1. What does the enzyme DNA polymerase synthesise in a cell?

A a polypeptide using DNA as a template

B a strand of DNA using a polypeptide as a template
C a strand of DNA using DNA as a template
D a strand of mRNA using DNA as a template
c
2. 21.2% of the bases in a molecule of DNA are cytosine.
What percentage would be adenine?
A 21.2% C 42.4%
B 28.8% D 57.6%
b

3. One gene provides the code for the production of which type of molecule?
A amino acid C nucleotide
B DNA D polypeptide
d
4. The table shows the mode of action of two antibacterial drugs that can affect the synthesis
of proteins.

B
5. DNA contains the ……X…… base ……Y…… which is joined to adenine with ……Z…… hydrogen
bonds. Which row correctly completes the statement about DNA?

c
6. The diagram shows the nucleotide sequence of a small section of a gene which is
transcribed.
CGCCGCACGCGC
The table shows the amino acids coded for by 10 mRNA codons.
 a
7. The statements describe the features of some nucleic acids.

1 carry an amino acid to a ribosome

2 carry a genetic code sequence out of the nucleus
3 carry a genetic code sequence to a ribosome
4 hold amino acids in position for translation Which functions are carried out by tRNA?

A 1 and 2 c. C 2 and 3
B 1 and 4 D 3 and 4
b
8. Which statements about complementary base pairing are correct?

1 Cytosine forms three hydrogen bonds with guanine.

2 Purines and pyrimidines are different sizes.
3 It allows transcription to occur.
4 The base pairs are of different lengths.

A 1, 2 and 3 C 1, 3 and 4
B 1, 2 and 4 D 2, 3 and 4
a

9. Bacteria were grown in a medium containing 15N. After several generations, all of the DNA
contained 15N. Some of these bacteria were transferred to a medium containing the
common isotope of nitrogen, 14N. The bacteria were allowed to divide once. The DNA of
some of these bacteria was extracted and analysed. This DNA was all hybrid DNA containing
equal amounts of 14N and 15N.
The remaining bacteria were left in the medium with 14N and allowed to divide one more
time. The DNA of some of these bacteria was extracted and analysed.
 What is the composition of this DNA?
A 25% hybrid DNA C 75% hybrid DNA
B 50% hybrid DNA D 100% hybrid DNA
b

10. Which statements about tRNA are correct?

1 It contains base pairing.

2 It contains hydrogen bonds.
3 It contains uracil.
4 It is single stranded.

A 1, 2, 3 and 4 C 1 and 2 only

B 1, 3 and 4 only D 2 and 3 only
a

11. The diagram shows the nucleotide sequence of a small section of a gene which is
transcribed.
TTCTTCCCGTTC
The table shows the amino acids coded for by 10 mRNA codons.

B
12. Which statement about nitrogenous bases is correct?

A Adenine is a pyrimidine with a double ring structure.

B Cytosine is a purine with a double ring structure.
C Guanine is a purine with a single ring structure.
D Uracil is a pyrimidine with a single ring structure.
d
13. Rifampicin is an antibiotic used to treat tuberculosis. It works by inhibiting RNA polymerase
in bacteria. Which of these processes will be directly inhibited by this antibiotic?

1 ATP synthesis 2 transcription 3 translation

A 1 and 2 C 2 only
 B 1 and 3 D 3 only
c
14. Meselson and Stahl investigated DNA in bacteria. They grew bacteria in a medium with only
heavy nitrogen, 15N, until all of the bacterial DNA contained only heavy nitrogen. These
bacteria were then moved from the heavy nitrogen medium and cultured in a medium with
only light nitrogen, 14N. Some bacteria were collected from each of the next three
generations and their DNA was analysed. Hybrid DNA contains both heavy and light
nitrogen. Which row shows the correct DNA of the first and third generations?

15. The diagram shows the stages in the production of part of a polypeptide.

A
16. Which nucleic acid bases are purines?
A adenine and cytosine C guanine and adenine
B cytosine and thymine D uracil and cytosine
C

17. In a genetic engineering experiment a piece of double-stranded DNA containing 6000

nucleotides coding for a specific polypeptide is transcribed and translated.
What is the total number of amino acids in this polypeptide?

A 500 B 1000 C 2000 D 3000

18. Which statements about tRNA are correct?

1 Hydrogen bonds between bases temporarily hold tRNA against mRNA.

2 The base sequences in the tRNA molecules are the same as the base sequences in the
mRNA that is being translated.
3 tRNA translates the base sequence in mRNA into the amino acid sequence in a protein.

A 1, 2 and 3 B 1 and 2 only C 1 and 3 only D 2 and 3 only

 C
19. Which statement correctly describes the base pairing in a molecule of DNA?
A The purine adenine forms bonds with the pyrimidine thymine.
B The purine adenine forms bonds with the pyrimidine uracil.
C The purine cytosine forms bonds with the pyrimidine guanine.
D The purine guanine forms bonds with the pyrimidine thymine.
A
20. The diagram shows the possible organisation of DNA molecules after one replication. Which
organisation is correct?

C
21. The diagram shows part of the DNA sequence of a gene and a mutated sequence of the
same gene.

D
22. What is the role of DNA polymerase?

A condensation reactions to produce DNA nucleotides for replication

B correct alignment of RNA nucleotides along a template strand of DNA
C formation of bonds to complete the sugar-phosphate backbone
D formation of glycosidic bonds between complementary base pairs
C
23. Which row represents the correct features of the nitrogenous base thymine?
 B
24. The table shows the DNA triplet codes for some amino acids.

25. Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-
globin polypeptide of haemoglobin.
The diagram shows the sequence of bases in a small section of the coding strand of DNA for
both the HbA (normal) and HbS (sickle cell) β-globin alleles.

HbA CTGACTCCTGAGGAGAAGTCT
HbS CTGACTCCTGTGGAGAAGTCT

How will the mutation in the allele result in the production of an altered version of the β-
globin polypeptide?

A A tRNA molecule with the anticodon GUG will hydrogen bond to the altered codon on
mRNA.
B All the amino acids coded for after the mutation will differ from those in the HbA protein.
C mRNA transcribed from the HbS allele will contain the codon CAC instead of the codon
CTC.
D The ribosome will be unable to continue translation of the HbS mRNA after the altered
codon.
 A
II. Theory
1. The following RNA strand was produced:

5′ AUG GCG UUU 3’
What is the DNA template of this RNA. Include the direction. (2 pts.)
3’TAC CGC AAA 5’
2. Fill the blanks about replication, transcription and translation

Replication
The DNA template is a _(a)__Double helix_____________(two words) which
was originally discovered by _(b)_____rosalind franklin_______________( two
words). Then, _(c)__watson___________ and Crick borrowed the idea when she
died. First, an enzyme (d)_DNA Primase____ will put a primer on the location in
DNA with 3’ to 5’ direction. The DNA (e) __polymerase_______ will start
adding the _(f)___nucleotides__________. We call the new strand as the
(g)_leading___________ strand. On the other strand, The primers will be put in
the location where the DNA strand has already unwounded. The replicated
segment is called (h)_okazaki fragment__________. There are many of them in
this strand. The new strand is called (i)__lagging________________. This
replication is called _(j)___semi conservative____________ because the new
DNA is composed of new and old strand.

Translation
The mRNA that is made inside the _(a)__nucleus______ goes out to the
cytoplasm. It will go to the (b)___cytoplasm______ to be translated into amino
acid. The _(c)__tRNA_______ that carries the amino acid will go to the ribosome
and attach to the codon in mRNA. The reading will continue and the translation
will finish when the (d)__STOP_____ codon is read. The amino acids are
attached to each other by (e)__peptide_____ bond.

III. Definition
1. Okazaki Fragment
2. DNA polymerase
3. DNA ligase
4. RNA polymerase
5. Leading strand
6. Lagging strand
7. Codon
8. Anticodon
9. tRNA
10. mRNA
11. deletion
 12. Translocation
13. Nondisjunction
14. Point mutation
15. primer

V. Why is frameshift mutation dangerous?

FILL IN THE BLANKS
Four bases of DNA A) Adenine B) Thymine C) Cytosine D) Guanine

Forms pair between two strands.

In order to unwind DNA the interactions between base pair must be broken. This is
performed by an enzyme called DNA helicase.

DNA is directional in both strand signified by 5’ and 3’ end. This directional key is important
for replication because it progresses in the 5’ to 3’ direction.

However the replication is by directional, one strand is oriented to the 3’ to 5’

direction leading strand.

While the other is oriented 5’ to 3’ direction lagging strand.

Enzyme known as DNA polymerase as responsible creating by the newly strand by a

process called elongation.

DNA polymerase/primase then adds piece of DNA called Okazaki fragment (2 words)

Another enzyme called DNA ligase joins Okazaki fragments together.

TRANSCRIPTION Transcription is the process in which a DNA gene sequence is copied

transcribed to make a RNA molecule it begins when an RNA polymerase binds a promoter
sequence near the beginning of a gene

Before transcription can take place the DNA double helix must unwind

Transcription uses one of the two exposed DNA strand as a template this strand is called
the template strand

RNA polymerase always builds a new RNA strand in the 5’ to 3’ direction

The RNA transcript is nearly identical to the non-template or coding strand of DNA. However
RNA strand has the base uracil in place of thymine

An RNA transcript that is ready to be used in translation is called a mRNA

The mRNA carries genetic information encoded as a ribonucleotide sequence from the
chromosomes to the ribosome

The ribonucleic are read by translational machinery in a sequence of nucleotide triplets

called codons

Each of those triplets codes for a specific amino acid

The amino acids are in the tRNA in cytoplasm and will be transferred to the growing chain of
amino acid as coded by the mRNA