Science of the Total Environment 838 (2022) 155923

Contents lists available at ScienceDirect

Science of the Total Environment

journal homepage: www.elsevier.com/locate/scitotenv

Removal of Mg2+ inhibition benefited the growth and isolation of ammonia-

oxidizing bacteria: An inspiration from bacterial interaction
Buchan Liu a,1, Weitie Lin a,b,1, Shenxi Huang a, Qiuyun Sun a, Hao Yin a, Jianfei Luo a,b,
⁎
a
Guangdong Key Laboratory of Fermentation and Enzyme Engineering, School of Biology and Biological Engineering, South China University of Technology, Guangzhou 510006, PR China
b
MOE Joint International Research Laboratory of Synthetic Biology and Medicine, South China University of Technology, Guangzhou 510006, PR China

H I G H L I G H T S G R A P H I C A L A B S T R A C T

• The relationship between AOB and its bac-

terial partners improve the ammonia oxi-
dation.
• The heterotroph grown in co-cultivation
contributed to the removal of Mg2+.
• Removal of Mg2+ benefited to the ammo-
nia oxidation of AOB grown in pure culti-
vation.
• Removal of Mg2+ benefited to the colony
formation of AOB grown on agar plates.
• AOB colonies could be easily identified
following the hydrolytic zones of CaCO3.

A R T I C L E I N F O A B S T R A C T

Editor: Huu Hao Ngo Ammonia-oxidizing bacteria (AOB) play an important role in the global nitrogen cycle and have broad applications in
the nitrogen removal from wastewater. However, the AOB species are sensitive to environmental factors and usually
Keywords: form tight relationships with other microbes, making the AOB isolation and maintenance are difficult and time-
Ammonia-oxidizing bacteria consuming. In this study, the relationship that occurred between AOB and their bacterial partners was found to be
Co-cultivation
able to improve the ammonia oxidation; during the co-cultivation, the magnesium ions (Mg2+) with removal rate
Mg2+ inhibition
Isolation
as high as 36.7% was removed from culture medium by the concomitant bacterial species, which was regarded as
the main reason for improving ammonia oxidation. During the pure cultivation of AOB isolate, when the concentration
of Mg2+ reduced to low levels, the ammonia-oxidizing activity was more than 5 times and the amoA gene expression
was more than 12 times higher than that grown in the initial culture medium. Based on a newly designed culture me-
dium, the ammonia oxidation of AOB isolate grown in liquid culture was significantly promoted and the visible AOB
colonies with much more number and larger diameter were observed to form on agar plates. With the addition of high
concentration of calcium carbonate (CaCO3), AOB colonies could be easily and specifically identified by following the
hydrolytic zones that formed around AOB colonies. Another AOB isolates were successively obtained from different
samples and within a short time, suggesting the feasibility and effectivity of this culture medium and strategy on the
AOB isolation from environments.

⁎ Corresponding author at: Guangdong Key Laboratory of Fermentation and Enzyme Engineering, School of Biology and Biological Engineering, South China University of Technology,
Guangzhou 510006, PR China.
E-mail address: ljfjf2002@scut.edu.cn (J. Luo).
1
These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.scitotenv.2022.155923
Received 19 April 2022; Received in revised form 9 May 2022; Accepted 10 May 2022
Available online 14 May 2022
0048-9697/© 2022 Elsevier B.V. All rights reserved.
B. Liu et al.
1. Introduction
Ammonia-oxidizing bacteria (AOB) are widely distributed on the earth
and particularly prefer the nutrient rich habitats such as the eutrophic fresh-
water, fertilized soils and wastewater treatment plants (WWTPs) (Soliman
and Eldyasti, 2018; Kumwimba and Meng, 2019; Lukumbuzya et al.,
2020). In terrestrial environments, the AOB species are one of the primary
drivers of ammonia oxidation and play an important role in the global nitro-
gen cycle. For example, during the nitrogen removal in WWTPs, the effective
partial nitrification needs to simultaneously stimulate AOB and inhibit
nitrite-oxidizing bacteria (NOB) activities; then, the successfully accumulated
nitrite could be directly reduced to N2 by denitrifies or anaerobic ammonia-
oxidizing (Anammox) bacteria (Wang et al., 2021; Chang et al., 2022; He
et al., 2022). This wastewater treatment process is well-known for its signif-
icances in reducing the oxygen and energy demand, as well as producing less
sludge during the wastewater treatment (Soliman and Eldyasti, 2018; Wang
et al., 2021). Besides the applications in nitrogen removal from wastewater,
AOB have potential to act as a kind of biocathode in the microbial fuel cell
(MFC) to generate electricity or contributors to the cometabolic biodegrada-
tion of some pollutants in environments (Kumwimba and Meng, 2019;
Chawley et al., 2021; Li et al., 2022; Kennes-Veiga et al., 2022).
Currently, all the known AOB species are classified into two lineages
within the Proteobacteria, including the genera Nitrosococcus and
Nitrosoglobus from Gammaproteobacteria, the genera Nitrosomonas,
Nitrosospira, Nitrosovibrio and Nitrosolobus from Betaproteobacteria (Soliman
and Eldyasti, 2018; Lukumbuzya et al., 2020). Despite they are ubiquitous
in almost all oxic environments and have broad ecological importance, the
number of AOB isolates with standing in nomenclature remains low
(Lukumbuzya et al., 2020). This is probably due to their long generation
times and sensitivity to environmental factors that making AOB isolation
and maintenance difficult and time-consuming (Kowalchuk and Stephen,
2001; Bollmann et al., 2011; Stein, 2019). More importantly, AOB species
often grow better in natural or engineered environments (such as the acti-
vated sludges and WWTPs) but few are available in pure cultures
(Gonzalez-Cabaleiro et al., 2019). They usually form some tight relationships
with other microbes, which help them to detoxify metabolic intermediates,
prevent oxidative stress or obtain nutrients by cross-feeding (Palatinszky
et al., 2015; Stein, 2019; Lu et al., 2020). It is very likely that some relation-
ships are able to reduce the lag phase or increase the substrate affinity of
AOB when grown in enrichment or in situ cultures, which then promote
their growth rate. In accordance with this situation, if the mechanisms of
AOB cooperating with other microbial partners are revealed, the pure AOB
cultures grown either in liquid culture or on solid agar plate could be success-
fully obtained.
The insufficient of strategy for AOB isolation has limited the discovery of
new species, and the lack of pure culture has limited the physiological and ge-
nomic analyses of AOB species that originating from different habitat or tax-
onomy. In this study, the ammonia oxidation of AOB isolate was found to be
improved by co-cultivations with their bacterial partners, and the improve-
ment was found to benefit from the Mg2+ removal from co-cultures that
likely performed by heterotrophs. Based on a newly designed culture me-
dium, in which the Mg2+ reduced to a low concentration, the ammonia-
oxidizing activity and amoA gene expression of AOB grown in pure cultiva-
tion had significant promotions, and the AOB colonies visibly formed on
agar plates. In addition, the presences of CaCO3 and ethylene diamine
tetraacetic acid (EDTA) in the newly designed culture medium could easily
and specifically identify the AOB colonies that grown on agar plates. Based
on the new culture medium and strategy, five AOB isolates were successively
obtained from different environmental samples and within a short time.
2. Materials and methods
2.1. Enrichment cultivation and bacterial community analysis
Surface water sample was collected from the Guangzhou section of the
Pearl River. After the centrifugation at 1000g for 2 min, the supernatant
2
Science of the Total Environment 838 (2022) 155923
was collected and inoculated into a flask containing with A1 culture medium:
0.5 g/L KCl, 0.485 g/L MgSO4·7H2O, 1.0 g/L NaCl, 0.3 g/L KH2PO4, 0.1 g/L
CaCl2·2H2O, 1.0 g/L CaCO3, 0.21 g/L NaHCO3, 0.54 g/L NH4Cl, 0.2 g/L
Na2EDTA, and 0.1% (v/v) trace element solution (2.1 g/L FeSO4·7H2O,
0.062 g/L H3BO3, 0.017 g/L CuCl2·2H2O, 0.1 g/L MnC12·4H2O, 0.036 g/L
Na2MoO4·2H2O, 0.07 g/L ZnCl2, 0.19 g/L CoCl2·6H2O, and 0.024 g/L
NiCl2·6H2O). When the concentration of ammonia was almost used up,
10% (v/v) of the enrichment cultures were transferred into the fresh A1 cul-
ture medium. Cultivations were incubated on a shaker with a speed of
150 rpm and at 30 °C.
Genomic DNA from water sample and enrichment cultures were ex-
tracted according to a modified CTAB method (Luo et al., 2010). Using
the extracted DNA as template, the V4 region of bacterial 16S rRNA
gene was amplified by using a primer pair 515FmodF/806RmodR,
with the PCR procedure according to a previous study (Wang et al.,
2020). After the purification by TaKaRa Agarose Gel DNA Purification
Kit (TaKaRa, Dalian, China), the PCR products were sequenced on a
MiSeq platform (Illumina, San Diego, USA) by Majorbio (Shanghai,
China).
2.2. Bacterial isolation and identification
After the continuous subcultivation being performed for several genera-
tions, the activities of ammonia oxidation and nitrite oxidation, as well as
the bacterial community in nitrifier enrichment were almost maintained at
steady levels (data not shown). Then, the enrichment culture was used as
the inoculum to spread on the agar plates that containing A1 or N1 (same
as the A1 medium, only the ammonia was replaced by nitrite, which is spe-
cific for NOB cultivation) culture medium. After the incubation for at least
30 days, a few visible but small colonies were found to form on agar plates,
with the simultaneous presence of heterotrophs' colonies. Small colonies
were picked and inoculated into liquid culture medium; after the identifica-
tion of ammonia or nitrite oxidation activity, the cultures were spread on
the related agar plates again. The pick-inoculation-spread procedure was re-
peated until no detection of the presence of heterotroph in AOB and NOB cul-
tures. The purity of AOB and NOB isolates/cultures was assessed by
observation under microscope, cultivation in the organic culture media in-
cluding Luria-Bertani and Nutrient Broth, and sequencing of 16S rRNA
gene. The heterotroph partners that always presented in AOB cultures was
isolated using organic culture medium.
After the optimization, a new culture medium that named A3 was
obtained, which contains: 0.03 g/L MgSO 4 ·7H2 O, 0.1 g/L KH 2 PO 4 ,
1.0 g/L CaCO 3 , 0.21 g/L NaHCO 3 , 0.54 g/L NH 4 Cl, and 0.1% (v/v)
trace element solution. To assess the effect of CaCO3 and EDTA on the
AOB isolation, 0.2 g/L Na2 EDTA and/or 1.0–5.0 g/L CaCO 3 was
added in A3 culture medium to prepare solid agar plates. Enrichment
cultures from water and soil samples were used as the inoculum to
spread on the agar plates to perform AOB isolation, according to the
pick-inoculation-spread procedure.
The 16S rRNA gene of bacterial isolates was obtained by PCR ampli-
fication using universal primer 27F/1492R (Frank et al., 2008). The
functional genes including amoA of AOB and nxrA of NOB were ob-
tained by PCR amplification using primer pairs amoA-1F/amoA-2R
(Rotthauwe et al., 1997) and F1370 F1/F2843 R2 (Wertz et al., 2008),
respectively. All genes were sequenced by GENEWIZ (Guangzhou,
China) and the 16S rRNA gene of bacterial isolates were submitted to
the NCBI GenBank under accession numbers ON117826, ON117843,
and ON129503-ON129507.
2.3. Preparation of pure and co-cultivations
AOB, NOB and heterotroph isolates were cultivated in A1, N1 and
Nutrient Broth culture media, respectively. After the cultivation, the cul-
tures were filtered through 0.22 um membranes to collect bacterial cells;
cell pellets were separately washed into the A1 culture medium. To prepare
the co-cultivations, 10% (v/v) of AOB, NOB and heterotroph cultures were
B. Liu et al. Science of the Total Environment 838 (2022) 155923

inoculated into the A1 culture medium. When the concentration of ammo- 2.6. Statistical analysis
nia was almost used up, 10% (v/v) of the co-cultures were transferred into
the fresh A1 culture medium. After the continuous subcultivation being per- Each experiment was carried out in triplicate. Mean and standard devi-
formed for five times, the bacterial community in co-cultures reached ation values were analyzed using one-way analysis of variance (ANOVA).
steady statuses; then, the co-cultures, with the final number of AOB deter- Significance of difference was determined as P < 0.05.
mined to be ~1.1 × 106 amoA copies/mL, were inoculated into A1 culture
medium to start the co-cultivation of AOB with NOB or/and heterotroph. 3. Results
To perform the pure cultivation of AOB, a certain volume of AOB culture
was inoculated into A1 culture medium, making the initial number of 3.1. Co-cultivation of AOB with their bacterial partners benefited to the ammonia
AOB to reach 1.1 × 106 amoA copies/mL. oxidation

2.4. Quantitative PCR analyses During the enrichment cultivation of nitrifiers from the Pearl River
water, the AOB and NOB abundances in subcultures continuously in-
Total DNA and RNA in pure and co-cultures were extracted by using a creased; after the fifteenth generation, the abundances of AOB and NOB
modified CTAB method and RNAprep Pure Cell/Bacteria Kit (Tiangen, Bei- in the nitrifiers enrichment reached 10% and 2%, and their communities
jing, China), respectively. Their concentrations were quantified using a were dominated by genus Nitrosomonas and Nitrobacter, respectively
Nanodrop-Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, (Fig. S1). Using the enrichment culture as inoculum, both of the AOB and
USA) and verified by agarose gel electrophoresis. gDNA was removed and NOB isolates were successively obtained after repeating the pick-
cDNA was synthesized by PrimeScript™ RT reagent Kit with gDNA Eraser inoculation-spread procedure and were identified to be closely related to
kit (TaKaRa, Dalian, China) using RNA as temperate. the genus Nitrosomonas and Nitrobacter, respectively (Fig. S2); meanwhile,
The numbers of amoA, nxrA and 16S rRNA genes were quantified by a bacterial isolate from the genus Pseudomonas which taking up 72% of
qPCR using amoA-1F/amoA-2R, F1370 F1/F2843 R2, and 1369F/ the total community was also obtained from the enrichment culture.
1492RmodR (Liu et al., 2019) as primer pairs, respectively. PCR reac- During the pure cultivation of Nitrosomonas, the complete oxidation of
tion was performed in 20 μL volume containing 10.0 μL TransStar Tip ammonia cost seventy-two hours; however, the times of Nitrosomonas
Green qPCR SuperMix (TransGen Biotech, Beijing, China), 0.4 μM of grown in the co-cultivations with Nitrobacter or/and Pseudomonas or in the
each primer, 0.4 μL Passive Reference Dye (50×) and 2 μL DNA or enrichment were significantly reduced (Fig. 1a). The ANP co-cultivation
cDNA. PCR amplification was performed in Applied Biosystems 7500 that including Nitrosomonas, Nitrobacter and Pseudomonas was determined
Real-Time PCR (Applied Biosystems, CA, USA). The r 2 values were > to have the highest ammonia-oxidizing rate; however, it was measured to
0.99 and the efficiencies of amplification ranged from 90% to 101%. have the lowest number of Nitrosomonas cells (Fig. 1b). It was probably due
Agarose gel electrophoresis and melting curve were used to guarantee to the simultaneous presence of NOB and heterotrophic partners in the cul-
the specificity of amplification products. Standard curves were prepared ture, the cooperation that occurred between them contributed to the highest
using six serial tenfold dilutions ranging from 102 to 107 gene copies / activity. Though these bacterial species were also simultaneously presented
mL and used to quantify the gene number. in the nitrifier enrichment, the numbers of Nitrobacter and the Pseudomonas
To quantify the relative expression of amoA gene in pure and co- (taking up ~72% of the total community) were lower than that in the ANP
cultures, a primer pair 794F/1019R (794F: 5′- AGTTGTCGGGTCTTATTG co-culture, which possibly resulted in the lower activity (Fig. 1b). During
GG -3′; 1019R: 5′- AGCACCTGTGTTCAAATTCTCTT −3′) that specifically the co-cultivation of Nitrosomonas with their bacterial partners Nitrobacter
attaches to the 16S rRNA gene of AOB isolate was designed. The 2 -ΔΔCT or/and Pseudomonas, the relative expression of amoA gene was 9–67 times
method was used to estimate fold change in gene expression, normalized higher than that grown in pure cultivation (Fig. 1c). The functional gene ex-
to the endogenous control 16S rRNA gene. pression was consistent with the ammonia-oxidizing activity, which suggests
the co-cultivation of AOB with NOB or with heterotroph could significantly
2.5. Analytical methods enhance the ammonia oxidation.

−
The concentrations of NH+
4 and NO2 were determined by the Indophe- 3.2. Removal of Mg2+ led to the benefit of ammonia oxidation in pure and
nol blue spectrophotometric and Griess-saltzman methods, respectively co-cultures
(ISO/TS, 2003). The concentrations of K+, Na+ and Mg2+ in cultures
were measured by using ICP-OES after the removal of cells by the filtration After the cultivations, the concentration of cation ions including K+, Na+
through 0.22 um filters. and Mg2+ in pure and co-cultures were determined. About 2.3–5.1%,

80 160 80
A: Nitrosomonas
a AN: Nitrosomonas + Nitrobacter b
AP: Nitrosomonas + Pseudomonas 120 amoA
70
c
nxrA
ANP: Nitrosomonas + Nitrobacter + Pseudomonas
Relative expression of amoA gene
Gene numbers ( 106 copies/mL)

80
Ammonia concentration (mg/L)

NE: Nitrifiers enrichment 16S rDNA

60 60
40

50

15
40 40

30
10

20 20

5
10

0 0
0 12 24 36 48 60 72 A AP ANP NE A AN AP ANP
Cultivation time (h)

Fig. 1. Ammonia oxidation (a), bacteria quantification (b) and amoA gene expression (c) of AOB grown in pure and co-cultures.

3
B. Liu et al.
40 80
K+
a Mg2+ concentration
35 70
Na+
Mg2+
Nitrite concentration (mg/L)
30 60
Removal rate (%)
25 50
20 40
15 30
10 20
5 10
0 0
A AN AP ANP NE
Fig. 2. Metal ion removal rate in the pure and co-cultures (a), ammonia oxidation (b) and amoA gene expression (c) of AOB isolate grown under different concentration of Mg2+.
8.8–10.8% and 4.6–36.7% of K+, Na+ and Mg2+ was removed from the cul-
tures, respectively (Fig. 2a). Though the EDTA that presented in culture me-
dium could chelate a certain amount of these cation ions especially for the
Mg2+, the chelated ions are still dissolved and then could not be removed
from the liquid medium. Only the ions that absorbed by microbial cells
could be removed after the removal of cells by centrifugation or filtration
through 0.22 um filters. During the pure and co-cultivations, the removal of
K+, Na+ and Mg2+ were mainly attributed to the cell absorption.
The removal rates of K+ and Na+ in these cultures were determined to
have significant differences; however, the removal rate and the difference
are all small when compared with that of Mg2+ removal. The removal
rate of Mg2+ in co-cultures are almost higher than the other cation ions
and about 1.8–8.1 times higher than that of the Mg2+ removal in pure cul-
ture (Fig. 2a). Obviously, the co-cultivation of AOB with NOB and hetero-
trophs contributed to the high removal rate of Mg2+ from culture
medium. As results indicated, the number of total bacterial cells in co-
cultures was about 10 times higher than that in the pure culture (Fig. 1b),
which seemingly makes sense that the bacterial cells in co-cultures would
absorb much more cation ions, especially for the divalent Mg2+. However,
the cell number in all co-cultures were almost equal to each other, but the
ion removal rates between them are significantly different and even have
about 4 times difference. As results suggested, the heterotroph Pseudomonas
was mainly responsible for the Mg2+ absorption only if the simultaneous
presence of AOB and NOB species.
The high rate of Mg2+ removal in co-cultures probably contributed to
the improvement of ammonia oxidation in these cultivations. To make
this clear, during the pure cultivation of AOB, the concentration of Mg2+
in culture medium was reduced to low levels; as results indicated, when
the concentration reduced to 30 mg/L, the ammonia-oxidizing activity
was significantly higher than that grown under other concentrations, and
the mean activity was more than 5 times higher than that grown in the ini-
tial culture (A1) medium (Fig. 2b). Along with the increase of Mg2+ con-
centration, the expression of amoA gene was determined to decrease on
the contrary, reaching more than 12 times of decreases as the Mg2+ in-
creased from 19.7 mg/L to or higher than 59.2 mg/L (Fig. 2c).
3.3. A new culture medium designed for AOB cultivation and isolation
Besides the Mg2+, the cation ions K+ and Na+ that in the forms of KCl
and NaCl were also found to have negative effect on the ammonia oxidation
of AOB isolate when cultivated in pure culture (Fig. S3). It is probably that
the K+ and Na+ in other forms, such as the KH2PO4 and NaHCO3, have al-
ready been presented in the culture medium; extra additions of K+ and
Na+ would be harmful to the ammonia oxidation. In accordance with
these observations, a new culture medium that named A3 was specifically
designed for the cultivation and isolation of AOB. In the new culture
Science of the Total Environment 838 (2022) 155923
16
b c
0 mg/L 14
30 mg/L
Relative expression of amoA gene
100 mg/L
12
200 mg/L
400 mg/L
10
8
6
4
2
0
0 12 24 36 48 60 72 84 96 108 120 19.72 39.44 59.16 98.59
Cultivation time (h) Mg2+ concentration (mg/L)
medium, the components KCl and NaCl were removed, and the Mg2+
was reduced to a low concentration. Based on this culture medium, the am-
monia oxidation of AOB isolate grown in pure culture proceeded well either
with or without presence of EDTA, who acts as a kind of metal chelate; how-
ever, due to the presence of Mg2+ inhibition in A1 culture medium, the am-
monia oxidation hardly proceeded if removal of EDTA (Fig. 3a). It was
suggested that the A3 culture medium is suitable for the cultivation of
AOB isolate in liquid medium after the removal of Mg2+ inhibition.
Similarly, due to the Mg2+ inhibition in A1 culture medium, no visible
colony formed on the agar plates if removal of EDTA (Fig. 3b). However,
using A3 as the culture medium to perform AOB cultivation, the colonies
with much more number and larger diameter were found to form on the
agar plates either with or without addition of EDTA (Fig. 3b). It was once
again suggested that A3 culture medium is suitable for the growth of AOB
on agar plate, and also their isolations using the conventional culture-based
method. Despite AOB colonies were formed on agar plate, the colonies are
still too small to practically be picked. In order to specifically identify the
AOB colonies grown on agar plates, high concentration of CaCO3 was
added into the culture media. When the concentration of CaCO3 reached 4
g/L in A1 medium or 2 g/L in A3 medium, visible hydrolytic zones were
found to form around the AOB colonies, and the higher of CaCO3 was
added the larger number and diameter of hydrolytic zones were formed
(Fig. 3b). Interestingly, the presence of EDTA was benefit to the formation
of hydrolytic zones.
Based on the optimized culture medium, the AOB enrichment cultures of
water and soil sample were spread on the agar plates; after the incubation for
about two weeks, some clear and well-defined colonies, as well as the related
hydrolytic zones were found to form on the agar plates (Fig. 3c). Five colonies
were randomly picked from these plates and separately inoculated into the
liquid A3 culture medium; after assessing the purity of these isolates, no het-
erotroph was identified in their cultures. Based on the phylogenetic analysis,
the 16S rRNA gene of these isolates was identified belonging to the genus
Nitrosomonas and closely related to the species Nitrosomonas nitrosa or
Nitrosomonas oligotropha, showing sequence identities from 97.8 to 99.5%
(Fig. 3d).
4. Discussion
Microbial interactions are diverse and prevalent in the nature, with un-
derlying mechanisms are largely unknown (Faust and Raes, 2012). In gen-
eral, the microbial interactions are usually essential for the growth of
microbes living in complex ecosystems, as well as for the plant's develop-
ment and vegetable's production (Zengler and Zaramela, 2018; Turan
et al., 2019; Tauqeer et al., 2022). In this study, the co-cultivations of
Nitrosomonas with their bacterial partners Nitrobacter or/and Pseudomonas
were found to significantly benefit the ammonia oxidation. As one of the
4
B. Liu et al. Science of the Total Environment 838 (2022) 155923

a b c
Medium CaCO3 Na2-EDTA AOB Hydrolytic
140 A1 EDTA
A1 colony zone
A3 1 A1 1 g/L 0.2 g/L ++ ─
120 A3 + EDTA
Nitrite concentration (mg/L)

2 A1 2 g/L 0.2 g/L ++ ─

100
3 A1 2 g/L ─ ─ ─
4 A1 4 g/L 0.2 g/L ++ +

80
5 A1 4 g/L ─ ─ ─
6 A1 5 g/L 0.2 g/L +++ ++ Water sample SG Soil sample CD

60
7 A3 0 g/L 0.2 g/L + ─
8 A3 1 g/L 0.2 g/L +++ ─

40
9 A3 2 g/L 0.2 g/L +++ +++
10 A3 2 g/L ─ +++ +
20 11 A3 4 g/L 0.2 g/L ++++ ++++
12 A3 4 g/L ─ ++++ ++
0 13 A3 5 g/L 0.2 g/L +++++ +++++
0 24 48 72 96 120 144 Sediment sample NT Water sample MT
Cultivation time (h)
97 MT, ON129507
84 CD, ON129505
99
d SG, ON129504
72
Nitrosomonas nitrosa Nm90, FR828477.1
100
NT-2, ON129503
Nitrosomonas communis Nm2, HE856821.1
100 Nitrosomonas halophila Nm1, FR828475.1
100 Nitrosomonas europaea ATCC 25978, HE862405.1
Nitrosomonas eutropha C91, NR 027566.1
100 Nitrosomonas aestuarii Nm36, FR828476.1
98 Nitrosomonas marina Nm22, FR828473.1
99 Nitrosomonas ureae Nm10, FR828472.1
98 Nitrosomonas oligotropha Nm45, FR828478.1
NT-1, ON129506
0.01

Fig. 3. Growths of AOB in liquid cultures (a) and on solid agar plates (b) by using the formerly or newly designed culture medium, agar plate profiles of AOB isolation from
different samples by new culture medium (c), and phylogenetic analysis of AOB isolates (d).

well-known partners or mutualistic symbionts of AOB, the species of NOB studies on AOB cultures, the evidence and mechanism of Mg2+ inhibition
in mutual coaggregation are able to relieve the toxicity of nitrite and the ox- to them are still not clear. It was supposed that Mg2+ competes with the es-
idative stress to ammonia oxidation, or secret siderophores to satisfy AOB sential metal ions (such as Cu2+) to uptake active sites of ammonia
by iron uptake (Sedlacek et al., 2016; Daims et al., 2016; Stein, 2019). Be- monooxygenase (AMO), which then inactivates the ammonia-oxidizing ac-
sides the species of NOB, many heterotrophic partners are hypothesized to tivity (Jeong and Bae, 2021). A competition between Zn2+ and Cu2+ has
supply metabolites, eliminate toxic compounds, or reduce oxidative stress been reported in Nitrosomonas europaea (Radniecki et al., 2009); from there
to favor autotrophic ammonia oxidizers, which then benefit their growth to here, the competition between Mg2+ and Cu2+ or other essential ions
(Sedlacek et al., 2016; Kim et al., 2016; Xu et al., 2022). For example, the would probably make sense. The nitrification inhibition by metals in
species from genus Pseudomonas are often abundant in the enrichment cul- WWTPs has been extensively discussed (Li et al., 2015); however, they are
tures of AOB or some other ammonia oxidizers (Kim et al., 2012; Jung et al., seldom mentioned in the pure culture of nitrifiers and the Mg2+ inhibition
2014; Sedlacek et al., 2016); they were also reported to enhance the biofilm has also rarely been discussed in complex microbial community. In contrast
formation, which is expected to extend the retention time of slow-growing to many kinds of metals, the inhibition of Mg2+ is too low or could be easily
AOB in bioreactors (Petrovich et al., 2017). In this study, during the enrich- relieved by the assistance from heterotrophs, and then has usually been
ment cultivation, the abundance of genus Pseudomonas increased from less neglected in natural or engineered environments.
than 1% in the environmental sample to 72% in the fifteenth-generation Actually, a large number of microbes have been reported to remove metal
subculture; during the purification of AOB isolates, AOB colonies were ions from environments. For example, the bacterial strain Pseudomonas
hard to form if the absence of EDTA or Pseudomonas colonies on the agar hibiscicola that immobilized on peanut shell biochar could efficiently remove
plates. These results suggested that a very tight relationship was formed be- Ni(II), Cr(VI) and Cu(II) from wastewater (An et al., 2022); Bacillus Subtilis re-
tween AOB and Pseudomonas, which then benefited the growth and activity moved Pb2+ by the production of lipopeptides (Zhao et al., 2020); the my-
of AOB species. corrhizal fungi that combined with pistachio husk biochar was able to
Despite the underlying mechanism of the benefit appears broad, in this reduce Ni2+ distribution and then benefited the growth of mung bean
study, the bacterial partners of AOB that grown in co-cultivations were plant (Turan, 2021). In this study, the concomitant species of Pseudomonas
found to be able to remove the Mg2+ from culture medium. Based on an in- was regarded to be mainly responsible for the Mg2+ absorption and the
spiration from this observation, during the pure cultivation of AOB, when the high removal rate only occurred if the simultaneous presence of AOB and
concentration of Mg2+ in culture medium was reduced to low levels, the am- NOB species. Many species of Pseudomonas have been reported to absorb var-
monia oxidation was significantly improved. Thus it can be seen that high ious kinds of metals by producing polysaccharides (Tuzen et al., 2008;
concentration of cation ion Mg2+ would inhibit the activity of AOB, and Sathiyanarayanan et al., 2016; Cavallero et al., 2020). However, the produc-
the interaction between AOB and their bacterial partners including NOB or tion of polysaccharides needs to consume a lot of organic substance. In natu-
heterotroph species (Pseudomonas) could remove the Mg2+ inhibition. The ral environments, nitrifying chemoautotrophs usually act as one of the
Mg2+ exposure has been reported to have negative on the nitrifying commu- primary producers by assimilating inorganic carbon and releasing organic
nity and inhibit the activity of AOB but not NOB in wastewaters (Macedo carbon to microbial ecosystems, which support the growth of diverse con-
et al., 2019; Jeong and Bae, 2021). However, due to the lack of related comitant heterotrophs (Keluskar et al., 2013; Murakami et al., 2022). Then,

5
B. Liu et al.
during the co-cultivation in inorganic culture medium, the organic sub-
stances that secreted by AOB and NOB could be used to feed the growth
and metabolism of Pseudomonas, as well as to feed the activity of Mg2+ ab-
sorption.
In comparison with the growth in liquid culture, AOB are usually hard
to form colonies on agar plate, which in terms of the AOB isolation and
new species discovery are often limited (Aakra et al., 1999; Smith et al.,
2001; Fujitani et al., 2015). Despite some AOB species are able to form col-
onies on agar plate, the colonies are usually too small to practically be
picked and isolated (Hommes et al., 1996; Bollmann et al., 2011). In this
study, during the cultivation and isolation of AOB using the conventional
agar plate method, the supply of high concentration of CaCO3 was helpful
for the specifically identify of AOB colonies, which was accomplished by
following the visible hydrolytic zones that form around the AOB colonies.
In fact, CaCO3 is usually applied to the cultivation of ammonia oxidizers,
acting as a pH adjuster to offset the H+ that generated from ammonia oxi-
dation (Itoh et al., 2013; Daims et al., 2015; Sauder et al., 2018). However,
it has rarely been used for the cultivation of ammonia oxidizers on solid
agar plates. Due to the H+ is continuously generated from ammonia oxida-
tion, the undissolved CaCO3 would be dissolved by it, and the more the H+
is released, the larger the hydrolytic zone would be formed.
5. Conclusions
In this study, the removal of Mg2+ by concomitant heterotrophs that
presented in the co-cultures was responsible for the promotion of ammonia
oxidation. After the reduction of Mg2+ inhibition, the ammonia oxidation
in pure cultivation was significantly improved and the visible AOB colonies
were observed to form on agar plates. Addition of CaCO3 and EDTA to the
newly designed culture medium could easily and specifically identify the
AOB colonies that grown on agar plates. This study provides a suitable cul-
ture medium for the pure cultivation of AOB isolates and an effective strat-
egy for the isolation of AOB from environments.
CRediT authorship contribution statement
Buchan Liu: Investigation, Methodology, Validation, Formal analysis,
Data curation. Weitie Lin: Conceptualization, Writing – review & editing,
Funding acquisition, Supervision. Shenxi Huang: Methodology. Qiuyun
Sun: Methodology. Hao Yin: Methodology. Jianfei Luo: Conceptualiza-
tion, Writing – original draft, Writing – review & editing, Funding acquisi-
tion, Supervision.
Declaration of competing interest
The authors declare that they have no known competing financial inter-
ests or personal relationships that could have appeared to influence the
work reported in this paper.
Acknowledgements
This work was supported by the National Natural Science Foundation of
China (No. 41977034 and No. 91951118), and the Guangdong Basic and
Applied Basic Research Foundation (No. 2021A1515010565).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.scitotenv.2022.155923.
References
Aakra, A., Utaker, J.B., Nes, I.F., Bakken, L.R., 1999. An evaluated improvement of the extinc-
tion dilution method for isolation of ammonia-oxidizing bacteria. J. Microbiol. Methods
39, 23–31.
6
Science of the Total Environment 838 (2022) 155923
An, Q., Jin, N., Deng, S., Zhao, B., Liu, M., Ran, B., Zhang, L., 2022. Ni(II), Cr(VI), Cu(II) and
nitrate removal by the co-system of Pseudomonas hibiscicola strain L1 immobilized on
peanut shell biochar. Sci. Total Environ. 814, 152635.
Bollmann, A., French, E., Laanbroek, H.J., 2011. Isolation, cultivation, and characterization of
ammonia-oxidizing bacteria and archaea adapted to low ammonium concentrations.
Methods Enzymol. 486, 55–88.
Cavallero, G.J., Ferreira, M.L., Casabuono, A.C., Ramirez, S.A., Vullo, D.L., Couto, A.S., 2020.
Structural characterization and metal biosorptive activity of the major polysaccharide
produced by Pseudomonas veronii 2E. Carbohydr. Polym. 245, 116458.
Chang, M., Liang, B., Zhang, K., Wang, Y., Jin, D., Zhang, Q., et al., 2022. Simultaneous short-
cut nitrification and denitrification in a hybrid membrane aerated biofilms reactor (H-
MBfR) for nitrogen removal from low COD/N wastewater. Water Res. 211, 118027.
Chawley, P., Rana, A., Jagadevan, S., 2021. Envisioning role of ammonia oxidizing bacteria in
bioenergy production and its challenges: a review. Crit. Rev. Biotechnol. https://doi.org/
10.1080/07388551.2021.1976099.
Daims, H., Lebedeva, E.V., Pjevac, P., Han, P., Herbold, C., Albertsen, M., et al., 2015. Com-
plete nitrification by Nitrosopira bacteria. Nature 528, 504–509.
Daims, H., Lucker, S., Wagner, M., 2016. A new perspective on microbes formerly known as
nitrite-oxidizing bacteria. Trends Microbiol. 24, 699–712.
Faust, K., Raes, J., 2012. Microbial interactions: from networks to models. Nat.Rev. Microbiol.
10, 538–550.
Frank, J.A., Reich, C.I., Sharma, S., Weisbaum, J.S., Wilson, B.A., Olsen, G.J., 2008. Critical
evaluation of two primers commonly used for amplification of bacterial 16S rRNA
genes. Appl. Environ. Microbiol. 74, 2461–2470.
Fujitani, H., Kumagai, A., Ushiki, N., Momiuchi, K., Tsuneda, S., 2015. Selective isolation of
ammonia-oxidizing bacteria from autotrophic nitrifying granules by applying cell-
sorting and sub-culturing of microcolonies. Front. Microbiol. 6, 1159.
Gonzalez-Cabaleiro, R., Curtis, T.P., Ofiteru, I.D., 2019. Bioenergetics analysis of ammonia-
oxidizing bacteria and the estimation of their maximum growth yield. Water Res. 154,
238–245.
He, Q., Liu, J., Peng, Y., Li, X., Zhang, Q., 2022. Realization of partial nitrification and in-situ
anammox in continuous-flow anaerobic/aerobic/anoxic process with side-stream sludge
fermentation for real sewage. Bioresour. Technol. 346, 126520.
Hommes, N.G., Sayavedra-Soto, L.A., Arp, D.J., 1996. Mutagenesisi of hydroxylamine oxido-
reductase in Nitrosomonas europaea by transformation and recombination. J. Bacteriol.
178, 3710–3714.
ISO/TS 14256–1:2003, 2003. Soil Quality-determination of Nitrate, Nitrite And Ammonium
in Field Moist Soils by Extraction With Potassium Chloride Solution. International Orga-
nisation for Standardisation, Geneva.
Itoh, Y., Sakagami, K., Uchino, Y., Boonmak, C., Oriyama, T., Tojo, F., et al., 2013. Isolation
and characterization of a thermotolerant ammonia-oxidizing bacterium Nitrosomonas
sp. JPCCT2 from a thermal power station. Microbes Environ. 28, 432–435.
Jeong, D., Bae, H., 2021. Insight into functionally active bacteria in nitrification following Na
+ and Mg2+ exposure based on 16S rDNA and 16S rRNA sequencing. Sci. Total Envi-
ron. 758, 143592.
Jung, M.Y., Park, S.J., Kim, S.J., Kim, J.G., Damste, J.S.S., Jeon, C.O., et al., 2014. A
mesophilic, autotrophic, ammonia-oxidizing archaeon of thaumarchaeal group I.
1a cultivated from a deep oligotrophic soil horizon. Appl. Environ. Microbiol. 80,
3645–3655.
Keluskar, R., Nerurkar, A., Desai, A., 2013. Mutualism between autotrophic ammonia-
oxidizing bacteria (AOB) and heterotrophs present in an ammonia-oxidizing colony.
Arch. Microbiol. 195, 737–747.
Kennes-Veiga, D.M., Gonzalez-Gil, L., Carballa, M., Lema, J.M., 2022. Enzymatic cometabolic
biotransformation of organic micropollutants in wastewater treatment plants: a review.
Bioresour. Technol. 344 (part B), 126291.
Kim, J.G., Jung, M.Y., Park, S.J., Rijpstra, I.C., Damste, J.S.S., Madsen, E.L., et al., 2012. Cul-
tivation of a highly enriched ammonia-oxidizing archaeon of thaumarchaeotal group I.1b
from an agricultural soil. Environ. Microbiol. 14, 1528–1543.
Kim, J.G., Park, S.J., Damste, J.S.S., Schouten, S., Rijpstra, W.I.C., Jung, M.Y., et al., 2016. Hy-
drogen peroxide detoxification is a key mechanism for growth of ammonia-oxidizing ar-
chaea. PNAS 113, 7888–7893.
Kowalchuk, G.A., Stephen, J.R., 2001. Ammonia-oxidizing bacteria: a model for molecular
microbial ecology. Annu. Rev. Microbiol. 55, 485–529.
Kumwimba, M.N., Meng, F., 2019. Roles of ammonia-oxidizing bacteria in improving metab-
olism and cometabolism of trace organic chemicals in biological wastewater treatment
processes: a review. Sci. Total Environ. 659, 419–441.
Li, S., Peng, L., Yang, C., Song, S., Xu, Y., 2022. Cometabolic biodegradation of antibiotics by
ammonia oxidizing microorganisms during wastewater treatment processes. J. Environ.
Manag. 305, 114336.
Li, X., Kapoor, V., Impelliteri, C., Chandran, K., Domingo, J.W.S., 2015. Measuring nitrifica-
tion inhibition by metals in wastewater treatment systems: current state of science and
fundamental research needs. Crit. Rev. Environ. Sci. Technol. 46, 249–289.
Liu, L., Li, S., Han, J., Lin, W., Luo, J., 2019. A two-step strategy for the rapid enrichment of
Nitrosocosmicus-like ammonia-oxidizing Thaumarchaea. Front. Microbiol. 10, 875.
Lu, X., Taylor, A.E., Myrold, D.D., Neufeld, J.D., 2020. Expanding perspectives of soil nitrifi-
cation to include ammonia-oxidizing archaea and comammox bacteria. Soil Sci. Soc.
Am. J. 84, 287–302.
Lukumbuzya, M., Kristensen, J.M., Kitzinger, K., Pommerening-Roser, A., Nielsen, P.H.,
Wagner, M., et al., 2020. A refined set of rRNA-targeted oligonucleotide probes for in
situ detection and quantification of ammonia-oxidizing bacteria. Water Res. 186,
116372.
Luo, J.F., Lin, W.T., Guo, Y., 2010. Method to detect only viable cells in microbial ecology.
Appl. Microbiol. Biotechnol. 86, 377–384.
Macedo, W.V., Sakamoto, I.K., Azevedo, E.B., Damianovic, M.H.R.Z., 2019. The effect of cat-
ions (Na+, Mg2+, and Ca2+) on the activity and structure of nitrifying and denitrifying
bacterial communities. Sci. Total Environ. 679, 279–287.
B. Liu et al.
Murakami, C., Machida, K., Nakao, Y., Kindaichi, T., Ohashi, A., Aoi, Y., 2022. Mutualistic re-
lationship between Nitrospira and concomitant heterotrophs. Environ. Microbiol. Rep.
14, 130–137.
Palatinszky, M., Herbold, C., Jehmlich, N., Pogoda, M., Han, P., von Bergen, M., et al., 2015.
Cyanate as an energy source for nitrifiers. Nature 524, 105–108.
Petrovich, M., Wu, C.Y., Rosenthal, A., Chen, K.F., Packman, A.I., Wells, G.F., 2017.
Nitrosomonas europaea biofilm formation is enhanced by Pseudomonas aeruginosa.
FEMS Microbiol. Ecol. 93, fix047.
Radniecki, T.S., Semprini, L., Dolan, M.E., 2009. Expression of merA, amoA and Hao in con-
tinuously cultured Nitrosomonas europaea cells exposed to zinc chloride additions.
Biotechnol. Bioengin. 102, 546–553.
Rotthauwe, J.H., Witzel, K.P., Lierack, W., 1997. The ammonia monooxygenase structural
gene amoA as a functional marker: molecular fine-scale analysis of natural ammonia-
oxidizing populations. Appl. Environ. Microbiol. 63, 4704–4712.
Sathiyanarayanan, G., Bhatia, S.K., Kim, H.J., Kim, J.H., Jeon, J.M., Kim, Y.G., et al., 2016.
Metal removal and reduction potential of an exopolysaccharide produced by Arctic
psychrotrophic bacterium Pseudomonas sp. PAMC 28620. RSC Adv. 6, 96870–96881.
Sauder, L.A., Engel, K., Lo, C.C., Chain, P., Neufeld, J.D., 2018. “Candidatus nitrosotenuis
aquarius”, an ammonia-oxidizing archaeon from a freshwater aquarium biofilter. Appl.
Environ. Microbiol. 84, e01430-18.
Sedlacek, C.J., Nielsen, S., Greis, K.D., Haffey, W.D., Revsbech, N.P., Ticak, T., 2016. Effects of
bacterial community members on the proteome of the ammonia-oxidizing bacterium
Nitrosomonas sp. strain Is79. Appl. Environ. Microbiol. 82, 4776–4788.
Smith, Z., McCaig, A.E., Stephen, J.R., Embley, T.M., Prosser, J.I., 2001. Species diversity of
uncultured and cultured populations of soil and marine ammonia oxidizing bacteria.
Microb. Ecol. 42, 228–237.
Soliman, M., Eldyasti, A., 2018. Ammonia-oxidizing bacteria (AOB): opportunities and
applications-a review. Rev. Environ. Sci. Biotechnol. 17, 285–321.
Stein, L.Y., 2019. Insights into the physiology of ammonia-oxidizing microorganisms. Curr.
Opin. Chem. Biol. 49, 8–15.
Tauqeer, H.M., Turan, V., Iqbal, M., 2022. Production of safer vegetables from heavy metals
contaminated soils: The current situation, concerns associated with human health and
Science of the Total Environment 838 (2022) 155923
novel management strategies. In: Malik, J.A. (Ed.), Advances in Bioremediation And
Phytoremediation for Sustainable Soil Management: Principles, Monitoring And Remedi-
ation. Springer International Publishing, Cham, pp. 301–312.
Turan, V., 2021. Arbuscular mycorrhizal fungi and pistachio husk biochar combination re-
duces Ni distribution in mungbean plant and improves plant antioxidants and soil en-
zymes. Physiol. Plant. 173, 418–429.
Turan, V., Schroder, P., Bilen, S., Insam, H., Juarez, M.F.D., 2019. Co-inoculation effect of Rhi-
zobium and Achillea millefolium L. oil extracts on growth of common bean (Phaseolus
vulgaris L.) and soil microbial-chemical properties. Sci. Rep. 9, 15178.
Tuzen, M., Saygi, K.O., Usta, C., Soylak, M., 2008. Pseudomonas aeruginosa immobilized
multiwalled carbon nanotubes as biosorbent for heavy metal ions. Bioresour. Technol.
99, 1563–1570.
Wang, L., Qiu, S., Guo, J., Ge, S., 2021. Light irradiation enables rapid start-up of nitritation
through suppressing nxrB gene expression and stimulating ammonia-oxidizing bacteria.
Environ. Sci. Technol. 19, 13297–13305.
Wang, X., Liu, L., Lin, W., Luo, J., 2020. Development and characterization of an aerobic bac-
terial consortium for autotrophic biodegradation of thiocyanate. Chem. Eng. J. 398,
125461.
Wertz, S., Poly, F., Le Roux, X., Degrange, V., Notes, A., 2008. Development and application of
a PCR-denaturing gradient gel electrophoresis tool to study the diversity of Nitrobacter-
like nxrA sequences in soil. FEMS Microbiol. Ecol. 63, 261–271.
Xu, S., Chai, W., Xiao, R., Smets, B.F., Palomo, A., Lu, H., 2022. Survival strategy of
comammox bacteria in a wastewater nutrient removal system with sludge fermentation
liquid as additional carbon source. Sci. Total Environ. 802, 149862.
Zengler, K., Zaramela, L.S., 2018. The social network of microorganisms - how auxotrophies
shape complex communities. Nat.Rev. Microbiol. 16, 383–390.
Zhao, P., Xu, X., Zhao, X., Ai, C., Xu, K., Li, M., Jiang, C., Shi, J., 2020. Capability of Bacillus
subtilis to remove Pb2+ via producing lipopeptides. Sci. Total Environ. 730, 138941.