandible front teeth with
silk thread with ends tied to the needle
6. Pull the suture firmly and tie the square knot tight (see Note 6).
7. Cut excess suture from the knot with a scissors (Fig. 6d).
3.3 Microinjection 1. After anesthesia, mount the mouse and open its mouth (see
steps 1–3 in Subheading 3.2).
2. Microinject into the palatal gingiva with Hamilton micro
syringe. The insertion position should be approximately
3 mm from palatal side of the first molar, and the needle tip is
advanced to the second molar palatal gingiva as it slides over
the palatal bone (see Note 7).
3. Inject slowly so as to penetrate compound into the entire palate
gingiva on one side (see Note 8) (see Fig. 7).
3.4 Bone Analysis 1. Mount and open mouth immediately after sacrificing. Remove
the suture and cut it approximately 4 mm with a scissors. Put
the cut suture into a 1.5 mL tube containing 1 mL PBS (see
Subheading 2.7).
2. Cut the neck, and then stick the 26-G needle in both ears and
nose for mounting. Start cutting from both angle of the mouth
Fig. 6 (a) The maxillary molars of the mouse. (b) Pass the 5–0 silk suture through interdental area between
second molar and third molar with micro forceps (no. 5 angle) and Dumont Mini Forceps. (c) Pass the 5–0 silk
suture through interdental area between first molar and second molar with micro forceps (no. 5 angle) and
Dumont Mini Forceps. (d) Pull the suture firmly and tie square knot tight with Suture-tying forceps. Cut excess
suture from the knot with a scissors
Fig. 7 Trypan blue infusion. Due to the palatine suture, the injected reagent remains on one side
Fig. 8 (a) The sampling gingival area on the ligature side (red line), and the un-ligated side (blue line). Cut out
the gingiva of the part surrounded by a line with 15C scalpel blades and Dumont Mini Forceps. (b) The gingiva
can be collected in one set as shown
and advance parallel to the occlusal surface, resulting in com-

plete opening. Remove the mandibula with scissors and stick it
with a needle for mounting, such that the maxillary molars can
be seen clearly.
3. Cut the palatal gingiva from the third molar to the first molar,
which was surrounded by the line as shown in Fig. 8, with 15C
blades and collect in a dish containing fluid of the All Prep
DNA/RNA Mini Kit (see Note 9) (see Subheading 2.6).
4. Put the head in a beaker of water, cover with aluminum foil and
autoclave at 121 C for 8 min. This makes it easy to remove the
soft tissue attached to the bone.
5. After autoclaving, get rid of the skin and remove the excess
loose soft tissue with fingers. Remove the mandibula and cra-
nial bone with scissors and forceps for separating the maxilla
(Fig. 9a).
6. Completely remove the soft tissue attached to the maxillary
bone and place the maxillary bone in a test tube containing
2 mL hydrogen peroxide; subject it to ultrasonic cleaning for
15 min. Then, store it at 4 C, overnight in a hydrogen perox-
ide (Fig. 9b).
7. Wash the hydrogen peroxide solution with distilled water
(DW) and dry it.
8. Soak sample in methylene blue in a petri dish for 1 min. Then,
wash the sample with sufficient DW until excess stain is cleared
(Fig. 9c).
9. Check for remaining soft tissue in teeth and alveolar bone using
a microscope; if present, remove gently with a toothbrush and
dry at room temperature (Fig. 9d).
Fig. 9 (a) After autoclaving, excess soft tissue was removed from the maxilla. (b) It was then soaked in
hydrogen peroxide, rinsed for 15 min with an ultrasonic cleaner, and soaked overnight. (c) Then, it was
immersed in 5% trypan blue for 1 min and washed with distilled water. (d) Soft tissue and dirt were carefully
removed using a toothbrush. (e) A lump of clay slightly larger than the sample. (f) Fix the sample arcus
zygomaticus into the clay
Untreated
0.5 0.5
Ligated + PBS
0.5 0.5
Ligated + REP
0.5 0.5
Fig. 10 Representative image of a bone specimen. Representative images of 3D reconstructed with micro CT
scanning and stereoscopic microscope from indicated groups (scale bar ¼ 0.5 mm). REP: Rice endosperm
protein
10. Make a lump of clay with slightly larger than the sample
(Fig. 9e). Flatten the bottom of the clay and fix the sample
arcus zygomaticus into the clay and adjust the molar alveolar
bone surface of the palate and the microscope lens in parallel
(Fig. 9f).
11. Measure the distances from the cementoenamel junction to
alveolar bone crest (CEJ-ABC) on the palatal side of ligature
site using a microscope (see Note 10 and Fig. 10) [14].
12. In this study, the sample from the maxillae of the tooth ligation
mouse model is scanned using a high-resolution micro scanner
CosmoScan GX. Micro CT is run with isometric resolution of
20 μm; the X-energy is set at 90 kV and 88 μA with an exposure
time of 14 min. The CosmoScan GX software is used to recon-
struct the three-dimensional image (Fig. 10) [14].
3.5 Tissue Analysis 1. Cut the neck and remove the mandibula and cranial bone with
scissors.
2. Immerse in 4% PFA overnight. Then, remove excess soft tissue,
other than maxillary gingiva, and place it in the case of
decalcification mesh.
C
C C
PDL PDL
PDL
B B B
Untreated PBS REP
Fig. 11 Example of a stained maxillary bone section. Representative sections with tartrate-resistant acid
phosphatase (TRAP) and hematoxylin stain of maxillae at indicated groups; arrows indicate TRAP+ osteoclasts.
REP: Rice endosperm protein. C cementum, PDL periodontal ligament, B alveolar bone
3. Immerse the sample in a beaker containing 500 mL of decalci-

fying solution B (EDTA) and stir. Maintain adequate water
flow and decalcify it for a week at 4 C.
4. Confirm the degree of decalcification of the hard tissue after
1 week (if insufficient, extend the immersion in the decalcifica-
tion solution). Make a cup of aluminum foil just enough to
hold the sample (see Note 11). Put the sample in the cup and
fill it with the compound. Freeze from the bottom of the cup
with liquid nitrogen (see Note 12) [14].
5. Set the cryostat to 30 C. Cut samples to 10 μm thickness
with a microtome blade and attach a section of approximately
four pieces per plate (see Note 13).
6. Store at 80 C until staining of the sections. Examples of
TRAP and nuclear stained sections are shown in Fig. 11.
3.6 Molecular 1. Prepare mRNA using All Prep DNA/RNA Mini Kit RNA.
Analysis 2. Measure the RNA absorbance (see Note 14).
3. Perform cDNA synthesis with SuperScript VILO IV
Mastermix.
4. Perform qPCR using a probe of the gene of your interest.
3.7 Bacteria Analysis 1. Vortex the tube with ligature for 1 min 30 s (see Note 15).
2. Dilute the PBS in the tube after agitation by ten-, 100-, 1000-,
and 10,000-fold.
3. Inoculate 100 μL of each dilution per blood agar plate.
4. Culture the cells overnight in aerobic or anaerobic conditions
at 37 C.
5. Select the appropriate plate of dilution (1000- or 10,000-fold
dilution) suitable for counting colonies (see Note 16).
4 Notes
1. Clay is convenient for mounting when observing bone with a

microscope.
2. Make 1-cm diameter cups of aluminum foil. Cups are easily
shaped using the round part of a pen tip.
3. Appropriate airflow and nose pressure should be maintained. If
the positive pressure on the mouse is too strong, the anesthetic
could flow into the digestive tract, leading to death.
4. Grasp 1 cm from the end of the ligature with forceps. Holding
the ligature too long will result in no force being applied to the
interdental area, which may subsequently cause buccal mucosa
injury.
5. Push the tip of the Dumont mini forceps with a ligature into
the interdental area and separate the teeth slightly to make it
easier for the ligature to enter.
6. Tying the ligature strongly by suture-tying forceps or hand is
important. A weak knot may cause the ligature to get detached.
7. Aim the cut face of the needle to the bone surface. The needle
insertion position should be set to the gingiva on the anterior
side of the gingiva from which the sample is collected. This
reduces the influence of inserting the needle into the gingiva as
much as possible. Advance the needle slowly without force so
that the gingiva does not come off the teeth.
8. If injected rapidly, the drug solution would leak out. Further,
hold the needle for approximately 5 s after injection and then
remove the needle to minimize the leakage of the drug
solution.
9. The gingiva on the unligated side is firmly attached to the
teeth. Therefore, it is important to place the scalpel firmly.
10. Alveolar bone resorption also occurs in the first molar distal
and in the third molar mesial. Therefore, the distance measure-
ment of CEJ-ABC should be set to a total of 5–7 places
including the first molar distal, the third molar mesial, and
the second molar against one section.
11. It is best to use 0.5 mol/L EDTA solution for decalcification,
otherwise bone is completely dissolved, which will lead to
failure of TRAP/ALP staining.
12. Pour a small amount of compound into the cup and set up such
that the sample is erected upon solidifying with liquid nitrogen.
Then, fill the cup completely with the compound and freeze
again with liquid nitrogen.
13. When pouring the compound into the cup take care that no air
bubble enters the cup. Air bubbles might cause the section to
break when cutting.
14. A total of 2 μg of RNA can be collected from the plate gingiva
on one side.
15. If the vortex time is short, the bacteria will not be diffused, and
the colony number will be incorrect.
16. In our experimental results, ~5.0 105 colony count is
obtained when collected 1 week after ligation.
References
1. Socransky SS, Haffajee AD, Cugini MA, Iwakura Y, Nakashima T, Okamoto K, Takaya-
Smith C, Kent RL Jr (1998) Microbial com- nagi H (2018) Host defense against oral micro-
plexes in subgingival plaque. J Clin Periodon- biota by bone-damaging T cells. Nat Commun
tol 25(2):134–144 9(1):701
2. Christersson LA, Zambon JJ, Genco RJ (1991) 9. Abe T, Hajishengallis G (2013) Optimization
Dental bacterial plaques. Nature and role in of the ligature-induced periodontitis model in
periodontal disease. J Clin Periodontol 18 mice. J Immunol Methods 394(1–2):49–54
(6):441–446 10. Maekawa T, Abe T, Hajishengallis E, Hosur
3. Baker PJ, Evans RT, Roopenian DC (1994) KB, DeAngelis RA, Ricklin D, Lambris JD,
Oral infection with Porphyromonas gingivalis Hajishengallis G (2014) Genetic and interven-
and induced alveolar bone loss in immunocom- tion studies implicating complement C3 as a
petent and severe combined immunodeficient major target for the treatment of periodontitis.
mice. Arch Oral Biol 39(12):1035–1040 J Immunol 192(12):6020–6027
4. Maekawa T, Takahashi N, Tabeta K, Aoki Y, 11. Shusterman A, Salyma Y, Nashef A, Soller M,
Miyashita H, Miyauchi S, Miyazawa H, Wilensky A, Mott R, Weiss EI, Houri-Haddad-
Nakajima T, Yamazaki K (2011) Chronic oral Y, Iraqi FA (2013) Genotype is an important
infection with Porphyromonas gingivalis accel- determinant factor of host susceptibility to
erates atheroma formation by shifting the lipid periodontitis in the collaborative cross and
profile. PLoS One 6(5):e20240 inbred mouse populations. BMC Genet 14:68
5. Arimatsu K, Yamada H, Miyazawa H, 12. Costalonga M, Batas L, Reich BJ (2009)
Minagawa T, Nakajima M, Ryder MI, Effects of Toll-like receptor 4 on Porphyromo-
Gotoh K, Motooka D, Nakamura S, Iida T, nas gingivalis-induced bone loss in mice. J
Yamazaki K (2014) Oral pathobiont induces Periodontal Res 44(4):537–542
systemic inflammation and metabolic changes 13. Valerio MS, Basilakos DS, Kirkpatrick JE,
associated with alteration of gut microbiota. Sci Chavez M, Hathaway-Schrader J, Herbert
Rep 4:4828 BA, Kirkwood KL (2017) Sex-based differen-
6. Olsen I (2008) Update on bacteraemia related tial regulation of bacterial-induced bone
to dental procedures. Transfus Apher Sci 39 resorption. J Periodontal Res 52(3):377–387
(2):173–178 14. Tamura H, Maekawa T, Domon H, Hiyoshi T,
7. Han YW, Wang X (2013) Mobile microbiome: Yonezawa D, Nagai K, Ochiai A, Taniguchi M,
oral bacteria in extra-oral infections and inflam- Tabeta K, Maeda T, Terao Y (2019) Peptides
mation. J Dent Res 92(6):485–491 from rice endosperm protein restrain periodon-
8. Tsukasaki M, Komatsu N, Nagashima K, tal bone loss in mouse model of periodontitis.
Nitta T, Pluemsakunthai W, Shukunami C, Arch Oral Biol 98(2):132–139
INDEX
A methods
enzymatic activity, butyryl-CoA:acetate CoA
Acquired immunodeficiency syndrome (AIDS) .......... 207 transferases................................................... 169
Affinity chromatography............144, 145, 147, 150, 151 GS-MS analysis ..........................................170–171
Aggregatibacter actinomycetemcomitans
Annexin V-FITC ..................................................... 193 C
apoptosis .................................................................. 186
Annexin V................................................. 188, 190 Carbobenzoxy-L-histidyl-L-glutamyl-L-lysine-4-
DNA laddering......................................... 187, 190 methylcoumaryl-7-amide (Z-His-Glu-Lys-
LDH release ............................................. 188, 191 MCA) ............................................................. 99
leucocytes.................................................. 186, 187 Carbobenzoxy-L-phenylalanyl-L-arginine-4-
THP-1 ............................................................... 189 methylcoumaryl-7-amide
leukotoxin................................................................ 185 (Z-Phe-Arg-MCA) ........................................ 99
dental plague preparation ........................ 186, 188 Carbonate–bicarbonate transfer buffer ........................ 153
PCR........................................................... 186, 188 C-C chemokine receptor type 5 (CCR5) .................... 208
THP-1 ..................................................................... 191 Chemiluminescence (CL) response ........... 103, 108, 109
Anti-Pgm6/7 antibody................................................. 153 Chromatography buffer (CB) ...................................... 138
Antiretroviral therapy (ART)........................................ 208 Confocal microscopy .......................... 215–219, 221–223
Apoptosis ....................................................................... 186 Coomassie brilliant blue (CBB) ...............................78, 82
Arginine (R)-specific (Rgp) gingipain Cross-linking mass spectrometry ........................ 114, 118
FimA .......................................................................... 98 Cryo containers ............................................................... 93
proteinase inhibitors ................................................. 98 Cryo-electron microscopy ............................................ 118
RgpA .......................................................................... 97 Crystallization
RgpB .......................................................................... 97 additives ..................................................................... 93
substrates pH, solution .............................................................. 93
BApNA................................................................. 99 plates .......................................................................... 91
Boc-Phe-Ser-Arg-MCA ...................................... 99 premade screens ........................................................ 91
KYT-1 and KYT-36........................................... 111 Crystallization, fimbrial proteins of P. gingivalis
Z-Phe-Arg-MCA................................................. 99 commercial crystallization kits ................................. 89
Azidothymidine (AZT) ................................................ 209 cryo crystallography ............................................89, 90
cryoprotection of crystals ......................................... 91
B crystal growth............................................................ 94
crystallization drops .................................................. 91
Bacteroidetes phylum...................................................... 33
initial screening ......................................................... 89
Biotin ............................................................................. 219 optimization .............................................................. 89
Bone marrow-derived macrophages (BMMs) ............. 198 protein crystallization ......................................... 90–91
Bradford method........................................................... 164
X-ray diffraction data ................................................ 91
Brain heart infusion (BHI) ............................63, 196, 209 C-terminal domain (CTD) ........................................... 123
Butyrate Cys-Cys cross-linking.................................. 62, 65, 68, 70
metabolic pathway .................................................. 167
oral cavity................................................................. 167 D
periodontal pockets................................................. 167
SCFAs in bacterial culture ...................................... 170 Deionized water (DIW).................................................. 62
Butyrate-producing pathway, in P. gingivalis Density gradient centrifugation .........161, 162, 164, 165
materials Dentilisin ....................................................................... 173
colorimetric assay .............................................. 168 Dimethyl sulfoxide (DMSO)........................................ 197
GC-MS assay ..................................................... 169 Dispersity ......................................................................... 93
vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2, © Springer Science+Business Media, LLC, part of Springer Nature 2021
251
PERIODONTAL PATHOGENS: METHODS AND PROTOCOLS
252 Index
Dot blot analysis................................................. 62, 65, 68 p-nitroanilide substrates.................................... 101
Dulbecco’s modified Eagle’s medium (DMEM) ........ 209 protein substrates .............................................. 100
Rgp, substrates .................................................... 99
E sample preparation ........................................ 98–99
10 luminol-dependent CL........................103–104
Endothelial Growth Medium 2 (EGM-2)................... 226
Enzyme-linked Immunosorbent Assay (ELISA)......... 210 ultrapure water .................................................... 98
Ethylenediaminetetraacetic acid (EDTA) .................... 138 vascular permeability in vivo............................. 104
methods
F caseinolytic activity....................................106–107
gelatin zymography........................................... 107
Fetal bovine serum (FBS) .................................... 196, 209 hemoglobin-hydrolyzing activity ..................... 106
FimA fimbriae.................................................................. 75 luminol-dependent CL response of
fimA type-specific primer sets......................................... 54 neutrophils................................................... 108
Fimbriae sample preparation ............................................ 104
extracellular proteins/protein polymers .................. 87 using MCA substrates ....................................... 105
gram-negative bacteria.............................................. 88 using p-nitroanilide substrates .................105–106
Fimbrial proteins vascular permeability in vivo............................. 108
characterization ......................................................... 88 Gingipains.......................................................61, 124, 158
gram-positive bacteria ............................................... 87 cysteine proteinases ................................................... 97
gram-positive protein................................................ 88 functions .................................................................... 98
intramolecular isopeptide bonds .............................. 88 gelatin zymography................................................. 107
polymerization mechanism ....................................... 87 inhibition, gingipain activity................................... 111
Freeze Throw Buffer (FTB) ........................................... 35 Kgp............................................................................. 97
French pressure cell press (French press) .................... 153 proteinase inhibitors ................................................. 98
Fusobacterium nucleatum vascular permeability ................................98, 108, 110
bacterial strains/plasmids ......................................... 46 virulence .................................................................... 98
fadA-complemented mutant Gingipains Rgp................................................................ 97
DNA construct.................................................... 48 Globomycin treatment..............................................65–67
sonoporation ....................................................... 49 Glycoproteins ................................................................ 144
fadA-deletion mutant detection of glycosylated proteins.......................... 148
DNA construct.................................................... 47 molecular marker .................................................... 147
sonoporation ....................................................... 48 in P. gingivalis ......................................................... 144
genetic tools .............................................................. 43 Pro-Q Emerald........................................................ 153
genomic analysis ........................................................ 43 Glycosylated OmpA-like proteins, separation method
plasmid DNA............................................................. 44 Ficoll PM400 .......................................................... 153
primers ....................................................................... 45 materials
sonoporation techniques .......................................... 44 bacterial whole-cell lysates ................................ 146
transformation ........................................................... 44 detection of proteins ......................................... 147
bacterial preparation ........................................... 46 glycoprotein stain .............................................. 148
sonoporation ....................................................... 47 growth of bacterial cells ............................145–146
lectin affinity chromatography ......................... 147
G
SDS-PAGE ........................................................ 147
Gas chromatography–mass spectrometry (GC-MS) western blotting ........................................148–149
assay ......................................................................... 168 methods
SCFAs detection............................................. 169–171 detection of proteins ......................................... 150
Gene replacement ......................................................... 5, 7 detection, glycosylated proteins .............. 150, 151
Gingipain characteristics and activities growth of anaerobic bacterial cells ................... 149
materials lectin affinity chromatography ......................... 150
caseinolytic activity............................................ 102 preparation, bacterial whole-cell lysates........... 149
gelatin zymography...................................102–103 SDS-PAGE ........................................................ 150
hemoglobin-hydrolyzing activity ..................... 101 solubilization, bacterial whole-cell lysates ....... 149
Kgp, substrates ............................................99–100 western blotting ........................................151–152
MCA substrates .........................................100–101 WGA lectin affinity chromatography ..................... 151
Index 253
H substrates
Boc-Val-Leu-Lys-MCA....................................... 99
Hemagglutination test ....................................... 36, 38, 39 KYT-1 and KYT-36........................................... 111
Hemagglutinin/adhesin (HA) ..................................... 124 L-Lysine-p-nitroanilide dihydrobromide ........... 99
Histone deacetylase (HDAC)....................................... 208 Z-His-Glu-Lys-MCA.......................................... 99
Homologous recombination ........................................ 5, 7 Lysine methylation.......................................................... 95
Human aortic endothelial cells (HAECs).................... 226
Human immunodeficiency virus (HIV) ............. 207–209 M
Human umbilical vein endothelial cells
(HUVECs)................................................... 226 Membrane vesicles (MVs)
bacteria-host interactions........................................ 157
I description ............................................................... 157
isolation method (see Isolation method from
Immortalized human gingival epithelial (IHGE) ....... 220 P. gingivalis MVs)
Interleukin-1β (IL-1β) .................................................. 196 Mfa1 fimbriae .................................................................. 84
Intranasal immunization, mouse model ............. 160, 163 Micro seeding.................................................................. 94
Isolation method from P. gingivalis MVs Microbial lipoprotein .................................................... 199
materials Minimum inhibitory concentration (MIC)................... 12
cultivation of P. gingivalis ................................ 158 Molecular weight cutoff (MWCO).............................. 138
density gradient centrifugation ........................ 159 Mycoplasma salivarium
intranasal immunization ................................... 160 cultures ........................................................... 196–199
MV preparation ........................................ 158, 159 FSL-1-Fluorescein................................................... 203
quantification of lipids ..............................159–160 lipopeptide FSL-1 ................................................... 200
methods lipopeptide transfection .......................................... 198
intranasal immunization, MVs to mice............ 163 lipoprotein extraction .................................... 197, 198
MV preparation .........................................160–162 lipoproteins..................................................... 195, 196
quantification of lipids ...................................... 161 TX-114 phase separation technique ............. 199–201
L N
Lactate dehydrogenase (LDH) .................................... 186 N-acetylmuramic acid (NAM) .............................. 25, 137
Legionaminic acid residue ............................................ 136 Nα-Benzoyl-DL-arginine 4-nitroanilide (BApNA) ........ 99
Leukotoxin .................................................................... 185
Ligature-induced periodontitis .................................... 237 O
animal model ........................................................... 238
bacterial analysis ............................................. 242, 248 OmpA-like proteins
bone analysis................................................... 240, 243 bioactivity ................................................................ 144
breeding................................................................... 242 extracellular matrix proteins ................................... 144
inhalation anesthesia device .................................... 239 lectin blot analysis ................................................... 144
ligation ................................................... 238, 242, 243 O-GlcNAc modification ......................................... 144
ligature model ......................................................... 239 separation method (see Glycosylated OmpA-like
maxillary molars, mouse ......................................... 244 proteins, separation method)
micro CT scanning.................................................. 247 WGA lectin-agarose ................................................ 145
micro scanner .......................................................... 241 with 1% DDM ......................................................... 144
microinjection ....................................... 239, 240, 243 Open reading frame (ORF)............................................ 22
molecular analysis........................................... 241, 248 Optimization
tissue analysis .................................................. 240, 244 crystallization, P. gingivalis fimbrial proteins .... 89–91
Lipid quantification
P
MVs, P. gingivalis .......................................... 159–161
Lipopeptide transfection............................................... 198 Palmitic acid labeling experiment ..................... 65, 67, 68
Lipopolysaccharide (LPS) ................................................. 3 Periodontal disease.......................................................... 15
L-Lysine-p-nitroanilide dihydrobromide ....................... 99 and systemic diseases............................................... 143
Luria–Bertani (LB) broth ............................................... 45 Periodontal pathogen ..................................................... 75
Lysine (K)-specific (Kgp) gingipain Periodontitis .......................... 53, 54, 135, 225, 237, 238
autoproteolytic processing........................................ 98 Periodontopathic bacteria.................................... 208, 209
proteolytic and adhesin domains.............................. 98 cell culture ............................................................... 209
254 Index
Periodontopathic bacteria (cont.) gingipains.................................................................. 97,
culture supernatant ................................................. 210 (see also Gingipains)
ELISA ...................................................................... 210 gingival epithelial cells ............................................ 215
HIV antigens ........................................................... 210 globomycin treatment ........................................ 65–67
HIV replications ...................................................... 212 gram-negative bacterium .......................................... 97
HIV-1 ...................................................................... 212 growth conditions ................................................... 226
luciferase assay ......................................................... 210 host cells .................................................................. 218
PCR.......................................................................... 210 IHGE .............................................................. 216–223
stimulation experiments................................. 209–211 immunoblotting ........................................... 64, 65, 78
viral replication infection of cells ...................................................... 222
ELISA ................................................................ 211 intranasal immunization, mouse model........ 160, 163
HIV RNA expression ........................................ 211 invasion to endothelial cells.................. 227, 229, 230
immunoblotting ................................................ 211 isolation/purification ................................... 78, 80, 81
luciferase assay ................................................... 213 Mfa1 fimbriae ............................................... 81, 83, 84
Periodontopathogenic bacteria .................................... 167 MVs (see Membrane vesicles (MVs))
Phalloidin....................................................................... 217 nested PCR................................................................ 57
Phalloidin staining ........................................................ 217 NO production .............................................. 227, 230
Phosphate buffered saline (PBS).......................... 36, 114, OmpA-like proteins ................................................ 145
220, 242 palmitic acid labeling experiment................ 65, 67, 68
Polymerase chain reaction (PCR) .................................. 53 PCR......................................................................55, 56
Polyvinylidene difluoride (PVDF).................................. 78 pili .............................................................................. 62
Porphyromonas gingivalis .................................................. 3 PorK/N complex isolation ............................ 116, 117
adherence................................................................. 229 PorK/N complex purification ....................... 114, 115
adherence to endothelial cells ................................ 226 purity of fimbriae
adhesion to endothelial cells.......................... 228, 229 electron microscopy ............................................ 83
ATCC........................................................................... 4 immunoblotting ............................................82, 83
bacterial DNA ........................................................... 56 SDS-PAGE .......................................................... 82
BHI ............................................................................ 63 random mutagenesis
biotin........................................................................ 219 colony immunoblotting........................... 7, 10, 11
cell culture ...................................................... 226–228 transposon ......................................................... 7, 9
cell staining .............................................................. 221 rRNA-specific primers............................................... 57
chronic inflammation and tooth loss ....................... 87 samples/culture......................................................... 54
clinical sample collection .......................................... 55 SDS ......................................................................63, 64
confocal microscopy....................................... 221, 222 SDS-PAGE .................................................78, 82, 117
cross linking......................................... 65, 68, 70, 116 site-directed mutagenesis
crystallization, fimbrial proteins (see Crystallization, competent cell ................................................... 6, 8
fimbrial proteins of P. gingivalis) culture conditions ..................................................7
cultivation .................................................................. 77 culture media/antibiotics ......................................6
culture .......................................................79, 220, 221 DNA constructs ................................................ 6–8
DNA extraction...................................................55, 56 electroporation .................................................. 6, 9
dot blot ................................................................65, 68 soluble fraction............................................. 77, 79, 80
electron microscopy .................................... 65, 66, 68, T9SS
71, 79, 115 colony pigmentation ................................ 126, 129
cross-linking mass spectrometry.............. 118, 119 complemented strains .............................. 125, 126
cryo .................................................................... 118 conjugative transfer ........................................... 129
negative staining................................................ 118 deficient mutant ....................................... 124, 125
electrophoresis........................................................... 55 drug resistant mutant........................................ 128
E-selectin ........................................................ 225, 231 gingipains........................................................... 124
fimA gene ..................................................... 54, 56, 58 HA ..................................................................... 124
fimbriae ................................................ 3, 4, 54, 75, 76 hemagglutination test .............................. 126, 130
fimbriae-deficient mutants........................................ 10 multidrug-drug resistant mutant ..................... 128
genetic variations....................................................... 53 progingipains ....................................126, 129, 130
genetics ........................................................................ 4 subcellular fractionation .......................... 127, 131
supernatant protein .................................. 127, 131
Index 255
vector plasmid ...........................................127–129 culturing ......................................................... 136–138
vector plasmid into E.coli.................................. 129 electrocompetent cells ........................................27, 28
type-V fimbriae.......................................................... 88 electroporation .......................................................... 26
virulence factors .......................................97, 143, 167 isolation, glycosylated OmpA-like proteins
vWF release.............................................227, 230–232 (see Glycosylated OmpA-like proteins,
Prevotella melaninogenica separation method)
bacterial conjugation................................................. 34 mutant ................................................................25, 29,
chromosomal structure ............................................. 38 (see also Mycoplasmasalivarium)
conjugative transfer .............................................37, 38 outer membrane proteins .............................. 144, 145
E.coli........................................................................... 36 partial purification .......................................... 137–139
ermF ........................................................................... 38 SDS-PAGE .............................................................. 141
hemagglutination test .........................................36, 38 separation of virulence factors ................................ 144
mutant ....................................................................... 34 size exclusion chromatography ..................... 138, 140
pathogenic factors ..................................................... 34 S-layer ...................................................................... 136
phagocytosis .............................................................. 34 target gene................................................................. 27
polymicrobial diseases ............................................... 33 transformation ........................................................... 29
pork-deletion mutant ................................................ 35 virulence factors ...................................................... 143
suicide plasmid vector ............................................... 37 Tartrate-resistant acid phosphatase (TRAP)................ 248
suicide vector plasmid ............................................... 36 t-Butyloxycarbonyl-L-phenylalanyl-L-seryl-L-arginine-4-
Propionyl-CoA .............................................................. 171 methylcoumaryl-7-amide (Boc-Phe-Ser-Arg-
Pro-Q Emerald.............................................................. 153 MCA) ............................................................. 99
Protease inhibitor cocktail (PIC) ................................. 114 t-Butyloxycarbonyl-L-valyl-L-leucyl-L-lysine-4-
Protein glycosylation..................................................... 144 methylcoumaryl-7-amide (Boc-Val-Leu-Lys-
Protein melting curves.................................................... 95 MCA) ............................................................. 99
Protein purity .................................................................. 93 Tosyl-L-lysyl-chloromethane hydrochloride
Pseudaminic acid residue .............................................. 136 (TLCK) .......................................................... 64
Transposon mutagenesis...........................................4, 7, 9
Q Treponema denticola
Quantitative polymerase chain reaction (qPCR)......... 238 antibiotic protection assay ............................. 177, 182
chemically induced competent cells ......................... 19
S cis-complementation ...........................................16, 21
coaggregation assay........................................ 177, 182
Seeding ............................................................................ 94 competent cells........................................................ 181
Short chain fatty acids (SCFAs) constructing materials............................................... 17
in bacterial culture................................................... 170 dentilisin ......................................................... 173, 174
GC-MS assay ........................................................... 169 competent cells.................................................. 181
in saliva..................................................................... 168 DNA construct.................................................. 180
ion-monitoring data................................................ 171 measurement ....................................175, 176, 180
Sodium dodecyl sulfate–polyacrylamide gel mutant (electroporation) .................................. 176
electrophoresis (SDS-PAGE) ........... 63, 64, 76 mutant (heat shock).......................................... 177
Sonoporation techniques................................................ 44 purification ..............................174, 175, 177, 179
classification ............................................................... 44 electrocompetent cells .............................................. 18
use .............................................................................. 44 electrotransformation................................................ 19
gene deletion
T allelic exchange.................................................... 18
Tannerella forsythia ......................................................... 25 counterselectable maker...................................... 18
allelic exchange mutagenesis ..............................28, 29 genetic transformation........................................15, 16
bacterial culture ......................................................... 26 heat shock transformation ........................................ 20
blood agar.................................................................. 27 pathogenecity ................................................. 176, 180
constructing materials............................................. 136 plating selection ........................................................ 20
CsCl ultracentrifugation ......................................... 140 prtP mutant ............................................................. 177
256 Index
Treponema denticola (cont.) V
trans-complementation ............................................ 21
transformation ......................................................... 181 Vascular permeability
virulence factors ...................................................... 173 by gingipains.............................................98, 108, 110
Tris-buffered sodium chloride solution (TBS).............. 78 von Willebrand factor (VWF)....................................... 227
Triton X-114 ................................................................. 195
W
Trypan blue infusion..................................................... 244
Trypticase soy broth (TSB) ................................... 77, 220 Wheat germ agglutinin (WGA) lectin144, 145, 149, 151,
Tryptone–yeast extract–gelatin–volatile fatty acids–serum 152
(TYGVS) ...................................................... 174
TX-114 phase separation technique ............................ 199 X
Type IX secretion system (T9SS) ............... 113, 123, 124
X-ray crystallography methods ....................................... 88
Type V pili ....................................................................... 62
U
Ultracentrifugation .............................................. 159, 165

Methods in Molecular Biology 2210 Keiji Nagano Editor, Yoshiaki

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Methods in Molecular Biology 2210 Keiji Nagano Editor, Yoshiaki

Uploaded by

Copyright:

Available Formats

Methods in

Molecular Biology 2210

For further volumes:

Methods and Protocols

ISSN 1064-3745 ISSN 1940-6029 (electronic)

© Springer Science+Business Media, LLC, part of Springer Nature 2021

Periodontal disease is characterized by chronic inflammation of periodontal tissue, often

Hokkaido, Japan Keiji Nagano

PART I METHODS FOR BACTERIAL GENETIC MANIPULATION

1 Site-Directed and Random Mutagenesis in Porphyromonas gingivalis:

PART II EXPERIMENTAL METHODS TO EXAMINE VIRULENCE FACTORS

6 Genotyping of Porphyromonas gingivalis in Relationship to Virulence . . . . . . . . . 53

12 Methods for Functional Characterization of the Type IX Secretion

PART III INTERACTIONS WITH OTHER PATHOGENIC MICROORGANISM

20 Analysis of the Interaction Between HIV and Periodontopathic

PART IV ANIMAL MODEL OF PERIODONTITIS

ATSUO AMANO • Department of Preventive Dentistry, Graduate School of Dentistry, Osaka

YOSHIO KONDO • Department of Pediatric Dentistry, Nagasaki University Graduate School

MIKIO SHOJI • Department of Microbiology and Oral Infection, Graduate School of

Methods for Bacterial Genetic Manipulation

Site-Directed and Random Mutagenesis in Porphyromonas

Key words Porphyromonas gingivalis, Gene replacement, Site-directed mutagenesis, Homologous

Porphyromonas gingivalis, a gram-negative anaerobe, is a causative

fimA fimB fimC fimD fimE

mfa1 mfa2 mfa3 mfa4 mfa5

FimB (encoded by fimB, located immediately downstream of

PCR with primers a-b

PCR with primers a-e

PCR with primers a-d

Cloned into a plasmid vector

Linearization of the plasmid

2.1 Site-Directed 1. Strains: E. coli (DH5α, HB101, or BW19851) and P. gingivalis

2.1.2 Preparation of DNA 1. Chromosomal DNA of P. gingivalis (see Note 4).

2.1.3 Preparation 1. sBHI medium (see Subheading 2.1.1).

2.1.4 Electroporation 1. sTSB medium (see Subheading 2.1.1).

2.2 Random 1. E. coli (HB101/R751::*Ω4 [18, 21] or BW19851/pEP4351

2.2.2 Colony 1. sTSB medium (see Subheading 2.1.1).

3.1 Site-Directed 1. Inoculate P. gingivalis cells with a toothpick from a single

multistep PCR. The “hybrid” DNA fragment is then cloned into a

4. Harvest cells by centrifugation (2600 g) at 4 C for 10 min.

3.2 Random 1. Inoculate a single colony of P. gingivalis into 3 mL of sTSB and

Fig. 3 Screening for fimbriae-deficient mutants by colony immunoblotting. The

3. Transfer the cells to nitrocellulose membranes (one membrane

1. All of the methods described in this section were developed for

11. sBHI (or sTSB) should be preincubated at 37 C in anaerobic

We would like to thank Professor John S. Parkinson (University of

Genetic Manipulations of Oral Spirochete Treponema

Key words Periodontal disease, Spirochete, Treponema denticola, Genetic manipulation

Treponema denticola is an obligate anaerobic and highly motile

our experience, the chemically induced transformation method is

1. T. denticola ATCC 35405 and ATCC 33520 are two com-

chloramphenicol (all dissolved in ethanol and filter-sterilized—

3.3 Preparing 1. Inoculate 50 mL of TYGVS medium in a 250-mL flask with

5. Decant the supernatant and resuspend the cell pellet in 500 μL

3.4 Electro- 1. Cool electroporation cuvettes (0.2 cm electrode gap) to 4  C

3.5 Preparing 1. Inoculate 50 mL of TYGVS medium in a 250-mL flask with

3.6 Heat Shock 1. Transfer 10 μL of DNA (approximately 5 μg) (see Note 5) to

3.7 Selection 1. Autoclave 3% SeaPlaque low melting temperature agarose and

3.9 Trans- 1. Search the DNA sequence of a gene to be complemented and

1. T. denticola ATCC 35405 and ATCC33520 are two most

3. The original antibiotic for genetic manipulation is erythromy-

resistance), and pBFC (confers chloramphenicol resistance)

Construction of a Gene-Deletion Mutant in Tannerella

3.4 Electro- 1. Cool electroporation cuvettes (0.2 cm electrode gap) to 4 C

4. Cultivate at 37 C under anaerobic conditions for 5 days.