Bioorganic Chemistry 117 (2021) 105412

Contents lists available at ScienceDirect

Bioorganic Chemistry
journal homepage: www.elsevier.com/locate/bioorg

Hepatoprotective, antioxidant and anti-inflammatory potentials of Vit-E/

C@SeNPs in rats: Synthesis, characterization, biochemical,
radio-biodistribution, molecular and histopathological studies
Safa A. Aljuhr a, Gamal Abdelaziz b, Basma M. Essa c, Wafaa A. Zaghary a, Tamer M. Sakr c, *
a
Pharmaceutical Chemistry Department, Faculty of Pharmacy, Helwan University, Cairo, Egypt
b
Labeled Compounds Department, Hot Laboratories Center, Egyptian Atomic Energy Authority, 13759 Cairo, Egypt
c
Radioactive Isotopes and Generators Department, Hot Laboratories Center, Egyptian Atomic Energy Authority, 13759 Cairo, Egypt

A R T I C L E I N F O A B S T R A C T

Keyword: This study aimed to synthesize a nano-structure between selenium, Vit. C, and Vit. E (Vit-E/C@SeNPs) as a
Selenium nanoparticles promising protective and therapeutic agent for hepatocellular carcinoma. Vit-E/C@SeNPs were characterized
Hepatocellular carcinoma using TEM and DLS and its zetapotential was measured to evaluate its stability. DPPH assay and SRB test were
Vit. A
performed to estimate its antioxidant capacity and cytotoxicity, respectively. A radiosynthesis of 99mTc-Vit-E/
Vit. C
Anti-oxidant
C@SeNPs was done for further in-vivo pharmacokinetic studies on normal and solid tumor induced mice. Further,
Anti-inflammatory in-vivo studies were conducted to investigate Vit-E/C@SeNPs efficacy against hepatocellular damage in Wistar
albino rats induced by diethylnitrosamine (DEN) / Carbon Tetra chloride (CCl4). The synthesis results showed
spherical Vit-E/C@SeNPs with core size of 50 nm, radical scavenging activity (%RSC) of 75.9%, and IC50 of 27.9
µg/ml. The biochemical analysis results showed that the lower liver function biomarker values (ALT, AST, ALP,
total bilirubin and GGT) has gone for the Vit-E/C@SeNPs prevention and treated group, which also showed
significant depletion of liver tissue L-MDA, and obvious increase in GSH concentration and CAT activity and
marked improvement in the histological feature of liver tissue. Additionally, a significant up-regulation of mRNA
gene expression levels of inflammatory gene (TGFβ1, NFκB, iNOS, PPAR-γ and TNFα) and Apoptotic gene (P53)
were determined by using Quantitative real-time PCR (qPCR). The values down regulate and tend to normal in
prevention and control group. All of these introduce Vit-E/C@SeNPs as a promising agent as protective and
therapeutic agent against DEN/ CCl4-induced hepatocellular damage (Hepatocellular carcinoma).

1. Introduction biotechnology and pharmaceutical fields [1]. “Nanoparticles” is a term

given to the materials in nanometer scale, which their size ranges from 1
Nanotechnology has become an innovative tool by introducing a nm to 100 nm. Nanoparticles have impact in many medical applications
huge difference in many fields such as engineering, medical, like drug delivery, targeted therapy, detection, and diagnosis due to

Abbreviations: AlP, Alkaline phosphatase; AFP, Alpha fetoprotein; AST, Aspartate aminotransferase; ALT, Alanine aminotransferase; BVs, Blood vessels; CAT,
Catalase; DEN, Nitrosodiethylamine; DPPH, 2,2-diphenyl-1-picryl-hydrazyl-hydrate; EDTA, Ethylenediamine tetraacetic acid; GSH, Glutathione; H&E stain, He­
matoxylin and eosin stain; HCC, Hepatocellular carcinoma; iNOS, Inducible nitric oxide synthase; L-MDA, L-malondialdehyde; LDH, Lactate dehydrogenase; NAFLD,
Non-alcoholic fatty liver disease; PCS, Photo correlation spectrometer; PET, Positron emission tomography; qPCR, Quantitative real-time polymerase chain reaction;
RSC, Radical scavenging activity; SRB, Sulforhodamine B; TCA, Trichloroacetic; TGFβ1, Transforming growth factor beta 1; TXNRDs, Thioredoxin reductases; AFB,
Aflatoxin B1; AKT, AK strain transforming; Alb, Albumin; ANOVA, One-way analysis of variance; CBC, Complete Blood Count; DMRT, Duncan’s multiple range test;
DLS, Dynamic light scattering; EPR, Enhanced permeability and retention; GPXs, Glutathione peroxidases; GST, Glutathione-S-Transferase; HR-TEM, High Resolution
Transmission Electron Microscopy; ID/g, Injected dose per gram organ; JNK, Jun N-terminal kinase; LPO, Lipid peroxide; NFκB, Nuclear factor kappa light chain
enhancer of activated B cells; NASH, Nonalcoholic steatohepatitis; PBS, Phosphate buffered saline; PPAR-γ, Peroxisome proliferator- activated receptor gamma; ROS,
Reactive oxygen species; SeNPs, Selenium nanoparticles; SPECT, Single photon emission-computed tomography; TAA, Thioacetic acid; TNFα, Tumor necrosis factor
alpha; γ-GT, γ-glutamyltransferase.
* Corresponding author.
E-mail address: Tamer_sakr78@yahoo.com (T.M. Sakr).

https://doi.org/10.1016/j.bioorg.2021.105412
Received 17 September 2021; Accepted 5 October 2021
Available online 8 October 2021
0045-2068/© 2021 Elsevier Inc. All rights reserved.
S.A. Aljuhr et al.
Fig. 1. Chemical structure of Vit. C and Vit. E.
Fig. 2. Vit-E/C@SeNPs solution.
their small size and large surface area that boost their penetration to
most tissue [2,3]. The impact of nanoparticles stems from merging them
with targeting biomolecules like monoclonal antibodies, peptides, and
polysaccharides [4–6] or in imaging agents like positron emission to­
mography (PET) and single photon emission-computed tomography
(SPECT) [7–9].
Selenium element is considered as one of the most antioxidant diet
supplements as it fights intensively against cellular damage and so
prevents cancers [10,11]. Antioxidant effect of selenium is stemmed
from scavenging free radicals such as reactive oxygen species (ROS) [12]
and it is also incorporated into about most of selenoproteins, as naturally
form (selenocysteine), like glutathione peroxidases (GPXs), thioredoxin
reductases (TXNRDs) [13]. Selenium is the key against oxidative stress
as it regenerates and activates low molecular weight antioxidants (Q10,
Vitamin C and E etc.) [14]. Selenium nanoparticles (SeNPs) is a new
platform as it maximizes the biological activity of selenium with
lowering its toxicity, so it is incorporated into different therapeutic ap­
proaches like anti-inflammatory action and anticancer [15–18]. SeNPs
can get over the extracellular and intracellular barriers as size plays an
important role of cellular process of nanoparticles. Selenium in nano
form provides better in-vivo bioavailability, biocompatibility, and de­
gradability than other selenium forms as selenite (SeO3− 2), selenate
(SeO4− 2), and organo-selenium compounds [19].
Vitamin C (L-Ascorbic acid) (Fig. 1) is one of the most potent anti­
oxidants in human. Vitamin C is a six-carbon lactone that is not syn­
thesized in human due to lack of gluconolactone oxidase, which is
essential for ascorbic acid synthesis [20]. Vitamin C is called radical
2
Bioorganic Chemistry 117 (2021) 105412
scavenging or quenching as it’s an electron donor that is the main reason
behind its all physiological and biochemical functions [21]. After
donating electrons, it prevents other compounds from oxidation and
prevent many diseases such as cancer and atherosclerosis [22]. Vitamin
E (tocopherol) (Fig. 1) is a lipid-soluble vitamin. It consists of a group of
eight tocopherols, but the most active form of vitamin E is alpha
tocopherol according to animal growth assay results [23]. The skeleton
of vitamin E consists of two rings (chromanol skeleton) and have a side
chain containing three isoprene units (15 carbon atoms). Vitamin E is
chain breaking antioxidant [24]. It prevents oxidation of macromole­
cules by scavenging of ROS like lipid peroxyl radicals and it terminates
free radical chain reactions [23]. Vitamin E has a potent function in
improving immune system, stress, and disease resistance [25]. After
reaction of vitamin E with ROS, tocopheroxy radical is formed, which is
reduced back to vitamin E by ubiquinol, glutathione or by vitamin C
[26].
Hepatocellular carcinoma (HCC) is primary liver cancers, which
represents an increasing challenge for physician due to its incremental
numbers of morbidity and mortality [27]. The main causes of HCC are
HCV, HBV infections and alcohol-induced liver injury [27]. Lower
frequent causes occur due to some autoimmune and metabolic diseases
such as non-alcoholic fatty liver disease (NAFLD) and nonalcoholic
steatohepatitis (NASH), other rarer cause of HCCis represented by
Aflatoxin B1 (AFB) that is predominant in Asian and African countries
[28,29]. Chemicals can cause damage to the liver and induce progres­
sion and development of tumors. Two main types of compounds that can
induce carcinogenesis, (i) compounds that induce directly tumor for­
mation (genotoxic agents) (ii) compounds that enhance tumor formation
if taken with genotoxic agents (promoting agents) [27,30]. When tumor-
promoting agents are administered, they facilitate the clonal expansion
of the preneoplastic cells that directly increase tumor development and
tumor aggressiveness. Chemical induction model of tumor is superior
over other induction models as it’s very similar to the injur­
y–fibrosis–malignancy cycle seen in humans. HCC can be developed
after administration N, nitrosodiethylamine (DEN) to rat [31]. DEN
exerts its carcinogenicity in 2 different mechanisms: (i) DNA alkylation
causing DNA damage followed by cell degeneration and (ii) activation of
hepatocytes cytochrome P450 that induce ROS formation. A single dose
administration of DEN induces tumor in 80% of cases in 15-day-old
mice, that is increased to 100% with long term administration of DEN.
Oxidative stress considers an important branch to be measured in case of
tissue injury or regeneration. Many parameters can be measured such
Catalase (CAT), L-malondialdehyde (L-MDA) and glutathione-S-
Transferase (GST) [32]. CAT consider a key enzyme in hydrogen
peroxide (H2O2) and reactive nitrogen species metabolism [32].
This study describes synthesis of ascorbic acid coated selenium with
vitamin E complex (Vit-E/C@SeNPs) and evaluates its hepatoprotective,
antioxidant and anti-inflammatory potentials.
2. Experimental
2.1. Chemicals and instrumentations
Sodium selenite (Na2SeO3, M.W. = 172.94 g/mole), Purity ≥ 98%,
Sigma Aldrich, ST. Louis, MO., USA. L-ascorbic acid (M.W. = 176.12 g/
S.A. Aljuhr et al.
mole), (Alpha Chemika, Andheri, Maharashtra, India). Vitamin E
(C31H52O3, M.W. = 472.76 g/mole), (Lobachemie, Mumbai, India).
Dimethyl sulfoxide (DMSO), Acetonitrile, DEN and all other chemicals
used in this experiment were purchased from Sigma Chemicals Co. (St.
Louis, MO, USA). All kits used for Liver function assessment purchased
from well-known brands manufactured in USA and specific for
biomarker evaluations in Rats. Whatman No.1 paper chromatography
was purchased from Whatman International Ltd (Maidstone, Kent, UK).
Technetium-99 m was obtained from 99Mo/99mTc generator - Radio­
isotopes Production facility (RPF), Egyptian Atomic Energy Authority
(EAEA). All aqueous solutions were prepared in bidistilled water. High
Resolution Transmission Electron Microscopy (HR TEM, Ted Pella,
Redding, CA, USA), dynamic light scattering (DLS, Brookhaven In­
struments Corp. (BIC), USA) and photo correlation spectrometer (PCS,
Zetasizer Nano™, Beckman Coulter, Miami, FL, USA) were used for
SeNPs characterization. NaI (Tl) γ-ray scintillation counter (SPECTECH,
ST450 SCA, USA) for measuring radioactivity
2.2. Synthesis of Vit-E/C@SeNPs
SeNPs coated with vitamin C and vitamin E were prepared in two
steps. Firstly, ascorbic acid coated selenium nanoparticles were pre­
pared by a chemical reduction method, by adding 2 ml of vitamin C
solution (4 mg/ml H2O) to 2 ml of 5 mM Na2SeO3 in a dry clean vial
[33]. Secondly, 2 ml of vitamin E solution (0.5 ml/20 ml acetonitrile)
was mixed with stirring to the previous solution and the mixture was
stand for 30 min then its color is turned into orange red, which is the
color of Vit-E/C@SeNPs, (Fig. 2).
2.3. Characterization of Vit-E/C@SeNPs
Vit-E/C@SeNPs was characterized using High Resolution Trans­
mission Electron Microscopy (HR-TEM) for particle size and shape
detection, dynamic light scattering (DLS) for hydrodynamic diameter
detection, Photo correlation spectrometer (PCS) for zetapotential (sur­
face charge) determination and UV–visible spectroscopy for determi­
nation of its optical properties.
2.4. Antioxidant capacity determination (DPPH assay) of Vit-E/
C@SeNPs
2,2-diphenyl-1-picryl-hydrazyl-hydrate (DPPH) assay had been per­
formed to determine the scavenging capacity of selenium, Vit. C, Vit. E
and Vit-E/C@SeNPs to investigate whether Vit-E/C@SeNPs would show
a high or low antioxidant capacity compared with its components
separately at the same concentration (1 mg/mL). DPPH assay result was
represented as percentages of radical scavenging activity (%RSC). 4 ml
DPPH solution (0.1 mM DPPH in ethanol) was used as control sample.
The test sample was 0.2 ml sample – at 1 mg/mL concentration - added
to 3.8 ml DPPH solution (0.1 mM DPPH in ethanol). Samples were then
kept for 30 min in darkness at room temperature and their absorbance
were evaluated at 517 nm by U.V. spectrophotometer [33–35]. The
percentages of RSC were determined using the following equation:
Ao − A1
%RSC = × 100
Ao
where Aο: the absorbance of the control sample and A1: the absorbance
of the test sample.
2.5. In-vitro cytotoxicity study
Cell viability analysis (Sulforhodamine B (SRB)) was applied on
Normal human Lung fibroblast cells (MRC-5) was obtained from the
American Type Culture Collection (ATCC, Rockville, MD). Aliquots of
cells at a density of 5 × 103 were incubated in 96-well plates for 24 h.
3
Bioorganic Chemistry 117 (2021) 105412
Cells were treated with different concentrations of nanoparticles of Vit-
E/C@SeNPs (0.01, 0.1, 1, 10, 100 μg/ml). After 72 h of drug exposure,
cells were fixed by 150 μl of 10% trichloroacetic (TCA) and incubated for
1 h at 4◦ C After that, the cells were washed 5 times with distilled water
after removing the TCA solution. Aliquots of 70 μl of SRB (0.4% w/v)
were incubated for 10 mins in a dark place at room temperature. Plates
were washed using 1% acetic acid and allowed for dryness overnight.
Protein-bound SRB stain was dissolved by adding 150 μl (10 mM) of tris
and the absorbance was measured at 540 nm using a BMG LABTECH-
The FLUOstar® Omega microplate reader (Ortenberg- Germany).
2.6. Radiosynthesis of 99m
Tc-Vit-E/C@SeNPs complex
At room temperature (25 ◦ C), in a clean and dry vial, 1 μg of Sn (II)
were added and then 100 μl of fresh elute 99mTc as Na99mTcO4 in saline
with about 200 MBq activity were added, then 0.5 ml Vit-E/C@SeNPs
was added. Components were then mixed well and left for 30 min.
The same steps were run with varying Sn (II) amounts (0.5–3 µg),
varying Vit-E/C@SeNPs volumes (0.25–1.5 ml), different reaction time
(5–360 mins), and different pH values (3–8) to obtain the optimum
conditions to boost and maximize the radiosynthesis yield.
The radiosynthesis yield percentage of 99mTc-Vit-E/C@SeNPs com­
plex was determined by ascending paper chromatographic technique.
Strips of Whatman No.1 (13 cm × 1 cm) were marked at 2 cm from the
lower end and lined into sections 1 cm each up to 10 cm. One drop from
99m
Tc-Vit-E/C@SeNPs was spotted using hypodermic syringe and the
strip was ascendingly developed using acetone as a developing solvent
for one strip and water: ethanol: ammonia mixture (5:2:1) as a devel­
oping solvent for the second strip [36,37]. After full development, the
paper strips were dried, cut into fragments and their radioactivities were
counted by NaI (Tl) γ-ray scintillation counter [36–38].
2.7. In-vivo pharmacokinetic study of 99m
Tc-Vit-E/C@SeNPs complex
The study was carried out according to the approved protocol by the
animal ethics committee of the Egyptian Atomic Energy Authority
(EAEA), where the European Community guidelines principles for the
use of experimental animals were followed [39,40]. Biodistribution
studies of Vit-E/C@SeNPs in normal Swiss Albino mice of bodyweight
20–25 g (n = 5) were carried out at 10, 30-, 60-, 120-, and 180-min post-
injection. Exactly 100 µl of 99mTc-E/C@SeNPs complex was injected into
each mouse tail vein. The mice were anesthetized and weighed at their
proper time. All organs were rapidly harvested, rinsed, and weighed
then the radioactivity was measured using a well-type γ-counter. Bone
muscles and blood were assumed to be 10, 40, and 7 % of the total body
weight, respectively [41]. The radioactivity of each sample was counted
in a NaI(Tl) γ-ray scintillation counter. The percent of the injected dose
per gram (% ID/g) in a population of five mice for each time point was
calculated.
2.8. In-vivo application of Vit-E/C@SeNPs
2.8.1. Animals and experimental design
Twenty-five male Wistar Albino rats were used for this experiment.
Rats were purchased from the animal house of the Faculty of Pharmacy,
Ain-Shams University, Cairo, Egypt that were 6-week-old and with an
average body weight of 160 ± 10 g. The rats were acclimatized for 7
days before the onset of the experiment. Animals were maintained in a
good ventilation place, 12 h light/dark cycle, and temperature adjusted
at 25 ℃. The animal experimental protocols were approved by the
Animal Care and Use Committee Faculty of Pharmacy – Ain Shams
University. The rats were divided separately into a control group and
four experimental groups (5 rats per group). Animals were kept in in­
dividual metal cages, and fresh and clean drinking water was supplied
ad-libitum.
S.A. Aljuhr et al. Bioorganic Chemistry 117 (2021) 105412

Table 1 time of sacrifice in serum tubes (red capped vacutainer) that were
Forward and reverse primers sequence for primers used in q-Real Time PCR. centrifuged for 10 min at 4000 rpm to obtain serum. The serum levels of
Gene Forward primer Reverse primer the liver injury biomarkers (AST, ALT, ALP, Alb, total bilirubin, and
(/5 ———— /3) (/5 ———— /3) GGT) were measured using spectrometric based kits.
TNFα GCATGATCCGCGACGTGGAA AGATCCATGCCGTTGGCCAG
NFκB CCTAGCTTTCTCTGAACTGCAAA GGGTCAGAGGCCAATAGAGA 2.8.4. Evaluation of liver lipid peroxidation and antioxidant biomarkers
TGFβ1 AAGAAGTCACCCGCGTGCTA TGTGTGATGTCTTTGGTTTTGTCA Liver homogenates were prepared using cold phosphate buffer saline
PPARγ GCCAAGAACATCCCCAACTTC GCAAAGATGGCCTCATGCA (PBS) , followed by centrifugation at 10000 rpm for 20 min at 4 ◦ C [32].
P53 ATGGCTTCCACCTGGGCTTC TGACCCACAACTGCACAGGGC
iNOS CACCACCCTCCTTGTTCAAC CAATCCACAACTCGCTCCAA
The supernatants were used to measure the levels of lipid peroxidation
β-actin AAGTCCCTCACCCTCCCAAAAG AAGCAATGCTGTCACCTTCCC marker MDA and GST as well as the activity CAT were determined in
liver homogenates using commercially available kits (Biodiagnostics,
Egypt).
• Group I (Control Normal group): Rats received no drugs, served as
control non-treated for all experimental groups. 2.8.5. Molecular analysis by Real-Time PCR
• Group II (Vit-E/C@SeNPs supplement): Rats received weekly dose of Quantitative and relative expression of inflammation related genes
Vit-E/C@SeNPs for 16 successive weeks. (Transforming growth factor beta 1(TGFβ1), nuclear factor kappa light
• Group III (Liver damage induction group): Rats received weekly chain enhancer of activated B cells (NFκB), Inducible nitric oxide syn­
doses of DEN (10 ul/kg/rat) for the first four weeks from beginning thase (iNOS), Peroxisome proliferator- activated receptor gamma
of the experiment by IP route, and the rest of 16 weeks injected by (PPAR-γ), and Tumor necrosis factor alpha (TNFα)) and Apoptotic gene
weekly dose of CCl4 (300 ul/ rat), where feeding daily water contains (P53) were determined by using Quantitative real-time polymerase
thioacetic acid (TAA) as a third agent for inflammation and cancer chain reaction (qPCR). Total RNA was isolated from liver tissues using a
induction agent. CCl4 re-dissolved in Corn oil with ratio of 1:1 commercially available kit (GeneJET RNA Purification Kit, Thermo
[42,43]. Scientific, #K0731, USA) according to the manufacturer’s protocol.
• Group ІV (Prevention group): Rats received weekly dose of Vit-E/ Then all extracted RNA samples have been quantified by a Nanodrop
C@SeNPs in parallel with the induction protocol of group III. spectrophotometer (Quawell, USA). While reverse transcription of RNA
• Group V (Treatment group): In this group, firstly the liver injury was into cDNA has been achieved using RevertAid H Minus Reverse Tran­
induced to produce cancer as in protocol of group III, then after 9 scriptase containing kit (Thermo Scientific, #EP0451, USA). In 0.2 ml
weeks from the experiment beginning, the induction agent was PCR tube, a qPCR reaction with a total volume of 20 µl was done, con­
stopped then treatment course with Vit-E/C@SeNPs for three suc­ taining cDNA, QuantiTect SYBR Green qPCR Master Mix and specific
cessive weeks with a dose every week was conducted. primers designed by online software (Primer 3) a web-based tool
(Table 1). Reaction placed in StepOnePlus qPCR thermal cycler (Applied
2.8.2. Sampling Biosystem, USA), with thermal conditions including one cycle of initial
After the 16th week from the beginning of the experiment, all groups denaturation at 94 ◦ C for 4 min, followed by 40 cycles of amplification
have been sacrificing and lobe of liver tissue collected for histological each cycle contained denaturation at 94 ◦ C for 40 s, annealing at 60 ◦ C
investigation in 10% formalin. Another lobe was preserved in ice for for 30 s, and extension at 72 ◦ C for 30 s. β actin gene was used as an
immediate tissue biochemical analysis, mRNA isolation and first strand internal control [44,45].
cDNA formation for molecular study of related gene expression. On the
other hand, Blood samples were collected in two kinds of tube, one 2.8.6. Histopathological study
contains Ethylenediamine tetra acetic acid (EDTA) drops for doing Dissected liver samples from all 5 groups of rats were subjected to
Complete Blood Count (CBC), while the other tube is plain for serum histological examination, specimens were trimmed and fixed for 72 h in
isolation and measuring the liver function parameters alpha fetoprotein 10% neutral buffered formalin. Then samples were processed in serial
(AFP), aspartate aminotransferase (AST), alanine aminotransferase grades of ethyl alcohol, cleared in xylene, infiltrated with Paraplast
(ALT), alkaline phosphatase (AlP), Albumin (Alb), γ-glutamyltransferase synthetic wax, lastly, embedded in tissue blocks. Four-micrometer-thick
(GGT), and Total Bilirubin. tissue sections has been cut from each sample by rotatory microtome
and then mounted on glass slides. Next, tissues sections have been
2.8.3. Evaluation of serum biochemical parameters stained by hematoxylin and eosin (H&E stain), which considered a
Standard protocol was conducted for blood samples collection at the

Fig. 3. Characterization of Vit-E/C@SeNPs: a- UV/Visible absorption spectrum, b- TEM image, c- DLS hydrodynamic diameter.

4
S.A. Aljuhr et al. Bioorganic Chemistry 117 (2021) 105412

general staining procedure for histological evaluation. All methods of

tissue samples were processed and stained as outlined by [46]. Tissues
sections suffered blinded microscopic examination, while abnormal
tissues alterations records were scored according to [47] as follows:
Nil : No abnormal cellular alterations were demonstrated

þ : Few lesions were focally demonstrated in the 1–3 examined samples

þþ : Mild lesions were focally demonstrated in the 4–6 examined samples
þþþ : Moderate lesions were diffusely recorded in the 4–6 examined samples
þþþþ : Severe lesions were diffusely recorded in all the examined samples

2.9. Statistical analysis

Fig. 4. Antioxidant activity (RSC%) of Na2SeO3, Vit. C, Vit. E, and Vit-E/
C@SeNPs, all at concentration of 1 mg/ml.
All the data were expressed as means ± S.E. The statistical signifi­
cance was evaluated by one-way analysis of variance (ANOVA) using
SPSS, 18.0 software, 2011 and the individual comparisons were ob­
tained by Duncan’s multiple range test (DMRT). Values were considered
statistically significant when p < 0.05.

3. Results and discussion

3.1. Synthesis and characterization of Vit-E/C@SeNPs

Selenium, Vit. C and Vit. E are well-known potential antioxidants.

Vit. C was used to reduce selenium ions to selenium particles. Vit. E was
used as stabilizing agent as it played a crucial role in controlling the
particle sizes of formed SeNPs via preventing selenium particles aggre­
gation and coating them [48]. Vit. C and Vit. E could also contribute to
lower the cytotoxicity profile of SeNPs by enhancing their execration in-
vivo [49].
Fig. 5. Cell cytotoxicity of Vit-E/C@SeNPs incubated with MRC-5 cells.
(Fig. 3a) displayed the UV–visible absorption spectrum of Vit-E/
C@SeNPs that showed a clear peak at 264 which confirms the forma­
tion of Vit-E/C@SeNPs, which has orange red color. Two techniques are

99m
Fig. 6. Radiosynthesis yield of Tc-Vit-E/C@SeNPs complex as a function of; a- Sn (II) amount, b- Vit-E/C@SeNPs, c- pH and d- reaction time.

5
S.A. Aljuhr et al. Bioorganic Chemistry 117 (2021) 105412

Fig. 7. Biodistribution of Vit-E/C@SeNPs in normal mice at different time intervals via intravenous injection; I.V. in tail vein (Data represented as % ID/g).

Table 2
Results of biochemical markers of liver for all groups were compared to each other; (G1) Control group; (G2) Vit-E/C@SeNPs only; (G3) DEN/CCl4 Hepatocellular
Damage group; (G4) Prevention group; (G5) Treatment group.
Parameter Group 1 Group 2 Group 3 Group 4 Group 5

Control Vit-E/C@SeNPs DEN/CCl4 Hepatocellular DEN/CCl4 Vit-E/C@SeNPs DEN/CCl4 Vit-E/C@SeNPs

Only damage Preventive Treatment

ALT (U/L) 56 ± 1.5 60 ± 3.4 232.5 ± 20.1 72 ± 4.8 80 ± 5.3

AST (U/L) 15.0 ± 1.8 20.7 ± 2.1 63.5 ± 8.5 23.0 ± 5.8 32.2 ± 4.5
ALP (U/L) 110.0 ± 2.0 122.5 ± 11.1 262.5 ± 45.5 92.0 ± 10.1 85.5 ± 6.5
γ-GT (U/L) 7.0 ± 1.6 10.5 ± 2.1 21.8 ± 3.6 11.0 ± 3.1 14.9 ± 2.5
T. Bilirubin (mg/dl) 0.96 ± 0.05 1.12 ± 0.15 2.9 ± 0.36 1.5 ± 0.21 1.8 ± 0.11
Albumin (g/dl) 4.2 ± 0.9 3.9 ± 0.3 2.2 ± 0.2 3.5 ± 0.3 3.2 ± 0.4

Fig. 8. Preventive and treatment effect of Vit-E/C@SeNPs on oxidative stress (MDA) and antioxidant status (GST, and CAT) in rat liver. Values are expressed as
mean ± SEM (n = 5/ group). Columns carrying different letters [a (the highest value) – d (the lowest value)] are significantly different at p < 0.05. All groups were
compared to each other. (G1) Control group; (G2) Vit-E/C@SeNPs only; (G3) DEN/CCl4 Hepatocellular Damage group; (G4) Prevention group; (G5) Treat­
ment group.

used to analysis the average particles size of Vit-E/C@SeNPs, TEM and
DLS. TEM analysis shows nanoparticles that are nearly spherical in
shape with mean core size 50 nm (Fig. 3b). DLS results of Vit-E/
C@SeNPs showed that average hydrodynamic size was 180 nm with
narrow size distribution (Fig. 3c).
Colloidal stability of Vit-E/C@SeNPs was expressed by zeta potential
that measured by PCS. The results showed negative zeta potential with
− 31 mV, which indicates the stability of aqueous colloidal solution of
Vit-E/C@SeNPs. This stability may arise from electrostatic repulsion
among charged surfaces of SeNPs and may contribute to medical
application of Vit-E/C@SeNPs [50].
3.2. Antioxidant capacity Vit-E/C@SeNPs
DPPH assay results that were showed in (Fig. 4) revealed that the
percentage of RSC of selenium, Vit. C, Vit. E and Vit-E/C@SeNPs. The
formula (Vit-E/C@SeNPs) had the highest antioxidant capacity of
(75.9%), while its separate components as selenium ions, Vit. C, and Vit.
E had showed (31.8 %), (40%) and (18.6), respectively [51].
3.3. Cytotoxicity evaluation of Vit-E/C@SeNPs
SRB test depends on assay of cellular protein content via colorimetric

6
S.A. Aljuhr et al.
Fig. 9. qPCR analysis shows changes in the relative expression of (TGFβ1, NFκB, TNFα, P53, PPARγ and iNOS) genes relative to the housekeeping β-actin gene. Gene
expression fold changes were presented as mean ± SEM (n = 5/group). Columns carrying different letters [a (the highest value) – d (the lowest value)] are
significantly different at p < 0.05. All groups were compared to each other. (G1) Control group; (G2) Vit-E/C@SeNPs only; (G3) DEN/CCl4 Hepatocellular Damage
group; (G4) Prevention group; (G5) Treatment group.
measurement of the amount of SRB dye, which binds stoichiometrically
to the protein components of the cells that have been fixed to tissue-
culture plates by TCA. The results of this test revealed that IC50 was
27.9 µg/ml for Vit-E/C@SeNPs (Fig. 5). This result credits for Vit-E/
C@SeNPs formula as it could be used safely in-vivo because its lower
toxicity.
99m
3.4. Optimization of radiosynthesis yield of Tc-Vit-E/C@SeNPs
complex
Paper chromatography revealed that radiosynthesis yield of 99mTc-
Vit-E/C@SeNPs complex was determined to be 91 ± 2%. Sn(II) amount,
Vit-E/C@SeNPs amount (by volume), pH and reaction time were opti­
mized as reaction factors of radiosynthesis process [52]. Results showed
that the optimum conditions were 1 μg of Sn (II), and 0.5 ml of Vit-E/
C@SeNPs colloid solution in pH 5 for 30 min reaction time (Fig. 6).
99m
3.5. In-vivo pharmacokinetic study of Tc-Vit-E/C@SeNPs complex
As noticed in (Fig. 7), the cellular uptake of 99mTc-Vit-E/C@SeNPs
complex is almost plateaued in liver and kidney and almost no signifi­
cant accumulation in spleen and stomach. The highest biodistribution
percentage of 99mTc-Vit-E/C@SeNPs complex is in liver with % ID/g of
29.56% at 120 min post-injection (p.i.), which credits for hep­
atoprotective and anti-inflammatory potential of Vit-E/C@SeNPs and
the next highest percentage go for kidney with % ID/g 29.24% as Vit. C
cleared via urinary tract [53]. These high percentages of accumulation
take a hand of Vit-E/C@SeNPs complex to be a promising and preven­
tive agent in liver and kidney cancer. Small nanosize of selenium
nanoparticles and capping them with Vit. C and Vit. E which are
7
Bioorganic Chemistry 117 (2021) 105412
compatible well in-vivo are the reasons behind the advantages of Vit-E/
C@SeNPs like passive targeting through the enhanced permeability and
retention (EPR) effect in leaky tissues and target specific tumor via
molecular interaction and affinity [54–56].
3.6. Biochemical markers
Rats administered DEN/CCl4 (hepatocellular damage group) showed
significantly (p < 0.05) higher levels of liver damage parameters (AST,
ALT, ALP, γ-GT, and total bilirubin) where the results were 232.5 ± 20.1
U/L, 63.5 ± 8.5 U/L, 262.5 ± 45.5 U/L, 21.8 ± 3.6 U/L, and 2.9 ± 0.36
mg/dl for ALT, AST, ALP, γ-GT, and T. Bilirubin, respectively and
significantly lower levels of albumin than the control group that was 2.2
± 0.2 g/dl for hepatocellular damage group and 4.2 ± 0.9 g/dl for
control group) (Table 2). Treatment with Vit-E/C@SeNPs restored these
parameters to levels comparable to the control group. The highest
improvement was observed in (preventive group No 4) where the
findings were 72 ± 4.8 U/L, 23.0 ± 5.8 U/L, 92.0 ± 10.1U/L, 11.0 ±
3.1U/L, 1.5 ± 0.21 mg/dl, and 3.5 ± 0.3 g/dl for ALT, AST, ALP, γ-GT, T.
Bilirubin, and albumin, respectively which were slightly significantly
better than (treatment group No 5) that was co-treated with Vit-E/
C@SeNPs in parallel with hepatocellular damage induction. These
findings indicate that treatment with Vit-E/C@SeNPs ameliorate DEN/
CCl4-induced liver damage with best effect for the preventive group than
treatment group. The preventive effect of selenium may contribute to
that Vit-E/C@SeNPs could inhibit liver damage through boosting
glutathione peroxidase mRNA expression or induced apoptosis in HCC
via reactive ROS that activate jun N-terminal kinase (JNK) [57] or by
increase the release of lactate dehydrogenase (LDH) and decreasing
glutathione (GSH) production [58]. Vit-E/C@SeNPs may also exerts the
S.A. Aljuhr et al. Bioorganic Chemistry 117 (2021) 105412

Fig. 10. Photomicrographs of ×400H&E-stained sections in rat liver, demonstrating the effect anti-inflammatory and curative effect of Vit E/C@ SeNPs adminis­
tration to rat induced by DEN/CCl4 for induction of liver fibrosis and inflammation, (a) Control group; (b) Vit-E/C@SeNPs only; (c) DEN/CCl4 Hepatocellular
Damage group; (d) Prevention group; (e) Treatment group.

a significantly higher MDA level and a significantly lower GST level and
Table 3 antioxidant activity of CAT in their livers than control animals (Fig. 8).
The scores of histological alterations of liver in the different groups. Administration of Vit-E/C@SeNPs restored these oxidant/antioxidant
Histological alteration Group Group Group Group Group biomarkers to levels comparable to the control. In addition, the pre­
1 2 3 4 5 ventive group showed best improvement (lowest MDA and highest GST,
Focal hepatocellular − − +++ − − and CAT) than treatment group (Fig. 8). These data imply that Vit-E/
alterations C@SeNPs could attenuate oxidative stress damage in the liver induced
Inflammatory cells − − ++++ ++ +++ by DEN/CCl4 through inhibition of the lipid peroxidation because se­
infiltrates lenium is inserted in selenoproteins especially GPXs which in active
Fibroblastic activity and − − +++ ++ +++
collagen formation
oxidative metabolism compete for scavenging H2O2, ROS, and lipid
Congested BVs − − +++ + ++ peroxide (LPO) so, it is important to correct blood selenium level of HCC
patients [60].

apoptosis effect through and AK strain transforming (AKT) signaling

pathway [59]. 3.8. Vit-E/C@SeNPs effects on expression of inflammatory and apoptotic
genes/proteins

3.7. Oxidative stress results qPCR has been applied to determine inflammation related genes
(TGFβ1, NFκB, iNOS, PPAR-γ and TNFα) and Apoptotic gene (P53)
Animals treated with DEN/CCl4 (hepatocellular damage group) had relative expressions in liver of rat suffering damage by mixed IP

8
S.A. Aljuhr et al.
administration with DEN/CCl4, that give rise of inflammation and
fibrotic features in the liver. Then parallel administration of Vit-E/
C@SeNPs as a protective agent or post administration in case of treat­
ment strategy. The obtained results showed significant up-regulation of
all previously mentioned inflammatory and apoptotic hepatic genes, in
the DEN/CCl4 treated group (Group 3) as compared to the control group
(Fig. 9). In addition to the typical histological features of hepatitis seen
in the DEN/CCl4-treated group, hepatitis was confirmed on molecular
levels. We found a significantly higher expression of inflammatory genes
(TGFβ1, NFκB, iNOS, PPAR-γ and TNFα) and Apoptotic gene (P53)
protein in the DEN/CCl4-treated group as compared to the control
group. High mRNA levels of the epithelial mesenchymal transition
marker TGFβ1 could explain the occurrence of fibrosis in DEN/CCl4-
treated animals G5. Additionally, the elevation of TNFα and NFκB gene
could also be associated with chronic inflammation and fibrosis.
Persistent high NFκB mRNA and protein levels in chronic hepatitis is the
main inducer of liver cancer. Our data showed that rat uptake of Vit-E/
C@SeNPs for prevention or treatment had showed lower expression
levels of these inflammatory markers. This suggests an ameliorative
effect of this nano fabricated composite, on the DEN/CCl4-induced liver
damage.
3.9. Histopathological findings
The microscopic examination of the five groups of liver samples
tissue sections is presented in Fig. 10. Group 1 (Normal control group)
showed normal histological features of rat liver parenchyma with many
apparent intact hepatocytes with intact subcellular details, intact he­
patic vasculatures, and portal areas with intact hepatic sinusoids. In
parallel with group 2 (drug control) showed almost apparent intact
morphological features resembling normal control samples without
abnormal pathological changes. While group 3 (induced group without
treatment) showed scattered large focal sized areas of hepatocellular
alteration showing cytoplasmic vacuolation and reticulation (red arrow)
accompanied with significant fibroblastic activity and collagen fibers
deposition (blue arrow) with moderate pseudo lobulation of hepatic
parenchyma. Moderate perivascular inflammatory cells infiltrate (yel­
low arrow) was shown with moderate dilatation of hepatic BVs. (star).
Group 4 (preventive group) showed almost intact hepatic parenchyma
with minimal records of degenerative changes (red arrow) and without
detectable focal alterations with minimal inflammatory cells infiltrates
and mild congested vasculatures. However, mild scanty records of
collagen fibers with fibroblastic activity (dashed arrow) could be
observed in less than 30 % of examined samples. Finally, group 5
(treated group) showed mild degenerative changes in few hepatocytes
(red arrow) without detectable areas of focal alterations. However,
moderate higher records of inflammatory cells infiltrate (yellow arrow)
as well as fibroblastic activity with abundant collagen deposition (blue
arrow) were shown in more than 50% of examined samples with mod­
erate congested BVs (star) (Table 3).
4. Conclusion
This study developed a synthetic method to produce selenium
nanoparticles decorated with Vit C and Vit E (Vit-E/C@SeNPs) and radio
synthesized complex of 99mTc-Vit-E/C@SeNPs. The nano-size, stability,
antioxidant capacity, and cytotoxicity of the complex were all accept­
able and satisfying. Vit-E/C@SeNPs had showed remarkable low liver
function biomarkers in prevention and treated group (After treating
with Vit-E/C@SeNPs), a significant depletion of liver tissue L-MDA, and
obvious increase in GSH concentration and CAT activity and down
regulate values of inflammatory gene (TGFβ1, NFκB, iNOS, PPAR-γ and
TNFα) and Apoptotic gene (P53) that determined by qPCR in the same
groups. All these findings concluded that Vit-E/C@SeNPs is a promising
protective and therapeutic agent against DEN/ CCl4-induced hepato­
cellular damage (Hepatocellular carcinoma).
9
Bioorganic Chemistry 117 (2021) 105412
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgment
Prof. Tamer M. Sakr expresses his grateful appreciation and thanks
for International Atomic Energy Authority (IAEA) for international
collaboration and funding this work under CRP No. F22064. Prof. Wafaa
A. Zaghary expresses her grateful appreciation and thanks for Research
Support Center, Helwan University, Egypt for funding this work.
References
[1] J. Diani, Y. Liu, K. Gall, Finite strain 3D thermoviscoelastic constitutive model for
shape memory polymers, Polym. Eng. Sci. 46 (4) (2006) 486–492.
[2] H. Fayez, M.A. El-Motaleb, A.A. Selim, Synergistic cytotoxicity of shikonin-silver
nanoparticles As an opportunity for lung cancer, J. Labelled Compd. Radiopharm.
63 (1) (2020) 25–32.
[3] D. Psimadas, P. Bouziotis, P. Georgoulias, V. Valotassiou, T. Tsotakos, G. Loudos,
Radiolabeling approaches of nanoparticles with 99mTc, Contrast Media Mol.
Imaging 8 (4) (2013) 333–339.
[4] G. Abdelaziz, Applying radiolabeled novel recombinant insulin via 99mTc for
ensuring native like action by in vivo biodistribution in mice, Arab. J. Nucl. Sci.
Appl. 53 (2) (2020) 125–130.
[5] P. Sonkusre, S.S. Cameotra, Biogenic selenium nanoparticles induce ROS-mediated
necroptosis in PC-3 cancer cells through TNF activation, J. Nanobiotechnol. 15 (1)
(2017) 1–12.
[6] J.M. Thurman, N.J. Serkova, Nanosized contrast agents to noninvasively detect
kidney inflammation by magnetic resonance imaging, Adv. Chronic Kidney Dis. 20
(6) (2013) 488–499.
[7] G. Abdelaziz, H.A. Shamsel-Din, M.O. Sarhan, M.A. Gizawy, Tau protein targeting
via radioiodinated azure A for brain theranostics: radiolabeling, molecular
docking, in vitro and in vivo biological evaluation, J. Labelled Compd.
Radiopharm. 63 (1) (2020) 33–42.
[8] T.M. Sakr, O.M. Khowessah, M.A. Motaleb, A. Abd El-Bary, M.T. El-Kolaly, M.
M. Swidan, I-131 doping of silver nanoparticles platform for tumor theranosis
guided drug delivery, Eur. J. Pharm. Sci. 122 (2018) 239–245.
[9] M.M. Swidan, O.M. Khowessah, M. Abd El-Motaleb, A. Abd El-Bary, M.T. El-Kolaly,
T.M. Sakr, Iron oxide nanoparticulate system as a cornerstone in the effective
delivery of Tc-99 m radionuclide: a potential molecular imaging probe for tumor
diagnosis, DARU, J. Pharm. Sci. 27 (1) (2019) 49–58.
[10] G.N. Schrauzer, Nutritional selenium supplements: product types, quality, and
safety, J. Am. Coll. Nutr. 20 (1) (2001) 1–4.
[11] H. Zeng, G.F. Combs Jr, Selenium as an anticancer nutrient: roles in cell
proliferation and tumor cell invasion, J. Nutritional Biochem. 19 (1) (2008) 1–7.
[12] P.D. Ray, B.-W. Huang, Y. Tsuji, Reactive oxygen species (ROS) homeostasis and
redox regulation in cellular signaling, Cell. Signal. 24 (5) (2012) 981–990.
[13] J.C. Avery, P.R. Hoffmann, Selenium, selenoproteins, and immunity, Nutrients 10
(9) (2018) 1203.
[14] M. Wallenberg, S. Misra, A.M. Wasik, C. Marzano, M. Björnstedt, V. Gandin, A.
P. Fernandes, Selenium induces a multi-targeted cell death process in addition to
ROS formation, J. Cell Mol. Med. 18 (4) (2014) 671–684.
[15] T. Nie, H. Wu, K.-H. Wong, T. Chen, Facile synthesis of highly uniform selenium
nanoparticles using glucose as the reductant and surface decorator to induce cancer
cell apoptosis, J. Mater. Chem. B 4 (13) (2016) 2351–2358.
[16] J. Pi, H. Jin, RuiYing Liu, B. Song, Q. Wu, L.i. Liu, JinHuan Jiang, F. Yang,
HuaiHong Cai, J. Cai, Pathway of cytotoxicity induced by folic acid modified
selenium nanoparticles in MCF-7 cells, Appl. Microbiol. Biotechnol. 97 (3) (2013)
1051–1062.
[17] L. Tan, X. Jia, X. Jiang, Y. Zhang, H. Tang, S. Yao, Q. Xie, In vitro study on the
individual and synergistic cytotoxicity of adriamycin and selenium nanoparticles
against Bel7402 cells with a quartz crystal microbalance, Biosens. Bioelectron. 24
(7) (2009) 2268–2272.
[18] Y. Xia, P. You, F. Xu, J. Liu, F. Xing, Novel functionalized selenium nanoparticles
for enhanced anti-hepatocarcinoma activity in vitro, Nanoscale Res. Lett. 10 (1)
(2015) 1–14.
[19] T.M. Sakr, M. Korany, K.V. Katti, Selenium nanomaterials in biomedicine—An
overview of new opportunities in nanomedicine of selenium, J. Drug Delivery Sci.
Technol. 46 (2018) 223–233.
[20] S.J. Padayatty, A. Katz, Y. Wang, P. Eck, O. Kwon, J.-H. Lee, S. Chen, C. Corpe,
A. Dutta, S.K. Dutta, Vitamin C as an antioxidant: evaluation of its role in disease
prevention, J. Am. Coll. Nutr. 22 (1) (2003) 18–35.
[21] H. Sakagami, S. Amano, H. Kikuchi, Y. Nakamura, R. Kuroshita, S. Watanabe,
K. Satoh, H. Hasegawa, A. Nomura, T. Kanamoto, Antiviral, antibacterial and
vitamin C-synergized radical-scavenging activity of Sasa senanensis Rehder
extract, In vivo 22 (4) (2008) 471–476.
[22] B.H.J. Bielski, H.W. Richter, P.C. Chan, Some properties of the ascorbate free
radical, Ann. N. Y. Acad. Sci. 258 (1 Second Confer) (1975) 231–237.
S.A. Aljuhr et al.
[23] M.A.O. Dawood, M. Zommara, N.M. Eweedah, A.I. Helal, Synergistic effects of
selenium nanoparticles and vitamin E on growth, immune-related gene expression,
and regulation of antioxidant status of Nile tilapia (Oreochromis niloticus), Biol.
Trace Elem. Res. 195 (2) (2020) 624–635.
[24] M.G. Traber, L. Packer, Vitamin E: beyond antioxidant function, Am. J. Clin. Nutrit.
62 (6) (1995) 1501S–1509S.
[25] C.-Y.-J. Lee, F. Wan, Vitamin E supplementation improves cell-mediated immunity
and oxidative stress of Asian men and women, J. Nutrit. 130 (12) (2000)
2932–2937.
[26] M.G. Traber, J. Atkinson, Vitamin E, antioxidant and nothing more, Free Radical
Biol. Med. 43 (1) (2007) 4–15.
[27] S. De Minicis, T. Kisseleva, H. Francis, G.S. Baroni, A. Benedetti, D. Brenner,
D. Alvaro, G. Alpini, M. Marzioni, Liver carcinogenesis: rodent models of
hepatocarcinoma and cholangiocarcinoma, Digestive Liver Dis. 45 (6) (2013)
450–459.
[28] C.P.A. Rogério, A. Daniele, G. Betty, M. Carla, V. Monica, H. Michele, T. Deborah,
K. Mario, G. Otavio, P. Paula, Advanced hepatocellular carcinoma. Review of
targeted molecular drugs, Ann. Hepatol. 10 (1) (2011) 21–27.
[29] A.E. Mohamed, M.A. El-Magd, K.S. El-Said, M. El-Sharnouby, E.M. Tousson, A.
F. Salama, Potential therapeutic effect of thymoquinone and/or bee pollen on
fluvastatin-induced hepatitis in rats, Sci. Rep. 11 (1) (2021) 1–12.
[30] H.A. Shamsel-Din, M.A. Gizawy, G. Abdelaziz, Molecular docking and preliminary
bioevaluation of 99m Tc-Thiadiazuron as a novel potential agent for cervical
cancer imaging, J. Radioanal. Nucl. Chem. 326 (2) (2020) 1375–1381.
[31] P. Muriel, Role of free radicals in liver diseases, Hep. Intl. 3 (4) (2009) 526–536.
[32] S. Hussein, M.B. Abd Elazem, H. Mostafa Ali, The potential anti-inflammatory
effect of Omega-3 polyunsaturated fatty acids on experimentally induced
ulcerative colitis in rats, Benha Veterinary Med. J. 37 (1) (2019) 242–249.
[33] M. Korany, B. Mahmoud, S.M. Ayoub, T.M. Sakr, S.A. Ahmed, Synthesis and
radiolabeling of vitamin C-stabilized selenium nanoparticles as a promising
approach in diagnosis of solid tumors, J. Radioanal. Nucl. Chem. 325 (1) (2020)
237–244.
[34] M. Korany, F. Marzook, B. Mahmoud, S.A. Ahmed, S.M. Ayoub, T.M. Sakr,
Exhibiting the diagnostic face of selenium nanoparticles as a radio-platform for
tumor imaging, Bioorg. Chem. 100 (2020), 103910.
[35] T. Shimamura, Y. Sumikura, T. Yamazaki, A. Tada, T. Kashiwagi, H. Ishikawa,
T. Matsui, N. Sugimoto, H. Akiyama, H. Ukeda, Applicability of the DPPH assay for
evaluating the antioxidant capacity of food additives–inter-laboratory evaluation
study, Anal. Sci. 30 (7) (2014) 717–721.
[36] B.M. Essa, A.A. El-Mohty, M.A. El-Hashash, T.M. Sakr, 99mTc-citrate-gold
nanoparticles as a tumor tracer: synthesis, characterization, radiolabeling and in-
vivo studies, Radiochim. Acta 108 (10) (2020) 809–819.
[37] T.M. Sakr, M. El-Hashash, A. El-Mohty, B.M. Essa, 99mTc-gallic-gold nanoparticles
as a new imaging platform for tumor targeting, Appl. Radiat. Isot. 164 (2020),
109269.
[38] M.A. Motaleb, A.S.A. Adli, M. El-Tawoosy, M.H. Sanad, M. AbdAllah, An easy and
effective method for synthesis and radiolabelling of risedronate as a model for bone
imaging, J. Labelled Compd. Radiopharm. 59 (4) (2016) 157–163.
[39] H.G. Abdulwahab, M.F. Harras, N.G. El Menofy, A.M. Hegab, B.M. Essa, A.A. Selim,
T.M. Sakr, H.S. El-Zahabi, Novel thiobarbiturates as potent urease inhibitors with
potential antibacterial activity: Design, synthesis, radiolabeling and biodistribution
study, Bioorg. Med. Chem. 28 (23) (2020), 115759.
[40] M.A. Motaleb, M.H. Sanad, A.A. Selim, M. El-Tawoosy, M. Abd-Allah, Synthesis,
Characterization, and Radiolabeling of Heterocyclic Bisphosphonate Derivative as
a Potential Agent for Bone Imaging, Radiochemistry 60 (2) (2018) 201–207.
[41] M.A. Motaleb, A.A. Selim, M. El-Tawoosy, M.H. Sanad, M.A. El-Hashash, Synthesis,
characterization, radiolabeling and biodistribution of a novel cyclohexane dioxime
10
Bioorganic Chemistry 117 (2021) 105412
derivative as a potential candidate for tumor imaging, Int. J. Radiat Biol. 94 (6)
(2018) 590–596.
[42] F. Heindryckx, I. Colle, H. Van Vlierberghe, Experimental mouse models for
hepatocellular carcinoma research, Int. J. Exp. Pathol. 90 (4) (2009) 367–386.
[43] T. Uehara, I.P. Pogribny, I. Rusyn, The DEN and CCl4-induced mouse model of
fibrosis and inflammation-associated hepatocellular carcinoma, Current protocols
in pharmacology 66(1) (2014) 14.30. 1-14.30. 10.
[44] H. Grunenwald, Optimization of polymerase chain reactions, PCR protocols,
Springer, 2003, pp. 89–99.
[45] G.J. Viljoen, L.H. Nel, J.R. Crowther, Molecular diagnostic PCR handbook,
Springer Science & Business Media, 2005.
[46] J.D. Bancroft, M. Gamble, Theory and practice of histological techniques, Elsevier
Health Sciences, 2008.
[47] N.A. El-Nabarawy, A.S. Gouda, M.A. Khattab, L.A. Rashed, Effects of nitrite graded
doses on hepatotoxicity and nephrotoxicity, histopathological alterations, and
activation of apoptosis in adult rats, Environ. Sci. Pollut. Res. 27 (12) (2020)
14019–14032.
[48] Z. Zhang, S. Huey Lee, S.-S. Feng, Folate-decorated poly (lactide-co-glycolide)-
vitamin E TPGS nanoparticles for targeted drug delivery, Biomaterials 28 (10)
(2007) 1889–1899.
[49] J. Yang, K.-Q. Yang, L.i. Qiu, Biosynthesis of vitamin C stabilized tin oxide
nanoparticles and their effect on body weight loss in neonatal rats, Environ.
Toxicol. Pharmacol. 54 (2017) 48–52.
[50] E. Piacenza, A. Presentato, E. Ambrosi, A. Speghini, R.J. Turner, G. Vallini,
S. Lampis, Physical–chemical properties of biogenic selenium nanostructures
produced by Stenotrophomonas maltophilia SeITE02 and Ochrobactrum sp. MPV1,
Front. Microbiol. 9 (2018) 3178.
[51] M.N. Alam, N.J. Bristi, M.d. Rafiquzzaman, Review on in vivo and in vitro methods
evaluation of antioxidant activity, Saudi Pharmaceut. J. 21 (2) (2013) 143–152.
[52] B. Essa, T. Sakr, M.A. Khedr, F. El-Essawy, A. El-Mohty, 99mTc-amitrole as a novel
selective imaging probe for solid tumor: in silico and preclinical pharmacological
study, Eur. J. Pharm. Sci. 76 (2015) 102–109.
[53] U.S. Yigit, F.Y. Lambrecht, P. Ünak, F.Z. Biber, E.I. Medine, B. Çetinkaya,
Preparation of 99mTc labeled vitamin C (ascorbic acid) and biodistribution in rats,
Chem. Pharm. Bull. 54 (1) (2006) 1–3.
[54] W.I. El-Ghareb, M.M. Swidan, I.T. Ibrahim, A. Abd El-Bary, M.I. Tadros, T.M. Sakr,
99mTc-Doxorubicin-loaded gallic acid-gold nanoparticles (99mTc-DOX-loaded GA-
Au NPs) as a multifunctional theranostic agent, Int. J. Pharm. 586 (2020), 119514.
[55] D. El-Safoury, A.B. Ibrahim, D. El-Setouhy, O. Khowessah, M. Motaleb, T.M. Sakr,
Amelioration of Tumor Targeting and In Vivo Biodistribution of 99mTc-Metho­
trexate-Gold Nanoparticles (99mTc-Mex-AuNPs), J. Pharm. Sci. (2021).
[56] S.K. Nune, P. Gunda, P.K. Thallapally, Y.-Y. Lin, M. Laird Forrest, C.J. Berkland,
Nanoparticles for biomedical imaging, Expert Opin. Drug Deliv. 6 (11) (2009)
1175–1194.
[57] Y. Zou, P. Niu, J. Yang, J. Yuan, T. Wu, X. Chen, The JNK signaling pathway is
involved in sodium-selenite-induced apoptosis mediated by reactive oxygen in
HepG2 cells, Cancer Biol. Ther. 7 (5) (2008) 689–696.
[58] H.-M. Shen, W.-X. Ding, C.-N. Ong, Intracellular glutathione is a cofactor in
methylseleninic acid-induced apoptotic cell death of human hepatoma HEPG2
cells, Free Radical Biol. Med. 33 (4) (2002) 552–561.
[59] Y. Li, M. Guo, Z. Lin, M. Zhao, Y.u. Xia, C. Wang, T. Xu, B. Zhu, Multifunctional
selenium nanoparticles with Galangin-induced HepG2 cell apoptosis through p38
and AKT signalling pathway, R. Soc. Open Sci. 5 (11) (2018) 180509, https://doi.
org/10.1098/rsos.180509.
[60] D.N. Ekoue, C. He, A.M. Diamond, M.G. Bonini, Manganese superoxide dismutase
and glutathione peroxidase-1 contribute to the rise and fall of mitochondrial
reactive oxygen species which drive oncogenesis, Biochimica et Biophysica Acta
(BBA)-Bioenergetics 1858 (8) (2017) 628–632.