Small Ruminant Research 201 (2021) 106399

Contents lists available at ScienceDirect

Small Ruminant Research

journal homepage: www.elsevier.com/locate/smallrumres

Comparison of kinship estimates in Santa Inês sheep using microsatellite

and genome-wide SNP markers
Alzira Regina Silva de Deus a, b, *, Geice Ribeiro Silva a, Luciano Silva Sena a, Fábio Barros Britto c,
Débora Araújo de Carvalho a, Jorge Victor Gomes de Freitas d, José Lindenberg Rocha Sarmento e
a
Agrarian Sciences Center (CCA), Federal University of Piauí (UFPI), Campus Universitário Ministro Petrônio Portella, Teresina, PI, 64049-550, Brazil
b
Department of Clinical and Toxicological Analysis (DACT), Health Sciences Center, Federal University of Rio Grande do Norte (UFRN), Campus Central, Natal, RN,
59078-970, Brazil
c
Department of Biology, UFPI, Campus Universitário Ministro Petrônio Portella, Teresina, PI, 64049-550, Brazil
d
Undergraduate Course in Veterinary Medicine, CCA, UFPI, Campus Universitário Ministro Petrônio Portella, Teresina, PI, 64049-550, Brazil
e
Department of Animal Science, CCA, UFPI, Campus Universitário Ministro Petrônio Portella, Teresina, PI, 64049-550, Brazil

A R T I C L E I N F O A B S T R A C T

Keywords: The Santa Inês breed stands out in meat sheep production in Brazil. However, this breed is under risk to lose
Co-ancestry important traits, especially due to pedigree errors and uncontrolled mating. The use of suitable molecular
Conservation markers can help in the efficient parentage assignment and kinship analysis. In the present study, we aimed to
Inbreeding
evaluate the power of different numbers of microsatellite markers in comparison to a genome-wide SNP array in
Kinship estimators
Genetic improvement
kinship estimation in Santa Inês sheep flocks. Blood samples from 257 animals raised in six flocks located in the
Molecular markers Mid-North sub-region of Brazil were used for DNA extraction. The microsatellite data were obtained using four
panels with different numbers of loci (10, 12, 15, and 19). The panel OvineSNP50 BeadChip (Illumina Inc.) was
used for genotyping the animals with SNP data, which were used to calculate the genomic relationship matrix
(G). The COANCESTRY program was used to propose the best kinship estimator among seven that were tested.
The R package RELATED was used to obtain kinship estimates. The kinships obtained using SNPs and micro­
satellites were compared using descriptive analysis and Pearson correlation. It was possible to estimate relat­
edness between full siblings, half siblings, parent-offspring, and unrelated animals using the four microsatellite
panels. However, panels containing less than 15 markers had lower efficiency. Most of the pairs of individuals
were unrelated or half sibs. In the six flocks, several pairs of individuals showed some degree of relatedness. This
indicates that a great number of related individuals have mated. Our results demonstrated that kinships esti­
mated using microsatellite panels were highly correlated to those obtained using the SNP panel, with correlations
above 0.89. Thus, a low number of microsatellite markers estimates kinship in Santa Inês sheep with similar
efficiency to a genome-wide SNP panel.

1. Introduction Breeders – ARCO, 2019).

Sheep production has expanded in the last decades in Brazil and
currently, the national sheep flock has more than 18 million heads
(Brazilian Institute of Geography and Statistics – IBGE, 2018). Most of
this flock is composed of Santa Inês sheep and their crossbreds. The
Santa Inês breed has raised the interest of breeders and researchers due
to important productive aspects. Animals of this breed have good
adaptability to tropical conditions, outstanding growth potential, and
excellent meat quality (Sousa et al., 2003; Brazilian Association of Sheep
Despite the great importance of Santa Inês sheep for meat produc­
tion, efficient programs without the use or with limited use of pedigree
records are lacking for genetic improvement and conservation of genetic
diversity of this breed (Rego Neto et al., 2018; Lobo, 2019). Further­
more, pedigree errors and the selection based only on phenotypic re­
cords represent a risk for the loss of important traits in Santa Inês sheep
and make the genetic improvement of this genetic resource inefficient.
This could affect the conservation and performance of this breed
(McManus et al., 2010; Alves et al., 2016).

* Corresponding author at: Agrarian Sciences Center (CCA), Federal University of Piauí (UFPI), Campus Universitário Ministro Petrônio Portella, Teresina, PI,
64049-550, Brazil.
E-mail address: alziraregina@hotmail.com (A.R.S. de Deus).

https://doi.org/10.1016/j.smallrumres.2021.106399
Received 9 August 2020; Received in revised form 10 March 2021; Accepted 25 April 2021
Available online 30 April 2021
0921-4488/© 2021 Elsevier B.V. This article is made available under the Elsevier license (http://www.elsevier.com/open-access/userlicense/1.0/).
A.R.S. de Deus et al. Small Ruminant Research 201 (2021) 106399

An alternative for genetic management of flocks with few or no
pedigree records consists of determining kinship relationships using
molecular markers, through the calculation of allelic frequencies of each
individual. This alternative takes into account that alleles of related
individuals are identical by descent (IBD) (Thompson, 2013).
Several studies have shown that SNP (Single Nucleotide Poly­
morphism) markers are a powerful tool for parentage assignment and
kinship analysis (e.g., Heaton et al., 2002; Hayes, 2011; Lopes et al.,
2013; Panetto et al., 2017; Goudet et al., 2018). SNP markers are spread
throughout the genome, are highly informative for prediction of
genomic breeding values, and have both a low mutation rate and low
genotyping error rate (Tokarska et al., 2009; Yu et al., 2015). Never­
theless, kinship analyses require a great number of SNPs, as these
markers are biallelic (Morin et al., 2004; Kling et al., 2012). This in­
creases the cost and complexity of using SNPs for kinship assessment.
Microsatellite (or simple sequence repeat (SSR)) markers represent
another important alternative for kinship analysis due to their high
polymorphism and relatively easy application. SSR markers consist of
simple sequences of one to six base pairs that are repeated in tandem and
widely distributed throughout the genome (Ellegren, 2004). The
co-dominant nature of microsatellites makes them easy to be used in
population studies as an efficient tool for kinship estimation (Webster
and Reichart, 2005).
In the present study, we aimed to evaluate the power of different
numbers of microsatellite markers in comparison to a high-density SNP
array in kinship estimation in Santa Inês sheep flocks, in order to give
support to breeding programs and conservation of genetic resources in
flocks with poor genealogical control.
2. Material and methods
2.1. Population structure
All the experimental procedures carried out in this study were
approved by the Committee on Ethics in the Use of Animals (CEUA) of
the Federal University of Piauí (UFPI), Brazil (protocol number 337/17).
Data from 257 animals of the Santa Inês sheep breed raised in six
flocks located in different municipalities of the states of Piauí (PI) and
Maranhão (MA), in the Mid-North sub-region of Brazil were used. The
animals were registered in the Brazilian Association of Sheep Breeders
(ARCO) or belonged to the sheep and goats conservation nucleus of the
federal research unit Embrapa Meio Norte (Campo Maior, Piauí). For the
analyses, we considered all individuals as the whole population (POP 1)
and the subsets of six populations divided according to the origin of the
animals (Table 1).
2.2. Collection of biological material and DNA extraction
Blood samples were collected in the animal’s jugular vein using
vacuum tubes (Vacutainer®) with capacity of 4.50 mL containing EDTA
anticoagulant. Prior to DNA extraction, the blood samples were stored at
− 20 ◦ C.
The DNA extraction was performed using the DNeasy Blood & Tissue
Kit (Qiagen, Hilden, Germany) according to the manufacturer’s proto­
col. For this procedure, 300 μL of blood of each individual were used.
After the extraction, an ultraviolet (UV) transiluminator was used for
DNA visualization using 1% agarose gels and ethidium bromide staining
in order to check the DNA quality. The DNA concentration was also
verified through comparison to lambda DNA standard using known
concentrations. The DNA obtained after extraction was stored at -20 ◦ C
until the execution of further procedures.
The SNP genotyping was performed at the DEOXI laboratory in
Araçatuba, São Paulo, Brazil. All other procedures and statistical ana­
lyses were carried out at the Laboratory of Animal Genetics (LABGEN) of
the Department of Animal Science (DZO) of UFPI, Teresina, Piauí, Brazil.
2.3. DNA amplification and genotyping with microsatellite markers
A total of 20 microsatellite loci were selected from the list of
microsatellites recommended for sheep by the Food and Agricultural
Organization of the United Nations (FAO) (Table 2) (Food and Agri­
culture Organization (FAO), 2004) for DNA amplification using poly­
merase chain reaction (PCR). The reactions were tested and optimized in
a volume of 16 μL containing the following profile: 2.50 mMdNTPs, 1 ×
of Tris− HCl/KCl buffer, 1.00–2.00 mM MgCl2, 1.25 μM of each primer,
one unit of Taq DNA Polymerase, deionized water, and 3 μL of extracted
DNA (3 ng/μL).
The thermalcycler (GeneAmp Thermal Cycler 2720, Applied Bio­
systems, Foster City, CA, USA) used for the amplifications was pro­
grammed with the following parameters for PCR (Table 2): 94 ◦ C for 5
min, followed by 30–35 cycles of denaturation (94 ◦ C, 45 s); annealing
(50–62 ◦ C, 45 s); and extension (72 ◦ C, 50 s). After the cycles, a final
extension (72 ◦ C, 7 min) was performed. The products of amplification
were visualized in 6% non-denaturing polyacrylamide gel stained with
silver nitrate solution (1.50 mg/mL) with a 0.40 % (v/v) formaldehyde
solution and revealed by NaOH (1.50 mg/mL) with 0.40 % (v/v)
formaldehyde, using a modification of the method proposed by Ben­
bouza et al. (2006). The fragments were recorded in a spreadsheet in
order to obtain a database of allele frequencies.
2.4. Analysis of microsatellite data

Initially, we used the Micro-Checker software v.2.2.3 (Van Oos­

terhout et al., 2004) to detect possible genotyping errors and the pres­
Table 1
ence of null alleles. The allele frequencies in each locus and the
List of the Santa Inês sheep populations and their respective location
polymorphic information content (PIC) were estimated using the Cervus
coordinates.
software v.3.0.3 (Marshall et al., 1998). PIC is a measure of informa­
Flock Municipality – State Geographic location Number of samples tiveness related to the expected heterozygosity that is calculated based
POP 1a 257 on allele frequencies (Botstein et al., 1980). PIC values above 0.50 are
POP 2 José de Freitas – PI 4◦ 39′ 27.2′′ S 135 considered as highly informative, whereas values between 0.25 and 0.50
42◦ 28′ 37.8′′ W
are moderately informative, and PIC values less than 0.25 are consid­
POP 3 Santa Inês – MA 3◦ 42′ 43.4′′ S 52
45◦ 18′ 09.3′′ W ered uninformative.
POP 4 José de Freitas – PI 4◦ 39′ 34.7′′ S 27 In order to estimate kinship using molecular markers, the relatedness
42◦ 28′ 20.1′′ W coefficient (r) can be calculated using genotyping data and allele fre­
POP 5 Floriano – PI 6◦ 46′ 19.9′′ S 19 quency. The relatedness coefficient measures the expected proportion of
43◦ 03′ 42.4′′ W
POP 6 Campo Maior – PI 4◦ 47′ 58.2′′ S 18
alleles shared identical by descent (IBD) among individuals (Blouin,
42◦ 08′ 03.4′′ W 2003). Considering that there are various kinship estimators and there is
POP 7 Campo Maior – PI 5◦ 02′ 50.4′′ S 6 not a universal estimator for all types of data, we used the COANCESTRY
42◦ 01′ 12.9′′ W program v.1.0.1 (Wang, 2011) to derive the best kinship estimator.
POP: population; PI: state of Piauí, Brazil; MA: state of Maranhão, Brazil. The following kinship estimators were compared: triadic likelihood
a
POP 1 was the whole population, i.e., included all the other populations in estimator (TrioML) (Wang, 2007); genetic relatedness estimator of
study. Wang (Wang, 2002); LynchLi estimator (Lynch, 1988; Li et al., 1993);

2
A.R.S. de Deus et al. Small Ruminant Research 201 (2021) 106399

Table 2
Marker loci, forward and reverse sequences of the primer, annealing temperature (At), concentration of Magnesium chloride (MgCl2) used in polymerase chain re­
action (PCR), allele sizes obtained with PCR, references, and number of alleles.
Primer sequence
Markers At(◦ C) MgCl (mM)a Cycles Variation (bp)b A
Forward (F) Reverse (R)

F: AAAGGCCAGAGTATGCAATTAGGAG
MAF065 60 1.3 30 100− 158 19
R: CCACTCCTCCTGAGAATATAACATG
F: GATCACAAAAAGTTGGATACAACCGTG
MAF209 62 1.3 30 100− 154 15
R: TCATGCACTTAAGTATGTAGGATGCTG
F: CATGCCAAACAATATCCAGC
BM6526 55 1.3 30 140− 180 13
R: TGAAGGTAGAGAGCAAGCAGC
F: CCCTAGGAGCTTTCAATAAAGAATCGG
OarFCB304 55 1.0 30 160− 198 18
R: CGCTGCTGTCAACTGGGTCAGGG
F: AAGATGTGATCCAAGAGAGAGGCA
CSRM60* 55 1.5 30 60− 92 14
R:AGGACCAGATCGTGAAAGGCATAG
F: ACACAAATCCTTTCTGCCAGCTGA
CSSM66 55 1.5 30 12− 208 10
R: AATTTAATGCACTGAGGAGCTTGG
F: GCT TGC TAC ATG GAA AGT GC
ILSTS11 55 1.5 30 254− 294 9
R: CTA AAA TGC AGA GCC CTA CC
F: GAGTAGAGCTACAAGATAAACTTC
INRA23 58 1.0 30 190− 296 17
R: TAACTACAGGGTGTTAGATGAACTC
F: GTTCAGGACTGGCCCTGCTAACA
ETH10 57 1.5 30 200− 242 13
R: CCTCCAGCCCACTTTCTCTTCTC
F: CTCTATCTGTGGAAAAGGTGGG
BM8125 57 1.3 30 108− 132 12
R: GGGGGTTAGACTTCAACATACG
F: CAAGACAGGTGTTTCAATCT
MM12 54 1.3 30 100− 144 10
R: ATCGACTCTGGGGATGATGT
F: TTGTTTAGGCAAGTCCAAAGTC
BM1329 53 1.5 30 146− 180 10
R: AACACCGCAGCTTCATCC
F: AGCTGGGAATATAACCAAAGG
BM1818 55 1.5 30 248− 298 22
R: AGTGCTTTCAAGGTCCATGC
F: ATTTGCACAAGCTAAATCTAACC
INRA063 58 1.5 30 150− 184 12
R: AAACCACAGAAATGCTTGGAAG
F: AGCAGACATGATGACTCAGC
ILSTS87 55 1.5 30 140− 182 12
R: CTGCCTCTTTTCTTGAGAG
F: CCACTTCCCTGTATCCTCCT
INRABERN172 56 2.0 35 132− 192 36
R: GGTGCTCCCATTGTGTAGAC
F: GGACTTGCCAGAACTCTGCAAT
CSRD247 50 1.5 35 200− 264 29
R: CACTGTGGTTTGTATTAGTCAGG
F: CCCTCCTCCAGGTAAATCAGC
TGLA122 52 1.5 30 136− 182 12
R: AATCACATGGCAAATAAGTACATAC
F: GATCACCTTGCCACTATTTCCT
ETH225 50 2.0 35 130− 162 14
R: ACATGACAGCCAGCTGCTACT
F: GAGTTAGTACAAGGATGACAAGAGGCAC
OarFCB48 58 1.5 30 138− 170 11
R: GACTCTAGAGGATCGCAAAGAACCAG

A = number of alleles.
a
Monomers.
b
Base pairs.

LynchRd estimator (Lynch and Ritland, 1999); Ritland estimator (Rit­
land, 1996); QuellerGt estimator (Queller and Goodnight, 1989); and
dyadic likelihood estimator (DyadML) (Milligan, 2003; Wang, 2007).
For this, simulations were initially performed using the COANCESTRY
program with genotype data and allele frequencies of all individuals
using a panel with 19 microsatellite loci. The simulations were per­
formed using a permutation procedure with 100,000 bootstraps that
showed the average relationship between individuals. The selection of
the estimator was based on a true value of 1. Therefore, the estimator
with the value closest to 1 was considered the best for the proposed
population. The values obtained had a 95 % confidence (Wang, 2011).
All estimators mentioned above infer kinship assuming the presence
of inbred individuals, possible genotyping errors, and the presence of
null alleles. Therefore, pairs of haploid-haploid (Δ1 = 0) or diploid-
haploid (Δ2 = 2) individuals assume four kinship groups based on the
following equation: r = Δ1/2 + Δ2. The kinship groups assume relat­
edness values of zero for unrelated individuals (UR), 0.25 for half sibs
(HS), 0.50 for full sibs (FS) (i.e., individuals with common sire and dam),
and 0.50 for parent-offspring (PO) (Wang, 2006). Although FS and PO
have the same relatedness values, these two groups have different IBD
allele sharing patterns. A dyad (i.e., the genotypes of a pair of in­
dividuals) of PO must share at least one allele at every locus, whereas a
dyad of FS can share 0, 1 or 2 alleles. Thus, the PO group has lower
variation among loci in comparison to FS.
After the determination of the best kinship estimator, the RELATED
package (Pew et al., 2015) of the R software (R Development Core Team,
2013) was used to create a graphic with kinship values of the 257
genotyped animals, as well as the kinship for each population evaluated.
The RELATED package estimates kinship using the same approaches
available at the COANCESTRY program, so that it is possible to analyze
co-dominant molecular markers such as microsatellites.
Initially, we inserted the data into the R software using the ‘read­
genotypedata’ function of the RELATED package. Subsequently, the
‘familysim’ function was used to generate the pairs of individuals for
each degree of relatedness. Then, the ‘coancestry’ function was used to
obtain point estimates of relatedness using the DyadML estimator, which
was the best estimator based on the analyses performed using the
COANCESTRY program. Finally, graphics were generated for visuali­
zation of kinship values for each expected degree of relatedness.
The analyses mentioned above were performed using panels con­
taining 10 (Panel 1), 12 (Panel 2), 15 (Panel 3), and 19 (Panel 4) mi­
crosatellite loci (Table 3). The markers of each panel were selected based
on PIC values and possible presence of null alleles. Only markers that
showed the best values for the parameters mentioned above were kept in
the smaller panels. The performance of each panel regarding the kinship
estimates was graphically evaluated. Furthermore, the means of all

3
A.R.S. de Deus et al. Small Ruminant Research 201 (2021) 106399

Table 3 3. Results
List of markers used in the four microsatellite panels evaluated.
Panel 1 Panel 2 Panel 3 Panel 4 3.1. Overall analyses
MAF065 MAF065 MAF065 MAF065
BM6526 BM6526 BM6526 MAF209 Based on the estimates, assuming Hardy-Weinberg equilibrium and
INRA23 INRA23 OarFCB304 BM6526 heterozygote deficiency (Brookfield, 1996), the presence of null alleles
ETH10 ETH10 INRA23 OarFCB304 was observed in 10 microsatellite markers when all individuals were
BM8125 BM8125 ETH10 CSSM66 considered in the analysis. When the analyses of different farms were
BM1818 BM1818 BM8125 ILSTS11
ILSTS87 ILSTS87 BM1818 INRA23
considered, the number of markers with null alleles decreased. How­
INRABERN172 INRABERN172 ILSTS87 ETH10 ever, it was not possible to estimate the presence of null alleles in POP 7,
CSRD247 CSRD247 INRABERN172 BM8125 due to its small sample size. The locus CSRM60 demonstrated the
OarFCP48 TGLA122 CSRD247 MM12 occurrence of null alleles in all populations, with a frequency above
ETH225 TGLA122 BM1329
0.40, whereas the locus ETH225 contained null alleles only when all
OarFCP48 ETH225 BM1818
OarFCP48 INRA063 individuals were considered. In all analyses, the frequencies of null al­
INRA063 ILSTS87 leles were lower than 0.20 for all microsatellite markers, with the
OarFCP48 INRABERN172 exception of the locus CSRM60. According to Dakin and Avise (2004),
CSRD247 null allele frequencies lower than 0.20 do not affect the quality of
TGLA122
ETH225
markers for kinship analysis. Thus, only the locus CSRM60 was excluded
OarFCP48 from the kinship analysis, because of its high null allele frequency (>
0.20).
The performance analyses indicated that all markers deviated from
kinship values obtained in the four panels were compared. the Hardy-Weinberg equilibrium. The number of alleles ranged from 9
(locus ILSTS11) to 36 (locus INRABERN172), with a total of 308 alleles
2.5. Analysis of SNP data generated by all samples. All markers were highly polymorphic, with
minimum PIC of 0.72 (ILST11), maximum PIC of 0.93 (CSRD247), and
For kinship analysis using SNP markers, the 257 individuals that mean PIC of 0.88 ± 0.05. The expected heterozygosity (He) ranged from
were analyzed using microsatellites were used to create the G matrix 0.76 (ILST11) to 0.93 (MAF209, BM1818, and CSRD247), with a mean
(genomic relationship matrix). For this, we used information of animals of 0.89 ± 0.21. The minimum observed heterozygosity (Ho) was 0.00
genotyped with the OvineSNP50 BeadChip array (Illumina Inc., San (CSRM60), whereas the maximum Ho was 0.93 (OarFCB304), and the
Diego, CA, EUA). This panel contains 54,241 SNPs evenly spaced mean Ho was 0.78 ± 0.04.
throughout the sheep (Ovis aries) chromosomes.
Initially, we performed the quality control of SNP data using the 3.2. Kinship analysis using microsatellites
PREGSF90 program (Misztal et al., 2018). Quality control consisted of
excluding SNP markers with unknown genomic positions, located on sex The simulation analysis of markers from all individuals indicated
chromosomes or mitochondrial DNA, with minor allele frequency (MAF) that the estimators TrioML and DyadML were the best for true kinship
lower than 0.01, call rate lower than 0.90 (i.e., genotyping rate < 90 %), analysis in the proposed population, with means 0.34 and 0.35,
and in extreme departure from Hardy-Weinberg equilibrium (P-value < respectively. The values of both these estimators were the closest to the
10− 6). Also, monomorphic markers were removed. After the quality true value of 1. Furthermore, the estimators TrioML and DyadML were
control, 47,069 SNPs remained for further analyses. highly correlated (0.99). The lowest kinship mean was presented by the
The G matrix was calculated according to VanRaden (2008), as Ritland estimator (0.31). The lowest correlation was observed between
follows: the estimators Ritland and Wang (Table 4).
ZDZ’ When the Panel 4 was used in the whole population (POP 1), the
G = ∑m
2 i=1 pi(1 − pi) pairs of individuals (that is, groups of any two animals in the population)
were grouped into four categories according to mean kinship values.
where Z is a matrix that relates genotypes of each locus, D is a diagonal Therefore, r = 0.25 for half siblings (HS), r = 0.00 for unrelated in­
matrix of weights for variances of SNPs, and pi is the minor allele fre­ dividuals (UR), r = 0.50 for full siblings (FS), and r = 0.50 for parent-
quency of SNP i. offspring (PO). The minimum pairwise kinship was 0.00, whereas the
maximum was 0.81, and the mean was 0.35.
2.6. Performance comparison of SNP and microsatellite markers Individuals of the FS (r = 0.23 to 0.81) and HS (r = 0.04 to 0.51)
groups showed higher variation of r, whereas unrelated individuals (r =
There are few reports comparing the power of microsatellites and 0.00 to 0.22) and parent-offspring (r = 0.50 to 0.76) had r values closer
SNPs for kinship analysis, especially in sheep. Therefore, we compared to the expected. Most of the relationships between individuals were in
kinship estimates obtained using information of 47,069 SNPs to results the categories UR and HS (Fig. 1). A great number of pairs of animals
obtained using the four microsatellite panels (Table 3) to evaluate the were composed of full sibs, whereas parent-offspring represented the
variation in the estimates. lowest number of relationships between pairs of individuals. When the
In order to check the true kinship generated using SNP and micro­ populations were analyzed separately, the number of FS pairs increased.
satellite data, as well as to infer the performance of each panel, we This suggests that a great part of the individuals is closely related and
created graphics of distribution of the kinship values estimated using many individuals with common ancestors have mated. As a conse­
SNPs and the four microsatellite panels. The Pearson correlation be­ quence, this could cause genetic losses in the studied flocks due to
tween kinships estimated using SNPs and microsatellites was calculated inbreeding.
to evaluate the association between values estimated using the different In kinship analyses considering the 257 genotyped individuals, the
approaches. four microsatellite panels enabled the estimation of the degree of
relatedness between individuals. However, the panel containing 10 loci
did not demonstrate a high confidence level. The kinship estimated
using the Panel 1 showed the highest variation around the expected
kinship values, whereas the Panels 2, 3, and 4 showed r values closer to

4
A.R.S. de Deus et al. Small Ruminant Research 201 (2021) 106399

Table 4
Means and variances of kinship estimates and correlations among the seven estimators used in the whole population (POP 1) of Santa Inês sheep evaluated.
Estimator
Parameter
TrioML Wang LynchLi LynchRd Ritland QuellerGt DyadML

Mean 0.34 0.32 0.32 0.32 0.31 0.32 0.35

Variance 0.03 0.03 0.03 0.04 0.04 0.03 0.03
Estimator Wang LynchLi LynchRd Ritland QuellerGt DyadML
TrioML 0.97 0.98 0.91 0.87 0.98 0.99
Wang 0.98 0.90 0.84 0.97 0.97
Correlation LynchLi 0.90 0.85 0.99 0.98
LynchRd 0.94 0.90 0.92
Ritland 0.86 0.87
QuellerGt 0.98

individuals were unrelated. This indicates that a low number of micro­

satellite markers can generate reliable results, considering that a panel
containing 12 markers showed results similar to those obtained using a
panel with 19 microsatellite markers (Fig. 2).

3.3. Comparison of kinship estimates obtained using SNP and

microsatellite markers

The genomic relationship matrix obtained using the SNP panel

Fig. 1. Distribution of pairs of individuals in the different relationship cate­
gories. UR: unrelated; HF: half sibs; FS: full sibs; PO: parent-offspring.
the expected for each degree of relatedness (Fig. 2).
The average genomic kinships were similar in the four microsatellite
panels evaluated, i.e., 0.08 for Panel 1, 0.07 for Panel 2, 0.07 for Panel 3,
and 0.06 for Panel 4. These values were expected, as most of the pairs of
showed r values ranging from 0.00 to 0.66, with a mean of 0.04. These
values were similar to those obtained using microsatellite panels.
Most of the pairs of individuals showed r values close to 0.04 when
the SNP panel was used, whereas using the microsatellite panels, most of
the kinship estimates between any two individuals of the population
were centered to zero (Fig. 3). Furthermore, whereas the number of
microsatellite markers increased, the number of individuals with r =
0.00 decreased and the frequency of kinship values between 0.06 and
0.08 increased. The mean kinship value in the Panel 1 (0.08) was the
most distant of the mean value obtained using the SNP panel (0.04). On
the other hand, the mean obtained using the Panel 4 (0.06) was the
closest to the mean value obtained using SNPs. The mode values were
equal in all microsatellite panels, where the most frequent value was

Fig. 2. Kinship values for pairs of individuals with different degrees of relatedness obtained using microsatellite panels containing 10 (Panel 1), 12 (Panel 2), 15
(Panel 3), and 19 (Panel 4) markers.

5
A.R.S. de Deus et al. Small Ruminant Research 201 (2021) 106399

Fig. 3. Distribution of kinship values estimated using a SNP panel (47,069 SNPs of the panel OvineSNP50 BeadChip, Illumina Inc.) and different microsatellite panels
containing 10 (Panel 1), 12 (Panel 2), 15 (Panel 3), and 19 (Panel 4) markers.

zero. the Ritland estimator showed the lowest mean kinship value. TrioML is a
In general, the kinship estimates generated using either the SNP triadic likelihood estimator that uses a third individual (W) as a control
panel or the microsatellite panels were close, as the relationship in the estimate of r between two focal individuals (X and Y), thus
matrices were highly correlated (Table 5). As expected, the lowest cor­ reducing the chance that genes identical by state (IBS) be erroneously
relation was obtained between the kinships estimated using the SNP inferred as identical by descent (IBD) (Wang, 2007). DyadML is a dyadic
panel and the Panel 1 (0.89), whereas the highest correlation was ob­ likelihood estimator that takes into account different sampling condi­
tained between the kinships obtained using the SNP panel and the Panel tions, such as the number of sampled loci, number of segregating alleles,
4 (0.94). and allele frequencies (Milligan, 2003). The Ritland estimator, in turn,
depends greatly on the true relationship between individuals and the
4. Discussion real genetic information. Thus, this estimator is more sensitive to gen­
otyping errors (Ritland, 1996).
When the performance of markers was evaluated, it was possible to In the analyses considering either the farms separately or using a
observe that only the locus CSRM60 had null allele frequency higher single population with all individuals, a great part of the pairs of in­
than 0.20, whereas the null allele frequencies of all other microsatellite dividuals showed some degree of relatedness. These results indicate that
markers did not affect their quality for kinship analysis (Dakin and these populations have a great number of individuals with a common
Avise, 2004). This can be confirmed by the results of the degree of sire or dam. This type of kinship is common in sheep flocks because most
polymorphism and the number of alleles, which were high for the 19 of the sheep breeders use one or few breeding males for a long time,
microsatellite markers evaluated. These results are expected for micro­ which contributes to the family structure mentioned above (Tino et al.,
satellite loci, as high polymorphisms are common in various species, as 2020). This may cause some undesirable effects in the medium and long
observed by Al-Atiyat (2015) in Australian sheep and by Agung et al. terms, such as the loss of genetic information. As a consequence, this can
(2019) in cattle. affect the conservation of genetic resources and increase thehomo­
The simulation results showed that the likelihood estimators TrioML zygosity. Thus, the careful monitoring of these populations is important
and DyadML had the highest mean kinship values. On the other hand, to perform more efficient inbreeding control.
The knowledge on the degree of relatedness between two individuals
of a population is essential for different types of studies, such as con­
Table 5 servation of species, genetic improvement, and prediction of breeding
Pearson correlation between relationship matrices obtained using a SNP panel values in populations with poor pedigree information, but that have
and different microsatellite panels. individuals with a close relative with known records. The Santa Inês
Panel Panel 1a Panel2a Panel3a Panel4a breed has been subjected to random mating and crossbreeding that
SNP b
0.89 0.92 0.92 0.94 cause loss of genetic variability, as well as the decrease in the quality of
Panel1a 1.00 0.99 0.99 the flock (Santos et al., 2016). Also, pedigree errors caused especially by
Panel2a 1.00 0.99 failures in mating records are common in Santa Inês sheep flocks (Ó
Panel3a 1.00
et al., 2012). In this context, we must also consider the difficulty of
a
Microsatellite panels containing 10 (Panel 1), 12 (Panel 2), 15 (Panel 3), and implementation of programs that support the selection and conservation
19 (Panel 4) markers. of genetic resources, as most of these programs have difficult execution
b
Information of 47,069 SNPs of the panel OvineSNP50 BeadChip (Illumina and high costs.
Inc.).

6
A.R.S. de Deus et al.
In the present study, panels containing more than 12 microsatellite
markers were efficient for kinship estimation with a 95 % confidence.
This indicates that a low number of markers can generate accurate re­
sults. These results corroborate the study of Yilmaz (2016), who tested
seven microsatellite panels for paternity analysis in sheep and obtained
the best result using a panel containing 12 markers. Yilmaz et al. (2018)
also demonstrated that paternity testing achieved high accuracy using a
relatively small number of microsatellites (less than 12). Nevertheless,
as mentioned above, there is a paucity of analysis comparing the accu­
racy of microsatellites and SNPs for kinship analysis in sheep. To the best
of our knowledge, there are no reports of this type of study in Santa Inês
sheep.
Several studies have already used SNP markers to construct the
relationship of individuals (e.g. Santure et al., 2010; Harlizius et al.,
2011; Lopes et al., 2013). SNP markers have as advantages their wide
coverage of the genome (Brumfield et al., 2003) and the low rate of
genotyping error. Nevertheless, SNPs are biallelic and have a low het­
erozygosity rate (Kaiser et al., 2017). Therefore, a higher number of
SNPs is recommended for kinship analysis (Glaubitz et al., 2003; Santure
et al., 2010).
The large amount of data generated when SNPs are used may limit
their use, due to the increase in complexity of computational analyses
(Hubley et al., 2003). This may increase the cost of the analyses, which
may be a problem, especially for small flocks (Santos et al., 2017).
In the present study, the kinship values obtained using microsatellite
panels were similar to those obtained using SNP data. However, more
pairs of individuals with r = 0.00 were identified using the panels
containing 10 and 12 microsatellites than using the SNP panel. These
results were expected and confirm that a reduced number of microsat­
ellite markers have informative potential for kinship estimation equiv­
alent to a great number of SNP markers.
Thus, kinship analysis using microsatellite markers can be included
in Santa Inês sheep breeding and conservation programs to ensure
efficient inbreeding control and avoid the loss of genetic information.
Also, the application of this methodology in breeding programs can help
in the genetic improvement of the Santa Inês breed through the esti­
mation of breeding values of these sheep for traits of interest. In the
current study, this methodology generated reliable results and had lower
costs than the analysis that used SNPs for kinship estimation in flocks
with small size or poor pedigree control.
5. Conclusions
A panel containing as low as 12 microsatellite markers can
adequately estimate kinship in Santa Inês sheep, with a 95 % confidence.
The kinship obtained using this panel was highly correlated with that
estimated using SNP markers.
Thus, it is possible to infer that the use of microsatellite markers is a
suitable alternative for kinship estimation in Santa Inês sheep and can be
used to give support in breeding programs, conservation of genetic re­
sources, and flocks with poor genealogical control. Furthermore, the
information generated by microsatellites in this study can be used to
correct pedigree errors and for inbreeding control, thus resulting in
gains in prediction of breeding values. These benefits of the use of
microsatellites would improve the production and health of animals,
and increase the profitability of sheep breeders, especially in developing
or emerging countries.
Funding
The National Council for Scientific and Technological Development
(CNPq) granted a scholarship to the first author. This study was also
partially funded by the Coordenação de Aperfeiçoamento de Pessoal de
Nível Superior – Brasil (CAPES – Register number: 001). The Brazilian
National Institute of Science and Technology in Animal Science (INCT-
CA; Process 465377/2014− 9), the National Council for Scientific and
7
Small Ruminant Research 201 (2021) 106399
Technological Development (CNPq; Process: 481031/2012− 0), the
Federal University of Piauí (UFPI; Grant 2013NE801717), and the
Foundation for Support to Research and Scientific and Technological
Development of Maranhão (FAPEMA; Process 01488/16) gave financial
support for the genotyping of the animals.
Authors’ contribution
Alzira Regina Silva de Deus: Conceptualization, Data curation,
Investigation, Methodology, Project administration, Software, Writing -
Original Draft. Geice Ribeiro Silva: Methodology, Software, Formal
analysis, Writing – Review & Editing. Luciano Silva Sena: Methodol­
ogy, Software, Formal analysis, Investigation, Writing – Review &
Editing. Fábio Barros Britto: Validation, Writing – Review & Editing.
Débora Araújo de Carvalho: Methodology, Writing – Review & Edit­
ing. Jorge Victor Gomes de Freitas: Methodology, Writing – Review &
Editing. José Lindenberg Rocha Sarmento: Conceptualization, Meth­
odology, Validation, Supervision, Project administration, Funding
acquisition, Writing – Review & Editing.
Declaration of Competing Interest
The authors declare that there are no conflicts of interest.
Acknowledgements
The authors thank the support given by the Santa Inês sheep breeders
of the Piauí and Maranhão states and Embrapa Meio-Norte for the data
collection.
References
Agung, P.P., Saputra, F., Zein, M.S.A., Wulandari, A.S., Putra, W.P.B., Said, S., Jakaria, J.,
2019. Genetic diversity of Indonesian cattle breeds based on microsatellite markers.
Asian Australas. J. Anim. Sci. 32, 467–476. https://doi.org/10.5713/ajas.18.0283.
Al-Atiyat, R.M., 2015. The power of 28 microsatellite markers for parentage testing in
sheep. Electron. J. Biotechnol. 18, 116–121. https://doi.org/10.1016/j.
ejbt.2015.01.001.
Alves, A.A.C., Lôbo, A.M.B.O., Facó, O., Silva, L.P., Lôbo, R.N.B., 2016. Genetic
parameters for rank of the Santa Inês sheep in agricultural fairs using Bayesian
procedures. Ital. J. Anim. Sci. 15, 604–609. https://doi.org/10.1080/
1828051X.2016.1248866.
Benbouza, H., Jacquemin, J.M., Baudoin, J.P., Mergeai, G., 2006. Optimization of a
reliable, fast, cheap and sensitive silver staining method to detect SSR markers in
polyacrylamide gels. Biotechnol. Agron. Soc. Environ. 10, 77–81. https://popups.
uliege.be:443/1780-4507/index.php?id=1128.
Blouin, M.S., 2003. DNA-based methods for pedigree reconstruction and kinship analysis
in natural populations. Trends Ecol. Evol. (Amst.) 18, 503–511. https://doi.org/
10.1016/S0169-5347(03)00225-8.
Botstein, D., White, R.L., Skolnick, M., Davis, R.W., 1980. Construction of a genetic
linkage map in man using restriction fragment length polymorphisms. Am. J. Hum.
Genet. 32, 314–331. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1686077/.
Brazilian Association of Sheep Breeders – ARCO, 2019. Padrões Raciais (accessed 17
June 2019). http://www.arcoovinos.com.br/index.php/mn-srgo/mn-padroesraciai
s/40-santa-ines/.
Brazilian Institute of Geography and Statistics – IBGE, 2018. Produção Da Pecuária
Municipal (accessed 12 December 2018). https://agenciadenoticias.ibge.gov.br/
media/com_mediaibge/arquivos/6d3123bbf5f78aa3492c41003c7a38f6.pdf.
Brookfield, J.F., 1996. A simple new method for estimating null allele frequency from
heterozygote deficiency. Mol. Ecol. 5, 453–455. https://doi.org/10.1046/j.1365-
294X.1996.00098.x.
Brumfield, R.T., Beerli, P., Nickerson, D.A., Edwards, S.V., 2003. The utility of single
nucleotide polymorphisms in inferences of population history. Trends Ecol. Evol. 18,
249–256. https://doi.org/10.1016/S0169-5347(03)00018-1.
Dakin, E.E., Avise, J.C., 2004. Microsatellite null alleles in parentage analysis. Heredity
93, 504–509. https://doi.org/10.1038/sj.hdy.6800545.
Ellegren, H., 2004. Microsatellites: simple sequences with complex evolution. Nat. Rev.
Genet. 5, 435–445. https://doi.org/10.1038/nrg1348.
Food and Agriculture Organization (FAO), 2004. Secondary Guidelines for Development
of National Farm Animal Genetic Resources Management Plans: Measurement of
Domestic Animal Diversity (MoDAD): Recommended Microsatellite Markers.
Recommendations of joint International Society of Animal Genetics (ISAG)/FAO
Standing Committee, Rome, Italy. http://www.fao.org/3/a-aq569e.pdf.
Glaubitz, J.C., Rhodes Jr, O.E., Dewoody, J.A., 2003. Prospects for inferring pairwise
relationships with single nucleotide polymorphisms. Mol. Ecol. 12, 1039–1047.
https://doi.org/10.1046/j.1365-294x.2003.01790.x.
A.R.S. de Deus et al.
Goudet, J., Kay, T., Weir, B.S., 2018. How to estimate kinship. Mol. Ecol. 27, 4121–4135.
https://doi.org/10.1111/mec.14833.
Harlizius, B., Lopes, M.S., Duijvesteijn, N., Van De Goor, L.H.P., Van Haeringen, W.A.,
Panneman, H., Guimarães, S.E.F., Merks, J.W.M., Knol, E.F., 2011. A single
nucleotide polymorphism set for paternal identification to reduce the costs of trait
recording in commercial pig breeding. J. Anim. Sci. 89, 1661–1668. https://doi.org/
10.2527/jas.2010-3347.
Hayes, B.J., 2011. Technical note: efficient parentage assignment and pedigree
reconstruction with dense single nucleotide polymorphism data. J. Dairy Sci. 94,
2114–2117. https://doi.org/10.3168/jds.2010-3896.
Heaton, M.P., Harhay, G.P., Bennett, G.L., Stone, R.T., Grosse, W.M., Casas, E., Keele, J.
W., Smith, T.P.L., Chitko-McKown, C.G., Laegreid, W.W., 2002. Selection and use of
SNP markers for animal identification and paternity analysis in U.S. Beef cattle.
Mamm. Genome 13, 272–281. https://doi.org/10.1007/s00335-001-2146-3.
Hubley, R.M., Zitzler, E., Roach, J.C., 2003. Evolutionary algorithms for the selection of
single nucleotide polymorphisms. BMC Bioinform. 4 (30) https://doi.org/10.1186/
1471-2105-4-30, 2003.
Kaiser, S.A., Taylor, S.A., Chen, N., Sillett, T.S., Bondra, E.R., Webster, M.S., 2017.
A comparative assessment of SNP and microsatellite markers for assigning parentage
in a socially monogamous bird. Mol. Ecol. Resour. 17, 183–193. https://doi.org/
10.1111/1755-0998.12589.
Kling, D., Welander, J., Tillmar, A., Skare, O., Egeland, T., Holmlund, G., 2012. DNA
microarray as a tool in establishing genetic relatedness – current status and future
prospects. Forensic Sci. Int. Genet. 6, 322–329. https://doi.org/10.1016/j.
fsigen.2011.07.007.
Li, C.C., Weeks, D.E., Chakravarti, A., 1993. Similarity of DNA fingerprints due to chance
and relatedness. Hum. Hered. 43, 45–52. https://doi.org/10.1159/000154113.
Lobo, R.N.B., 2019. Opportunities for investment into small ruminant breeding
programmes in Brazil. J. Anim. Breed. Genet. 136, 313–318. https://doi.org/
10.1111/jbg.12396.
Lopes, M.S., Silva, F.F., Harlizius, B., Duijvesteijn, N., Lopes, P.S., Guimarães, S.E.F.,
Knol, E.F., 2013. Improved estimation of inbreeding and kinship in pigs using
optimized SNP panels. BMC Genet. 14, 92. https://doi.org/10.1186/1471-2156-14-
92.
Lynch, M., 1988. The divergence of neutral quantitative characters among partially
isolated populations. Evolution 42, 455–466. https://doi.org/10.1111/j.1558-
5646.1988.tb04152.x.
Lynch, M., Ritland, K., 1999. Estimation of pairwise relatedness with molecular markers.
Genetics 152, 1753–1766. https://www.genetics.org/content/152/4/1753.
Marshall, T.C., Slate, J., Kruuk, L.E., Pemberton, J.M., 1998. Statistical confidence for
likelihood-based paternity inference in natural populations. Mol. Ecol. 7, 639–655.
https://doi.org/10.1046/j.1365-294x.1998.00374.x.
McManus, C., Paiva, S.R., Araújo, R.O., 2010. Genetics and breeding of sheep in Brazil.
Rev. Bras. Zoot. 39, 236–246. https://doi.org/10.1590/S1516-
35982010001300026.
Milligan, B.G., 2003. Maximum-likelihood estimation of relatedness. Genetics 163,
1153–1167. http://www.genetics.org/content/163/3/1153.
Misztal, I., Tsuruta, S., Lourenco, D.A.L., Masuda, Y., Aguilar, I., Legarra, A., Vitezica, Z.,
2018. Manual for BLUPF90 Family of Programs (accessed 10 May 2019). http://nce.
ads.uga.edu/wiki/lib/exe/fetch.php?media=blupf90_all7.pdf.
Morin, P.A., Luikart, G., Wayne, R.K., the SNP workshop group, 2004. SNPs in ecology,
evolution and conservation. Trends Ecol. Evol. 19, 208–216. https://doi.org/
10.1016/j.tree.2004.01.009.
Ó, A.O., Rêgo Neto, A.A., Santos, G.V., Sarmento, J.L.R., Biagiotti, D., Sousa, J.E.R.,
2012. Curva de crescimento de ovinos Santa Inês no Vale do Gurgueia. R. Bras.
Saúde Prod. Anim. 13, 912–922. https://doi.org/10.1590/S1519-
99402012000400019.
Panetto, J.C.C., Machado, M.A., da Silva, M.V.G.B., Barbosa, R.S., Santos, G.G., Leite, R.
M.H., Peixoto, M.G.C.D., 2017. Parentage assignment using SNP markers, inbreeding
and population size for the Brazilian Red Sindhi cattle. Livest. Sci. 204, 33–38.
https://doi.org/10.1016/j.livsci.2017.08.008.
Pew, J., Muir, P.H., Wang, J., Frasier, T.R., 2015. Related: an R package for analysing
pairwise relatedness from codominant molecular markers. Mol. Ecol. Resour. 15,
557–561. https://doi.org/10.1111/1755-0998.12323.
Queller, D.C., Goodnight, K.F., 1989. Estimating relatedness using genetic markers.
Evolution 43, 258–275. https://doi.org/10.1111/j.1558-5646.1989.tb04226.x.
Small Ruminant Research 201 (2021) 106399
R Development Core Team, 2013. R: a Language and Environment for Statistical
Computing. R Foundation for Statistical Computing, Vienna, Austria. http://www.
R-project.org/.
Rego Neto, A., Sarmento, J.L.R., Santos, N.P.S., Campelo, J.E.G., Sena, L.S., Biagiotti, D.,
Santos, G.V., 2018. Population genetic structure of Santa Inês sheep in Brazil. Trop.
Anim. Health Prod. 50, 503–508. https://doi.org/10.1007/s11250-017-1459-5.
Ritland, K., 1996. Estimators for pairwise relatedness and individual inbreeding
coefficients. Genet. Res. 67, 175–185. https://doi.org/10.1017/
S0016672300033620.
Santos, N.P.S., Sarmento, J.L.R., Carvalheiro, R., Campelo, J.E.G., Sousa, W.H.,
Figueiredo Filho, L.A.S., Rego Neto, A.A., Biagiotti, D., 2016. Contribuição genética
ótima aplicada à seleção de ovinos Santa Inês. Pesq. Agropec. Bras. 51, 745–750.
https://doi.org/10.1590/S0100-204X2016000600006.
Santos, B.F., van der Werf, J.H., Gibson, J.P., Byrne, T.J., Amer, P.R., 2017. Genetic and
economic benefits of selection based on performance recording and genotyping in
lower tiers of multi-tiered sheep breeding schemes. Genet. Sel. Evol. 49, 10. https://
doi.org/10.1186/s12711-016-0281-2.
Santure, A.W., Stapley, J., Ball, A.D., Birkhead, T.R., Burke, T., Slate, J., 2010. On the use
of large marker panels to estimate inbreeding and relatedness: empirical and
simulation studies of a pedigreed zebra finch population typed at 771 SNPs. Mol.
Ecol. 19, 1439–1451. https://doi.org/10.1111/j.1365-294X.2010.04554.x.
Sousa, W.H., Lôbo, R.N., Morais, O.R., 2003. Ovinos Santa inês: estado de arte e
perspectivas (Santa Inês hair sheep: state of the art and perspectives). In: EMEPA
State Agriculture and Cattle Research Agency, João PessoaProceedings of the
International Symposium on Sheep and Goat Production, 2; International
Symposium on the Agribusiness of the Goat Milk Industry, 1, vol. 1, pp. 501–522.
Thompson, E.A., 2013. Identity by descent: variation in meiosis, across genomes, and in
populations. Genetics 194, 301–326. https://doi.org/10.1534/genetics.112.148825.
Tino, C.R.S., Cavani, L., Fonseca, R., Silva, K.M., 2020. Análise da estrutura populacional
de ovinos deslanados do núcleo de conservação. Arq. Bras. Med. Vet. Zootec. 72,
560–564. https://doi.org/10.1590/1678-4162-10502.
Tokarska, M., Marshall, T., Kowalczyk, R., Wójcik, J.M., Pertoldi, C., Kristensen, T.N.,
Loeschcke, V., Gregersen, V.R., Bendixen, C., 2009. Effectiveness of microsatellite
and SNP markers for parentage and identity analysis in species with low genetic
diversity: the case of European bison. Heredity 103, 326–332. https://doi.org/
10.1038/hdy.2009.73.
Van Oosterhout, C., Hutchinson, W.F., Wills, D.P.M., Shipley, P., 2004. MICRO-
CHECKER: software for identifying and correcting genotyping errors in
microsatellite data. Mol. Ecol. Notes 4, 535–538. https://doi.org/10.1111/j.1471-
8286.2004.00684.x.
VanRaden, P.M., 2008. Efficient methods to compute genomic predictions. J. Dairy Sci.
91, 4414–4423. https://doi.org/10.3168/jds.2007-0980.
Wang, J., 2002. An estimator for pairwise relatedness using molecular markers. Genetics
160, 1203–1215. https://www.genetics.org/content/160/3/1203.
Wang, J., 2006. Informativeness of genetic markers for pairwise relationship and
relatedness inference. Theor. Popul. Biol. 70, 300–321. https://doi.org/10.1016/j.
tpb.2005.11.003.
Wang, J., 2007. Triadic IBD coefficients and applications to estimating pairwise
relatedness. Genet. Res. 89, 135–153. https://doi.org/10.1017/
s0016672307008798.
Wang, J., 2011. COANCESTRY: a program for simulating, estimating and analysing
relatedness and inbreeding coefficients. Mol. Ecol. Resour. 11, 141–145. https://doi.
org/10.1111/j.1755-0998.2010.02885.x.
Webster, M.S., Reichart, L.M., 2005. Use of microsatellites for parentage and kinship
analyses in animals. Methods Enzymol. 395, 222–238. https://doi.org/10.1016/
S0076-6879(05)95014-3.
Yilmaz, O., 2016. Power of different microsatellite panels for paternity analysis in sheep.
Anim. Sci. Pap. Rep. 34, 155–164. http://archiwum.ighz.edu.pl/files/objects/7605/
66/str_155-164.pdf.
Yilmaz, O., Cemal, I., Coşkun, B., Oğrak, Y.Z., Ata, N., Karaca, O., 2018. Comparison of
different paternity test panels in sheep. Turk. J. Vet. Anim. Sci. 42, 633–641. https://
doi.org/10.3906/vet-1805-80.
Yu, G.C., Tang, Q.Z., Long, K.R., Che, T.D., Li, M.Z., Shuai, S.R., 2015. Effectiveness of
microsatellite and single nucleotide polymorphism markers for parentage analysis in
European domestic pigs. Genet. Mol. Res. 14, 1362–1370. https://doi.org/10.4238/
2015.February.13.15.