nature cell biology

Article https://doi.org/10.1038/s41556-022-01061-0

Nucleus-exported CLOCK acetylates PRPS to

promote de novo nucleotide synthesis and
liver tumour growth

Received: 28 February 2022 Tong Liu    1,2,3,4,12, Zheng Wang1,2,12, Leiguang Ye5,6,12, Yuran Duan1,12,
Hongfei Jiang7, Haiyan He1,2, Liwei Xiao1,2, Qingang Wu1,2, Yan Xia8,
Accepted: 24 November 2022
Mengke Yang9, Ke Wu1, Meisi Yan10, Guimei Ji1, Yuli Shen1, Lei Wang1, Lin Li1,
Published online: 16 January 2023 Peixiang Zheng1, Bofei Dong1, Fei Shao    7, Xu Qian11, Rilei Yu9, Zhiren Zhang4,
Zhimin Lu    1,2  & Daqian Xu    1,2 
Check for updates

Impairment of the circadian clock is linked to cancer development. However,

whether the circadian clock is modulated by oncogenic receptor tyrosine
kinases remains unclear. Here we demonstrated that receptor tyrosine
kinase activation promotes CK2-mediated CLOCK S106 phosphorylation
and subsequent disassembly of the CLOCK–BMAL1 dimer and suppression
of the downstream gene expression in hepatocellular carcinoma (HCC)
cells. In addition, CLOCK S106 phosphorylation exposes its nuclear export
signal to bind Exportin1 for nuclear exportation. Cytosolic CLOCK acetylates
PRPS1/2 K29 and blocks HSC70-mediated and lysosome-dependent PRPS1/2
degradation. Stabilized PRPS1/2 promote de novo nucleotide synthesis and
HCC cell proliferation and liver tumour growth. Furthermore, CLOCK S106
phosphorylation and PRPS1/2 K29 acetylation are positively correlated in
human HCC specimens and with HCC poor prognosis. These findings delineate
a critical mechanism by which oncogenic signalling inhibits canonical CLOCK
transcriptional activity and simultaneously confers CLOCK with instrumental
moonlighting functions to promote nucleotide synthesis and tumour growth.

Circadian rhythms govern many physiological and metabolic functions output cycles kaput (CLOCK) and brain and muscle Arnt-like protein 1
through the internal self-sustained circadian clock, which is regulated (BMAL1, also known as ARNTL). These molecules form a tightly inter-
by interconnected negative feedback loops1. The circadian clock is twined heterodimer and bind to E-box sequences of the targeted pro-
primarily regulated by the transcription factors circadian locomotor moters to induce the transcription of many clock-controlled genes

Zhejiang Provincial Key Laboratory of Pancreatic Disease, The First Affiliated Hospital, Institute of Translational Medicine, Zhejiang University School of
1

Medicine, Zhejiang University, Hangzhou, China. 2Cancer Center, Zhejiang University, Hangzhou, China. 3Department of Breast Surgery, Harbin Medical
University Cancer Hospital, Harbin, China. 4NHC Key Laboratory of Cell Transplantation, The First Affiliated Hospital of Harbin Medical University, Harbin,
China. 5Department of Medical Oncology, Harbin Medical University Cancer Hospital, Harbin, China. 6Harbin, China. 7The Affiliated Hospital of Qingdao
University and Qingdao Cancer Institute, Qingdao, China. 8Department of Cancer Biology, Department of Neuro-Oncology, The University of Texas MD
Anderson Cancer Center, Houston, TX, USA. 9Key Laboratory of Marine Drugs, Chinese Ministry of Education, School of Medicine and Pharmacy, Ocean
University of China, Qingdao, China. 10Department of Pathology, Harbin Medical University, Harbin, China. 11Department of Clinical Laboratory, Cancer
Hospital of the University of Chinese Academy of Sciences (Zhejiang Cancer Hospital), Institute of Basic Medicine and Cancer (IBMC), Chinese Academy
of Sciences, Hangzhou, China. 12These authors contributed equally: Tong Liu, Zheng Wang, Leiguang Ye, Yuran Duan.  e-mail: zhiminlu@zju.edu.cn;
xudaqian@zju.edu.cn

Nature Cell Biology | Volume 25 | February 2023 | 273–284 273

Article
(CCGs), including period (encoding PER1/2/3) and cryptochrome
(encoding CRY1/2), during the day2,3. In turn, PER and CRY assemble
into a heterodimer and suppress CLOCK/BMAL1 activity during the
night, thereby forming a negative feedback cycle4,5. In addition, the
CLOCK–BMAL1 complex regulates the expression of the orphan nuclear
hormone receptors REV-ERBα/β, which in turn represses BMAL1, and
retinoic acid orphan receptors, which subsequently activate BMAL1,
thus constituting a second feedback loop4,5.
The functionality of the circadian clock in tumour cells was shown
to be impaired1. Bioinformatic analyses of 14 different cancer types
revealed that many core clock genes and CCGs were differentially
expressed6. Experimental jet lag and genetic mutation of the cen-
tral circadian clock components BMAL1 and PER2 exacerbated lung
tumourigenesis7. In addition, mice lacking PER1 and PER2, CRY1 and
CRY2 or one copy of BMAL1 all showed increased spontaneous and
radiation-induced tumour development8,9. However, circadian genes
may aggravate tumour progression in some instances. For instance,
depletion of CLOCK and BMAL1 impeded murine acute myeloid leukae-
mia cell growth and dampened glioblastoma stem cell proliferation and
brain tumour growth10,11. These findings suggest that the roles of clock
genes in different types of cancer are disparate and that the distinct
effects of core clock deficiency on tumour formation can result from
disruption of not only their transcriptional functions but also gene
expression-independent functions. However, whether CLOCK directly
regulates cancer cell proliferation in response to oncogenic signalling
in an expression- and canonical transcriptional function-independent
manner remains unclear.
In this Article, we revealed that activation of receptor tyrosine
kinases disrupted the CLOCK/BMAL1 complex and its transcriptional
activity by CK2-dependent CLOCK S106 phosphorylation. This phos-
phorylation resulted in Exportin1-mediated nuclear exportation of
CLOCK, which acetylated PRPS1/2 at K29 in the cytosol and stabilized
PRPS1/2 expression to promote de novo nucleotide synthesis and
hepatocellular carcinoma (HCC) cell proliferation.
Results
CLOCK S106 phosphorylation induces its nuclear exportation
To determine whether CLOCK is regulated by oncogenic signalling,
we treated Huh7 and Hep3B human HCC cells for 1 h with insulin-like
growth factor 1 (IGF1), which activates IGF1 receptor (IGF1R) and is
critical for HCC development12,13. Co-immunoprecipitation (IP) analyses
showed that IGF1 reduced CLOCK–BMAL1 heterodimerization (Fig. 1a).
Consistently, IGF1 treatment inhibited the transcriptional activity
of CLOCK (Extended Data Fig. 1a) and reduced the expression of the
CLOCK downstream genes Dbp and Nr1d1 in HCC cells (Fig. 1b).
Pre-treatment of Huh7 cells with MK-2206, SU6656, SP600125
and TBB, which inhibited IGF1-induced activation of AKT, c-Src,
c-Jun N-terminal kinase ( JNK) and CK2α, respectively (Extended
Data Fig. 1b), showed that only the CK2α inhibitor TBB blocked
IGF1-induced disruption of the CLOCK–BMAL1 complex (Fig. 1c).
A GST pulldown assay showed that purified bacteria-expressed
GST-CLOCK interacted with purified bacteria-expressed His-CK2α
(Fig. 1d). It was previously shown that ERK activated by growth fac-
tors phosphorylates CK2α at T360/S362, subsequently enhancing
CK2α activity14. Treatment with the ERK inhibitor U0126 (Extended
Data Fig. 1c), the expression of CK2α T360A/S362A mutant, or treat-
ment with calf intestinal alkaline phosphatase (CIP) abrogated the
IGF1-induced interaction between CK2α and CLOCK (Extended
Data Fig. 1d). Consistently, the presence of purified active His-ERK2
increased the binding of purified His-CLOCK to purified wild-type
(WT) GST-CK2α but not the GST-CK2α T360A/S362A mutant, and
CIP treatment reduced the association between CK2α and CLOCK
(Extended Data Fig. 1e). These results indicate that IGF1-induced
and ERK-mediated CK2α T360/S362 phosphorylation promotes
the binding of CK2α to CLOCK.
Nature Cell Biology | Volume 25 | February 2023 | 273–284
https://doi.org/10.1038/s41556-022-01061-0
To determine whether CK2α phosphorylates CLOCK, we per-
formed an in vitro phosphorylation analysis by incubating purified
GST-CK2α with purified His-CLOCK. Mass spectrometry analyses
showed that CLOCK was phosphorylated at S106 (Extended Data
Fig. 1f), which is evolutionarily conserved and in a phosphorylation
consensus motif of CK2α (Extended Data Fig. 1g). This result was vali-
dated by mixing purified WT GST-CK2α or inactive GST-CK2α K68M
with WT His-CLOCK or His-CLOCK S106A in the presence of [γ-32P]
ATP, showing that only WT GST-CK2α phosphorylated WT His-CLOCK
but not His-CLOCK S106A (Fig. 1e). This phosphorylation was also
detected using a specificity-validated anti-CLOCK pS106 antibody
(Fig. 1e and Extended Data Fig. 1h–j). Consistent results showed that
IGF1 treatment of Huh7 cells induced phosphorylation of CLOCK S106
and α-catenin S641, an established CK2α phosphorylation substrate14,
which was abrogated by TBB treatment (Fig. 1f). In vitro GST pulldown
experiments showed that purified His-BMAL1 bound to purified WT
GST-CLOCK and GST-CLOCK S106A, whereas the presence of purified
CK2α reduced the binding of His-BMAL1 to WT GST-CLOCK but not
to GST-CLOCK S106A (Fig. 1g). In addition, CLOCK S106A expressed
in Huh7 cells was resistant to IGF1-induced dissociation of CLOCK
from BMAL1 (Fig. 1h). These results indicate that IGF1-induced and
CK2α-phosphorylated CLOCK S106 phosphorylation promotes the
disassembly of the CLOCK–BMAL1 complex.
Intriguingly, immunofluorescence staining showed that CLOCK,
which was originally localized in the nucleus, exhibited cytosolic accu-
mulation upon IGF1 treatment (Fig. 1i). These results were validated by
cell fractionation analyses (Extended Data Fig. 1k,l). Notably, expres-
sion of CLOCK S106A (Fig. 1j), TBB treatment (Extended Data Fig. 1m)
or the inactive CK2α K68M expression (Extended Data Fig. 1n) inhibited
IGF1-induced cytosolic accumulation of CLOCK. These results indicate
that IGF1-induced and CK2α-phosphorylated CLOCK S106 promotes
cytosolic CLOCK accumulation in HCC cells.
CLOCK pS106 binds to Exportin1 for nuclear exportation
Analyses of the peptide sequence adjacent to the S106 revealed a poten-
tial nuclear export signal (NES) (Extended Data Fig. 2a). Molecular
dynamic (MD) simulations show that CLOCK S106 phosphorylation
elicited dramatic conformation perturbation of the CLOCK–BMAL1
complex (Extended Data Fig. 2b), suggesting that the S106 phospho-
rylation introduces notable steric effects on the adjacent amino acids.
Consistent results showed that the non-phosphorylated S106 and the
three adjacent Leu residues at the NES fragment of CLOCK were closely
surrounded or covered by three highly flexible loops (loops 1, 2 and 3)
of BMAL1 containing negatively charged D144, D231, D299 and E303,
which are in close proximity to S106 (Fig. 2a, top, and Extended Data
Fig. 2c). CLOCK S106 phosphorylation flipped over these three loops
to the other sides, resulting in the more solvent exposed NES frag-
ment (Fig. 2a, bottom). However, mutations of D144, D231, D299 and
E303 into Ala in BMAL1 (BMAL1 4Mut) conferred the resistance of the
CLOCK–BMAL1 complex to CLOCK S106 phosphorylation-induced
conformational changes (Extended Data Fig. 2d). In addition, co-IP
analyses showed that BMAL1 4Mut was resistant to be dissociated from
CLOCK upon IGF1 treatment (Fig. 2b). Consistently, a GST pulldown
assay showed that purified His-BMAL1 4Mut, unlike its WT counter-
part, failed to dissociate from purified GST-CLOCK in the presence of
CK2α (Extended Data Fig. 2e). These results strongly suggested that
phosphorylated and negatively charged S106 of CLOCK repels the
negative charged amino acids in loops 1, 2 and 3 of BMAL1, leading to
conformational change of both CLOCK and BMAL1, exposure of CLOCK
NES and consequently disruption of the interaction between CLOCK
and BMAL1. In line with these results, mutation of this NES sequence
diminished IGF1-induced CLOCK-nuclear exportation, as shown by
immunofluorescence (Fig. 2c) and immunoblotting (Extended Data
Fig. 2f) analyses, further supporting that CLOCK S106 phosphoryla-
tion exposes its NES for subsequent cytosolic translocation of CLOCK.
274
Article https://doi.org/10.1038/s41556-022-01061-0

a Huh7 Hep3B b c IGF1 – + + + + +

IP: IP: Hep3B MK-2206 – – + – – –
Huh7
SU6656 – – – + – –
G

G
CLOCK CLOCK Dbp Nr1d1
Ig

Ig
Dbp Nr1d1 SP600125 – – – – + –
IGF1 – – + – – + 1.5 1.5 1.5 1.5
* * ** * TBB – – – – – +

mRNA level

mRNA level
mRNA level
mRNA level
75

Relative

Relative
Relative
Relative
1.0 1.0 1.0 1.0
IP WB: BMAL1 75
IP:
100 0.5 0.5 0.5 0.5
CLOCK WB: BMAL1
WB: CLOCK 100
0 0 0 0
75 IGF1 – + IGF1 – + IGF1 – + IGF1 – + WB: CLOCK
Input WB: BMAL1 75
50 Input WB: BMAL1
WB: tubulin
50
WB: tubulin

d e f g
His-CLOCK S106A – + – + – TBB – – – – – – +
His-CK2α + + – GST-CLOCK WT – + – + –
His-CLOCK WT + – + – + IGF1 (min) 0 5 10 15 30 60 60
GST + – – GST-CLOCK S106A – – + – +
GST-CLOCK – + + GST-CK2α WT – – + + – 100 His-CK2α WT – – – + +
GST-CK2α K68M – – – – + WB: CLOCK pS106 His-BMAL1 + + + + +
37
pulldown

WB: CK2α 100 100 GST + – – – –

150
GST

32
P-CLOCK WB: CLOCK 75
100 100 WB: BMAL1

pulldown
WB: CLOCK pS106 WB: α-catenin pS641
25 100

GST
WB: GST 75 100 WB: CLOCK pS106
Input 150
37 WB: CK2α WB: α-catenin
WB: CK2α
100 50
WB: CLOCK WB: tubulin 25
WB: GST

h i j Flag-CLOCK WT S106A Input WB: BMAL1

75

Flag-CLOCK WT S106A
IGF1 – + IGF1 – + – +
IGF1 – + – + 37
100 WB: CK2α
75
Cytosolic distributive

40 WB: Flag (CLOCK)

WB: BMAL1 CLOCK ***
Cytosol
intensity (%)

IP: Flag 100

30 50
WB: tubulin
WB: CLOCK pS106 20
37
100 10
WB: CLOCK WB: PCNA
CLOCK
75 +DAPI 0 100
WB: BMAL1 IGF1 – + WB: Flag (CLOCK)
100 100
Input WB: α-catenin pS641 20 µm WCL WB: α-catenin pS641
100 100
WB: α-catenin WB: α-catenin
50 50
WB: tubulin WB: tubulin

Fig. 1 | CLOCK S106 phosphorylation induces its nuclear exportation. g, Bacterially purified GST-CLOCK WT or GST-CLOCK S106A on glutathione
a, Huh7 and Hep3B cells were treated with or without IGF1 (100 ng ml−1) for 1 h. agarose beads was incubated with or without His-CK2α in the presence of ATP
b, The mRNA expression levels of CLOCK downstream target genes were for an in vitro kinase assay. The beads were then washed with PBS five times
measured using quantitative PCR (n = 6). The data represent the mean ± s.d. and incubated with purified His-BMAL1 proteins. h, Flag-CLOCK WT or Flag-
of three independent experiments. *P < 0.001, **P < 0.0001 by two-tailed CLOCK S106A was transfected into Huh7 cells that were then stimulated with or
Student’s t-test. c, Huh7 cells were pre-treated with or without MK-2206 without IGF1 (100 ng ml−1) for 1 h. i, Huh7 cells were treated with or without IGF1
(10 μM), SU6656 (4 μM), SP600125 (25 μM) or TBB (10 μM) for 30 min before (100 ng ml−1) for 1 h. Top: immunofluorescence analyses were performed with
treatment with or without IGF1 (100 ng ml−1) for 1 h. d, A GST pulldown assay the indicated antibodies. Bottom: the cytosolic distribution intensity of CLOCK
was performed by mixing purified His-CK2α with purified GST or GST-CLOCK. is shown. Data are shown as mean ± s.d., n = 10. *P < 0.001, **P < 0.0001 by two-
Immunoblotting analyses were performed as indicated. e, In vitro kinase assays tailed Student’s t-test. j, Huh7 cells transfected with the indicated plasmids were
and autoradiography were performed by mixing purified WT GST-CK2α or GST- treated with or without IGF1 (100 ng ml−1) for 1 h. Cytosolic and whole-cell lysates
CK2α K68M protein with purified His-CLOCK WT or His-CLOCK S106A protein in were collected. All experiments were repeated three times independently with
the presence of [γ32P]-ATP. f, Huh7 cells pre-treated with or without TBB (10 μM) similar results. In a, c and e–h, IP and immunoblotting analyses were performed
for 30 min were treated with IGF1 (100 ng ml−1) for the indicated periods. with the indicated antibodies.

The NES of nuclear proteins is recognized by a nuclear export the presence of WT CK2α but not inactive His-CK2α K68M (Fig. 2e).
receptor, such as Exportin1 (also known as CRM1 or XPO1), Expor- Consistently, IGF1 treatment induced the binding of Exportin1 to
tin2 and Exportin3, which translocate proteins out of the nucleus15,16. reconstituted WT CLOCK, but not CLOCK S106A or the CLOCK NES
Co-IP analyses showed that IGF1 treatment induced the binding of mutant, in endogenous CLOCK-depleted Huh7 (Fig. 2f and Extended
Flag-Exportin1, but not Flag-Exportin2 or Flag-Exportin3, to CLOCK Data Fig. 2h) and Hep3B cells (Extended Data Fig. 2i). As expected,
(Fig. 2d), and this binding was inhibited by TBB treatment (Extended depletion of Exportin1 blocked IGF1-induced CLOCK-nuclear exporta-
Data Fig. 2g) or expression of BMAL1 4Mut (Fig. 2b). A GST pulldown tion in Huh7 cells (Fig. 2g). These results indicate that IGF1-induced and
assay showed that purified GST-Exportin1 bound to purified WT CK2α-mediated CLOCK S106 phosphorylation promotes the binding
His-CLOCK, but not CLOCK S106A or the His-CLOCK NES mutant, in of CLOCK to Exportin1 for nuclear exportation of CLOCK.

Nature Cell Biology | Volume 25 | February 2023 | 273–284 275

Article https://doi.org/10.1038/s41556-022-01061-0

a CLOCK non-phosphorylation b c Flag-rCLOCK

Flag-rBMAL1 WT + + + + – –
BMAL1 CLOCK Flag-rBMAL1 4Mut – – – – + + WT S106A NES mutant
BMAL1 shRNA + + + + + +
HA-CLOCK WT + + – – + +

Flag
HA-CLOCK S106A – – + + – –
IGF1 – + – + – +
Loop 3

+IGF1
S106 100
WB: Exportin1

Flag + DAPI
L118 75
L113 WB: Flag (rBMAL1)
IP: HA
Loop 1 L115
100
WB: CLOCK pS106 *** 20 µm
30 ***
100

Cytosolic distributive
Loop 2
WB: HA (CLOCK)

intensity (%)
20
100
WB: Exportin1
10
75
WB: BMAL1
Input 100 0
T A n t
WB: α-catenin pS641 Flag-rCLOCK W 06 ta
CLOCK S106 phosphorylation S1 mu
100 S
WB: α-catenin NE
BMAL1 CLOCK
50
d IgG IP: Flag
WB: tubulin Flag-Exportin1 + + + – – – –
Flag-Exportin2 – – – + + – –
Loop 3 Flag-Exportin3 – – – – – + +
pS106
IGF1 + – + – + – +
f Huh7 100

Flag-rCLOCK WT + + – – – – IP: Flag WB: CLOCK

Loop 1 L118
L113 Flag-rCLOCK S106A – – + + – – 100
Flag-rCLOCK NES mutant – – – – + + WB: Flag (Exportin)
L115 CLOCK shRNA + + + + + + 100
IGF1 – + – + – +
Input WB: CLOCK

Loop 2 100 50
WB: Exportin1 WB: tubulin
IP: Flag 100
WB: CLOCK pS106 g CRM1 shRNA – – + +
e His-CLOCK WT + + – – – – + 100 IGF1 – + – +
His-CLOCK S106A – – + + – – – WB: Flag (rCLOCK) 100
His-CLOCK NES mutant – – – – + + – 100
WB: CLOCK
GST-Exportin1 + + + + + + + WB: CLOCK Cytosol 50
His-CK2α WT – + – + – + – WB: tubulin
Cytosol 50
His-CK2α K68M – – – – – – + 37
WB: tubulin
WB: PCNA
pulldown

100 37
100
GST

WB: CLOCK WB: PCNA

WB: CLOCK
150
100 100
WB: GST (Exportin1) WB: Exportin1 WB: Exportin1
100 100 WCL 100
WB: CLOCK pS106 Input WB: α-catenin pS641 WB: α-catenin pS641
Input 100 100 100
WB: CLOCK WB: α-catenin WB: α-catenin

50 50
37
WB: CK2α WB: tubulin WB: tubulin

Fig. 2 | CLOCK pS106 binds to Exportin1 for nuclear exportation. a, The
conformation of the CLOCK–BMAL1 complex of the last frame extracted from
250 ns MD simulation. CLOCK structures with and without S106 phosphorylation
are shown in cyan and green, respectively. BMAL1 is shown in blue. Loop 1,
loop 2 and loop 3 of BMAL1 and the CLOCK NES residues, including L113, L115
and L118, are shown as indicated. The red arrows indicate CLOCK S106 with and
without side-chain phosphorylation. b, Huh7 cells expressing BMAL1
shRNA with reconstituted expression of the indicated BMAL1 proteins were
transfected with the indicated plasmids and treated with or without IGF1
(100 ng ml−1) for 1 h. IP and immunoblotting analyses were performed with the
indicated antibodies. c, Huh7 cells expressing CLOCK shRNA with reconstituted
expression of Flag-rCLOCK WT, S106A or NES mutant protein were treated
with IGF1 (100 ng ml−1) for 1 h. Immunofluorescence analyses were performed
with the indicated antibodies. The cytosolic distribution intensity of CLOCK
is shown (bottom). Data are shown as mean ± s.d., ***P < 0.0001 by one-way
ANOVA post hoc test. d, Huh7 cells transfected with the indicated plasmids
were treated with or without IGF1 (100 ng ml−1) for 1 h. IP and immunoblotting
analyses were performed with the indicated antibodies. e, An in vitro kinase assay
was performed by mixing the indicated His-CLOCK and CK2α proteins in the
presence of ATP, followed by a GST pulldown assay by incubation with
GST-Exportin1 as indicated. f, Huh7 cells expressing CLOCK shRNA with
reconstituted expression of Flag-rCLOCK WT, S106A or NES mutant protein
were treated with or without IGF1 (100 ng ml−1) for 1 h. Cytosolic and whole-cell
lysates were collected for IP and immunoblotting analyses as indicated. g, Huh7
cells expressing CRM1 shRNA were treated with or without IGF1 (100 ng ml−1)
for 1 h. IP and immunoblotting analyses were performed with the indicated
antibodies. All experiments were repeated three times independently with
similar results.

Nature Cell Biology | Volume 25 | February 2023 | 273–284 276

Article https://doi.org/10.1038/s41556-022-01061-0

a Flag-rCLOCK WT + + – – – – b GST-CLOCK WT – + – + – + GST-CLOCK WT – + – + – +

Flag-rCLOCK NES mutant – – + + – – GST-CLOCK S106A – – + – + – GST-CLOCK S106A – – + – + –
Flag-rCLOCK S106A – – – – + + His-CK2α WT – – – + + + His-CK2α WT – – – + + +
CLOCK shRNA + + + + + + His-PRPS1 + + + + + + His-PRPS2 + + + + + +
IGF1 – + – + – + TBB – – – – – + TBB – – – – – +
37 37 37
WB: acetyl-lysine WB: acetyl-lysine
WB: PRPS1/2
37 37
IP: Flag 100
WB: PRPS1/2 WB: PRPS1/2
WB: CLOCK pS106
100 100
100 WB: CLOCK pS106 WB: CLOCK pS106
WB: Flag (rCLOCK)
100 100
37 WB: CLOCK WB: CLOCK
Input WB: PRPS1/2
37 37
50 WB: CK2α WB: CK2α
WB: tubulin

c d Huh7 Hep3B
Flag-PRPS1 WT + + – – Flag-PRPS2 WT + + – – C 1 2 1 C2
R- R-
C -C -
Flag-PRPS1 K29R – – + +Flag-PRPS2 K29R – – + + 9 9 9R 9R
PRPS1/2 WT K2 K2 WT K2 K2
IGF1 – + – + IGF1 – + – +
IGF1 – + – + – + – + – + – +
37 37
IP: Flag WB: PRPS1/2 K29ac IP: Flag WB: PRPS1/2 K29ac 37
WB: PRPS1/2 K29ac
37 37
37
WB: Flag (PRPS1) WB: Flag (PRPS2)
WB: PRPS1/2
100 100
WB: CLOCK pS106 100
WB: CLOCK pS106 WB: CLOCK pS106
Input 100 Input 100
100
WB: CLOCK WB: CLOCK WB: CLOCK
50 50 50
WB: tubulin WB: tubulin
WB: tubulin

e HA-PRPS1 + + + + HA-PRPS2 + + + +
f HA-PRPS1 + + + + + + HA-PRPS2 + + + + + +
Flag-rCLOCK WT + + – – Flag-rCLOCK WT + + – – Flag-rCLOCK WT + + – – – – Flag-rCLOCK WT + + – – – –
Flag-rCLOCK mutant A – – + – Flag-rCLOCK mutant A – – + – Flag-rCLOCK NES mutant – – + + – – Flag-rCLOCK NES mutant – – + + – –
Flag-rCLOCK mutant B – – – + Flag-rCLOCK mutant B – – – + Flag-rCLOCK S106A – – – – + + Flag-rCLOCK S106A – – – – + +
CLOCK shRNA + + + + CLOCK shRNA + + + + CLOCK shRNA + + + + + + CLOCK shRNA + + + + + +
IGF1 – + + + IGF1 – + + + IGF1 – + – + – + IGF1 – + – + – +
37 37 37 37
IP: HA WB: PRPS1/2 K29ac IP: HA WB: PRPS1/2 K29ac IP: HA WB: PRPS1/2 K29ac IP: HA WB: PRPS1/2 K29ac
37 37 37 37
WB: HA (PRPS1) WB: HA (PRPS2) WB: HA (PRPS1) WB: HA (PRPS2)
100 100 100 100
WB: CLOCK pS106 WB: CLOCK pS106 WB: CLOCK pS106 WB: CLOCK pS106
Input 100 Input 100 Input 100 Input 100
WB: Flag (rCLOCK) WB: Flag (rCLOCK) WB: Flag (rCLOCK) WB: Flag (rCLOCK)
50 50 50 50
WB: tubulin WB: tubulin WB: tubulin WB: tubulin

Fig. 3 | CLOCK acetylates PRPS1/2 K29 upon IGF1R activation. a, Huh7 cells
expressing CLOCK shRNA with reconstituted expression of Flag-rCLOCK WT,
S106A or NES mutant protein were treated with or without IGF1 (100 ng ml−1)
for 1 h. IP and immunoblotting analyses were performed with the indicated
antibodies. b, Purified GST-CLOCK proteins on glutathione agarose beads were
incubated with or without His-CK2α and TBB (10 μM) in the presence of ATP for
an in vitro kinase assay. The beads were then washed with PBS (five times) and
incubated with or without the indicated His-PRPS1/2 proteins in the presence of
acetyl-CoA. c, Huh7 cells transfected with the indicated plasmids were treated
with or without IGF1 (100 ng ml−1) for 1 h. IP using limited amount of Flag antibody
and immunoblotting analyses were performed with the indicated antibodies.
d, Parental Huh7 and Hep3B cells and the indicated clones with knock-in
expression of PRPS1/2 K29R mutants were stimulated with or without IGF1
(100 ng ml−1) for 1 h. Immunoblotting analyses were performed with the
indicated antibodies. e,f, Huh7 cells expressing CLOCK shRNA with
reconstituted expression of the indicated CLOCK proteins were transfected
with HA-PRPS1/2 and treated with or without IGF1 (100 ng ml−1) for 1 h. IP using
limited amount of HA antibody and immunoblotting analyses were performed
with the indicated antibodies. All experiments were repeated three times
independently with similar results.

CLOCK acetylates PRPS1/2 K29 upon IGF1R activation
To determine the cytosolic function of CLOCK, we performed mass spec-
trometry analyses of CLOCK immunoprecipitates from IGF1-stimulated
Huh7 cells and revealed that CLOCK interacted with cytosolic phos-
phoribosyl pyrophosphate (PRPP) synthetase 1 (PRPS1) and PRPS2
(Extended Data Fig. 3a). PRPS catalyses the first and rate-limiting reac-
tion for de novo nucleotide synthesis, converting ribose 5-phosphate to
PRPP17. Co-IP analyses showed that IGF1 treatment of Huh7 cells induced
the binding of WT CLOCK, but not the CLOCK S106A or NES mutant,
to PRPS1/2, as detected by an antibody recognizing both PRPS1 and
PRPS2 (Fig. 3a). These results indicate that cytosolic CLOCK interacts
with PRPS1/2 upon IGF1 stimulation.
CLOCK possesses intrinsic acetyltransferase activity that acety-
lates histone, BMAL1 and argininosuccinate synthase 1 (ASS1)18–20.
An in vitro acetylation assay showed that purified GST-CLOCK acety-
lated purified His-PRPS1 (Fig. 3b, left) and His-PRPS2 (Fig. 3b, right), as
detected by immunoblotting analyses with an anti-pan-acetylation anti-
body. Mass spectrometry analyses showed that the acetylated PRPS1
residue is K29 (Extended Data Fig. 3b), which is shared between PRPS1
and PRPS2 and evolutionarily conserved (Extended Data Fig. 3c). IGF1
treatment of Huh7 cells for 1 h induced acetylation of WT Flag-PRPS1
(Fig. 3c, left) and WT Flag-PRPS2 (Fig. 3c, right) but not Flag-PRPS1 K29R
or Flag-PRPS2 K29R, as detected by a specific anti-PRPS1/2 K29 acetyla-
tion antibody (Extended Data Fig. 3d,e). Consistently, knock-in expres-
sion of PRPS1/2 K29R in HCC cells by clustered regularly interspaced
short palindromic repeats (CRISPR)/Cas9 genome-editing technology
(Extended Data Fig. 3f–i) abrogated IGF1- (Fig. 3d) or overexpression of
an activated IGF1R-CA mutant-induced (Extended Data Fig. 3j) PRPS1/2
K29 acetylation. As expected, catalytically inactive CLOCK P660A/
Y662A/N663A (mutant A) and CLOCK G673A/S674A/V676A (mutant
B)18 were unable to acetylate PRPS1 or PRPS2 at K29 in vitro (Extended
Data Fig. 3k), and reconstituted expression of the CLOCK (mutant
A/B) mutants in endogenous CLOCK-depleted Huh7 cells (Extended
Data Fig. 3l) inhibited IGF1-induced K29 acetylation of PRPS1/2
(Fig. 3e), although these mutants could still bind to PRPS1/2 (Extended
Data Fig. 3m). In addition, reconstituted expression of CLOCK S106A

Nature Cell Biology | Volume 25 | February 2023 | 273–284 277

Article
or the His-CLOCK NES mutant, but not WT CLOCK, abrogated the K29
acetylation of PRPS1/2 (Fig. 3f) upon IGF1 treatment. These results
indicate that cytosolic CLOCK acetylates PRPS1/2 K29 in response to
IGF1R activation.
CLOCK-induced PRPS1/2 acetylation inhibits their
degradation
A time-course experiment showed that IGF1 treatment increased the
PRPS1/2 K29 acetylation levels that corresponded with upregulated
PRPS1/2 expression levels (Fig. 4a,b). In addition, overexpression of
the IGF1R-CA mutant enhanced PRPS1/2 expression (Extended Data
Fig. 4a). IGF1 treatment (Extended Data Fig. 4b) or IGF1R-CA expression
(Extended Data Fig. 4c) did not obviously alter the Prps1/2 mRNA expres-
sion levels, suggesting a transcription-independent PRPS1/2 regulation.
Treatment of the IGF1R-CA-expressing HCC cells with cycloheximide
(CHX), a protein translation inhibitor that eliminates the effect of pro-
tein translation, showed that PRPS1/2 K29R had a much shorter half-life
than its WT counterpart (Fig. 4c,d). Consistently, the expression of
CLOCK S106A, the CLOCK NES mutant (Extended Data Fig. 4d,e), or the
inactive CLOCK mutants (Extended Data Fig. 4f,g) accelerated PRPS1/2
turnover. These results indicate that CLOCK-mediated PRPS1/2 K29
acetylation stabilizes PRPS1/2 expression.
We next treated HCC cells with the proteasome inhibitor MG132 or
PS341 or the lysosomal inhibitor chloroquine (CQ) or bafilomycin A1
(BFA) and showed that CQ or BFA treatment enhanced PRPS1/2 expres-
sion (Extended Data Fig. 4h), unveiling a role of lysosome in PRPS1/2
degradation. Analyses of the PRPS1/2 peptide sequence revealed that
30-VVTKK-34 is a consensus and evolutionarily conserved sequence
that can be recognized by heat shock cognate protein of 70 kDa
(HSC70) (Extended Data Fig. 4i), which mediates chaperone-mediated
autophagy (CMA) and subsequent lysosomal degradation21–23. Deple-
tion of HSC70 (Fig. 4e) or lysosome-associated membrane protein-2A
(LAMP2A) (Extended Data Fig. 4j), a receptor in the lysosomal mem-
brane for substrate proteins of CMA, enhanced PRPS1/2 expression in
HCC cells, demonstrating a critical role of the CMA–lysosome pathway
in PRPS1/2 degradation.
Co-IP analyses showed that HSC70 interacted with Flag-PRPS1/2
but not the HSC70 binding motif-mutated Flag-PRPS1/2 V30A/V31A
mutant (Fig. 4f), which had a higher expression level and longer half-life
than its WT counterpart (Fig. 4g,h) in the cells with reconstituted
expression of Flag-PRPS1/2 (Extended Data Fig. 4k–n). In addition,
the PRPS1/2 V30A/V31A mutation abrogated the effect of the PRPS1/2
K29R mutation on PRPS1/2 degradation (Fig. 4i,j). Consistently,
PRPS exhibited a longer half-life (~12 h) in the presence of IGF1R-CA
(Fig. 4d,j) than that in the absence of IGF1R-CA (~4.5 h) (Fig. 4h).
These results indicate that PRPS1/2 K29 acetylation inhibits the bind-
ing of HSC70 to the K29-adjacent consensus sequence of PRPS1/2
and subsequent PRPS1/2 degradation. To corroborate this finding,
we performed a GST pulldown assay and showed that both purified
WT GST-PRPS1/2 and the GST-PRPS1/2 K29R mutant interacted with
Fig. 4 | CLOCK-induced PRPS1/2 acetylation inhibits their degradation. a,b,
Huh7 and Hep3B cells were stimulated with IGF1 (100 ng ml−1) for the indicated
time periods (a). The relative PRPS1/2 protein abundance was quantified by
densitometric analysis of the blots (n = 6). Data are the mean ± s.d. ***P < 0.0001
by two-tailed Student’s t-test (b). c,d, Constitutively active IGF1R (IGF1R-CA)-
expressing parental Huh7 and Hep3B cells and the indicated clones with knock-in
expression of PRPS1/2 K29R mutants were treated with CHX (100 μg ml−1) for
the indicated periods of time (c). The quantification of PRPS1/2 protein levels
relative to tubulin levels is shown. Data are the mean ± s.d., n = 6, **P < 0.001; ***
P < 0.0001 by one-way ANOVA post hoc test (d). e, Huh7 and Hep3B cells stably
transfected with HSC70 shRNA were collected. f, Huh7 cells expressing the
indicated proteins were collected for IP using limited amount of Flag antibody.
g–j, Huh7 cells expressing PRPS1/2 shRNA (g and h) and constitutively active
IGF1R (IGF1R-CA) (i and j) with reconstituted expression of the indicated PRPS1/2
Nature Cell Biology | Volume 25 | February 2023 | 273–284
https://doi.org/10.1038/s41556-022-01061-0
purified HSC70 (Fig. 4k). Notably, inclusion of CK2α-phosphorylated
S protein-Flag-streptavidin-binding peptide (SFB)-tagged CLOCK
inhibited the binding of HSC70 to WT PRPS1/2 but not to PRPS1/2 K29R
(Fig. 4k). In addition, IGF1 treatment reduced the association of
HSC70 and LAMP2A with PRPS1/2 (Fig. 4l and Extended Data Fig. 4o),
and this effect was largely abrogated by expression of PRPS1/2 K29R
(Fig. 4l), CLOCK S106A, the CLOCK NES mutant and inactive CLOCK
mutants (Extended Data Fig. 4o). These results indicate that IGF1R
activation-induced and cytosolic CLOCK-mediated PRPS1/2 acetylation
inhibits the binding of HSC70 to PRPS1/2 and the subsequent CMA/
lysosomal-dependent PRPS1/2 degradation.
CLOCK-acetylated PRPS1/2 promote nucleotide synthesis
To determine the effect of CLOCK-mediated PRPS1/2 acetylation
on de novo nucleic acid synthesis, we incubated HCC cells with a
limited amount of d-[6-14C] glucose. We found that IGF1 treatment
(Fig. 5a,b) or IGF1R-CA expression (Extended Data Fig. 5a,b) strongly
increased the production of glucose-derived 14C-RNA (Fig. 5a and
Extended Data Fig. 5a) and 14C-DNA (Fig. 5b and Extended Data Fig.
5b). Reconstituted expression of CLOCK S106A, the CLOCK NES
mutant or the inactive CLOCK mutants (Fig. 5a,b and Extended Data
Fig. 5a,b) or knock-in expression of PRPS1/2 K29R (Fig. 5c,d and
Extended Data Fig. 5c, d) inhibited IGF1- and IGF1R-CA-increased
14
C-RNA and 14C-DNA.
We next measured the incorporation of stable isotope-labelled
glucose (13C6-glucose) into purine and pyrimidine intermediates.
IGF1 treatment of Huh7 cells (Fig. 5e,f) or expression of IGF1R-CA in
these cells (Extended Data Fig. 5e,f) strongly increased the amount of
13
C-labelled PRPP, purine (IMP, AMP and GMP) and pyrimidine (UMP
and CMP) intermediates; this increase was abrogated by reconsti-
tuted expression of CLOCK S106A, the CLOCK NES mutant or the inac-
tive CLOCK mutants (Fig. 5e and Extended Data Fig. 5e) or knock-in
expression of PRPS1/2 K29R (Fig. 5f and Extended Data Fig. 5f). Given
that PRPS1/2 K29 acetylation did not directly activate PRPS1/2 activ-
ity in vitro (Extended Data Fig. 5g), these results indicate that IGF1R
activation-induced and cytosolic CLOCK-mediated PRPS1/2 stabiliza-
tion promotes de novo nucleotide synthesis.
Similarly to IGF1 treatment, treatment of Huh7 cells with epidermal
growth factor (EGF) and fibroblast growth factor 1 (FGF1) enhanced
CLOCK S106 phosphorylation, the cytosolic accumulation of CLOCK,
and PRPS1/2 K29 acetylation (Extended Data Fig. 5h,i). Consequently,
treatment with EGF and FGF1 (Extended Data Fig. 5j) or expression
of activated EGFR-vIII and FGFR1 CA mutant (Extended Data Fig. 5k)
enhanced PRPS1/2 expression. In addition, expression of the CLOCK
S106A and NES mutant inhibited EGF- and FGF1-induced nucleus
exportation of CLOCK and PRPS1/2 K29 acetylation (Extended Data
Fig. 5h,i) and decreased half-life of PRPS1/2 in HCC cells expressing
EGFR-vIII or FGFR1 CA (Extended Data Fig. 5l). These results indicate
that activation of IGF1R, EGFR and FGFR1 shares the same mechanism
to regulate PRPS1/2.
proteins were treated with CHX (100 μg ml−1) for the indicated periods of time.
The quantification of PRPS1/2 protein levels relative to tubulin levels is shown.
Data are the mean ± s.d., n = 6, **P < 0.001 by two-tailed Student’s t-test
(h). ***P < 0.0001 by one-way ANOVA post hoc test (j). k, Purified SFB-CLOCK
proteins on streptavidin beads were incubated with or without His-CK2α in
the presence of ATP for an in vitro kinase assay. The washed beads were then
incubated with or without the indicated GST-PRPS1/2 proteins in the presence of
acetyl-CoA. The beads were removed, and GST-PRPS1/2 was incubated with His-
HSC70 followed by a GST pulldown assay as indicated. l, Huh7 cells expressing
the indicated proteins were serum-starved for 12 h in the presence of lysosomal
inhibitor CQ (25 μM) and then treated with or without IGF1 (100 ng ml−1) for 1 h.
All experiments were repeated three times independently with similar results. In
a–c, g and i, IP and immunoblotting analyses were performed with the indicated
antibodies.
278
Article https://doi.org/10.1038/s41556-022-01061-0

To examine the effect of IGF1R activation on other types of liver translocation of CLOCK, PRPS1/2 K29 acetylation (Extended Data
tumour, such as intrahepatic cholangiocarcinomas, we treated CCLP1 Fig. 6a,b) and glucose-derived amounts of 14C-RNA and 14C-DNA
or HuCCT1 intrahepatic cholangiocarcinoma cells with IGF1. IGF1 (Extended Data Fig. 6c). This induction was inhibited by expression of
treatment increased CLOCK S106 phosphorylation, the cytosolic the CLOCK S106A and NES mutant, which also decreased the half-life of

a b Huh7 Hep3B
c

protein abundance
Huh7 Hep3B Huh7 (IGF1R-CA)

protein abundance
4 4

Relative PRPS1/2
***

Relative PRPS1/2
IGF1 (h) 0 0.5 2 6 18 0 0.5 2 6 18 *** PRPS1/2 WT K29R-C1 K29R-C2
3 3
37 CHX (h) 0 3 6 12 0 3 6 12 0 3 6 12
WB: PRPS1/2 K29ac 2 2
37
37
WB: PRPS1/2 1 1 WB: PRPS1/2
50
50 0 0
WB: tubulin WB: tubulin
IGF1 (h) 0 0.5 2 6 18 0 0.5 2 6 18

d e PRPS1/2 WT
Hep3B (IGF1R-CA)
K29R-C1 K29R-C2
Huh7 (IGF1R-CA) Hep3B (IGF1R-CA)
PRPS1/2 WT PRPS1/2 WT Huh7 Hep3B CHX (h) 0 3 6 12 0 3 6 12 0 3 6 12
PRPS1/2 K29R-C1 PRPS1/2 K29R-C1 Mock + – – + – – 37
Ratio of initial protein

Ratio of initial protein

120 PRPS1/2 K29R-C2 120 PRPS1/2 K29R-C2 HSC70 shRNA1 – + – – + – WB: PRPS1/2
100 100 HSC70 shRNA2 – – + – – + 50
80 80
37 WB: tubulin
(%)

(%)

60 60 WB: PRPS1/2
40 40 *** 75
***
***
**

20 20 WB: HSC70
0 0 50
0 3 6 12 0 3 6 12 WB: tubulin
CHX chase time (h) CHX chase time (h)

f g
Flag-rPRPS1 WT V30A/V31A Flag-rPRPS2 WT V30A/V31A
CHX (h) 0 3 6 12 0 3 6 12 CHX (h) 0 3 6 12 0 3 6 12
l ag l ag 37
:F :F 37
IgG IP IgG IP WB: Flag (rPRPS1) WB: Flag (rPRPS2)
Flag-PRPS1 WT + + – Flag-PRPS2 WT + + – 50 50
Flag-PRPS1 V30A/V31A – – + Flag-PRPS2 V30A/V31A – – + WB: tubulin WB: tubulin
75 75
WB: HSC70 WB: HSC70 h Flag-rPRPS1 WT Flag-rPRPS2 WT
IP: Flag Flag-rPRPS1 V30A/V31A Flag-rPRPS2 V30A/V31A
100 IP: Flag 100

Ratio of initial protein

Ratio of initial protein

120 120
WB: LAMP2A WB: LAMP2A
37 37 100 100
WB: Flag (PRPS1) WB: Flag (PRPS2) 80 80

(%)
(%)

100 100 60 60
WB: LAMP2A WB: LAMP2A 40 40
** **
Input 75 Input 75 20 20
WB: HSC70 WB: HSC70 0 0
50 50 0 3 6 12 0 3 6 12
WB: tubulin WB: tubulin CHX chase time (h) CHX chase time (h)

i Huh7 (IGF1R-CA)
K29R/
j
Flag-rPRPS1 WT K29R V30A/V31A Huh7 (IGF1R-CA) Huh7 (IGF1R-CA)
CHX (h) 0 3 6 12 0 3 6 12 0 3 6 12
Flag-rPRPS1 WT Flag-rPRPS2 WT
37
Flag-rPRPS1 K29R Flag-rPRPS2 K29R
WB: PRPS1/2
Flag-rPRPS1 K29R/V30A/V31A Flag-rPRPS2 K29R/V30A/V31A
Ratio of initial protein

Ratio of initial protein

50 120 120
WB: tubulin 100
K29R/ 100
WT K29R 80
Flag-rPRPS2 V30A/V31A 80
(%)

(%)

60 60
CHX (h) 0 3 6 12 0 3 6 12 0 3 6 12
40 40
***
***

***
**

37 20
WB: PRPS1/2 20
0 0
50 0 3 6 12 0 3 6 12
WB: tubulin
CHX chase time (h) CHX chase time (h)

k His-CK2α WT – – + + His-CK2α WT – – + + l
SFB-CLOCK WT – + + + SFB-CLOCK WT – + + +
GST-PRPS1 WT + + + – GST-PRPS2 WT + + + –
GST-PRPS1 K29R – – – + GST-PRPS2 K29R – – – + Flag-PRPS1 WT + + – – Flag-PRPS2 WT + + – –
His-HSC70 + + + + His-HSC70 + + + + Flag-PRPS1 K29R – – + + Flag-PRPS2 K29R – – + +
75 75 IGF1 – + – + IGF1 – + – +
pulldown
pulldown

WB: HSC70 WB: HSC70 75 75

GST
GST

50 50 WB: HSC70 WB: HSC70

100
WB: PRPS1/2 K29ac WB: PRPS1/2 K29ac 100
IP: Flag WB: LAMP2A IP: Flag WB: LAMP2A
50 50 37
WB: GST (PRPS1) WB: GST (PRPS2) 37
WB: PRPS1/2 K29ac
75 75 WB: PRPS1/2 K29ac
37
WB: HSC70 WB: HSC70 37
WB: Flag (PRPS1) WB: Flag (PRPS2)
100 100 100
100
Input WB: CLOCK pS106 Input WB: CLOCK pS106 WB: LAMP2A
WB: LAMP2A
100 100 Input 75 Input 75
WB: Flag (SFB-CLOCK) WB: Flag (SFB-CLOCK) WB: HSC70 WB: HSC70
37 37 50 50
WB: CK2α WB: CK2α WB: tubulin WB: tubulin

Nature Cell Biology | Volume 25 | February 2023 | 273–284 279

Article https://doi.org/10.1038/s41556-022-01061-0

a Huh7 Hep3B b Huh7 Hep3B

** ** *
* * ** *
2.5 ** 3 ****
** 2.5 **
* **
* 2.5

DNA/total DNA

DNA/total DNA
RNA/total RNA

RNA/total RNA
radiolabelled

radiolabelled

radiolabelled

radiolabelled
2.0 2.0 2.0

Relative

Relative
2

Relative

Relative
1.5 1.5 1.5
1.0 1.0 1.0
1
0.5 0.5 0.5
0 0 0 0
Flag-rCLOCK WT + + – – – – + + – – – – Flag-rCLOCK WT + + – – – – + + – – – –
Flag-rCLOCK NES mutant – – + – – – – – + – – – Flag-rCLOCK NES mutant – – + – – – – – + – – –
Flag-rCLOCK S106A – – – + – – – – – + – – Flag-rCLOCK S106A – – – + – – – – – + – –
Flag-rCLOCK mutant A – – – – + – – – – – + – Flag-rCLOCK mutant A – – – – + – – – – – + –
Flag-rCLOCK mutant B – – – – – + – – – – – + Flag-rCLOCK mutant B – – – – – + – – – – – +
IGF1 – + + + + + – + + + + + IGF1 – + + + + + – + + + + +

c e 13
C-PRPP 13
C-IMP 13
C-AMP
Huh7 Hep3B * **
** ** **
** ** **

radiolabelled PRPP

radiolabelled AMP
3 3 ** 3.0 2.5 * 3.0 **

radiolabelled IMP
* * ***
RNA/total RNA

RNA/total RNA
radiolabelled

2.5 2.5
radiolabelled

2.0
2 2 2.0 2.0
Relative

Relative

Relative
Relative
Relative

1.5
1.5 1.5
1.0
1 1 1.0 1.0
0.5 0.5 0.5
0 0 0 0 0
PRPS1/2 WT + + – – + + – – Flag-rCLOCK WT + + – – – – + + – – – – + + – – – –
PRPS1/2 K29R – – + + – – + + Flag-rCLOCK NES mutant – – + – – – – – + – – – – – + – – –
IGF1 – + – + – + – + Flag-rCLOCK S106A – – – + – – – – – + – – – – – + – –
Flag-rCLOCK mutant A – – – – + – – – – – + – – – – – + –
Flag-rCLOCK mutant B – – – – – + – – – – – + – – – – – +
IGF1 – + + + + + – + + + + + – + + + + +

13 13 13
C-GMP C-UMP C-CMP
* ***
d Huh7 Hep3B
***
** *
* ***
**
*
*****

radiolabelled CMP
radiolabelled GMP

radiolabelled UMP
3 3 2.5 2.5 * 2.5
DNA/total DNA

DNA/total DNA

*
radiolabelled

radiolabelled

* 2.0 2.0 2.0

2 2

Relative
Relative
Relative

Relative

Relative

1.5 1.5 1.5

1.0 1.0 1.0
1 1
0.5 0.5 0.5
0 0 0 0 0
PRPS1/2 WT + + – – + + – – Flag-rCLOCK WT + + – – – – + + – – – – + + – – – –
PRPS1/2 K29R – – + + – – + + Flag-rCLOCK NES mutant – – + – – – – – + – – – – – + – – –
IGF1 – + – + – + – + Flag-rCLOCK S106A – – – + – – – – – + – – – – – + – –
Flag-rCLOCK mutant A – – – – + – – – – – + – – – – – + –
Flag-rCLOCK mutant B – – – – – + – – – – – + – – – – – +
IGF1 – + + + + + – + + + + + – + + + + +

f 13
C-PRPP 13
C-IMP 13
C-AMP 13
C-GMP 13
C-UMP 13
C-CMP
*
radiolabelled PRPP

radiolabelled AMP

3 3 3
radiolabelled GMP

radiolabelled CMP
radiolabelled UMP

3 3 3
radiolabelled IMP

** ***
** ** ***
2 2 2
Relative
Relative

Relative

2 2 2
Relative

Relative
Relative

1 1 1 1 1 1

0 0 0 0 0 0
PRPS1/2 WT + + – – + + – – + + – – + + – – + + – – + + – –
PRPS1/2 K29R – – + + – – + + – – + + – – + + – – + + – – + +
IGF1 – + – + – + – + – + – + – + – + – + – + – + – +

Fig. 5 | CLOCK-acetylated PRPS1/2 promote nucleotide synthesis. a,b, Huh7 were treated with or without IGF1 (100 ng ml−1) for 12 h, followed by metabolic
or Hep3B cells expressing CLOCK shRNA with reconstituted expression of labelling with 13C6-glucose (10 mmol l−1) for 30 min. The 13C-labelled metabolite
the indicated CLOCK proteins were treated with or without IGF1 (100 ng ml−1) intermediates of PRPP, IMP, AMP, GMP, UMP and CMP were measured by
for 12 h, followed by labelling with d-[6-14C] glucose (1 μCi, 0.01 mmol l−1) for LC–MS/MS. Data are the mean ± s.d., *P < 0.01; **P < 0.001; ***P < 0.0001 by
0.5 h. The amounts of 14C-RNA (a) and 14C-DNA (b) were measured. Data are the one-way ANOVA post hoc test. f, Parental Huh7 cells and the indicated clones
mean ± s.d., *P < 0.01; **P < 0.001 by one-way ANOVA post hoc test. c,d, Parental with knock-in expression of PRPS1/2 K29R mutants were treated with or without
Huh7 and Hep3B cells and the indicated clones with knock-in expression of IGF1 (100 ng ml−1) for 12 h, followed by metabolic labelling with 13C6-glucose
PRPS1/2 K29R mutants were treated with or without IGF1 (100 ng ml−1) for 12 h, (10 mmol l−1) for 30 min. The 13C-labelled metabolite intermediates of PRPP,
followed by labelling with d-[6-14C] glucose (1 μCi, 0.01 mmol l−1) for 0.5 h. The IMP, AMP, GMP, UMP and CMP were measured by LC–MS/MS. Data are the
amounts of 14C-RNA (c) and 14C-DNA (d) were measured. Data are the mean ± s.d., mean ± s.d., *P < 0.01; **P < 0.001; ***P < 0.0001 by one-way ANOVA post
*P < 0.01; **P < 0.001 by one-way ANOVA post hoc test. e, Huh7 cells expressing hoc test. All experiments were repeated three times independently with
CLOCK shRNA with reconstituted expression of the indicated CLOCK proteins similar results.

PRPS1/2 in HCC cells expressing IGF1R-CA (Extended Data Fig. 6d). These in L02 or THLE-2 normal hepatocytes upon IGF1 treatment, but at very
results suggest that IGF1 induces the same signalling transduction in moderate levels compared with HCC cells (Extended Data Fig. 6e). These
more than one cancer type. Notably, phosphorylation of α-catenin S641 results suggest that highly expressed IGF1, overexpressed or mutated
and CLOCK S106 and acetylation of PRPS1/2 at K29 were also increased IGF1R, highly activated ERK due to activated IGFR or other receptor

Nature Cell Biology | Volume 25 | February 2023 | 273–284 280

Article https://doi.org/10.1038/s41556-022-01061-0

a Huh7 Hep3B b Huh7 Hep3B

Flag-rCLOCK WT Flag-rCLOCK WT PRPS1/2 WT PRPS1/2 WT
Flag-rCLOCK S106A Flag-rCLOCK S106A PRPS1/2 K29R-C1 PRPS1/2 K29R-C1
Flag-rCLOCK NES mutant Flag-rCLOCK NES mutant PRPS1/2 K29R-C2 PRPS1/2 K29R-C2
60 60 60 60

Cell number
Cell number

Cell number
50 50 50 50

Cell number

***
***
***
***

**
***
***

**
(×104)
(×104)

(×104)
40 40 40 40

(×104)
30 30 30 30
20 20 20 20
10 10 10 10
0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3
Days Days Days Days

c d
Flag-rCLOCK WT S106A NES mutant PRPS1/2 WT K29R-C1 K29R-C2 *
* *

Tumour volume
1,500 1,500
*

Tumour volume
1,000

(mm3)
1,000

(mm3)
500 500

0 0
2 cm Flag-rCLOCK T A nt 2 cm PRPS1/2 T 1 2
W 106 uta W R-C -C
S m 2 9 9R
K K 2
ES
N
e Flag-rCLOCK WT S106A NES mutant f
CLOCK
pS106

PRPS1/2 WT K29R-C1 K29R-C2

PRPS1/2
K29ac
PRPS1/2
K29ac

PRPS1/2
PRPS1/2

50 µm

50 µm

Fig. 6 | CLOCK-acetylated PRPS1/2 promote HCC cell proliferation. a, Huh7
and Hep3B cells expressing CLOCK shRNA with reconstituted expression of
the indicated CLOCK proteins were plated in complete culture medium for
3 days. The cells were then collected and counted. Data are the mean ± s.d. n = 6,
***P < 0.0001 by one-way ANOVA post hoc test. b, Parental Huh7 and Hep3B cells
and the indicated clones with knock-in expression of PRPS1/2 K29R mutants were
plated in complete culture medium for 3 days. The cells were then collected and
counted. Data are the mean ± s.d., n = 6, **P < 0.001; ***P < 0.0001 by one-way
ANOVA post hoc test. c, Huh7 cells expressing CLOCK shRNA with reconstituted
expression of the indicated CLOCK proteins were intrahepatically injected into
6-week-old male athymic BALB/c nude mice (n = 6 per group). Tumour growth
was examined 28 days after injection. The arrows indicate tumours. Tumour
volumes were calculated (right). Data are the mean ± s.d., *P < 0.01 by one-way
ANOVA post hoc test. d, Parental Huh7 cells and the indicated clones with
knock-in expression of PRPS1/2 K29R mutants were intrahepatically injected
into athymic nude mice (n = 6 per group). Tumour growth was examined 28 days
after injection. The arrows indicate tumours. Tumour volumes were calculated
(right). Data are the mean ± s.d., *P < 0.01 by one-way ANOVA post hoc test.
e,f, IHC analyses of the indicated xenograft tumours from nude mice (n = 6)
were performed with the indicated antibodies. Representative staining images
are shown. All experiments were repeated at least twice independently with
similar results.

tyrosine kinase receptors, such as EGFR and FGFR, and overexpressed
CK2α in cancer cells confer specific enhancement of the signalling in
cancer cells. Consistent results showed that CK2α expression levels
were much higher in the HCC cells than in the normal hepatocytes
(Extended Data Fig. 6e). As expected, overexpression of CK2α in L02
cells increased CLOCK S106 phosphorylation and PRPS1/2 K29 acetyla-
tion (Extended Data Fig. 6f) with correspondingly prolonged half-life
of PRPS1/2 (Extended Data Fig. 6g) upon IGF1 treatment. In contrast,
CK2α depletion in Huh7 cells decreased IGF1-induced CLOCK S106 phos-
phorylation and PRPS1/2 K29 acetylation (Extended Data Fig. 6h) with
correspondingly shortened PRPS1/2 half-life (Extended Data Fig. 6i).
These results indicate that CK2α, which is overexpressed in HCC cells,
is critical for CLOCK S106 phosphorylation-enhanced PRPS1/2 stability.
CLOCK-acetylated PRPS1/2 promote HCC cell proliferation
Consistent with the effect of CLOCK-mediated PRPS1/2 acetylation on
de novo nucleotide synthesis in HCC cells, reconstituted expression of
CLOCK S106A and the CLOCK NES mutant (Fig. 6a) or knock-in expres-
sion of PRPS1/2 K29R (Fig. 6b) inhibited the proliferation of HCC cells
expressing IGF1R. To differentiate the role of cytosolic CLOCK func-
tion from the transcriptional functions of CLOCK–BMAL1 complex in
tumour cell proliferation, we depleted BMAL1 in HCC cells (Extended
Data Fig. 7a). As expected, BMAL1 depletion inhibited the transcrip-
tional activity of CLOCK (Extended Data Fig. 7b) and the expression
of CLOCK–BMAL1 complex-regulated Dbp and Nr1d1 genes (Extended
Data Fig. 7c). Notably, these effects were recapitulated by expression
of CLOCK S106D phosphorylation-mimicking mutant (Extended Data
Fig. 7a–c), indicating that both BMAL1 depletion and CLOCK S106
phosphorylation inhibit the transcriptional functions of CLOCK.
However, BMAL1 depletion did not induce CLOCK S106 phosphoryla-
tion (Extended Data Fig. 7d). Consistently, BMAL1 depletion, unlike
CLOCK S106D expression, failed to increase the cytosolic translo-
cation of CLOCK (Extended Data Fig. 7d), PRPS1/2 K29 acetylation
(Extended Data Fig. 7d), PRPS1/2 stability (Extended Data Fig. 7e) and

Nature Cell Biology | Volume 25 | February 2023 | 273–284 281

Article https://doi.org/10.1038/s41556-022-01061-0

a Case 1 Case 2 c Tumour 1 Tumour 2 Tumour 3 Tumour 4

Non- tumour HCC Non-tumour HCC

pY1161
IGF1R
pY1161
IGF1R

α-Catenin
pS641
CLOCK
pS106

CLOCK
pS106
PRPS1/2
K29ac

PRPS1/2
K29ac
PRPS1/2

PRPS1/2
50 µm

b Non-tumour HCC
8 *** *** *** *** 50 µm e Low staining
Staining score

6 High staining
P < 0.01
4

Survival proportion
IGF1R pY1161
1.0
2
0.8
0 0.6
61 10
6
9a
c
1/
2 0.4
11 PS
pY pS K2
PR
0.2
F 1R CK 1 /2 0
IG O PS
CL PR 0 20 40 60 80
Survival time (months)
d R = 0.7730 R = 0.8213 R = 0.7970 Low staining
P < 0.0001 P < 0.0001 High staining
P < 0.0001
PRPS1/2 K29ac score

CLOCK pS106 score

CLOCK pS106 score

P < 0.01
8 8 8

Survival proportion
1.0 CLOCK pS106
6 6 6
0.8
4 4 4 0.6
2 2 2 0.4
0.2
0 0 0
0
0 2 4 6 8 0 2 4 6 8 0 2 4 6 8
0 20 40 60 80
IGF1R pY1161 score IGF1R pY1161 score α-Catenin pS641 score
Survival time (months)
Low staining
R = 0.8607 R = 0.7981 R = 0.8397 High staining
P < 0.0001 P < 0.0001 P < 0.0001 P < 0.01
PRPS1/2 K29ac score

Survival proportion

8 8 8 PRPS1/2 K29ac
1.0
PRPS1/2 score
PRPS1/2 score

6 6 6 0.8
4 4 4 0.6
0.4
2 2 2
0.2
0 0 0 0
0 2 4 6 8 0 2 4 6 8 0 2 4 6 8 0 20 40 60 80
CLOCK pS106 score PRPS1/2 K29ac score CLOCK pS106 score Survival time (months)

f
HSC70 Lamp2A

HSC70 Lamp2A
Ac
Limited PRPS1/2 PRPS1/2 Sufficient
nucleotide synthesis nucleotide synthesis
CLOCK

CMA-mediated CMA-mediated
degradation degradation

Exportin1

P Circadian-clock-
CK2 CLOCK related genes

Fig. 7 | CLOCK-acetylated PRPS1/2 predict human HCC aggressiveness. of human HCC samples with the indicated antibodies was scored, and correlation
a,b, IHC staining of human HCC and matched non-tumour tissue samples was analyses were performed. A Pearson correlation test was used (two-tailed). Note
performed with the indicated antibodies. Representative images of two cases that the scores for some samples overlap (d). e, Kaplan–Meier plots of the overall
are shown (a). The indicated staining scores for the indicated proteins in HCC survival rates in 90 patients with HCC grouped according to high (staining score,
and matched non-tumour liver samples (n = 30) were compared. Data are the 4–8) and low (staining score, 0–3) expression of IGFR1 pY1161, CLOCK pS106 and
mean ± s.d., *P < 0.0001 by Mann–Whitney U test compared with the non-tumour PRPS1/2 K29ac. P values were calculated using a log-rank test (two-tailed). f, A
adjacent tissue (b). c,d, Ninety human HCC samples were analysed with the schematic model showing nucleus-exported CLOCK acetylates PRPS to promote
indicated antibodies. Representative staining images are shown (c). IHC staining de novo nucleotide synthesis and tumour growth.

Nature Cell Biology | Volume 25 | February 2023 | 273–284 282

Article
glucose-derived amounts of 14C-RNA and 14C-DNA (Extended Data
Fig. 7f,g). Consequently, BMAL1 depletion promoted HCC cell prolifera-
tion to a lesser degree than did CLOCK S106D expression (Extended
Data Fig. 7h). These results indicate that both inhibition of canonical
transcriptional activity of CLOCK and activation of its non-canonical
cytosolic function contribute to HCC cell proliferation.
Sorafenib treatment of HCC is a standard therapy24. Treatment
of HCC cells with sorafenib dose-dependently, but partially, inhibited
IGF1-induced phosphorylation of ERK, α-catenin S641, and CLOCK S106
and acetylation of PRPS1/2 K29 (Extended Data Fig. 7i). In addition,
sorafenib treatment reduced PRPS1/2 stability in Huh7 cells express-
ing IGF1R-CA (Extended Data Fig. 7j) with corresponding inhibition of
cell proliferation (Extended Data Fig. 7k). Notably, these effects were
reverted by CLOCK S106D expression (Extended Data Fig. 7i–k) which
by itself was sufficient to increase PRPS1/2 K29 acetylation (Extended
Data Fig. 7l), PRPS1/2 expression (Extended Data Fig. 7m) and HCC cell
proliferation (Extended Data Fig. 7n). These results suggested that the
therapeutic effect of sorafenib on HCC could be attributed to the inhibi-
tion of the non-canonical function of CLOCK. However, these effects
could be dampened due to overexpressed CK2α in tumour cells, which
bypasses the input from receptor protein kinase activity, compensates
sorafenib-inhibited upstream signalling and phosphorylates CLOCK
S106 to promote tumour cell proliferation.
We next intrahepatically (Fig. 6c,d) and subcutaneously (Extended
Data Fig. 8a,b) injected these cells into nude mice. Reconstituted
expression of CLOCK S106A and the CLOCK NES mutant (Fig. 6c
and Extended Data Fig. 8a) or knock-in expression of PRPS1/2 K29R
(Fig. 6d and Extended Data Fig. 8b) inhibited orthotoptic and subcuta-
neous tumour growth with a corresponding decrease in Ki67 expres-
sion (Extended Data Fig. 8c,d) and increase in apoptosis (Extended
Data Fig. 8e,f). Immunohistochemistry (IHC) analyses of liver tumour
tissues showed that the expression of these mutants reduced the lev-
els of PRPS1/2 K29 acetylation and PRPS1/2 expression (Fig. 6e,f). In
addition, CLOCK NES mutant expression resulted in the accumulation
of phosphorylated CLOCK S106 in the nucleus, whereas the CLOCK
S106A-expressing liver tumour tissues exhibited vanished staining of
CLOCK pS106 (Fig. 6e). In contrast to CLOCK S106A-elicited tumour
growth inhibition, reconstituted expression of CLOCK S106D pro-
moted tumour growth (Extended Data Fig. 8g,h).
CLOCK-acetylated PRPS1/2 predict human HCC
aggressiveness
To determine the clinical importance of CLOCK-upregulated PRPS1/2
expression, we analysed 90 human primary HCC specimens using IHC
staining with validated anti-IGF1R pY1161 to reflect the combinational
inputs to IGF1R activities from overexpressed IGF1, IGF1R and oncogenic
mutations of IGFR, anti-CLOCK pS106, anti-PRPS1/2 K29 acetylation,
and anti-PRPS1/2 antibodies, and the results showed that the levels
of these protein markers were much higher in the HCC tissues than
in their adjacent normal tissues (Fig. 7a,b). In addition, the levels of
IGF1R pY1161, α-catenin pS641, CLOCK pS106, PRPS1/2 K29 acetylation
and PRPS1/2 expression were positively correlated with each other
(Fig. 7c,d). Notably, phosphorylation of IGF1R Y1161 and CLOCK S106
and PRPS1/2 K29 acetylation were positively associated with poor sur-
vival of patients with HCC (Fig. 7e). These results indicate that IGF1R
activation-induced and cytosolic CLOCK-mediated PRPS1/2 acetylation
plays an instrumental role in the clinical aggressiveness of human HCC.
Discussion
The transcriptional activity of CLOCK governs circadian rhythms, and
impairment of the circadian clock has been linked to cancer develop-
ment1. However, whether the circadian clock is regulated by the activa-
tion of receptor tyrosine kinases, which frequently occurs in cancer
and plays a direct role in the regulation of cancer cell proliferation in
a CLOCK transcriptional activity-independent manner, is unclear. We
Nature Cell Biology | Volume 25 | February 2023 | 273–284
https://doi.org/10.1038/s41556-022-01061-0
demonstrate here that activation of receptor tyrosine kinases promoted
the binding of CK2α to CLOCK and the subsequent CK2α-mediated
CLOCK S106 phosphorylation. This phosphorylation disassembled
CLOCK–BMAL1 heterodimerization, leading to suppression of the
CLOCK/BMAL1-mediated expression of the downstream genes in HCC
cells. Peptide sequence analyses of CLOCK revealed that an NES is adja-
cent to phosphorylated S106, and MD simulation analyses showed that
S106 phosphorylation induced a conformational change in CLOCK and
exposed its NES for binding to Exportin1, resulting in nuclear exporta-
tion of CLOCK. In the cytosol, CLOCK bound and acetylated PRPS1/2 at
K29, which is close to the binding consensus sequence (30-VVTKK-34)
of HSC70, thereby reducing the interaction of HSC70 with PRPS1/2 and
blocking HSC70-mediated CMA-lysosomal degradation of PRPS1/2.
Stabilized PRPS1/2 promoted de novo nucleotide synthesis and HCC
cell proliferation and liver tumour growth in mice (Fig. 7f).
IGF1 expression is connected to circadian rhythms, and
plasma IGF1 rhythms are disrupted with reduced IGF1 expression in
Cry-deficient mice25. IGF1, in turn, entrains the circadian clock by upreg-
ulating PER expression through mTOR-promoted Per translation26. We
demonstrate that IGF1 elicited limited effect on CLOCK-dependent
regulation of PRPS1/2 stability in normal cells, which was substantially
enhanced by CK2α expression that frequently occurs in tumour cells.
These findings suggest that IGF1-induced downstream signalling is
distinctly regulated in normal and tumour cells by cytosolic oncogenic
proteins, leading to distinct impact on canonical and non-canonical
functions of CLOCK.
The connection of circadian rhythms to cancer has been inten-
sively studied by modulating core clock gene expression levels to
intervene in the transcriptional activity of the CLOCK–BMAL1 complex1.
However, a meta-analysis of studies assessing the clinicopathological
and prognostic importance of the expression of PER1-3, CRY1-2, CLOCK
and BMAL1 in 7,476 cases of different types of cancer revealed that low
expression of PER1 and PER2, but not CLOCK or others, could serve as
unfavourable indicators for cancer progression and poor overall sur-
vival of some types of patients with cancer27. These findings suggested
that the dysregulation of CLOCK at its transcriptional activity rather
than its expression is critical for tumour development. Here we revealed
a critical mechanism underlying oncogenic signalling-induced disrup-
tion of the CLOCK–BMAL1 complex and its transcriptional activity in
HCC cells. Importantly, the finding of inhibited tumour growth by inhi-
bition of CLOCK-increased PRPS1/2 stability revealed the instrumental
role of the non-canonical and acetyltransferase functions of CLOCK in
tumour development. The positive correlation between CLOCK S106
phosphorylation and PRPS1/2 K29 acetylation and poor survival of
patients with HCC highlighted the importance of CLOCK-mediated
PRPS1 acetylation in the clinical aggressiveness of human HCC. Our
findings delineate a critical mechanism by which oncogenic signalling
disrupts CLOCK-regulated circadian rhythms and confers CLOCK with
a moonlighting function in the promotion of de novo nucleotide syn-
thesis. These findings underscore the potential to target the cytosolic
moonlighting function of CLOCK for human HCC treatment.
Online content
Any methods, additional references, Nature Portfolio reporting sum-
maries, source data, extended data, supplementary information,
acknowledgements, peer review information; details of author contri-
butions and competing interests; and statements of data and code avail-
ability are available at https://doi.org/10.1038/s41556-022-01061-0.
References
1. Kinouchi, K. & Sassone-Corsi, P. Metabolic rivalry: circadian
homeostasis and tumorigenesis. Nat. Rev. Cancer 20, 645–661
(2020).
2. Bass, J. & Takahashi, J. S. Circadian integration of metabolism and
energetics. Science 330, 1349–1354 (2010).
283
Article
3. Sahar, S. & Sassone-Corsi, P. Metabolism and cancer: the
circadian clock connection. Nat. Rev. Cancer 9, 886–896 (2009).
4. Reinke, H. & Asher, G. Crosstalk between metabolism and
circadian clocks. Nat. Rev. Mol. Cell Biol. 20, 227–241 (2019).
5. Patke, A., Young, M. W. & Axelrod, S. Molecular mechanisms and
physiological importance of circadian rhythms. Nat. Rev. Mol. Cell
Biol. 21, 67–84 (2020).
6. Ye, Y. et al. The genomic landscape and pharmacogenomic
interactions of clock genes in cancer chronotherapy. Cell Syst. 6,
314–328 e312 (2018).
7. Papagiannakopoulos, T. et al. Circadian rhythm disruption
promotes lung tumorigenesis. Cell Metab. 24, 324–331 (2016).
8. Fu, L., Pelicano, H., Liu, J., Huang, P. & Lee, C. The circadian gene
Period2 plays an important role in tumor suppression and DNA
damage response in vivo. Cell 111, 41–50 (2002).
9. Lee, S., Donehower, L. A., Herron, A. J., Moore, D. D. & Fu, L.
Disrupting circadian homeostasis of sympathetic signaling
promotes tumor development in mice. PLoS One 5, e10995
(2010).
10. Ruan, W., Yuan, X. & Eltzschig, H. K. Circadian rhythm as a
therapeutic target. Nat. Rev. Drug Discov. 20, 287–307 (2021).
11. Dong, Z. et al. Targeting glioblastoma stem cells through
disruption of the circadian clock. Cancer Discov. 9, 1556–1573
(2019).
12. Breuhahn, K. & Schirmacher, P. Reactivation of the insulin-like
growth factor-II signaling pathway in human hepatocellular
carcinoma. World J. Gastroenterol. 14, 1690–1698 (2008).
13. Xu, D. et al. The gluconeogenic enzyme PCK1 phosphorylates
INSIG1/2 for lipogenesis. Nature 580, 530–535 (2020).
14. Ji, H. et al. EGF-induced ERK activation promotes CK2-mediated
disassociation of α-Catenin from β-Catenin and transactivation of
β-Catenin. Mol. Cell. 36, 547–559 (2009).
15. Paci, G., Caria, J. & Lemke, E. A. Cargo transport through the
nuclear pore complex at a glance. J. Cell Sci. https://doi.org/
10.1242/jcs.247874 (2021).
16. Elfgang, C. et al. Evidence for specific nucleocytoplasmic
transport pathways used by leucine-rich nuclear export signals.
Proc. Natl Acad. Sci. USA 96, 6229–6234 (1999).
17. Ben-Sahra, I., Howell, J. J., Asara, J. M. & Manning, B. D.
Stimulation of de novo pyrimidine synthesis by growth signaling
through mTOR and S6K1. Science 339, 1323–1328 (2013).
Nature Cell Biology | Volume 25 | February 2023 | 273–284
https://doi.org/10.1038/s41556-022-01061-0
18. Doi, M., Hirayama, J. & Sassone-Corsi, P. Circadian regulator
CLOCK is a histone acetyltransferase. Cell 125, 497–508
(2006).
19. Hirayama, J. et al. CLOCK-mediated acetylation of BMAL1 controls
circadian function. Nature 450, 1086–1090 (2007).
20. Lin, R. et al. CLOCK acetylates ASS1 to drive circadian rhythm of
ureagenesis. Mol. Cell 68, 198–209 e196 (2017).
21. Liu, R. et al. Choline kinase alpha 2 acts as a protein
kinase to promote lipolysis of lipid droplets. Mol. Cell 81,
2722–2735 e2729 (2021).
22. Cuervo, A. M. & Wong, E. Chaperone-mediated autophagy: roles
in disease and aging. Cell Res 24, 92–104 (2014).
23. Kaushik, S. & Cuervo, A. M. The coming of age of
chaperone-mediated autophagy. Nat. Rev. Mol. Cell Biol. 19,
365–381 (2018).
24. Wong, K. M., King, G. G. & Harris, W. P. The treatment landscape
of advanced hepatocellular carcinoma. Curr. Oncol. Rep. 24,
917–927 (2022).
25. Chaudhari, A., Gupta, R., Patel, S., Velingkaar, N. & Kondratov, R.
Cryptochromes regulate IGF-1 production and signaling through
control of JAK2-dependent STAT5B phosphorylation. Mol. Biol.
Cell 28, 834–842 (2017).
26. Crosby, P. et al. Insulin/IGF-1 drives period synthesis to entrain
circadian rhythms with feeding time. Cell 177, 896–909 e820
(2019).
27. Zhang, J., Lv, H., Ji, M., Wang, Z. & Wu, W. Low circadian clock
genes expression in cancers: a meta-analysis of its association
with clinicopathological features and prognosis. PLoS ONE 15,
e0233508 (2020).
Publisher’s note Springer Nature remains neutral with regard to
jurisdictional claims in published maps and institutional affiliations.
Springer Nature or its licensor (e.g. a society or other partner) holds
exclusive rights to this article under a publishing agreement with
the author(s) or other rightsholder(s); author self-archiving of the
accepted manuscript version of this article is solely governed by the
terms of such publishing agreement and applicable law.
© The Author(s), under exclusive licence to Springer Nature Limited
2023
284
Article
Methods
This research complies with all relevant ethical regulations of The
First Affiliated Hospital, Zhejiang University School of Medicine and
Qingdao Cancer Institute, including the Institutional Review Board
and Institutional Animal Care and Use Committee.
Materials
Antibodies against HA (ab18181) (for IP), c-SRC (ab16885), c-Src pY418
(ab4816), CK2α pT360/S362 (ab119410), CLOCK (ab3517) (for IHC),
HSC70 (ab154415), IGF1R pY1161 (ab39398) and LAMP2A (ab18528) were
purchased from Abcam. Antibodies against CLOCK (#5157) (for western
blot (WB)), Exportin1 (#46249), AKT (#4685), AKT pS473 (#4060), acet-
ylated lysine (#9441), HA (#3724) (for WB), ERK1/2 (#4695), pERK1/2
(#4370), c-Jun (#9165) and c-Jun pS73 (#3270) were purchased from Cell
Signaling Technology. Anti-PCNA (#610665) antibody was obtained
from BD Biosciences. BMAL1 (NBP2-02544) antibody was purchased
from Novus Biologicals. Normal mouse IgG (sc-2025), normal rabbit IgG
(sc-2027), GST (sc-138), CK2α (sc373894) (for WB), PRPS1/2 (sc-376440)
(for IHC), PRPS1/2 (sc-100822) (for IP and WB), and tubulin (sc-8035)
antibodies were obtained from Santa Cruz Biotechnology. [γ-32P] ATP
was obtained from PerkinElmer. Rabbit anti-Ki67 antibody (AB9260)
was obtained from Millipore. TBB, SP600125, sorafenib, U0126,
SU6656, CHX, CQ, PS341, MG132, BFA, EGF, ATP, acetyl co-enzyme A,
streptavidin magnetic beads, anti-Flag M2 agarose beads, EDTA-free
protease inhibitor cocktail, 3× Flag peptides, mouse anti-Flag (F1804),
rabbit anti-Flag (F7425) and anti-His (SAB1305538) antibodies were pur-
chased from Sigma-Aldrich. MK-2206, hygromycin (400053), puromy-
cin (540222) and G418 (345810) were purchased from EMD Biosciences.
FGF1 was purchased from R&D Systems. Antibodies against α-catenin
pS641 (GTX79145), α-catenin (GTX111095) and CLOCK (GTX134464)
(for immunofluorescence) were obtained from Genetex. CLOCK anti-
body (A302-617A) (for IP), CK2α (A300-198A) (for WB and IP), glu-
tathione agarose, DAPI, Alexa Fluor 488 goat anti-rabbit (A11008), Alexa
Fluor 594 goat anti-rabbit (A11012), Alexa Fluor 488 goat anti-mouse
(A11029) and Alexa Fluor 594 goat anti-mouse antibodies (A11005) were
obtained from Thermo Fisher Scientific. Primary antibodies were used
at a dilution of 1:1,000. Secondary HRP-coupled antibodies were used
at 1:5,000.Ni-NTA agarose was obtained from Qiagen. CLOCK pS106
blocking peptide (WKPTFL-pS-NEEFTQ) and PRPS1/2 K29ac blocking
peptide (LGLELG-Kac-VVTKKF) were synthesized by Selleck-Chem.
CLOCK pS106- and PRPS1/2 K29ac-specific antibodies were generated
by Signalway Biotechnology.
DNA construction and mutagenesis
PCR-amplified human CLOCK, PRPS1, PRPS1, CK2α, HSC70, BMAL1,
ERK2, IGF1R, FGFR1, EGFR, Exportin1, Exportin2, Exportin3 and LAMP2A
were cloned into pcDNA3.1/hygro(+)-Flag, pcDNA3.1/hygro(+)-HA,
pcDNA3.1/hygro(+)-Myc, twin Flag-streptavidin, PGEX4T-1 (GST) or
pColdI vectors, as previously described28. The following mutations
were generated using a QuikChange site-directed mutagenesis kit
(Stratagene): PRPS1/2 K29R, V30A/V31A, and K29R/V30A/V31; CLOCK
S106A, CLOCK S106D, NES mutant (L113A/L115A/L118A), mutant A
(P660A/Y662A/N663A) and mutant B (G673A/S674A/V676A); Ck2α
K68M and T360/S362A, IGF1R (V922E) (IGF1R-CA), Bmal1 4Mut (D144A/
D231A/D299A/E303A), DFGFR1 (K567E) (FGFR1-CA), and short hairpin
RNA (shRNA)-resistant CLOCK constructs containing T723C, G726C,
A729G and T732C; shRNA-resistant PRPS1 constructs containing T567C,
C570A and G573A; shRNA-resistant PRPS2 constructs containing
C285A, A288C and A291G; shRNA-resistant BMAL1 constructs contain-
ing C1110A, A1113C and G1116A. The PLKO.1 shRNA target sequences
were as follows: CLOCK, 5′-CGCACACATAGGCCATCTTAT-3′; PRPS1,
5′-TGGACTTTGCCTTGATTCACA-3′; PRPS2, 5′-CCATACGCCCGACA
AGATAAA-3′; and Exportin1 (CRM1), 5′-CCTGCTTTCAAGGAACAT
TTA-3′. HSC70 shRNA1: 5′-CCAAGACTTCTTCAATGGAAA-3′; HSC70
shRNA2: 5′-GCAACTGTTGAAGATGAGAAA-3′; LAMP2A shRNA1: 5′-GC
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
TCAAGACTGCAGTGCAGAT-3′; LAMP2A shRNA2: 5′-GCAGTGCAG
ATGACGACAACT-3′. BMAL1 shRNA1: 5′-CTTCTAGGCACATC
GTGTTAT-3′; BMAL1 shRNA2: 5′-GCAGAATGTCATAGGCAAGTT-3′.
CK2α shRNA1: 5′-GCACAGAAAGCTACGACTAAT-3′; CK2α shRNA2:
5′-TGGACAAACTGCTGCGATATG-3′. HA-EGFR-vIII was kindly provided
by Dr. Xinjian Li from CAS Key Laboratory of Infection and Immunity,
CAS Center for Excellence in Biomacromolecules, Institute of Bio-
physics, Chinese Academy of Sciences, Beijing, China. The expression
plasmid for the Per1-driven luciferase reporter was kindly provided by
Dr Yi Liu (School of Basic Medical Sciences, Fudan University, China).
Cell lines and cell culture conditions
Hep3B, THLE-2 and 293T were obtained from ATCC. Huh7, L02, CCLP1
and HuCCT1 were purchased from the Type Culture Collection of the
Chinese Academy of Sciences, Shanghai, China. Huh7, Hep3B, 293T and
L02 were maintained in Dulbecco’s modified Eagle medium (DMEM)
supplemented with 10% bovine calf serum (HyClone). THLE-2 was
cultured in BEGM from Lonza, supplied with 10% foetal bovine serum
in pre-coated dish. CCLP1 and HuCCT1 were cultured in RPMI1640 com-
plete medium supplemented with 10% bovine calf serum (HyClone).
No cell lines used in this study were found in the database of commonly
misidentified cell lines that is maintained by the International Cell Line
Authentication Committee and the BioSample database maintained
by the NCBI. Glucose deprivation was carried out by washing the cells
twice with phosphate-buffered saline (PBS) and then culturing the
cells in glucose-free DMEM (Gibco). The transfection procedure was
performed using PolyJet (SignaGen) or Lipofectamine 2000 (Invitro-
gen) according to the manufacturers’ instructions29.
IP and immunoblotting analysis
The extraction of proteins from cultured cells was performed with a
modified buffer and was followed by IP and immunoblotting using
corresponding antibodies as described previously30. Immunoblot-
ting intensity was quantified by ImageJ (National Institutes of Health).
Measurement of PRPS activity
PRPS activity was measured as previously reported31,32. Briefly, different
purified PRPS1/2 (10 ng) proteins were incubated in 100 μl of reaction
buffer (110 mM NaH2PO4, pH 7.0, 4.7 mM ribose 5-phosphate, 0.4 mM
NADH, 3.2 mM ATP, 1.8 mM phosphoenolpyruvate, 6 mM MgCl2, 31 mM
NaHCO3, 7 U of pyruvate kinase, 10 U of lactic dehydrogenase and 10 U
of myokinase) at 25 °C in a 96-well plate. The absorbance was read at
340 nm in kinetic mode for 5 min using multi-detection microplate
readers (BMG Labtech). Myokinase, pyruvate kinase, lactic dehydro-
genase and phosphoenolpyruvate were excessive in the system to
ensure complete consumption of AMP generated by the PRPS pro-
tein. The amount of PRPS protein in the immunoprecipitates or elu-
ates was quantified by immunoblot using purified His-PRPS protein
as a standard.
GST pulldown assay
Equal amounts of His-tagged purified protein (200 ng per sample) were
incubated with 100 ng of GST fusion proteins together with glutathione
agarose beads in modified binding buffer (50 mM Tris–HCl, pH 7.5; 1%
Triton X-100; 150 mM NaCl; 1 mM dithiothreitol (DTT); 0.5 mM EDTA;
100 μM phenylmethylsulfonyl fluoride; 100 μM leupeptin; 1 μM apro-
tinin; 100 μM sodium orthovanadate; 100 μM sodium pyrophosphate;
and 1 mM sodium fluoride). The glutathione agarose beads were then
washed four times with binding buffer and subjected to immunoblot-
ting analysis as previously described33.
Purification of recombinant proteins
GST-CLOCK WT, GST-CLOCK S106A, GST-CLOCK NES mutant
(L113A/L115A/L118A), GST-CLOCK mutant A (P660A/Y662A/N663A),
GST-CLOCK mutant B (G673A/S674A/V676A), GST-Exportin1,
Article
GST-PRPS1/2 WT, GST-PRPS1/2 K29R, GST-CK2α WT, GST-CK2α K68M,
GST-CK2α T360/S362A, His-PRPS1/2 WT, His-PRPS1/2 K29R, His-CLOCK
WT, His-CLOCK S106A, His-CLOCK NES mutant, His-ERK2,
His-CK2α WT, His-CK2α K68M, His-BMAL1 and His-HSC70 were
expressed in bacteria and purified as previously described 34.
S-protein-Flag-streptavidin-binding peptide (SFB)-tagged CLOCK
and the indicated mutants expressed in 293T cells were enriched by
anti-Flag agarose beads and eluted with 3× Flag peptide. After ultra-
filtration and removal of the 3× Flag peptide from the eluted protein,
a secondary streptavidin pulldown assay was performed.
CRISPR–Cas9-mediated genome editing
Genomic mutations were introduced into cells using the CRISPR–Cas9
system, as described previously35. Single-guide RNAs (sgRNAs) were
designed to target the genomic area adjacent to mutation sites in
PRPS1/2 K29R using the CRISPR design tool (http://crispr.mit.edu/). The
annealed guide RNA oligonucleotides were inserted into a PX458 vector
(Addgene) digested with the BbsI restriction enzyme. Cells were seeded
at 60% confluence, followed by co-transfection of sgRNAs (0.5 μg)
and single-stranded donor oligonucleotides (10 pmol) as a template
to introduce mutations. Twenty-four hours after transfection, cells
were trypsinized, diluted for single cells and seeded into 96-well plates.
Genomic DNA was extracted from GFP-positive cells, followed by
sequencing of the PCR products spanning the mutation sites. sgRNA tar-
geting sequence for Prps1 (K29R): 5′-GGGCCTGGAGCTAGGCAAGG-3′;
single-stranded donor oligonucleotide (ssODN) sequence for
PRPS1 (K29R): 5′- ATGCCGAATATCAAAATCTTCAGCGGCAGCTCCC
ACCAGGACTTATCTCAGAAAATTGCTGACCGCCTGGGCCTGGA
G C TAG G C AGAGTAGTGAC TA AGA A AT TC AG C A ACC AG GAG
ACCTGGTAAGGACCAAGTTGGGACCCTGACTAGACCTCACCTGC
CCAGGC-3′; sgRNA targeting sequence for PRPS2 (K29R):
5′-GGGCCTGGAGCTGGGCAAGG -3′; ssODN sequence for PRPS2
(K29R): 5′- CCATGCCCAACATCGTGCTGTTCAGCGGCAGCTCG
CATCAGGACCTGTCCCAGCGCGTGGCCGACCGCCTGGGCCTG
GAGCTGGGCAGAGTAGTCACGAAGAAGTTCAGCAACCAGGAGACCAG
GTGGGGGCCGCGCCGGCGGCCGGGCTAGGGAGAGCGCTGGGCAC-3′.
The lowercase letters in the ssODN sequences indicate the mutated
nucleotides that will replace the endogenous nucleotides in the
genomic DNA of parental cells using the CRISPR–Cas9 system.
Genotyping was performed by sequencing PCR products ampli-
fied from the following primers: Prps1 forward: 5′-CGGGAATGTA
AGATGGCGGA-3′; Prps1 reverse: 5′-TCAGTACGCAGGTAGGCTCT-3′;
Prps2 forward: 5′-CTTCCCTACATCTAGCCGCC-3′; Prps2 reverse:
5′- GGGGGAAACCTTTAGTCGCA-3′.
Influx of glucose into nucleic acids
An assay of the influx of glucose to nucleic acids was performed as previ-
ously described with modifications. In brief, Huh7 or Hep3B cells were
seeded in a six-well plate and incubated in 2 ml of fresh medium spiked
with 1 μCi of d-[6-14C] glucose (0.01 mmol l−1) for 30 min, followed by
washing with ice-cold PBS to remove extra medium components. RNA
or DNA was extracted, and 14C-RNA or 14C-DNA was assayed using a
scintillation counter.
Analysis of intermediate metabolites by LC–MS/MS
Analysis of intermediate metabolites by liquid chromatography with
tandem mass spectrometry (LC–MS/MS) was performed as previously
described32. Briefly, for analysis of the incorporation of glucose carbon
(13C6-glucose) into intracellular nucleotide metabolites, extracts were
prepared and analysed by high-resolution mass spectrometry. Cells at
approximately 80% confluence were seeded in 10 cm dishes in tripli-
cate. For glucose labelling, cells were washed with glucose-free DMEM
and incubated in fresh medium containing 13C6-glucose (10 mmol l−1)
for 30 min. Then, the cells were quickly washed with ice-cold PBS to
remove extra medium components. Nucleotide metabolites were
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
extracted using 90/9/1 (v/v/v) acetonitrile/water/formic acid. Samples
were centrifuged at 17,000g for 5 min at 4 °C, and supernatants were
transferred to clean tubes, followed by evaporation to dryness using
nitrogen. Samples were reconstituted in 0.2% ammonium hydroxide
in ammonium acetate (10 mmol l−1), and then, 10 μl was injected into a
Thermo Scientific Vanquish liquid chromatography system containing
a ThermoHypercarb 100 × 3 mm 3 μm HPLC column heated to 35 °C
with mobile phase A (MPA) consisting of 0.2% ammonium hydroxide
in ammonium acetate (10 mmol l−1) and mobile phase B (MPB) consist-
ing of 0.2% ammonium hydroxide in acetonitrile. With a flow rate of
0.3 ml min−1, the gradient elution programme was 0 min (0% MPB)–
2.0 min (0% MPB)–15.0 min (30% MPB)–15.1 min (95% MPB)–20.0 min
(95% MPB)–20.1 min (0% MPB)–25.0 min (STOP). Data were acquired
using a Thermo Orbitrap Fusion Tribrid Mass Spectrometer in selected
ion mode (SIM) electrospray positive mode. Peak integration and area
calculation were performed by using Thermo TraceFinder software.
In vitro kinase assay
An in vitro kinase assay was performed as previously described with
modifications36. Briefly, purified CK2α was incubated with different
bacterially purified His or GST-CLOCK (200 ng) proteins in 25 μl of
kinase buffer (50 mM Tris–HCl, pH 7.5; 100 mM KCl; 50 mM MgCl2; 1 mM
Na3VO4; 1 mM DTT; 5% glycerol; 0.5 mM ATP; and 10 μCi [γ-32P] ATP) at
25 °C for 1 h. The reaction was terminated by adding SDS–PAGE loading
buffer and heating to 100 °C for 5 min. The reaction mixture was then
subjected to SDS–PAGE or autoradiography analysis.
In vitro acetylation assay
An in vitro acetylation reaction was performed as described previ-
ously37. In brief, purified GST-CLOCK proteins on glutathione agarose
beads were incubated with or without His-CK2α in the presence of ATP
for an in vitro kinase assay. The beads were then washed with PBS five
times and incubated with or without the indicated His-PRPS1/2 in 30 μl
of reaction buffer (20 mM Tris–HCl (pH 8.0), 20% glycerol, 100 mM KCl,
1 mM DTT, 0.2 mM EDTA, 10 mM Trichostatin A, 10 mM nicotinamide
and 100 mM acetyl-CoA) at 30 °C for 1 h. The reaction was terminated
by adding SDS–PAGE loading buffer. The samples were then subjected
to immunoblotting analyses.
Per1-driven luciferase reporter assay
Luciferase reporter activity in cell lysates was measured as previ-
ously described38. In brief, Huh7 cells were transfected with 0.1 μg
of Per1-driven luciferase reporter and 0.075 μg of β-galactosidase.
Twenty-four hours later, the cells were stimulated with or without
IGF1 (100 ng ml−1) for 12 h. Cell lysates were measured for the activity
of luciferase and β-galactosidase according to the manufacturer’s
instructions (Promega).
Apoptosis assay
For a TUNEL assay, tumour tissues were sectioned at 5 μm thickness.
Apoptotic cells were counted using a Dead-End colourimetric TUNEL
system (Promega) according to the manufacturer’s instructions.
Cell proliferation assay
A total of 2 × 105 cells suspended in 2 ml of medium were seeded in
six-well plates and were maintained in maintained in complete medium.
The cells in each well were trypsinized and counted every day after
seeding.
Mass spectrometry analyses
For identification of interacting proteins, a protein band visualized
via Coomassie blue staining was excised from an SDS–PAGE gel and
digested in gel in 50 mM ammonium bicarbonate buffer containing
RapiGest (Waters Corporation) overnight at 37 °C with 200 ng of
modified sequencing-grade trypsin (Promega). The digested protein
Article
samples were analysed using high-sensitivity LC–MS/MS with an
Orbitrap Elite mass spectrometer (Thermo Fisher Scientific). Proteins
were identified by searching the fragment spectra against the UniProt
protein database (EMBL-EBI) using the Mascot search engine (v.2.3;
Matrix Science) with the Proteome Discoverer software program (v.1.4;
Thermo Fisher Scientific). For detection of phosphorylation sites,
in vitro phosphorylation of CLOCK by CK2α was performed according
to the in vitro kinase assay protocol described above. For detection of
acetylation sites, purified GST-CLOCK proteins on glutathione agarose
beads were incubated with or without His-CK2α in the presence of
ATP for an in vitro kinase assay. The beads were then washed with PBS
five times and incubated with or without the indicated His-PRPS1/2
proteins in the presence of acetyl-CoA. Then, the protein samples
were digested using trypsin or GluC and analysed using LC–MS/MS
with an Orbitrap Elite mass spectrometer as described previously34.
Mass spectrometric analysis of a tryptic fragment at m/z 887.35431 Da
(−0.33 mmu/−0.37 ppm), which was matched with the +1 charged
peptide 102-PTFLSNE-108, suggested that CLOCK S106 was phospho-
rylated. The XCorr score was 2.33. Mass spectrometric analysis of a
tryptic fragment at m/z 599.87543 Da (+1.51 mmu/+2.53 ppm), which
was matched with the +2 charged peptide 23-LGLELGKVVTK-33, sug-
gested that PRPS K29 was acetylated. The XCorr score was 3.25.
Immunofluorescence analysis
Cells were fixed and incubated with primary antibodies at a dilution of
1:100, fluorescence dye-conjugated secondary antibodies and DAPI,
according to standard protocols. Immunofluorescence microscopic
images of the cells were obtained and viewed with an IX81 confocal
microscope system (Olympus America). FV10-ASW Viewer (Version
4.2b) is used to collect the immunofluorescence data. Fluorescence
intensity was quantified by ImageJ (National Institutes of Health).
Subcellular fractionation
Nuclear and cytosolic fractions were isolated from the cells using a
nuclear/cytosol fractionation kit (K266, BioVision) according to the
manufacturer’s instructions.
Real-time PCR
Total RNA was extracted from cells and tissue specimens using TRIzol
according to the manufacturer’s instructions (Invitrogen). A total
of 1 mg per sample RNA was used for cDNA synthesis with a TaqMan
reverse transcription reagent kit (Applied Biosystems). Quantitative
real-time PCR was carried out in a 7500 real-time PCR system (Applied
Biosystems) using a SYBR Premix Ex Taq kit for real-time PCR (TaKaRa)
as previously reported39. GAPDH served as the normalization gene in
these studies. The following primers were used for qRT–PCR:
Nr1d1, 5′-CCCTGGGAGTCTACAAGTGG-3′ and 5′-GCGATTGATGC
GGACGAT-3′; Dbp, 5′-CCTCGAAGACATCGCTTCTC-3′ and 5′-GCCT
CGTTGTTCTTGTACCG-3′; Prps1, 5′-GATCTATTTGGCCTCTCAAA-3′
and 5′-CACACAGGTACACACACTTTATT-3′; Prps2, 5′-GGACCTGCA
TGCTTCTCAG-3′ and 5′-ATGTTTTCCCGAATCCACTG-3′; and Gapdh,
5′-AGCCACATCGCTCAGACAC-3′ and 5′-GCCCAATACGACCAATCC-3′.
MD simulations
The human CLOCK/BMAL1 complex model was built using the crystal
structure of the mouse CLOCK/BMAL1 (PDB ID: 4F3L) as the template
using MODELLER10.1 as previously described40. In this study, 1,000
homology models were created and the top model with highest dope
score was selected for the MD simulations. After creation of the human
CLOCK/BMAL1 complex model, MD simulations were performed using
FF19SB forcefield for the proteins in AMBER20 package as previously
described41. The protein was solvated in a truncated octahedral OPC
water box containing 25,534 water molecules. Three Na+ ions were
added to neutralize the systems. Before production runs, the sys-
tem was minimized and equilibrated. Afterwards, 500 ns simulations
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
with the pressure coupling set at 1 atm and a constant temperature of
300 K were performed for the CLOCK/BMAL1 system with and without
S106 phosphorylation. MD trajectories were analysed using VMD
(http://www.ks.uiuc.edu/), and the molecules were drawn using PyMOL
(https://pymol.org/2/)).
IHC analysis and histological evaluation of human HCC
specimens
Human HCC and adjacent matched non-tumour tissue samples were
obtained from The First Affiliated Hospital, Zhejiang University School
of Medicine and The Affiliated Hospital of Qingdao University. The use
of human HCC samples and the relevant database was approved by the
Research Ethics Committee of The First Affiliated Hospital, Zhejiang
University School of Medicine and The Affiliated Hospital of Qingdao
University, complied with all relevant ethical regulations. All tissue
samples were collected in compliance with the informed consent
policy. Non-tumour and HCC samples from 24 males and 6 females
with an average (±standard deviation (s.d.)) age 63.1 (±10.8) years
were used for IHC staining to compare the protein expression between
tumour and normal tissue specimen. HCC samples from 71 males and
19 females with an average (±s.d.) age of 61.4 (±11.2) years were used
to analyse the relationship between IGFR1 pY1161, α-catenin pS641,
CLOCK pS106, PRPS1/2 K29ac, PRPS1/2 and the clinical aggressiveness
of HCC. All the patient samples underwent surgical resection and were
collected in compliance with the informed consent policy. Sections of
paraffin-embedded human HCC samples were stained with antibodies
against IGFR1 pY1161, α-catenin pS641, CLOCK pS106, PRPS1/2 K29ac or
PRPS1/2 and non-specific IgG as a negative control. The staining of the
tissue sections was quantitatively scored according to the percentage
of positive cells and the staining intensity as described previously42.
The following proportion scores were assigned to the sections: 0 if
0% of the tumour cells exhibited positive staining, 1 for 0–1% of cells
stained, 2 for 2–10% of cells stained, 3 for 11–30% of cells stained, 4 for
31–70% of cells stained and 5 for 71–100% of cells stained. In addition,
the staining intensity was rated on a scale of 0–3: 0, no staining; 1, weak;
2, moderate; and 3, strong. The proportion and intensity scores were
then combined to obtain a total score (range, 0–8). The scores were
compared with overall survival duration, defined as the time from the
date of diagnosis to that of death or last known follow-up examination.
All patients had received standard therapies after surgery.
Animal studies
Six-week-old male athymic BALB/c nude mice were housed under
specific-pathogen-free conditions in a 14 h light/10 h dark cycle. Ambi-
ent temperature (21–23 °C, 50% humidity) with access to water and food
ad libitum. Animal studies were approved by Research Ethics Commit-
tee and complied with the ethical regulations of The First Affiliated
Hospital, Zhejiang University School of Medicine and Qingdao Cancer
Institute. One million Huh7 cells expressing CLOCK shRNA with recon-
stituted expression of the indicated Flag-rCLOCK proteins or parental
Huh7 cells and the indicated clones with knock-in expression of PRPS1/2
K29R mutants were collected in 20 μl of DMEM with 33% Matrigel and
intrahepatically injected into the livers of 6-week-old male athymic
BALB/c nude mice. The injections were performed as described previ-
ously31. The animals were killed 28 days after injection. The liver of each
mouse was dissected and then fixed in 4% formaldehyde and embed-
ded in paraffin. Tumour formation and phenotype were determined
by histologic analysis of haematoxylin-and-eosin-stained sections.
Tumour volume was calculated using the following formula: V = 1/2a2b
(V, volume; a, shortest diameter; b, longest diameter). The animals
were treated in accordance with relevant institutional and national
guidelines and regulations. The use of the animals was approved by
the Institutional Review Board at The First Affiliated Hospital, Zheji-
ang University School of Medicine and Qingdao Cancer Institute. The
maximal tumour burden permitted by ethics committee is 1,500 cm3,
Article
and the maximal tumour burden did not exceed the limit. No statistical
method was used to pre-determine the sample size. The investigators
were not blinded to treatment allocation during experiments or to the
outcome assessment.
Statistics and reproducibility
All statistical data are presented as mean ± s.d. All experiments were
repeated at least twice independently with similar results. The mean
values obtained in the control and experimental groups were analysed
for significant differences. Pairwise comparisons were performed using
a Student’s t-test (two-tailed), one-way ANOVA post hoc test (unpaired
two-tailed Student’s t-test with Bonferroni correction) or Mann–Whit-
ney U test. P values of less than 0.05 were considered significant. No
statistical method was used to pre-determine sample size. No data
were excluded from the analyses. Data distribution was assumed to be
normal, but this was not formally tested. Unless stated otherwise, the
experiments were not randomized. Data collection and analysis were
not performed blind to the conditions of the experiments.
Reporting summary
Further information on research design is available in the Nature Port-
folio Reporting Summary linked to this article.
Data availability
Mass spectrometry data have been deposited in ProteomeXchange with
the accession code PXD037738. UniProt protein database (EMBL-EBI)
was used for protein identification. All other data supporting the find-
ings of this study are available from the corresponding author on
reasonable request. Source data are provided with this paper.
References
28. Li, X. et al. Nucleus-translocated ACSS2 promotes gene
transcription for lysosomal biogenesis and autophagy. Mol. Cell
66, 684–697 e689 (2017).
29. Lee, J. H. et al. EGFR-phosphorylated platelet isoform of
phosphofructokinase 1 promotes PI3K activation. Mol. Cell 70,
197–210 e197 (2018).
30. Lee, J. H. et al. Stabilization of phosphofructokinase 1 platelet
isoform by AKT promotes tumorigenesis. Nat. Commun. 8, 949
(2017).
31. Li, X. et al. A splicing switch from ketohexokinase-C to
ketohexokinase-A drives hepatocellular carcinoma formation.
Nat. Cell Biol. 18, 561–571 (2016).
32. Qian, X. et al. Conversion of PRPS hexamer to monomer by
AMPK-mediated phosphorylation inhibits nucleotide synthesis in
response to energy stress. Cancer Discov. 8, 94–107 (2018).
33. Xu, D. Q. et al. PAQR3 controls autophagy by integrating AMPK
signaling to enhance ATG14L-associated PI3K activity. EMBO J. 35,
496–514 (2016).
34. Qian, X. et al. KDM3A senses oxygen availability to regulate
PGC-1α-mediated mitochondrial biogenesis. Mol. Cell 76,
885–895 e887 (2019).
35. Qian, X. et al. PTEN suppresses glycolysis by dephosphorylating
and inhibiting autophosphorylated PGK1. Mol. Cell 76, 516–527
e517 (2019).
36. Xu, D. et al. The protein kinase activity of fructokinase A specifies
the antioxidant responses of tumor cells by phosphorylating p62.
Sci. Adv. 5, eaav4570 (2019).
37. Lin, S. Y. et al. GSK3-TIP60-ULK1 signaling pathway links growth
factor deprivation to autophagy. Science 336, 477–481 (2012).
38. Du, L. et al. β-Catenin induces transcriptional expression of PD-L1
to promote glioblastoma immune evasion. J. Exp. Med. https://
doi.org/10.1084/jem.20191115 (2020).
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
39. Xu, D. et al. PAQR3 modulates cholesterol homeostasis by
anchoring Scap/SREBP complex to the Golgi apparatus. Nat.
Commun. 6, 8100 (2015).
40. Yu, R., Craik, D. J. & Kaas, Q. Blockade of neuronal α7-nAChR
by α-conotoxin ImI explained by computational scanning
and energy calculations. PLoS Comput. Biol. 7, e1002011
(2011).
41. Yu, R. et al. Molecular determinants conferring the
stoichiometric-dependent activity of α-conotoxins at the human
α9α10 nicotinic acetylcholine receptor subtype. J. Med. Chem. 61,
4628–4634 (2018).
42. Yang, W. et al. Nuclear PKM2 regulates β-catenin transactivation
upon EGFR activation. Nature 480, 118–122 (2011).
Acknowledgements
This study was supported by grants from the Ministry of Science
and Technology of the People’s Republic of China (2020YFA0803300,
Z.L.; 2021YFA0805600, D.X.), the National Natural Science Foundation
of China (92157113 and 82072630, D.X.; 82173114, Z.W.; 82072903
and 82272872, T.L.; 82002811, M. Yan; 82188102 and 82030074,
Z.L.), the Zhejiang Natural Science Foundation Key Project
(LD22H160002, D.X.; LD21H160003, Z.L.), Zhejiang Natural Science
Foundation Discovery Project (LQ22H160023, Z.W.), and the Leading
Innovative and Entrepreneur Team Introduction Program of Zhejiang
(2019R01001, Z.L.). Z.L. is the Kuancheng Wang Distinguished
Chair. The authors received no specific funding for this work. We
express our great gratitude to Dr. Hong Wang and his team from
the Hangzhou Cosmos Wisdom Mass Spectrometry Center of
Zhejiang University Medical School for their technical support in
sample analysis utilizing an integrated nanoLC–ESI–MS/MS and data
processing platform.
Author contributions
D.X. and Z.L. conceived and designed the study and wrote the
manuscript. T.L., Z.W., L.Y., Y.D., H.H., K.W., M. Yan, G.J., Y.S., L.W., L.L.,
P.Z., B.D., F.S. and Z.Z. performed the experiments; H.J., M. Yang and
R.Y. were involved in MD simulation analyses. Y.X., L.X., Q.W. and X.Q.
reviewed and edited the manuscript.
Competing interests
Z.L. owns shares in Signalway Biotechnology (Pearland, TX), which
supplied rabbit antibodies that recognize CLOCK pS106 and PRPS1/2
K29ac. Z.L.’s interest in this company had no bearing on its being
chosen to supply these reagents. The remaining authors declare no
competing interests.
Additional information
Extended data is available for this paper at https://doi.org/10.1038/
s41556-022-01061-0.
Supplementary information The online version contains
supplementary material available at https://doi.org/10.1038/s41556-
022-01061-0.
Correspondence and requests for materials should be addressed to
Zhimin Lu or Daqian Xu.
Peer review information Nature Cell Biology thanks Lars Zender,
Tsuyoshi Hirota and the other, anonymous, reviewer(s) for their
contribution to the peer review of this work.
Reprints and permissions information is available at
www.nature.com/reprints.
Article
Extended Data Fig. 1 | CLOCK S106 phosphorylation disassembles the
CLOCK–BMAL1 complex. (b-e, h, j, k, m, n) Immunoprecipitation and
immunoblotting with the indicated antibodies was performed. All experiments
were repeated at least twice independently. Data are the mean ± SD. (a) The
luciferase activity of the indicated cells expressing a Per1-driven luciferase
reporter was measured after IGF1 treatment (12 h) (n = 6). *P < 0.01; **P < 0.001
by One-way ANOVA post hoc test. (b, c, m, n) The indicated cells were pretreated
with or without the indicated inhibitors for 30 min before IGF1 treatment for
30 min (b, c, m) or transfected with the indicated plasmids before IGF1 treatment
for 1 h (n). Total cell lysates and cytosolic fractions were prepared. (d) Flag-CK2α
immunoprecipitated from Huh7 cells treated with or without IGF1 for 30 min
was incubated with or without CIP for 30 min. (e) Purified GST-CK2α was mixed
with or without active His-ERK2 for in vitro kinase assay, followed by incubation
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
with purified His-CLOCK. Proteins precipitated by GST pulldown assay were
incubated with or without CIP for 30 min. (f) In vitro kinase assays were
performed by mixing purified His–CLOCK with or without purified GST-CK2α in
the presence of ATP. Mass-spectrometric analysis was performed. (g) Alignment
of CLOCK to the consensus CK2α-phosphorylated substrate motif (SXXD/E). (h,
i) Huh7 cells expressing Flag-CLOCK were treated with or without IGF1 for 1 h (h).
Immunoblotting (h) or IHC analyses of human HCC samples (i) were performed
with the indicated antibodies and a CLOCK pS106-blocking peptide. ( j-l) The
indicated cells expressing the indicated plasmids (j) were treated with or without
IGF1 for 1 h ( j-l). Total cell lysates and cytosolic and nuclear fractions were
prepared (k). The relative CLOCK abundance was quantified (n = 10) (l). *P < 0.05;
***P < 0.0001 by two-tailed Student’s t test.
Article
Extended Data Fig. 2 | CLOCK S106 phosphorylation is required for its
nuclear exportation. (e-i) Immunoprecipitation and immunoblotting analyses
were performed with the indicated antibodies. All experiments were repeated
three times independently with similar results. (a) Alignment of protein
sequences spanning CLOCK S106 and the adjacent noncanonical NES from
different species. (b, d) MD simulation of CLOCK bound with BMAL1 WT (b) or
BMAL1 4Mut (D144A/D231A/D299A/E303A) (d). Evolution of the backbone root-
mean-square-deviation (RMSD) of the CLOCK-BMAL1 complex from the initial
frame in 250 ns MD simulations. RMSD of the CLOCK-BMAL1 complex with and
without CLOCK S106 phosphorylation are shown in red and black, respectively.
(c) The conformation of the CLOCK-BMAL1 complex of the last frame extracted
from 250 ns MD simulation. CLOCK and BMAL1 structures are shown in green
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
and blue, respectively. The red arrow indicates CLOCK S106. D144, D232, D299,
and E303 of BMAL1, which are in a close proximity with CLOCK S106, are shown.
(e) Bacterially purified WT GST-CLOCK or GST-CLOCK S106A was incubated with
or without His-CK2α in the presence of ATP for an in vitro kinase assay, followed
by incubation with the indicated His-BMAL1 proteins. (f) Huh7 cells stably
transfected with the indicated plasmids were treated with or without IGF1 for
1 h. Total cell lysates and cytosolic fractions were prepared. (g) Huh7 cells were
pretreated with or without TBB for 30 min before treatment with or without
IGF1 for 1 h. (h) The indicated cells expressing CLOCK shRNA with reconstituted
expression of the indicated CLOCK proteins were harvested. (i) Hep3B cells
expressing CLOCK shRNA with reconstituted expression of Flag-rCLOCK
proteins were treated with or without IGF1 for 1 h.
Article
Extended Data Fig. 3 | CLOCK acetylates PRPS1/2 K29. (d, j, m)
Immunoprecipitation and immunoblotting with the indicated antibodies was
performed. All experiments were repeated at least twice independently. (a)
Huh7 cells with or without expression of Flag–CLOCK were treated with or
without IGF1 for 1 h. The immunoprecipitated Flag–CLOCK was eluted with
Flag peptide and stained with Coomassie Brilliant Blue after SDS-PAGE. Mass
spectrometry-identified protein peptide hits are shown. (b) Purified GST–CLOCK
was incubated with or without His-CK2α and TBB for an in vitro kinase assay,
followed by incubation with or without the indicated His-PRPS1/2 proteins in
the presence of acetyl-CoA. Mass-spectrometric analysis was performed. (c)
Alignment of protein sequences spanning PRPS1/2 K29 from different species.
(d, e) Huh7 cells expressing Flag-PRPS1 were treated with or without IGF1 for
1 h (d). Immunoblotting analyses (d) or IHC analyses of human HCC samples (e)
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
were performed with the indicated antibodies and a PRPS1/2 K29 acetylation-
blocking peptide. (f-j) Genomic DNA was extracted from two individual clones
of the indicated cells with knock-in expression of PRPS1/2 K29R. PCR products
amplified from the indicated DNA fragments were shown (f, g) and sequenced
(h, i). The red line indicates the sgRNA-targeting sequence. The black line
indicates the PAM. Blue arrows indicate mutated nucleotides. A mutated amino
acid and its WT counterpart are indicated by the solid red box (h, i). These cells
were transfected with or without constitutively active IGF1R-CA ( j). (k) Purified
GST–CLOCK were incubated with or without His-CK2α for an in vitro kinase assay,
followed by incubation with or without the indicated His-PRPS1/2 proteins in the
presence of acetyl-CoA. (l, m) Huh7 (l, m) and Hep3B (l) cells expressing CLOCK
shRNA with reconstituted expression of the indicated CLOCK proteins were
harvested or (l) treated with or without IGF1 for 1 h (m).
Article
Extended Data Fig. 4 | Cytosolic CLOCK promotes PRPS1/2 stabilization.
(a, d-h, j, k, l, o) Immunoprecipitation and immunoblotting with the indicated
antibodies was performed. All experiments were repeated three times
independently. (a) The indicated cells were stably transfected with active
IGF1R-CA. (b, c) Huh7 cells stimulated with IGF1 for the indicated time (b) or
expressing IGF1R-CA (c) were harvested. The mRNA expression levels of the
PRPS1/2 genes were measured using qPCR (n = 6). Data are the mean ± SD. N.S.,
not significant by One-way ANOVA post hoc test (b) or two-tailed Student’s t
test (c). (d-g) The indicated cells expressing CLOCK shRNA and active IGF1R-CA
with reconstituted expression of the indicated CLOCK protein were treated with
CHX for the indicated time (d, f). The quantification of PRPS1/2 levels is shown.
Data are the mean ± SD, n = 6, **P < 0.001; ***P < 0.0001 by One-way ANOVA post
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
hoc test (e, g). (h) The indicated cells were treated with DMSO, MG132 (10 μM),
PS341 (10 μM), CQ (25 μM) or bafilomycin A1 (BFA) (10 nM) for 8 h. (i) Alignment
of protein sequences spanning PRPS1/2 K29 and the adjacent HSC70 recognized
motif from different species. ( j) LAMP2A shRNA was expressed in the indicated
cells. (k-n) Huh7 cells expressing PRPS1/2 shRNA with reconstituted expression
of the indicated PRPS1/2 proteins were harvested for immunoblotting (k, l) or
qPCR (n = 6) to measure Prps1/2 mRNA levels (m, n). Data are the mean ± SD.
N.S., not significant by One-way ANOVA post hoc test. (o) Endogenous CLOCK-
depleted Huh7 cells with reconstituted expression of the indicated CLOCK
protein were transfected with HA-PRPS1/2 and treated with or without IGF1 for
1 h. Immunoprecipitation using limited amount of HA antibody was performed.
Article https://doi.org/10.1038/s41556-022-01061-0

Extended Data Fig. 5 | See next page for caption.

Nature Cell Biology

Article
Extended Data Fig. 5 | CLOCK-mediated PRPS1/2 stabilization promotes de
novo nucleotide synthesis. (g-l) Immunoprecipitation and immunoblotting
with the indicated antibodies was performed. All experiments were repeated
at least twice independently. (a-g) Data are the mean ± SD, n = 6, *P < 0.01;
**P < 0.001; ***P < 0.0001; N.S., not significant by One-way ANOVA post hoc test.
(a-f) The indicated cells expressing CLOCK shRNA with reconstituted expression
of the indicated CLOCK proteins (a, b, e) or the indicated clones with knock-in
expression of PRPS1/2 K29R (c, d, f) were transfected with or without active
IGF1R-CA, followed by labeling with D-[6-14C] glucose for 30 min. The amounts of
14
C-RNA (a, c) and 14C-DNA (b, d) were measured. The 13C-labeled PRPP, IMP, AMP,
GMP, UMP, and CMP were measured by LC/MS-MS (e, f). (g) Purified GST–CLOCK
was incubated with or without His-CK2α in the presence of ATP for an in vitro
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
kinase assay, followed by incubation with or without the indicated His-PRPS1/2
proteins in the presence of acetyl-CoA. The PRPS1/2 activity was measured. (h,
i) Huh7 cells expressing CLOCK shRNA with reconstituted expression of the
indicated Flag-rCLOCK were serum-starved for 12 h in the presence of CQ and
then treated with or without EGF (h) or FGF1 (i) for 1 h. Cytosolic and whole
cell lysates were harvested. ( j) Huh7 cells were stimulated with EGF (100 ng/
ml) or FGF1 (25 ng/ml) for the indicated time. (k) Huh7 cells stably transfected
with constitutively active EGFR-vIII or FGFR1-CA were harvested. (l) Huh7 cells
expressing CLOCK shRNA and constitutively active EGFR-vIII or FGFR1-CA with
reconstituted expression of the indicated Flag-rCLOCK were treated with CHX
for the indicated time. The quantification of PRPS1/2 protein levels is shown. Data
are the mean ± SD, **P < 0.001 by One-way ANOVA post hoc test.
Article https://doi.org/10.1038/s41556-022-01061-0

Extended Data Fig. 6 | See next page for caption.

Nature Cell Biology

Article
Extended Data Fig. 6 | Overexpressed CK2α in HCC cells is critical for
CLOCK-enhanced PRPS1/2 stability. (a, b, d-l) Immunoprecipitation and
immunoblotting with the indicated antibodies was performed. All experiments
were repeated three times independently. (c, d, g, i) Data are the mean ± SD.
n = 6, *P < 0.01; **P < 0.001; ***P < 0.0001 by One-way ANOVA post hoc test. (a, b)
The indicated cells expressing CLOCK shRNA with reconstituted expression of
the indicated shRNA-resistant CLOCK were constructed (a) and serum-starved
for 12 h in the presence of CQ before treatment with or without IGF1 for 1 h (b).
Cytosolic and whole cell lysates were harvested. (c) The indicated cells with
reconstituted expression of the indicated CLOCK proteins were treated with
or without IGF1 for 12 h, followed by labeling with D-[6-14C] glucose for 30 min.
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
The amounts of 14C-RNA and 14C-DNA were measured. (d) The indicated cells
expressing CLOCK shRNA and IGF1R-CA with reconstituted expression of Flag-
rCLOCK were treated with CHX for the indicated time. The quantification of
PRPS1/2 levels is shown. (e, f) The indicated cells were treated with or without
IGF1 for 1 h. Whole cell lysates were harvested. (g) L02 cells transfected with the
indicated plasmids were treated with CHX for the indicated time in the presence
or absence of IGF1. The quantification of PRPS1/2 levels is shown. (h) Huh7 cells
transfected with the indicated shRNA were treated with or without IGF1 for 1 h. (i)
Huh7 cells transfected with the indicated shRNA were treated with CHX for the
indicated time in the presence or absence of IGF1. The quantification of PRPS1/2
levels is shown.
Article
Extended Data Fig. 7 | Both nuclear transcriptional activity and cytosolic
function of CLOCK contribute to HCC cell proliferation. (a, d, e, i, j, l, m)
Immunoprecipitation and immunoblotting with the indicated antibodies was
performed. All experiments were repeated at least twice independently. (a-c,
e-g, h, j, k, n) Data are the mean ± SD. *P < 0.01; **P < 0.001; ***P < 0.0001 by One-
way ANOVA post hoc test. (a-c) The indicated cells stably transfected with the
indicated plasmids and shRNA were constructed (a) and transiently expressed
a Per1-driven luciferase reporter before IGF1 treatment for 12 h. The luciferase
activity is shown (n = 6). The mRNA levels of CLOCK-downstream target genes
were measured using qPCR (n = 6) (c). Cytosolic and whole cell lysates from Huh7
cells were harvested (d). (e) Huh7 cells transfected with the indicated plasmids
and shRNA were treated with CHX. PRPS1/2 protein was quantified (n = 6). (f,
g) The indicated cells transfected with the indicated plasmids and shRNA were
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
labeled with D-[6-14C] glucose. The amounts of 14C-RNA (f) and 14C-DNA (g) were
measured (n = 6). (h) The indicated cells transfected with the indicated plasmids
and shRNA were plated in complete culture medium and counted (n = 6). (i)
Huh7 cells were pretreated with or without different dose of Sorafenib for
30 min before IGF1 treatment for 1 h. ( j, k) The indicated cells expressing CLOCK
shRNA and active IGF1R-CA with reconstituted expression of Flag-rCLOCK WT or
S106D were treated with CHX ( j) or without CHX (k) in the presence or absence
of Sorafenib for the indicted time. PRPS1/2 protein quantification ( j) and cell
counting (k) were performed (n = 6). (l-n) The indicated cells with reconstituted
expression of Flag-rCLOCK WT or S106D were harvested (l) or treated with CHX
(m) or without CHX (n) for the indicated time. PRPS1/2 protein quantification (m)
and cell counting (n) were performed (n = 6).
Article
Extended Data Fig. 8 | CLOCK-mediated PRPS1/2 stabilization promotes
HCC cell proliferation and liver tumor growth. (a, b) Huh7 cells (1 × 106)
expressing CLOCK shRNA with reconstituted expression of the indicated CLOCK
proteins (a) expressing WT PRPS1/2 or PRPS1/2 K29R knock-in mutants (b)
were subcutaneously injected into athymic nude mice (n = 6 per group). The
mice were euthanized and examined for tumor growth 28 days after injection.
Tumor volumes were calculated, and the tumors were weighed. Data are the
mean ± SD, n = 7, *P < 0.01; **P < 0.001 by One-way ANOVA post hoc test. (c, d)
IHC analyses of the indicated tumor samples were performed with an anti-Ki67
antibody. Ki67-positive cells were quantified. Data are the mean ± SD, n = 10,
***P < 0.0001 by One-way ANOVA post hoc test. (e, f) TUNEL analyses of the
indicated tumor samples were performed (upper). Apoptotic cells were stained
Nature Cell Biology
https://doi.org/10.1038/s41556-022-01061-0
brown and quantified in n = 10 microscopic fields (lower). Data are the mean ± SD,
***P < 0.0001 by One-way ANOVA post hoc test. (g) Huh7 cells (1 × 106) expressing
CLOCK shRNA with reconstituted expression of the indicated CLOCK proteins
were intrahepatically injected into athymic nude mice (n = 6 per group). The mice
were euthanized and examined for tumor growth 22 days after injection. The
arrows indicate tumors (left). The tumor volumes were measured (right). Data are
the mean ± SD, n = 6, *P < 0.01 by two-tailed Student’s t test. (h) Huh7 cells (1 × 106)
expressing CLOCK shRNA with reconstituted expression of the indicated CLOCK
proteins were subcutaneously injected into athymic nude mice (n = 7 per group).
The resulting tumors were resected 22 days after injection (left). The growth of
xenografted tumors in the mice was measured (middle) and the tumors were
weighed (right). Data are the mean ± SD, **P < 0.001 by two-tailed Student’s t test.
 α

α α
α