Herpes Simplex Virus: Methods and Protocols

Methods in
Molecular Biology 2060
Russell J. Diefenbach
Cornel Fraefel Editors
Herpes
Simplex Virus
Methods and Protocols
Second Edition
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK
For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by-
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
Herpes Simplex Virus
Methods and Protocols
Second Edition
Edited by
Russell J. Diefenbach
Department of Biomedical Sciences, Macquarie University, Sydney, NSW, Australia
Cornel Fraefel
Institute of Virology, University of Zurich, Zürich, Switzerland
Editors
Russell J. Diefenbach Cornel Fraefel
Department of Biomedical Sciences Institute of Virology
Macquarie University University of Zurich
Sydney, NSW, Australia Zürich, Switzerland
ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-4939-9813-5 ISBN 978-1-4939-9814-2 (eBook)
https://doi.org/10.1007/978-1-4939-9814-2
© Springer Science+Business Media, LLC, part of Springer Nature 2020
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.
The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Cover caption: HSV-1 virions in the extracellular space of Vero cells prepared for electron microscopy by high-pressure
freezing, freeze-substitution, embedding in epon and ultrathin sectioning showing core, capsid, tegument, envelope and
glycoproteins. The size difference is due to the section plane. Bar ¼ 100 nm. Elisabeth M. Schraner, Institute of Virology,
University of Zurich, Zürich, Switzerland.
This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.
Preface
Herpes simplex viruses type 1 and 2 (HSV-1, HSV-2) are important human pathogens.
HSV-1, for example, has a worldwide seroprevalence of more than 80% in adults. The virus
typically enters orofacial mucosal epithelial cells, where productive infection takes place, but
it can also infect genital mucosa epithelial cells. Productive replication in epithelial cells leads
to release of progeny virus at the site of host entry, from where the virus can access neurons
of the trigeminal ganglia to establish lifelong latency and to create a reservoir for periodic
reactivation. In immunocompromised patients, HSV-1 can cause severe meningoencephali-
tis or keratoconjunctivitis that can lead to permanent neurological damage and death or
blindness, respectively, if not treated. The herpes simplex viruses have been the prototype
viruses of the Alphaherpesvirinae subfamily and have been extensively studied for decades on
all aspects of infection, replication, and pathogenesis. HSV-1 and HSV-2 have also become
important tools to study cell biology and immunology, and for the development of innova-
tive vaccines and vectors for gene- and tumor therapy.
It would be impossible to cover all aspects of methodology related to the investigation
of herpes simplex viruses in one book. We hope in this second edition that we have again
successfully encapsulated a significant breath of relevant methodology but also incorporated
new rapidly developing technologies such as next-generation sequencing, CRISPR/Cas9
engineering, and the use of BioID to identify protein–protein interactions. The chapters
contained within will be of interest to immunologists as well as molecular and cell biologists.
It will appeal to those researchers who wish to initiate molecular- and/or cellular-based
approaches to investigate HSV. Many of the techniques can be readily translated to other
closely related herpesviruses.
The first two chapters of this book include comprehensive reviews on HSV-1 biology
and life cycle and the current state of play in antiviral and vaccine development. These are
followed by a wide collection of protocols, including basic protocols on growing viruses
in cell culture and manipulating viral DNA. Other chapters describe approaches to design
and application of HSV-1 vectors for cancer- and gene therapy, or to study specific
aspects of HSV-1 biology such as latency, intracellular transport, and protein–protein
interaction using a number of cell culture and animal models. Rapidly developing areas
such as the topic of extracellular vesicles, in the context of HSV-1, have also been included.
Procedures for structural analyses, microscopy, proteomics, and testing of antivirals are
included as well. The methods provided are intended to aid new researchers in the field of
herpes virology as well as those experienced investigators wishing to embark on new
techniques.
We would like to thank all who have contributed to the completion of this book, in
particular the authors of the chapters. We would also like to thank the editor of the Methods
in Molecular Biology series, John Walker, for his constant support during the preparation of
this volume. We gladly accepted John’s invitation to co-edit a second edition of a HSV
protocols book largely based on our prior experience with the first edition and how well it
v
vi Preface
has been received. Finally, we hope that our book will help many researchers in the herpes
virus field in their pursuit of understanding the complex interactions between herpes virus
and host. Still, much remains to be discovered!
Sydney, NSW, Australia Russell J. Diefenbach

Zürich, Switzerland Cornel Fraefel
Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
1 Tour de Herpes: Cycling Through the Life and Biology of HSV-1 . . . . . . . . . . . . 1

Christopher E. Denes, Roger D. Everett, and Russell J. Diefenbach
2 Vaccines for Herpes Simplex: Recent Progress Driven by Viral
and Adjuvant Immunology. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Kerrie J. Sandgren, Naomi R. Truong, Jacinta B. Smith,
Kirstie Bertram, and Anthony L. Cunningham
3 Herpes Simplex Virus Growth, Preparation, and Assay . . . . . . . . . . . . . . . . . . . . . . 57
Sereina O. Sutter, Peggy Marconi, and Anita F. Meier
4 Engineering HSV-1 Vectors for Gene Therapy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
William F. Goins, Shaohua Huang, Bonnie Hall, Marco Marzulli,
Justus B. Cohen, and Joseph C. Glorioso
5 Preparation of Herpes Simplex Virus Type 1 (HSV-1)-Based
Amplicon Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91
Cornel Fraefel and Alberto L. Epstein
6 HSV-1 Amplicon Vectors as Genetic Vaccines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
Anita F. Meier and Andrea S. Laimbacher
7 oHSV Genome Editing by Means of galK Recombineering . . . . . . . . . . . . . . . . . . 131
Laura Menotti, Valerio Leoni, Valentina Gatta, Biljana Petrovic,
Andrea Vannini, Simona Pepe, Tatiana Gianni, and Gabriella
Campadelli-Fiume
8 Rescue, Purification, and Characterization of a Recombinant
HSV Expressing a Transgenic Protein . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 153
Andrea Vannini, Biljana Petrovic, Valentina Gatta,
Valerio Leoni, Simona Pepe, Laura Menotti,
Gabriella Campadelli-Fiume, and Tatiana Gianni
9 CRISPR/Cas9-Based Genome Editing of HSV. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169
Thilaga Velusamy, Anjali Gowripalan, and David C. Tscharke
10 Latent/Quiescent Herpes Simplex Virus 1 Genome Detection
by Fluorescence In Situ Hybridization (FISH) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185
Camille Cohen, Armelle Corpet, Mohamed Ali Maroui,
Franceline Juillard, and Patrick Lomonte
11 Oligonucleotide Enrichment of HSV-1 Genomic DNA
from Clinical Specimens for Use in High-Throughput Sequencing. . . . . . . . . . . . 199
Mackenzie M. Shipley, Molly M. Rathbun, and Moriah L. Szpara
12 HSV Mutant Generation and Dual Detection Methods
for Gaining Insight into Latent/Lytic Cycles In Vivo . . . . . . . . . . . . . . . . . . . . . . . 219
Nancy M. Sawtell and Richard L. Thompson
vii
viii Contents
13 Phenotypic and Genotypic Testing of HSV-1 and HSV-2

Resistance to Antivirals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 241
Andreas Sauerbrei and Kathrin Bohn-Wippert
14 Using Primary SCG Neuron Cultures to Study Molecular
Determinants of HSV-1 Latency and Reactivation . . . . . . . . . . . . . . . . . . . . . . . . . . 263
Hui-Lan Hu, Kalanghad Puthankalam Srinivas, Ian Mohr,
Tony T. Huang, and Angus C. Wilson
15 Characterization of Extracellular HSV-1 Virions by Proteomics. . . . . . . . . . . . . . . 279
Roger Lippé
16 Analysis and Sorting of Individual HSV-1 Particles by Flow Virometry . . . . . . . . 289
Bita Khadivjam, Nabil El Bilali, and Roger Lippé
17 Isolation/Analysis of Extracellular Microvesicles from HSV-1-Infected
Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 305
Raquel Bello-Morales and José Antonio Lo pez-Guerrero
18 Conformational Change in Herpes Simplex Virus Entry
Glycoproteins Detected by Dot Blot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 319
Tri Komala Sari, Katrina A. Gianopulos, and Anthony V. Nicola
19 BioID Combined with Mass Spectrometry to Study
Herpesvirus Protein–Protein Interaction Networks . . . . . . . . . . . . . . . . . . . . . . . . . 327
Mujeeb R. Cheerathodi and David G. Meckes Jr.
20 Preparation of Herpes Simplex Virus-Infected Primary
Neurons for Transmission Electron Microscopy . . . . . . . . . . . . . . . . . . . . . . . . . . . . 343
Monica Miranda-Saksena, Ross A. Boadle,
and Anthony L. Cunningham
21 Transmission Immunoelectron Microscopy of Herpes Simplex
Virus-1-Infected Dorsal Root Ganglia Neurons Sectioned
in Growth Plane . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 355
Monica Miranda-Saksena, Ross A. Boadle,
22 Multifluorescence Live Analysis of Herpes Simplex Virus
Type-1 Replication. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 365
Michael Seyffert and Cornel Fraefel
23 Expression, Purification, and Crystallization of HSV-1
Glycoproteins for Structure Determination . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 377
Ellen M. White, Samuel D. Stampfer, and Ekaterina E. Heldwein
24 Expression, Purification, and Crystallization of Full-Length
HSV-1 gB for Structure Determination. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 395
Rebecca S. Cooper and Ekaterina E. Heldwein
25 The Use of Microfluidic Neuronal Devices to Study the Anterograde
Axonal Transport of Herpes Simplex Virus-1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 409
Kevin Danastas, Anthony L. Cunningham,
and Monica Miranda-Saksena
Contents ix
26 A Model of In Vivo HSV-1 DNA Transport Using Murine

Retinal Ganglion Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 419
Jennifer H. LaVail
27 The Murine Intravaginal HSV-2 Challenge Model for Investigation
of DNA Vaccines. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 429
Joshua O. Marshak, Lichun Dong, and David M. Koelle
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 455
Contributors
RAQUEL BELLO-MORALES Departamento de Biologı́a Molecular, Universidad Autonoma de

Madrid, Madrid, Spain; Centro de Biologı́a Molecular Severo Ochoa, CSIC-UAM,
Madrid, Spain
KIRSTIE BERTRAM Centre for Virus Research, The Westmead Institute for Medical Research,
Westmead, NSW, Australia; Sydney Medical School, The University of Sydney, Westmead,
NSW, Australia
ROSS A. BOADLE Westmead Research Hub, Westmead, NSW, Australia
KATHRIN BOHN-WIPPERT Department of Bioengineering, University of Illinois at Urbana-
Champaign, Urbana, IL, USA
GABRIELLA CAMPADELLI-FIUME Department of Experimental, Diagnostic and Specialty
Medicine, University of Bologna, Bologna, Italy
MUJEEB R. CHEERATHODI Department of Biomedical Sciences, Florida State University
College of Medicine, Tallahassee, FL, USA
CAMILLE COHEN Univ Lyon, Université Claude Bernard Lyon 1, CNRS UMR 5310,
INSERM U 1217, LabEx DEVweCAN, Institut NeuroMyoGène (INMG), Team
Chromatin Assembly, Nuclear Domains, Virus, Lyon, France
JUSTUS B. COHEN Department of Microbiology and Molecular Genetics, University of
Pittsburgh School of Medicine, Pittsburgh, PA, USA
REBECCA S. COOPER Department of Molecular Biology and Microbiology, Tufts University
School of Medicine, Boston, MA, USA
ARMELLE CORPET Univ Lyon, Université Claude Bernard Lyon 1, CNRS UMR 5310,
ANTHONY L. CUNNINGHAM Centre for Virus Research, The Westmead Institute for Medical
Research, Westmead, NSW, Australia; Sydney Medical School, The University of Sydney,
Westmead, NSW, Australia
KEVIN DANASTAS Centre for Virus Research, The Westmead Institute for Medical Research,
Westmead, NSW, Australia; The University of Sydney, Westmead, NSW, Australia
CHRISTOPHER E. DENES Centre for Virus Research, The Westmead Institute for Medical
Research, The University of Sydney, Westmead, NSW, Australia
RUSSELL J. DIEFENBACH Centre for Virus Research, The Westmead Institute for Medical
Research, The University of Sydney, Westmead, NSW, Australia; Department of Biomedical
Sciences, Faculty of Medicine and Health Sciences, Macquarie University, Sydney, NSW,
Australia
LICHUN DONG Department of Medicine, University of Washington, Seattle, WA, USA
NABIL EL BILALI Department of Pathology and Cell Biology, University of Montreal,
Montreal, QC, Canada
ALBERTO L. EPSTEIN UMR INSERM U1179, University of Versailles Saint Quentin en
Yvelines (UVSQ), Montigny le Bretonneux, France
ROGER D. EVERETT MRC-University of Glasgow Centre for Virus Research, Glasgow,
Scotland, UK
CORNEL FRAEFEL Institute of Virology, University of Zurich, Zürich, Switzerland
xi
xii Contributors
VALENTINA GATTA Department of Experimental, Diagnostic and Specialty Medicine,

University of Bologna, Bologna, Italy
TATIANA GIANNI Department of Experimental, Diagnostic and Specialty Medicine,
KATRINA A. GIANOPULOS Department of Veterinary Microbiology and Pathology, College of
Veterinary Medicine, Washington State University, Pullman, WA, USA; School of
Molecular Biosciences, College of Veterinary Medicine, Washington State University,
Pullman, WA, USA
JOSEPH C. GLORIOSO Department of Microbiology and Molecular Genetics, University of
WILLIAM F. GOINS Department of Microbiology and Molecular Genetics, University of
ANJALI GOWRIPALAN John Curtin School of Medical Research, The Australian National
University, Canberra, ACT, Australia
BONNIE HALL Department of Microbiology and Molecular Genetics, University of Pittsburgh
School of Medicine, Pittsburgh, PA, USA
EKATERINA E. HELDWEIN Department of Molecular Biology and Microbiology, Tufts
University School of Medicine, Boston, MA, USA
HUI-LAN HU Department of Biochemistry and Molecular Pharmacology, New York
University School of Medicine, New York, NY, USA
SHAOHUA HUANG Department of Microbiology and Molecular Genetics, University of
TONY T. HUANG Department of Biochemistry and Molecular Pharmacology, New York
University School of Medicine, New York, NY, USA
FRANCELINE JUILLARD Univ Lyon, Université Claude Bernard Lyon 1, CNRS UMR 5310,
BITA KHADIVJAM Department of Pathology and Cell Biology, University of Montreal,
Montreal, QC, Canada
DAVID M. KOELLE Department of Medicine, University of Washington, Seattle, WA, USA;
Department of Laboratory Medicine, University of Washington, Seattle, WA, USA;
Department of Global Health, University of Washington, Seattle, WA, USA; Vaccine and
Infectious Diseases Division, Fred Hutchinson Cancer Research Center, Seattle, WA, USA;
Benaroya Research Institute, Seattle, WA, USA
ANDREA S. LAIMBACHER Musculoskeletal Research Unit (MSRU), Vetsuisse Faculty,
University of Zurich, Zürich, Switzerland; Center for Applied Biotechnology and Molecular
Medicine (CABMM), University of Zurich, Zürich, Switzerland
JENNIFER H. LAVAIL Department of Anatomy, University of California San Francisco, San
Francisco, CA, USA
VALERIO LEONI Department of Experimental, Diagnostic and Specialty Medicine,
ROGER LIPPÉ Department of Pathology and Cell Biology, University of Montreal, Montreal,
QC, Canada
PATRICK LOMONTE Univ Lyon, Université Claude Bernard Lyon 1, CNRS UMR 5310,
Contributors xiii
JOSÉ ANTONIO LÓPEZ-GUERRERO Departamento de Biologı́a Molecular, Universidad

Autonoma de Madrid, Madrid, Spain; Centro de Biologı́a Molecular Severo Ochoa, CSIC-
UAM, Madrid, Spain
PEGGY MARCONI Department of Chemical and Pharmaceutical Sciences (DipSCF),
University of Ferrara, Ferrara, Italy
MOHAMED ALI MAROUI Univ Lyon, Université Claude Bernard Lyon 1, CNRS UMR
5310, INSERM U 1217, LabEx DEVweCAN, Institut NeuroMyoGène (INMG), Team
JOSHUA O. MARSHAK Department of Medicine, University of Washington, Seattle, WA,
USA
MARCO MARZULLI Department of Microbiology and Molecular Genetics, University of
DAVID G. MECKES JR. Department of Biomedical Sciences, Florida State University College
of Medicine, Tallahassee, FL, USA
ANITA F. MEIER Institute of Virology, Vetsuisse Faculty, University of Zurich, Zürich,
Switzerland
LAURA MENOTTI Department of Pharmacy and Biotechnology, University of Bologna,
Bologna, Italy
MONICA MIRANDA-SAKSENA Centre for Virus Research, The Westmead Institute for Medical
Research, Westmead, NSW, Australia; The University of Sydney, Westmead, NSW,
Australia
IAN MOHR Department of Microbiology, New York University School of Medicine, New York,
NY, USA
ANTHONY V. NICOLA Department of Veterinary Microbiology and Pathology, College of
Veterinary Medicine, Washington State University, Pullman, WA, USA; School of
Molecular Biosciences, College of Veterinary Medicine, Washington State University,
Pullman, WA, USA
SIMONA PEPE Department of Experimental, Diagnostic and Specialty Medicine, University
of Bologna, Bologna, Italy
BILJANA PETROVIC Nouscom Srl, Rome, Italy
MOLLY M. RATHBUN Department of Biochemistry and Molecular Biology, Center for
Infectious Disease Dynamics, The Huck Institutes of the Life Sciences, Pennsylvania State
University, University Park, PA, USA
KERRIE J. SANDGREN Centre for Virus Research, The Westmead Institute for Medical
TRI KOMALA SARI Department of Veterinary Microbiology and Pathology, College of
Veterinary Medicine, Washington State University, Pullman, WA, USA
ANDREAS SAUERBREI Section of Experimental Virology, Institute for Medical Microbiology,
Jena University Hospital, Jena, Germany
NANCY M. SAWTELL Division of Infectious Diseases, Department of Pediatrics, Cincinnati
Children’s Hospital Medical Center, Cincinnati, OH, USA
MICHAEL SEYFFERT Institute of Virology, University of Zurich, Zürich, Switzerland
MACKENZIE M. SHIPLEY Department of Biochemistry and Molecular Biology, Center for
xiv Contributors
JACINTA B. SMITH Centre for Virus Research, The Westmead Institute for Medical Research,
Westmead, NSW, Australia; Sydney Medical School, The University of Sydney, Westmead,
NSW, Australia
KALANGHAD PUTHANKALAM SRINIVAS Department of Microbiology, New York University
School of Medicine, New York, NY, USA
SAMUEL D. STAMPFER Department of Molecular Biology and Microbiology, Tufts University
SEREINA O. SUTTER Institute of Virology, Vetsuisse Faculty, University of Zurich, Zürich,
Switzerland
MORIAH L. SZPARA Department of Biochemistry and Molecular Biology, Center for
RICHARD L. THOMPSON Department of Molecular Genetics, Biochemistry, and Microbiology,
University of Cincinnati College of Medicine, Cincinnati, OH, USA
NAOMI R. TRUONG Centre for Virus Research, The Westmead Institute for Medical
DAVID C. TSCHARKE John Curtin School of Medical Research, The Australian National
ANDREA VANNINI Department of Experimental, Diagnostic and Specialty Medicine,
THILAGA VELUSAMY John Curtin School of Medical Research, The Australian National
ELLEN M. WHITE Department of Molecular Biology and Microbiology, Tufts University
ANGUS C. WILSON Department of Microbiology, New York University School of Medicine,
New York, NY, USA
Chapter 1
Tour de Herpes: Cycling Through the Life and Biology

of HSV-1
Christopher E. Denes, Roger D. Everett, and Russell J. Diefenbach
Abstract
Herpes simplex virus type 1 (HSV-1) is a prevalent and important human pathogen that has been studied in a
wide variety of contexts. This book provides protocols currently in use in leading laboratories in many fields
of HSV-1 research. This introductory chapter gives a brief overview of HSV-1 biology and life cycle, covering
basic aspects of virus structure, the prevalence of and diseases caused by the virus, replication in cultured cells,
viral latency, antiviral defenses, and the mechanisms that the virus uses to counteract these defenses.
Key words Herpes simplex virus type 1, HSV-1 biology, HSV-1 life cycle, Nomenclature
1 Introduction
Herpes simplex virus type 1 (HSV-1) is a prevalent and important

human pathogen. The model human alphaherpesvirus, HSV-1 pro-
vides an excellent experimental system to study many aspects of viral
replication, virus–host interactions, and antiviral defense. This chapter
aims to give a brief overview of the biology and life cycle of HSV-1
with sufficient information to place in context the chapters that follow.
This chapter does not go into the details that can be found in many
existing comprehensive reviews and book chapters, and accordingly
mainly cites publications that serve as good starting points for the
reader wishing to delve in more detail into HSV-1 research. Particu-
larly recommended is a textbook edited by Sandra Weller [1].
2 Herpesviruses
The Herpesviridae family within the order Herpesvirales includes a

large number of individual virus species that have been isolated
from an incredibly wide range of organisms, extending through
the evolutionary scale from oysters to humans (for general reviews,
Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology,
vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_1, © Springer Science+Business Media, LLC, part of Springer Nature 2020
1
2 Christopher E. Denes et al.
see refs. 2, 3). The genomes of herpesviruses range in size from

around 125 to 230 kbp, encoding around 80–180 viral proteins.
All are characterized by having enveloped particles (180 nm diam-
eter in HSV-1) that include an icosahedral capsid (125 nm diameter
in HSV-1) containing a large, double-stranded DNA genome
(Fig. 1a). Between the outer shell of the capsid and the envelope
Fig. 1 HSV-1 virion structure, genome organization, and gene expression strategy. (a) A schematic and
electron micrograph of the HSV-1 virion, illustrating the envelope with extending glycoproteins, the tegument
and the nucleocapsid containing condensed dsDNA. (b) A conventional representation of the HSV-1 genome
(prototype orientation), drawn to scale, showing the positions of the five immediate-early (IE) genes and their
protein products. Please refer to the main text for descriptions of labels. (c) The gene expression program of
HSV-1. VP16 in the viral tegument stimulates viral IE transcription, leading to the expression of five IE proteins.
At least three of these (ICP4, ICP0, and ICP27) have major roles in stimulating transcription and expression of
early and late genes, while ICP4 is also able to depress (autoregulate) IE transcription. Early gene expression is
required for the initiation of viral DNA replication, while in turn late gene expression occurs much more
efficiently once DNA replication has commenced
The Life and Biology of HSV-1 3
is a relatively unstructured layer known as the tegument, which

contains a number of viral proteins that are important for efficient
infection. The host cell-derived envelope includes multiple viral
glycoproteins, many of which are key for virus adsorption to the
cell surface, receptor recognition, and membrane fusion, enabling
viral entry into the cell. Although herpesviruses rely on the tran-
scriptional machinery of the host cell, they code for several proteins
of their own that modulate transcription, RNA processing and
translation, and produce the apparatus required for replicating
viral DNA.
The Herpesviridae family is further divided into three subfami-
lies [3] (alpha-, beta- and gammaherpesviridae) on the basis of their
biological characteristics, genomic sequence relatedness, tissue and
cell-type tropism, and cell types in which latent infections are
established. The alphaherpesviridae subfamily, which includes
human pathogens HSV-1, HSV-2, and varicella zoster virus, is
defined by the characteristic ability to establish latent infections in
neurons.
3 The HSV-1 Life Cycle In Vivo
HSV-1 is carried by 45–90% of the population, with the higher

prevalence in the developing world. Primary infection usually
occurs at an early age, resulting in the establishment of latent
infections in sensory neurons. Periodically the virus can reactivate,
causing renewed episodes of clinical disease that enable transmis-
sion between individuals. The primary infection site for HSV-1 is
most commonly the oral mucosa and less frequently the genital
mucosa, but infections can also occur in other epithelial regions at
the periphery. During the initial active infection, virus particles
enter the axons of ganglionic neurons and travel to the nuclei
located in the cell body where the viral genome is assembled into
a repressed extrachromosomal chromatin structure. Although indi-
vidual latently infected neurons may contain from tens to hundreds
of viral genomes, lytic cycle viral genes are not expressed; viral DNA
does not replicate and the great majority of the genome is transcrip-
tionally silent. Only one group of viral transcripts, derived from a
single primary transcript, is expressed, known as the latency-
associated transcripts (LATs). The LATs are noncoding and the
most abundant is a stable intron that accumulates in the nuclei of
latently infected neurons. As neurons are nondividing, the viral
genomes are maintained despite the absence of replication, and
the lack of viral protein expression in latently infected neurons
means these cells are not susceptible to immunological surveillance.
Put simply, latently infected neurons are maintained long-term; the
virus cannot be eliminated and infection is lifelong.
The most common clinical signs of HSV-1 infection are the

characteristic minor lesions in the oral region (herpes labialis).
These cold sores occur following reactivation of latent virus within
infected neurons and transport in a retrograde manner down the
axon to the peripheral site of the primary infection. Lytic infection
(i.e., active genome replication, temporal gene expression, virus
release) in the epithelia then gives rise to symptoms. In addition
to the common cold sore, HSV-1 can also cause lesions at other
sites, such as around the genital mucosa (herpes genitalis), on
fingers (herpetic whitlow), at sites of abrasion (herpes gladiatorum)
and on the eyelids (herpes blepharitis), and infection of the eye can
also lead to conjunctivitis. Genital herpes (more often caused by
HSV-2) can cause significant physical and psychological issues and
is one of the most common sexually transmitted diseases. Due to
the lesions caused by disease, herpes infections of the genital tract
are associated with increased HIV susceptibility [4]. HSV-1 can
also infect the corneal tissues in the eye, leading to herpes keratitis
which results in corneal scarring and impairment or loss of sight.
The most serious HSV-associated disease occurs when the virus
enters the central nervous system, causing herpes encephalitis and
although rare, this condition has a high mortality rate. Most HSV
infections are just a minor irritation, but for the immunocompro-
mised they can be much more serious if untreated. For example,
genital herpes during late pregnancy necessitates caesarean deliv-
ery because HSV infections of newborns can be extremely
damaging.
4 HSV-1 Treatment
4.1 Antivirals Despite considerable effort, there is no cure and still no vaccine for
HSV-1. There are, however, effective antiviral drugs of which the
most commonly used is acycloguanosine (acyclovir). This is a nucle-
oside analog that can be phosphorylated by virally- encoded thymi-
dine kinase, but not the cellular form, with the produced
nucleotide terminating DNA replication once incorporated into
replicating DNA in virus-infected cells. Drugs such as acyclovir
therefore limit lytic infections once they have reactivated, but they
cannot eliminate the virus and so do not decrease the potential of
future reactivation unless used for prophylaxis.
Most tolerated newer antivirals follow a similar mechanism of
action (with toxicity effects hampering the use of other drugs like
foscarnet) and so new drugs targeting other stages of the viral life
cycle are needed to address the emerging antiviral resistance seen in
clinics. Prolonged use of antivirals is contributing to resistant
strains being transmitted among the population, and the risk of
increased disease severity in immunocompromised individuals
demands the development of new therapeutics. For recent reviews

on current clinical practices and antiviral development, please refer
to [5–8] and for further discussion see Chapter 2 of this book.
4.2 Vaccines HSV-1 vaccine research has produced many vaccine candidates that
have ultimately failed at human clinical trial stages. Therapeutic
vaccination for such a prevalent virus would aim to reduce symptom
severity, virus shedding and transmission, while preventative vacci-
nation looks to block the initial infection of wild-type virus and
limit transmission in this way. For recent reviews on the status of
HSV vaccine development, refer to [7, 9, 10] and for further
discussion see Chapter 2 of this book.
5 The HSV-1 Replication Cycle in Cultured Cells
HSV-1 provides an excellent model for the study of herpesvirus

infection in cultured cells because it replicates rapidly and efficiently
in a wide variety of cell types. As such, historically it has been the
most intensely studied of the herpesviruses, although in more
recent years there has been greater emphasis on viruses of the
beta- and gammaherpesviridae subfamilies. Here we describe the
replication cycle of HSV-1 in cultured non-neuronal cells (Fig. 2).
For recent reviews on the HSV-1 life cycle in epithelial cell and
neuronal cells (including the role of the cytoskeleton during each
stage), please refer to [11, 12] and references therein.
5.1 The HSV-1 HSV-1 has a double-stranded DNA genome of approximately

Genome 152 kbp, varying slightly between laboratory strains and clinical
and Nomenclature isolates. Structurally, the genome is divided into distinct segments,
comprising two major unique fragments (unique long or UL and
unique short or US), each bounded by lengthy inverted repeats (RL
and RS, with prefixes I or T denoting internal or terminal, and
subscript indicating which unique region they border) which them-
selves are bounded by shorter repeated segments known as the “a”
sequence (Fig. 1b). The “a” sequence is repeated in one or more
copies at the IRL/IRS junction, and the presence of “a” sequences
also at the termini of TRL and TRS enables inversion of the orien-
tation of the unique segments with respect to each other, thus
producing four genomic isomers in equal ratios and with equal
functionality. Approximately 80 genes have been identified by
direct study of transcripts and proteins, or by interpretation of
open reading frames (ORFs) within the sequence.
Nomenclature of most of the genes themselves is straightfor-
ward, simply by numbering from the left of the conventional
genome isomer orientation and notation of the segment in which
the gene lies; thus RL1, RL2, UL1–UL56, RS1 and US1–12 (refer to
Table 1 for protein coding genes). Genes in the repeats are
Fig. 2 HSV-1 entry, assembly and egress in cultured nonneuronal cells. HSV-1 glycoprotein C (gC) binds host
cell surface receptors. Interactions between gD and gB/gH/gL facilitate binding and subsequent fusion of virus
and host cell membranes for delivery of the tegument-wrapped nucleocapsid into the cytoplasm. Having been
stripped of the outer tegument layer, inner tegument proteins recruit dynein motors to facilitate retrograde
transport along microtubules toward the microtubule organizing center (MTOC). The nucleocapsid is trans-
ported to a nuclear pore where viral DNA is delivered through a vertex portal into the nucleus (shown in blue).
Here viral DNA undergoes both transcription and replication. mRNA is delivered to and translated in the cytosol
in a temporal manner (immediate-early, early, late). After DNA replication, the viral genome is packaged into
an immature capsid before undergoing nuclear egress. The prevailing hypothesis for nuclear egress suggests
that the nucleocapsid buds into the perinuclear space (in doing so attaining a primary envelope) before it fuses
with the outer nuclear membrane (losing its primary envelope) and is released into the cytosol. Here the
nucleocapsid matures further, attaining tegument proteins and envelope proteins processed at the endoplas-
mic reticulum (ER)/Golgi. The maturing virus is transported along microtubules by kinesin motors via the trans-
Golgi network (TGN) or endosome, where the virus gains its fully matured host-derived envelope in a process
of secondary envelopment, and finally the virus is released by exocytosis. Adapted from [11]
Table 1
Nomenclature used in HSV-1 research for established protein-coding genes
Infected Strict
Systematic ORF cell ortholog
notationa Recommended/alternative Virion protein Immediate- α Strict ortholog group group
(RL/UL/RS/US) protein names polypeptide (VP) (ICP) Vmw early (IE) gene nameb numberb
RL1 Neurovirulence factor n/a ICP34.5 n/a n/a n/a n/a n/a
γ134.5 ICP34.5
Protein γ134.5
RL2 RING-type E3 ubiquitin n/a ICP0 Vmw110 IE1 α0 n/a n/a
ligase ICP0 Previously
Trans-acting transcriptional IE110
protein ICP0
UL1 Envelope glycoprotein L n/a n/a n/a n/a n/a A.S/Glycoprotein L 2768
(gL)
UL2 Uracil-DNA glycosylase n/a n/a n/a n/a n/a ABG/Uracil DNA 2834
(UDG) glycosylase
UNG
UL3 Nuclear phosphoprotein n/a n/a n/a n/a n/a A/Nuclear 2782
UL3 phosphoprotein UL3
UL4 Nuclear protein UL4 n/a n/a n/a n/a n/a A/Nuclear protein UL4 2783
UL5 DNA replication helicase n/a n/a n/a n/a n/a ABG/DNA replication 2818
(HELI) helicase
UL6 Capsid portal protein n/a n/a n/a n/a n/a ABG.ABG/Portal 2799
protein
UL7 Cytoplasmic envelopment n/a n/a n/a n/a n/a ABG.ABG/Cytoplasmic 2798
protein 1 (CEP1) envelopment protein 1
The Life and Biology of HSV-1
(continued)
7
8
Table 1
(continued)
Infected Strict
UL8 DNA helicase/primase n/a n/a n/a n/a n/a ABG.ABg/DNA helicase 2800
complex-associated primase complex
protein (HEPA) associated protein
Primase-associated factor
Christopher E. Denes et al.
UL9 Replication origin-binding n/a n/a n/a n/a n/a Ab/Replication origin- 2838
protein (OBP) binding protein
OriBP
UL10 Envelope glycoprotein M n/a n/a n/a n/a n/a ABG/Envelope 2821
(gM) glycoprotein M
UL11 Cytoplasmic envelopment n/a n/a n/a n/a n/a A/Cytoplasmic 2772
UL12 Alkaline nuclease n/a n/a n/a n/a n/a ABG/Alkaline nuclease 2812
UL12.5
UL13 Serine/threonine-protein n/a n/a Vmw57 n/a n/a n/a n/a
kinase UL13
UL14 Tegument protein UL14 n/a n/a n/a n/a n/a A/Tegument protein 2787
UL14
UL15 Tripartite terminase subunit n/a n/a n/a n/a n/a ABG/Tripartite 2831
3 (TRM3) terminase subunit 3
Terminase large subunit
UL16 Cytoplasmic envelopment n/a n/a n/a n/a n/a ABG/Cytoplasmic 2816
UL17 Capsid vertex component n/a n/a n/a n/a n/a ABG/Capsid vertex 2814
1 (CVC1) component 1
UL18 Triplex capsid protein VP23 ICP40 n/a n/a n/a ABG/Triplex capsid 2832
2 (TRX2) protein 2
UL19 Major capsid protein (MCP) VP5 ICP5 Vmw155 n/a n/a ABG/Major capsid 2823
protein
UL20 Envelope protein UL20 n/a n/a n/a n/a n/a A/Protein UL20 2784
UL21
UL22 Envelope glycoprotein H n/a n/a n/a n/a n/a ABG/Envelope 2820
(gH) glycoprotein H
UL23 Thymidine kinase (tk) n/a n/a n/a n/a n/a AG.A/Thymidine kinase 2835
UL24 Protein UL24 n/a n/a n/a n/a n/a ABG/Protein UL24 2827
UL25 Capsid vertex component n/a n/a n/a n/a n/a ABG/Capsid vertex 2815
2 (CVC2) component 2
UL26 Capsid scaffolding protein UL26 (codon n/a n/a n/a n/a ABG/Capsid scaffolding 2813
Capsid protein P40 248–635) ¼ protein
Virion structural protein VP21
UL26 UL26 (codons
Protease precursor 1–247) ¼ VP24
UL26.5 Major scaffolding protein UL26 (codons n/a n/a n/a n/a n/a n/a
307–635) ¼
VP22a
UL27 Envelope glycoprotein B VP7 n/a n/a n/a n/a ABG.AbG/Glycoprotein 2802
(gB) B
(continued)
9
10
Table 1
(continued)
Infected Strict
UL29 Major DNA-binding protein n/a ICP8 n/a n/a n/a ABG/Major DNA 2822
(DBP) binding protein
UL30 DNA polymerase catalytic n/a n/a n/a n/a n/a ABG.a/DNA polymerase 2805
subunit
UL31 Nuclear egress protein n/a n/a n/a n/a n/a ABG/Nuclear egress 2824
1 (NEC1) protein 1
UL32 Packaging protein UL32 n/a n/a n/a n/a n/a ABG/Packaging protein 2826
UL32
UL34 Nuclear egress protein n/a n/a n/a n/a n/a ABG/Nuclear egress 2825
2 (NEC2) protein 2
UL35 Small capsomere-interacting VP26 n/a n/a n/a n/a A/Small capsomere- 2786
protein (SCP) interacting protein
UL36 Large tegument protein VP1/2 ICP1/2 n/a n/a n/a ABG.A/Large tegument 2797
deneddylase (LTP) protein deneddylase
UL37 Inner tegument protein n/a n/a n/a n/a n/a A/Inner tegument 2778
Viral deamidase UL37 protein UL37
UL38 Triplex capsid protein VP19C ICP32 Vmw51 n/a n/a ABG/Triplex capsid 2833
1 (TRX1) protein VP19C
UL39 Ribonucleoside- n/a ICP6 Vmw136 n/a n/a ABG.AG/ 2801
diphosphate reductase Ribonucleoside-
large subunit (RR1) diphosphate reductase
Ribonucleotide reductase large subunit
large subunit
UL40 Ribonucleoside- n/a n/a Vmw38 n/a n/a AG/Ribonucleoside- 2837
diphosphate reductase diphosphate reductase
small subunit (RR2) small subunit
Ribonucleotide reductase
small subunit
UL41 Virion host shutoff n/a n/a Vmw58 n/a n/a n/a n/a
protein (vhs)
UL42 DNA polymerase n/a n/a n/a n/a n/a A/DNA polymerase 2929
processivity factor processivity factor
DNA-binding protein UL42
Polymerase accessory
protein (PAP)
UL43 Membrane protein UL43 n/a n/a n/a n/a n/a A/Membrane protein 2780
UL43
UL44 Envelope glycoprotein VP8 n/a n/a n/a n/a A/Envelope glycoprotein 2773
C (gC) C
UL45 Envelope protein UL45 n/a n/a n/a n/a n/a S/Membrane protein 2914
18 kDa protein UL45
UL46 Tegument protein UL46 VP11/12 n/a n/a n/a n/a A/Tegument protein 2789
Tegument protein VP11/12 UL46
UL47 Tegument protein UL47 VP13/14 ICP19/20 Vmw82/ n/a n/a A/Tegument protein 2790
82/81 kDa tegument 81 UL47
protein
(continued)
11
12
Table 1
(continued)
Infected Strict
UL48 Tegument protein VP16 VP16 ICP25 Vmw65 n/a n/a A.S/Transactivating 2771
Alpha trans-inducing tegument protein
protein VP16
αTIF
UL49 Tegument protein VP22 VP22 ICP39 n/a n/a n/a A/Glycoprotein N 2777
UL49A Envelope glycoprotein n/a n/a n/a n/a n/a n/a n/a
N (gN)
UL50 Deoxyuridine n/a n/a n/a n/a n/a ABG/Deoxyuridine 2819
50 -triphosphate 50 -triphosphate
nucleotidohydrolase, nucleotidohydrolase
dUTPase (DUT)
dUTP pyrophosphatase
UL51
UL52 DNA primase n/a n/a n/a n/a n/a ABG/DNA primase 2817
UL53 Envelope glycoprotein K n/a n/a n/a n/a n/a A/Envelope glycoprotein 2776
(gK) K
Syncytial protein
UL54 mRNA export factor n/a ICP27 Vmw63 IE2 α27 ABG.a/mRNA export 2806
Previously factor
IE63
UL55
UL56 Protein UL56 n/a n/a n/a n/a n/a S/Membrane protein 2915
UL56
RS1 Major viral transcription VP4 ICP4 Vmw175 IE3 α4 A/Major viral 2779
factor ICP4 Previously transcription factor
IE175 ICP4
US1 Transcriptional regulator n/a ICP22 Vmw68 IE4 α22 A/Transcriptional 2793
ICP22 Previously regulator ICP22
IE68
US2 Protein US2 n/a n/a n/a n/a n/a S/virion protein US2 2920
US3 Serine/threonine-protein n/a n/a n/a n/a n/a A/Serine/threonine- 2785
kinase US3 protein kinase
US4 Envelope glycoprotein G n/a n/a n/a n/a n/a n/a n/a
(gG)
US5 Envelope glycoprotein J (gJ) n/a n/a n/a n/a n/a S/Envelope 2912
glycoprotein J
US6 Envelope glycoprotein D VP17, VP18 n/a n/a n/a n/a S/Envelope glycoprotein 2910
(gD) D/G
US7 Envelope glycoprotein I (gI) n/a n/a n/a n/a n/a A/Envelope 2775
g70 glycoprotein I
US8 Envelope glycoprotein E VP12.3, VP12.6 n/a n/a n/a n/a A/Envelope 2774
(gE) glycoprotein E
US8A Protein US8A/US8.5 n/a n/a n/a n/a n/a n/a n/a
US9 Envelope protein US9 n/a n/a n/a n/a n/a A/Membrane protein 2781
10 kDa protein U S9
(continued)
13
14
Table 1
(continued)
Infected Strict
US10 Virion protein US10 n/a n/a n/a n/a n/a A/Virion protein US10 2796
US11 Accessory factor US11 n/a n/a Vmw21 n/a n/a n/a n/a
US12 TAP transporter inhibitor n/a ICP47 Vmw12 IE5 α47 S/TAP transporter 2918
Previously inhibitor ICP47
IE12
a
For protein naming, many contemporary papers add a “p” in front of the systematic notation to differentiate protein product from gene name
b
Strict ortholog group (SOG) naming comes from a recent publication classifying Herpesviridae orthologs using domain-architecture aware inference of orthologs (DAIO) [13]
duplicated and not distinguished by this annotation. Some genes

have been identified subsequent to this original definition, and in
most cases are named by fractional numbers (e.g., UL12.5). In the
case of the immediate-early (IE) genes the nomenclature is more
complicated, as in addition to their systematic identification (RL2,
UL54, RS1, US1, and US12) they have also been named α genes
(α0, α27, α4, α22, and α47) and IE genes (IE1, IE2, IE3, IE4, and
IE5), respectively.
The nomenclature of encoded proteins is yet more complex.
Infected cell proteins (ICPs) have been named in (mostly) ascend-
ing order of gel mobility (ICP0–ICP47) while many older papers
use a now obsolete system with the prefix Vmw followed by appar-
ent molecular size (e.g., Vmw110 for ICP0). Proteins identified as
components of the virus particle have the prefix VP, followed by a
number which again derives from ascending order of gel mobility.
Properly, the products of the genes identified in the systematic ORF
notation system should be known, for example, as pUL12, but in
practice the name of the protein and the gene are used interchange-
ably. Virion components are more commonly known by their VP
numbers rather than by systematic gene number (e.g., the major
capsid protein VP5), and many proteins have been named accord-
ing to their function (e.g., thymidine kinase, tk, and all the glyco-
proteins, such as glycoprotein E or gE). Therefore, a given protein
may variously be referred to by its systematic gene name, its ICP
name, or its descriptive name (e.g., UL39, ICP6, ribonucleotide
reductase large subunit RR1). In practice, the groups working on
any particular protein tend to keep to only one of the possible
names.
A further complication is that the same systematic gene num-
bering system is used for all herpesviruses, and because gene pres-
ence and order differ, UL15, for example, of HSV-1 is not related to
UL15 of HCMV. It is therefore helpful, where possible, to use
descriptive names (for example, the gB proteins of HSV-1 and
HCMV are indeed related). In this chapter, where systematic gene
numbers are used, they will also be used to refer to the protein to
avoid unnecessarily convoluted description. In order to minimize
confusion and simplify interpretation between publications, this
chapter presents a comprehensive table of all nomenclature formats
(Table 1).
5.2 Virus Entry HSV-1 entry into cells is a complex multistage process requiring
both surface-expressed cellular receptors and viral envelope glyco-
proteins (reviewed in refs. 14–16). The initial interaction between
cellular proteoglycans (such as heparan sulfate) and gC is followed
by interactions between cellular receptors and gD (Fig. 2). The
receptors for HSV-1 that have been identified include the herpes
virus entry mediator (HVEM) and nectin-1. Next, binding of gD
to its cellular receptor recruits a fusion complex of gB/gH/gL to
trigger fusion between the viral and cellular membranes. Once

released into the cytoplasm, viral capsids are carried in a dynein-
dependent manner, via binding of dynein to capsid-bound tegu-
ment protein VP1/2 (pUL36) [17], along microtubules toward the
microtubule organizing center (MTOC), and thereafter to the
nuclear envelope. One of the 12 capsid vertices comprises a dode-
cameric pUL6 portal complex and a complex of pUL17, pUL25,
and pUL36 that facilitates binding of the portal complex to nuclear
pore complexes at the nuclear envelope. Here, by a mechanism only
starting to be understood, the C-terminus of pUL25 triggers
uncoating of the viral genome and its subsequent release into the
nucleoplasm [18–20].
5.3 Viral Tegument The herpesvirus tegument layer contains a large number of com-
Proteins ponents, some in high abundance with others present in trace
amounts, perhaps in some cases nonspecifically [21–23]. Tegument
proteins are released into the cell following membrane fusion
(Fig. 2) and therefore can have roles not only in virus particle
assembly, but also in regulating the initial events of infection.
There is evidence of some organization of the tegument, particu-
larly the inner layer that is more tightly associated with the capsid.
Many tegument proteins have defined functions that are important
for efficient infection.
pUL36 is the largest protein encoded by HSV-1 and is essential
for both release of the viral genome from the capsid through the
nuclear pore and for tegumentation and capsid envelopment. It has
orthologs throughout the Herpesviridae, and it includes a domain
with ubiquitin-specific protease activity [24]. VP16 (pUL48) is
essential for particle assembly, interacts with many other viral tegu-
ment proteins, and has a major role in stimulating IE transcription
(see below). The product of gene UL41, the vhs protein, destabi-
lizes mRNAs and is required for shutoff of host protein synthesis.
The pUL13 and pUS3 [25] tegument proteins are protein kinases
known to phosphorylate other viral tegument components and are
therefore, although individually nonessential, likely to be involved
in tegument-related functions. Other major tegument proteins are
VP22 (pUL49, which is very abundant and has multiple properties
and functions; see refs. 26, 27 and references therein), VP13/14
(encoded by UL47), VP11/12 (encoded by UL46), and pUL37
[28]. A complex of tegument proteins pUL7 and pUL51 is neces-
sary for effective virus assembly and is important for keeping
infected cells attached to their surroundings during infection by
forming focal adhesion complexes [29]. Intriguingly, important
proteins such as ICP0 and ICP4 are also found in the tegument,
but whether their presence in virus particles contributes to infec-
tion is currently unknown.
5.4 Viral Gene Temporal herpesviral gene expression can be divided into three
Expression groups named immediate-early (IE or α), early (or β) and late
(or γ) (Fig. 1c). Functionally, these groups are defined by the
following criteria: IE genes are the first to be transcribed via a
process that uses the host transcriptional apparatus and, although
stimulated by the viral tegument protein VP16, does not require de
novo viral gene expression; early gene transcription requires the
presence of functional IE proteins but occurs independently of viral
DNA replication; late genes are transcribed only once viral DNA
replication has commenced. Late genes can be further subdivided
into leaky-late (γ1) and true-late (γ2) depending on how strict their
requirement is for DNA replication.
Although these groups may be easily distinguished through the
use of viral mutants or inhibitors, it is perhaps misleading during
normal infection to use the common phrase “tightly controlled
temporal cycle” to describe viral gene expression. After the initial
stages of a normal infection of cultured cells, both IE and early
genes are expressed, and after DNA replication has commenced, all
groups of viral genes may be expressed simultaneously (Fig. 2). The
timescale of the replication cycle within a culture depends on both
cell type and the input multiplicity of infection, but as a rough
guide for most common laboratory cell types infected at a multi-
plicity sufficient to infect all the cells, maximum progeny viral yields
are reached by ~24 h post infection.
The three temporal groups of viral genes are also characterized
by the sequence complexity of their promoter regions. IE genes are
the most complex, with definitive sequence motifs (consensus
TAATGARAT, where R is a purine) upstream of the core promoter
that includes a TATA box and transcription factor binding sites.
The TAATGARAT motif is bound by a tripartite complex of the
viral protein VP16 and the cellular factors Oct1 and HCF, which
brings the C-terminal transcriptional activation domain of VP16
into the vicinity of the promoter, thereby enhancing the assembly
of active transcription complexes. Early gene promoters are simpler,
with a TATA box and upstream transcription factor binding ele-
ments, while late gene promoters have only a TATA box and an
initiator region.
5.5 Immediate-Early The initial stages of infection are crucial for determining the out-
Proteins and Their come of HSV-1 engagement with a cell, and it is therefore not
Functions surprising that there has been much work on VP16-mediated acti-
vation of IE transcription and the functions of the IE proteins
themselves. HSV-1 encodes five IE proteins, of which two (ICP4
and ICP27) are essential for productive infection (Fig. 1b, c).
ICP4 (IE3) is a large 1298 amino acid protein (HSV-1 strain
17) that is required for early and late gene transcription. It possesses
a DNA-binding domain that has a relaxed sequence specificity,
enabling it to bind to multiple locations within the viral genome.
It interacts with components of the cellular basal transcription

apparatus in order to stimulate viral gene transcription (reviewed
in ref. 30).
ICP27 (IE2) is a multifunctional protein that enhances proces-
sing and export of viral mRNAs and in some cases stimulates their
translation (reviewed in ref. 31). It is a representative of a small
group of viral proteins for which orthologs exist in a wide range of
herpesviruses.
ICP0 (IE1) is another IE protein that has been the subject of a
large body of research (reviewed in refs. 32–35). Although not
absolutely essential for HSV-1 replication in cultured cells, it is
extremely important for the biology of the virus. HSV-1 mutants
lacking functional ICP0 are less likely to proceed into lytic replica-
tion, with the extent of this defect being cell-type dependent (of the
order of 1000-fold in human diploid fibroblasts). Such mutants
also reactivate from latency poorly in mouse models, while expres-
sion of ICP0 is sufficient to stimulate reactivation of HSV-1 from
quiescence in cell culture models of latency. Biochemically, ICP0 is
an E3 ubiquitin ligase that stimulates degradation of a number of
cellular proteins, and the consequence of this activity is thought to
impede cell-mediated restriction of viral gene expression [32].
ICP22 (IE4) is heavily phosphorylated and regulates the phos-
phorylation state of the C-terminal domain of RNA polymerase II
(reviewed in ref. 36). Recent findings have shown a role for ICP22
in recruiting host cell complexes and transcription elongation fac-
tors to herpesviral genomes to facilitate efficient transcription of
viral genes [37]. ICP22 is required for efficient infection of certain
commonly used laboratory cell types and has been shown to impact
host cell gene expression [38].
Unlike the other IE proteins, which are all involved in aspects
of the regulation of viral gene expression, ICP47 (IE5) is a small
protein that inhibits transport of virally derived peptides to MHC
Class I molecules. ICP47 competitively binds the transporter asso-
ciated with antigen processing (TAP) by forming a hairpin struc-
ture, prohibiting substrate binding and interfering with antigen
presentation [39]. This suggests that herpesviral immune evasion
strategies have evolved to occur during the very early stages of
infection.
5.6 Viral DNA Viral DNA replication takes place in the nucleus and only com-
Replication mences after early gene expression has begun (Fig. 2). HSV-1 has
three origins of DNA replication: one in each of the two repeated
IRS sequences bounding the US region, and one in the middle of
UL. The virus encodes all proteins required for replicating its DNA,
including an origin recognition protein (pUL9), a tripartite heli-
case/primase complex (proteins pUL5, pUL8 and pUL52), a viral
DNA polymerase and accessory protein (pUL30 and pUL42) and a
major ssDNA-binding protein (ICP8, encoded by UL29). HSV-1
also encodes several proteins involved in nucleotide metabolism,

including a thymidine kinase (pUL23), a two-subunit ribonucleo-
tide reductase (encoded by UL39 and UL40), a deoxyuridine tri-
phosphatase (pUL50), and a uracil DNA-glycosylase (pUL2). DNA
replication involves the formation of long concatemers of viral
DNA which are then processed into unit length molecules during
packaging into new capsid particles.
For many years, the accepted model for viral DNA replication
was that the DNA circularized rapidly after nuclear entry, then
replication occurred through a rolling circle mechanism. Circulari-
zation does not appear to occur during normal lytic infection and
instead replication is driven via the formation of concatemers that
initially form through recombination events in the terminal
sequences [40, 41]. Recently, the annealing activity of ICP8 has
been shown to be essential for viral DNA replication and adds
support to the proposed mechanism of recombination-dependent
replication (RDR) [42]. During replication, the UL and US regions
can invert (due to their positions flanked by inverted repeats),
resulting in the four isomeric genomes mentioned previously.
Inversion is dependent on seven essential viral replication proteins
and suggests viral DNA synthesis is intrinsically recombinogenic
[43]. Further, pUL8 may have a function in generating the X- and
Y-branched structures that are produced during HSV-1 replication
which are themselves similar to recombination intermediates [44].
DNA replication occurs in nuclear locations known as viral
replication compartments. The first step in this process appears to
be the association of ICP4 with parental viral genomes to form
prereplication compartments. Once the DNA replication proteins
are expressed they are recruited into these compartments which
develop into mature replication compartments by a multistage
pathway [40]. Viral replication compartments expand, and
although those developing from different parental viral genomes
appear later to fuse and almost fill the nucleus, there is evidence that
genomes derived from different initial centers do not substantially
intermingle [45]. DNA replication is very efficient, producing the
equivalent of many hundreds if not thousands of viral genome
copies.
5.7 Capsid Assembly The mature HSV-1 capsid is an icosahedral structure, 125 nm in
and DNA Packaging diameter, containing 162 capsomers, each including either six (for
hexons) or five (for pentons) molecules of the major capsid protein
VP5 (pUL19). The VP5 molecules of hexons (but not pentons)
bind one molecule of VP26 each, and between the hexons and
pentons are triplexes composed of VP19C and VP23 (see ref. 46
for references and a more detailed description). One vertex of the
structure forms the capsid portal that allows packaging of viral
DNA into the maturing capsid. This is composed largely of pUL6,
which forms a 12-membered ring with a central hole through
which the DNA may pass. Other less abundant capsid components
include pUL15, pUL17, pUL25, pUL28 and pUL33, which are
involved in processing and packaging of replicated viral DNA.
Newly synthesized HSV-1 capsid proteins accumulate in the
nucleus and are assembled in an orderly manner into immature
capsids, known as B-capsids, that also include the UL26.5-encoded
scaffolding protein (VP21) and VP24 (encoded by UL26). The
scaffold is dismantled by UL26-dependent cleavage and the DNA
is then packaged through the portal to eventually form the mature
C-capsids. A-capsids do not contain viral DNA and are likely to
result from abortive packaging events.
DNA packaging requires specific packaging sequences (pac1
and pac2) within the “a” segment of the genome, and proceeds
from TRL toward the TRS end of the genome. The pUL12 alkaline
exonuclease is required for processing the complex branched repli-
cated viral DNA into a form suitable for packaging. Once an entire
genome has been packaged into the capsid shell, a terminase com-
plex comprising pUL15, pUL28, and pUL33 cleaves the concate-
meric replicated DNA to release the unit length viral genome.
pUL17 and pUL32 are also required for this process. pUL32
appears to be involved in disulfide bond formation during capsid
assembly [47]. pUL17 forms part of the tripartite capsid vertex
specific component (CVSC) and anchors this complex (also made
up of pUL25 and pUL36) to the capsid, and is also required for viral
DNA concatemer cleavage and packaging into capsids [46, 48,
49]. pUL25, which is another low abundance capsid component,
is required to maintain the stability of packaged C-capsids.
5.8 Assembly Once the capsid has been assembled and DNA packaging com-
of Virus Particles pleted in the nucleus, the nucleocapsid begins a complicated jour-
and Egress ney that results in the release of mature virus particles from the cell,
complete with tegument and envelope (reviewed in refs. 21, 22,
50–52) (Fig. 2). The initial step is the budding of the capsid
through the inner nuclear membrane into the perinuclear space
via a process that requires the nuclear export complex which con-
tains key viral proteins pUL31 and pUL33 [53]. Electron micros-
copy and other lines of evidence indicate that the primary
enveloped particles in the perinuclear space do not include a full
tegument and lack many of the glycoproteins of the mature parti-
cle. In the most widely accepted model, these particles then bud
through the outer nuclear membrane via membrane fusion, thus
releasing into the cytoplasm capsids that again lack an envelope.
Capsids then associate with the membranes of Golgi vesicles, where
the tegument and host-derived envelope (studded with mature viral
glycoproteins) becomes assembled around the capsids as they bud
into the vesicles [52]. Protein–protein interactions between enve-
lope glycoproteins and the tegument anchor the membrane to the
tegument layer surrounding the new capsid [23, 51, 52]. For
example, envelope protein gE requires binding of tegument pro-

teins pUL11, pUL16 and pUL21 to its cytoplasmic tail to become
fully functional in its role in egress and cell-to-cell spread
[54]. Lastly, these vesicles are transported to the cytoplasmic mem-
brane where they undergo membrane fusion and release the mature
virus particles from the cell by exocytosis (Fig. 2). The mechanisms
behind this transport are not yet understood. Recent structural
analyses of proteins seemingly necessary for egress (e.g., pUL21
[55] and pUL37 [56]) and cell-to-cell spread may lead to new
discoveries in this field as well as research into the cellular compo-
nents hijacked for their activities [57–60].
6 Latent and Quiescent HSV-1 Infections
Latency is the hallmark of herpesvirus biology, enabling a viral

reservoir to be maintained in a high proportion of the population
while evading host antiviral defenses. The core features of the
establishment of HSV-1 latency in neurons after initial infection
at the periphery were described above (see also refs. 61–65 for
reviews). Once the viral genomes have entered the nucleus of the
neuron, they are assembled into a chromatin structure resembling
heterochromatin and become transcriptionally repressed [66]. At
least some of these genomes appear to be sequestered within mod-
ified PML nuclear bodies (PML-NBs—see below for further details
on these structures) [67]. While the great majority of the viral
genome is transcriptionally silent during latency, the region that
runs countersense to RL2 (which encodes IE protein ICP0) pro-
duces a family of RNAs known as the LATs that accumulate in the
nucleus of some, but not all, latently infected cells. The LAT region
has a chromatin structure distinct from that of the bulk of the viral
genome, with more markers of active euchromatin. The prevailing
view is that the LATs are noncoding; indeed, the most abundant is a
nonpolyadenylated product that is a stable form of an excised
intron [61]. The biological function of LATs remains enigmatic
and controversial, despite decades of interest from a large number
of investigators. It is generally accepted, however, that they are not
essential for any stage of the latency program, but they have vari-
ously been linked to the efficiency of establishment of latency, or of
reactivation [68], and with the efficiency of maintenance of latency
perhaps through antiapoptotic functions (discussed in ref. 61).
Studies into latency require conceptually and practically diffi-
cult experiments, and the results can be influenced by the virus
strain and the animal model that is used; recent research has found
that neuronal subtype can impact LAT promoter activity during
latency [69]. It is eminently feasible that the influence of LATs is
more marked in human infections than in the available rodent
models and so the recent development of a scalable human cellular
model of latent HSV-1 infection will support future research in this

area [70]. LAT transcripts may also be processed to produce a
number of miRNAs, some of which accumulate to high levels in
latently infected cells [71]. Studies on the roles of these miRNAs
during both lytic and latent infection are beginning to be
developed [72].
Traditionally it is thought that the virus defaults to the latent
pathway as a result of failed IE protein transcription (or dominantly
efficient repression thereof) once the viral genome has entered the
nucleus of the neuron. Certainly, it seems likely that delivery of the
IE transcriptional activator VP16 from the tegument to the cell
body might be inefficient in neurons after the long-distance migra-
tion of the capsid up the axon compared to the short distances
travelled in non-neuronal cells. This assumption has been
challenged by recent evidence that has highlighted the presence of
some initial IE transcription in a substantial proportion of neurons
in which latency becomes established, and in a lower proportion of
cells some early and, in rare cells, even late gene transcription has
occurred [73–75]. Equally, the assumption that latency is tightly
maintained until a reactivation event causes clinically manifest
symptoms has been challenged by recent evidence finding that
subclinical reactivation events are common [76]. Therefore, the
virus can be transmitted between individuals even without the
obvious symptoms of a recurrent infection.
6.1 Quiescent While true latency can only be studied in animal models, there are a
Infections in Cultured number of systems in which quiescent infections can be established
Cells in cultured cells (both fibroblasts and cells of neuronal origin)
(reviewed in ref. 62). These systems use defective virus mutants
and/or suboptimal, inhibitory infection conditions to repress viral
gene expression, after which repressed viral genomes can be main-
tained in the cells for a number of days or even weeks. Among other
things, these systems have been very useful for studies on the
chromatin structure of quiescent viral genomes [77, 78], and they
led to the discovery that ICP0 expression has dual roles in latency:
the protein is sufficient to reactivate viral gene expression in quies-
cently infected cells [79] and is also able to promote LAT expres-
sion and maintain the latent state by promoting total histone and
heterochromatin loading on the viral genome [80].
7 Antiviral Defenses and Viral Countermeasures
This section provides an overview of the three major arms of

cellular antiviral defenses and the mechanisms which HSV-1 may
use to evade them.
7.1 Innate Immunity Innate immunity comprises several aspects, including natural killer
cells, the complement system, and interferon (IFN)-mediated
defenses. For brevity, this section will discuss only the
IFN-mediated defenses. IFNs are cytokines that are synthesized in
response to pathogen infections. They engage with cell surface
receptors and initiate signal transduction cascades which activate
the synthesis of a large number of IFN-stimulated genes (ISGs),
many of which encode proteins with antiviral properties. Infected
cells can thus signal to neighboring uninfected cells through IFN
production, thereby allowing an antiviral state to be developed
before a virus engages a cell (reviewed in ref. 81).
There is abundant evidence that IFN pathways inhibit HSV-1
infection both in animal models and in cultured cells (reviewed in
ref. 82). A fascinating aspect of this topic is provided by the obser-
vation that HSV-1 infection triggers the synthesis of ISGs through
both IFN-dependent and IFN-independent pathways. Infection
with the virus stimulates pathways that lead to the activation of
IFN regulatory factor 3 (IRF3), which then translocates to the
nucleus to promote the formation of active transcription complexes
on the IFN-β gene promoter. The IFN-β that is synthesized is then
secreted so that it can bind to IFN receptors on the surface of other
cells. This triggers the activation of the JAK/STAT signal transduc-
tion pathway leading to transcription of ISGs that include IFN-α,
which further enhances the IFN response. Activation of IRF3 by
HSV-1 infection also stimulates transcription of ISGs directly, even
in the absence of IFN [82]. This antiviral response is, however, only
readily detectable during infections with HSV-1 mutants defective
in viral protein synthesis; thus the virus first activates and subse-
quently disarms IFN pathway responses.
7.2 HSV-1 In common with many other viruses [81], HSV-1 encodes proteins
Interference that counteract IFN pathway defenses, either by impeding the
with the IFN Response signaling pathways, inhibiting synthesis of ISGs, or interfering
with the antiviral functions of selected ISGs themselves. For exam-
ple, ICP0 is required (but not sufficient) for inhibiting IRF3-
mediated IFN and ISG induction (discussed in ref. 82), and it
also targets IFN pathway activation through the DNA sensor
IFI16 [83]. The virion host shutoff factor (vhs, pUL41) promotes
the degradation of host cell mRNAs and therefore inhibits
IFN-stimulated gene expression. The UL34.5 product inhibits pro-
tein kinase R (PKR), a major ISG, and therefore relieves transla-
tional inhibition brought about by PKR through phosphorylation
of the translation factor eIF2α. The tegument protein pUS11 is able
to inhibit oligoadenylate synthetase (OAS), another major ISG.
These and other aspects of the interplay between HSV-1 and innate
immunity pathways are described in more detail elsewhere [83–87].
7.3 Acquired Individuals infected with HSV-1 mount robust humoral and cell-
Immunity mediated acquired immunity defenses. Antibody seropositivity is
used as a diagnostic method for HSV-1 (and HSV-2) infection, and
neutralizing antibodies directed against a range of viral proteins,
particularly glycoproteins and other components of the virus parti-
cle, are produced in high titer (reviewed in ref. 84). However, this
strong and persistent humoral response against the virus is insuffi-
cient to eliminate reactivation episodes, perhaps because spread of
the virus from the reactivating neuron and through infected epithe-
lia can occur by cell-to-cell spread. There is clearer evidence for the
importance of cell-mediated immunity for containing and clearing
active infections, as immunocompromised individuals (particularly
those with low CD8+ T cells) suffer from more severe disease. T
cells can infiltrate both the peripheral infection-site lesion and also
the latently infected ganglion. It has been suggested that
HSV-specific T cells within the ganglion control the infection at
that site via mechanisms that do not involve clearance of the latently
infected neurons but instead in some way enhance maintenance of
latency (reviewed in refs. 84, 88). Interestingly, HSV-specific CD8+
T cells persist at the sites of HSV-2 peripheral lesions even after
healing has been completed [89, 90]. These findings are consistent
with the concept that latency is not simply an either/or situation.
Increasing evidence proposes that latency involves frequent, sub-
clinical reactivation episodes that are held in check by continuous
CD8+ T cell immunological surveillance.
7.4 HSV-1 Evasion Compared to some other herpesviruses, whose latency mechanisms
of the Acquired may involve more active viral replication, HSV-1 appears to express
Immune Response a relatively modest number of proteins that counteract the acquired
immune response. The glycoproteins gE and gI act as Fc receptors
to impede antibody mediated immunity (reviewed in ref. 84), while
the IE protein ICP47 inhibits the loading of virus-specific peptides
onto MHC class I molecules to reduce the potential for T cell
recognition [91]. These and other aspects of HSV evasion of
acquired immune responses are discussed in more detail in [84].
7.5 Intrinsic The third and most recently recognized arm of antiviral defenses is
Immunity known as intrinsic immunity, or intrinsic antiviral defense. This is a
broad concept that involves the functions of constitutively
expressed cellular proteins that act within an individual infected
cell. Therefore, as opposed to innate and adaptive immunity, intrin-
sic immunity neither depends on signal transduction nor presence
of antigen. Intrinsic immunity covers a wide range of cellular pro-
teins that act on different viruses and at different stages of their life
cycles. In many cases, viruses express proteins that counteract these
cellular proteins that restrict the efficiency of the infection, such
that the inhibitory effect becomes noticeable only when viruses
lacking the relevant function are studied. Furthermore, even in
these cases the restriction can be overcome by high input doses of

mutant virus. The restrictive proteins themselves are often
expressed or act in a cell- or species-specific manner. Intrinsic
immunity is a flexible concept that can cover many different aspects
of virus infection.
There is a 1000-fold decrease in probability that a restrictive
cell infected with an ICP0-null mutant HSV-1 will progress to
productive lytic infection, reflecting the actions of cellular intrinsic
immunity restriction factors (reviewed in refs. 32, 34). The conse-
quence of such restriction in the absence of ICP0 is that the viral
genome is assembled into a repressed chromatin structure, enabling
a quiescent infection to be established. There are a number of
strands of research that are related to this eventuality, including
the involvement of chromatin-modifying proteins and complexes
[66, 78, 92–94] and the repressive effects of components of cellular
nuclear substructures known as PML-NBs or ND10 [32, 34,
95]. These distinct punctate bodies are nucleated by the promye-
locytic leukemia (PML) protein and their assembly requires that
PML is modified by small ubiquitin-like proteins known as SUMO-
1, -2, and -3 [96]. PML and other major PML-NB components,
such as Sp100, hDaxx, and ATRX, have all been linked with restric-
tion of herpesvirus infections (reviewed in refs. 32, 34, 95–97).
A striking feature of HSV-1 infection is that several PML-NB
proteins are rapidly recruited to the parental viral genomes via a
mechanism that involves SUMO modification and the ability of
proteins to interact noncovalently with SUMO [98]. This response
of this group of proteins correlates with their repressive effects on
HSV-1 replication (reviewed in ref. 32). This restriction is over-
come by ICP0, which induces the degradation of PML and several
other SUMO-modified proteins and also inhibits the recruitment
of this group of proteins to the viral genome [32]. For further
discussion of these topics, along with the mechanisms used by ICP0
to overcome these defenses, please refer to the cited reviews and
publications.
8 Concluding Remarks
Clinically, HSV-1 is an important human pathogen, widely preva-

lent in society, but it is also important because it provides excellent
experimental systems for studying many aspects of virology and
virus–cell interactions. Decades of research have provided incredi-
bly valuable insight into subjects extending beyond virology, such
as cell biology and the regulation of many cellular processes. This
chapter aims to take a quick tour through herpes virus research,
providing a comprehensive but surface review on the biology and
life cycle of the virus, including virus structure, prevalence
and disease, replication in cultured cells, latency, antiviral defense,
and viral mechanisms to overcome the cellular response. The fol-

lowing chapters provide detailed protocols currently in use in labs
across the world at the forefront of HSV-1 research.
Acknowledgments
This work was funded by the UK Medical Research Council (to R.

D.E.) and the Australian National Health and Medical Research
Council (to R.J.D.). An Australian Government Research Training
Program stipend was awarded to C.E.D. The authors are very
grateful for the TEM image provided by Dr. Monica Miranda-
Saksena that is presented in Fig. 1a.
References
1. Weller SK (2011) Alphaherpesviruses. Molecu- 11. Denes CE, Miranda-Saksena M, Cunningham
lar virology. Caister Academic Press, Norfolk, AL, Diefenbach RJ (2018) Cytoskeletons in
UK the closet-subversion in alphaherpesvirus infec-
2. Knipe DM, Howley PM (2013) Fields virol- tions. Viruses 10:E79
ogy. Lippincott Williams and Wilkins, Philadel- 12. Miranda-Saksena M, Denes CE, Diefenbach
phia, PA RJ, Cunningham AL (2018) Infection and
3. Davison AJ, Eberle R, Ehlers B, Hayward GS, transport of herpes simplex virus type 1 in neu-
McGeoch DJ, Minson AC, Pellett PE, rons: role of the cytoskeleton. Viruses 10:E92
Roizman B, Studdert MJ, Thiry E (2009) 13. Zmasek CM, Knipe DM, Pellett PE, Scheuer-
The order Herpesvirales. Arch Virol mann RH (2019) Classification of human Her-
154:171–177 pesviridae proteins using domain-architecture
4. Looker KJ, Elmes JAR, Gottlieb SL, Schiffer aware inference of orthologs (DAIO). Virology
JT, Vickerman P, Turner KME, Boily MC 529:29–42
(2017) Effect of HSV-2 infection on 14. Eisenberg RJ, Heldwein EE, Cohen GH,
subsequent HIV acquisition: an updated sys- Krummenacher C (2011) Recent progress in
tematic review and meta-analysis. Lancet Infect understanding herpes simplex virus entry: rela-
Dis 17:1303–1316 tionship of structure to function. In: Weller SK
5. Kukhanova MK, Korovina AN, Kochetkov SN (ed) Alphaherpesviruses. Molecular virology.
(2014) Human herpes simplex virus: life cycle Caister Academic Press, Norfolk, UK, pp
and development of inhibitors. Biochemistry 131–152
79:1635–1652 15. Agelidis AM, Shukla D (2015) Cell entry
6. Birkmann A, Zimmermann H (2016) HSV mechanisms of HSV: what we have learned in
antivirals - current and future treatment recent years. Future Virol 10:1145–1154
options. Curr Opin Virol 18:9–13 16. Arii J, Kawaguchi Y (2018) The role of HSV
7. Whitley R, Baines J (2018) Clinical manage- glycoproteins in mediating cell entry. Adv Exp
ment of herpes simplex virus infections: past, Med Biol 1045:3–21
present, and future. F1000Res 7. https://doi. 17. Zaichick SV, Bohannon KP, Hughes A, Sollars
org/10.12688/f1000research.16157.1 PJ, Pickard GE, Smith GA (2013) The herpes-
8. Shiraki K (2018) Antiviral drugs against alpha- virus VP1/2 protein is an effector of dynein-
herpesvirus. Adv Exp Med Biol 1045:103–122 mediated capsid transport and neuroinvasion.
9. Johnston C, Gottlieb SL, Wald A (2016) Status Cell Host Microbe 13:193–203
of vaccine research and development of vac- 18. Preston VG, Murray J, Preston CM, McDou-
cines for herpes simplex virus. Vaccine gall IM, Stow ND (2008) The UL25 gene
34:2948–2952 product of herpes simplex virus type 1 is
10. Rajcani J, Banati F, Szenthe K, Szathmary S involved in uncoating of the viral genome. J
(2018) The potential of currently unavailable Virol 82:6654–6666
herpes virus vaccines. Expert Rev Vaccines 19. Huffman JB, Daniel GR, Falck-Pedersen E,
17:239–248 Huet A, Smith GA, Conway JF, Homa FL
(2017) The C terminus of the herpes simplex
virus UL25 protein is required for release of 32. Boutell C, Everett RD (2013) The regulation
viral genomes from capsids bound to nuclear of alphaherpesvirus infections by the ICP0
pores. J Virol 91:e00641–e00617 family of proteins. J Gen Virol 94:465–481
20. McElwee M, Vijayakrishnan S, Rixon F, Bhella 33. Everett RD (2006) The roles of ICP0 during
D (2018) Structure of the herpes simplex virus HSV-1 infection. In: Sandri-Goldin RM
portal-vertex. PLoS Biol 16:e2006191 (ed) Alpha herpesviruses. Molecular and cellu-
21. Mettenleiter TC, Klupp BG, Granzow H lar biology. Caister Academic Press, Wymond-
(2009) Herpesvirus assembly: an update. ham, pp 39–64
Virus Res 143:222–234 34. Everett RD (2011) The role of ICP0 in coun-
22. Mettenleiter TC, Minson T (2006) Egress of teracting intrinsic cellular resistance to virus
alphaherpesviruses. J Virol 80:1610–1611 infection. In: Weller SK
23. Diefenbach RJ (2015) Conserved tegument (ed) Alphaherpesviruses: molecular virology.
protein complexes: essential components in Caister Academic Press, Norfolk, UK, pp
the assembly of herpesviruses. Virus Res 51–72
210:308–317 35. Hagglund R, Roizman B (2004) Role of ICP0
24. Abaitua F, Souto RN, Browne H, Daikoku T, in the strategy of conquest of the host cell by
O’Hare P (2009) Characterization of the her- herpes simplex virus 1. J Virol 78:2169–2178
pes simplex virus (HSV)-1 tegument protein 36. Rice SA (2011) Multiple roles of immediate-
VP1-2 during infection with the HSV early protein ICP22 in HSV-1 replication. In:
temperature-sensitive mutant tsB7. J Gen Weller SK (ed) Alphaherpesviruses. Molecular
Virol 90:2353–2363 virology. Caister Academic Press, Norfolk, UK,
25. Kato A, Kawaguchi Y (2018) Us3 protein pp 73–88
kinase encoded by HSV: the precise function 37. Fox HL, Dembowski JA, DeLuca NA (2017) A
and mechanism on viral life cycle. Adv Exp Med herpesviral immediate early protein promotes
Biol 1045:45–62 transcription elongation of viral transcripts.
26. Maringer K, Stylianou J, Elliott G (2012) A MBio 8:e00745–e00717
network of protein interactions around the her- 38. Zaborowska J, Baumli S, Laitem C, O’Reilly D,
pes simplex virus tegument protein VP22. J Thomas PH, O’Hare P, Murphy S (2014) Her-
Virol 86:12971–12982 pes simplex virus 1 (HSV-1) ICP22 protein
27. Sciortino MT, Taddeo B, Giuffre-Cuculletto- directly interacts with cyclin-dependent kinase
M, Medici MA, Mastino A, Roizman B (2007) (CDK)9 to inhibit RNA polymerase II tran-
Replication-competent herpes simplex virus scription elongation. PLoS One 9:e107654
1 isolates selected from cells transfected with a 39. Oldham ML, Hite RK, Steffen AM, Damko E,
bacterial artificial chromosome DNA lacking Li Z, Walz T, Chen J (2016) A mechanism of
only the UL49 gene vary with respect to the viral immune evasion revealed by cryo-EM
defect in the UL41 gene encoding host shutoff analysis of the TAP transporter. Nature
RNase. J Virol 81:10924–10932 529:537–540
28. Mettenleiter TC (2002) Herpesvirus assembly 40. Ward SA, Weller SK (2011) HSV-1 DNA rep-
and egress. J Virol 76:1537–1547 lication. In: Weller SK (ed) Alphaherpesviruses.
29. Albecka A, Owen DJ, Ivanova L, Brun J, Molecular virology. Caister Academic Press,
Liman R, Davies L, Ahmed MF, Colaco S, Norfolk, UK, pp 89–112
Hollinshead M, Graham SC, Crump CM 41. Wilkinson DE, Weller SK (2003) The role of
(2017) Dual function of the pUL7-pUL51 DNA recombination in herpes simplex virus
tegument protein complex in herpes simplex DNA replication. IUBMB Life 55:451–458
virus 1 infection. J Virol 91:e02196–e02116 42. Weerasooriya S, DiScipio KA, Darwish AS,
30. DeLuca NA (2011) Functions and mechanism Bai P, Weller SK (2019) Herpes simplex virus
of action of the herpes simplex virus regulatory 1 ICP8 mutant lacking annealing activity is
protein, ICP4. In: Weller SK deficient for viral DNA replication. Proc Natl
(ed) Alphaherpesviruses. Molecular virology. Acad Sci U S A 116:1033
Caister Academic Press, Norfolk, UK, pp 43. Weber PC, Challberg MD, Nelson NJ,
17–38 Levine M, Glorioso JC (1988) Inversion events
31. Sandri-Goldin RM (2011) The functions and in the HSV-1 genome are directly mediated by
activities of HSV-1 ICP27, a multifunctional the viral DNA replication machinery and lack
regulator of gene expression. In: Weller SK sequence specificity. Cell 54:369–381
(ed) Alphaherpesviruses. Molecular virology. 44. Bermek O, Weller SK, Griffith JD (2017) The
Caister Academic Press, Norfolk, UK, pp UL8 subunit of the helicase-primase complex
39–50 of herpes simplex virus promotes DNA
annealing and has a high affinity for replication of viral maturation and egress. Microb Pathog
forks. J Biol Chem 292:15611–15621 118:146–153
45. Sourvinos G, Everett RD (2002) Visualization 58. Roussel E, Lippe R (2018) Cellular protein
of parental HSV-1 genomes and replication kinase D modulators play a role during multi-
compartments in association with ND10 in ple steps of herpes simplex virus 1 egress. J
live infected cells. EMBO J 21:4989–4997 Virol 92:e01486–e01418
46. Heming JD, Conway JF, Homa FL (2017) 59. Albecka A, Laine RF, Janssen AF, Kaminski CF,
Herpesvirus capsid assembly and DNA packag- Crump CM (2016) HSV-1 glycoproteins are
ing. Adv Anat Embryol Cell Biol 223:119–142 delivered to virus assembly sites through
47. Albright BS, Kosinski A, Szczepaniak R, Cook dynamin-dependent endocytosis. Traffic
EA, Stow ND, Conway JF, Weller SK (2015) 17:21–39
The putative herpes simplex virus 1 chaperone 60. Carmichael JC, Yokota H, Craven RC,
protein UL32 modulates disulfide bond forma- Schmitt A, Wills JW (2018) The HSV-1
tion during infection. J Virol 89:443–453 mechanisms of cell-to-cell spread and fusion
48. Salmon B, Cunningham C, Davison AJ, Harris are critically dependent on host PTP1B. PLoS
WJ, Baines JD (1998) The herpes simplex virus Pathog 14:e1007054
type 1 U(L)17 gene encodes virion tegument 61. Bloom DC, Kwiatkowski DL (2011) HSV-1
proteins that are required for cleavage and latency and the roles of LATs. In: Weller SK
packaging of viral DNA. J Virol 72:3779–3788 (ed) Alphaherpesviruses. Molecular virology.
49. Wang J, Yuan S, Zhu D, Tang H, Wang N, Caister Academic Press, Norfolk, UK, pp
Chen W, Gao Q, Li Y, Wang J, Liu H, 295–316
Zhang X, Rao Z, Wang X (2018) Structure of 62. Efstathiou S, Preston CM (2005) Towards an
the herpes simplex virus type 2 C-capsid with understanding of the molecular basis of herpes
capsid-vertex-specific component. Nat Com- simplex virus latency. Virus Res 111:108–119
mun 9:3668 63. Nicoll MP, Proenca JT, Efstathiou S (2012)
50. Mettenleiter TC, Muller F, Granzow H, Klupp The molecular basis of herpes simplex virus
BG (2013) The way out: what we know and do latency. FEMS Microbiol Rev 36:684–705
not know about herpesvirus nuclear egress. 64. Phelan D, Barrozo ER, Bloom DC (2017)
Cell Microbiol 15:170–178 HSV1 latent transcription and non-coding
51. Crump C (2018) Virus assembly and egress of RNA: a critical retrospective. J Neuroimmunol
HSV. Adv Exp Med Biol 1045:23–44 308:65–101
52. Owen DJ, Crump CM, Graham SC (2015) 65. Collins-McMillen D, Goodrum FD (2017)
Tegument assembly and secondary envelop- The loss of binary: pushing the herpesvirus
ment of alphaherpesviruses. Viruses latency paradigm. Curr Clin Microbiol Rep
7:5084–5114 4:124–131
53. Bigalke JM, Heldwein EE (2017) Have NEC 66. Knipe DM, Cliffe A (2008) Chromatin control
coat, will travel: structural basis of membrane of herpes simplex virus lytic and latent infec-
budding during nuclear egress in herpesviruses. tion. Nat Rev Microbiol 6:211–221
Adv Virus Res 97:107–141 67. Catez F, Picard C, Held K, Gross S,
54. Han J, Chadha P, Starkey JL, Wills JW (2012) Rousseau A, Theil D, Sawtell N,
Function of glycoprotein E of herpes simplex Labetoulle M, Lomonte P (2012) HSV-1
virus requires coordinated assembly of three genome subnuclear positioning and associa-
tegument proteins on its cytoplasmic tail. tions with host-cell PML-NBs and centromeres
Proc Natl Acad Sci U S A 109:19798–19803 regulate LAT locus transcription during latency
55. Metrick CM, Heldwein EE (2016) Novel in neurons. PLoS Pathog 8:e1002852
structure and unexpected RNA-binding ability 68. Watson ZL, Washington SD, Phelan DM,
of the C-terminal domain of herpes simplex Lewin AS, Tuli SS, Schultz GS, Neumann
virus 1 tegument protein UL21. J Virol DM, Bloom DC (2018) In vivo knockdown
90:5759–5769 of the herpes simplex virus 1 latency-associated
56. Koenigsberg AL, Heldwein EE (2018) The transcript reduces reactivation from latency. J
dynamic nature of the conserved tegument Virol 92:e00812–e00818
protein UL37 of herpesviruses. J Biol Chem 69. Cabrera JR, Charron AJ, Leib DA (2018) Neu-
293:15827–15839 ronal subtype determines herpes simplex virus
57. Raza S, Alvisi G, Shahin F, Husain U, 1 latency-associated-transcript promoter activ-
Rabbani M, Yaqub T, Anjum AA, Sheikh AA, ity during latency. J Virol 92:JVI.00430-00418
Nawaz M, Ali MA (2018) Role of Rab GTPases 70. Edwards TG, Bloom DC (2019) Lund human
in HSV-1 infection: molecular understanding mesencephalic (LUHMES) neuronal cell line
supports HSV-1 latency in vitro. J Virol 93: signalling, antiviral responses and virus coun-
e02210–e02218 termeasures. J Gen Virol 89:1–47
71. Umbach JL, Kramer MF, Jurak I, Karnowski 82. Sobol PT, Mossman KL (2011) Mechanisms of
HW, Coen DM, Cullen BR (2008) Micro- subversion of type I interferon responses by
RNAs expressed by herpes simplex virus 1 dur- alphaherpesviruses. In: Weller SK
ing latent infection regulate viral mRNAs. (ed) Alphaherpesviruses. Molecular virology.
Nature 454:780–783 Caister Academic Press, Norfolk, UK, pp
72. Flores O, Nakayama S, Whisnant AW, 219–336
Javanbakht H, Cullen BR, Bloom DC (2013) 83. Orzalli MH, DeLuca NA, Knipe DM (2012)
Mutational inactivation of herpes simplex virus Nuclear IFI16 induction of IRF-3 signaling
1 microRNAs identifies viral mRNA targets during herpesviral infection and degradation
and reveals phenotypic effects in culture. J of IFI16 by the viral ICP0 protein. Proc Natl
Virol 87:6589–6603 Acad Sci U S A 109:E3008–E3017
73. Nicoll MP, Proenca JT, Connor V, Efstathiou S 84. Jerome KR (2011) Immunity to herpes simplex
(2012) Influence of herpes simplex virus virus. In: Weller SK (ed) Alphaherpesviruses.
1 latency-associated transcripts on the estab- Molecular virology. Caister Academic Press,
lishment and maintenance of latency in the Norfolk, UK, pp 331–350
ROSA26R reporter mouse model. J Virol 85. Luecke S, Paludan SR (2015) Innate recogni-
86:8848–8858 tion of alphaherpesvirus DNA. Adv Virus Res
74. Proenca JT, Coleman HM, Connor V, Win- 92:63–100
ton DJ, Efstathiou S (2008) A historical anal- 86. Kurt-Jones EA, Orzalli MH, Knipe DM
ysis of herpes simplex virus promoter (2017) Innate immune mechanisms and herpes
activation in vivo reveals distinct populations simplex virus infection and disease. Adv Anat
of latently infected neurones. J Gen Virol Embryol Cell Biol 223:49–75
89:2965–2974 87. Su C, Zhan G, Zheng C (2016) Evasion of host
75. Proenca JT, Coleman HM, Nicoll MP, antiviral innate immunity by HSV-1, an
Connor V, Preston CM, Arthur J, Efstathiou update. Virol J 13:38
S (2011) An investigation of herpes simplex 88. Zhang J, Liu H, Wei B (2017) Immune
virus promoter activity compatible with latency response of T cells during herpes simplex virus
establishment reveals VP16-independent acti- type 1 (HSV-1) infection. J Zhejiang Univ Sci
vation of immediate-early promoters in sensory B 18:277–288
neurones. J Gen Virol 92:2575–2585
89. Zhu J, Koelle DM, Cao J, Vazquez J, Huang
76. Ramchandani M, Kong M, Tronstein E, ML, Hladik F, Wald A, Corey L (2007) Virus-
Selke S, Mikhaylova A, Magaret A, Huang specific CD8+ T cells accumulate near sensory
ML, Johnston C, Corey L, Wald A (2016) nerve endings in genital skin during subclinical
Herpes simplex virus type 1 shedding in tears HSV-2 reactivation. J Exp Med 204:595–603
and nasal and oral mucosa of healthy adults.
Sex Transm Dis 43:756–760 90. Zhu J, Peng T, Johnston C, Phasouk K, Kask
AS, Klock A, Jin L, Diem K, Koelle DM,
77. Ferenczy MW, DeLuca NA (2009) Epigenetic Wald A, Robins H, Corey L (2013) Immune
modulation of gene expression from quiescent surveillance by CD8alphaalpha+ skin-resident
herpes simplex virus genomes. J Virol T cells in human herpes virus infection. Nature
83:8514–8524 497:494–497
78. Ferenczy MW, DeLuca NA (2011) Reversal of 91. Hill A, Jugovic P, York I, Russ G, Bennink J,
heterochromatic silencing of quiescent herpes Yewdell J, Ploegh H, Johnson D (1995) Her-
simplex virus type 1 by ICP0. J Virol pes simplex virus turns off the TAP to evade
85:3424–3435 host immunity. Nature 375:411–415
79. Harris RA, Everett RD, Zhu XX, Silverstein S, 92. Ferenczy MW, Ranayhossaini DJ, Deluca NA
Preston CM (1989) Herpes simplex virus type (2011) Activities of ICP0 involved in the rever-
1 immediate-early protein Vmw110 reactivates sal of silencing of quiescent herpes simplex
latent herpes simplex virus type 2 in an in vitro virus 1. J Virol 85:4993–5002
latency system. J Virol 63:3513–3515
93. Gu H, Roizman B (2007) Herpes simplex
80. Raja P, Lee JS, Pan D, Pesola JM, Coen DM, virus-infected cell protein 0 blocks the silencing
Knipe DM (2016) A herpesviral lytic protein of viral DNA by dissociating histone deacety-
regulates the structure of latent viral chroma- lases from the CoREST-REST complex. Proc
tin. MBio 7:e00633–e00616 Natl Acad Sci U S A 104:17134–17139
81. Randall RE, Goodbourn S (2008) Interferons 94. Gu H, Roizman B (2009) The two functions of
and viruses: an interplay between induction, herpes simplex virus 1 ICP0, inhibition of
silencing by the CoREST/REST/HDAC 97. Tavalai N, Stamminger T (2008) New insights

complex and degradation of PML, are executed into the role of the subnuclear structure ND10
in tandem. J Virol 83:181–187 for viral infection. Biochim Biophys Acta
95. Glass M, Everett RD (2013) Components of 1783:2207–2221
promyelocytic leukemia nuclear bodies 98. Cuchet-Lourenco D, Boutell C,
(ND10) act cooperatively to repress herpesvi- Lukashchuk V, Grant K, Sykes A, Murray J,
rus infection. J Virol 87:2174–2185 Orr A, Everett RD (2011) SUMO pathway
96. Everett RD, Boutell C, Hale BG (2013) Inter- dependent recruitment of cellular repressors
play between viruses and host sumoylation to herpes simplex virus type 1 genomes. PLoS
pathways. Nat Rev Microbiol 11:400–411 Pathog 7:e1002123
Chapter 2
Vaccines for Herpes Simplex: Recent Progress Driven

by Viral and Adjuvant Immunology
Kerrie J. Sandgren, Naomi R. Truong, Jacinta B. Smith, Kirstie Bertram,
Abstract
Herpes simplex viruses (HSV) types 1 and 2 are ubiquitous. They both cause genital herpes, occasionally
severe disease in the immunocompromised, and facilitate much HIV acquisition globally. Despite more
than 60 years of research, there is no licensed prophylactic HSV vaccine and some doubt as to whether this
can be achieved. Nevertheless, a previous HSV vaccine candidate did have partial success in preventing
genital herpes and HSV acquisition and another immunotherapeutic candidate reduced viral shedding and
recurrent lesions, inspiring further research. However, the entry pathway of HSV into the anogenital
mucosa and the subsequent cascade of immune responses need further elucidation so that these responses
could be mimicked or improved by a vaccine, to prevent viral entry and colonization of the neuronal
ganglia. For an effective novel vaccine against genital herpes the choice of antigen and adjuvant may be
critical. The incorporation of adjuvants of the vaccine candidates in the past, may account for their partial
efficacy. It is likely that they can be improved by understanding the mechanisms of immune responses
elicited by different adjuvants and comparing these to natural immune responses. Here we review the
history of vaccines for HSV, those in development and compare them to successful vaccines for chicken pox
or herpes zoster. We also review what is known of the natural immune control of herpes lesions, via
interacting innate immunity and CD4 and CD8 T cells and the lessons they provide for development of
new, more effective vaccines.
Key words Herpes simplex, Varicella, Vaccine development, Antigen, Adjuvants, Antibody, T cells,
Innate immunity
1 Introduction
1.1 The Need The two great challenges in translational research for Herpes sim-
for Herpes Simplex plex virus are prevention of initial genital herpes and suppression of
Virus Vaccines recurrent herpes, by prophylactic vaccines and either antivirals or
immunotherapeutic vaccines respectively. There is currently no
licensed prophylactic vaccine. Antiviral therapy for recurrent genital
herpes markedly reduces clinical episodes but does not completely
suppress viral shedding and would benefit from a longer drug half-
life [1]. Thus, prophylactic and immunotherapeutic vaccines have
31
32 Kerrie J. Sandgren et al.
different goals and different challenges. Prophylactic vaccines must

stimulate a protective naive immune response whereas immuno-
therapeutic vaccines must exceed the existing natural immune
response. The latter is particularly difficult for recurrent herpes
simplex where each recurrence boosts the immune response locally
and systemically but is still insufficient to prevent future
recurrences.
A prophylactic vaccine for HSV1 and 2 is a global public health
priority for development, as stated by WHO [2, 3] for several
reasons: (1) genital herpes caused by HSV1 or 2 is one of the
commonest sexually transmitted infection; (2) it causes severe dis-
ease in neonates; (3) HSV1 is the leading cause of infectious blind-
ness in Western countries; and (4) prior HSV2 infection leads to a
three- to sixfold increased risk of HIV infection globally [4–6]. Up
to 50% of HIV transmissions in sub-Saharan Africa are estimated to
occur in a setting of HSV2 infection [7, 8] and are more likely to
occur soon after HSV2 acquisition [9]. Therefore, a prophylactic
HSV vaccine would be likely to reduce HIV spread [10].
1.2 The History The only licensed human herpesvirus vaccines are live attenuated
of HSV Vaccine viral vaccines or subunit vaccines for chicken pox and herpes zoster
Development (shingles), both caused by varicella zoster virus (VZV). Progress
with development of vaccines for herpes simplex virus has been very
slow. During 60 years of mostly unsuccessful attempts at develop-
ment of an HSV vaccine, live attenuated candidates have been
avoided because of concerns about potential carcinogenicity (for
cervical cancer) and recombination with clinical strains resulting in
reversion to virulence.
In the 1990s two recombinant viral protein (subunit) vaccine
candidates were trialed. The Chiron vaccine candidate consisted of
HSV2 entry glycoproteins B and D combined with oil in water
emulsion adjuvant, MF59. When administered to subjects with
recurrent genital herpes it induced high levels of neutralizing anti-
body but had no persistent or significant effect on frequency of
recurrences [11]. The GSK vaccine candidate, Simplirix, consisted
of just the HSV2 entry glycoprotein D (gD), and the adjuvant
system AS04 [12]. HSV2 gD is widely recognized by human
populations, inducing both neutralizing antibody and CD4 T
cells [13]. AS04 consists of alum and deacylated monophosphoryl
lipid A (dMPL). Simplirix showed 74% efficacy but only in HSV1/
2 seronegative women with long-term HSV2-infected partners
[12]. However, the subsequent Herpevac trial of Simplirix in ran-
domly selected HSV1 and 2 seronegative women surprisingly
showed significant efficacy against genital herpes caused by HSV1
(58% efficacy) but not HSV2 (only 20% and insignificant efficacy)
[14]. Thus, cross-protection against HSV1 was achieved with
recombinant HSV2 gD, which is highly conserved between the
two serotypes [15]. This protection correlated with HSV1
Immunology Drives HSV Vaccine Progress 33
neutralizing antibody titers, whereas HSV2 neutralizing antibody

titers were low. The better efficacy of the first trial might be
explained by subclinical genital exposure to HSV2 shed by the
infected partner, priming a later successful vaccine response. The
efficacy of the novel adjuvant dMPL was attributed to induction of
CD4 follicular helper (Tfh, and possibly Th1) T cells as well as
neutralizing antibody. However, no specific CD8 T cells were
induced [16].
More recently, new specifically mutated, live attenuated candi-
dates have been developed. The most advanced is HSV529 where
two key proteins have been deleted, rather than using simple point
mutations, to reduce the likelihood of reversion to virulence. They
are currently in clinical trials [17]. Other vaccine candidates have
included DNA vaccines and hybrid recombinant viruses.
1.3 A Comparison The pathogenesis of the alphaherpesviruses VZV and HSV is simi-
of the Recent Herpes lar. Both infect skin and nerves and reactivate, from latent infection
Zoster and Herpes in trigeminal and dorsal root ganglia (TG and DRG), although this
Simplex Vaccines is much more frequent for HSV. Vaccination with live attenuated
varicella virus Oka strain has been successful against chicken pox
(Varivax) and against Herpes zoster with a 14-fold more concen-
trated preparation (Zostavax). Zostavax prevents herpes zoster in
51% of immunized subjects over 60 years of age and prolonged pain
or postherpetic neuralgia (PHN) in 65% of them, but its efficacy
against the incidence of zoster diminishes in subjects >70 years of
age and markedly declines in all over 8 years [18, 19]. Recently a
new recombinant protein vaccine for herpes zoster (RZV) was
shown to have much higher efficacy of >90%, even in subjects
>80 years of age. There was no significant decline in protection
over 4 years, with immunogenicity retained for 9 years
[20–22]. The vaccine contains a single varicella glycoprotein
(E) and the adjuvant system, AS01B, which consists of toll-like
receptor 4 agonist dMPL and the saponin QS21, formulated in
liposomes. QS21 stimulates a complex cascade of innate and adap-
tive immunity in injected muscle and draining lymph nodes.
Together the adjuvant system stimulates VZV glycoprotein-specific
CD4 T cells (and low level CD8 memory T cells) and gE specific
antibody responses. CD8 T cell responses are only detected by the
most sensitive assays [20, 23–26]. Therefore, very high levels of
protection against a reactivating alphaherpesvirus can be induced
by a single recombinant viral protein combined with an adjuvant
that induces the appropriate adaptive (T and B cell) immune
response by initially targeting innate immune and antigen present-
ing cells, including macrophages, NK cells and dendritic cells. This
is a strong improvement in immunogenicity and efficacy over the
response induced by the live attenuated vaccine [25, 27].
The marked difference between the 90% efficacy of RZV and
the partial efficacy of Simplirix despite similar compositions is
probably due to the following factors: (1) prevention of primary

versus recurrent disease—RZV is controlling disease after viral
reactivation, whereas Simplirix was aimed at preventing disease
after first or primary infection; (2) virus specific differences in the
immune responses needed for prevention or control; (3) important
differences in the mechanism of action of dMPL alone and com-
bined dMPL and QS21; (4) possibly strategies which each virus
uses to evade the immune response [28, 29]. Understanding the
relative importance of each mechanism may help develop a more
efficacious HSV vaccine.
There is a very important distinction between an “immuno-
therapeutic” and a “prophylactic” vaccine. Prophylactic vaccines
aim at preventing entry of a pathogen usually at a skin/mucosal
surface and therefore need to stimulate broad and durable immu-
nity at this site. Simplirix stimulated both antibody and CD4 T cell
responses and the best correlation with efficacy in the Herpevac trial
was antibody to which CD4 T (probably Tfh) cells contributed
[16]. These responses were measured in blood but local immune
responses to HSV in skin (and possibly nerve ganglia) are more
important and may not parallel those in blood. CD8 T cell
responses almost certainly need to be stimulated [30]. This is
supported by results of trials of candidate immunotherapeutic vac-
cines from Genocea and Agenus where the correlation of immune
effectors with vaccine efficacy suggests all three—antibody, CD4
and CD8 T cells—are important. This may also be true for prophy-
lactic HSV vaccines. Furthermore, a prophylactic vaccine will need
to stimulate dendritic cells (DCs) to induce all of these immune
effectors as these are the only cells which can stimulate naı̈ve T cells.
Alternatively, the aim of therapeutic vaccines is to prevent or
reduce recurrences or to reduce disease severity or duration. Herpes
zoster results from neuronal VZV reactivation so in preventing it,
RZV acts like an immunotherapeutic vaccine. The mechanism of
action of RZV is activation and/or recruitment of blood and
presumably tissue memory T cells in a polyfunctional state which
lasts for many years [20]. It also stimulates a weak CD8 T cell
memory response [26]. These combined effects of QS21 and
dMPL compared to dMPL alone may partly explain its increased
efficacy over Simplirix.
Furthermore, future vaccine design should be guided by pre-
cisely elucidating the effects of such adjuvants on the innate
immune response, especially on subsets of DCs, which result in
the immune effector response required for prevention of infection
or disease. The following mechanisms need to be defined: (1) the
important effector immune responses (antibody, CD4 and/or
CD8 T cells; key cytokines); (2) which pathogen proteins induce
them; (3) which DCs to target to induce such effectors; (4) which
adjuvants will activate the appropriate DC subsets and where will
they work; (5) what side-effects of these adjuvants might lead to
toxicity.
2 Immune Control of HSV
2.1 Innate Immunity Keratinocytes are the first line of defense against HSV infection in
the skin and form a formidable barrier to pathogen entry. Kerati-
2.1.1 Skin and Mucosal
nocytes also play a key role in innate immunity against pathogens
Keratinocytes
[31, 32] expressing many Toll-like receptors (TLRs) and producing
a vast array of antimicrobial peptides [33]. In HSV, keratinocytes
attract activated CD4 or CD8 T cells by producing the chemokines
CCL3, 4, and 5 [13] and direct the immune response to Th1 or
Th2/Treg response through proinflammatory cytokines—TNF,
IL-1α, IL-1β, IL-6, IL-10, IL-18, and IL-33 [13, 34, 35]. In
addition, keratinocytes have also been shown to be an accessory
or “nonprofessional” antigen presenting cell that upregulate MHC
class II in response to IFN-γ produced by T cells [36, 37].
2.1.2 Type I Interferons Type I Interferons (IFNs) are a key component of innate antiviral
and Plasmacytoid DCs immunity, produced by keratinocytes and antigen presenting cells
in the epidermis following detection of the virus and activation of
pattern recognition receptor signalling, such as the TLR and
RNA/DNA sensor signalling pathways. The type I IFNs expressed
in humans include IFN-α (with multiple subtypes), IFN-β, IFN-ε,
IFN-ω, and IFN-κ, although the functions of IFN-α and -β have
been best characterized [38, 39]. Type I IFNs induce the expres-
sion of antiviral genes known as IFN stimulated genes (ISGs),
which play a role in inhibiting viral replication and promoting
degradation of viral mRNA [39]. Type I IFNs also activate multiple
immune cell types in response to HSV infection, including neutro-
phils, macrophages, natural killer cells and DCs [38].
In human recurrent genital herpes lesions, IFN-α producing
plasmacytoid dendritic cells (pDCs) have been shown to infiltrate
the dermis and were often found at the dermoepidermal junction,
surrounded by ISG-producing stromal cells. They were closely
associated with activated CD69+ T cells as well as NK cells
[40]. Despite expressing the HSV entry receptors nectin1, nectin2
and HVEM, pDCs were resistant to HSV infection in vitro, but
were able to stimulate virus-specific autologous T cell proliferation,
particularly in CD8 T cells, indicating their capacity to cross-
present antigens. Thus pDCs were both strong producers of
IFN-α and stimulated T cell proliferation in these lesions. However,
more recent studies suggest that in general T cell proliferation is
stimulated by a subset of DCs, AXL+SIGLEC6+ DCs (AS-DCs),
copurifying with pDCs rather than pDCs themselves. This needs to
be studied in herpes lesions.
2.1.3 Natural Killer Cells Several studies suggest a role for natural killer (NK) cells in response
and Innate Lymphoid Cells to HSV infection, particularly in controlling the severity of infec-
tion. In mouse studies, mice that lack or are depleted of NK cells or
that have defective NK cell activity have increased susceptibility to

HSV2 infection and increased viral titers in the skin, vaginal
mucosa, spinal cord, and brain stem [41–43]. Similarly, in humans,
case studies examining patients with a specific lack of NK cells have
correlated this with increased susceptibility to severe HSV infec-
tions [44, 45]. Furthermore, enrichment of NK cells has been
observed in recurrent herpes lesions [46], interacting with pDCs
[40] and CD4 T cells [47]. In in vitro studies, TLR2-stimulated
NK cells could directly activate HSV gD-specific CD4 T cells [47],
and their high frequency of contact with CD4 T cells in herpetic
lesions suggests they play a role in stimulating CD4 T cells in this
setting. These studies indicate that NK cells play a role in
controlling HSV infection by restricting viral replication and spread
through the early production of IFNγ and may also be important
stimulators of adaptive immunity. However, studies in both mice
and humans have not identified a correlation between NK cell
activity and viral clearance, which appears to be the role of T
lymphocytes [46, 48–50].
NK cells are part of a network of innate lymphoid cells (ILCs),
whose functions are analogous to T cell subsets [51]. ILCs prefer-
entially localize into barrier tissues such as the skin, lungs, and gut
[52]. To date, no studies have investigated the presence and role of
ILCs in HSV infection.
2.2 Adaptive Levels of HSV specific IgG and more importantly mucosal IgA, are
Immunity increased in vaginal secretions of mice, guinea pigs, and nonhuman
primates intravaginally vaccinated with HSV2 [48, 53, 54], as well
2.2.1 The Role
as in cervical secretions of women with primary HSV2 infection
of Neutralizing Antibodies
[53]. Antibody responses vary, with IgG present as early as a few
in HSV Infection
days and IgA present up to 2 weeks postinfection; however, both
persist for weeks after infection. Both antibodies react to various
HSV glycoproteins, including gD, gB, and gC [53]. However, the
relative importance of antibody in protection against HSV2 in
animal models has been contradictory [39], as has data from vac-
cine trials [55–59]. Some studies found that T cells, rather than B
cells, were critical for protection against lethal challenge of HSV2
[60, 61].
More recently, the importance of neutralizing antibodies has
again been demonstrated in studies of a trivalent vaccine containing
HSV2 gC, gD and gE with adjuvants CpG and alum in rhesus
macaques and guinea pigs. The vaccine induced plasma and muco-
sal neutralizing antibodies that blocked gD and gE immune evasion
activities and stimulated CD4 T cell responses [62]. In guinea pigs
the vaccine reduced the frequency of recurrent lesions and vaginal
shedding of HSV2 DNA by approximately 50% and almost
completely prevented viral shedding [63].
In a human in vitro model of fetal dorsal root ganglionic
(DRG) neurons innervating autologous epidermal skin explants,
neutralizing antibodies reduced transmission of virus from axons to

epidermis by 90% by binding to the virus in the intercellular gaps
between axon termini and epidermal cells. It was suggested that
antibodies might also be effective in preventing epidermis-to-neu-
ron transmission during primary HSV infection [64]. Studies of
neonatal herpes and the protective effects of maternal immuniza-
tion also provide some strong evidence for the importance of
neutralizing antibodies in protection against HSV infection. Neo-
natal HSV infections are rare, but cause considerable morbidity and
mortality in infants, with an estimated fatality rate of 60% world-
wide [65]. The risk of neonatal herpes infection is highest in
mothers who have first-episode primary infection at the time of
delivery, with transmission rates up to 60%, whereas only 1–2% of
babies born to mothers with recurrent HSV are likely to develop
neonatal herpes [66–68]. Thus, maternal immunity provides pro-
tection to the neonate.
During pregnancy, IgG antibodies are transferred from mother
to child across the placenta [69], and low maternal neutralizing
antibody titer and avidity have been identified as risk factors for
transmission to neonates [66, 67]. Some pregnant women do not
have protective antibody levels and there is some evidence in mice
that maternal immunization could provide protection [70–72], as
with tetanus and seasonal influenza [73].
Clearly, neutralizing antibodies play a key early role in primary
HSV infection, and may be particularly important in preventing
vertical transmission from mother to neonate. However, they are
not acting in isolation, as cell-mediated immunity is also necessary
for HSV protection and especially clearance [39].
2.2.2 The Role of T Cells CD4 and CD8 T cells are major cell-mediated immune effectors.
in HSV Infection CD4 T cells “help” activate B cells and class-switching of antibody
from IgM to IgG, and also help activate CD8 T cells to be cytotoxic
or secrete cytokines [74, 75]. CD4 T cells cytokines such as TNF
and IFN-γ, which are antiviral, control HSV viral replication and
spread [76]. Several groups have shown that IFN-γ is important in
human recurrent herpes [50, 77]. It exerts its effect by inducing
antiviral ISGs [78], immunologically by activating NK and CDT
cells, stimulating macrophage phagocytosis, enhancing MHCI and
inducing MHCII expression by secondary antigen presenting cells,
including keratinocytes. CD8 T cells kill virally infected cells via
perforin and granzymes and also secrete IFN-γ and TNF [78].
T cell immunity to HSV acts at two main sites—at the anogen-
ital mucosa and at neuronal ganglia: After initial mucosal HSV
infection, HSV-specific, activated effector memory CD4 and CD8
T cells expressing IFN-γ and TNF infiltrate trigeminal ganglia
(TG) and surround neurons and adherent satellite cells. It has
been speculated that these T cells might be tissue resident memory
cells (TRMs), but so far this remains unproven [79, 80]. The same
phenomenon has been observed in mice where the T cells control

latency (and a minor degree of reactivation) via granzymes which
penetrate the neurons and degrade intracellular HSV immediate
early protein ICP4 [81, 82].
CD4 and CD8 T cells are also important in control of HSV
infection in the anogenital mucosa, as shown by early studies of
human recurrent herpes lesions. CD4 T cells infiltrate early and
remain predominant in the first 12–48 h after lesion appearance,
followed by later infiltration of CD8 T cells [50]. HSV infection
downregulates MHCI on keratinocytes, so they cannot be recog-
nized by CD8 T cells, however, the early infiltrating CD4 T cells
produce IFN-γ, which can restore MHCI expression, allowing
recognition by the later infiltrating HSV specific CD8 T cells.
IFN-γ also upregulates MHC class II on keratinocytes allowing
them to present HSV antigen to the specific CD4 T cells
[27]. Although HSV does not downregulate MHCI in mice, deple-
tion of CD4 T cells provided evidence of their critical role—CD4 T
cell-deficient mice fail to recruit CD8 T cells to the vaginal epithe-
lium through failure of epithelial cells to secrete CXCL9 and
CXCL10 after IFN-γ stimulation [83]. The later infiltration of
CD8 T cells [50] into genital herpes lesions is strongly correlated
with viral clearance [46].
In biopsies at the site of healed human recurrent herpes lesions,
HSV specific resident memory CD4 and CD8 T cells persist in this
genital skin for at least 6 months posthealing [84] and are able to
produce IFN-γ [1]. The CD8 TRMs express two CD8α chains
which result in high affinity antiviral binding to infected cells
[85]. They persist at the dermoepidermal junction (deeper than
in mice) adjacent to peripheral nerve endings where they monitor
reactivation and respond by expressing genes for antiviral function
and chemotaxis [86–88]. CD4 TRMs are deeper in the dermis.
CD8 TRMS lack expression of chemokine receptors required for
egress from dermis and recirculation and are mostly noncytolytic
[85]. Therefore, these cells maintain active immunosurveillance
after clearance of a recurrent lesion or symptomatic shedding.
Nevertheless, viral shedding continues to occur at variable rates in
different subjects. Mathematical modelling showed that insufficient
CD8 TRM cells are present in genital skin to eliminate foci of
reactivation. The restricted spatial distribution and heterogeneity
of TRM cells allow areas for replication of reactivated HSV to occur
in keratinocytes between them. The mathematical modelling was
confirmed through immunohistology of genital biopsies. This pau-
city of genital tract TRM cells explains how reactivation continues
to occur, despite their presence, and suggest a zone of remote
control of HSV replication around them probably via antiviral
cytokines [89].
The above studies show key roles for CD8 T cells in recurrent
genital herpes. They clear HSV infected cells from active lesions and
then some transition to TRM cells, immune sentinels, to partly
control viral shedding after reactivation. We have also shown
marked infiltration of CD4 and CD8 T cells in the upper dermis
after initial genital herpes (unpublished observations). These stud-
ies suggest they are important target cells for prophylactic as well as
immunotherapeutic vaccines. Therefore, development of new vac-
cines for genital herpes should include a focus on stimulation of
both CD4 and CD8 T cells as they are synergistic, and also on
induction of TRM cells that remain at the site of a lesion or of viral
shedding, ready for the next encounter with HSV after reactivation.
Higher TRM cell numbers than those induced by natural infection
may be required to overcome the inadequate spatial distribution
and to provide higher IFN-γ production, perhaps needing special
adjuvants [89].
On the other hand, induction of regulatory CD4 T cells
(Tregs) by adjuvants should be avoided. Although they have been
found to suppress the proliferation of HSV specific CD4 T cells at
times of clinical quiescence [90], they have also been shown to
suppress T cell effector functions in mice [91, 92] and correlate
with increased viral shedding in humans [93].
Gamma-delta (γδ) T cells defined by the expression of a γδ
TCR, not an αβ TCR, are enriched in skin, in both the epidermis
and dermis in mice but only the dermis in humans [94], In mice
one study found that γδ T cells were protective [95], but a more
recent study found that they were the first immune effector to
encounter HSV and were directly infected, prior to the infection
of Langerhans cells [96]. However, the role of skin γδ T cells during
HSV infection has not been investigated in human skin or genital
mucosa and whether they are relevant to vaccine design.
2.2.3 The Role Dendritic cells (DCs) patrol skin and mucosa to detect and take up
of Dendritic Cells pathogens, after which they mature and migrate to lymph nodes
in Stimulating HSV where they present their antigens to naıve T cells, thereby activating
Immunity the adaptive immune response [97]. Early studies of the role and
response of human DCs to HSV infection used model monocyte-
derived DCs (MDDCs) because of technical limitations in obtain-
ing human skin/mucosa DCs. These immature MDDCs could be
productively infected by HSV, resulting in apoptosis (a process that
HSV normally inhibits). Bystander uninfected DCs pulsed with
apoptotic HSV-infected DCs could cross-present and stimulate
HSV specific CD8 T cells [98, 99].
These studies complimented murine studies in the 1980s
showing the importance of Langerhans cells (LCs), the major DC
subtype in the stratified squamous epidermis of anogenital mucosa,
in uptake and deep transport of HSV [100]. However murine LCs
do not present HSV antigen to naı̈ve CD8 T cells in lymph nodes
but this is the function of CD8α+ DCs and CD103+ dermal DCs
(cDC1s) [101–103]. The latter are the predominant cells trans-
porting HSV antigens out of murine skin explants [96] suggesting
an exchange of HSV antigen between different DC subtypes occurs
in skin.
This has been demonstrated in our human studies where LCs
are productively infected and migrate into the dermis while devel-
oping apoptosis [104]. Unlike murine LCs, there was no inhibition
of migration of a significant proportion of LCs to the dermis. In
recent years, single cell RNA-sequencing have facilitated the classi-
fication of DC subsets. In human dermis, the two main DC subsets
are conventional DC type 1 and 2 (cDC1 and cDC2) [105]. cDC1s
are a minor subset proportionally, but are highly efficient at cross-
presentation of exogenous antigen to CD8 T cells [106]. The major
dermal DC subset are cDC2s, which have conventional antigen-
presenting capacity to stimulate CD4 T cells, but also have some
ability to cross-present to CD8 T cells [107, 108]. DC-SIGN
expressing dermal DCs are now thought to be more accurately
classified as macrophages [109].
Using this new classification, we studied the interaction of
HSV-infected LCs with dermal cDC1s in human inner foreskin
explants and in biopsies of initial herpes simplex virus lesions. The
migrating apoptotic HSV1 infected LCs interacted with cDC1s in
clusters in the dermis. LC fragments were detected within some
cDC1s, and cDC1s emigrated from HSV1 infected explants, similar
to CD103+ dermal DCs in murine models. Additionally,
DC-SIGN+ MNPs were also observed in clusters interacting with
HSV-infected LCs in the dermis [104]. Therefore, epidermal LCs
take up HSV, become infected and transfer the virus or viral anti-
gens to subsets of dermal DCs/MNPs, facilitating viral relay, prob-
ably leading to stimulation of CD4 and CD8 T cells in lymph nodes
and even lesions by different pathways. An important question that
remains is whether human cDC2s have similar interactions with
HSV-infected LCs? Understanding the roles of specific human DC
subsets in response to HSV infection should help DC targeting of
vaccines (and adjuvants), perhaps simulating the same immune
responses as natural infection and stimulating CD8 T cell responses.
A summary of the HSV viral relay and localization of immune cell
subsets in human skin is shown in Fig. 1.
3 Using Knowledge of Natural Immunity to Design a Vaccine
3.1 Prophylactic Prophylactic vaccines need to stimulate primary immune responses

Versus at the site of pathogen entry to prevent its acquisition and therefore
Immunotherapeutic need to stimulate DCs to provide naıve T cells with an antigen-
Vaccines specific signal and a second costimulatory signal to differentiate
into effectors. However, immunotherapeutic vaccines can
Fig. 1 The HSV viral relay and localization of immune cell subsets in human skin. In humans, HSV infects
Langerhans cells (LCs) causing them to mature and migrate to the dermis and undergo apoptosis. Once in the
dermis, HSV infected apoptotic LCs have been observed in clusters with and taken up by dermal cDC1s and
CD14+ MNPs [104], potentially for antigen presentation to T cells. Whether cDC2s are also involved in the
uptake and presentation is unknown in humans. Whilst we have pieced together multiple cellular players in
this viral relay, there are an abundance of other innate and adaptive immune cells residing in the dermis,
including additional DC subsets, macrophages, and γδ T cells, as well as infiltrating immune cells, such as
pDCs and T cells. NK cells are found both constitutively in skin in low numbers and also infiltrate into the skin
during infection or inflammation. There is increasing evidence that at least some of these additional cell types
influence the developing immune response to HSV infection in the skin and further illuminating this complex
picture would inform vaccine design
restimulate already existing memory T cell responses through “sec-

ondary” or “nonprofessional” antigen presenting cells (including
keratinocytes and monocytes). Thus in herpes simplex memory T
cells resident (TRMs) in skin/mucosa can be restimulated [85, 86].
Thus TRMs and neutralizing antibodies in the mucosa are
critical for protection against release of virus from the DRG in
recurrent infection [80] and also likely to prevent virus entry into
the DRG during initial infection. It is therefore important to con-
sider how to design a prophylactic vaccine that will induce the
development of local TRM cells and mucosal antibody to prevent
infection with HSV as recruitment of B and T cells from the blood
may be too slow to prevent viral seeding of the nerves.
3.2 Targeting Key Neutralizing antibodies or ADCC target surface HSV envelope
Antigens and Epitopes glycoproteins and CD4 T cells usually target structural HSV core,
tegument or envelope proteins whereas CD8 T cells can target both
structural and nonstructural proteins. The envelope glycoproteins
gD and gB are dominant targets for HSV neutralizing antibodies,
of which multiple epitopes are recognized [110, 111], as well as gC
and gH/L in human sera directed against HSV1
[13, 110–113]. Other envelope glycoproteins, such as gK, have
only been investigated in murine models [114]. Therefore gD and
gB were used as immunogens in the Chiron trial and gD combined
with dMPL (AS04) was used in the Simplirix and Herpevac trials.
In the Herpevac trial, high anti-gD antibody titers correlated with
protection against genital disease caused by HSV1 (but not HSV2).
In guinea pig models the more gD epitopes the animals recognized,
the better the protection against genital disease, but women in the
Herpevac trial recognized significantly fewer epitopes [115]. A
recently developed trivalent vaccine candidate containing recombi-
nant gC, gD, and gE provided sterilizing immunity in 98% of
guinea pigs, apparently due to induction of high levels of plasma
and mucosal neutralizing antibodies [63]. Human antibody
responses to this vaccine are yet to be assessed.
A well characterized live attenuated vaccine candidate HSV529
(deleted for UL5 and UL29) was shown to induce significant
HSV2-specific antibody dependent cellular cytotoxicity (ADCC),
as well as neutralizing antibodies in humans [116] suggesting it
may be important to induce ADCC activity. Another recently
developed live attenuated HSV vaccine candidate explored the
importance of subdominant HSV epitopes by deleting gD. In
murine models it induced low titers of mucosal neutralizing anti-
bodies but high ADCC and provided sterilizing immunity against
multiple clinical isolates. This immunity against vaginal murine
infection could be passively transferred [117–119]. However they
did not control for neutralization due to complement. Murine
models are poor predictors of human vaccine responses so human
trials are awaited.
Although these studies seem to indicate the importance of

inducing strong neutralizing antibody responses by vaccines, sev-
eral previous vaccine candidates did induce neutralizing antibodies
and yet were unsuccessful in human clinical trials [120, 121]. This
suggests neutralizing antibodies alone are insufficient to protect
against HSV infection. Both CD4 and CD8 T cells are probably
also needed and should be targeted and improved from previous
vaccine candidates.
CD4 T cells respond mainly to late HSV glycoproteins, such as
gD, gB, gC, and gH. They also recognize the tegument proteins
VP16 and UL49 and the capsid protein VP5 [13, 27, 122]. HSV2
gD contains several immunodominant epitopes which are recog-
nized by CD4 T cells from both HSV1 and HSV2 seropositive
patients and across multiple MHCII types [123]. In a vaccine
these cross-reactive epitopes would be useful to target genital her-
pes caused by either HSV1 or 2. CD8 T cells recognize many HSV
proteins, including the early nonstructural viral proteins ICP27,
ICP4, and ICP0 [27, 124], and also tegument and capsid proteins
[125]. Many (13) CD4 and CD8 T cell epitopes are also conserved
between VZV and HSV [126]. Recently HSV gD was shown to be
selectively taken up by the DC subtype cDC1s, which cross-present
the antigen to CD8 T cells. Thus gD may be an important target for
all major immune effectors: CD4 and CD8 T cells [127] and B
cells. Further definition of conserved and cross-reactive epitopes
and incorporation into vaccine candidates might allow targeting of
multiple herpesviruses through multiple immune cells in a single
vaccine.
Although most studies defining HSV T cell epitopes in humans
have focused on blood, HSV targets for tissue-specific responses
may differ in magnitude and specificity, that is, recent studies have
shown compartmentalization of T cell clone expansion at different
sites as shown by T-cell receptor (TCR) repertoires. This may be
relevant to responses to potential vaccine candidates. Posavad et al.
have shown such differences in magnitude between blood and
cervical CD4 T cell responses with a 25-fold enrichment of cervical
HSV2-reactive CD4 T cells compared to blood in HSV2 infected
women [87]. They also showed little overlap in TCR repertoires of
TRMs in genital mucosa and those found in blood. Thus, similar
tissue-based T cell responses will need evaluation in response to
vaccines [128].
3.3 Vaccine Delivery Clearly HSV vaccines must be effective at inducing protective
immunity at mucosal surfaces. Vaccine delivery has conventionally
been intramuscular; however, intravaginal immunization is a strat-
egy that has been thoroughly tested and been successful in small
animal models and should be considered in humans. For example,
intravaginal delivery of a live attenuated, replication defective
HSV2 vaccine candidate (HSV2-gD27) induced superior
protection against HSV2 intravaginal challenge than intramuscular,

subcutaneous or intranasal administration [129]. As an alternative
to direct intravaginal vaccination which may be impractical in
human trials, a “prime and pull” approach was developed in murine
models. Systemic T cells were primed by subcutaneous immuniza-
tion and then CXCL9 and CXCL10 topically applied to the genital
mucosa to “pull” them into the mucosa [130]. This resulted in
long term establishment of IFN-γ expressing CD8 TRMs which
conferred protection against HSV2 challenge [131].
Other novel delivery systems aimed at inducing mucosal immu-
nity, currently being tested include intranasal application of
nanoemulsion-based adjuvants in RSV and TB vaccines resulting
in high antibody titers, Th1 and Th17 T cell responses
[132, 133]. A nanoemulsion vaccine for HSV2 is also being devel-
oped (BlueWillow Biologics, formerly NanoBio Corporation) with
preliminary evidence showing protection against genital HSV2
challenge in animal models [134]. Many types of experimental
peptide vaccines are being tested, including lipopeptides or synthet-
ically designed peptides, combined with nanoparticle adjuvants.
Some of these vaccines strongly stimulate systemic polyfunctional
cytotoxic CD8 T cells, as well as in the genital mucosa and in
draining lymph nodes, capable of protecting against lethal HSV
challenge [135, 136]. Combination of a calcium phosphate-based
nanoparticle and HSV2 epitope in a vaccine also showed enhanced
mucosal and systemic protection [137]. However, mouse models
provide a notoriously optimistic prediction and these experimental
vaccines need to be tested in phase I human clinical trials.
3.4 Vaccine As discussed above, in contrast to live attenuated vaccines, vaccines

Adjuvants consisting of recombinant protein usually require one or a combi-
nation of adjuvants (adjuvant systems) to replace the danger-
associated molecular pattern (protein/lipid/nucleic acid) stimuli
from the original pathogen. These adjuvants direct the desired
immune response usually by stimulating innate immune cells, ulti-
mately DCs, and then immune effectors—antibody and T cells (for
HSV, including TRMs). They can also act as antigen carriers (e.g.,
alum, liposomes).
Adjuvants able to enhance neutralizing antibody responses to
HSV have included the traditionally used alum, MF59 used in the
Chiron HSV2 gB/gD subunit vaccine [11], alum/dMPL used in
the Simplirix gD vaccine [12, 14], and more recently, alum/CpG
used in the trivalent gC, gD, and gE vaccine [63]. dMPL acts to
enhance antibody production by inducing follicular helper CD4 T
cells. The older alum adjuvant is a poor stimulator of T cell
responses [138, 139]. MF59, ISCOMs (saponin-based immune
stimulating complexes), TLR2 and TLR5 ligands enhance T cell
responses without altering the Th1/Th2 balance. Conversely
adjuvants that act as agonists of TLR3, TLR4, TLR7/8, and TLR9

(including dMPL and CpG) induce Th1 cell responses.
The partially successful Simplirix HSV vaccine containing
dMPL, was initially thought to induce mainly a Th1 pattern of
cytokines (including IFN-γ) but the Tfh response is at least as
important [16]. There was no CD8 T cell response. Indeed adju-
vants inducing antigen cross-presentation and primary human CD8
T cell responses would be most valuable but are still to be defined.
Saponin-based adjuvants have been shown to induce strong T cell
responses and in particular memory CD8 T cell responses, and their
use in recently trialed immunotherapeutic vaccines has shown some
success. As mentioned, the highly successful RZV vaccine for her-
pes zoster contains dMPL formulated together with QS21, a sapo-
nin, in liposomes. RZV induced VZV-specific CD4 T cells as well as
memory CD8 T cells, although not naive CD8 T cells [24]. Simi-
larly, the Agenus HerpV vaccine contains a patented QS21 stimu-
lon adjuvant and the Genocea vaccine contains a saponin Matrix
M2 adjuvant. Both the immunotherapeutic Agenus and Genocea
vaccines induced a combination of neutralizing antibody, CD4 and
CD8 T cell responses in animal models. In the human clinical trial
of the Genocea vaccine, equivalent CD8 T cell responses were
induced to both HSV gD and ICP4, confirming that gD contains
CD8 T cell epitopes, and that saponin-based adjuvants are able to
induce memory CD8 T cell responses through cross presentation
[140, 141].
In the future broader targeting of adjuvants to other immune
cells or different modes of action may be needed to stimulate the
required responses for an HSV vaccine, including neutralizing and
nonneutralizing antibody, different subsets of CD4 T cells and
CD8 T cells. For example, for subunit vaccines to target the key
dermal DC subsets involved in primary HSV infection, adjuvants
may need to simulate the immune effects of HSV-infected apopto-
tic LCs [104]. Furthermore, other immune cell effectors which are
often overlooked in the vaccine design, such as NK cells, should
also be considered as targets [47, 142, 143]. Suppressive immune
responses such as Tregs may also need to be antagonized by adju-
vants. For example the adjuvant CpG was able to suppress induc-
tion of antigen specific FoxP3+ Tregs after primary and repeated
vaccination with influenza viral peptides and promoted viral clear-
ance in murine models. Similar studies are needed using HSV
vaccines.
Nevertheless, there have been concerns about inducing or reac-
tivating autoimmune diseases by using powerful adjuvants to direct
the immune response. So far, over 70,000 subjects have been immu-
nized with vaccines, containing dMPL and QS21, in trials and no
Table 1
The developmental status of HSV vaccine candidatesa
Vaccine Developmental
candidate Company Vaccine constitution stage References
Subunit/s + adjuvants
Simplirix/ GlaxoSmithKline gD2 and AS04 (dMPL) Ceased after Phase III [14, 144]
Herpevac trials
GEN-003 Genocea gD2 and Matrix M2 Ceased after Phase II [145–147]
trials
HerpV Agenus Peptide vaccine + QS-21 No development [148, 149]
Stimulon since Phase II trials
VCL-HB01 Vical gD2 UL46 and Vaxfectin Ceased after Phase II [150, 151]
DNA vaccine trials
COR-1 Admedus gD2 codon optimized DNA Phase IIb planned [152–154]
vaccine
NE-HSV2 BlueWillow Nanoemulsion with gB2 and Pre-clinical, clinical [134, 155]
Biologics gD2 antigens trial planned
HSV2 University of gC2, gD2, gE2 Pre-clinical [62, 156]
trivalent Pennsylvania
vaccine
G103 Immune Design HSV2 gD, UL19 and UL25 Pre-clinical [157]
Live-attenuated
HSV529 Sanofi Pasteur Replication defective HSV2, Phase I trial ongoing [17, 158]
UL5, UL29 deletion
RVX201 Rational Vaccines HSV2 ICP0 deletion mutant Phase Ib/IIa planned [159]
VC2 Louisiana State HSV1 with mutations in gK Pre-clinical [114, 160,
University and UL20 161]
R2 Thyreos LLC HSV1 with UL37 R2 region Pre-clinical [162]
mutation
HSV2 Albert Einstein HSV2 with US6 Pre-clinical [117, 119]
ΔgD2 College of (gD) deletion Pre-clinical
Medicine
a
Adapted from [163]
such safety signals have been observed. Continuing postmarketing

surveillance will be required. Furthermore, QS21 has been shown to
elicit a high degree of systemic and injection site reactogenicity.
Whether the reactogenicity and immunogenicity of such adjuvants
can be dissociated through chemical modifications is a challenge.
The status of current HSV vaccine candidates is provided in Table 1.
4 Concluding Remarks
Newer-generation vaccines aim to use adjuvants to advantageously

manipulate the immune response or, alternatively, permanently
attenuate live vaccine candidates through specific mutations. For
herpes zoster surprisingly, RZV had a higher degree of efficacy and
immunogenicity than the live attenuated HZ vaccine Zostavax
[20, 26]. A key question is whether this higher vaccine efficacy
induced by adjuvants in RZV can be exploited to improve vaccines
for genital herpes. Perhaps one antigen alone is insufficient and
more are needed. The recent reports on RZV and Zostavax immu-
nogenicity indicate a need for a much more detailed understanding
of initial protective immune responses. As highlighted in consensus
statements on HSV vaccine development, immunologic correlates
of efficacy in partially successful vaccines (e.g., Genocea, Herpevac)
are particularly important, that is, comparing immune responses in
protected vs. unprotected patients.
A successful prophylactic vaccine against initial genital herpes
must prevent HSV seeding of the neuronal ganglia via the cutane-
ous sensory nerves. To do this the vaccine would need to prevent
virus entering nerve terminals in the epidermis. This might be
achieved by resident immune cells which can quickly migrate into
the stratified squamous epidermis or produce rapidly diffusing
protective cytokines upon infection. High levels of neutralizing
antibodies may also penetrate the epidermis from dermal vessels
although this is unknown. We do know that viruses such as HIV can
be contained by these mechanisms even if they obtain a “toe-hold”
in mucosal epidermis. Nevertheless much more needs to be known
about the interaction of HSV infected epidermal cells with key
innate and adaptive immune responses in the skin and mucosa.
Multiple innate immune cells including DC subsets, NK cells,
monocytes/macrophages, and γδ T cells may play a role and inter-
act with each other at the site of HSV entry. Together with antibody
and T cells, they may all play a role in protecting against or
controlling initial HSV infection.
Finally there are other cofactors of potential importance in
initial HSV mucosal infection. One of the most important is the
role of the microbiome in mucosal integrity and interacting with
mucosal immunity, thus determining susceptibility to viral patho-
gen entry. Many women have a “diverse” vaginal microbiome
without Lactobacilli which increases the likelihood of HIV and
possibly HSV acquisition, especially in sub-Saharan Africa
[80, 164–167]. The effects of an altered microbiome on HSV
specific mucosal immunity and interactions with HSV immuniza-
tion also require future investigation.
References
1. Schiffer JT, Swan D, Corey L et al (2013) 10. Spicknall IH, Looker KJ, Gottlieb SL et al
Rapid viral expansion and short drug half-life (2018) Review of mathematical models of
explain the incomplete effectiveness of cur- HSV-2 vaccination: implications for vaccine
rent Herpes Simplex Virus-2 directed antiviral development. Vaccine. https://doi.org/10.
agents. Antimicrob Agents Chemother 1016/j.vaccine.2018.02.067
57:5820–5829. https://doi.org/10.1128/ 11. Corey L, Langenberg AG, Ashley R et al
AAC.01114-13 (1999) Recombinant glycoprotein vaccine
2. Gottlieb SL, Giersing BK, Hickling J et al for the prevention of genital HSV-2 infection:
(2017) Meeting report: Initial World Health two randomized controlled trials. Chiron
Organization consultation on herpes simplex HSV Vaccine Study Group. JAMA 282
virus (HSV) vaccine preferred product char- (4):331–340
acteristics. Vaccine. https://doi.org/10. 12. Stanberry LR, Spruance SL, Cunningham AL
1016/j.vaccine.2017.10.084 et al (2002) Glycoprotein-D-adjuvant vaccine
3. 2011–2020 GVAP (2012) Global vaccine to prevent genital herpes. N Engl J Med 347
action plan 2011–2020 [online]. https:// (21):1652–1661. https://doi.org/10.1056/
www.who.int/immunization/global_vac NEJMoa011915
cine_action_plan/GVAP_doc_2011_2020/ 13. Mikloska Z, Cunningham AL (1998) Herpes
en/ simplex virus type 1 glycoproteins gB, gC and
4. Freeman EE, Weiss HA, Glynn JR et al (2006) gD are major targets for CD4 T-lymphocyte
Herpes simplex virus 2 infection increases cytotoxicity in HLA-DR expressing human
HIV acquisition in men and women: system- epidermal keratinocytes. J Gen Virol 79. (Pt
atic review and meta-analysis of longitudinal 2:353–361
studies. AIDS 20(1):73–83 14. Belshe RB, Leone PA, Bernstein DI et al
5. Looker KJ, Elmes JAR, Gottlieb SL et al (2012) Efficacy results of a trial of a herpes
(2017) Effect of HSV-2 infection on simplex vaccine. N Engl J Med 366(1):34–43.
subsequent HIV acquisition: an updated sys- https://doi.org/10.1056/NEJMoa1103151
tematic review and meta-analysis. Lancet 15. Lamers SL, Newman RM, Laeyendecker O et
Infect Dis 17(12):1303–1316. https://doi. al (2015) Global diversity within and between
org/10.1016/s1473-3099(17)30405-x human herpesvirus 1 and 2 glycoproteins. J
6. Bradley J, Floyd S, Piwowar-Manning E et al Virol 89(16):8206–8218. https://doi.org/
(2018) Sexually transmitted bedfellows: 10.1128/jvi.01302-15
exquisite association between HIV and herpes 16. Belshe RB, Heineman TC, Bernstein DI et al
simplex virus type 2 in 21 communities in (2014) Correlate of immune protection
southern Africa in the HIV prevention trials against HSV-1 genital disease in vaccinated
network 071 (PopART) study. J Infect Dis women. J Infect Dis 209(6):828–836.
218(3):443–452. https://doi.org/10.1093/ https://doi.org/10.1093/infdis/jit651
infdis/jiy178 17. Bernard MC, Barban V, Pradezynski F et al
7. Wald A, Link K (2002) Risk of human immu- (2015) Immunogenicity, protective efficacy,
nodeficiency virus infection in herpes simplex and non-replicative status of the HSV-2 vac-
virus type 2-seropositive persons: a meta-anal- cine candidate HSV529 in mice and guinea
ysis. J Infect Dis 185(1):45–52. https://doi. pigs. PLoS One 10(4):e0121518. https://
org/10.1086/338231 doi.org/10.1371/journal.pone.0121518
8. Omori R, Nagelkerke N, Abu-Raddad LJ 18. Oxman MN, Levin MJ, Johnson GR et al
(2018) HIV and herpes simplex virus type (2005) A vaccine to prevent herpes zoster
2 epidemiological synergy: misguided obser- and postherpetic neuralgia in older adults. N
vational evidence? A modelling study. Sex Engl J Med 352(22):2271–2284. https://
Transm Infect 94(5):372–376. https://doi. doi.org/10.1056/NEJMoa051016
org/10.1136/sextrans-2017-053336 19. Morrison VA, Johnson GR, Schmader KE et
9. Reynolds SJ, Risbud AR, Shepherd ME et al al (2015) Long-term persistence of zoster
(2003) Recent herpes simplex virus type vaccine efficacy. Clin Infect Dis 60
2 infection and the risk of human immunode- (6):900–909. https://doi.org/10.1093/
ficiency virus type 1 acquisition in India. J cid/ciu918
Infect Dis 187(10):1513–1521. https://doi. 20. Cunningham AL, Heineman TC, Lal H et al
org/10.1086/368357 (2018) Immune responses to a recombinant
glycoprotein E herpes zoster vaccine in adults
aged >/=50 years. J Infect Dis 217:1750. 31. Heath WR, Carbone FR (2013) The skin-
https://doi.org/10.1093/infdis/jiy095 resident and migratory immune system in
21. Lal H, Cunningham AL, Godeaux O et al steady state and memory: innate lymphocytes,
(2015) Efficacy of an adjuvanted herpes zoster dendritic cells and T cells. Nat Immunol 14
subunit vaccine in older adults. N Engl J Med (10):978–985. https://doi.org/10.1038/ni.
372(22):2087–2096. https://doi.org/10. 2680
1056/NEJMoa1501184 32. Albanesi C, Scarponi C, Giustizieri ML et al
22. Schwarz TF, Volpe S, Catteau G et al (2018) (2005) Keratinocytes in inflammatory skin
Persistence of immune response to an adju- diseases. Curr Drug Targets Inflamm Allergy
vanted varicella-zoster virus subunit vaccine 4(3):329–334
for up to year nine in older adults. Hum Vac- 33. Kuo IH, Yoshida T, De Benedetto A et al
cin Immunother 14(6):1370–1377. https:// (2013) The cutaneous innate immune
doi.org/10.1080/21645515.2018.1442162 response in patients with atopic dermatitis. J
23. Didierlaurent AM, Laupeze B, Di Pasquale A Allergy Clin Immunol 131(2):266–278.
et al (2017) Adjuvant system AS01: helping to https://doi.org/10.1016/j.jaci.2012.12.
overcome the challenges of modern vaccines. 1563
Expert Rev Vaccines 16(1):55–63. https:// 34. Strittmatter GE, Sand J, Sauter M et al (2016)
doi.org/10.1080/14760584.2016.1213632 IFN-gamma primes keratinocytes for HSV-1-
24. Leroux-Roels I, Leroux-Roels G, Clement F induced inflammasome activation. J Invest
et al (2012) A phase 1/2 clinical trial evaluat- Dermatol 136(3):610–620. https://doi.
ing safety and immunogenicity of a varicella org/10.1016/j.jid.2015.12.022
zoster glycoprotein e subunit vaccine candi- 35. Aoki R, Kawamura T, Goshima F et al (2016)
date in young and older adults. J Infect Dis The Alarmin IL-33 derived from HSV-2-
206(8):1280–1290. https://doi.org/10. infected keratinocytes triggers mast cell-
1093/infdis/jis497 mediated antiviral innate immunity. J Invest
25. Weinberg A, Kroehl ME, Johnson MJ et al Dermatol 136(6):1290–1292. https://doi.
(2018) Comparative immune responses to org/10.1016/j.jid.2016.01.030
licensed herpes zoster vaccines. J Infect Dis 36. Cunningham AL, Noble JR (1989) Role of
218(Suppl_2):S81–S87. https://doi.org/10. keratinocytes in human recurrent herpetic
1093/infdis/jiy383 lesions. Ability to present herpes simplex
26. Levin MJ, Kroehl ME, Johnson MJ et al virus antigen and act as targets for T lympho-
(2018) Th1 memory differentiates recombi- cyte cytotoxicity in vitro. J Clin Invest 83
nant from live herpes zoster vaccines. J Clin (2):490–496. https://doi.org/10.1172/
Invest 128(10):4429–4440. https://doi. jci113908
org/10.1172/jci121484 37. Nickoloff BJ, Turka LA (1994) Immunologi-
27. Mikloska Z, Kesson AM, Penfold ME et al cal functions of non-professional antigen-pre-
(1996) Herpes simplex virus protein targets senting cells: new insights from studies of T-
for CD4 and CD8 lymphocyte cytotoxicity in cell interactions with keratinocytes. Immunol
cultured epidermal keratinocytes treated with Today 15(10):464–469. https://doi.org/10.
interferon-gamma. J Infect Dis 173(1):7–17 1016/0167-5699(94)90190-2
28. Arvin A, Abendroth A (2007) VZV: immuno- 38. Takaoka A, Yanai H (2006) Interferon signal-
biology and host response. In: Arvin A, Cam- ling network in innate defence. Cell Microbiol
padelli-Fiume G, Mocarski E et al (eds) 8(6):907–922. https://doi.org/10.1111/j.
Human herpesviruses: biology, therapy, and 1462-5822.2006.00716.x
immunoprophylaxis. Cambridge University 39. Chan T, Barra NG, Lee AJ et al (2011) Innate
Press, Cambridge, p 2007 and adaptive immunity against herpes simplex
29. Mori I, Nishiyama Y (2005) Herpes simplex virus type 2 in the genital mucosa. J Reprod
virus and varicella-zoster virus: why do these Immunol 88(2):210–218. https://doi.org/
human alphaherpesviruses behave so differ- 10.1016/j.jri.2011.01.001
ently from one another? Rev Med Virol 15 40. Donaghy H, Bosnjak L, Harman AN et al
(6):393–406. https://doi.org/10.1002/ (2009) Role for plasmacytoid dendritic cells
rmv.478 in the immune control of recurrent human
30. Koelle DM, Corey L (2008) Herpes simplex: herpes simplex virus infection. J Virol 83
insights on pathogenesis and possible vac- (4):1952–1961. https://doi.org/10.1128/
cines. Annu Rev Med 59:381–395. https:// jvi.01578-08
doi.org/10.1146/annurev.med.59.061606. 41. Ashkar AA, Rosenthal KL (2003) Interleukin-
095540 15 and natural killer and NKT cells play a
critical role in innate protection against geni- 52. Yang Q, Bhandoola A (2016) The develop-
tal herpes simplex virus type 2 infection. J ment of adult innate lymphoid cells. Curr
Virol 77(18):10168–10171 Opin Immunol 39:114–120. https://doi.
42. Kawakami Y, Ando T, Lee JR et al (2017) org/10.1016/j.coi.2016.01.006
Defective natural killer cell activity in a 53. Ashley RL, Corey L, Dalessio J et al (1994)
mouse model of eczema herpeticum. J Allergy Protein-specific cervical antibody responses to
Clin Immunol 139(3):997–1006.e1010. primary genital herpes simplex virus type
https://doi.org/10.1016/j.jaci.2016.06. 2 infections. J Infect Dis 170(1):20–26
034 54. Gallichan WS, Rosenthal KL (1998) Long-
43. Thapa M, Kuziel WA, Carr DJ (2007) Suscep- term immunity and protection against herpes
tibility of CCR5-deficient mice to genital her- simplex virus type 2 in the murine female
pes simplex virus type 2 is linked to NK cell genital tract after mucosal but not systemic
mobilization. J Virol 81(8):3704–3713. immunization. J Infect Dis 177
https://doi.org/10.1128/jvi.02626-06 (5):1155–1161
44. Biron CA, Byron KS, Sullivan JL (1989) 55. Parr EL, Parr MB (1997) Immunoglobulin G
Severe herpesvirus infections in an adolescent is the main protective antibody in mouse vag-
without natural killer cells. N Engl J Med 320 inal secretions after vaginal immunization
(26):1731–1735. https://doi.org/10.1056/ with attenuated herpes simplex virus type 2.
nejm198906293202605 J Virol 71(11):8109–8115
45. Dalloul A, Oksenhendler E, Chosidow O et al 56. Halford WP, Geltz J, Messer RJ et al (2015)
(2004) Severe herpes virus (HSV-2) infection Antibodies are required for complete vaccine-
in two patients with myelodysplasia and unde- induced protection against herpes simplex
tectable NK cells and plasmacytoid dendritic virus 2. PLoS One 10(12):e0145228.
cells in the blood. J Clin Virol 30 https://doi.org/10.1371/journal.pone.
(4):329–336. https://doi.org/10.1016/j. 0145228
jcv.2003.11.014 57. Halford WP, Geltz J, Gershburg E (2013)
46. Koelle DM, Frank JM, Johnson ML et al Pan-HSV-2 IgG antibody in vaccinated mice
(1998) Recognition of herpes simplex virus and guinea pigs correlates with protection
type 2 tegument proteins by CD4 T cells infil- against herpes simplex virus 2. PLoS One 8
trating human genital herpes lesions. J Virol (6):e65523. https://doi.org/10.1371/jour
72(9):7476–7483 nal.pone.0065523
47. Kim M, Osborne NR, Zeng W et al (2012) 58. McDermott MR, Brais LJ, Evelegh MJ
Herpes simplex virus antigens directly activate (1990) Mucosal and systemic antiviral antibo-
NK cells via TLR2, thus facilitating their pre- dies in mice inoculated intravaginally with
sentation to CD4 T lymphocytes. J Immunol herpes simplex virus type 2. J Gen Virol 71
188(9):4158–4170. https://doi.org/10. (Pt 7):1497–1504. https://doi.org/10.
4049/jimmunol.1103450 1099/0022-1317-71-7-1497
48. Milligan GN, Bernstein DI (1997) Inter- 59. Morrison LA, Zhu L, Thebeau LG (2001)
feron-gamma enhances resolution of herpes Vaccine-induced serum immunoglobin con-
simplex virus type 2 infection of the murine tributes to protection from herpes simplex
genital tract. Virology 229(1):259–268. virus type 2 genital infection in the presence
https://doi.org/10.1006/viro.1997.8441 of immune T cells. J Virol 75(3):1195–1204.
49. Gill N, Ashkar AA (2009) Overexpression of https://doi.org/10.1128/jvi.75.3.1195-
interleukin-15 compromises CD4-dependent 1204.2001
adaptive immune responses against herpes 60. Dudley KL, Bourne N, Milligan GN (2000)
simplex virus 2. J Virol 83(2):918–926. Immune protection against HSV-2 in B-cell-
https://doi.org/10.1128/jvi.01282-08 deficient mice. Virology 270(2):454–463.
50. Cunningham AL, Turner RR, Miller AC et al https://doi.org/10.1006/viro.2000.0298
(1985) Evolution of recurrent herpes simplex 61. Harandi AM, Svennerholm B, Holmgren J et
lesions. An immunohistologic study. J Clin al (2001) Differential roles of B cells and IFN-
Invest 75(1):226–233. https://doi.org/10. gamma-secreting CD4(+) T cells in innate and
1172/jci111678 adaptive immune control of genital herpes
51. Eberl G, Colonna M, Di Santo JP et al (2015) simplex virus type 2 infection in mice. J Gen
Innate lymphoid cells. Innate lymphoid cells: Virol 82(Pt 4):845–853. https://doi.org/10.
a new paradigm in immunology. Science 348 1099/0022-1317-82-4-845
(6237):aaa6566. https://doi.org/10.1126/ 62. Awasthi S, Hook LM, Shaw CE et al (2017)
science.aaa6566 An HSV-2 trivalent vaccine is immunogenic
in rhesus macaques and highly efficacious in (Suppl 1):S22. https://doi.org/10.1093/

guinea pigs. PLoS Pathog 13(1):e1006141. ofid/ofx162.056
https://doi.org/10.1371/journal.ppat. 73. Marchant A, Sadarangani M, Garand M et al
1006141 (2017) Maternal immunisation: collaborating
63. Awasthi S, Hook LM, Shaw CE et al (2017) A with mother nature. Lancet Infect Dis 17(7):
trivalent subunit antigen glycoprotein vaccine e197–e208. https://doi.org/10.1016/
as immunotherapy for genital herpes in the s1473-3099(17)30229-3
guinea pig genital infection model. Hum Vac- 74. Cella M, Scheidegger D, Palmer-Lehmann K
cin Immunother 13(12):2785–2793. et al (1996) Ligation of CD40 on dendritic
https://doi.org/10.1080/21645515.2017. cells triggers production of high levels of
1323604 interleukin-12 and enhances T cell stimula-
64. Mikloska Z, Sanna PP, Cunningham AL tory capacity: T-T help via APC activation. J
(1999) Neutralizing antibodies inhibit axonal Exp Med 184(2):747–752
spread of herpes simplex virus type 1 to epi- 75. Murphy KM, Stockinger B (2010) Effector T
dermal cells in vitro. J Virol 73(7):5934–5944 cell plasticity: flexibility in the face of changing
65. Looker KJ, Magaret AS, May MT et al (2017) circumstances. Nat Immunol 11(8):674–680.
First estimates of the global and regional inci- https://doi.org/10.1038/ni.1899
dence of neonatal herpes infection. Lancet 76. Iijima N, Linehan MM, Zamora M et al
Glob Health 5(3):e300–e309. https://doi. (2008) Dendritic cells and B cells maximize
org/10.1016/s2214-109x(16)30362-x mucosal Th1 memory response to herpes sim-
66. Prober CG, Sullender WM, Yasukawa LL et al plex virus. J Exp Med 205(13):3041–3052.
(1987) Low risk of herpes simplex virus infec- https://doi.org/10.1084/jem.20082039
tions in neonates exposed to the virus at the 77. Bourne N, Perry CL, Banasik BN et al (2019)
time of vaginal delivery to mothers with recur- Increased frequency of virus shedding by her-
rent genital herpes simplex virus infections. N pes simplex virus 2-infected guinea pigs in the
Engl J Med 316(5):240–244. https://doi. absence of CD4(+) T lymphocytes. J Virol 93
org/10.1056/nejm198701293160503 (4). https://doi.org/10.1128/jvi.01721-18
67. Brown ZA, Wald A, Morrow RA et al (2003) 78. Egan KP, Wu S, Wigdahl B et al (2013)
Effect of serologic status and cesarean delivery Immunological control of herpes simplex
on transmission rates of herpes simplex virus virus infections. J Neurovirol 19
from mother to infant. JAMA 289 (4):328–345. https://doi.org/10.1007/
(2):203–209 s13365-013-0189-3
68. Allen UD, Robinson JL (2014) Prevention 79. Ouwendijk WJ, Laing KJ, Verjans GM et al
and management of neonatal herpes simplex (2013) T-cell immunity to human alphaher-
virus infections. Paediatr Child Health 19 pesviruses. Curr Opin Virol 3(4):452–460.
(4):201–212 https://doi.org/10.1016/j.coviro.2013.04.
69. Dancis J, Lind J, Oratz M et al (1961) Placen- 004
tal transfer of proteins in human gestation. 80. van Velzen M, Jing L, Osterhaus AD et al
Am J Obstet Gynecol 82:167–171 (2013) Local CD4 and CD8 T-cell reactivity
70. Evans IA, Jones CA (2002) Maternal immu- to HSV-1 antigens documents broad viral
nization with a herpes simplex virus type 2 rep- protein expression and immune competence
lication-defective virus reduces visceral in latently infected human trigeminal ganglia.
dissemination but not lethal encephalitis in PLoS Pathog 9(8):e1003547. https://doi.
newborn mice after oral challenge. J Infect org/10.1371/journal.ppat.1003547
Dis 185(11):1550–1560. https://doi.org/ 81. Decman V, Kinchington PR, Harvey SA et al
10.1086/340572 (2005) Gamma interferon can block herpes
71. Jiang Y, Patel CD, Manivanh R et al (2017) simplex virus type 1 reactivation from latency,
Maternal antiviral immunoglobulin accumu- even in the presence of late gene expression. J
lates in neural tissue of neonates to prevent Virol 79(16):10339–10347. https://doi.
HSV neurological disease. mBio 8(4). org/10.1128/jvi.79.16.10339-10347.2005
https://doi.org/10.1128/mBio.00678-17 82. Knickelbein JE, Khanna KM, Yee MB et al
72. Kao C, Burn C, Jacobs WR Jr et al (2017) (2008) Noncytotoxic lytic granule-mediated
Maternal immunization with a single-cycle CD8+ T cell inhibition of HSV-1 reactivation
herpes simplex virus (HSV) candidate vaccine, from neuronal latency. Science 322
ΔgD-2, protects neonatal mice from lethal (5899):268–271. https://doi.org/10.1126/
viral challenge. Open Forum Infect Dis 4 science.1164164
83. Nakanishi Y, Lu B, Gerard C et al (2009) 93. Milman N, Zhu J, Johnston C et al (2016) In

CD8(+) T lymphocyte mobilization to virus- situ detection of regulatory T cells in human
infected tissue requires CD4(+) T-cell help. genital herpes simplex virus type 2 (HSV-2)
Nature 462(7272):510–513. https://doi. reactivation and their influence on spontane-
org/10.1038/nature08511 ous HSV-2 reactivation. J Infect Dis 214
84. Zhu J, Hladik F, Woodward A et al (2009) (1):23–31. https://doi.org/10.1093/
Persistence of HIV-1 receptor-positive cells infdis/jiw091
after HSV-2 reactivation is a potential mecha- 94. Bos JD, Teunissen MB, Cairo I et al (1990) T-
nism for increased HIV-1 acquisition. Nat cell receptor gamma delta bearing cells in nor-
Med 15(8):886–892. https://doi.org/10. mal human skin. J Invest Dermatol 94
1038/nm.2006 (1):37–42
85. Zhu J, Peng T, Johnston C et al (2013) 95. Sciammas R, Kodukula P, Tang Q et al (1997)
Immune surveillance by CD8alphaalpha+ T cell receptor-gamma/delta cells protect
skin-resident T cells in human herpes virus mice from herpes simplex virus type 1-
infection. Nature 497(7450):494–497. induced lethal encephalitis. J Exp Med 185
https://doi.org/10.1038/nature12110 (11):1969–1975
86. Zhu J, Koelle DM, Cao J et al (2007) Virus- 96. Puttur FK, Fernandez MA, White R et al
specific CD8+ T cells accumulate near sensory (2010) Herpes simplex virus infects skin
nerve endings in genital skin during subclini- gamma delta T cells before Langerhans cells
cal HSV-2 reactivation. J Exp Med 204 and impedes migration of infected Langer-
(3):595–603. https://doi.org/10.1084/ hans cells by inducing apoptosis and blocking
jem.20061792 E-cadherin downregulation. J Immunol 185
87. Posavad CM, Zhao L, Dong L et al (2017) (1):477–487. https://doi.org/10.4049/
Enrichment of herpes simplex virus type jimmunol.0904106
2 (HSV-2) reactive mucosal T cells in the 97. Kashem SW, Haniffa M, Kaplan DH (2017)
human female genital tract. Mucosal Immu- Antigen-presenting cells in the skin. Annu
nol 10(5):1259–1269. https://doi.org/10. Rev Immunol 35:469–499. https://doi.org/
1038/mi.2016.118 10.1146/annurev-immunol-051116-
88. Peng T, Zhu J, Phasouk K et al (2012) An 052215
effector phenotype of CD8+ T cells at the 98. Bosnjak L, Miranda-Saksena M, Koelle DM et
junction epithelium during clinical quiescence al (2005) Herpes simplex virus infection of
of herpes simplex virus 2 infection. J Virol 86 human dendritic cells induces apoptosis and
(19):10587–10596. https://doi.org/10. allows cross-presentation via uninfected den-
1128/jvi.01237-12 dritic cells. J Immunol 174(4):2220–2227
89. Schiffer JT, Swan DA, Roychoudhury P et al 99. Mikloska Z, Bosnjak L, Cunningham AL
(2018) A fixed spatial structure of CD8(+) T (2001) Immature monocyte-derived den-
cells in tissue during chronic HSV-2 infection. dritic cells are productively infected with her-
J Immunol 201(5):1522–1535. https://doi. pes simplex virus type 1. J Virol 75
org/10.4049/jimmunol.1800471 (13):5958–5964. https://doi.org/10.1128/
90. Diaz GA, Koelle DM (2006) Human CD4+ jvi.75.13.5958-5964.2001
CD25 high cells suppress proliferative mem- 100. Sprecher E, Becker Y (1986) Skin Langerhans
ory lymphocyte responses to herpes simplex cells play an essential role in the defense
virus type 2. J Virol 80(16):8271–8273. against HSV-1 infection. Arch Virol 91
https://doi.org/10.1128/jvi.00656-06 (3–4):341–349
91. Fernandez MA, Puttur FK, Wang YM et al 101. Allan RS, Smith CM, Belz GT et al (2003)
(2008) T regulatory cells contribute to the Epidermal viral immunity induced by CD8al-
attenuated primary CD8+ and CD4+ T cell pha+ dendritic cells but not by Langerhans
responses to herpes simplex virus type 2 in cells. Science 301(5641):1925–1928.
neonatal mice. J Immunol 180 https://doi.org/10.1126/science.1087576
(3):1556–1564 102. Bedoui S, Whitney PG, Waithman J et al
92. Fernandez MA, Yu U, Zhang G et al (2013) (2009) Cross-presentation of viral and self
Treg depletion attenuates the severity antigens by skin-derived CD103+ dendritic
of skin disease from ganglionic spread after cells. Nat Immunol 10(5):488–495. https://
HSV-2 flank infection. Virology 447 doi.org/10.1038/ni.1724
(1–2):9–20. https://doi.org/10.1016/j. 103. Zhao X, Deak E, Soderberg K et al (2003)
virol.2013.08.027 Vaginal submucosal dendritic cells, but not
Langerhans cells, induce protective Th1
responses to herpes simplex virus-2. J Exp 113. Eisenberg RJ, Long D, Ponce de Leon M et al
Med 197(2):153–162 (1985) Localization of epitopes of herpes
104. Kim M, Truong NR, James V et al (2015) simplex virus type 1 glycoprotein D. J Virol
Relay of herpes simplex virus between Lan- 53(2):634–644
gerhans cells and dermal dendritic cells in 114. Stanfield BA, Stahl J, Chouljenko VN et al
human skin. PLoS Pathog 11(4):e1004812. (2014) A single intramuscular vaccination of
https://doi.org/10.1371/journal.ppat. mice with the HSV-1 VC2 virus with muta-
1004812 tions in the glycoprotein K and the membrane
105. Guilliams M, Ginhoux F, Jakubzick C et al protein UL20 confers full protection against
(2014) Dendritic cells, monocytes and lethal intravaginal challenge with virulent
macrophages: a unified nomenclature based HSV-1 and HSV-2 strains. PLoS One 9(10):
on ontogeny. Nat Rev Immunol 14 e109890. https://doi.org/10.1371/journal.
(8):571–578. https://doi.org/10.1038/ pone.0109890
nri3712 115. Hook LM, Cairns TM, Awasthi S et al (2018)
106. Theisen D, Murphy K (2017) The role of Vaccine-induced antibodies to herpes simplex
cDC1s in vivo: CD8 T cell priming through virus glycoprotein D epitopes involved in
cross-presentation. F1000Research 6:98. virus entry and cell-to-cell spread correlate
https://doi.org/10.12688/f1000research. with protection against genital disease in
9997.1 guinea pigs. PLoS Pathog 14(5):e1007095.
107. Fehres CM, Bruijns SC, Sotthewes BN et al https://doi.org/10.1371/journal.ppat.
(2015) Phenotypic and functional properties 1007095
of human steady state CD14+ and CD1a+ 116. Dropulic L, Wang K, Oestreich M et al
antigen presenting cells and epidermal Lan- (2017) A replication-defective herpes simplex
gerhans cells. PLoS One 10(11):e0143519. virus (HSV)-2 vaccine, HSV529, is safe and
https://doi.org/10.1371/journal.pone. well-tolerated in adults with or without HSV
0143519 infection and induces significant HSV-2-spe-
108. Haniffa M, Shin A, Bigley V et al (2012) cific antibody responses in HSV seronegative
Human tissues contain CD141hi cross-pre- individuals. Open Forum Infect Dis 4(Suppl
senting dendritic cells with functional homol- 1):S415–S416. https://doi.org/10.1093/
ogy to mouse CD103+ nonlymphoid ofid/ofx163.1041
dendritic cells. Immunity 37(1):60–73. 117. Burn C, Ramsey N, Garforth SJ et al (2018) A
https://doi.org/10.1016/j.immuni.2012. herpes simplex virus (HSV)-2 single-cycle
04.012 candidate vaccine deleted in glycoprotein D
109. McGovern N, Schlitzer A, Gunawan M et al protects male mice from lethal skin challenge
(2014) Human dermal CD14(+) cells are a with clinical isolates of HSV-1 and HSV-2. J
transient population of monocyte-derived Infect Dis 217(5):754–758. https://doi.org/
macrophages. Immunity 41(3):465–477. 10.1093/infdis/jix628
https://doi.org/10.1016/j.immuni.2014. 118. Petro C, Gonzalez PA, Cheshenko N et al
08.006 (2015) Herpes simplex type 2 virus deleted
110. Cairns TM, Huang ZY, Gallagher JR et al in glycoprotein D protects against vaginal,
(2015) Patient-specific neutralizing antibody skin and neural disease. eLife 4. https://doi.
responses to herpes simplex virus are attribu- org/10.7554/eLife.06054
ted to epitopes on gD, gB, or both and can be 119. Petro CD, Weinrick B, Khajoueinejad N et al
type specific. J Virol 89(18):9213–9231. (2016) HSV-2 DeltagD elicits FcgammaR-
https://doi.org/10.1128/jvi.01213-15 effector antibodies that protect against clinical
111. Cairns TM, Huang ZY, Whitbeck JC et al isolates. JCI Insight 1(12). https://doi.org/
(2014) Dissection of the antibody response 10.1172/jci.insight.88529
against herpes simplex virus glycoproteins in 120. Mertz GJ, Ashley R, Burke RL et al (1990)
naturally infected humans. J Virol 88 Double-blind, placebo-controlled trial of a
(21):12612–12622. https://doi.org/10. herpes simplex virus type 2 glycoprotein vac-
1128/jvi.01930-14 cine in persons at high risk for genital herpes
112. Berman PW, Gregory T, Crase D et al (1985) infection. J Infect Dis 161(4):653–660
Protection from genital herpes simplex virus 121. Terhune SS, Coleman KT, Sekulovich R et al
type 2 infection by vaccination with cloned (1998) Limited variability of glycoprotein
type 1 glycoprotein D. Science 227 gene sequences and neutralizing targets in
(4693):1490–1492 herpes simplex virus type 2 isolates and stabil-
ity on passage in cell culture. J Infect Dis 178
(1):8–15
122. Koelle DM, Schomogyi M, McClurkan C et al against genital HSV-2. Nat Commun
(2000) CD4 T-cell responses to herpes sim- 7:13346. https://doi.org/10.1038/
plex virus type 2 major capsid protein VP5: ncomms13346
comparison with responses to tegument and 132. Ahmed M, Smith DM, Hamouda T et al
envelope glycoproteins. J Virol 74 (2017) A novel nanoemulsion vaccine induces
(23):11422–11425 mucosal Interleukin-17 responses and confers
123. Kim M, Taylor J, Sidney J et al (2008) Immu- protection upon Mycobacterium tuberculosis
nodominant epitopes in herpes simplex virus challenge in mice. Vaccine 35
type 2 glycoprotein D are recognized by CD4 (37):4983–4989. https://doi.org/10.1016/
lymphocytes from both HSV-1 and HSV- j.vaccine.2017.07.073
2 seropositive subjects. J Immunol 181 133. O’Konek JJ, Makidon PE, Landers JJ et al
(9):6604–6615 (2015) Intranasal nanoemulsion-based inacti-
124. Mikloska Z, Ruckholdt M, Ghadiminejad I et vated respiratory syncytial virus vaccines pro-
al (2000) Monophosphoryl lipid A and QS21 tect against viral challenge in cotton rats.
increase CD8 T lymphocyte cytotoxicity to Hum Vaccin Immunother 11
herpes simplex virus-2 infected cell proteins (12):2904–2912. https://doi.org/10.1080/
4 and 27 through IFN-gamma and IL-12 21645515.2015.1075680
production. J Immunol 164(10):5167–5176 134. Bluewillow Biologics (2018) HSV-2 vaccine.
125. Hosken N, McGowan P, Meier A et al (2006) Bluewillow Biologics. http://www.blue
Diversity of the CD8+ T-cell response to her- willow.com/vaccine-pipeline/hsv-2-vaccine/
pes simplex virus type 2 proteins among per- 135. Zhang X, Chentoufi AA, Dasgupta G et al
sons with genital herpes. J Virol 80 (2009) A genital tract peptide epitope vaccine
(11):5509–5515. https://doi.org/10.1128/ targeting TLR-2 efficiently induces local and
JVI.02659-05 systemic CD8+ T cells and protects against
126. Jing L, Laing KJ, Dong L et al (2016) Exten- herpes simplex virus type 2 challenge. Muco-
sive CD4 and CD8 T cell cross-reactivity sal Immunol 2(2):129–143. https://doi.org/
between Alphaherpesviruses. J Immunol 196 10.1038/mi.2008.81
(5):2205–2218. https://doi.org/10.4049/ 136. Zhang X, Dervillez X, Chentoufi AA et al
jimmunol.1502366 (2012) Targeting the genital tract mucosa
127. Porchia B, Moreno ACR, Ramos RN et al with a lipopeptide/recombinant adenovirus
(2017) Herpes simplex virus glycoprotein D prime/boost vaccine induces potent and
targets a specific dendritic cell subset and long-lasting CD8+ T cell immunity against
improves the performance of vaccines to herpes: importance of MyD88. J Immunol
human papillomavirus-associated tumors. 189(9):4496–4509. https://doi.org/10.
Mol Cancer Ther 16(9):1922–1933. 4049/jimmunol.1201121
https://doi.org/10.1158/1535-7163.Mct- 137. He Q, Mitchell A, Morcol T et al (2002)
17-0071 Calcium phosphate nanoparticles induce
128. Ford E, Li A, Dong L, et al. (2018) Expan- mucosal immunity and protection against
sion of the tissue based T-cell receptor reper- herpes simplex virus type 2. Clin Diagn Lab
toire is distinct from the PBMC response after Immunol 9(5):1021–1024
immunotherapeutic HSV-2 vaccine. Paper 138. Marrack P, McKee AS, Munks MW (2009)
presented at the International Herpesvirus Towards an understanding of the adjuvant
Workshop, Vancouver, BC action of aluminium. Nat Rev Immunol 9
129. Wang K, Goodman KN, Li DY et al (2016) A (4):287–293. https://doi.org/10.1038/
herpes simplex virus 2 (HSV-2) gD mutant nri2510
impaired for neural tropism is superior to an 139. Di Pasquale A, Preiss S, Tavares Da Silva F et
HSV-2 gD subunit vaccine to protect animals al (2015) Vaccine adjuvants: from 1920 to
from challenge with HSV-2. J Virol 90 2015 and beyond. Vaccine 3(2):320–343.
(1):562–574. https://doi.org/10.1128/jvi. https://doi.org/10.3390/vaccines3020320
01845-15 140. den Brok MH, Bull C, Wassink M et al (2016)
130. Shin H, Iwasaki A (2012) A vaccine strategy Saponin-based adjuvants induce cross-presen-
that protects against genital herpes by estab- tation in dendritic cells by intracellular lipid
lishing local memory T cells. Nature 491 body formation. Nat Commun 7:13324.
(7424):463–467. https://doi.org/10.1038/ https://doi.org/10.1038/ncomms13324
nature11522 141. Flechtner JB, Long D, Larson S et al (2016)
131. Shin H, Kumamoto Y, Gopinath S et al Immune responses elicited by the GEN-003
(2016) CD301b+ dendritic cells stimulate tis- candidate HSV-2 therapeutic vaccine in a
sue-resident memory CD8+ T cells to protect
randomized controlled dose-ranging phase 154. Proactive Investors (2017) Admedus meets
1/2a trial. Vaccine 34(44):5314–5320. primary endpoint for herpes vaccine study
https://doi.org/10.1016/j.vaccine.2016. [online]. https://www.proactiveinvestors.
09.001 com.au/companies/news/177275/
142. Ferlazzo G, Morandi B (2014) Cross-talks admedus-meets-primary-endpoint-for-her
between natural killer cells and distinct sub- pes-vaccine-study-177275.html
sets of dendritic cells. Front Immunol 5:159. 155. Bluewillow Biologics (2017) Nanobio
https://doi.org/10.3389/fimmu.2014. receives sbir grant for genital herpes vaccine
00159 [online]. http://www.bluewillow.com/
143. Deauvieau F, Ollion V, Doffin AC et al nanobio-receives-sbir-grant-for-genital-her
(2015) Human natural killer cells promote pes-vaccine/
cross-presentation of tumor cell-derived anti- 156. Awasthi S, Huang J, Shaw C et al (2014)
gens by dendritic cells. Int J Cancer 136 Blocking herpes simplex virus 2 glycoprotein
(5):1085–1094. https://doi.org/10.1002/ E immune evasion as an approach to enhance
ijc.29087 efficacy of a trivalent subunit antigen vaccine
144. Cohen J (2010) Immunology. Painful failure for genital herpes. J Virol 88(15):8421–8432
of promising genital herpes vaccine. Science 157. Odegard JM, Flynn PA, Campbell DJ et al
330(6002):304 (2016) A novel HSV-2 subunit vaccine
145. Bernstein DI, Wald A, Warren T et al (2017) induces GLA-dependent CD4 and CD8 T
Therapeutic vaccine for genital herpes simplex cell responses and protective immunity in
virus-2 infection: findings from a randomized mice and guinea pigs. Vaccine 34(1):101–109
trial. J Infect Dis 215(6):856–864 158. NIH (2018) HSV vaccine in hsv-2 seroposi-
146. Genocea (2017) Genocea announces strate- tive adults [online]. https://clinicaltrials.
gic shift to immuno oncology and the devel- gov/ct2/show/record/NCT02571166?
opment of neoantigen cancer vaccines view=record
147. Van Wagoner N, Fife K, Leone PA et al 159. Halford WP, Puschel R, Gershburg E et al
(2018) Effects of different doses of GEN- (2011) A live-attenuated HSV-2 ICP0 virus
003, a therapeutic vaccine for genital herpes elicits 10 to 100 times greater protection
simplex virus-2, on viral shedding and lesions: against genital herpes than a glycoprotein D
results of a randomized placebo-controlled subunit vaccine. PLoS One 6(3):e17748
trial. J Infect Dis 218(12):1890–1899 160. Stanfield BA, Pahar B, Chouljenko VN et al
148. Wald A, Koelle DM, Fife K et al (2011) Safety (2017) Vaccination of rhesus macaques with
and immunogenicity of long HSV-2 peptides the live-attenuated HSV-1 vaccine VC2 sti-
complexed with rhHsc70 in HSV-2 seroposi- mulates the proliferation of mucosal T cells
tive persons. Vaccine 29(47):8520–8529 and germinal center responses resulting in
149. Agenus (2014) Agenus vaccine shows signifi- sustained production of highly neutralizing
cant reduction in viral burden after herpv antibodies. Vaccine 35(4):536–543
generated immune activation [online]. 161. Stanfield BA, Rider PJF, Caskey J et al (2018)
https://investor.agenusbio.com/2014-06- Intramuscular vaccination of guinea pigs with
26-Agenus-Vaccine-Shows-Significant-Reduc the live-attenuated human herpes simplex
tion-in-Viral-Burden-after-HerpV-Gener vaccine VC2 stimulates a transcriptional pro-
ated-Immune-Activation file of vaginal Th17 and regulatory Tr1
150. Veselenak RL, Shlapobersky M, Pyles RB et al responses. Vaccine 36(20):2842–2849
(2012) A Vaxfectin((R))-adjuvanted HSV- 162. Richards AL, Sollars PJ, Pitts JD et al (2017)
2 plasmid DNA vaccine is effective for pro- The pUL37 tegument protein guides alpha-
phylactic and therapeutic use in the guinea pig herpesvirus retrograde axonal transport to
model of genital herpes. Vaccine 30 promote neuroinvasion. PLoS Pathog 13
(49):7046–7051 (12):e1006741
151. Vical (2018) Vical reports phase 2 trial of 163. Truong NR, Smith JB, Sandgren KJ et al
HSV-2 therapeutic vaccine did not meet pri- (2019) Mechanisms of immune control of
mary endpoint. Vical mucosal HSV infection: a guide to rational
152. Admedus (2017) Admedus hsv 2 phase iia vaccine design. Front Immunol 10:373
results. Admedus 164. Chohan V, Baeten JM, Benki S et al (2009) A
153. Dutton JL, Woo WP, Chandra J et al (2016) prospective study of risk factors for herpes
An escalating dose study to assess the safety, simplex virus type 2 acquisition among high-
tolerability and immunogenicity of a Herpes risk HIV-1 seronegative women in Kenya. Sex
Simplex Virus DNA vaccine, COR-1. Hum Transm Infect 85(7):489–492. https://doi.
Vaccin Immunother 12(12):3079–3088 org/10.1136/sti.2009.036103
165. Gosmann C, Anahtar MN, Handley SA et al Kenyan high-risk women from 1993 to
(2017) Lactobacillus-deficient cervicovaginal 2012. AIDS 29(9):1077–1085. https://doi.
bacterial communities are associated with org/10.1097/qad.0000000000000646
increased HIV acquisition in young South 167. Masese L, Baeten JM, Richardson BA et al
African women. Immunity 46(1):29–37. (2014) Incident herpes simplex virus type
https://doi.org/10.1016/j.immuni.2016. 2 infection increases the risk of subsequent
12.013 episodes of bacterial vaginosis. J Infect Dis
166. Masese L, Baeten JM, Richardson BA et al 209(7):1023–1027. https://doi.org/10.
(2015) Changes in the contribution of genital 1093/infdis/jit634
tract infections to HIV acquisition among
Chapter 3
Herpes Simplex Virus Growth, Preparation, and Assay

Sereina O. Sutter, Peggy Marconi, and Anita F. Meier
Abstract
The human herpesvirus family members, in particular herpes simplex virus type 1 (HSV-1) and herpes
simplex virus type 2 (HSV-2), are abundant and extremely contagious viruses with a high seroprevalence in
the human population emphasizing the importance of studying their biology. Hence, the propagation and
purification of virus stocks constitute a key element in laboratory work.
Key words HSV growth, Plaque purification, Plaque titration, Growth curve, Virus stock,
Purification
1 Introduction
Herpes, derived from the ancient Greek word “to creep or crawl”
[1] refers to a family of viruses of which HSV-1 and HSV-2 are
common and important human pathogens. HSV infections cause a
wide range of diseases, some of which show a mild course of disease
while others are life threatening. HSV-1 most frequently invades
oral and ocular epithelial cells while HSV-2 infects the genital areas,
but both strains have the ability to cause infection in either area of
the body. After initial infection and replication in the epithelial
mucosa, which causes epithelial cell death, the virus enters the
sensory neurons that innervate the infected area and, following
retrograde transport to the cell bodies, establishes a lifelong latent
infection in sensory ganglia. HSV has the ability to infect and grow
in a wide variety of cell types. Different permissive cell lines can be
routinely used to grow replication competent HSV, such as Vero
(African green monkey kidney), BHK (baby hamster kidney), RK
(rabbit kidney), HeLa (human cervical cancer) as well as HEp2
(HeLa derivative, human epidermoid carcinoma) cells. HSV can
spread from a single infected cell to neighboring cells by two
distinct routes: cytolysis or cell fusion. Some virus strains induce
cytopathic effects leading to necrosis of the infected cells. Progeny
virus particles are set free by virus-induced lysis (cytolysis) leading
57
58 Sereina O. Sutter et al.
to the infection of neighboring cells. Other virus strains can pass

from cell to cell without lysis. Instead, they induce fusion between
the cells, leading to a polykaryocyte formation (syncytial pheno-
type, Syn+). Cytolysis as well as syncytium foci result in plaques of
infection that can be counted to determine the virus titers (number
of plaque-forming units, PFU).
Many different strategies and methods for HSV manipulation
and purification have been developed in the past in order to obtain
high titers of purified virus stocks. However, although it appears
simple to produce HSV stocks, there are specific aspects that should
be considered, such as spontaneous genomic mutations, which
(if they are not essential for virus replication) are maintained in
the progeny virus population. A full factorial assay (serum, cell
density, cell type, time of harvesting) should be performed in
order to define the optimal conditions to prepare high titer HSV
stocks. In our experience, it is crucial to infect the cells with the
optimal multiplicity of infection (MOI). A low MOI allows optimal
amplification and packaging of the complete virion and avoids the
formation of defective particles.
2 Materials
2.1 Cell Culture 1. Incubator: humidified, 37 C, 95% air, 5% CO2, suitable for cell
culture.
2. 1 PBS (phosphate buffered saline): 137 mM NaCl, 2.7 mM
KCl, 8 mM Na2HPO4, 2 mM KH2PO4, pH 7.4. Dissolve 8 g
of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4, 0.24 g of KH2PO4
in 800 ml of distilled H2O. Adjust pH to 7.4 and bring the
volume to 1 l with distilled H2O. Sterilize by autoclaving. Store
at room temperature.
3. Trypsin solution: 0.25% trypsin–0.02% EDTA.
4. Vero cells (African green monkey kidney, ATCC).
5. Cell culture medium: Dulbecco’s Modified Eagle’s Medium
(DMEM) high glucose, supplemented with 10% fetal bovine
serum (FBS), 2 mM glutamine, 100 units/ml penicillin,
100 μg/ml streptomycin.
6. 75-cm2 tissue culture flask.
7. Hemacytometer.
2.2 Limiting Dilution 1. Incubator.

2. HSV-1 stock (titrated).
3. Sonicator: Ultrasonic Processor with 2½00 Cup Horn.
4. 1 PBS.
5. Trypsin solution.
HSV-1 Preparation 59
6. Vero cells.
7. Serum-free cell culture medium: Dulbecco’s Modified Eagle’s
Medium (DMEM) high glucose, without FBS or antibiotic/
antimycotic.
8. Cell culture medium.
9. 15 ml polypropylene centrifuge tubes.
10. 50 ml reagent reservoirs, polystyrene.
11. Multichannel pipette.
12. 96-well plates.
13. Pipette tips with filters for p20, p200, and p1000 to protect the
pipette shafts from contamination and reduce the risk of cross-
contamination with virus particles.
14. Light microscope.
2.3 Preparation 1. Incubator.

of Wild-Type HSV Midi 2. T75 or T175 cm2 tissue culture flask.
Stocks
3. Vero cells.
5. Serum-free cell culture medium.
7. 1 PBS.
8. HSV-1 stock (from limiting dilution prepared in
Subheading 3.2).
9. Cell scrapers: 18 cm handle/1.8 cm blade and 25 cm handle/
1.8 cm blade.
10. 15 and 50 ml polypropylene centrifuge tubes.
11. 30 ml tubes (Centrifuge Oak Ridge copolymer).
12. Sonicator.
13. Appropriate centrifuge and rotor (e.g., Beckman Avanti J25
with JA-20 rotor).
14. Liquid N2.
15. Water bath.
16. Glycerol.
17. 1.5 ml tubes suitable for storage at 80 C.
2.4 Preparation 1. Incubator.

of Wild-Type HSV 2. T150–175 cm2 tissue culture flasks.
Stocks
3. Vero cells.
7. 1 PBS.
8. HSV-1 stock (titrated HSV-1 midi stock prepared in Subhead-
ing 3.3).
9. Cell scrapers: 18 cm handle/1.8 cm blade and 25 cm handle/
1.8 cm blade.
10. 15 and 50 ml polypropylene centrifuge tubes.
11. 30 ml tubes (Centrifuge Oak Ridge copolymer).
12. Sonicator.
with JA-20 rotor).
14. Liquid N2.
15. Water bath.
16. Glycerol.
2.5 Purification 1. OptiSeal polyallomer centrifuge tubes and plugs 5/8 2¾ in.,
of HSV Stocks 11.2 ml capacity.
2. Needles: 18 G, 1½ in.
3. Syringes: 10 cc.
4. Sonicator.
with JA-20 rotor).
6. Appropriate centrifuge and rotor (e.g., Ultracentrifuge Beck-
man Coulter Optima LE-80K with Vti65.1 rotor).
7. Iodixanol solution: 60% (w/v) iodixanol in water with a density
of 1.32 g/ml (e.g., OptiPrep).
8. Stericup, vacuum disposable filtration system, 0.22 μm.
9. Gradient solution A: 2.8 ml of 5 M NaCl, 6 ml of 1 M HEPES,
pH 7.3, 1.2 ml of 0.5 M EDTA, pH 8.0. Add dH2O to a final
volume of 100 ml and filter-sterilize with the Stericup vacuum
disposable filtration system, 0.22 μm. Store at 4 C.
10. Gradient solution B: 2.8 ml of 5 M NaCl, 1 ml of 1 M HEPES,
pH 7.3, 200 μl of 0.5 M EDTA, pH 8.0. Add dH2O to a final
volume of 100 ml and filter-sterilize the same way as for gradi-
ent solution A. Store at 4 C.
11. Gradient solution C: 5 volumes of iodixanol solution and
1 volume of gradient solution A (5:1). 4.5 ml of solution C is
required for each OptiSeal tube. For gradient solution C, 10 ml
iodixanol solution and 2 ml of gradient solution A is sufficient
for two OptiSeal tubes.
12. Gradient solution D: Mix virus solution with gradient solution

B to obtain a total volume of 4.5 ml per OptiSeal tube. Purify
up to 0.5 ml of virus solution per OptiSeal tube.
13. Gradient solution E or top-up solution: 1.27 ml gradient
solution B (without virus) and 1 ml gradient solution C (see
Note 1).
14. High precision scale.
15. 1 PBS.
16. 30 ml tubes (Nalgene Centrifuge Oak Ridge copolymer).
2.6 Titration of Virus 1. Incubator.

2.6.1 Plaque Assay 2. 6-well plates.
3. Vero cells.
6. 1 PBS.
7. Pipette tips with filters for p20, p200, and p1000.
8. Sonicator.
9. Methylcellulose overlay: 1.5% methylcellulose in PBS. Add
1.5 g of methylcellulose to 100 ml PBS, pH 7.5 in a sterile
bottle containing a stir bar. Autoclave the bottle on liquid cycle
for 45 min. After the solution has cooled down, add 350 ml of
cell culture medium. Mix well, place the bottle on a stir plate at
4 C overnight or until the methylcellulose has completely
dissolved.
10. Staining solution: 1% crystal violet in a 50:50 (v/v) metha-
nol–H2O solution.
11. 1.5 ml tubes.
2.6.2 End Point Dilution 1. Incubator.

Assay 2. 96-well plates.
3. Vero cells.
6. Cell culture medium containing 2% FBS: Dulbecco’s Modified
Eagle’s Medium (DMEM) high glucose, supplemented with
2% fetal bovine serum (FBS).
8. 1 PBS.
9. Sonicator.
11. 1.5 ml tubes.
2.7 Growth Curve 1. Incubator.

Assay 2. 6-well plates.
3. Vero cells. Or other cells of interest.
7. 1 PBS.
9. Liquid N2.
10. Water bath.
3 Methods
Pathogens that are classified as biosafety level 2 organisms, such as

HSV, require good microbiological practice as well as sterile working
conditions. The main safety hazards concerning herpes viruses are
based on direct contact with virus isolates, such as exposure of
mucous membranes (e.g., eyes, nose and mouth) to droplets, inha-
lation of concentrated aerosolized material, or accidental parenteral
injection. Generally, any work that involves handling of the virus
should be conducted in a biological safety hood with protective
clothing (e.g., lab coat, gloves, and safety glasses). The use of nee-
dles, syringes, and other sharp objects should be strictly limited. All
waste that contains or has come in contact with replicating HSV has
to be decontaminated with 1% sodium hypochlorite (bleach) solu-
tion, which is the most effective disinfectant for HSV (see Note 2).
3.1 Cell Culture: Most methods explained below require working with cell cultures.
Maintenance and Always use biological safety hoods when working with cell cultures
Seeding to avoid contamination. In this section we describe how to main-
tain and seed Vero cells. If other cells are used, conditions need to
be adjusted. Contact the provider of the cell line for details on
growth conditions.
1. Maintain Vero cells in a humid incubator at 37 C and 5% CO2.
Propagate the culture twice a week by splitting ~1/5 in fresh
medium (10 ml) into a new 75-cm2 tissue culture flask.
2. In order to split or seed the cells aspirate culture medium, wash
each flask bottom with 5 ml 1 PBS, add 2 ml of trypsin
solution, and incubate for 10 min at 37 C to allow cells to
detach from the flask bottom. Resuspend cells in fresh culture
medium.
3. Count cells using a hemacytometer and plate the indicated

number of cells into the appropriate tissue culture dish contain-
ing sufficient medium to cover the cell layer. Incubate cells at
37 C and 5% CO2 in a humid incubator.
3.2 Limiting Dilution To guarantee the genomic homogeneity and the purity of the HSV
stock, the initial inoculum has to derive from a single infectious
particle isolated by a limiting dilution procedure. The main benefit
of this procedure is the substantial reduction of contaminating
particles that often occur in standard plaque isolation techniques,
such as 2% methylcellulose or agarose overlay procedures. In order
to obtain a pure virus stock, it is essential to go through at least
three rounds of limiting dilution as follows:
1. It is recommended to sonicate the original virus stock for a few
seconds in order to resuspend the virus particles, thereby pre-
venting single plaques arising from two or more virus particles.
2. Detach the Vero cell monolayer with trypsin solution, count
cells, and transfer 2 106 cells in a final volume of 2 ml serum-
free cell culture medium to a 15 ml polypropylene centrifuge
tube (see Subheading 3.1 for more detailed instructions).
3. Add 20–30 PFU of titered original virus stock to the cells.
Rock the tube containing the cells and virus inoculum at
37 C for 1 h to allow the virus to adsorb to the cells.
4. Add 8 ml of cell culture medium containing 10% FBS to the
2 ml of the infected cells to reach a final volume of 10 ml, mix
well. By using a 50 ml reagent reservoir and a multichannel
pipette, dispense 100 μl into each well of a 96-well plate.
5. Incubate the plate in an incubator until plaques become visible
(2–3 days). Plaques can be identified using a light microscope.
First, infected cells become rounded up or fuse with neighbor-
ing cells leading to syncytia formation. At later stages infected
cells will lyse leaving empty spots (plaques) in the monolayer.
6. Identify and mark the wells containing single plaques. Carefully
inspect the edges of the wells under high magnification to
ensure that no additional plaques are present.
7. Freeze the plate at 80 C and thaw at 37 C. Repeat the
freeze-thaw cycle twice.
8. Using a p200 Pipetman, scrape the cells from the bottom of
each well identified to contain a single plaque and pipet the
entire content of the well into 1.5 ml Eppendorf tube; store at
80 C or proceed with the next step.
9. Repeat steps 1–8 two more times using 50 μl of the virus
obtained from a single well (step 8) (second and third limiting
dilutions).
10. After the final round of limiting dilution, the virus stock can be
used to produce a midi stock in Subheading 3.3 from which a
high-titer stock can then be prepared.
3.3 Preparation 1. Seed 7 106 or 2 107 Vero cells in 10–20 ml of cell culture
of Wild-Type HSV Midi medium into a 75 cm2 or 175 cm2 tissue culture flasks, respec-
Stocks tively and incubate overnight at 37 C in a humidified 95%
air-5% CO2 incubator (see Subheading 3.1 for more detailed
instructions).
2. On the next day, decant medium from the cells and add the
virus (complete amount of virus after last round of limiting
dilution from Subheading 3.2) in a sufficient quantity of
serum-free cell culture medium to cover the monolayer. Incu-
bate the cells for 1 h at 37 C to allow adsorption of the virus to
the cells. Rock the flasks every 15 min in order to evenly
distribute the inoculum.
3. Aspirate the virus inoculum and add cell culture medium with a
final volume of 10–20 ml per flask.
4. Incubate the infected cells at 37 C in a humidified 95% air-5%
CO2 incubator for 36–48 h until complete cytopathic effect
(CPE) is reached.
5. Scrape cells with the cell scraper into the medium and pipet the
suspension into 50 ml polypropylene centrifuge tubes.
6. Pellet at 1204 g for 15 min at 4 C.
7. Decant the supernatant into Oak Ridge polypropylene tubes.
Centrifuge at 48,384 g for 30 min at 4 C to concentrate the
virions released into the medium. Resuspend the virus pellets in
a small volume of supernatant, combine in only one tube, and
repellet.
8. Resuspend cell pellet (from step 6) in a small volume of super-
natant, combine, and repellet as described in step 6.
9. Resuspend and combine virus and cell pellet in 2–3 ml of the
same supernatant derived from the infected cells in a 15 ml
polypropylene centrifuge tube. Store at 80 C or continue
with the next step.
10. Freeze-thaw the cell pellet three times using liquid nitrogen
and a water bath set to 37 C; vortex each time after thawing.
After the final thawing, sonicate three times for 10–15 s with
10 s of incubation on ice after each sonication. The virus
suspension should be homogeneous.
11. Centrifuge the suspension at 1734 g for 15 min at 4 C to
pellet cell debris.
12. Transfer the supernatant from step 11 into Oak Ridge poly-
propylene tube from step 7 and centrifuge for 30 min and 4 C
at 48,384 g.
13. Decant and discard supernatant. Carefully remove remaining
supernatant and resuspend pellet by vortexing or pipetting in
1 ml growth medium without serum, add glycerol to a final
concentration of 10% for cryopreservation. Briefly spin the
tube to remove bubbles.
14. Once a virus midi stock has been grown up from a plaque-
purified isolate, store aliquots at 80 C and use as the only
source of virus for generating working virus stocks (see Note 3).
15. Virus midi stocks should be titered. For titration two different
protocols are provided (see Subheading 3.6). Both protocols
should lead to a comparable result if the same stock is used.
3.4 Preparation To produce a large master stock of wild-type HSV, ten 175-cm2
of Wild-Type HSV tissue culture flasks, each containing 2 107 permissive cells, are
Stocks infected with an MOI of 0.01 PFU/cell using the midi stock from
Subheading 3.3. The number of cells and the MOI can be adjusted
depending on the virus strain. Virus particles are isolated from the
supernatant and cell pellet as soon as the entire cell monolayer
displays a CPE by rounding up and cells starting to detach from
the flask. The use of fast dividing and permissive cells, as well as the
ideal time point to harvest the virus, are important factors that
affect the overall yield of infectious virus particles. The following
protocol has been optimized to achieve maximal yields.
1. Seed 1 107 Vero cells in 20 ml of cell culture medium into
each of the ten 150–175 cm2 tissue culture flasks and incubate
overnight at 37 C in a humidified 95% air-5% CO2 incubator
(see Subheading 3.1 for more detailed instructions).
2. On the next day, decant medium from the cells and add the
virus (e.g., MOI of 0.01 PFU/cell) in an amount of serum-free
cell culture medium sufficient to cover the monolayer. Incu-
bate the cells for 1 h at 37 C to allow adsorption of the virus to
the cells. Rock the flasks every 15 min in order to evenly
distribute the inoculum.
3. Aspirate the virus inoculum and add cell culture medium to a
final volume of 20 ml per flask.
4. Incubate the infected cells at 37 C in a humidified 95% air-5%
CO2 incubator for 36–48 h until complete CPE is reached.
5. Scrape cells with the cell scraper into the medium and pipet the
suspension into 50 ml polypropylene centrifuge tubes.
6. Pellet at 1204 g for 15 min at 4 C.
7. Decant the supernatant into Oak Ridge polypropylene tubes
(the supernatant derived from ten 150–175 cm2 flasks fits into
six tubes). Centrifuge at 48,384 g for 30 min at 4 C to

concentrate the virions released into the medium. Resuspend
the virus pellets in a small volume of supernatant, combine in
only one tube, and repellet.
8. Resuspend cell pellet (from step 6) in a small volume of super-
natant, combine, and repellet as described in step 6.
9. Resuspend and combine virus and cell pellet in 2–3 ml of the
same supernatant derived from the infected cells in a 15 ml
polypropylene centrifuge tube. Store at 80 C or continue
with the next step.
10. Freeze-thaw the cell pellet three times using liquid nitrogen
and a water bath set to 37 C; vortex each time after thawing.
After the final thawing, sonicate three times for 10–15 s with
10 s of incubation on ice after each sonication. The virus
suspension should be homogeneous.
11. Centrifuge the suspension at 1734 g for 15 min at 4 C to
pellet cell debris.
12. Transfer the supernatant from step 11 into 30-ml Oak Ridge
polypropylene tube from step 7 and centrifuge for 30 min and
4 C at 48,384 g.
13. Decant and discard supernatant. Carefully remove remaining
supernatant and resuspend pellet by vortexing or pipetting in
1 ml growth medium without serum, add glycerol to a final
concentration of 10% for cryopreservation. Briefly spin the
tube to remove bubbles.
14. Store aliquots at 80 C. For titration of master stocks see
Subheading 3.6. Note that if the virus stock is used for animal
experiments it must be gradient purified to remove cell debris.
In this case do not add glycerol or freeze the virus, but proceed
directly with the purification protocol in Subheading 3.5.
3.5 Purification There are diverse protocols available to purify HSV-1 stocks from
of HSV Stocks cell debris and proteins for preclinical experiments [2, 3]. These
protocols are based on centrifugation [4], gradients [4], filtration
[5], and affinity chromatography [6]. The following protocol
describes the use of iodixanol gradients.
1. It is recommended to keep all gradient solutions on ice and to
precool the ultracentrifuge rotor (see Note 1).
2. Prepare OptiSeal polyallomer centrifuge tubes and pipet 4.5 ml
of gradient solution C into each tube.
3. Sonicate the virus stock to break up clumps before adding it
into gradient solution B to obtain gradient solution D. Mix
gradient solution D well before adding it into the tube contain-
ing gradient solution C (see Note 4).
Fig. 1 Band containing the HSV-1 particles in an OptiPrep gradient
4. Slowly add 4.5 ml of gradient solution D into each tube. Be

careful to avoid clogging of neck and bubble formation. If
necessary, remove bubbles using a syringe.
5. Fill up the tubes with gradient solution E (approximately
1.5 ml per tube).
6. Leave a small air bubble in the neck of the tube and close it with
the cap.
7. Balance tubes using a scale; if necessary, add solution E.
8. Dry the outside of the tubes if necessary and place them into
the rotor. Place plugs and caps, and close tubes by using
120 in. lb torque value.
9. Place rotor into ultracentrifuge, close door, turn on vacuum,
enter run specifications: speed 296,516 g 4–15 h, 4 C,
maximum acceleration rate, no brake during deceleration. It
takes a minimum of 4 h to obtain the separation but longer run
times are recommended. As deceleration without brake takes at
least 2 h, over-night centrifugation is convenient. During the
run, check if centrifuge attained full speed.
10. At the end of the run, turn off vacuum, remove rotor and
carefully put the tubes on ice. A band containing the virus
will be visible in the middle of the gradient (Fig. 1).
11. Collect the band by puncturing the side of the tube 2–3 mm
under the band with a needle and syringe. Be careful not to
aspirate too much volume to avoid collecting debris.
12. Place the collected virus into 30 ml Nalgene Centrifuge Oak

Ridge tubes and add cold PBS to fill up the tubes and to dilute
the residual iodixanol solution within the collected virus solu-
tion (see Note 5).
13. Centrifuge the tubes at 48,384 g for 30 min and 4 C to
concentrate the virus.
14. Discard supernatant and resuspend the pellet in approximately
1–2 ml of cold PBS. If resuspension is a problem, leave the
tubes overnight on ice.
15. Carefully transfer the virus into a tube, which can be used for
sonication. Sonicate to break up clumps (2–3 times, 5–10 s
each time, with 10 s of incubation on ice between sonication
steps). The virus suspension should be homogeneous.
16. Aliquot the virus in small volumes in 1.5 ml tubes to avoid
repeated thawing and loss of infectivity.
17. Store the aliquots at 80 C. Virus stocks should be titered.
For titration we provide two different protocols (Subheading
3.6). Both protocols should lead to a comparable result if the
same stock is used.
3.6 Titration of Virus Different protocols were established to titer virus stocks. Plaque
forming viruses, such as the HSV-1, can be titered using the
described assays (plaque assay and end point dilution assay). Here,
the titer is determined by plaque forming units (PFU) per volume,
indicating that the concentration of infectious particles is deter-
mined. Viruses, which do not induce cell lysis or plaque formation
(e.g., adeno-associated virus or viral vectors) can be titered by
determining genome containing particles (gcp) using qPCR or
alkaline gels. Note that with the latter methods the concentration
of viral genomes opposed to infectious entities is determined.
3.6.1 Plaque Assay 1. One day prior to titration, prepare 6-well tissue culture plates
with 0.5 106 Vero cells per well. Note that on the day of
titration the cell monolayer should be confluent (see Subhead-
ing 3.1 for more detailed instructions).
2. Thaw the virus on ice and sonicate it for a few seconds prior to
infection in order to separate virus particles.
3. Prepare a series of tenfold dilutions (102 to 1010) of the virus
stock in 1 ml cell culture medium without serum in 1.5 ml
Eppendorf tubes.
4. Add 100 μl of each dilution per well.
5. Allow the virus to infect the cells for 1 h at 37 C in a humidi-
fied 95% air-5% CO2 incubator. Rock the plate every 15 min to
distribute the inoculum to all cells in the monolayer.
6. Aspirate the virus inoculum, and overlay the monolayer with

3 ml of methylcellulose overlay in cell culture medium (see
Note 6).
7. Incubate the plates for 3–5 days until well-defined plaques are
visible.
8. Aspirate the methylcellulose medium and stain for 10–20 min
with 2 ml of crystal violet staining solution. The stain fixes the
cells and the virus.
9. Aspirate the crystal violet staining solution, rinse gently with
tap water to remove excess dye and then air dry.
10. Count the number of plaques per well, determine the average
for each dilution (if it is in duplicate or triplicate), and multiply
by 10 to the power of the dilution to obtain the number of
plaque forming units per milliliter (PFU/ml) (see Note 7).
3.6.2 End Point Dilution 1. One day prior to titration, prepare a 96-well tissue culture plate
Assay with 104 Vero cells per well (see Subheading 3.1 for more
detailed instructions).
2. Thaw the virus on ice and sonicate it for a few seconds prior to
infection in order to separate virus particles.
3. Prepare a series of tenfold dilutions (102 to 1010) of the virus
stock in 1 ml cell culture medium without serum in 1.5 ml
Eppendorf tubes.
4. Add 100 μl of each dilution per well (prepare 10 wells per
dilution).
5. Allow the virus to infect the cells for 1 h at 37 C in a humidi-
fied 95% air-5% CO2 incubator.
6. Aspirate the virus inoculum and add 100 μl cell culture medium
containing 2% FBS.
7. Incubate the plates for 3–4 days until well-defined plaques are
visible.
8. Count the number of infected wells for each dilution (10 wells)
and determine the ratio of infection as well as the proportion of
infection. To define the 50% Tissue Culture Infection Dose
(TCID50) use the calculation of Spearman-K€arber [7, 8] (see
Note 8). To convert the TCID50 to PFU/ml multiply
TCID50/ml by 0.69 (see Note 9).
3.7 Growth Curve Determining growth curves represents a suitable and sensitive
Assay method for analyzing HSV replication, as it defines virus yield as a
function of time. Growth curve assays are widely used to investigate
the impact of different parameters, such as cell number, multipli-
cities of infection, temperature, or antivirals, on virus
replication [9].
1. Seed 6-well tissue culture plates with 0.5 106 cells per well in
cell culture medium containing 10% FBS; use one plate for each
cell line in order to evaluate the growth curves in different
permissive cells. Incubate the plates overnight in a humidified
95% air-5% CO2 incubator at 37 C (see Subheading 3.1 for
more detailed instructions).
2. The next day, aspirate the medium and infect the cell mono-
layer with a MOI of 2–5 PFU/cell, resuspended in 1 ml of cell
culture medium without serum for 1 h at 37 C in a humidified
95% air-5% CO2 incubator (see Note 10).
3. After 1 h of adsorption, wash the cells with PBS in order to
remove unbound virus particles and add 2 ml of cell culture
medium containing 10% FBS and incubate at 37 C.
4. At 4, 8, 12, 18, and 24 h post infection (hpi), remove the plates
from the incubator and scrape the cells into the medium.
Transfer cells and the cell culture medium into a test tube and
store at 80 C.
5. After all time points have been harvested, freeze-thaw the
crude virus lysate three times, vortex after each cycle.
6. Determine the titers of the virus stocks from each time point as
described in Subheading 3.6. Calculate the titer of the original
virus suspension to get a t ¼ 0 h PFU/ml value. Store lysates at
80 C for retitration (see Note 11).
4 Notes
1. To prepare gradient solution D, sonicate the virus to break up

clumps before adding it to gradient solution B. Use the virus
obtained from no more than three T175 tissue culture flasks for
each OptiSeal polyallomer centrifuge tube in order to prevent
overloading the gradient. Gradient solution E is used to top up
the tubes and to balance them. To prepare gradient solution E,
gradient solutions B and C are mixed to give a final concentra-
tion of 22% of iodixanol. Prepare all solutions immediately
before use.
2. 1% sodium hypochlorite: Just before use, dilute 1 volume of
commercial bleach solution (with 6% sodium hypochlorite,
e.g., Clorox) with 5 volumes of tap water. Ensure a 15 min
contact time with sodium hypochlorite solution. Use this dis-
infectant for treatment of reusable equipment, surfaces, and
liquid waste (final volume 1%). Disinfectant alternatives include
phenolics, 2% glutaraldehyde, pantasept, and 70% ethanol.
3. Virus stocks should be maintained at a low passage number.
Use one vial of a newly prepared stock for preparing all future
stocks used in a series of experiments. In order to reduce the
chance of acquiring undesired mutations during the propaga-

tion of viruses, stocks should be routinely prepared from single
plaque isolates. Also avoid repeated freeze and thaw cycles of
the virus stock.
4. Gradients should not be overloaded; for example, if the virus is
resuspended in a final volume of 2 ml from the stock prepara-
tion prior to iodixanol purification, do not load more than
0.5 ml of virus per gradient.
5. The virus bands collected after gradient fractionation are
diluted 2–4 times with cold PBS before centrifugation. The
dilution with PBS is important to avoid the presence of a high
percentage of residual iodixanol that could affect pellet forma-
tion leaving the virus particles in suspension.
6. Plaque assays in cell-culture monolayers under solid or semi-
solid overlays are commonly used for virus titration. The over-
lay prevents viral spread and ensures formation of localized
plaques. A similar result can be achieved by overlaying the
infected monolayer with medium containing 0.3% of human
gamma globulin.
7. Calculation of titers. As an example if 100 μl of a 106 dilution
yields 45 plaques, the titer of the virus is 45 107 PFU/ml or
4.5 108 PFU/ml. If 10 μl of a 106 dilution yields 30 pla-
ques, the titer of the virus is 30 108 PFU/ml or 3 109
PFU/ml.
8. The log10 of the virus suspension containing 1 TCID50/0.1 ml
is: L d(s 0.5). L represents the log10 of the most concen-
trated virus dilution tested, d constitutes the log10 of the
dilution factor and s defines the sum of the proportions.
Example:
Class limits 3 4 5 6 7 8 9 10

Ratio of infection 5/5 5/5 4/5 3/5 2/5 1/5 0/5 0/5
Proportion of infection 1 1 0.8 0.6 0.4 0.2 0 0
L ¼ 3
d¼1
s ¼ 1 + 1 + 0.8 + 0.6 + 0.4 + 0.2 + 0 + 0 ¼ 4
In this example, the log10 TCID50/
0.1 ml ¼ 3 1 (4 0.5) ¼ 6.5.
The virus titer corresponds to 106.5 TCID50/0.1 ml or
7.5
10 TCID50/ml.
9. The relationship between TCID50/ml and PFU/ml depends
on the Poisson distribution.
10. All cells in a culture should become infected simultaneously so

that only a single cycle of infection occurs. Synchronous infec-
tion can be achieved by using high MOIs.
11. At 4 hpi, virus titers should have dropped significantly because
much of the input virus becomes uncoated during this time.
Any virus titers detected at this time originates from virus
particles that have not yet entered the cell. By 8 h of infection,
the titer is nearly at the level of the original input virus due to
de novo synthesis, and two- to fivefold higher than the original
input by 18–24 h of infection. However, the values can change
depending on the permissiveness of the cells.
References
1. Beswick TSL (1962) The origin and the use of 6. Jiang C, Wechuck JB, Goins WF et al (2004)
the word herpes. Med Hist 6:214–232 Immobilized cobalt affinity chromatography
2. Segura MM, Kamen AA, Garnier A (2011) provides a novel, efficient method for herpes
Overview of current scalable methods for purifi- simplex virus type 1 gene vector purification. J
cation of viral vectors. In: Merten O-W, Al-Ru- Virol 78:8994–9006
beai M (eds) Viral vectors for gene therapy: 7. K€arber G (1931) Beitrag zur kollektiven Behan-
methods and protocols. Humana, Totowa, NJ, dlung pharmakologischer Reihenversuche.
pp 89–116 Naunyn-Schmiedebergs Arch Für Exp Pathol
3. Mundle ST, Hernandez H, Hamberger J et al Pharmakol 162:480–483
(2013) High-purity preparation of HSV-2 vac- 8. Spearman C (1908) The method of “right and
cine candidate ACAM529 is immunogenic and wrong cases” (constant stimuli) without Gauss’s
efficacious in vivo. PLoS One 8:e57224 formula. J Psychol 2:227–242
4. Vahlne AG, Blomberg J (1974) Purification of 9. Ozuer A, Wechuck JB, Goins WF et al (2002)
herpes simplex virus. J Gen Virol 22:297–302 Effect of genetic background and culture condi-
5. Knop DR, Harrell H (2008) Bioreactor produc- tions on the production of herpesvirus-based
tion of recombinant herpes simplex virus vec- gene therapy vectors. Biotechnol Bioeng
tors. Biotechnol Prog 23:715–721 77:658–692
Chapter 4
Engineering HSV-1 Vectors for Gene Therapy

William F. Goins, Shaohua Huang, Bonnie Hall, Marco Marzulli,
Justus B. Cohen, and Joseph C. Glorioso
Abstract
Virus vectors have been employed as gene transfer vehicles for various preclinical and clinical gene therapy
applications and with the approval of Glybera (Alipogene tiparvovec) as the first gene therapy product as a
standard medical treatment (Yla-Herttuala, Mol Ther 20:1831–1832, 2013), gene therapy has reached the
status of being a part of standard patient care. Replication-competent herpes simplex virus (HSV) vectors
that replicate specifically in actively dividing tumor cells have been used in Phase I–III human trials in
patients with glioblastoma multiforme (GBM), a fatal form of brain cancer, and in malignant melanoma. In
fact, Imlygic® (T-VEC, Talimogene laherparepvec, formerly known as OncoVex GM-CSF), displayed
efficacy in a recent Phase-III trial when compared to standard GM-CSF treatment alone (Andtbacka
et al., J Clin Oncol 31:sLBA9008, 2013), and has since become the first FDA-approved viral gene therapy
product used in standard patient care (October 2015) (Pol et al., Oncoimmunology 5:e1115641, 2016).
Moreover, increased efficacy was observed when Imlygic® was combined with checkpoint inhibitory
antibodies as a frontline therapy for malignant melanoma (Ribas et al., Cell 170:1109–1119.e1110,
2017; Dummer et al., Cancer Immunol Immunother 66:683–695, 2017). In addition to the replication-
competent oncolytic HSV vectors like T-VEC, replication-defective HSV vectors have been employed in
Phase I–II human trials and have been explored as delivery vehicles for disorders such as pain, neuropathy
and other neurodegenerative conditions. Research during the last decade on the development of HSV
vectors has resulted in the engineering of recombinant vectors that are completely replication defective,
nontoxic, and capable of long-term transgene expression in neurons. This chapter describes methods for
the construction of recombinant genomic HSV vectors based on the HSV-1 replication-defective vector
backbones, steps in their purification, and their small-scale production for use in cell culture experiments as
well as preclinical animal studies.
Key words Herpes simplex virus, Gene therapy, Gene transfer, Virus vectors, Virus purification, Virus
production
1 Introduction
HSV-1 (HHV-1) is one of the eight members of the human her-

pesvirus (HHV) family that also includes HSV-2 (HHV-2), vari-
cella zoster virus (VZV or HHV-3), Epstein–Barr virus (EBV or
HHV-4), human cytomegalovirus (HCMV of HHV-5), human
herpesvirus 6 (HHV-6), human herpesvirus 7 (HHV-7), and
73
74 William F. Goins et al.
Kaposi-sarcoma herpes virus (KSHV or HHV-8), all of which cause

some form of human disease and are capable of long-term persis-
tence within specific cells of the human host. Of the three neuro-
tropic herpesviruses or alphaherpesviruses (HSV-1, HSV-2, and
VZV), HSV-1 contains a 152-kb linear double-stranded DNA
genome encoding approximately 85 gene products [1]. The HSV
genome (Fig. 1a) is composed of two segments, the unique long
(UL) and unique short (US) components, each of which is flanked
by inverted repeats containing important viral regulatory genes and
elements. With few exceptions, HSV genes are present as contigu-
ous transcription units in a single copy, which makes their genetic
manipulation relatively straightforward for the construction of
recombinant vectors, with the exception of the genes that are
present as two identical copies within the inverted repeats. The
HSV particle (Fig. 1b) is composed of over 34 proteins with an
icosahedral-shaped nucleocapsid composed of structural capsid
proteins surrounded by a lipid envelope bilayer possessing virus-
encoded glycoproteins essential for attachment and penetration of
(A) HSV Genome

VP16 ICP27
ICP4 ICP4
Essential UL US
Accessory LAT LAT ICP22 ICP47
ICP0 UL41 ICP0
(B) HSV Particle

Envelope
Glycoproteins
Viral dsDNA
Genome
Viral Capsid
Tegument
Proteins
Fig. 1 Organization of the HSV-1 genome and structure of the virion particle. (a)
Schematic representation of the HSV-1 genome, showing the unique long (UL)
and unique short (US) segments, each bounded by inverted repeat elements
(boxes). The location of the VP16, ICP27, and ICP4 essential genes that are
required for viral replication in vitro are indicated above the viral genome while
the ICP0, LAT, UL41, ICP22 and ICP47 nonessential genes, which may be deleted
without dramatically affecting replication in tissue culture, are depicted below
the genome. (b) Electron microscopic depiction of the HSV virion showing the
icosahedral-shaped nucleocapsid containing the 152 kb double-stranded viral
genome; the tegument which contains VP16, UL41, and other HSV encoded gene
products; and the envelope containing the virus-encoded glycoproteins that are
responsible for the attachment and entry of the virus into receptor-bearing cells
HSV Vector Engineering 75
the virus into receptor-bearing cells. Between the capsid and the
envelope exists an amorphous protein matrix known as the tegu-
ment that contains a number of structural proteins, foremost of
which is VP16 [2] that acts in concert with cellular transcription
factors Oct-1 and HCF to activate HSV immediate early (IE) gene
promoters. Transcription of the IE transcriptional regulatory genes
activates the remainder of the lytic life cycle cascade of gene expres-
sion that ultimately results in the production of progeny virus
particles and lysis of the infected cell. In addition to VP16, the
tegument also contains the UL41 (virion host shutoff, vhs) gene
product involved in the shut off of host protein synthesis, thereby
aiding the preferential translation of viral messages [3].
During natural infection in the human host or in animal models
of virus infection, the virus initially replicates in epithelial cells of
the skin or mucosa, usually resulting in lysis of these cells. Progeny
virions from this initial infection attach to and enter into sensory
nerve termini of the peripheral nervous system (PNS), and are
carried via retrograde axonal transport to peripheral nerve cell
nuclei where the viral DNA genome is injected through a modified
capsid penton portal into the nucleus, after which two alternative
forms of the viral life cycle may ensue. The virus may enter the lytic
form of the replication cycle, in which expression of viral IE genes
serves to transactivate expression of early (E) genes whose products
are the principal components of the viral DNA replication machin-
ery that ultimately leads to the production of concatemers of the
viral genome. Following viral DNA synthesis, in conjunction with
IE gene products, the late (L) genes that encode the structural
proteins such as the capsid, tegument and viral glycoproteins pres-
ent within the virion envelope are then transcribed. These late
genes are required for viral particle assembly within the nucleus,
the budding of the particle through a modified portion of the
nuclear membrane, transport of that particle to the cell surface,
and egress from the cells with release of fully infectious progeny
virus particles. Alternatively, the virus may enter a latent state, in
which the over 85 viral genes that are active during lytic infection
are either not transcribed or are transcriptionally silenced over time
by mechanisms that are not yet completely understood but are
thought to involve genome methylation and histone binding and
acetylation. The ability of the virus to enter either the lytic or latent
stage of the virus life cycle holds true for replication-competent
(oncolytic) and replication-defective vectors. However, replication-
defective vectors that have been rendered replication-deficient
through the deletion of one or more essential HSV gene products,
typically one or more transcription regulatory factors such as the IE
gene products infected cell polypeptide (ICP) 4 and 27, directly
enter a quiescent, “latent-like” state where the viral genome persists
long-term with exclusive expression of the latency-associated
transcripts or LATs [4], the real hallmark of HSV latent infection of

the nervous system.
HSV possesses numerous biological features that make it
attractive as a gene delivery vehicle for gene transfer to the nervous
system and other tissues [5–7]. The virus possesses a broad host
range and is able to infect both nondividing cells, such as neurons,
and dividing cells at extremely high efficiencies [7–10]. The virus is
capable of establishing a latent infection in neurons as part of its
natural biology, a state in which viral genomes persist as intranuc-
lear episomal elements that become transcriptionally silent over
time. Completely replication-defective viruses can be constructed
which retain the ability to establish a latent-like state in neurons,
but which are unable to replicate or reactivate from this latent-like
state; in contrast, wild-type virus may be reactivated from latency.
These largely quiescent, defective genomes still retain the ability to
express transgenes long-term using the HSV latency viral promoter
system [11–13]. The large capacity of the viral genome (152 kb),
and the fact that many viral genes can be removed as contiguous
segments without dramatically affecting virus production, have
enabled the incorporation of large [14] or multiple [15] trans-
genes, making it a preferred vector for expression of multiple
gene products or gene libraries. Since HSV genes are expressed in
a sequential, interdependent lytic cycle cascade [16], the simple
removal of the essential IE gene ICP4 blocks expression of later
downstream viral genes in the gene expression cascade [17], result-
ing in the production of a first-generation replication-defective
vector that is incapable of producing virus particles. Since these
first-generation vectors are toxic to some cells in culture [18] due to
the expression of the remaining IE genes, second and third genera-
tion vectors deleted for combinations of these multiple IE genes
were engineered that displayed reduced cytotoxicity compared to
the first-generation vectors [19–21]. A third-generation vector
deleted for the IE genes ICP4, ICP27 and ICP22 (TOZ.1) and
containing an ICP0 promoter-lacZ expression cassette, exhibited
reduced toxicity in neurons in culture [19]. Another third-
generation vector, vHG [22], is also less cytotoxic than first- and
second-generation vectors.
We have developed methods to systematically introduce foreign
genes into the HSV-1 genome by homologous recombination
[23], initially using the TOZ.1 vector backbone. This vector can
only be propagated using ICP4/ICP27-complementing cells, such
as our Vero cell-derived 7b cell line that has been engineered to
avoid overlap of the complementing sequences with the deletions
present within the virus in order to eliminate the chance of homol-
ogous recombination and rescue of the mutant viruses during
propagation in the complementing line [24]. We have recently
developed another ICP4/ICP27-complementing cell line
(U2OS-ICP4/27) in the background of U2OS osteosarcoma
cells that possess the unique ability to complement mutations/

deletions in the HSV IE ICP0 gene [25, 26], enabling this line to
be used to complement the replication of highly defective HSV
vectors deleted for the expression of all the regulatory IE gene
products [25, 26].
Using homologous recombination between the TOZ.1 vector
backbone and a plasmid containing an expression cassette for a gene
of interest (GOI) within the UL41 gene sequence, we previously
constructed a series of gene delivery vectors [19, 23]. More
recently, we have employed the vHG backbone that contains the
same deletions of ICP4 and ICP27 as TOZ.1 but is not deleted for
ICP22 [22] (Fig. 2a) since we found that elimination of ICP22
resulted in a 1–2 log reduction in virus titers. Instead, vHG pos-
sesses deletions within the ICP22 and ICP47 IE gene promoters
that result in these genes being expressed as early (E) rather than IE
genes. Although vHG lacks the lacZ reporter gene cassette in the
UL41 locus, it possesses an HCMV promoter driven eGFP
reporter gene cassette within the ICP4 loci in place of the deleted
coding sequences for ICP4 (Fig. 2a). Recombination of targeting
plasmids such as pSASB3, that contains ICP4 flanking sequences
for homologous recombination on either side of a multicloning site
for insertion of a GOI between a promoter (e.g., HCMV, HSV
LAP2 latency promoter, or the hybrid LAP2-HCMV promoter)
and a bovine growth hormone (BGH) polyadenylation sequence
(pA) (Fig. 2b), into the viral ICP4 loci results in the insertion of the
GOI with the corresponding loss of the eGFP expression cassette,
enabling the rapid identification of recombinants due to the loss of
green fluorescent signal. However, we found that it was difficult to
identify recombinants that produced clear plaques in the back-
ground of green-plaque producing parental virus. To further aid
in the identification of recombinants, we have introduced an
HCMVp-mCherry expression cassette into the UL41 locus of
vHG (Fig. 2a), designated vHG-mCherry, that enables the easy
identification of bright-red mCherry+/eGFP plaques (Fig. 2c)
on the background of fainter mCherry+/eGFP+ plaques produced
by the parental virus. Moreover, inclusion of two fluorescent
reporter cassettes within the virus allows for the recombination of
genes into either or even both loci in circumstances that require the
introduction of multiple genes into the vector. Following three
rounds of limiting dilution analysis, the structure of the recombi-
nants is then confirmed by Southern blot, PCR, or sequence analy-
sis. We have also developed detailed methodologies for the
production and purification of large-scale stocks of HSV vectors
[27, 28]. We have recently applied Red-mediated recombineering
[29] to a bacterial artificial chromosome (BAC) containing a com-
plete HSV-1 genome [30] to rapidly engineer replication-defective
[25, 26] and replication-competent [31] HSV vectors. Although
the methods detailed in this chapter concentrate on the generation
ICP22 ICP47
UL41 ICP27
(A) vHG-mCherry
ICP4 ICP4
HCMV SV40 HCMV BGH BGH HCMV

dsRed GFP GFP
IEp pA IEp pA pA IEp
(B) pSASB3-LAP2 or –HCMV or LAP2-HCMV

ICP4 5’ flanking sequence ICP4 3’ flanking sequence
Hi
HindIII—LAP2– BamHI-SpeI-EcoRI-PstI-EcoRV-NotI-XhoI-SphI-XbaI-BGHpA-XbaI
-HCMV-
-LAP2-HCMV- UL41 ICP27 ICP22 ICP47
C) vH-Therapy Gene
(C)
ICP4 ICP4
HCMV SV40 HCMV Therapeutic BGH BGH Therapeutic HCMV

dsRed
IEp pA IEp Gene pA pA Gene IEp
(D) 1) Obtain plasmid clone containing therapeutic gene of interest

2) Subclone into ICP4 (pSASB3) or UL41 (p41) transfer plasmids
3) Verify clones by restriction digestion and/or sequencing
4) Prepare MaxiPrep of new plasmid construct
5) Transfect transfer plasmid into 7b cells twice, then infect with vHG-mCherry virus
6) Wait until CPE occurs, then harvest cells + supernatant
7) Perform limiting dilution analysis of harvest
8) Select mCherry+/GFP- (ICP4) or mCherry-/GFP+ (UL41) plaques
9) Screen isolates for the presence of therapeutic gene (Southern, Western, ELISA, IHC)
Fig. 2 Construction and production of a replication-defective recombinant HSV-1 vector. (a) Replication-
defective HSV-1 vector vHG-mCherry is deleted (Δ) for ICP4 and ICP27, expresses ICP22 and ICP47 as Early
genes (β-ICP22/β-ICP47), and contains an HCMV promoter-driven eGFP expression reporter gene cassette in
the ICP4 loci and an HCMVp-driven mCherry reporter gene cassette within the UL41 locus. This parental virus
vector produces both green and red plaques when plated on the complementing Vero-7b cells. (b) The GOI is
cloned into the multicloning site (MCS) of a pSASB3 transfer plasmid downstream of a promoter (HCMV, LAP2,
or hybrid LAP2-HCMV) and upstream of the BGH polyadenylation signal (pA). The pSASB3 plasmid possesses
over 1 kb of ICP4 flanking sequences on either side of the promoter-MCS-pA segment to ensure homologous
recombination into the ICP4 loci of vHG-mCherry. (c) Homologous recombination of the GOI within the pSASB3
transfer plasmid into the ICP4 loci of vHG-mCherry will result in a vector that shows an eGFP/mCherry+
plaque phenotype compared to the eGFP+/mCherry+ plaque phenotype of the parental vHG-mCherry vector.
(d) The various steps of the process of inserting your GOI into the vHG-mCherry vector by homologous
recombination are detailed
and use of replication-defective HSV vectors, the same techniques

can be applied to replication-competent vectors except that those
do not require a complementing cell line for vector growth and
propagation.
2 Materials
2.1 Cell Culture 1. DMEM/10% FBS: Dulbecco’s Eagle’s modified essential

medium (DMEM) supplemented with nonessential amino
acids, 100 U/mL penicillin G, 100 μg/mL streptomycin sul-
fate, 2 mM GlutaMAX, and 10% fetal bovine serum (FBS).
Store at 4 C.
2. VP-SFM, virus-production serum-free media (Life
Technologies).
3. Methylcellulose overlay (1.0%): Add 25 g methylcellulose
(Aldrich, Milwaukee, WI) to 100 mL phosphate-buffered
saline (PBS) pH 7.5 in a 500 mL sterile bottle containing a
stir bar. Autoclave the bottle on liquid cycle for at least 45 min.
After the solution cools, add 350 mL of DMEM supplemented
with nonessential amino acids, 100 U/mL penicillin G,
100 μg/mL streptomycin sulfate, and 2 mM GlutaMAX, mix
well and place the bottle on a stir plate at 4 C overnight. Once
the methylcellulose has entered solution, add 50 mL of FBS.
Store at 4 C (see Note 1).
4. 1% crystal violet solution (in 50:50 ethanol–dH2O, v/v). Dis-
solve 1 g crystal violet in 50 mL dH2O and then add 50 mL of
ethanol. Filter using a 0.22-μm filter and store at room
temperature.
2.2 Cells 1. Vero cells (African green monkey kidney; ATCC #CCL81,
Rockville, MD), or Vero-7b and U2OS-ICP4/27 cells that
express both ICP4 and ICP27 [24–26] are required to propa-
gate HSV-1 replication-competent or replication-defective
viruses, respectively.
2.3 Buffers 1. Tris-buffered saline (TBS) pH 7.5: 50 mM Tris–HCl pH 7.5,

and Solutions 150 mM NaCl, 1 mM ethylenediamine tetraacetic acid
(EDTA). Store at room temperature.
2. PBS (1) pH 7.5: 135 mM NaCl, 2.5 mM KCl, 1.5 mM
KH2PO4, 8.0 mM Na2HPO4 pH 7.5. Store at room
temperature.
3. Glycerol. Store at room temperature.
4. 70% ethanol. Store at 20 C.
5. Lipofectamine 3000 (Life Technologies). Store at 4 C.
6. Opti-MEM (Life Technologies). Store at 4 C.
7. 5 M NaCl. Store at 4 C.
8. 100 mg/mL dextran sulfate MW9-20K. Store at 4 C.
2.4 Nucleic Acids 1. Transfer plasmid pSASB3 (Fig. 2b) for recombination into the
ICP4 loci. Other transfer plasmids such as p41 can also be
employed [19, 23] that will enable transfer of the expression
cassette into the UL41 locus of the vector.
2. Plasmid containing gene of interest.
3. E1G6-mCherry (vHG-mCherry) virus (Fig. 2a).
2.5 Equipment 1. 6360-cm2 10-layer Cell Stack (Corning, Corning, NY).

2. 6-well, 12-well and 96-well flat-bottomed plates.
3. T-75 and T-150-cm2 flasks.
4. Cell scrapers.
5. 15- and 50-mL conical polypropylene tubes.
6. Cup-horn sonicator.
7. Nutator rocking platform.
8. Preparative and tabletop centrifuges.
9. CO2 incubator.
10. 50- and 500-mL polypropylene centrifuge bottle.
11. Multichannel pipettor.
12. Mini-Prep kit (Qiagen, Valencia, CA).
13. Parafilm.
14. 0.8-μm CN vacuum filter for small samples up to 100, 250,
500 or 1000 mL bottle filters (Nalgene-Thermo/Fisher, Pitts-
burgh, PA).
15. 1.5-mL cryovials.
3 Methods
The protocols contained herein describe the methods necessary to

construct and purify recombinant genomic HSV vectors. Although
the chapter details the procedures for constructing and producing a
replication-defective HSV vector, these same methods can be
applied to replication-competent genomic HSV vectors like the
oncolytic vectors employed in the glioblastoma multiforme
(GBM) and malignant melanoma clinical trials [31–37]. The only
major difference between the two is that the replication-defective
vectors require the use of a cell line that expresses HSV gene
products that are deleted from the genome of the replication-
defective vector to complement the missing essential genes. We
have also provided methods for the production and purification
of high-titer vector stocks once an isolate is identified and purified
through three rounds of limiting dilution analysis.
3.1 Construction of In order to engineer the desired recombinant virus, the GOI to be
Recombinant Virus inserted into the virus must first be cloned into the transfer plasmid
(pSASB3 or p41) that contains at least 500–1000 bp of flanking
HSV-1 sequences (Fig. 2b). In the example delineated in this
chapter, we will employ the pSASB3 transfer plasmid that contains
HSV flanking sequences that enable recombination of the gene
expression cassette into the ICP4 gene loci of the vHG-mCherry
vector (Fig. 2a) that will result in the loss of the GFP reporter with
positive isolates screened for the eGFP/mCherry+ phenotype.
The addition of 500–1000 bp of flanking sequence is needed to
achieve a high frequency of recombination between the plasmid
and viral genome; flanking sequences as small as 100–200 bp will
produce recombinants, but at a very reduced frequency. The basic
pSASB3 and p41 plasmids each contain a unique BamHI restriction
site for cloning of the expression cassette into the transfer plasmid.
The expression cassette should consist of the cDNA of interest
driven by a promoter of interest and followed by a polyadenylation
signal. Alternatively, we have created versions of pSASB3 that pos-
sess the HCMV, LAP2, or LAP2-HCMV hybrid promoter, a multi-
cloning site (MCS) for cDNA insertion, and a BGH polyA site
(Fig. 2b). The p41 transfer plasmid contains HSV-1 flanking
sequences for cDNA cassette recombination into the UL41 locus
of vHG-mCherry, resulting in eGFP+/mCherry recombinants, in
a manner similar to recombination into the UL41 locus of the
TOZ.1 vector that contained a lacZ reporter in UL41 rather than
mCherry [19, 23]. Initial studies were performed with vHG, which
lacks a second reporter gene cassette within the viral vector, so
recombination of the target plasmid into the ICP4 loci resulted in
the loss of the eGFP reporter and a clear plaque phenotype that was
difficult to screen for in the background of nonrecombinant vHG
plaques that appear bright green under fluorescence. Thus, in order
to readily detect the recombinants containing the desired GOI, the
parental virus backbone should possess two fluorescent reporter
gene cassettes (eGFP, mCherry), one each at a desired site of recom-
bination (e.g., ICP4 and UL41). Positive recombinants obtained
from recombination of the GOI cassette in the pSASB3 transfer
plasmid with the viral DNA will produce bright-red eGFP/
mCherry+ plaques (Fig. 2c) compared to the fainter-red eGFP+/
mCherry+ plaque phenotype of the parental virus, enabling rapid
identification.
1. Clone your cDNA expression cassette of interest into the
pSASB3 shuttle plasmid at the BamHI site or your cDNA
into one of the promoter-MCS-pA versions of pSASB3 (see
Note 2).
2. One day prior to transfection, seed 5 105 7b or U2OS-
ICP4/27 cells in a 6-well tissue culture plate in DMEM/10%
FBS. This will ensure that cells are nearly (80%) confluent the
next day.
3. Transfect the cells with the plasmid DNA using Lipofectamine
3000 in Opti-MEM following the manufacturer’s instructions.
It is important to linearize the plasmid construct before trans-
fection to increase the recombination frequency compared to
that obtained with uncut supercoiled plasmid. Digestion of the
plasmid to release the insert, followed by purification of the
restriction fragment does not increase the recombination fre-
quency, but does eliminate the chance of insertion of plasmid
vector sequences into the virus by semihomologous recombi-
nation with any complementary sequences such as promoters
or polyadenylation sites.
4. After incubation steps, add fresh DMEM–10% FBS and incu-
bate at 37 C.
5. At 24 h post transfection, repeat the plasmid transfection pro-
cess, and incubate at 37 C.
6. At 24 h after the second plasmid transfection step, infect with
the vHG-mCherry virus at a multiplicity of infection (MOI) of
1–3 virus PFU per cell in 1 mL serum-free DMEM for
60–90 min at 37 C. After the infection period, add 4 mL
DMEM–5% FBS and reincubate at 37 C.
7. It usually takes 2–5 days for plaques to develop depending on
the virus and the cell line. One can usually see some signs of
CPE within 24–48 h post-infection, due to the presence of the
fluorescent reporter gene that enables the identification of
virus-infected cells.
8. Examine the plate under a fluorescence microscope to look for
eGFP/mCherry+ recombinants in the background of
eGFP+/mCherry+ parental virus plaques (see Note 3).
9. Once plaques have formed, harvest media and cells using a cell
scraper and transfer into a 15-mL conical tube.
10. Subject cells/media to three cycles of freezing and thawing,
and sonicate the cells three times for 15 s each on setting
5 using a cup-horn sonicator.
11. Centrifuge at 2060 g for 5 min at 4 C to remove cell debris.
12. Store supernatant at 80 C for use as a stock (see Note 4).
3.1.1 Determine the Titer 1. Prepare a series of tenfold dilutions (102 to 1010) of the virus
of the Stock of stock in serum-free DMEM or VP-SFM media.
Recombinant Virus 2. Add 100 μL of each dilution to a well of a 12-well tissue culture
plate containing 4 105 Vero-7b or U2OS-ICP4/27 cells/
well (~80–90% confluent) (see Note 5).
3. Incubate the plates at 37 C in a CO2 incubator for 1 h, then

add 1 mL DMEM/10% FBS and place in the incubator
overnight.
4. Within the next 24 h, remove the media and overlay the
monolayer with 1 mL of 1% methycellulose/10% FBS solution
to limit virus spread and produce readily visible plaques.
5. Incubate the plates for 3–5 days until well-defined plaques
appear, depending on the virus and the cell line used. The
presence of the fluorescent reporter gene within the virus
readily accentuates the visualization of infectious centers and
plaques.
6. Aspirate the methycellulose overlay, and stain with 1% crystal
violet solution (in 50:50 ethanol:dH2O v/v) for 5 min.
Remove stain, rinse with water and air dry.
7. Count plaques and calculate the number of plaque-forming
units per 1 mL of original stock (see Note 6).
3.1.2 Limiting Dilution 1. Add ~30 PFU of titered original stock virus to 1 mL containing
Analysis to Isolate and 2 106 Vero-7b (or U2OS-ICP4/27) cells in suspension
Purify Recombinants (DMEM/10% FBS) in a 15-mL conical tube and place the
tube on a Nutator rocker platform at 37 C for 1.5 h. Cover
the cap with Parafilm to prevent leaking and contamination.
2. Add 9 mL of fresh DMEM/10% FBS media, mix and plate
100 μL in each well of a 96-well flat-bottomed tissue culture
plate using a multichannel pipettor.
3. Incubate the plates at 37 C in a CO2 incubator for a period of
3–5 days until plaques appear, depending on the virus and cell
line employed. Again, the presence of the fluorescent reporter
facilitates this step. Score the wells for the number of plaques.
Theoretically, there should be approximately 30 individual
plaque wells/plate. Most wells should lack plaques, while
some may have two or more plaques.
4. If recombination between the transgene cassette with the ICP4
(or UL41, depending on the transfer plasmid employed) flank-
ing sequences and the virus has occurred, the GOI will have
replaced the eGFP (or mCherry) reporter gene. When insert-
ing genes into the ICP4 loci, the corresponding positive
recombinants should produce the eGFP/mCherry+ plaque
phenotype, while the parental vHG-mCherry virus will show
an eGFP+/mCherry+ plaque phenotype.
5. Wrap the plate with Parafilm and store at 80 C for use as a
stock for the next round of limiting dilution. Alternatively, one
can just store the cells and media from wells displaying the
eGFP/mCherry+ plaque phenotype.
6. Score wells that have eGFP/mCherry+ plaques.
7. Select a well containing only eGFP/mCherry+ plaques, as

these were formed from virus recombinants in which the GOI
has replaced eGFP (or mCherry if using the p41 transfer plas-
mid) in vHG-mCherry.
8. Carry out at least two additional rounds of limiting dilution/
plaque isolation using the stock of virus stored at 80 C, as in
steps 1–5 above. At the final round of limiting dilution, all the
plaques identified on the plate should show the desired plaque
phenotype (i.e., red but not green plaques for insertion of
genes into the ICP4 loci of vHG-mCherry). At this point, the
virus stock can be used to produce a midi stock for the eventual
preparation of a high-titer stock for general experimental use.
At the same time this stock can be used to produce viral DNA
to confirm the presence of the insert as well as the absence of
the deleted sequences by Southern blot, PCR analyses and/or
sequencing.
3.2 Virus Stock The following procedure entails the preparation of a virus stock
Preparation and from one 10-layer cell stack factory that equates to an area of
Purification 6360 cm2 but can be scaled up or down depending on specific
needs. We have employed a salt-release treatment step in our pro-
duction runs as this increases the overall yield of virus in the
supernatant fraction 2 to tenfold [27, 28]. In addition, we have
now incorporated the addition of dextran sulfate treatment along
with the salt-release step to increase our yield (20–200) based on
the production of an HSV-2-based vaccine vector [38]. Our new
purification protocol (Fig. 3a) calls for the use of filtration steps can
that be employed to separate the virus from cellular debris in
combination with a centrifugation step to concentrate the filtrate.
The ultimate goal is to purify virus particles away from cellular and
extracellular debris which was a problem using our older purifica-
tion procedure (Fig. 3b, c). The purity achieved by this new meth-
odology is demonstrated in electron micrographs (EM) of purified
virus preparations where the traditional Dextran T-10 or Opti-
Prep/Iodixanol gradient centrifugation protocols yielded high
levels of membrane-containing contaminants (Fig. 3b, c), while
the biofiltration produced clean stocks consisting of almost exclu-
sively membraned HSV particles (Fig. 3d). In order to further
verify stock purity, we performed Western blot analysis of the new
filtration HSV virus stock preparations compared to traditional
OptiPrep purified virus stocks (Fig. 4). Additional downstream
purification steps may be added to further eliminate contaminating
cellular DNA and protein such as treatment with benzonase in
combination with other ultrafiltration steps.
1. Seed one 10-layer cell stack with 1.4 108 7b or U2OS-
ICP4/27 cells in 1400 mL DMEM/5% FBS and incubate at
37 C in a CO2 incubator.
Dextran sulfate
Low-speed centrifugation
High-speed centrifugation Low-speed centrifugation
High-speed centrifugation
Vial in 5-200 µL aliquots, store to -80°C, titer
(C) OptiPrep Gradient Purified HSV
Fig. 3 Comparison of the HSV vector production and purification procedures. (a) The previous methods to
obtain purified HSV vectors employed a series of centrifugation steps, culminating with an OptiPrep/Iodixanol
or Dextran T10 gradient step. We found that the integrity of the viral membrane was dramatically damaged by
multiple centrifugation steps that are frequently used to purify nonenveloped viral vectors such as AAV and
Adenovirus. In addition, density gradient centrifugation of the virus failed to sufficiently separate the viral
particles away from small cellular membrane vesicles, resulting in high levels of cellular contaminants within
the purified vector preparations. Thus, we developed a new strategy (a) for virus production and purification.
This new methodology employs salt and dextran sulfate treatment to achieve greater release of virus particles
from cellular membranes of infected cells and utilizes filtration methods for virus separation from cellular
debris. Our ultrafiltration methodology yielded virus of high purity by EM (d) compared to (b) Dextran T10 or (c)
OptiPrep density ultracentrifugation
2. Allow cells to become 80–100% confluent. If over confluent,

lower overall virus yield will be achieved.
3. Infect cells in a small volume using very low MOIs, usually
0.001–0.005 depending on the cell type and virus. For a
10-layer of 7b cells, infect with virus in a total volume of
300 mL of serum-free VP-SFM media. Make sure that equal
amounts of the inoculum spreads to each layer of the 10-layer
cell stack (see Note 7).
4. Infection should proceed at 37 C for 60–90 min, with rocking
of the cell-stack every 15 min to ensure that the inoculum
covers the monolayer.
OptiPrep
OptiPrep
Fig. 4 Western blot analyses of ultrafiltration compared to ultracentrifugation purification methodologies. To

assess whether our purification methods were capable of removing exosomes from the virus stocks, we
performed Western blot analyses with antibodies to CD81 and TSG101, two standard exosome markers, on
virus isolated from Vero-7b cells by the old OptiPrep method compared to virus isolated from Vero-7b or
U2OS-ICP4/27 cells by our current filtration method. The results show that the OptiPrep-prepared virus
contained high levels of exosomal marker contaminants. This probably equates to the fact that the EM from
the OptiPrep virus showed more exosome-like microvesicles than actual HSV particles
5. After the 90-min period, add 300–500 mL fresh VP-SFM

media. For a 10-layer cell stack of 7b cells we use a final total
volume of 800 mL (see Note 8).
6. Reincubate the 10-layer cell stack at 37 C overnight.
7. After 24 h, switch the 10-layer cell stack to 33 C (see Note 9).
8. Observe the flask daily for the presence of CPE. If virus con-
tains a fluorescent marker, it is easy to follow the infection.
9. Harvest once most cells show CPE (90–100%), have rounded
up, and are no longer adherent to the plastic, depending on
cell type.
10. Add 5 M NaCl to make the overall concentration 0.45 M and
add dextran sulfate solution to a final concentration of 100 μg/
mL; and reincubate overnight at 33 C.
11. The following morning, switch from 33 C to RT and place the
cell factory onto a shaking platform for a minimum of
60–90 min or longer. At this point all cells should have
detached from the monolayer.
12. Spin down cells and debris by low-speed centrifugation
1565 g – 2348 g at 4 C for 5–10 min in a refrigerated
tabletop centrifuge in 50-mL conical polypropylene tubes.
13. Remove supernatant and filter through a 0.8-μm CN vacuum

filter (see Note 10).
14. Pellet the virus from the supernatant using a high-speed spin
(41,657 g – 47,850 g) for 45 min at 4 C in a refrigerated,
preparative centrifuge in 50- or 500-mL polypropylene centri-
fuge tubes/bottles. A visible white pellet should be present in
each tube/bottle after pelleting the virus.
15. Wash 1 with 1PBS to eliminate any residual salt.
16. Resuspend the virus in as small a volume of 1PBS as possible
and leave the tube/bottle at an angle overnight at 4 C so that
the volume of liquid covers the visible virus pellet (see
Note 11).
17. Once the pellet is resuspended, chunks or particulates should
no longer be visible. Add glycerol (0.22-μm filtered) to 10% of
total volume, mix, aliquot into 1.5-mL cryovials and store at
80 C. We usually aliquot in at least two different volume
sizes; for example, 5 or 10 μL and a larger size like 50 or 100 μL
(see Note 12).
18. Select at least one cryovial from the 80 C virus stock to titer
according to the virus titration protocol (see Subheading
3.1.1). We routinely select one vial from the beginning, middle
and end of all the vials of newly made stock. We also confirm
the presence of the GOI by Southern blot, PCR or sequencing
of the insert in the purified virus stock. In addition, we confirm
expression of the GOI using Western blot, ELISA, IHC or
other applicable assay.
4 Notes
1. Stir methylcellulose overlay media before each use as methyl-

cellulose tends to settle at bottom of bottle.
2. The transfer plasmid DNA can be prepared by a variety of
methods. Large-scale plasmid preparations are not necessary
as plasmid DNA prepared using Mini-Prep kits such as the
Qiagen Mini-kit (Qiagen, Valencia, CA) is of sufficient purity
to deliver high transduction efficiencies.
3. When examining plates under the fluorescence microscope
using a filter for red fluorescence, the eGFP/mCherry+ pla-
ques will show a brighter red signal than those from the paren-
tal eGFP+/mCherry+ virus.
4. It is not necessary to add glycerol up to 10% to the virus
supernatant as the media contains 5% FBS and the proteins in
the media act as a cryoprotectant.
5. In order to obtain a more accurate titer, the titration should be

performed in duplicate or triplicate.
6. In calculating the average PFU/mL of the recombinant virus
stock, it is important to multiply the average number of plaques
counted at a specific dilution by the dilution factor. Since in this
example, 100 μL of each dilution of virus stock was plated, the
dilution factor for the calculation is 10. The overall titer in
PFU/mL ¼ the average number of plaques the dilution
factor to the power of the dilution wells counted.
7. It is important to employ low MOIs to generate the virus stock,
as high MOIs result in the introduction of unwanted mutations
throughout the viral genome.
8. It is crucial to keep the total volume as low as possible as this
determines the overall amount of fluid that one must process
during purification steps. Also, it is equally crucial to use a
sufficient volume to ensure coverage of the entire monolayer
of cells on each layer of the 10-layer cell stack.
9. It is critical to switch the infected cells from 37 to 33 C as we
have shown that the virus is more stable at 33 C versus 37 C,
and cell growth is more limited at 33 C, helping to produce
virus at a greater yield per cell.
10. If one employs 0.45-μm filters, one loses a reasonable percent-
age of the virus yield and one also gets shearing of virus
envelopes. The 0.65-μm size is most ideal for virus separation,
but syringe and filter flasks of the 0.65-μm pore size are not
commercially available so we employ the 0.8-μm filters. Impor-
tantly, using media with serum in it for the infection will readily
cause the filters to clog, so we use media without serum
(VP-SFM) once we begin the infection process, even for
viruses that grow poorly. Otherwise you will go through a
considerable number of filters during purification.
11. It is important to thoroughly resuspend the pellet in order to
get an even suspension of particles, but vortexing is not good as
it can damage the particles and render them noninfectious.
12. If virus does not resuspend in the volume of PBS added,
consider adding additional sterile PBS until the pellet has
resuspended completely.
Acknowledgments
This work was supported by NIH grant P01 DK044935

(Glorioso)-Viral Vector Core B (Goins) and P01 CA163205
(Caliguri/Chiocca)-Viral Vector Core B (Goins). We also thank
Drs. Krisky, Wolfe, Wechuck, Ozuer, and Kopp for their contribu-
tions to HSV vector production and purification methodologies.
References
1. Roizman B, Knipe DM (2001) Herpes simplex 13. Goins WF, Yoshimura N, Ozawa H,
viruses and their replication. In: Knipe DM, Yokoyama T, Phelan M, Bennet N, deGroat
Howley PM (eds) Fields virology, 4th edn. WC, Glorioso JC, Chancellor MB (2000) Her-
Lippincott Williams and Wilkins, Philadelphia, pes simplex virus vector-mediated nerve
PA, pp 2399–2459 growth factor expression in bladder and affer-
2. Mackem S, Roizman B (1982) Structural fea- ent neurons: potential treatment for diabetic
tures of the herpes simplex virus alpha gene bladder dysfunction. J Urol 165:1748–1754
4, 0, and 27 promoter-regulatory sequences 14. Akkaraju GR, Huard J, Hoffman EP, Goins
which confer alpha regulation on chimeric thy- WF, Pruchnic R, Watkins SC, Cohen JB, Glor-
midine kinase. J Virol 44:939–949 ioso JC (1999) Herpes simplex virus vector-
3. Oroskar A, Read G (1989) Control of mRNA mediated dystrophin gene transfer and expres-
stability by the virion host shutoff function of sion in MDX mouse skeletal muscle. J Gene
herpes simplex virus. J Virol 63:1897–1906 Med 1:280–289
4. Stevens JG (1989) Human herpesviruses: a 15. Krisky DM, Marconi PC, Oligino TJ, Rouse
consideration of the latent state. Microbiol RJ, Fink DJ, Cohen JB, Watkins SC, Glorioso
Rev 53:318–332 JC (1998a) Development of herpes simplex
5. Burton EA, Wechuck JB, Wendell SK, Goins virus replication-defective multigene vectors
WF, Fink DJ, Glorioso JC (2001) Multiple for combination gene therapy applications.
applications for replication-defective herpes Gene Ther 5:1517–1530
simplex virus vectors. Stem Cells 19:358–377 16. Honess R, Roizman B (1974) Regulation of
6. Goins WF, Wolfe D, Krisky DM, Bai Q, Burton herpes simplex virus macromolecular synthesis.
EA, Fink DJ, Glorioso JC (2004) Delivery I. Cascade regulation of the synthesis of three
using herpes simplex virus: an overview. Meth- groups of viral proteins. J Virol 14:8–19
ods Mol Biol 246:257–299 17. DeLuca NA, McCarthy AM, Schaffer PA
7. Wolfe D, Goins WF, Yamada M, Moriuchi S, (1985) Isolation and characterization of dele-
Krisky DM, Oligino TJ, Marconi PC, Fink DJ, tion mutants of herpes simplex virus type 1 in
Glorioso JC (1999) Engineering herpes sim- the gene encoding immediate-early regulatory
plex virus vectors for CNS applications. Exp protein ICP4. J Virol 56:558–570
Neurol 159:34–46 18. Johnson P, Miyanohara A, Levine F, Cahill T,
8. Glorioso J, Goins W, Meaney C, Fink D, Friedmann T (1992) Cytotoxicity of a
DeLuca N (1994) Gene transfer to brain replication-defective mutant herpes simplex
using herpes simplex virus vectors. Ann Neurol virus type 1. J Virol 66:2952–2965
35:S28–S34 19. Krisky DM, Wolfe D, Goins WF, Marconi PC,
9. Haarr L, Shukla D, Rodahl E, Dal Canto M, Ramakrishnan R, Mata M, Rouse RJ, Fink DJ,
Spear P (2001) Transcription from the gene Glorioso JC (1998b) Deletion of multiple
encoding the herpesvirus entry receptor immediate-early genes from herpes simplex
nectin-1 (HveC) in nervous tissue of adult virus reduces cytotoxicity and permits long-
mouse. Virology 287:301–309 term gene expression in neurons. Gene Ther
5:1593–1603
10. Mata M, Zhang M, Hu X, Fink D (2001)
HveC (nectin-1) is expressed at high levels in 20. Samaniego L, Webb A, DeLuca N (1995)
sensory neurons, but not in motor neurons of Functional interaction between herpes simplex
the rat peripheral nervous system. J Neurovirol virus immediate-early proteins during infec-
7:1–5 tion: gene expression as a consequence of
ICP27 and different domains of ICP4. J Virol
11. Goins WF, Lee KA, Cavalcoli JD, O’Malley 69:5705–5715
ME, DeKosky ST, Fink DJ, Glorioso JC
(1999) Herpes simplex virus type 1 vector- 21. Wu N, Watkins SC, Schaffer PA, DeLuca NA
mediated expression of nerve growth factor (1996) Prolonged gene expression and cell sur-
protects dorsal root ganglia neurons from per- vival after infection by a herpes simplex virus
oxide toxicity. J Virol 73:519–532 mutant defective in the immediate-early genes
encoding ICP4, ICP27, and ICP22. J Virol
12. Goins WF, Sternberg LR, Croen KD, Krause 70:6358–6368
PR, Hendricks RL, Fink DJ, Straus SE,
Levine M, Glorioso JC (1994) A novel 22. Srinivasan R, Huang S, Chaudhry S,
latency-active promoter is contained within Sculptoreanu A, Krisky D, Cascio M, Friedman
the herpes simplex virus type 1 UL flanking PA, de Groat WC, Wolfe D, Glorioso JC
repeats. J Virol 68:2239–2252 (2007) An HSV vector system for selection of
ligand-gated ion channel modulators. Nat P (2015) Use of miRNA response sequences to
Methods 4:733–739 block off-target replication and increase the
23. Krisky D, Marconi P, Oligino T, Rouse R, safety of an unattenuated, glioblastoma-
Fink D, Glorioso J (1997) Rapid method for targeted oncolytic HSV. Mol Ther 23:99–107
construction of recombinant HSV gene trans- 32. Andtbacka RHI, Collichio FA, Amatruda T,
fer vectors. Gene Ther 4:1120–1125 Senzer NN, Chesney J, Delman KA, Spitler
24. Marconi P, Krisky D, Oligino T, Poliani PL, LE, Puzanov I, Doleman S, Ye Y, Vanderwalde
Ramakrishnan R, Goins WF, Fink DJ, Glorioso AM, Coffin R, Kaufman H (2013) OPTiM: a
JC (1996) Replication-defective HSV vectors randomized phase III trial of talimogene laher-
for gene transfer in vivo. Proc Natl Acad Sci U parevec (T-VEC) versus subcutaneous
S A 93:11319–11320 (SC) granulocyte-macrophage colony-stimula-
25. Miyagawa Y, Marino P, Verlengia G, Uchida H, tory factor (GM-CSF) for the treatment (tx) of
Goins WF, Yokota S, Geller DA, Yoshida O, unresectable stage IIIB/C or IV melanoma. J
Mester J, Cohen JB, Glorioso JC (2015) Her- Clin Oncol 31:sLBA9008
pes simplex viral-vector design for efficient 33. Pol J, Kroemer G, Galluzzi L (2016) First
transduction of nonneuronal cells without oncolytic virus approved for melanoma immu-
cytotoxicity. Proc Natl Acad Sci U S A 112: notherapy. Oncoimmunology 5:e1115641
E1632–E1641 34. Ribas A, Dummer R, Puzanov I,
26. Miyagawa Y, Verlengia G, Reinhart B, Han F, VanderWalde A, Andtbacka RHI,
Uchida H, Zucchini S, Goins WF, Michielin O, Olszanski AJ, Malvehy J,
Simonato M, Cohen JB, Glorioso JC (2017) Cebon J, Fernandez E et al (2017) Oncolytic
Deletion of the virion host shut-off gene virotherapy promotes intratumoral T cell infil-
enhances neuronal-selective transgene expres- tration and improves anti-PD-1 immunother-
sion from an HSV vector lacking functional IE apy. Cell 170:1109–1119.e1110
genes. Mol Ther Methods Clin Dev 6:79–90 35. Dummer R, Hoeller C, Gruter IP, Michielin O
27. Ozuer A, Wechuck JB, Goins WF, Wolfe D, (2017) Combining talimogene laherparepvec
Glorioso JC, Ataai MM (2002) Effects of with immunotherapies in melanoma and other
genetic background and culture conditions on solid tumors. Cancer Immunol Immunother
production of herpesvirus-based gene therapy 66:683–695
vectors. Biotechnol Bioeng 77:685–692 36. Markert J, Medlock M, Rabkin S, Gillespie G,
28. Wechuck JB, Ozuer A, Goins WF, Wolfe D, Todo T, Hunter W, Palmer C, Feigenbaum F,
Oligino T, Glorioso JC, Ataai MM (2002) Tornatore C, Tufaro F, Martuza R (2000)
Effect of temperature, composition, and cell Conditionally replicating herpes simplex virus
passage on production of herpes-based viral mutant, G207 for the treatment of malignant
vectors. Biotechnol Bioeng 79:112–119 glioma: results of a phase I trial. Gene Ther
29. Tischer BK, von Einem J, Kaufer B, Osterrieder 7:867–874
N (2006) Two-step red-mediated recombina- 37. Rampling R, Cruickshank G, Papanastassiou V,
tion for versatile high-efficiency markerless Nicoll J, Hadley D, Brennan D, Petty R,
DNA manipulation in Escherichia coli. Bio- MacLean A, Harland J, McKie E, Mabbs R,
Techniques 40:191–197 Brown M (2000) Toxicity evaluation of
30. Gierasch WW, Zimmerman DL, Ward SL, Van- replication-competent herpes simplex virus
heyningen TK, Romine JD, Leib DA (2006) (ICP 34.5 null mutant 1716) in patients with
Construction and characterization of bacterial recurrent malignant glioma. Gene Ther
artificial chromosomes containing HSV-1 7:859–866
strains 17 and KOS. J Virol Methods 38. Mundle S, Hernandez H, Hamberger J,
135:197–206 Catalan J, Zhou C, Stegalkina S, Tiffany A,
31. Mazzacurati L, Marzulli M, Reinhart B, Kleanthous H, Delagrave S, Anderson S
Miyagawa Y, Uchida H, Goins WF, Li A, (2013) High-purity preparation of HSV-2 vac-
Kaur B, Caligiuri M, Cripe T, Chiocca N, cine candidate ACAM529 is immunogenic and
Amankulor N, Cohen JB, Glorioso JC, Grandi efficacious in vivo. PLoS One 8:e57224
Chapter 5
Preparation of Herpes Simplex Virus Type 1 (HSV-1)-Based

Amplicon Vectors
Cornel Fraefel and Alberto L. Epstein
Abstract
Amplicon vectors, or amplicons, are defective, helper-dependent, herpes simplex virus type 1 (HSV-1)-
based vectors. The main interest of amplicons as gene transfer tools stems from the fact that the genomes of
these vectors do not carry protein-encoding viral sequences. Consequently, they are completely safe for the
host and nontoxic for the infected cells. Moreover, the complete absence of virus genes provides a genomic
space authorizing a very large payload, enough to accommodate foreign DNA sequences up to almost
150-kbp, the size of the HSV-1 genome. This transgene capacity can be used to deliver complete gene loci,
including introns and exons, as well as long regulatory sequences conferring tissue-specific expression or
stable maintenance of the transgene in proliferating cells. For many years the development of these vectors
and their application in gene transfer experiments was hindered by the presence of contaminating toxic
helper virus particles in the vector stocks. In recent years, however, two different methodologies have been
developed that allow generating amplicon stocks either completely free of helper particles or only faintly
contaminated with fully defective helper particles. This chapter describes these two methodologies.
Key words HSV-1, Amplicon vectors, Gene transfer
1 Introduction
1.1 Amplicon As described in Chapter 1 of this book, herpes simplex virus type
Plasmids 1 (HSV-1) possesses a large, approximately 153-kbp, double-
and Amplicon Vectors stranded DNA genome. This implies that the virus particle is able
to accommodate and deliver large DNA fragments, either native
virus DNA or foreign DNA, to the nucleus of infected cells. How-
ever, among the different types of gene transfer vectors that can be
derived from HSV-1, only amplicons are able to fully exploit the
outstanding cargo capacity of the HSV-1 virion.
Amplicon vectors, or amplicons [1], are identical to wild type
HSV-1 particles from the structural, immunological and host-range
points of view, but which carry a concatemeric form of a DNA
plasmid, named the amplicon plasmid, instead of the viral genome.
An amplicon plasmid (Fig. 1a) is a standard E. coli plasmid carrying
91
92 Cornel Fraefel and Alberto L. Epstein
one origin of DNA replication (generally oriS) and one packaging

signal (pac) from HSV-1 [2, 3], in addition to the transgene
sequences of interest. The amplicon plasmid carries no genes
encoding virus trans-acting proteins. The most outstanding feature
of amplicons as gene transfer tools is that these vectors can exploit
the large empty space left available by the absence of virus genes to
accommodate and deliver up to 150-kbp of foreign DNA to the
nucleus of infected cells. In addition, as amplicons do not induce
synthesis of virus proteins, these vectors are nontoxic for the
infected cells and nonpathogenic for the inoculated organism.
Lastly, the absence of virus genes in the amplicon genome strongly
reduces the risk of reactivation, complementation, or recombina-
tion with latent or resident HSV-1 genomes.
Amplicons are versatile vector platforms for gene delivery. The
versatility of amplicons stems from the fact that during their pro-
duction the amplicon genome will replicate, like the HSV-1
genome, via a rolling circle-like mechanism, generating long con-
catemers composed of tandem repeats of the amplicon plasmid [4]
(Fig. 1b). Since HSV-1 particles will always package approximately
150-kbp of DNA, the size of the virus genome, the number of
repeats that a particular amplicon vector will carry and deliver,
depends on the size of the original amplicon plasmid [5]. Therefore,
an amplicon plasmid of around 5-kbp will be repeated some
30 times in the amplicon vector, while a very large amplicon plas-
mid, carrying a 150-kbp genomic locus, will generate amplicon
vectors carrying a single repeat of this sequence.
A B
Bacterial ori Amplicon
plasmid
pac
Reporter gene
MCS
Amplicon
plasmid
oriS
Antibiotic resistance gene
Fig. 1 Structure of the amplicon plasmid and amplicon vector. (a) An amplicon plasmid is a standard
Escherichia coli plasmid, containing one bacterial origin of replication (ori) and one gene conferring resistance
to an antibiotic (generally ampR), and carrying, in addition, one HSV-1 origin of DNA replication (oriS), one
HSV-1 packaging signal (pac), usually a reporter gene (represented as a green arrow) and a multiple cloning
site (MCS) for insertion of the transgene of interest. (b) An amplicon vector is an HSV-1 virus particle
containing a concatemer of the amplicon plasmid DNA of up to around 150-kbp as the genome
HSV-1-Based Amplicon Vectors 93
Since HSV-1-amplicon vectors carry no viral genes, they are

replication-defective and depend on helper functions for produc-
tion. The helper genome should provide all virus functions required
to replicate and package the amplicon genome (including replica-
tion, structural, and DNA packaging proteins), but should lack
packaging signals to avoid packaging of the helper genome itself.
It is critical that amplicon stocks used for gene transfer and gene
therapy do not contain contaminating helper virus particles in
order to avoid cytotoxicity and induction of immune responses.
For many years it was not possible to generate such helper virus-free
amplicon vector stocks, two different methodologies have been
developed over the past two decades that allow generating ampli-
con stocks, either completely free of helper particles or only faintly
contaminated with fully defective helper particles. One of these
methods is based on the cotransfection of the amplicon plasmid
and helper DNA genome, while the second method is based on the
transfection of the amplicon plasmid followed by super-infection of
the transfected cells with a defective HSV-1 helper virus (Fig. 2).
This chapter will describe in detail these two methods to produce
amplicon vector stocks.
1.2 Production Helper functions can be provided by replication-competent, but

of Amplicon Vectors by packaging-defective HSV-1 genomes cloned as a set of cosmids [6]
DNA Cotransfection or bacterial artificial chromosome (BAC) [7]. Following transfec-
Procedure tion into mammalian cells, sets of cosmids that overlap and repre-
sent the entire HSV-1 genome can form circular replication-
competent viral genomes via homologous recombination. These
reconstituted viral genomes give rise to infectious virus progeny.
Similarly, BACs that contain the entire HSV-1 genome also pro-
duce infectious virus progeny in transfected cells. If the viral DNA
packaging/cleavage (pac) signals are deleted from the HSV-1 cos-
mids or HSV-1 BACs, reconstituted virus genomes are packaging
defective; however, even in the absence of the pac signals, these
genomes can still provide all helper functions required for the
replication and packaging of cotransfected amplicon DNA. The
resulting amplicon vector stocks are essentially free of helper virus
contamination. To improve safety, in the latest version of this
strategy [7] the helper genome carried by the BAC lacks a gene
encoding one essential virus function (generally ICP27) and its
length is oversized, thus further avoiding packaging. Amplicon
plasmids are replicated and packaged in a cell line complementing
the lacking virus function, or cotransfected with a plasmid expres-
sing this function, as illustrated in Fig. 2a. For details on the
preparation of amplicon vectors following the BAC approach,
refer to Subheadings 2.1 and 3.1.
Fig. 2 Amplicon vector production. (a) DNA-based packaging system: Vero cells expressing the essential
HSV-1 protein ICP27 are cotransfected with the amplicon plasmid DNA, the fBACΔpac BAC DNA (which carries
a nonpackageable HSV-1 genome), and an ICP27-expressing plasmid. Helper virus-free amplicon vectors are
harvested from cells at 2 or 3 days posttransfection. (b) Helper virus-based packaging system: Vero cells
expressing the essential virus protein ICP4 are transfected with an amplicon plasmid and superinfected the
following day with the HSV-1-LaLΔJ helper virus (which lacks ICP4 and contains floxed pac signals). At 2 days
postinfection, the mixed population of virus particles (amplicon vector and helper virus) are harvested and
used to infect cells expressing both ICP4 and Cre recombinase. After 2 days, amplicon vectors are harvested.
These vector stocks are only faintly contaminated with defective virus particles
1.3 Production Alternatively, large amounts of amplicon vector stocks, only faintly
of Amplicon Vectors contaminated with defective helper virus, can be prepared using a
Using the Cre/loxP1 system based on the deletion of the pac signals from the helper virus
System genome by Cre/loxP1-based site-specific recombination [8]. This
helper virus, named HSV-1-LaLΔJ, carries a unique and ectopic
pac signal, flanked by two loxP1 sites in parallel orientation. This is
therefore a Cre-sensitive virus that cannot be packaged in

Cre-expressing cells due to deletion of the floxed packaging signals.
Nevertheless, some helper genomes can escape action of the
Cre-recombinase, allowing the production of some contaminating
helper virus particles. For this reason, the two genes surrounding
the cleavage/packaging signal, which respectively encode a viru-
lence factor known as ICP34.5 and the essential protein ICP4, were
also deleted from the HSV-1-LaLΔJ helper genome [8]. Although
the amplicon stocks prepared with this helper virus (in a comple-
menting cell line encoding both Cre and ICP4 proteins) still can
contain a small amount of contaminating helper virus particles,
these are replication incompetent and cannot spread upon infection
of target cells or tissues. The amplicon packaging process using
HSV-1-LaLΔJ as the helper virus includes two steps: a first one, in
ICP4-complementing cells, allows generating large amounts of
helper-contaminated amplicon vectors, while the second step, in
cells expressing both ICP4 and Cre-recombinase, allows eliminat-
ing by Cre-mediated deletion of the packaging signal, most of the
contaminating helper viruses (Fig. 2b). Use of the HSV-1-LaLΔJ
helper virus system generally results in the production of large
stocks of amplicon vectors with a very small contamination
(0.05–0.5%) of defective, nonpathogenic helper virus particles.
For details on the preparation of amplicon vectors following this
strategy, refer to Subheadings 2.2 and 3.2.
2 Materials
2.1 Packaging 1. E. coli clones of HSV-1 BAC fHSVΔpacΔ27ΔKn and plasmid

of HSV-1 Amplicon pEBHICP27 [7].
Vectors Using 2. LB medium containing 12.5 μg/ml of chloramphenicol.
a Defective HSV-1-
3. Plasmid Maxi Kit (Qiagen), which includes Qiagen-tip 500 col-
BAC DNA umns and buffers P1, P2, P3, QBT, QC, QGT, and QF.
2.1.1 Preparation 4. TE buffer pH 7.4.
of HSV-1 BAC DNA
5. Restriction endonucleases HindIII and KpnI.
6. TAE electrophoresis buffer (10): 24.2 g Tris base, 5.71 ml
glacial acetic acid, 3.72 g Na2EDTA·2H2O, H2O to 1 l. Store
7. Graduated snap-cap tubes 17 100 mm (e.g., Falcon 2059),
sterile.
8. Sorvall GSA and SS-34 rotors.
9. 120 mm diameter folded filters.
10. Ultra Clear Centrifuge tubes 13 51 mm (Beckman, Munich,

Germany).
11. TV 865-ultracentrifuge rotor (Sorvall).
12. 1 ml disposable syringes.
13. 21- and 36-gauge hypodermic needles.
14. UV-lamp (366 nm).
15. Dialysis cassettes, Slide-A-Lyzer 10K (10,000 MWCO).
16. UV spectrophotometer.
2.1.2 Preparation 1. Vero 2-2 cells [9].

of HSV-1 Amplicon Vector 2. Amplicon plasmid (see Note 1).
Stocks
3. Dulbecco’s modified Eagle medium (DMEM) with 10% or 6%
fetal bovine serum (FBS).
4. Geneticin (G418): 1 mg/ml G418 in DMEM with 10% FBS.
5. 0.25% trypsin–0.02% EDTA.
6. Opti-MEM I reduced-serum medium.
7. HSV-1 BAC fHSVΔpacΔ27ΔKn and pEBHICP27 plasmid
DNA (C. Fraefel, University of Zurich, Zurich, Switzerland:
cornel.fraefel@uzh.ch) [7].
8. HSV-1 amplicon DNA (Maxiprep DNA isolated from E. coli).
9. LipofectAMINE reagent.
10. Plus Reagent.
11. 10%, 30%, and 60% (w/v) sucrose in PBS.
12. Phosphate buffered saline (PBS).
13. 75 cm2 tissue culture flasks.
14. 60 mm diameter tissue culture dishes.
15. Probe sonicator.
16. 0.45 μm syringe-tip filters (Sarstedt polyethersulfone mem-
brane filters).
17. 20 ml disposable syringes.
18. 30 ml centrifuge tubes (Beckman Ultra-Clear 25 89 mm and
14 95 mm).
19. Sorvall SS-34 rotor.
20. Fiber-optic illuminator.
21. Ultracentrifuge (Sorvall) with Beckman SW28 and SW40
rotors.
22. Hemocytometer.
2.1.3 Harvesting, 1. Vero cells (clone 76; ECACC #85020205); BHK cells (clone
Purification, and Titration 21; ECACC #85011433); 293 cells (ATCC #1573).
of HSV-1 Amplicon Vectors 2. DMEM supplemented with 10% or 2% FBS.
3. 4% (w/v) paraformaldehyde solution.
4. X-gal staining solution: 20 mM K3Fe(CN)6, 20 mM K4Fe
(CN)6·3H2O, 2 mM MgCl2 in PBS pH 7.5. Filter-sterilize
and store up to 1 year at 4 C. Before use, equilibrate solution
to 37 C and add 20 μl/ml of 50 mg/ml 5-bromo-4-chloro-3-
indolyl-β-D-galactopyranoside (X-gal) in DMSO. Store X-gal
solution in 1 ml aliquots up to several years at 20 C in
the dark.
5. GST solution: 2% (v/v) goat serum and 0.2% (v/v) Triton
X-100 in PBS. Store up to 1 month at 4 C.
6. Primary and secondary antibodies specific for detection of the
transgene product.
7. 24 well tissue culture plates.
8. Inverted fluorescence microscope.
9. Inverted light microscope.
2.2 Packaging 1. Vero cells (African green monkey cells, ATCC).

of Amplicon Vectors 2. Vero-7b cells [10] or any other cell line expressing the essential
Using a Cre/loxP1 HSV-1 protein ICP4.
Sensitive Helper Virus
3. Gli36 cell line [11].
2.2.1 Preparation 4. TE-Cre-Grina cells [8], Vero-Cre4 cells [12], or any other cell
of the Defective Helper line expressing both ICP4 and Cre recombinase.
Virus
5. Six well tissue culture plates.
6. Growth medium: DMEM supplemented with 10% fetal bovine
serum, 100 units/ml penicillin, and 100 μg/ml streptomycin.
All cell lines are maintained at 37 C in humidified incubators
containing 5% CO2.
7. Maintenance medium: medium 199 supplemented with
1% FBS.
9. Geneticin (G418): 1 mg/ml G418 in growth medium.
10. Opti-MEM I.
11. LipofectAMINE Plus reagent.
12. Polystyrene roller bottles.
3 Methods
3.1 Packaging 1. Prepare a 17 100 mm sterile snap-cap tube containing 5 ml

of HSV-1 Amplicon LB/chloramphenicol medium. Inoculate with frozen long-
Vectors Using term culture of the HSV-1 BAC clone (fHSVΔpacΔ27ΔKn).
a Defective BAC Incubate for 8 h at 37 C in a shaker.
3.1.1 Preparation
2. Transfer 1 ml of the culture into each of four 2-l flasks contain-
of HSV-1 BAC DNA
ing 1 l sterile LB/chloramphenicol medium, and incubate for
16 h at 37 C, with shaking.
3. Distribute the 4 l overnight culture into six 250 ml polypropyl-
ene centrifuge tubes and pellet by centrifugation for 10 min at
4000 g and 4 C. Decant medium, fill polypropylene centri-
fuge tubes again with bacterial culture, and repeat
centrifugation.
4. After the last centrifugation, invert each tube on a paper towel
for 2 min to drain all liquid. Resuspend each of the pellets in
5 ml of buffer P1 and combine the six aliquots. Add 130 ml of
buffer P1 and distribute to four fresh 250-ml polypropylene
centrifuge tubes (40 ml per tube).
5. Add 40 ml of buffer 2 to each centrifuge tube, mix by inverting
the tubes four to six times, and incubate for 5 min at room
temperature.
6. Add 40 ml of buffer P3 and mix immediately by inverting the
tubes six times. Incubate the tubes for 20 min on ice. Invert the
tube once more and centrifuge for 30 min at 16,000 g and
4 C.
7. Filter the supernatants through a folded filter (120 mm diame-
ter) into four fresh 250 ml polypropylene centrifuge tubes.
8. Precipitate the DNA with 0.7 volumes (84 ml per tube) of
isopropanol, mix gently, and centrifuge immediately for 30 min
at 17,000 g and 4 C.
9. Remove the supernatants and mark the locations of the pellet.
Wash the DNA pellet by adding 20 ml cold 70% ethanol to each
and centrifuge for 30 min at 16,000 g and 4 C.
10. Carefully remove the supernatants and resuspend each of the
four pellets in 2 ml TE buffer, pH 7.4. Pool the four solutions
(total volume 8 ml) and add 52 ml QGT buffer (final volume
60 ml).
11. Equilibrate two Qiagen-tip 500 columns with 10 ml of buffer
QBT and allow the columns to empty by gravity flow.
12. Transfer the solution through a folded filter (120 mm diame-
ter) into Qiagen-tip 500 columns (30 ml per column) and
allow the liquid to enter the resin by gravity flow.
13. Wash each column twice with 30 ml of buffer QC, and then
elute DNA from each column with 15 ml of prewarmed
(65 C) buffer QF into a 30-ml centrifuge tube.
14. Precipitate the DNA with 0.7 volumes (10.5 ml) of isopropa-
nol, mix, and immediately centrifuge for 30 min at 20,000 g,
4 C.
15. Carefully remove the supernatants from step 14 and mark the
locations of the pellets on the outside of the tubes. Wash the
pellets with chilled 70% ethanol and, if necessary, repellet at the
same settings as in step 14.
16. Aspirate the supernatants completely. Resuspend each pellet in
3 ml TE buffer (pH 7.4) for several hours at 37 C.
17. Prepare two Beckman Ultra Clear Centrifuge tubes
(13 51 mm) with 3 g CsCl and add the DNA solution
from step 16 (3 ml per tube). Mix the solution gently until
salt is dissolved. Add 300-μl ethidium bromide (10 mg/ml in
H2O) to the DNA/CsCl solution. Then overlay the solution
with 300 μl paraffin oil and seal the tubes.
18. Centrifuge for 17 h at 218,500 g, 20 C.
19. Two bands of DNA, located in the center of the gradient,
should be visible in normal light. The upper band consists of
linear and nicked circular HSV-1 BAC DNA. The lower band
consists of closed circular HSV-1 BAC DNA.
20. Harvest the lower band using a disposable 1 ml syringe fitted
with a 21-gauge hypodermic needle under UV light and trans-
fer it into a microfuge tube.
21. Remove ethidium bromide from the DNA solution by adding
an equal volume of n-butanol in TE/CsCl (3 g CsCl dissolved
in 3 ml TE, pH 7.4).
22. Mix the two phases by vortexing and centrifuge at 210 g for
3 min at room temperature in a bench centrifuge.
23. Carefully transfer the lower, aqueous phase to a fresh micro-
fuge tube. Repeat steps 21–23 four to six times until the pink
color disappears from both the aqueous phase and the organic
phase.
24. Add an equal volume of isopropanol, mix and centrifuge at
210 g for 3 min at room temperature. Transfer the aqueous
phase to a fresh microfuge tube.
25. To remove the CsCl from the DNA solution, dialyze for 6 h
against TE, pH 7.4 at 4 C. Then, change the TE buffer and
dialyze overnight. For dialysis, the DNA solution is injected
into a dialysis cassette, Slide-A-Lyzer 10K using a 1 ml dispos-
able syringe fitted with a 36-gauge hypodermic needle. After
dialysis, the solution is recovered from the dialysis cassette by
using a fresh 1 ml disposable syringe fitted with a 36-gauge

hypodermic needle. The DNA solution is then transferred to a
clean microfuge tube and stored at 4 C. After characterization
of the DNA (concentration and restriction enzyme analysis),
store DNA at 4 C.
26. Determine the absorbance of the DNA solution from step 25
at 260 nm (A260) and 280 nm (A280) using an UV spectro-
photometer. From 4 L of bacterial culture, HSV-BAC DNA
yields are typically in the range of 200–300 μg.
27. Verify the HSV-1 BAC DNA by restriction endonuclease anal-
ysis (e.g. HindIII, KpnI). Separate the fragments overnight by
electrophoresis on a 0.4% agarose gel at 40 V in 1 TAE
electrophoresis buffer, using high-molecular-weight DNA
and 1-kb DNA ladder as size standards (see Note 2). Stain
with ethidium bromide (1 mg/ml in H2O) and compare
restriction fragment patterns with the published HSV-1
sequence [13].
3.1.2 Preparation 1. Prepare a 17 100-mm sterile snap-cap tube containing 5 ml

of Amplicon Plasmid DNA LB/chloramphenicol medium. Inoculate with frozen long-
term culture of the E. coli harboring the plasmid. Incubate for
8 h at 37 C in a shaker.
2. Transfer 1 ml of the culture into a 1 l flask containing 200 ml of
sterile LB medium supplemented with the appropriate antibi-
otic, and incubate for 16 h at 37 C, with shaking.
3. Transfer the overnight culture into a 250 ml polypropylene
centrifuge tube and pellet by centrifugation for 10 min at
4000 g and 4 C. Decant medium and invert the tube on a
paper towel for 2 min to drain all liquid. Resuspend the pellet
in 10 ml of buffer P1.
4. Add 10 ml of buffer 2, mix by inverting the tube four to six
times, and incubate for 5 min at room temperature.
5. Add 10 ml of chilled buffer P3 and mix immediately by invert-
ing the tube six times. Incubate the tube for 20 min on ice.
Invert the tube once more and centrifuge for 30 min at
16,000 g and 4 C.
6. Filter the supernatants through a folded filter (120 mm diame-
ter) into a 30 ml centrifuge tube.
7. Equilibrate a Qiagen-tip 500 column with 10 ml of buffer QBT
and allow the column to empty by gravity flow.
8. Transfer the solution from step 6 into the Qiagen-tip 500 col-
umn and allow the liquid to enter the resin by gravity flow.
9. Wash the column twice with 30 ml of buffer QC, and then
elute DNA from the column with 15 ml of prewarmed (65 C)
buffer QF into a 30 ml centrifuge tube.
nol, mix, and immediately centrifuge for 30 min at 20,000 g
and 4 C.
11. Carefully remove the supernatant from step 10 and mark the
location of the pellet on the outside of the tube. Wash the pellet
with chilled 70% ethanol and, if necessary, repellet at the same
settings as in step 10.
12. Aspirate the supernatant completely. Resuspend the pellet in
200 μl of TE buffer (pH 7.4), and determine the DNA con-
centration using a UV spectrophotometer.
3.1.3 Transfect Vero 2-2 1. Maintain Vero 2-2 cells in DMEM–10% FBS containing 1 mg/
Cells and Harvest, ml G418. Propagate the culture twice a week by splitting 1/5
and Purify Packaged in fresh medium (20 ml) into a new 75 cm2 tissue culture flask
Amplicon Vectors (see Note 3).
2. On the day before transfection, remove culture medium, wash
cells twice with PBS, add a thin layer of trypsin–EDTA, and
incubate for 10 min at 37 C to allow cells to detach from plate.
Count cells using a hemocytometer and plate 1.2 106 cells
per 60 mm diameter tissue culture dish in 3 ml
DMEM–10% FBS.
3. For each 60 mm dish, place 250 μl Opti-MEM I reduced-
serum medium into each of two 15 ml conical tubes. To one
tube, add 0.6 μg amplicon DNA, 2 μg of the HSV-1 BAC
DNA, and 0.2 μg pEBHICP27 DNA. Mix the tube and slowly
add 10 μl PLUS reagent. Incubate the tube for 5 min at room
temperature, mix and incubate for another 5 min. To the other
tube, add 15 μl Lipofectamine.
4. Combine the contents of the two tubes, mix well, and incubate
for 45 min at room temperature.
5. Wash the cultures prepared the day before (step 2) once with
2 ml of Opti-MEM I. Add 1.1 ml Opti-MEM I to the tube
from step 4. containing the DNA–Lipofectamine transfection
mixture (1.3 ml total volume). Aspirate medium from the
culture, add the transfection mixture, and incubate for 5.5 h.
6. Aspirate the transfection mixture and wash the cells three times
with 2 ml Opti-MEM I. After aspirating the last wash, add
3.5 ml DMEM–6% FBS and incubate 2–3 days.
7. Scrape cells into the medium using a rubber policeman. Trans-
fer the suspension to a 15-ml conical centrifuge tube and place
the tube containing the cells into a beaker of ice water. Sub-
merge the tip of the sonicator probe ~0.5 cm into the cell
suspension and sonicate for 20 s with 20% output energy.
This disrupts cell membranes and liberates cell-associated vec-
tor particles.
8. Remove cell debris by centrifugation for 10 min at 1400 g and

4 C, and filter the supernatant through a 0.45 μm syringe-tip
filter attached to a 20 ml disposable syringe into a new 15-ml
conical tube. Remove a sample for titration, then divide the
remaining stock into 1 ml aliquots, freeze them in a dry
ice/ethanol bath, and store at 80 C. Alternatively, concen-
trate (steps 9a and 10a) or purify and concentrate (steps 9b
and 10b) the stock before storage.
9a. Transfer the vector solution from step 8 to a 30 ml centrifuge
tube and spin for 2 h at 20,000 g and 4 C.
10a. Resuspend the pellet in a small volume (e.g., 300 μl) of 10%
sucrose. Remove a sample of the stock for titration, then
divide into aliquots (e.g., 30 μl) and freeze in a dry ice–etha-
nol bath. Store at 80 C.
9b. Prepare a sucrose gradient in a Beckman Ultra-Clear 25 89-
mm centrifuge tube by adding the following solutions into
the tube: 7 ml of 60% sucrose; 7 ml of 30% sucrose; 3 ml of
10% sucrose. Carefully add the vector stock from step 8 (up to
20 ml) on top of the gradient and centrifuge for 2 h at
100,000 g and 4 C, using a Beckman SW28 rotor.
10b. The interface between the 30% and 60% sucrose layers appears
as a cloudy band when viewed with a fiber-optic illuminator.
Aspirate the 10% and 30% sucrose layers from the top and
collect the virus band at the interface between the 30% and
60% layers. Transfer to a Beckman Ultra-Clear 14 95 mm
centrifuge tube, add ~15 ml PBS, and pellet virus particles for
1 h at 100,000 g and 4 C, using a Beckman SW40 rotor.
Resuspend the pellet in a small volume (e.g., 300 μl) of 10%
sucrose. Divide into aliquots (e.g., 30 μl) and freeze in a dry
ice–ethanol bath. Store at 80 C. Before freezing, retain a
sample of the stock for titration.
3.1.4 Titration of HSV-1 1. Plate cells (e.g., Vero 7b, BHK 21, or 293 cells) at a density of
Amplicon Vector Stocks 1.0 105 cells per well of a 24-well tissue culture plate in
0.5 ml DMEM–10% FBS. Incubate overnight at 37 C and 5%
CO2.
2. Aspirate the medium and wash each well once with PBS.
Remove PBS and add 0.1, 1, or 5 μl samples collected from
vector stocks to 250 μl of DMEM–2% FBS in microfuge
tubes.
3. Incubate for 1–2 days. Remove the inoculum and fix cells for
20 min at room temperature with 250 μl of 4% paraformalde-
hyde, pH 7.0. Wash the fixed cells three times with PBS, then
proceed (depending on the transgene) with a detection pro-
tocol such as green fluorescence (step 4), X-gal staining (steps
5 and 6), or immunocytochemical staining (steps 7–9).
4. Detect cells expressing the gene for EGFP: Examine the culture
from step 3 (before or after fixation) using an inverted fluores-
cence microscope. Count green fluorescent cells and determine
the vector titer in transducing units (TU)/ml by multiplying
the number of transgene-positive cells by the dilution factor
(see Note 4).
5. Detect cells expressing the E. coli lacZ gene: Add 250 μl X-gal
staining solution per well of the 24 well tissue culture plate
from step 3, and incubate for 4–12 h (depending on the cell
type and the promoter regulating expression of the transgene)
at 37 C and 5% CO2.
6. Stop the staining reaction by washing the cells three times with
PBS. Count blue cells using an inverted light microscope and
determine the vector titer in TU/ml by multiplying the num-
ber of transgene-positive cells by the dilution factor.
7. Detect transgene-expressing cells by immunocytochemical
staining: Add 250 μl GST solution per well of the 24 well tissue
culture plate from step 3 (to block nonspecific binding sites
and to permeabilize cell membranes) and let stand for 30 min at
room temperature. Replace the blocking solution with the
primary antibody (diluted in GST) and incubate overnight at
4 C.
8. Wash the cells three times with PBS, leaving the solution in the
well for 10 min each time. Add secondary antibody (diluted in
GST) and incubate for at least 4 h at room temperature.
9. Wash the cells twice with PBS and develop according to the
appropriate visualization protocol. Count transgene-positive
cells using an inverted light microscope and determine the
vector titer as TU/ml by multiplying the number of the
transgene-positive cells by the dilution factor.
3.2 Packaging HSV-1-LaLΔJ [8] is a defective recombinant virus. Therefore, to

of Amplicon Vectors prepare helper virus, follow the instructions described in Chapter 3
Using a Cre/loxP1 of this book. The only difference is that, since HSV-1-LaLΔJ lacks
Sensitive Helper Virus the gene encoding ICP4, it should be grown in ICP4-expressing
cells, such as the 7b Vero-derived cell line [10]. These cells grow in
DMEM supplemented with 10% FBS, L-glutamine, penicillin, and
streptomycin. G418 (1 mg/ml) should be added every four pas-
sages, to avoid losing the complementing ICP4 gene. To purify and
titrate the helper virus stock, follow the instructions described in
Chapter 3 of this book. The virus should be titrated simultaneously
in complementing cells, such as Vero-7b, and in noncomplement-
ing Vero cells, to allow detection of unwanted replication-
competent mutant viruses that can sometimes be generated by
recombination between the virus genome and the ICP4 gene
located in the cellular genome. If there are revertant viruses, they
will produce lysis plaques in Vero cells. If this is the case, start the
production again, infecting the complementing cells at a very low
MOI (lower than 0.05 PFU/cell), using plaque-purified defective
virus.
The production of amplicon vector stocks using HSV-1-LaLΔJ
as the helper virus is a two-step protocol, as illustrated in Fig. 2b. In
the first step, stocks of amplicons contaminated with large amounts
of helper virus particles are produced in ICP4-complementing
cells, such as Vero-7b cells. In the second step, stocks of vectors,
only faintly contaminated with replication-defective helper viruses,
are prepared in cells expressing both ICP4 and Cre-recombinase,
such as TE-Cre-Grina cells or Vero-Cre4 cells.
3.2.1 Generation of P0 1. The day before transfection, plate 5 106 Vero-7b cells in
Stock growth medium into a 75 cm2 tissue culture flask. Incubate the
cells over night at 37 C and 5% CO2.
2. The following day, mix 6 μg of amplicon plasmid DNA, 750 μl
of Opti-MEM, and 30 μl of Plus reagent per 75 cm2 cell culture
flask in a 15 ml conical tube. Incubate for 15 min at room
temperature, and then add a solution consisting of 45 μl of
LipofectAmine and 750 μl of Opti-MEM. After 15 min incu-
bation at room temperature, add the transfection mix to the
cells in 10 ml Opti-MEM medium and incubate at 37 C and
5% CO2.
3. After 3 h, add 10 ml Opti-MEM medium to the cells and
incubate the cultures overnight.
4. The following day, aspirate the medium from the flask, rinse the
cells once with maintenance medium and add 3 ml of mainte-
nance medium containing the helper virus diluted to a MOI of
0.3 PFU/cell (see Note 5).
5. Place the flask on a shaker for 1 h 30 min, if possible under 5%
CO2 atmosphere.
6. Discard medium, rinse twice with maintenance medium, and
then add 20 ml of maintenance medium.
7. Incubate cells for 48 h at 37 C and 5% CO2.
8. At 48 h postinfection when most of the cells show cytopathic
effects typical for HSV-1 infection, scrape the cells into the
medium and transfer the suspension into 50 ml Falcon tubes.
9. Spin down at 771 g for 10 min at 4 C.
10. Transfer the supernatant to a 35 ml oak ridge tube.
11. Resuspend the cell pellet in 1 ml of PBS and disrupt the cells
either by three cycles of freezing-thawing or by using a water
sonicator (three times 30 s in cold water). Then, spin down at
771 g for 10 min at 4 C.
Table 1
Titers, ratios, and amounts of amplicon vectors and helper particles (see Note 11)
P0 (HC)a P1 (HC) P2 (HC) P3 (HF)b

Titer amplicon (TU/ml) 107 108 109 108
Titer helper (PFU/ml) 3 107 5 107 108 5 105
Ratio A/H 1:3 2:1 10:1 200:1
Amount (ml) 0.5 1 5–10 5–10
a
HC helper-contaminated stocks
b
HF helper-free stocks. Note that “helper-free” stocks obtained using this strategy can be contaminated to a very low
extent with replication-defective helper viruses
12. Discard the pellet containing cell debris and store the superna-
tant containing the virus/vector particles on ice.
13. Centrifuge the supernatant from step 10 for 1 h 30 min at
18,000 g and 4 C. Discard the supernatant, resuspend the
pellet containing virus/vector particles in 1 ml of PBS, and
combine with the virus/vector particles collected in step 12.
Store this final P0 stock at 80 C until titration.
3.2.2 Titration 1. One day prior to titration of the P0 stock, prepare six well tissue
of Amplicon Vectors culture plates with 1 106 Gli36 cells, Vero-7b cells, or Vero
and Helper Virus in P0 cells per well in growth medium.
Stocks 2. Prepare a series of tenfold dilutions (10 2 to 10 8) of the P0
stock in Eppendorf tubes in 1 ml of growth medium without
serum.
3. Infect cells as described in Subheading 3.1.4, step 2.
4. To determine the titer of vector particles proceed with one of
the protocols described in Subheading 3.1.4, steps 3–9.
5. To determine the titer of the helper virus, fix the cells 3 days
after infection, count the numbers of plaques per well in the
Vero 7b monolayer, determine the average number of plaques
for each dilution (at least in in duplicate), and multiply by the
dilution factor to calculate the number of PFU/ml.
6. To determine if the virus/vector stock contains replication-
competent revertant virus, proceed exactly as in step 5 but
using non-trans-complementing Vero cells.
7. Table 1 gives an estimate of the titers that can usually be
expected. At this step the ratio of amplicon to helper particles
usually is about 0.3–0.5 (see Note 6).
3.2.3 Amplification 1. The day before infection, plate 1.3 107 Vero-7b cells in
from P0 to P1 and Titration growth medium per 175 cm2 tissue culture flask.
of P1 Stocks
2. The following day, aspirate the medium and add 5 ml of

maintenance medium containing the P0 stock diluted to a
MOI of 0.3 PFU (of helper virus)/cell.
CO2 atmosphere.
4. Discard medium, rinse cells twice with maintenance medium,
and add 30 ml of maintenance medium.
5. Then proceed as in Subheading 3.2.1, steps 8–13, and Sub-
heading 3.2.2, to respectively generate and titrate the P1 vector
stock (Table 1) (see Note 7).
3.2.4 Amplification Further amplification of the vector stock can be performed in

from P1 to P2 and Titration 175 cm2 tissue culture flasks as described in Subheading 3.2.3 or
of P2 Stocks in roller bottles as follows:
1. Seed 2 107 Vero-7b cells/roller bottle in 100 ml of growth
medium. Since cells in roller bottles are not incubated in a CO2
atmosphere, CO2 should be added to the growth medium
using a pipette connected to a CO2 gas bottle, until CO2
bubbles appear in the roller bottle.
2. Turn the roller bottles at a speed of 0.4 rounds per minute.
Cells generally become confluent (108 cells/bottle) in 4–5 days
of incubation at 37 C.
3. When cells are confluent, aspirate the medium and add 20 ml of
maintenance medium containing the P1 stock diluted to a
MOI of 0.3 PFU (of helper virus)/cell.
4. After 2 h, add maintenance medium to a final volume of 100 ml
per roller bottle and incubate for 48 h at 37 C, constantly
turning the bottles at a speed of 0.4 rounds per minute.
5. When cytopathic effects are apparent, which generally occurs at
48 h postinfection, collect and titrate the P2 stock as described
in Subheading 3.2.3 for the P1 stock, but scale up the number
of tubes (Table 1) (see Note 8).
3.2.5 Production 1. Plate 1.3 107 TE-Cre-Grina or Vero-Cre4 cells per 175 cm2
and Titration of P3 tissue culture flask in growth medium.
Amplicon Vector Stocks 2. The following day, infect cells with the P2 vector stock at an
MOI of 3 TU (of amplicon particles)/cell. At this dilution of
the amplicon vector, the concentration of the helper virus in
the stock should be approximately 0.5 PFU/cell. If the con-
centration of helper virus in the stock is too low, add more
helper virus (see Note 9).
CO2 atmosphere.
4. Discard medium, rinse cells twice with maintenance medium,

and add 30 ml of maintenance medium per flask. Incubate cells
for 48 h at 37 C and 5% CO2.
5. Collect and titrate the “helper-free” P3 vector stock as
described in Subheading 3.2.3 (Table 1).
6. Amplicon vector stocks can be purified and concentrated for
in vivo applications as described for wild-type HSV-1 and
recombinant viruses in Chapter 3 of this book (see Note 10).
4 Notes
1. An HSV-1 amplicon plasmid is a standard bacterial plasmid

containing one origin of DNA replication (ori) and one cleav-
age/packaging signal (“a” or pac) from HSV-1. It usually
carries also a reporter gene expressing GFP, LacZ, or luciferase,
which allows to easily titrate the vector stock and to identify the
infected cells. In addition, it contains a multiple cloning site
where the desired transgene sequences can be inserted. It is
propagated like any standard bacterial plasmid in E. coli
(Fig. 1).
2. Treat gel with care; 0.4% gels are very delicate.
3. Cells are incubated in a humidified 37 C, 5% CO2 incubator
throughout the protocol. All solutions and equipment coming
into contact with cells must be sterile.
4. The titers expressed as transducing units per milliliter (TU/ml)
are relative. Factors influencing relative transduction efficien-
cies include the cells used for titration, the promoter regulating
the expression of the transgene, the transgene, and the sensi-
tivity of the detection method. The vector titers realized with
amplicons that contain the standard ~1-kbp ori should be in
the range of 106–107 TU/ml before concentration. The recov-
ery of transducing units after concentration/purification is
around ~50%. While the number of physical particles is an
intrinsic property of the virus stock, independent of the cell
types to be infected, the number of infectious particles, hence
the titer of a virus or of a vector stock, strongly depends on the
susceptibility of the cells. In the case of helper virus-free ampli-
con vectors, some cell types, such as Gli36 cells (a human
glioblastoma cell line), give very high vector titers, while
Vero-derived cell lines give much lower vector titers. In con-
trast, Vero or Vero-derived cells give very good titers of the
helper virus.
5. Before infecting the transfected cells, confirm that transfection
was efficient, resulting in at least 30% of cells expressing the
reporter transgene (e.g., GFP). If this is not the case, it is better
to start again using fresh cells and optimize the transfection

procedure.
6. In a typical P0 situation we obtain an amplicon to helper ratio
of about 1:3. We usually do not observe replication-competent
viruses in Vero cells.
7. At this step the ratio of amplicon to helper particles generally
inverts in favor of amplicon particles (from 2:1 to 5:1). The
titers of the P1 stocks are generally one order of magnitude
higher than in P0.
8. At this step, the ratio of amplicon to helper particles further
increases in favor of amplicon particles (from 5:1 to 10:1), and
the titers of the stock can be substantially increased, depending
on the number of tissue culture flasks infected.
9. The critical point here is that each cell should receive at least
one amplicon particle. The infected cells will become round
but without displaying other cytopathic effects, as the helper
particles cannot spread in these cells.
10. We usually observe less than 1% contamination of the vector
stock with defective helper viruses (ratio of amplicon to helper
virus ranges from 100:1 and 500:1). However, the titer of the
amplicon vectors is generally one order of magnitude lower
than that of the P2 stock used to infect TE-Cre-Grina or Vero-
Cre4 cells.
11. Table 1 presents results obtained in a typical vector prepara-
tion. Values can be somewhat different depending on the
nature and size of the amplicon plasmid, on the passage num-
ber of cell lines, and on the efficiency of transfection in P0.
References
1. Spaete RR, Frenkel N (1982) The herpes sim- eukaryotic DNA sequences. J Virol
plex virus amplicon: a new eukaryotic 51:595–603
defective-virus cloning-amplifying vector. Cell 6. Fraefel C, Song S, Lim F, Lang P, Yu L,
30:295–304 Wang Y, Wild P, Geller AI (1996) Helper
2. Vlazny DA, Frenkel N (1981) Replication of virus-free transfer of herpes simplex virus type
herpes simplex virus DNA: localization of rep- 1 plasmid vectors into neural cells. J Virol
lication recognition signals within defective 70:7190–7197
virus genomes. Proc Natl Acad Sci U S A 7. Saeki Y, Fraefel C, Ichikawa T, Breakefield XO,
78:742–746 Chiocca EA (2001) Improved helper virus-free
3. Spaete RR, Frenkel N (1985) The herpes sim- packaging system for HSV amplicon vectors
plex virus amplicon: analyses of cis-acting rep- using an ICP27-deleted, oversized HSV-1
lication functions. Proc Natl Acad Sci U S A DNA in a bacterial artificial chromosome.
82:694–698 Mol Ther 3:591–601
4. Boehmer PE, Lehman IR (1997) Herpes sim- 8. Zaupa C, Revol-Guyot V, Epstein AL (2003)
plex virus DNA replication. Annu Rev Bio- Improved packaging system for generation of
chem 66:347–384 high levels non-cytotoxic HSV-1 amplicon vec-
5. Kwong AD, Frenkel N (1984) Herpes simplex tors using Cre-loxP1 site-specific recombina-
virus amplicon: effect of size on replication of tion to delete the packaging signals of
constructed defective genomes containing
defective helper genomes. Hum Gene Ther filament protein genes in human oligodendro-
14:1049–1063 glioma cell lines. J Neuropathol Exp Neurol
9. Smith IL, Hardwicke MA, Sandri-Goldin RM 54:23–31
(1992) Evidence that the herpes simplex virus 12. Melendez ME, Aguirre AI, Baez MV, Bueno
immediate early protein ICP27 acts post- CA, Salvetti A, Jerusalinsky DA, Epstein AL
transcriptionally during infection to regulate (2013) Improvements in HSV-1-derived
gene expression. Virology 186:74–86 amplicon vectors for gene transfer, Chapter 1.
10. Krisky DM, Wolfe D, Goins WF, Marconi PC, In: Borrelli J, Giannini Y (eds) Advances in
Ramakrishnan R, Mata M, Rouse RJ, Fink DJ, virus genomes research. Nova Science Publish-
Glorioso JC (1998) Deletion of multiple ers, Hauppauge, NY, pp 1–49
immediate-early genes from herpes simplex 13. McGeoch DJ, Dalrymple MA, Davison AJ,
virus reduces cytotoxicity and permits long- Dolan A, Frame MC, McNab D, Perry LJ,
term gene expression in neurons. Gene Ther Scott JE, Taylor P (1988) The complete DNA
5:1593–1603 sequence of the long unique region in the
11. Kashima T, Vinters HV, Campagnoni AT genome of herpes simplex virus type 1. J Gen
(1995) Unexpected expression of intermediate Virol 69:1531–15374
Chapter 6
HSV-1 Amplicon Vectors as Genetic Vaccines

Anita F. Meier and Andrea S. Laimbacher
Abstract
HSV-1 amplicon vectors have been used as platforms for the generation of genetic vaccines against both
DNA and RNA viruses. Mice vaccinated with such vectors encoding structural proteins from both foot-
and-mouth disease virus and rotavirus were partially protected from challenge with wild-type virus
(D’Antuono et al., Vaccine 28:7363–7372, 2010; Laimbacher et al., Mol Ther 20:1810–1820, 2012;
Meier et al., Int J Mol Sci 18:431, 2017), indicating that HSV-1 amplicon vectors are attractive tools for the
development of complex and safe genetic vaccines.
This chapter describes the preparation and testing of HSV-1 amplicon vectors that encode individual or
multiple viral structural proteins from a polycistronic transgene cassette. We further put particular emphasis
on generating virus-like particles (VLPs) in vector-infected cells. Expression of viral genes is confirmed by
Western blot and immune fluorescence analysis and generation of VLPs in vector-infected cells is demon-
strated by electron microscopy. Furthermore, examples on how to analyze the immune response in a mouse
model and possible challenge experiments are described.
Key words Helper virus-free HSV-1 amplicon vector, Polycistronic transgene cassette, Virus-like
particles, VLPs, Genetic vaccine
1 Introduction
Herpes simplex virus type 1 (HSV-1) amplicon vectors are versatile

gene transfer vehicles due to the very large transgene capacity, the
broad-range cell tropism, low immunogenicity and toxicity, and
ease of manipulation. The basic design of HSV-1 amplicon vectors
has remained unchanged over the past 30 years but development of
new amplicon vector systems, for example, by incorporating
genetic elements from other viruses or from nonviral systems,
have been reported. Amplicon vectors have shown promising
results in many preclinical gene- and cancer therapy applications,
as well as in vaccination studies [1, 2]. HSV-1 amplicons have also
been used for the synthesis of proteins from other viruses, for
example, amplicon vector mediated synthesis of the full set of
structural proteins allowed the assembly of retrovirus-like particles
(VLPs) [3, 4], foot-and-mouth disease virus [5] rotavirus [6, 7],
111
112 Anita F. Meier and Andrea S. Laimbacher
and West Nile virus [8]. In particular, the possibility of inducing

local assembly of inert VLPs in the context of a quasi-infectious
process holds great promise as vaccine formulation.
The large transgene capacity of HSV-1 amplicon vectors of up
to 150 kb allows the incorporation of several genes of interest and
the encapsidation of several copies of the transgene cassette,
thereby increasing the gene dose. Internal ribosome entry sites
(IRES) in polycistronic vectors have been shown to support the
simultaneous expression of multiple genes from a single promoter.
Amplicon vectors provide a high safety level as they can be pro-
duced using a helper virus-free packaging system leading to the
absence of expression of all HSV-1 genes. The expression of the
individual heterologous viral genes alone or in combination can be
confirmed by Western blot and immune fluorescence analysis, and
the generation of VLPs in vector-infected cells can be monitored by
electron microscopy.
For example, inoculation of mice with polycistronic amplicon
vectors encoding the structural proteins required for capsid assem-
bly of FMDV or rotavirus as a two-dose regimen without adjuvants
resulted in the expression of the heterologous viral antigens, fol-
lowed by induction of virus-specific immune responses and a vari-
able level of protection against challenge with a high dose of wild-
type virus [5–7].
This chapter provides detailed protocols for the production of
helper virus-free polycistronic HSV-1 amplicon vector stocks and
the characterization of the vectors by Western blot, immunofluo-
rescence analysis and electron microscopy. A summary describing
the immunization of experimental animals with HSV-1 amplicon
vectors, but no detailed protocols, as well as a basic protocol for
ELISA is provided at the end of the chapter.
2 Materials
2.1 Preparation 1. 17 100-mm graduated snap-cap tubes (for growing

of HSV-1 BAC DNA bacteria).
2.1.1 Extraction of HSV-1 2. Luria-Bertani (LB) medium: dissolve 10 g NaCl, 10 g Bacto
BAC DNA tryptone and 5 g Bacto yeast extract in 1000 ml ddH2O and
autoclave for 20 min at 121 C.
3. Chloramphenicol (1000 stock solution): 12.5 mg/ml dis-
solved in 75% ethanol; store at 20 C.
4. E. coli clone of HSV-1 BAC fHSVΔpacΔ27ΔKn [9].
5. Dimethyl sulfoxide (DMSO).
6. Plasmid Maxi kit (Qiagen).
Genetic Vaccine 113
7. High speed centrifuge equipped with rotor and tubes (Sorvall

RC6+, GSA rotor, SS34 rotor, and polypropylene tubes or
equivalent).
8. Resuspension buffer P1 (50 mM Tris–HCl, pH 8.0, 10 mM
EDTA, 100 μg/ml RNase A): Add 950 ml of H2O to a glass
beaker and add 6.06 g Tris base and 3.72 g Na2EDTA·2H2O.-
Mix on a magnetic stirrer, and adjust pH with HCl. Add H2O
to 1 l, and sterilize by autoclaving. Store at room temperature
(see Note 1).
9. Lysis buffer P2 (200 mM NaOH, 1% SDS (w/v)): Add 950 ml
of H2O to a glass beaker and add 8.0 g NaOH and 50 ml 20%
SDS (w/v). Mix on a magnetic stirrer. Add H2O to 1 l, and
sterilize by autoclaving. Store at room temperature (see Note 1).
10. Neutralization buffer P3 (3.0 M potassium acetate, pH 5.0):
Add 500 ml of H2O to a glass beaker and add 294.5 g potas-
sium acetate. Mix on a magnetic stirrer, and adjust pH with
glacial acetic acid (~110 ml). Add H2O to 1 l, and sterilize by
autoclaving, Store at room temperature (see Note 1).
11. 120-mm diameter folded filters.
12. 1 M Tris–HCl, pH 8.0: Add 800 ml of H2O to a glass beaker
and add 121.1 g Tris base. Mix on a magnetic stirrer, and adjust
pH with HCl. Add H2O to 1 l, and sterilize by autoclaving.
Store at room temperature.
13. 0.5 M EDTA, pH 8.0: Add 800 ml of H2O to a glass beaker
and add 186.1 g disodium EDTA·2H2O. Tris base. Mix on a
magnetic stirrer, and adjust pH with NaOH pellets. Add H2O
to 1 l, and sterilize by autoclaving. Store at room temperature.
14. TE buffer (10 mM Tris–HCl, pH 7.4, 0.1 mM EDTA): Mix
10 ml of 1 M Tris–HCl, pH 8.0 and 2 ml of 0.5 M EDTA,
pH 8 in 988 ml of H2O. Sterilize by autoclaving. Store at room
temperature.
15. Buffer QBT, QC, QF and Qiagen-tip 500 columns (Qiagen)
(see Note 1).
2.1.2 Purification of HSV- 1. 13 51-mm Ultra-Clear centrifuge tubes.

1 BAC DNA 2. Cesium chloride (CsCl).
3. Ethidium bromide in H2O: 10 mg/ml and 1 mg/ml stock
solutions.
4. Paraffin oil.
5. Ultracentrifuge equipped with Sorvall TV 865 rotor (fixed-
angle) or equivalent.
6. 1-ml disposable syringes.
7. 21- and 36-gauge hypodermic needles.
8. UV-lamp (366 nm).

9. TE/CsCl solution: dissolve 3 g CsCl in 3 ml TE buffer,
pH 7.4. Store up to several months at room temperature.
10. Dialysis cassettes (Slide-A-Lyzer, 10,000 MWCO).
2.1.3 Characterization 1. UV spectrophotometer.

of HSV-1 BAC DNA 2. High-molecular-weight- and 1-kb DNA standards.
3. Electrophoresis-grade agarose.
4. TAE (Tris–acetate–EDTA) electrophoresis buffer 10: Dis-
solve 24.2 g Tris base, 5.71 ml glacial acetic acid, and 3.72 g
Na2EDTA·2H2O in 1000 ml ddH2O. Store at room
temperature.
5. Electrophoresis chamber.
2.2 Production 1. Vero 2-2 cells, a derivative of Vero cells that express HSV-1
of HSV-1 Amplicon ICP27. [10].
Vector Stocks 2. DMEM (Dulbecco Modified Eagle’s medium) supplemented
2.2.1 Preparation of Cells
with 10% FBS.
3. G418 (Geneticin).
4. 0.25% trypsin–0.02% EDTA.
5. Hemacytometer.
2.2.2 Transfection 1. OptiMEM I reduced-serum medium (Thermo Fisher

Scientific).
2. Plasmid pEBHICP27 [9].
3. Lipofectamine LTX Reagent (Thermo Fisher Scientific).
4. PLUS Reagent (Thermo Fisher Scientific).
5. DMEM supplemented with 6% FBS.
2.2.3 Harvesting 1. Cell scraper.

of Vector Particles 2. Liquid N2.
3. Probe sonicator.
4. 0.45-μm syringe-tip polyethersulfone membrane filters.
5. 20-ml disposable syringe.
2.2.4 Concentration 1. Ultraspeed centrifuge equipped with rotor (Beckman SW28

of Vector Stocks rotor or equivalent).
2. Beckman Ultra-Clear centrifuge tubes (25 89 mm).
3. 25% sucrose in PBS.
Genetic Vaccine 115
2.3 Characterization 1. DMEM supplemented with 2% and 10% FBS.

of HSV-1 Amplicon 2. 24-well cell culture plates.
Vectors
3. 0.25% trypsin–0.02% EDTA.
2.3.1 Western Blotting 4. Protein loading buffer (PLB).
2.3.2 1. DMEM supplemented with 2% and 10% FBS.

Immunofluorescence 2. 24-well cell culture plates.
3. 12 mm glass coverslips.
4. 3.7% formaldehyde in PBS.
5. 0.1 M glycine in PBS.
6. PBS-T, PBS containing 0.2% Triton X-100.
7. PBS-BSA, PBS containing 3% BSA.
8. 1 μg/ml DAPI in PBS.
9. Mounting reagent (e.g., glycergel or ProLong (Thermo Fisher
Scientific)).
10. Clean microscope slides.
11. Fluorescence microscope or confocal laser-scanning
microscope.
2.4 Analysis of HSV- 1. DMEM supplemented with 2% and 10% FBS.

1 Amplicon Vector- 2. Cell scraper.
Encoded Heterologous
3. Liquid N2.
Virus-Like Particles
4. 0.45 μm syringe-tip polyethersulfone membrane filters.
2.4.1 Infection of Cells
5. 20-ml disposable syringe.
with HSV-1 Amplicon
Vectors and Harvesting 6. Beckman Ultra-Clear centrifuge tubes (14 95 mm).
of Virus-Like Particles 7. 10% sucrose in PBS.
8. Ultraspeed centrifuge equipped with rotor (SW40 rotor or
equivalent).
9. Protease inhibitor cocktail tablets complete, EDTA-free.
2.4.2 Negative Stain 1. 2% phosphotungstic acid (PTA) in ddH2O, pH 7.0, store at

Electron Microscopy 4 C.
2. 300 mesh/in. copper grids covered with carbon-coated
Parlodion film.
3. Transmission electron microscope equipped with a camera.
4. Glow discharger.
2.4.3 Immunoelectron 1. 300 mesh/in. copper grids covered with carbon-coated

Microscopy Parlodion film.
2. PBS-BSA/0.1%, PBS containing 0.1% BSA.
3. Secondary antibody, coupled to colloidal gold particles (e.g.,

12 nm).
4. 2% PTA, pH 7.0, in ddH2O.
5. Transmission electron microscope equipped with a camera.
2.5 Immunization 1. ELISA 96 microwell plate.

2.5.1 IgG ELISA 2. Coating buffer (carbonate-bicarbonate buffer): Add 800 ml of
H2O into a glass beaker and add 1.59 g of Na2CO3 and 2.93 g
of NaHCO3. Mix on a magnetic stirrer. Add H2O to 1 l, and
sterilize by autoclaving. Store at room temperature.
3. Concentrated or purified antigen.
4. Humidified chamber.
5. PBS-T: PBS containing 0.05% Tween20.
6. Dilution buffer: PBS containing 0.05% Tween20 and 1%
(m/v) casein.
7. HRP conjugated anti-IgG detection antibody.
8. Peroxidase (HRP) substrate.
9. Stop solution: 2 M H2SO4.
10. ELISA microplate reader.
3 Methods
3.1 Preparation The entire HSV-1 genome (with the pac signals deleted) has been
of HSV-1 BAC DNA cloned as a bacterial artificial chromosome (BAC) in E. coli
[11]. The pac-deleted HSV-1 BAC DNA can provide all the func-
tions required for supporting the replication and packaging of
HSV-1 amplicon vectors but cannot be packaged itself because of
the absence of packaging signals. To further improve safety, an
essential HSV-1 gene (ICP27) was deleted from the BAC-cloned
pac-deleted HSV-1 genome and is provided in trans from a separate
plasmid [9]. HSV-1 amplicon vector stocks produced with this
method are essentially free of helpervirus contamination [9].
3.2 Extraction 1. Prepare a 17 100-mm sterile snap-cap tube containing 6 ml

of HSV-1 BAC DNA sterile LB/chloramphenicol medium. Inoculate with a loop of
frozen long-term culture of the HSV-1 BAC clone. Incubate
for 8 h at 37 C in a shaker.
2. Transfer 1.5 ml of the culture from step 1 into each of four 2-l
Erlenmeyer flasks containing 1000 ml of sterile LB/chloram-
phenicol and incubate for 12–16 h at 37 C, with shaking.
3. Place 1-ml aliquots of the bacterial culture from step 2 into
each of two cryogenic storage vials and add 70 μl of DMSO to
Genetic Vaccine 117
each. Mix well and freeze at 80 C for long-term storage

(up to several years).
4. Distribute the 4 l of overnight culture from step 2 into six
250-ml polypropylene centrifuge tubes and centrifuge for
10 min at 4000 g (5000 rpm in a Sorvall GSA rotor), 4 C.
5. Decant the medium, fill polypropylene centrifuge tubes again
with bacterial culture and repeat centrifugation.
6. After the last centrifugation, invert each tube on a paper towel
for 1–2 min to drain all liquid.
7. Resuspend each pellet in 5 ml of buffer P1 and combine the six
aliquots (see Note 1).
8. Add 130 ml of buffer P1 and distribute to four fresh 250 ml
polypropylene centrifuge tubes (40 ml per tube).
9. Add 40 ml of buffer P2 to each centrifuge tube, mix by invert-
ing the tubes four to six times, and incubate 5 min at room
temperature.
10. Add 40 ml of buffer P3 and mix immediately by inverting the
tubes six times. Incubate the tubes for 20 min on ice.
11. Invert the tube once more and centrifuge for 30 min at
16,000 g (10,000 rpm in a Sorvall GSA rotor), 4 C.
12. Filter the supernatants through a folded filter (120 mm diam-
eter) into four fresh 250 ml polypropylene centrifuge tubes.
13. Precipitate the DNA with 0.7 volumes (84 ml per tube) of
isopropanol, mix gently, and centrifuge immediately for 30 min
at 17,000 g (11,000 rpm in a Sorvall GSA rotor), 4 C.
14. Carefully remove the supernatants and mark the locations of
the pellet. Wash the DNA pellet by adding 20 ml of cold 70%
ethanol to each tube and centrifuge for 15 min at 16,000 g
(10,000 rpm in a Sorvall GSA rotor), 4 C.
15. Carefully remove the supernatants and resuspend each of the
four pellets in 2 ml of TE buffer, pH 7.4. Pool the four
solutions (total volume 8 ml) and add 52 ml of QGT buffer
(final volume 60 ml).
16. Equilibrate two Qiagen-tip 500 columns with 10 ml of buffer
QBT and allow the columns to empty by gravity flow.
17. Transfer the solution from step 15 through a folded filter
(120 mm diameter) into the Qiagen-tip 500 columns (30 ml
per column) and allow the liquid to enter the resin by
gravity flow.
18. Wash each column twice with 30 ml of buffer QC and then
elute DNA from each column with 15 ml of prewarmed
(65 C) buffer QF into a 30 ml centrifuge tube.
nol, mix, and immediately centrifuge for 30 min at 20,000 g
(13,000 rpm in a Sorvall SS-34 rotor), 4 C.
20. Carefully remove the supernatant and mark the locations of the
pellets on the outside of the tubes. Wash the pellets with 5 ml
of chilled 70% ethanol and, if necessary (if the pellet becomes
detached), repellet at the same settings as in step 19.
21. Aspirate the supernatant completely but avoid drying the pel-
lets. Resuspend each pellet in 3 ml of TE buffer (pH 7.4) and
incubate for several hours at 37 C. Avoid pipetting the DNA
up and down as this can cause shearing of the DNA.
3.2.1 Purification of HSV- 1. Prepare two Beckman Ultra-Clear 13 51-mm centrifuge

1 BAC DNA tubes containing 3 g CsCl and add the DNA solution from
Subheading 3.2, step 21 (3 ml per tube). Mix gently until
dissolved. Add 300 μl of 10 mg/ml ethidium bromide to the
DNA/CsCl solution. Then overlay the solution with 300 μl of
paraffin oil and seal the tubes.
2. Centrifuge for 17 h at 218,500 g (48,000 rpm in a Sorvall
TV 865 ultracentrifuge rotor), 20 C.
3. Two bands of DNA located in the center of the gradient should
be visible in normal light (see Note 2).
4. Harvest the lower band under UV-light using a disposable
1-ml syringe fitted with a 21-gauge hypodermic needle and
transfer into a microcentrifuge tube.
5. Combine equal volumes of n-butanol and TE/CsCl solution.
Add one volume of the CsCl saturated n-butanol (the upper
phase) to one volume of the harvested DNA to remove ethi-
dium bromide.
6. Mix the two phases by vortexing and centrifuge for 3 min at
250 g, room temperature, in a benchtop centrifuge.
7. Carefully transfer the lower, aqueous phase to a fresh
microcentrifuge tube.
8. Repeat steps 5–7 four to six times until all the pink color
disappears from both the aqueous phase and the organic phase.
9. Add an equal volume of isopropanol, mix and centrifuge at
250 g for 3 min at room temperature.
10. Transfer the aqueous phase to a fresh microcentrifuge tube.
11. For dialysis, inject the DNA solution into a dialysis cassette
using a 1-ml disposable syringe fitted with a 36-gauge hypo-
dermic needle. Dialyze for 6 h against TE, pH 7.4 at 4 C.
Then, change the TE buffer and dialyze overnight to remove
all CsCl from the DNA solution.
Genetic Vaccine 119
12. Recover the DNA solution from the dialysis cassette using a
fresh 1-ml disposable syringe fitted with a 36-gauge hypoder-
mic needle and transfer to a clean microcentrifuge tube.
13. The DNA solution can be stored up to several months at 4 C.
3.2.2 Characterization Recombination events and deletion of sequences from HSV-1 BAC
of HSV-1 BAC DNA clones may occur during amplification in bacteria. Therefore,
isolated DNA should be analyzed before it is used for the prepara-
tion of amplicon vector stocks. The HSV-1 genome has been
sequenced (strain 17 [12]); restriction patterns can therefore be
predicted and used for characterization of the HSV-1 BAC DNA.
1. Determine the absorbance of the DNA solution from Subhead-
ing 3.2.1, step 13 at 260 nm (A260) and 280 nm (A280) using a
UV spectrophotometer.
2. Verify the HSV-1 BAC DNA by restriction endonuclease anal-
ysis (e.g., HindIII, KpnI).
3. Separate the fragments by overnight electrophoresis in a 0.4%
agarose gel at 40 V in TAE electrophoresis buffer, using high-
molecular-weight DNA and 1-kb DNA ladders as size
standards.
4. Stain with ethidium bromide (1 mg/ml in H2O) and compare
restriction fragment patterns with the published HSV-1
sequence [12].
3.3 Production To facilitate titration, it is convenient to include a gene encoding an

of HSV-1 Amplicon autofluorescent protein, such as enhanced green fluorescent pro-
Vector Stocks (See tein (EGFP), in the polycistronic HSV-1 amplicon vectors. In
Notes 3 and 4) addition, the vectors express individual or multiple other trans-
genes of interest. For example, the polycistronic HSV-1 amplicon
vector plasmid pHSVT[VP7/6/2] (Fig. 1) contains three IRES
signals between the HSV-1 immediate-early (IE) 4/5 promoter
and the SV40 polyadenylation signal and allows the efficient expres-
sion of up to four different transgenes. It might be beneficial to
optimize the transgene cassette to the specific codon usage of the
target species.
To package HSV-1 amplicon vectors into HSV-1 particles, cells
(e.g., Vero 2-2) are co-transfected with amplicon DNA, the ICP27-
and pac-deleted HSV-1 BAC helper DNA, and a plasmid that
encodes ICP27 by cationic liposome-mediated transfection using
Lipofectamine and Plus reagent. Amplicon vector particles are
harvested 2–3 days after transfection and, if desired, concentrated.
3.3.1 Preparation of Cells 1. Maintain Vero 2-2 cells in DMEM–10% FBS containing
for Transfection 500 μg/ml G418. Propagate the culture twice a week by
splitting ~1/5 in fresh medium (10 ml) into a new 75-cm2
tissue culture flask.
Fig. 1 Schematic representation of the polycistronic HSV-1 amplicon vector

pHSVT[VP7/6/2]. This vector encodes the three main structural proteins VP2,
VP6 and VP7 of rotavirus. Polycistronic expression is facilitated by two
picornavirus IRES and an encephalomyocarditis virus (EMCV) derived IRES, and
controlled by the HSV-1 IE4/5 promoter. The EGFP reporter gene facilitates
titration of vector stocks. The HSV-1 origin of DNA replication (oriS) and
packaging/cleavage signal (pac), as well as the SV40 polyadenylation signal
are indicated
2. On the day before transfection, aspirate culture medium, wash

each plate with 5 ml PBS, add 2 ml of trypsin–EDTA, and
incubate for 10 min at 37 C to allow cells to detach from plate.
Resuspend cells in fresh DMEM–10% FBS.
3. Count cells using a hemacytometer and plate 1.2 106 cells
per 60-mm diameter tissue culture dish in 3 ml of DMEM–10%
FBS. Incubate cells at 37 C and 5% CO2.
3.3.2 Transfection 1. For each 60-mm cell culture dish to be transfected, place 250 μl
of Opti-MEM I reduced-serum medium into each of two
15-ml conical tubes. A maximum of six dishes can conveniently
be manipulated at once.
2. To one tube add 0.4 μg of amplicon DNA and 2 μg of the
HSV-1 BAC DNA from Subheading 3.1 and 0.2 μg of pEB-
HICP27 DNA (see Note 5).
3. Mix the tube (flipping) and slowly add 10 μl of Plus reagent.
Incubate for 5 min at room temperature, then mix the tube
(flipping) and incubate again for 5 min.
4. To the other tube add 15 μl of Lipofectamine.
5. Combine the contents of the two tubes. Mix well (without
vortexing) and incubate for 30–45 min at room temperature.
6. Wash the cultures prepared the day before (Subheading 3.3.1)
once by adding 2 ml of Opti-MEM I, swirl the plate, and
aspirate the medium.
7. Add 1 ml of Opti-MEM I to the tube from step 5 containing
the DNA-Lipofectamine transfection mixture (1.5 ml total
volume).
8. Aspirate all medium from the culture, add the transfection
mixture, and incubate for 4 h at 37 C and 5% CO2.
Genetic Vaccine 121
9. Aspirate the transfection mixture and wash the cells three times
with 2 ml of Opti-MEM I, as described in step 6.
10. After aspirating the last wash, add 3 ml of DMEM–6% FBS and
incubate cells for 2–3 days at 37 C and 5% CO2.
3.3.3 Harvesting 1. Scrape cells from Subheading 3.3.2, step 10 into the medium
of Vector Particles using a cell scraper. Transfer the suspension to a 15-ml conical
centrifuge tube.
2. Perform three freeze–thaw cycles using liquid nitrogen and a
37 C water bath. The suspensions should not be left at 37 C
any longer than necessary for thawing. They can, however, be
kept frozen for extended periods.
3. Place the tube containing the cells into a beaker containing ice
water. Submerge the tip of the sonicator probe ~0.5 cm into
the cell suspension and sonicate 20 s with 20% output energy
(see Note 6).
4. Remove cell debris by centrifuging for 10 min at 1400 g,
4 C.
5. Filter the supernatant through a 0.45-μm syringe-tip filter
attached to a 20-ml disposable syringe into a new 15-ml conical
tube. Remove a sample for titration (see Note 3).
6. Divide the remaining stock into 1-ml aliquots, freeze in liquid
nitrogen, and store up to 6 months at 80 C.
7. Alternatively, concentrate the stock before storage as described
in Subheading 3.3.4.
3.3.4 Concentration For immunization of mice, vector stocks are purified and concen-
of Vector Stocks trated by centrifugation.
1. Add 15 ml of 25% sucrose in a Beckman Ultra-Clear 25 89-
mm centrifuge tube.
2. Carefully add the vector stock from Subheading 3.3.3, step 5
(up to 20 ml) on top of the sucrose cushion and centrifuge for
3 h at 100,000 g, 16 C, using a Beckman SW28 rotor.
3. Aspirate the supernatant and resuspend the pellet in a small
volume (e.g., 300 μl) of PBS. Remove a 10 μl sample of the
stock for titration (see Note 3).
4. Divide the resuspended pellet into aliquots (e.g., 30 μl) and
freeze in liquid nitrogen. Store up to 6 months at 80 C.
3.4 Characterization Immunofluorescence and Western analyses are performed to char-

of Polycistronic HSV-1 acterize the synthesis and subcellular localization of the transgene
Amplicon Vectors products upon infection of cells. For this, mammalian cells are
infected with the amplicon vectors, and the transgene products
are visualized using specific antibodies.
3.4.1 Western Blotting 1. Grow 1 105 cells (e.g., Vero 2-2) per well in 24-well tissue
culture plates in 0.5 ml of DMEM–10% FBS. Incubate over-
night at 37 C and 5% CO2.
2. Dilute the vector stocks in 250 μl of DMEM–2% FBS for a
multiplicity of infection (MOI) of 1 transducing unit
(TU) per cell.
3. Aspirate the growth medium and add the vector dilutions to
the cells. Incubate for 1–2 h, then remove the inoculum. Add
0.5 ml of DMEM–2% FBS and incubate for 24 h at 37 C and
5% CO2.
4. Collect the growth medium in a microcentrifuge tube, wash
the cells once with 200 μl of PBS, and collect the PBS in the
same tube.
5. Trypsinize the cells with 100 μl of trypsin–EDTA per well and
incubate for 5 min at 37 C.
6. Add 200 μl of DMEM–10% FBS, transfer cells to the tube of
step 4, wash the well with 200 μl of PBS and transfer to the
same tube.
7. Centrifuge samples for 2 min at maximum speed in a table top
centrifuge, discard supernatant.
8. Add 25 μl of 1 protein loading buffer (PLB) and boil samples
for 10 min.
9. The samples are now ready for Western analysis using standard
protocols.
3.4.2 Immuno- 1. Grow 0.8–1 105 cells (e.g., Vero 2-2) per well on 12 mm
fluorescence coverslips in 24-well tissue culture plates in 0.5 ml of
DMEM–10% FBS. Incubate overnight at 37 C and 5% CO2.
2. Dilute the vector stocks in 250 μl of DMEM–2% FBS for a
MOI of 1 TU per cell.
3. Aspirate the growth medium and add vector dilutions to the
cells. Incubate for 1–2 h, then remove the inoculum. Add
0.5 ml of DMEM–2% FBS and incubate for 24 h at 37 C
and 5% CO2.
4. Aspirate medium and wash the cells once with PBS.
5. Fix the cells with 3.7% of formaldehyde in PBS for 15 min at
room temperature.
6. Stop fixation with 0.1 M glycine in PBS for a minimum of
5 min at room temperature.
7. Optional: store in PBS overnight at 4 C.
8. Permeabilize cells with PBS-T (0.2% Triton X-100 in PBS) for
9. Wash immediately with PBS.
Genetic Vaccine 123
10. Block with PBS-BSA (3% BSA in PBS) for a minimum of

11. Incubate with the primary antibody diluted in PBS-BSA for 1 h
12. Wash cells three times with PBS for 5 min at room
temperature.
13. Incubate with secondary antibody diluted in PBS-BSA for 1 h
14. Wash three times for 5 min with PBS.
15. To stain nuclei, incubate cells for 15 min at room temperature
with DAPI in PBS (1 μg/ml) and wash three times for 5 min
with PBS.
16. Mount the coverslips onto microscope slides with mounting
reagent and let it dry.
17. The samples are now ready to be analyzed by fluorescence
microscopy.
3.5 Analysis of HSV- In order to examine the assembly of the vector encoded heterolo-
1 Amplicon Vector- gous structural proteins into virus-like particles, cells are infected
Encoded Heterologous with amplicon vectors and, after 48 h, total cell lysates are harvested
Virus-Like Particles and concentrated.
3.5.1 Infection of Cells 1. Grow 1.2 106 cells (e.g., Vero 2-2) per 60-mm diameter
with HSV-1 Amplicon tissue culture dish in 3 ml of DMEM–10% FBS. Incubate
Vectors and Harvesting overnight at 37 C and 5% CO2.
of Virus-Like Particles 2. Dilute the vector stocks from Subheading 3.3.3, step 6 or
Subheading 3.3.4, step 4 in 1.5 ml of DMEM–2% FBS for a
MOI of 2 TU per cell.
3. Aspirate the growth medium and add vector dilutions to the
cell culture plates. Incubate for 1–2 h at 37 C and 5% CO2 and
then remove the inoculum. Add 2 ml of DMEM–2% FBS and
incubate for 2 days at 37 C and 5% CO2.
4. Scrape cells into the medium using a cell scraper. Transfer the
suspension into a 15-ml conical centrifuge tube.
5. Perform three freeze–thaw cycles using liquid nitrogen and a
37 C water bath.
6. Remove cell debris by centrifugation for 10 min at 1400 g,
4 C.
7. Filter the supernatant through a 0.45-μm syringe-tip filter
attached to a 20-ml disposable syringe into a new 15-ml
conical tube.
8. Add 5 ml of 10% sucrose (in PBS) to a Beckman Ultra-Clear
14 95-mm centrifuge tube.
Fig. 2 Electron photomicrographs of HSV-1 amplicon vector encoded rotavirus-like particles (RVLPs). Two
days after infection, RVLPs were purified over a sucrose cushion and the concentrated particles were analyzed
by electron microscopy. (a) Negative staining of RVLPs from Vero 2-2 cells infected with the polycistronic
HSV-1 amplicon vector pHSVT[VP7/6/2]. (b) Immunogold staining of the same sample of RVLPs as in (a) using
a polyclonal anti-rotavirus serum and a secondary antibody coupled to 12 nm colloidal gold particles. Scale
bars ¼ 100 nm. (Photomicrographs by A. Laimbacher and E. Schraner, University of Zurich, Switzerland)
9. Carefully transfer the filtrate from step 4 on top of the sucrose

cushion and centrifuge for 2 h at 100,000 g, 16 C, using a
Beckman SW40 rotor.
10. Carefully aspirate the supernatant and resuspend the pellet in a
small volume (e.g. 40 μl) of PBS (see Note 7).
11. Store the suspension containing the VLPs at 4 C. The pelleted
VLPs are observed with a transmission electron microscope
either by negative stain electron microscopy (Subheading
3.5.2) or by immune electron microscopy (Subheading 3.5.3)
(Fig. 2). To further characterize the VLPs, Western analysis of
the same concentrated samples as used for electron microscopy
may be performed (see Note 8).
3.5.2 Negative Stain Negative staining requires heavy metal salts to enhance contrast.
Electron Microscopy Electron dense heavy metal salts surround small particles so that
these appear as electron lucent structures. It is a simple and direct
technique to examine virus morphology.
1. Place a drop (approx. 10 μl) of the resuspended virions or VLPs
from Subheading 3.5.1, step 11, a drop of ddH2O, and a drop
of 2% phosphotungstic acid (PTA) on a strip of Parafilm
mounted on a smooth surface.
2. Place the grid (carbon-coated Parlodion film mounted on a
300 mesh/in. copper grid, glow discharged) with the carbon-
coated side down on top of the sample drop for up to 10 min
(see Notes 9 and 10).
Genetic Vaccine 125
3. Remove the grid and wash once to several times (depending on

the probe) by placing it on top of the ddH2O drop.
4. Place the grid onto the drop of 2% PTA, pH 7.0, for 1 min (see
Note 11).
5. Remove excess PTA carefully with Whatman filter paper and let
the grid dry for a few minutes on a labeled piece of Whatman
filter paper. Important: do not remove any fluid at the end of
steps 2–4.
6. The specimen can now be examined by electron microscopy
and photographed.
3.5.3 Immunoelectron The immunogold technique allows identification of the examined

Microscopy sample with a specific primary antibody and a secondary antibody
coupled to colloidal gold particles.
1. Place a drop of the resuspended VLPs from Subheading 3.5.1,
step 11 onto a strip of Parafilm.
2. Place the grid (carbon-coated Parlodion films mounted on a
300 mesh/in. copper grid, glow discharged) with the carbon-
coated side down on top of the sample drop and let the sample
adsorb to the Parlodion film for 10 min.
3. Block the sample by placing the grid for 10 min on top of a
drop of PBS containing 0.1% BSA (PBS-BSA/0.1%).
4. Incubate with the primary antibody (specific for the structural
virus proteins) by placing the grid for 1 h on top of a drop
containing the primary antibody diluted in PBS-BSA/0.1%.
5. Wash several times by placing the grid on drops of
PBS-BSA/0.1%.
6. Incubate with the secondary antibody coupled to colloidal
gold particles (e.g., 12 nm), by placing the grid for 1 h on
top of a drop containing the secondary antibody diluted in
PBS-BSA/0.1%.
7. Wash several times by placing the grid on drops of PBS and
ddH2O.
8. Continue with the protocol for negative staining, Subhead-
ing 3.5.2, steps 4–6.
3.6 HSV-1 Amplicon HSV-1 amplicon vectors used for immunization of mice are con-
Vectors centrated by centrifugation (see Subheading 3.3.4). There is no
for Immunization need to add any adjuvant for immunization. For results from
immunization experiments using polycistronic HSV-1 amplicon
vectors, see refs. 6, 7 (rotavirus) and 5 (foot-and-mouth disease
virus).
3.6.1 Immunization Routes of injection include: intraperitoneal (i.p.), intranasal (i.n.),

of Mice and Sample intramuscular (i.m.), and subcutaneous (s.c.) [5–7, 13]. The choice
Collection of the route of injection may be based on a pilot experiment in
which the most efficient induction of immune responses is deter-
mined. For example, mice can be inoculated (i.m.) in a prime–boost
regimen with 5 105 TU or 1 106 TU of amplicon vectors.
Samples (e.g., serum, feces) may be collected on days 0, 21, and
42 after the first immunization. More frequent serum collection
can be performed using microcapillary tubes on tail punctuation for
minimal invasion.
3.6.2 Analysis The analysis of the immune response depends on the model. We
of Antibody Response propose to determine the antibody titers in the serum or stool
samples by ELISA. If desired, further characterization of the anti-
body specificity by Western blotting or immunofluorescence is
recommended.
3.6.3 IgG ELISA The ELISA protocol for IgG antibodies in sera can be adjusted to
for Serum Samples other isotypes by using different secondary antibodies. Analysis of
antibodies in other sample types (e.g., feces, milk) might require
the adjustment of the blocking agent. For further protocols see
ref. 13.
1. Appropriately dilute the antigen solution in coating buffer
(e.g., 1:100 for virus stocks concentrated over a sucrose cush-
ion or 1:10 for CsCl gradient purified virus). Add 0.1 ml of the
dilution to each well of an ELISA 96 microwell plate. Incubate
the plate in a humidified chamber for 1 h at room temperature
or overnight at 4 C. Remove the solution and wash the wells
three times with PBS-T.
2. Appropriately dilute the samples and controls in dilution
buffer. Ideal sample concentrations should be evaluated before-
hand (with a range of 1:100 to 1:10,000 to start with). Apply
0.1 ml of the diluted samples into each well and incubate for
1 h at 37 C in a humidified chamber. Remove the solution and
wash the wells three times with PBS-T.
3. Dilute the HRP conjugated detection antibody in dilution
buffer to an appropriate concentration (e.g., 1:4000). The
optimal dilution should be determined using a titration assay.
Apply 0.1 ml of the diluted detection antibody and incubate for
1 h at 37 C in a humidified chamber. Remove the solution and
wash the wells three times with PBS-T.
4. Add 0.1 ml of the freshly prepared substrate to each well. Allow
the color to develop for 15–30 min and measure the absorption
at λ ¼ 650 nm in a microplate reader before stopping the
reaction. Do not allow the signal to exceed the optical density
(O.D) of 0.6. Otherwise the substrate will form precipitates
Genetic Vaccine 127
after addition of the stop solution. Stop the reaction by adding

0.1 ml stop solution. Allow the reaction to develop for 10 min
and measure the plate at λ ¼ 450 nm (see Note 12).
3.6.4 Challenge Infection To evaluate the efficiency of the developed vaccine, challenge
and Analysis of Protection experiments are usually performed assessing the protection from
infection or, depending on the model used, protection from disease
symptoms.
For rotavirus there are different strategies to test the efficacy of
a rotavirus vaccine candidate. In all species, including human and
mice, rotavirus infection in adults is usually asymptomatic. In adult
mice, protection against rotavirus infection can be measured by
reduction of fecal virus shedding after oral challenge (adult mouse
model) [6]. Protection is defined as the absence of detectable fecal
viral antigen following challenge and partial protection is defined as
reduced quantities of fecal viral antigen compared to that shed by
control-inoculated mice [14, 15]. Therefore, virus antigen shed-
ding curves (absorbance versus days postchallenge) of each animal
are plotted and the area under the shedding curve for each animal
calculated and compared to that of a control group [16].
Similar to human babies and in contrast to adult humans and
mice, newborn mice develop severe diarrhea upon rotavirus infec-
tion. The immune system of newborn mice and humans is not fully
mature, thus it is unlikely to elicit a protective immune response
during the short time period of rotavirus disease susceptibility. This
makes the vaccination-based protection of newborn a difficult task.
Alternatively, protection in newborn mice might be induced by
immunization of mothers resulting in the protective transfer of
their antibody repertoire to the offspring. This mouse maternal
antibody model represents an alternative to the adult mouse
model. For example, HSV-1 amplicon vectors encoding rotavirus
proteins can be administered intramuscularly to pregnant mice.
The antibody titers are then analyzed in sera as well as in milk
samples of vaccinated dams and also in sera of their offspring
using ELISA [7].
4 Notes
1. Buffers P1, P2, P3, QBT, QC, and QF are components of the
Qiagen Plasmid Maxi Kit. The BAC DNA extraction procedure
uses a modified Qiagen-tip 500 protocol.
2. The upper band, which usually contains less material, consists
of linear and nicked circular HSV-1 BAC DNA. The lower
band consists of closed circular HSV-1 BAC DNA.
3. Titration of HSV-1 amplicon vector stocks: To determine the
concentration of infectious vector particles in an amplicon
vector stock, cells are infected with samples collected from

stocks either before or after concentration. Cells expressing
the transgene are counted 24–48 h after infection to calculate
the titer (transducing units per milliliter, TU/ml). Titers
expressed in TU/ml are relative and do not necessarily reflect
numbers of infectious vector particles per milliliter. It is conve-
nient to include a reporter gene that encodes an autofluores-
cent protein, such as EGFP, to facilitate titration using a
fluorescent microscope. EGFP is an ideal reporter as its fluo-
rescence is independent of substrates or cofactors, and trans-
fection and packaging efficiencies can be monitored in live cell
cultures during the entire course of the packaging process.
Alternatively, vector-infected cells can be stained using trans-
gene product-specific antibodies. The vector titers should be in
the range of 106–107 TU/ml before concentration. The recov-
ery of transducing units after concentration should be ~50% if
the titer of the crude vector stock was >106 TU, and ~10–20%
if the titer was <106 TU/ml.
4. Vero 2-2 cells are a derivative of Vero cells that express HSV-1
ICP27 [10]. Helpervirus-free packaging of amplicons has been
performed with various cell lines, but this protocol has been
optimized for Vero 2-2 cells. The number of cells plated per
60-mm tissue culture dish the day before transfection is very
important and should be optimized in each laboratory (starting
with 1.2 106 cells per 60-mm plate). The cells should form a
confluent monolayer by the time of transfection.
5. The 1-kb sequence homology between the origin of DNA
replication (ori) on the HSV-1 BAC DNA and the ori on the
amplicon poses a potential safety risk, as homologous recombi-
nation may support the generation of packaging-competent
HSV-1 helper genomes and contamination of amplicon vector
stocks with replication-competent HSV-1. To improve safety,
the essential HSV-1 IE2 gene encoding ICP27 was deleted
from the BAC-cloned HSV-1 genome and is provided in
trans from a separate plasmid [9]. Any packaging-competent
HSV-1 genome generated via recombination between the ori
sequences on the BAC DNA and the amplicon DNA would be
replication-deficient in absence of the ICP27 gene, thereby
improving the safety level of the system.
6. Before harvesting, the cultures should be observed under a
microscope to confirm that cells show cytopathic effects (evi-
denced by large and round cells). Freezing and thawing, and
the subsequent sonication of the cell suspension are important
to release cell-associated vector particles. Although HSV-1
virions are relatively stable, vector stocks should be kept on
ice while in use or stored in aliquots at 80 C. Repeated
freeze–thaw cycles of vector stocks should be avoided.
Genetic Vaccine 129
7. For protection of proteins against a broad range of proteases,

protease inhibitor (Protease inhibitor cocktail tablets complete,
EDTA-free) was added to the PBS used to resuspend the VLPs.
8. To analyze the concentrated VLPs, add PLB (final concentra-
tion 1) to samples, boil for 10 min and perform Western
blotting.
9. The support films on grids are naturally hydrophobic and this
would lead to rejection of the samples. Therefore, glow dis-
charge is used to deposit a charge onto the films rendering
them hydrophilic and allowing an aqueous solution of particles
to spread uniformly and adhere to the supporting film. For
this, place grids onto a clean microscope slide, place slide with
grids on top (carbon side up) in a vacuum chamber. Generate
the vacuum and perform glow discharge (10 s). After the
chamber is vented, place slide into a petri dish. Grids are now
ready for negative staining. Glow discharge of grids should be
performed no more than 20 h before grids are used. Under
certain laboratory conditions glow discharge is not necessary,
except when pure carbon films are used.
10. Depending on the concentration of particles in the probe,
adsorption times vary between 1 and 10 min.
11. Different dyes are available depending on the probe. 2% PTA,
pH 7.0 is widely used and a good starting dye. The concentra-
tion of PTA can be varied between 0.1 and 2% and the incuba-
tion time from 10 s to 5 min. Alternative stain: Uranyl acetate.
12. As ELISA HRP substrates do vary, the measured wavelengths
as well as the stop solution might vary. We used the TMB
substrate kit from ThermoScientific.
References
1. de Silva S, Bowers WJ (2009) Herpes virus virus-Epstein-Barr virus hybrid amplicons. J

amplicon vectors. Viruses 1:594–629 Virol 73:10426–10439
2. Caccuri F, Ronca R, Laimbacher AS et al 5. D’Antuono A, Laimbacher AS, La Torre J et al
(2017) U94 of human herpesvirus 6 down- (2010) HSV-1 amplicon vectors that direct the
modulates Src, promotes a partial in situ production of foot-and-mouth disease
mesenchymal-to-epithelial transition and inhi- virus antigens in mammalian cells can be used
bits tumor cell growth, invasion and metastasis. for genetic immunization. Vaccine
Ocotarget 8:44533–44549 28:7363–7372
3. Parrish E, Peltekian E, Dickson G et al (1999) 6. Laimbacher AS, Esteban LE, Castello AA et al
Cell engineering for muscle gene therapy: (2012) HSV-1 amplicon vectors launch the
extemporaneous production of retroviral vec- production of heterologous rotavirus-like par-
tor packaging macrophages using defective ticles and induce rotavirus-specific immune
herpes simplex virus type 1 vectors harbouring responses in mice. Mol Ther 20:1810–1820
gag, pol, env genes. Cytotechnology 7. Meier AF, Suter M, Schraner EM et al (2017)
30:173–180 Transfer of anti-rotavirus antibodies during
4. Sena-Esteves M, Saeki Y, Camp SM et al pregnancy and in milk following maternal vac-
(1999) Single-step conversion of cells to retro- cination with a herpes simplex virus type-1
virus vector producers with herpes simplex amplicon vector. Int J Mol Sci 18:431
8. Taylor TJ, Diaz F, Colgrove RC et al (2016) 12. McGeoch DJ, Dalrymple MA, Davison AJ et al
Production of immunogenic West Nile virus- (1988) The complete DNA sequence of the
like particles using a herpes simplex virus long unique region in the genome of herpes
1 recombinant vector. Virology 496:186–193 simplex virus type 1. J Gen Virol
9. Saeki Y, Fraefel C, Ichikawa T et al (2001) 69:1531–1574
Improved helper virus-free packaging system 13. Meier AF, Laimbacher AS, Ackermann M
for HSV amplicon vectors using an ICP27- (2016) Polycistronic herpesvirus amplicon vec-
deleted, oversized HSV-1 DNA in a bacterial tors for veterinary vaccine development. In:
artificial chromosome. Mol Ther 3:591–601 Brun A (ed) Vaccine technologies for veteri-
10. Smith IL, Hardwicke MA, Sandri-Goldin RM nary viral diseases. Springer, New York, NY,
(1992) Evidence that the herpes simplex virus pp 201–224
immediate early protein ICP27 acts post- 14. Coffin SE, Moser CA, Cohen S et al (1997)
transcriptionally during infection to regulate Immunologic correlates of protection against
gene expression. Virology 186:74–86 rotavirus challenge after intramuscular immu-
11. Saeki Y, Ichikawa T, Saeki A et al (1998) Her- nization of mice. J Virol 71:7851–7856
pes simplex virus type 1 DNA amplified as bac- 15. Ward RL, McNeal MM, Sheridan JF (1990)
terial artificial chromosome in Escherichia coli: Development of an adult mouse model for
rescue of replication-competent virus progeny studies on protection against rotavirus. J Virol
and packaging of amplicon vectors. Hum Gene 64:5070–5075
Ther 9:2787–2794 16. Gray J, Desselberger U (2000) Rotaviruses:
methods and protocols. Humana, New York
Chapter 7
oHSV Genome Editing by Means of galK Recombineering

Laura Menotti, Valerio Leoni, Valentina Gatta, Biljana Petrovic,
Andrea Vannini, Simona Pepe, Tatiana Gianni,
and Gabriella Campadelli-Fiume
Abstract
Since the cloning of the herpes simplex virus (HSV) genome as BAC (bacterial artificial chromosome), the
genetic engineering of the viral genome has become readily feasible. The advantage is that the modification
of the animal virus genome is carried out in bacteria, with no replication or production of viral progeny, and
is separated from the reconstitution or regeneration of the recombinant virus in mammalian cells. This
allows an easy engineering of essential genes, as well. Many technologies have been developed for herpesvi-
rus BAC engineering. In our hands the most powerful is galK recombineering that exploits a single marker
(galK) for positive and negative selection and PCR amplicons for seamless modification in the desired
genome locus. Here we describe the engineering of the HSV recombinant BAC 115 by the insertion of a
heterologous cassette for the expression of murine interleukin 12 (mIL12) in the intergenic sequence
between US1 and US2 ORFs.
Key words Herpes simplex virus, Oncolytic virotherapy, Virus engineering, galK recombineering,
Virus arming, Transgene expression, Interleukin 12
1 Introduction
OVs (oncolytic viruses) belong to different virus families and,

consequently, exhibit different pros and cons. The advantages of
herpes simplex virus (HSV) as an oncolytic agent are as follows:
l A detailed knowledge of the genomic arrangement and of the
function of the viral gene products.
l A large genome (about 150 kbp) which enables the insertion of a
number of foreign genes, up to three to four as of now. In
principle, this number can be substantially further increased.
l The viral genome does not integrate into the host genome.
l The technologies for the genetic engineering are well
established.
131
132 Laura Menotti et al.
l The ability to elicit a strong antiviral and antitumor innate

immunity; in essence oHSVs behave as antigen-agnostic anti-
cancer vaccines.
l The ability to synergize with checkpoint blockade, and to confer
sensitivity to and widen the activity of checkpoint inhibitors.
l Last but not least, a specific anti-herpes drug is available in a
worst-case scenario, a unique advantage of herpesviruses.
The major disadvantage of oHSV is possibly the prior immu-
nity in the human host. This limitation can be in part counteracted
by the route of administration. Because of these properties oHSVs
have been among the first viruses to be tested as oncolytic agents
[1, 2]; see also refs. 3, 4. The first registered OV belongs to the
herpesviridae family [5–7].
The application of molecular biology techniques to herpes-
viruses has been critical for development and improvements of
technologies aimed at generating HSV recombinants with the
desired modifications. Of the various genetic engineering technol-
ogies that our laboratory has applied over time, we found that galK
(galactokinase) recombineering (recombination-mediated genetic
engineering) is straightforward, relatively easy to design and to
carry out with high rate of success. It requires the prior cloning of
the herpesviral DNA as BAC (bacterial artificial chromosome)
[8, 9]. The insertion of BAC sequences in HSV was described in
detail [10–13] and was covered previously in this book series
[14]. galK recombineering allows the introduction of the planned
genetic modification into HSV-BAC DNA in bacteria (E. coli). Of
note, even essential viral genes can be readily manipulated, since no
viral gene expression takes place in the bacterial host. Following
recombineering, recombinant virus can be rescued upon transfec-
tion of the genetically modified (recombinant) HSV-BAC DNA in
mammalian cells, susceptible and permissive to HSV. Of note,
several types of viral modifications can be obtained, including
point mutations, deletions/insertions, marker or transgene expres-
sion, changes to viral tropism, etc.
The initial technologies for HSV-BAC engineering in E. coli
(two-step replacement strategy) involved the RecA-mediated
homologous recombination of the HSV-BAC with a transgene
carried by a shuttle plasmid and the use of two different markers
to select for the cointegrate and the resolved final genome
[15]. The technology had some pitfalls, mainly because of low
stringency of the marker employed in the counterselection of the
unresolved recombination intermediates. In particular, the sacB
marker present in the shuttle vector was quite easily inactivated
and lost its efficacy. In addition, the cloning of the desired modified
viral gene or heterologous transgene in a shuttle vector prevented
galK Recombineering on HSV-BACs 133
in most cases a seamless insertion of the desired mutations, due to

the restriction sites used for cloning.
Strategies involving double crossing-over like lambda (λ)
Red-mediated homologous recombination or ET-recombination
circumvented the issue of seamless insertions, as they exploit PCR
generated linear fragments with short homology arms (50–60 bp)
to the target site. The need to express the recombinases from an
additional plasmid and only for a short time period required an
extra transformation step and induction with L-arabi-
nose [16]. These methods were generally employed for gene inac-
tivation or deletions, in combination with the insertion of an
antibiotic resistance marker followed by FRT-Flp recombination,
for example, as we did to delete HSV glycoprotein D gene [17].
The galK recombineering technology has been developed by
Warming et al. and proposed as an innovative and powerful tool for
the engineering of BAC DNAs [18]. The advantages are twofold.
First, the λ Red-mediated homologous recombination is carried
out by recombinases transiently and inducibly expressed from the
genome of an appropriate E. coli host strain, SW102. Second, a
single marker, galK, is used for positive and negative selection, that
is, to target the desired site of insertion, and, subsequently, for the
replacement of the galK insert with heterologous or viral sequences
carrying the desired modification. This allows seamless modifica-
tions of the BAC and avoids the need of transformation of
recombinase-expressing plasmids. More importantly, it enhances
the efficiency of recovery of the final product, by putting a negative
selection on the constructs that still carry the galK marker.
In this chapter we provide an example of the insertion of a
transgene in HSV-BAC, by means of galK recombineering. The
subsequent steps for the rescue and cultivation of the recombinant
virus are illustrated in a separate chapter of this book (see
Chapter 8). We highlight the specific problems that can arise in
the procedure. The specific example is the generation of R-115,
that is, the insertion of mIL12 in R-LM113, an oHSV retargeted to
HER2 cancer receptor and expressing the EGFP reporter gene
(Fig. 1).
2 Materials
2.1 HSV-BAC DNA 1. E. coli bacterial strain SW102, derived from DH10B strain, is
Extraction used to harbor and amplify HSV-BACs, and for BAC recombi-
and Electroporation neering using galK positive/negative selection [18]. SW102
into E. coli SW102 strain must be grown at a temperature not exceeding 32 C, to
avoid unwanted expression of the three λ Red-encoded genes
(exo, bet, and gam recombinases) from a stably integrated
defective λ prophage (see Note 1).
UL US
a IGS
IR UL3 UL4 IR IR US1 US2 IR
HSV-BAC LM113
BAC EGFP
galK galK knock-in
b
galK
BAC EGFP
c
galK
BAC EGFP
pCMV mIL12 galK knock-out and
transgene knock-in
d
pCMV mIL12
BAC EGFP HSV-BAC 115
Fig. 1 Schematic diagram of galK recombineering for the generation of HSV-BAC 115. The line lengths and box
sizes are representative and are not drawn to scale. (a) The starting HSV-BAC LM113 carries EGFP as reporter
gene (green box). The two halves of the intergenic sequences (IGS) between US1 and US2 are depicted as
magenta and red boxes. The PCR amplicon of the galK cassette (orange box) carries upstream and
downstream arms homologous to the IGS. (b) Following the first step of galK recombineering with galK
positive selection, the galK cassette is inserted in the US1-US2 IGS. (c) The pCMV-mIL12 cassette (blue box) is
amplified with primers carrying the same homology arms for the IGS (magenta and red boxes). (d) After the
second step of galK recombineering and galK negative selection the pCMV-mIL12 cassette is inserted in place
of galK, and the final recombinant HSV-BAC 115 is generated. EGFP enhanced green fluorescence protein, IR
inverted repeats, UL unique long, US unique short
2. E. coli containing HSV-BAC DNA (e.g., DH10B containing

HSV-BAC LM113 [17]).
3. “Low salt” LB medium (see Note 2): 10 g Bacto tryptone, 5 g
yeast extract, and 5 g NaCl in 1 L ddH2O. Autoclave for
20 min at 121 C.
4. Chloramphenicol, 20 mg/mL in EtOH.
5. BAC DNA extraction kit (e.g., NucleoBond® BAC 100 kit
(Macherey-Nagel), containing buffers S1, S2, S3, N3, and
N5).
6. STE Buffer: 10 mM Tris–HCl (pH 8.0), 1 mM EDTA,
0.1 M NaCl.
7. Isopropanol.
8. 70% ethanol.
2.2 Buffers 1. 10 M9 medium: 60 g Na2HPO4, 30 g KH2PO4, 10 g

and Solutions for galK NH4Cl, 5 g NaCl in 1 L ddH2O, autoclave.
Recombineering 2. 5 M63 buffer: 10 g (NH4)2SO4, 68 g KH2PO4, 2.5 mg
and Characterization FeSO4·7H2O in 1 L ddH2O, adjust to pH 7.0 with 10 N
of Clones KOH, autoclave.
3. Supplements for M63 minimal plates: D-biotin (0.2 mg/mL,
sterile filtered); D-galactose (20%, autoclaved); 2-deoxy-galac-
tose (DOG, 20%, prepared just before use, sterile filtered, see
Note 3); glycerol (20%, autoclaved); L-leucine (10 mg/mL,
dissolved by heating, then cooled down and sterile filtered);
MgSO4·7H2O (1 M, autoclaved); Chloramphenicol (20 mg/
mL in EtOH).
4. M63 minimal plates: autoclave 15 g Bacto agar (see Note 4) in
800 mL of ddH2O, cool down to 50 C; add 200 mL of 5
M63 medium and 1 mL of 1 M MgSO4·7H2O; adjust volume
to 1 L with sterile ddH2O if necessary. Add 5 mL biotin (1 mg),
4.5 mL leucine (45 mg), and 625 μL chloramphenicol
(12.5 μg/mL working concentration). Complete with the car-
bon source and/or selective compound: for galactose minimal
plates, add 10 mL of 20% D-galactose; for DOG minimal plates,
add 10 mL of 20% glycerol and 10 mL of 20% 2-deoxy-
galactose.
5. MacConkey indicator plates: prepare MacConkey agar accord-
ing to the manufacturer’s instructions (see Note 5), autoclave,
cool at 50 C, add D-galactose (1% final concentration) and
chloramphenicol (12.5 μg/mL working concentration).
6. High fidelity polymerase and buffer (e.g., Phusion Polymerase
(Thermo Fisher)).
7. Taq polymerase and buffer.
8. 50 mM MgCl2.
9. dNTP mix, 10 mM.
10. Restriction endonucleases DpnI, BamHI, EcoRV, and KpnI.
11. 1-kb DNA ladder.
12. SK-OV-3, human ovarian cancer cell line (ATCC HTB-77).
13. Lipofectamine 2000.
2.3 Nucleic Acids 1. pgalK for galK knockin [18] (Fig. 2a).
2. pLM84, template plasmid for PCR amplification of a pCMV-
mIL12 expression cassette for recombination in HSV-BAC
[19] (Fig. 2b).
2.4 Agarose Gel 1. 50 TAE buffer (1 L): 242 g of Tris base, 57.1 mL of acetic
Electrophoresis Buffer acid (glacial), 100 mL of 0.5 M EDTA (pH 8.0). Working
dilution: 0.5.
a EM7 promoter (7-76)
(1-24)
pgalK
4176 bp
Rev primer
(1212-1231)
AmpR
b AmpR CMV promoter

T7 promoter
NotI (927)
pLM84
7566 bp EcoRI (1949)
HindIII (2101)
SV40 poly(A)
HindIII (2449)
BamHI (2478)
NeoR/KanR
HindIII (3134)
SV40 promoter BGH poly(A)
Fig. 2 Maps of the plasmids used for galK recombineering. (a) pgalK is the
template to amplify the galK cassette. The positions where chimeric primers
anneal are depicted as purple arrows. (b) pLM84 is used as template for the
amplification of the pCMV-mIL12 cassette [19]. mIL12b (subunit b) and mIL12a
(subunit a) coding sequences (blue arrows) are separated by an IRES (yellow).
The cassette is under control of CMV promoter and ends with the BGH poly
(A) site. Graphics were created with SnapGene
2. Ethidium bromide.
3. Agarose.
2.5 Equipment 1. Bench instrumentation: benchtop centrifuges, spectrophotom-

eter, electroporation system and electroporation cuvettes
(0.2 cm), Speed-Vac.
2. Molecular biology: PCR thermal cyclers, gel electrophoresis

system (for short and long run lengths), gel imaging system.
3. Incubators and shakers for bacteria.
4. Folded filter paper.
5. Ice–water slurry.
6. Eppendorf tubes.
7. 50 mL conical tubes.
8. 500 mL bottles.
3 Methods
This collection of protocols describes the methods to modify an

HSV-BAC by galK recombineering technologies. In the next chap-
ter, we will describe how to rescue the recombinant HSV, and
finally evaluate its biological properties in vitro. We focus here on
the expression of a heterologous gene, the cytokine murine inter-
leukin 12 (mIL12) in a replication-competent fully retargeted
HSV, by insertion of an expression cassette in the non-coding
intergenic region between US1 and US2 genes (Fig. 1).
3.1 HSV-BAC DNA In order to manipulate and engineer the HSV-BAC DNA of inter-
Extraction est, a critical feature is the E. coli strain. The galK recombineering
procedure requires SW102 cells, a strain derived from DH10B,
engineered with the λ prophage encoding the recombinases, and
deleted of the galactokinase gene (galK) in the galactose operon
[18]. If the HSV-BAC is hosted in a different bacterial strain, its
DNA must be extracted and transferred by electroporation into
SW102 bacteria.
In the example described in this chapter, the starting material is
HSV-BAC LM113 in DH10B cells [17]. For the extraction of
HSV-BAC DNA we use NucleoBond® BAC 100 kit (Macherey-
Nagel) (see Note 6). Throughout the protocol, maximum care
should be taken to avoid shearing of the high-molecular weight
HSV-BAC DNA.
1. Cultivate bacterial cells overnight at 30 C in 200 mL LB
medium + antibiotics (12.5 μg/mL chloramphenicol) (see
Note 7).
2. Harvest bacteria by centrifugation at 3000 g for 15 min at
4 C; resuspend the pellet in STE buffer and centrifuge the
bacteria again (see Note 8). Discard supernatant.
3. Thoroughly resuspend the pellet in 12 mL resuspension buffer
(S1) supplemented with 100 μg/mL RNase A.
4. Add 12 mL of room-temperature lysis buffer (S2) to the sus-
pension, mix gently by inverting the tube 6–8 times; the
solution turns viscous. Incubate at room temperature

(18–25 C) for max 5 min (see Note 9).
5. Add 12 mL precooled ice-cold neutralization buffer (S3) to the
suspension. Promptly mix the lysate gently by inverting the
tubes 6–8 times (see Note 9). A non-viscous suspension of
off-white flocculate must form. Incubate the suspension on
ice for 5 min.
6. Equilibrate a NucleoBond® BAC 100 (anion-exchange resin)
column with 2.5 mL of equilibration buffer (N2). Allow the
column to completely empty by gravity flow and discard flow-
through.
7. Clarify the lysate through a wet folded filter paper placed in a
funnel (see Note 10); collect the flow-through.
8. Load the cleared lysate onto the equilibrated NucleoBond®
BAC 100 column; allow the column to empty by gravity flow,
discard flow-through.
9. Wash the column twice with 12 mL wash buffer (N3) and
discard flow-through.
10. Elute the BAC DNA with 5 mL elution buffer (N5) preheated
at 50 C (see Note 11); gently mix and divide in five 1 mL
aliquots (see Note 12). To avoid shearing of HSV-BAC DNA,
use wide-orifice tips.
11. To precipitate the eluted HSV-BAC DNA add 0.7 mL of
room-temperature isopropanol to each aliquot. Mix carefully
by inversion (do not vortex) and centrifuge at 14,000 g for
30 min at 4 C. Carefully remove and discard the supernatant.
12. Add 1 mL ice-cold 70% ethanol to the pellet of each aliquot,
centrifuge at 14,000 g for 10 min at 4 C. Speed-Vac dry for
10 min.
13. Dissolve each aliquot of HSV-BAC DNA in 10 μL of sterile
ddH2O. Let the pellet hydrate for about 15 min. To avoid
shearing of HSV-BAC DNA, pipet gently using wide-
orifice tips.
14. Determine DNA yield using an UV spectrophotometer and
check HSV-BAC DNA integrity by agarose gel electrophoresis
(Fig. 3). Store the purified DNA at 4 C (see Note 13).
3.2 Electroporation 1. Pick a single colony of SW102 containing no BAC from a plate,
of HSV-BAC into and make a 5 mL overnight culture at 30 C (see Note 14).
SW102 Bacterial Strain 2. Dilute the overnight culture 1:50 in 100 mL of low salt LB
medium (see Note 15), without antibiotics, in a bottle or a
flask. Measure bacterial density (OD600) at time 0 (it should be
at least 0.03). Incubate the culture for about 3–4 h in a shaker
at 30 C (in an incubator or in a water bath) and measure
bacterial density at regular time intervals.
HSV-BAC
bp MW M 115
10000 *
**
6000
3000
1000
750
500
250
Fig. 3 Typical band pattern of an intact HSV-BAC DNA run on a 0.8% agarose gel
in 0.5 TAE. The bands are sharp, without smear. MW: GeneRuler 1 kb DNA
Ladder; sizes are in base pairs (bp). M: MassRuler DNA Ladder Mix (Thermo
Scientific): ∗: 50 ng, ∗∗: 40 ng
3. During the bacterial growth, prepare an ice–water slurry and

cool on ice 1 L of sterile ddH2O, 50 mL conical tubes, Eppen-
dorf tubes, 0.2 cm electroporation cuvettes (see Note 16).
4. When the OD600 of the culture is near 0.6, the bottle contain-
ing the bacteria is cooled down in the ice–water slurry for
1–2 min, and subsequently transferred into precooled 50 mL
conical tubes.
5. Spin down the bacteria in a cold (0–1 C) centrifuge for 8 min
at 3000 g.
6. Pour off all the supernatant, then add 5 mL ice-cold ddH2O,
while keeping the tube with the bacterial pellet in the ice–water
slurry. Resuspend the pellet in water by gently shaking the tube
in the ice–water slurry (the first time it will take about 5 min).
When resuspended, fill up to 50 mL with ice-cold ddH2O, mix
by inversion, and spin in a cold centrifuge for 8 min at
3000 g.
7. Make a second cold water wash as in step 6, then remove all
supernatant by inverting the tube on a paper towel. Gently
resuspend the bacterial pellet in the residual small amount of
ddH2O left in the tube and store the competent cells on ice.
8. Transfer 50 μL of the freshly made electrocompetent cells to a
precooled Eppendorf tube and mix with 100 ng–1 μg of the
HSV-BAC DNA to be transformed. Transfer to a precooled

0.2 cm electroporation cuvette.
9. Transform by electroporation (200 Ω, 25 μF, 2.5 kV), and
immediately add 1 mL of ice-cold low salt LB medium to the
cuvette. Transfer bacteria to an Eppendorf tube and incubate in
a shaker at 30 C for about 1 h.
10. Plate different amounts (1, 10, or 100 μL, and all the rest) of
the transformed bacteria on low salt LB agar plates plus chlor-
amphenicol (12.5 μg/mL) to obtain single colonies (see Note
17). Incubate at 30 C for 1–2 days.
3.3 Galk The galK recombineering technology allows to modify a BAC

Recombineering DNA cloned in Escherichia coli via lambda (λ) Red-mediated
homologous recombination. In this strategy, the use of restriction
enzymes and DNA ligases to modify DNA is not required, instead
BAC DNA is modified using galK positive/negative selection in a
two-step procedure [18]. The first step is a homologous recombi-
nation to insert (knockin) the galK cassette into the desired posi-
tion of the HSV-BAC DNA. Recombinant clones are selected by
positive selection of bacteria that acquired the ability to grow on
minimal media with galactose as the only carbon source. The
second step involves another homologous recombination to sub-
stitute the galK cassette (galK knockout) with the sequence of
interest. In this case a negative selection against galK with
2-deoxy-galactose (DOG), toxic following phosphorylation by
the galK gene product, ensures the identification of recombinant
clones. Both recombinations occur via short homology sequences
or homology arms, which flank the galK or the custom cassette,
and are homologous to the selected target position in the
HSV-BAC DNA (Fig. 1).
3.3.1 GalK Knockin The first step of galK recombineering technology consists of the
(Positive Selection) insertion of the constitutively expressed galactokinase cassette
(galK) into the HSV-BAC locus chosen for the selected modifica-
tion. To this purpose, first, it is necessary to PCR amplify the galK
cassette flanked by short homology arms included in the primers
(see Note 18).
1. Design PCR chimeric primers for the amplification of the galK
cassette. For the insertion described here, we used the follow-
ing primers: US1/US2_galK_f ATAAAAGACCAAAA
TCAAAGCGTTTGTCCCAGCGTCTTAATGGCGGGAAG
CCTGTTGACAATTAATCATCGGCA, and US1/US2_galK_r
AATAAACCCCCAAACACCCCCCATGTACGCGTGGTC
TGTTTCTCTCCGCCTCAGCACTGTCCTGCTCCTT (arms
with homology to HSV-BAC are in italics, whereas the sequences
annealing to galK cassette are in plain text).
2. Set up the PCR reaction with a high fidelity polymerase (here a

50 μL reaction with ThermoFisher Phusion polymerase is
reported): 10 μL of 5 Phusion HF buffer, 1 μL of 10 mM
dNTPs, 2.5 μL of 10 μM forward and reverse primers (0.5 μM
final concentration), 0.5 μL of Phusion polymerase; 33 μL of
ddH2O. Finally, add 1 μL of 2 ng/μL pgalK plasmid as tem-
plate. Amplification conditions: initial denaturation and hot
start at 98 C for 30 s, then 32 cycles at 98 C for 10 s,
58 C for 20 s, 72 C for 30 s, final extension at 72 C for
10 min. Run 5 μL of the PCR product on a 0.8% agarose gel. A
band of ~1.3 kbp is expected.
3. Digest the PCR product with 2 μL (40 U) of DpnI restriction
enzyme/50 μL reaction, for 1 h at 37 C to remove the
methylated template.
4. Run the DpnI digestion on a 0.6% agarose gel (1 h at 80 V) and
purify the galK band by gel extraction spin columns. Elute the
galK fragment in 50 μL nuclease free ddH2O (see Note 19).
5. Measure the concentration of the galK fragment with an UV
spectrophotometer and dilute it to a final concentration of
30 ng/μL with ddH2O.
6. Recombineering for galK positive selection. Inoculate a single
bacterial colony containing the recipient HSV-BAC (in this
example BAC LM113) in 5 mL of low salt LB + 12.5 μg/mL
chloramphenicol and incubate with shaking at 30 C
overnight.
7. Dilute 2 mL of the overnight culture in 100 mL of low salt
LB + 12.5 μg/mL chloramphenicol and shake it at 30 C to
reach an OD600 between 0.55 and 0.65. This step takes about
3.5 h. In the meantime precool in an ice–water slurry 1 L of
sterile ddH2O, 50 mL conical tubes, Eppendorf tubes, 0.2 cm
electroporation cuvettes.
8. Divide the culture in two 500 mL bottles. Shake one bottle in a
42 C water bath for 15 min (see Note 20) to induce λ pro-
phage recombinases (induced sample), leave the other bottle at
30 C (uninduced control).
9. Cool the two cultures (hereafter designated as “induced” and
“uninduced”) on ice for 5 min, transfer them to 50 mL pre-
cooled tubes and centrifuge for 8 min at 3500 g at 0 C.
10. Pour off all the supernatant, add 5 mL of sterile ice-cold
ddH2O and resuspend the pellet, with gentle swirling in an
ice–water slurry (see Note 21). Fill the Falcon tubes up to
50 mL with sterile ice-cold ddH2O and pellet again.
11. Repeat step 10.
12. Invert the tubes on a towel to remove the supernatant
completely and gently resuspend the bacterial pellet in the
residual small amount of ddH2O left in the tube by swirling in

the ice–water slurry. Keep the competent cells on ice.
13. Mix 50 μL of cells and 1 μL of galK fragment (30 ng/μL) in a
precooled Eppendorf tube.
14. Transfer and electroporate the DNA-cell mix in a precooled
0.2 cm electroporation cuvette at 25 μF, 2.5 kV and 200 Ω (see
Note 22).
15. Add 1 mL of ice-cold low salt LB medium and recover bacteria
for 90 min at 30 C in a shaker.
16. Wash bacteria (induced and uninduced) with 1 M9 salts (see
Note 23): pellet the culture (~1 mL) for 15 s at 14,000 g and
remove supernatant carefully with a micropipette, resuspend
pellet with 1 mL of 1 M9 salts.
17. Repeat step 16.
18. Plate different amounts (1, 10 or 100 μL, and all the rest) of
the cultures on M63-D-Galactose minimal plates (see Note 24).
19. Incubate plates at 30 C for 3–4 days (see Note 25).
20. For screening of recombinants after selection on M63-D-galac-
tose minimal plates, choose ten single colonies from induced
sample plates and streak each on a MacConkey indicator plate
to make a dilution grid (Fig. 4) (see Note 26). Incubate the
plates at 30 C overnight.
21. Choose one single brilliant red colony from each MacConkey
plate. Repeat the plating with the grid dilution method. This
ensures the isolation of pure, non-mixed, clones. Incubate at
30 C overnight.
1
7 6 5 4 3
2
11
10
Fig. 4 Dilution of bacteria with the grid method. Pick a single colony with a sterile
tip, and deposit the excess on the side of the plate by a forward-and-back streak
(black doodle #1). With the same tip make a linear streak as in black arrow #2.
Change tip and make linear streaks as depicted by the red arrows #3–7. Change
tip again and make linear streaks as shown by the green arrows #8–11. This will
result in a dilution of bacteria and should produce single colonies in the area
highlighted in yellow
22. Choose one or two single brilliant red colonies from each
MacConkey plate and make a small linear streak on low salt
LB plates + 12.5 μg/mL chloramphenicol. Incubate at 30 C
overnight.
23. Set up a colony PCR reaction to verify the presence of galK
cassette in the selected position in the HSV-BAC genome. In
the example of this chapter we used a forward primer
US1_1802_f (ACACGTTTCTCCGGCCGTGAGTCCG)
annealing on HSV US1 genomic sequence, and galK_417_r
(CATTGCCGCTGATCACCATGTCCACGC) a reverse
primer annealing on galK, yielding an amplification product
of 547 bp. Alternatively, for general purpose galK screening,
primers both annealing on galK sequences can be used (e.g.,
galK_827_f (GCGTGATGTCACCATTGAAG) and
galK_1142_r (TATTGTTCAGCGACAGCTTG)), yielding a
315-bp band (Fig. 5a).
Taq protocol (20 μL reaction): 2 μL of 10 Taq Buffer,
0.6 μL of 50 mM MgCl2, 0.4 μL of 10 mM dNTPs, 1 μL of
10 μM forward and reverse primers (0.5 μM final concentra-
tion), 0.08 μL of Taq polymerase, 14.9 μL of ddH2O. Finally,
as template, pick a tiny amount of bacterial colony, and dissolve
it directly in the PCR mix (see Note 27). When using primers
annealing both on galK, use 1 μL of 2 ng/μL pgalK plasmid,
or a pgalK colony, as positive control. Amplification condi-
tions: initial denaturation at 96 C for 3 min, then 32 cycles
at 94 C for 45 s, 55 C for 45 s, 72 C for 60 s, final extension
at 72 C for 10 min.
24. Extract HSV-BAC DNA from four positive clones (see Sub-
heading 3.1) and transfect SK-OV-3 (susceptible and
permissive) cells with Lipofectamine 2000 (see Chap. 8, Sub-
heading 3.1) to verify HSV-BAC genome integrity in terms of
ability to form plaques, spread and replicate. Monitor the
transfected cultures for 3 days for the formation of viral pla-
ques. In our example, plaques are EGFP positive and can be
visualized with an inverted fluorescence microscope.
25. Highly recommended: to check the insertion at the intended
position, PCR amplify the galK cassette including upstream
and downstream flanking regions from HSV-BAC genome,
and determine DNA sequence.
3.3.2 GalK Knockout The second step of galK recombineering technology consists in the
(Negative Selection) insertion of the transgene (in this example mIL12) in place of galK
cassette in the HSV-BAC clone obtained with the first step of
recombination. The cassette with the transgene of interest is ampli-
fied by PCR including in the primers short arms with homology to
the target insertion site (Fig. 1).
a b
pLM84
colony
pgalK
colony
bp MW bp MW 1 2 3
10000
6000 10000
3000 6000
3000
1000
750
500
250 1000
750
500
250
Fig. 5 Colony PCR pattern for galK or heterologous mIL12 cassette. Where a
plasmid is used as template for the positive control (“pgalK” or “pLM84”) the
bands are clean and sharp. Where colonies are used as template, below the
specific bands a nonspecific halo is visible, due to the dirty input of bacterial
cells. (a) Primers anneal both on galK and yield an amplicon of 315 bp. (b)
Primers anneal on mIL12b and on IRES and give rise to an amplicon of 300 bp.
1, 2: negative clones; 3: positive clone. MW: GeneRuler 1 kb DNA Ladder. Sizes
are in base pairs (bp)
1. Design PCR chimeric primers for the amplification of the

transgene cassette. For insertion of mIL12, we used the fol-
lowing primers: US1/US2_CMV_f
ATGTCCCCAAATAAAAGACCAAAATCAAAGCGTTTG
TCCCAGCGTCTTAATGGCGGGAAGCGTTTTGCGCTG
CTTCGCGATGTACGGGC, and US1/US2_polyA_rev
CCCCGATGTCAATAAACCCCCAAACACCCCCCATGT
ACGCGTGGTCTGTTTCTCTCCGCCGCCATAGAG
CCCACCGCATCCCCAGCATGCCTG (arms with
homology to HSV-BAC are in italics, whereas the
sequence that recognizes pCMV and polyA of mIL12
expression cassette on pLM84 are in plain text).
2. Set up the PCR reaction with a high fidelity polymerase (here a
50 μL reaction with ThermoFisher Phusion polymerase is
reported): 10 μL of 5 Phusion HF buffer, 1 μL of 10 mM
dNTPs, 2.5 μL of 10 μM forward and reverse primers (0.5 μM

final concentration), 0.5 μL of Phusion polymerase, 33 μL of
ddH2O. Finally, add 1 μL of 2 ng/μL pLM84 plasmid as
template. Amplification conditions are: initial denaturation
and hot start at 98 C for 30 s, then 32 cycles at 98 C for
10 s, 60 C for 40 s, 72 C for 4 min. Check the PCR product
on a 0.8% agarose gel.
3. Digest the PCR product with 2 μL (40 U) of DpnI restriction
enzyme/50 μL reaction, for 1 h at 37 C to remove the
methylated template.
4. Run the DpnI digestion on a 0.6% agarose gel (1 h at 80 V) and
purify the band of the heterologous cassette by gel extraction
spin columns. Elute the fragment in 50 μL nuclease free
ddH2O (see Note 19).
5. Quantify the transgene fragment with an UV spectrophotome-
ter and dilute it to a final concentration of 200 ng/μL with
ddH2O.
6. For recombineering and galK negative selection, inoculate one
galK positive clone in 3 mL of low salt LB + 12.5 μg/mL
chloramphenicol (in this example, BAC LM113 with galK
inserted at US1–US2 intergenic region).
7. Prepare electrocompetent cells as in Subheading 3.3.1, steps
7–12.
8. Mix 50 μL of cells and 1 μL of transgene fragment (200 ng/μ
L) in a precooled Eppendorf tube (see Note 28).
9. Transfer and electroporate the DNA-cell mix in a precooled
0.2 cm electroporation cuvette at 25 μF, 2.5 kV and 200 Ω (see
Note 22).
10. Add immediately 1 mL of ice-cold low salt LB, then transfer to
a tube containing 9 mL of low salt LB at room-temperature.
Recover bacteria for 4.5 h at 30 C in a shaker (see Note 29).
11. Pellet 1 mL of culture and wash twice in 1 M9 salts as in
Subheading 3.3.1, steps 16 and 17.
12. Plate different amounts (1, 10 or 100 μL, and all the rest) of
the induced and uninduced cultures on M63 DOG minimal
plates for selection against galK (see Note 24).
13. Incubate at 30 C for 5–7 days (see Note 30).
14. Screening of recombinant HSV-BAC DNAs after selection on
M63-DOG plates. Choose 30 single colonies from induced
sample plates and dilute each on a MacConkey plate indicator
plate with the grid scheme (Fig. 4) (see Note 26). Incubate the
plates at 30 C overnight.
15. Choose one single white/colorless colony from each MacCon-

key plate. Repeat the grid dilution on a fresh MacConkey plate.
This ensures the isolation of pure, not mixed clones. Incubate
at 30 C overnight.
16. Choose one or two single white/colorless colonies from each
MacConkey plate and make a small linear streak on low salt LB
plates + 12.5 μg/mL chloramphenicol. Incubate at 30 C
overnight.
17. Set up two colony PCR reactions to verify the presence of the
transgene cassette in the expected position in HSV-BAC
genome and the absence of galK cassette. In our example we
used mIL12a_601_f (CATCCTGCTTCACGCCTTCAG-
CACCC) and US2_short_r (AACCCCACCCAGCTACCC-
CAGGCC) for the presence of mIL12 (expected fragment
length: 607 bp), and US1_1802_f and galK_417_r (expected
fragment length: 547 bp) to verify the absence of galK. Gen-
eral purpose primers for the mIL12 heterologous cassette are
mIL12b_937_f (CAAAGGCGGGAATGTCTGCGTGC) and
IRES_201_r (GGGTTCCGCTGCCTGCAAAGGGTCG)
(Fig. 5b).
18. Extract the HSV-BAC DNA from four verified clones (see
Subheading 3.1), positive for the transgene cassette and nega-
tive for galK, and transfect them with Lipofectamine 2000 (see
Chap. 8, Subheading 3.1) in the appropriate susceptible and
permissive cell line (in this example SK-OV-3). Monitor for the
formation of plaques for 3 days.
19. Sequence the transgene cassette from the final HSV-BAC.
3.4 Characterization Restriction analysis of HSV-BAC clones is a rapid method to differ-

of Clones entiate clones with the correct insertion from the aberrant ones.
After restriction digestion, for each construct a peculiar restriction
enzyme fragments pattern is expected. If possible, include the
parental HSV-BAC as control.
1. Digest 2 μg of HSV-BAC DNA, extracted from bacteria, with
three different restriction enzymes (e.g., 50 U of BamHI, 50 U
of EcoRV, 25 U of KpnI) for 6 h or overnight at 37 C in a total
reaction volume of 50 μL.
2. Load on a 0.6% agarose gel prepared in 0.5 TAE and contain-
ing ethidium bromide. The gel should have a long run length
to allow a good separation of the bands. Include in the same gel
a DNA molecular weight marker (e.g., 1 kb DNA ladder).
3. Carry out electrophoresis in 0.5 TAE buffer at 40 V overnight
4. The next day, shift the voltage to 60 V for 3–4 h and finally
acquire an image with a gel imaging system (Fig. 6).
HSV-BAC 115
bp MW B K E
10000
8000
6000
5000
4000
3500
3000
2500
2000
1500
1000
750
500
Fig. 6 Check of HSV-BAC 115 DNA integrity by restriction endonuclease analysis

with BamHI (B), KpnI (K), and EcoRV (E). Bands were separated on a 0.6%
agarose gel in 0.5 TAE. MW: GeneRuler 1 kb DNA Ladder. Sizes are in base
pairs (bp)
4 Notes
1. To be on the safe side, we set the incubator and shaking water

bath at 29–30 C.
2. “Low salt” LB is recommended to prepare electrocompetent
SW102 E. coli, but we found it suitable for the normal routine
propagation of the strain as well.
3. Prepare just the required amount of 20% 2-deoxy-galactose, to
avoid oxidation of the solution. Autoclaving is possible, but not
recommended.
4. It is critical to use reliable Agar devoid of any carbon source, in

order to perform a stringent selection for galK-positive or
galK-negative clones.
5. Again, it is pivotal to use MacConkey Agar Base totally devoid
of lactose or any other carbon source whatsoever, in order to
accurately differentiate galK-positive and galK-negative
clones.
6. NucleoBond® PC 100 KIT is suitable for HSV-BAC DNA
preparation, as well.
7. To achieve the highest bacterial growth, perform a small scale
culture from a single colony in 5 mL low salt LB + antibiotics
for 4–6 h at 30 C, then dilute it 1:100 for the overnight
culture.
8. The STE wash is recommended to remove any trace of culture
medium and improve the purity of the extracted HSV-BAC.
9. Do not vortex, to avoid contamination by bacterial chromo-
somal DNA released from cellular debris.
10. This step is crucial to avoid clogging of the column in the
next step.
11. Preheating highly improves elution and recovery of
HSV-BAC DNA.
12. This helps in the subsequent steps of precipitation, washing,
drying and resuspension.

13. Avoid freezing at 20 C: freeze-thaw cycles fragment
HSV-BAC DNA.
14. All the procedures of this protocol must be performed with
standard aseptic technique close to a Bunsen burner.
15. To increase electroporation efficiency, it is important to reduce
NaCl traces in the final suspension of bacterial cells to be
electroporated.
16. Handling bacteria at low temperature increases the efficiency of
electroporation. It is important to work quickly on ice during
all the next steps of the procedure. An ice–water slurry is
preferred to ice only, because the latter harbors air between
the ice crystals.
17. To make sure to obtain colonies, we advise to plate the rest of
the transformed culture (the pellet from about 890 μL), too.
18. Typical homology arm length is 50 bp. In case of the insertion
of large fragments (3 kb or more) or to increase the recombi-
neering efficiency, it can be extended up to 70 bp for synthe-
sized oligonucleotides. Arms longer than 70 bp can be
obtained by extending the first PCR product with an extra
round of amplification with primers annealing more externally.
In a further case, longer homology arms (400 bp or more,
upstream and downstream the transgene expression cassette)

can be added with traditional cloning.
19. Use only ddH2O. Do not use salt-containing buffers, to avoid
interference with subsequent electroporation.
20. Check carefully the temperature of the shaking water bath,
possibly with an additional thermometer: a lower temperature
may reduce the efficiency of induction, and result in a drasti-
cally lower frequency of recombination.
21. Resuspension may take a while (up to 10 min). However, from
now until the electroporation step, it is very important not to
pipet the pellet in order to resuspend bacteria.
22. Check the output time constant on the electroporation device:
good values fall in the range 4.80–4.90 ms. Salt traces in the
electrocompetent bacteria suspension or in the fragment will
cause a small explosion (“arcing”). If this happens repeatedly
with a given batch, it is necessary to prepare new reagents and
materials.
23. This washing step is essential to remove any rich component of
LB medium from the samples, before the selection on minimal
galactose or DOG plates. It is therefore important to remove
carefully any residual LB medium by means of a micropipette
after every centrifugation.
24. The number of colonies may vary largely, depending on the
quality of the electrocompetent cells and the efficiency of elec-
troporation and of recombination. Therefore we advise to plate
dilutions and all the transformed culture to make sure to obtain
single colonies. The 1 and 10 μL aliquots should be made up
with 1 M9 salts to a suggested plating volume of 50–100 μL.
The rest of the transformed culture (about 890 μL) should be
pelleted by a short spin in a microfuge (15 s at 14,000 g),
resuspended in 50–100 μL 1 M9 salts and plated. Note that
the uninduced control shows a high level of bacterial lysis,
visible as viscosity in the sample.
25. A typical first step of galK recombineering (galK knockin)
yields about 20–30 colonies/μL of culture in the induced
sample. Usually all of them are positive in galK colony PCR.
The plates with the uninduced sample should have no colony:
the positive selection step is very stringent and uninduced
bacteria (in which λ Red recombinases have not been expressed
and galK cassette has not been inserted into the HSV-BAC) are
not able to grow on minimal plates containing D-galactose as
the sole carbon source.
26. Pay attention to streak the excess of colony on the tip on a side
of the plate, or you will not obtain single colonies.
27. Do not exceed with the quantity of input bacterial colony or

the PCR reaction may be inhibited. It is best to spread the
bacteria first on the wall of the tube, then to push them into the
PCR mix, to avoid lumping and sticking of bacteria on the tip.
Alternatively, dilute a colony in 20 μL of ddH2O, boil for 5 min
and use 2 μL as template for the colony PCR reaction.
28. In case of a large transgene cassette, it may be useful to perform
electroporation with up to 400 ng of PCR fragment.
29. In the second step of galK recombineering the recovery time
and the volume are increased with respect to the first step.
30. Small bacterial colonies will appear for both induced and unin-
duced sample. This happens because the negative selection
(galK counterselection) step is less stringent than the first
positive selection step. For this reason a large number of colo-
nies (sometimes 100+) need to be screened to find recombi-
nant clones.
Acknowledgments
This work was supported by European Research Council (ERC)

Advanced Grant number 340060, VII framework program to G.
C.-F., by RFO (University of Bologna) to L.M. and T.G, and by
Fondi Pallotti to T.G.
Competing interests: G.C.-F. owns shares in Nouscom Srl. B.P. is
currently an employee of Nouscom Srl. G.C.-F. and L.M. receive
equity payments from Amgen. The funders had no role in study
design, data collection and analysis, decision to publish, or prepa-
ration of the manuscript.
References
1. Martuza RL, Malick A, Markert JM, Ruffner 4. Campadelli-Fiume G, De Giovanni C, Gatta V,

KL, Coen DM (1991) Experimental therapy of Nanni P, Lollini PL, Menotti L (2011)
human glioma by means of a genetically engi- Rethinking herpes simplex virus: the way to
neered virus mutant. Science 252 oncolytic agents. Rev Med Virol 21
(5007):854–856 (4):213–226
2. Chambers R, Gillespie GY, Soroceanu L, 5. Hu JC, Coffin RS, Davis CJ, Graham NJ,
Andreansky S, Chatterjee S, Chou J, Groves N, Guest PJ, Harrington KJ, James
Roizman B, Whitley RJ (1995) Comparison ND, Love CA, McNeish I, Medley LC,
of genetically engineered herpes simplex Michael A, Nutting CM, Pandha HS, Shorrock
viruses for the treatment of brain tumors in a CA, Simpson J, Steiner J, Steven NM,
scid mouse model of human malignant glioma. Wright D, Coombes RC (2006) A phase I
Proc Natl Acad Sci U S A 92(5):1411–1415 study of OncoVEXGM-CSF, a second-
3. Markert JM, Gillespie GY, Weichselbaum RR, generation oncolytic herpes simplex virus
Roizman B, Whitley RJ (2000) Genetically expressing granulocyte macrophage colony-
engineered HSV in the treatment of glioma: a stimulating factor. Clin Cancer Res 12
review. Rev Med Virol 10(1):17–30 (22):6737–6747
6. Andtbacka RH, Kaufman HL, Collichio F, 13. Nagel CH, Dohner K, Fathollahy M, Strive T,
Amatruda T, Senzer N, Chesney J, Delman Borst EM, Messerle M, Sodeik B (2008)
KA, Spitler LE, Puzanov I, Agarwala SS, Nuclear egress and envelopment of herpes sim-
Milhem M, Cranmer L, Curti B, Lewis K, plex virus capsids analyzed with dual-color
Ross M, Guthrie T, Linette GP, Daniels GA, fluorescence HSV1(17+). J Virol 82
Harrington K, Middleton MR, Miller WH Jr, (6):3109–3124. https://doi.org/10.1128/
Zager JS, Ye Y, Yao B, Li A, Doleman S, JVI.02124-07
VanderWalde A, Gansert J, Coffin RS (2015) 14. Nagel CH, Pohlmann A, Sodeik B (2014)
Talimogene Laherparepvec improves durable Construction and characterization of bacterial
response rate in patients with advanced mela- artificial chromosomes (BACs) containing her-
noma. J Clin Oncol 33(25):2780–2788 pes simplex virus full-length genomes. Meth-
7. Ledford H (2015) Cancer-fighting viruses win ods Mol Biol 1144:43–62. https://doi.org/
approval. Nature 526(7575):622–623 10.1007/978-1-4939-0428-0_4
8. O’Connor M, Peifer M, Bender W (1989) 15. Borst EM, Hahn G, Koszinowski UH, Mes-
Construction of large DNA segments in serle M (1999) Cloning of the human cyto-
Escherichia coli. Science 244 megalovirus (HCMV) genome as an
(4910):1307–1312 infectious bacterial artificial chromosome in
9. Messerle M, Crnkovic I, Hammerschmidt W, Escherichia coli: a new approach for construc-
Ziegler H, Koszinowski UH (1997) Cloning tion of HCMV mutants. J Virol 73
and mutagenesis of a herpesvirus genome as an (10):8320–8329
infectious bacterial artificial chromosome. Proc 16. Wagner M, Koszinowski UH (2004) Mutagen-
Natl Acad Sci U S A 94(26):14759–14763 esis of viral BACs with linear PCR fragments
10. Saeki Y, Ichikawa T, Saeki A, Chiocca EA, (ET recombination). Methods Mol Biol
Tobler K, Ackermann M, Breakefield XO, Frae- 256:257–268
fel C (1998) Herpes simplex virus type 1 DNA 17. Menotti L, Cerretani A, Hengel H,
amplified as bacterial artificial chromosome in Campadelli-Fiume G (2008) Construction of
Escherichia coli: rescue of replication- a fully retargeted herpes simplex virus 1 recom-
competent virus progeny and packaging of binant capable of entering cells solely via
amplicon vectors. Hum Gene Ther 9 human epidermal growth factor receptor 2. J
(18):2787–2794 Virol 20(October):10153–10161
11. Horsburgh BC, Hubinette MM, Qiang D, 18. Warming S, Costantino N, Court DL, Jenkins
MacDonald ML, Tufaro F (1999) Allele NA, Copeland NG (2005) Simple and highly
replacement: an application that permits rapid efficient BAC recombineering using galK selec-
manipulation of herpes simplex virus type tion. Nucleic Acids Res 33(4):e36
1 genomes. Gene Ther 6(5):922–930 19. Menotti L, Avitabile E, Gatta V, Malatesta P,
12. Tanaka M, Kagawa H, Yamanashi Y, Sata T, Petrovic B, Campadelli-Fiume G (2018) HSV
Kawaguchi Y (2003) Construction of an excis- as a platform for the generation of retargeted,
able bacterial artificial chromosome containing armed, and reporter-expressing oncolytic
a full-length infectious clone of herpes simplex viruses. Viruses 10(7):E352
virus type 1: viruses reconstituted from the
clone exhibit wild-type properties in vitro and
in vivo. J Virol 77(2):1382–1391
Chapter 8
Rescue, Purification, and Characterization of a

Recombinant HSV Expressing a Transgenic Protein
Andrea Vannini, Biljana Petrovic, Valentina Gatta, Valerio Leoni,
Simona Pepe, Laura Menotti, Gabriella Campadelli-Fiume,
and Tatiana Gianni
Abstract
In the previous chapter, we describe the engineering of a HSV-BAC genome by galK recombineering. Here
we describe the procedures to reconstitute, or regenerate, the replicating recombinant virus, and the
methods to purify it and characterize it for the correct expression of the transgene. We present the example
of R-115, a recombinant expressing murine interleukin 12 (mIL12) from the US1–US2 intergenic region.
A specific method for the production of highly purified virions by iodixanol gradient, suitable for in vivo
applications, is also detailed.
Key words HSV rescue, Plaque purification, Plaque assay, Virion purification, mIL12 transgene
expression
1 Introduction
In the previous chapter we describe the engineering by galK

recombineering in E. coli of an HSV-BAC carrying a transgenic
cassette, exemplified by the HSV-BAC 115 recombinant, engi-
neered to encode murine IL12 (mIL12). Here we describe the
rescue of the recombinant virus R-115 [1] in susceptible and
permissive mammalian cells, the production of purified virions
suitable for animal experimentations, and the evaluation of the
transgenic mIL12 expression.
2 Materials
2.1 Cells, Cell 1. SK-OV-3 cells were purchased from ATCC and were grown in
Culture, RPMI Medium 1640-GlutaMAX-I with 100 units/mL peni-
and Transfection cillin and 100 μg/mL streptomycin (hereafter “RPMI-
153
154 Andrea Vannini et al.
GlutaMAX”), supplemented with 10% heat-inactivated FBS

(hereafter “FBSΔ”).
2. HSV-1 BAC DNA (e.g., R-115; [1]).
3. Phosphate buffered saline (PBS): 9.0 g NaCl, 795 mg Na2H-
PO4·H2O, 144 mg KH2PO4 in 800 mL ddH2O, adjust pH to
7.4, make up to 1 L with ddH2O, sterilize, store at 4 C.
4. Trypsin–EDTA (0.05%) in PBS without calcium and
magnesium.
5. 2 DMEM.
6. 5% agarose stock solution: dissolve 5 g of cell culture grade Sea
Plaque Agarose (Lonza) in 100 mL ddH2O, autoclave for
20 min at 121 C. While still hot, mix well. Store at room
temperature.
7. Agarose overlay (1%): melt the 5% agarose stock solution in a
microwave oven, let it cool at 45 C in water bath; in the
meantime prewarm 2 DMEM and RPMI-GlutaMAX at
45 C. For 100 mL final volume of agarose overlay (1% final
concentration), mix 20 mL of 5% agarose, 20 mL of
2 DMEM, 54 mL of RPMI-GlutaMAX, and 6 mL FBSΔ
(6% final concentration). Keep at 45 C until ready for use.
8. Lipofectamine 2000 (Life Technologies).
9. Acidic wash solution: 40 mM citric acid, 10 mM KCl, 135 mM
NaCl, pH 3; autoclave.
10. 70% ethanol.
11. 0.67% methyl cellulose (4000 centipoise) in RPMI-Gluta-
MAX/6% FBSΔ.
2.2 Iodixanol 1. Solution A. OptiPrep Sigma [60% (w/v) solution of iodixanol

solutions in water, sterile].
2. Solution B. Diluent (200 mL): mix 5.8 mL of 5 M NaCl
(0.85% final), 60 mL of 200 mM HEPES (60 mM final), adjust
pH to 7.4 with 1 M NaOH, make up to a final volume of
200 mL with ddH2O. Sterilize through a 0.2 μm filter.
3. Solution C: 50% iodixanol WS (working solution, for cushion):
mix 5 volumes of OptiPrep (Solution A) with 1 volume of
Diluent (Solution B).
4. Solution D: HEPES buffered saline (200 mL): 5.8 mL 5 M
NaCl (0.85% final), 10 mL 200 mM HEPES (10 mM final),
adjust pH to 7.4 with NaOH 1 M, make up to a final volume of
200 mL with ddH2O. Sterilize through a 0.2 μm filter.
5. Solution E: 25% iodixanol: mix equal volumes of 50% iodixanol
(Solution C) and HEPES buffered saline (Solution D).
Characterization of Reconstituted HSV-BAC Recombinants 155
2.3 Determination 1. DNaseI.

of Viral Genome Copies 2. Resuspension buffer: 10 mM Tris–HCl, 75 mM NaCl, 1 mM
by qPCR MgCl2, 0.02% PS-80, 5% sucrose, 0.1 mM EDTA, 10 mM L-
histidine, 0.5% ethanol, pH 7.4.
3. 0.5 M EDTA (pH 8.0): 186.1 g Na2EDTA·2H2O in 800 mL
ddH2O, adjust pH to 8.0 with NaOH, make up to 1 L with
ddH2O, aliquot and sterilize by autoclaving.
4. 0.2% SDS in ddH2O.
5. Proteinase K, 20 μg/mL in ddH2O.
2.4 Detection 1. Liquid nitrogen.

of Transgene 2. Fixing solution (e.g., methanol, 4% paraformaldehyde,
Expression by ELISA, ethanol).
FACS, or Western Blot
3. 0.1%/1% Triton X-100 in ddH2O.
4. Diluent for antibodies (immunostaining): 20% FBS in PBS.
5. AP buffer: 100 mM Tris, 100 mM NaCl, 5 mM MgCl2,
pH 9.6.
6. Substrate for alkaline phosphatase: 330 μg/mL NBT (nitro-
blue tetrazolium chloride) and 165 μg/mL BCIP (5-bromo-4-
chloro-30 -indolyphosphate p-toluidine salt) in AP buffer.
7. FACS buffer: 2% FBS in PBS.
8. Lysis buffer: 20 mM HEPES pH 7.5, 250 mM NaCl, 1 mM
EDTA, 1 mM DTT, 0.5% IGEPAL, 0.3 mM Nα-p-tosyl-L-
lysine chloromethyl ketone hydrochloride, 0.3 mM Nα-p-
tosyl-L-phenylalanine chloromethyl ketone.
2.5 Antibodies 1. Primary antibodies: MAb R1.302 (gift from Dr. Marc Lopez,
INSERM Marseille, or purchased from Santa Cruz Biotechnol-
ogy) to nectin1; MAb 9G6 (Santa Cruz) to HER2; PAb R140
to HVEM (gift from Dr. Gary Cohen, University of Pennsyl-
vania); MAb 52S to HSV gH [2].
2. Secondary antibodies: anti-mouse and anti-rabbit Alexa Fluor
488-, FITC- or alkaline phosphatase-conjugated antibodies.
2.6 Kits 1. Genomic DNA extraction kit.

2. Mouse IL-12 p70 ELISA kit (Thermo Scientific or R&D).
3. ECL Western blotting detection kit.
4. Reverse transcription kit.
2.7 Equipment 1. Bench instrumentation: benchtop centrifuges, microplate

reader, Western Blot apparatus and immunodetection system,
ultrasound sonicator, spectrophotometer, water bath, rocking
platform.
2. Microscopes: fluorescence microscope, inverted microscope,

stereomicroscope.
3. Molecular biology: PCR and RealTime-PCR thermal cyclers,
gel electrophoresis system, gel imaging system.
4. CO2 incubator for mammalian cell cultures.
5. Ultracentrifuge equipped with swing out (e.g., Beckman
SW28), fixed angle (e.g., Beckman Type 45 Ti), and vertical
(e.g., Beckman VTi 65) rotors and suitable tubes, Tube Sealer.
6. T25 and T175 tissue culture flasks.
7. 6-, 12-, and 24-well tissue culture plates.
8. 1.5 and 2 mL Eppendorf tubes.
9. 50 mL conical tubes.
10. Pasteur pipettes.
11. Cell scrapers.
12. 0.8 μm cellulose nitrate membrane filters.
13. Nitrocellulose or PVDF membranes.
3 Methods
3.1 Rescue The following protocol refers to transfection of SK-OV-3 cells.

of Recombinant Virus Transfect at least four recombinant clones, in duplicate.
(R-115) from BAC-DNA
1. The day before transfection, seed 4 105 SK-OV-3 cells per
by Transfection well of a 12-well tissue culture plate in RPMI-GlutaMAX/10%
FBSΔ. Incubate overnight at 37 C in a CO2 incubator and
allow cells to become 60–70% confluent.
2. Next day, dilute 4 μL of Lipofectamine 2000 in 100 μL of
medium without antibiotics and serum, mix gently and incu-
bate at room temperature for 5 min.
3. Meanwhile, dilute 0.5–1 μg of quantified HSV-BAC DNA in
100 μL of medium without antibiotics and serum (see Note 1).
4. Mix gently together the diluted DNA and Lipofectamine
2000, and incubate at room temperature for 20 min.
5. In the meantime, wash cell monolayers once with medium
without antibiotics and serum, remove the medium and add
1.3 mL of RPMI-GlutaMAX/2.5% FBSΔ with antibiotics (see
Note 2).
6. After the incubation time, gently transfer drop-by-drop the
DNA–Lipofectamine mix on cells using a pipette with wide-
orifice tip.
7. Incubate cells for 2–3 days at 37 C in a CO2 incubator. No
medium replacement is needed following transfection.
8. Allow plaques to develop for 2–3 days. Check the monolayers

under the fluorescence microscope for the expression of EGFP
reporter. In case you find many plaques in a well, detach cells
with a scraper and transfer with the medium in a 2 mL Eppen-
dorf tube. Sonicate or freeze at 80 C to release intracellular
recombinant virus and make the Seed (the first virus culture to
be used to start amplified virus cultures). Sonication is set at
12 μm peak to peak. Keep frozen at 80 C for long-term
storage.
9. Seed 1 106 SK-OV-3 cells per well of a 6-well tissue culture
plate in RPMI-GlutaMAX/10% FBSΔ. Incubate overnight at
37 C in a CO2 incubator.
10. Thaw the Seed lysate at 37 C in a water bath and infect the
SK-OV-3 monolayer in the 6-well tissue culture plate from
step 9 with 1 mL of the Seed lysate per well. Place the plate
on a rocking platform at 37 C for 1.5 h.
11. Remove inoculum, add RPMI-GlutaMAX/2.5% FBSΔ and
incubate for 2–3 days. This recombinant virus at passage
1 (p1) will serve for further analysis (e.g., transgene sequenc-
ing) and plaque purification (see Subheading 3.2).
3.2 Plaque 1. Seed 5 105 SK-OV-3 cells per well of a 12-well tissue culture
Purification plate in RPMI-GlutaMAX/10% FBSΔ. Incubate overnight at
37 C in a CO2 incubator and allow cells to become confluent.
2. Infect monolayers with 350 μL of tenfold dilutions of recom-
binant virus from passage 1 (p1). Place the plate on a rocking
platform at 37 C for 1.5 h. After virus adsorption, replace the
viral inoculum with agarose overlay (see Note 3). Incubate at
37 C in a CO2 incubator for 3–5 days and monitor the
formation of plaques.
3. The day before plaque picking, seed SK-OV-3 cells in 12-well
tissue culture plates as in step 1. In wells containing only a few
plaques, mark well-separated plaques under the stereomicro-
scope or fluorescence microscope (see Note 4).
4. Pick at least four single plaques by pushing a sterile glass
Pasteur pipette through the agarose overlay. Transfer the aga-
rose plugs by pipetting up and down several times in 500 μL
medium in a sterile 1.5 mL Eppendorf tube. Vortex and disrupt
the agarose plug by 15 s sonication.
5. Infect SK-OV-3 cells with 350 μL of the undiluted plaque
medium and 350 μL of three tenfold dilutions, from 101 to
103. Place the plate on a rocking platform at 37 C for 1.5 h.
Store the rest of the undiluted plaque medium at 80 C.
6. Carry out two additional rounds of plaque purification (steps
3–5).
7. After the third round of plaque purification, infect monolayers

of SK-OV-3 seeded in 6-well tissue culture plates or T25 flasks
(~105 cells/cm2) to amplify the four plaque-purified recombi-
nant viruses. Incubate for 2 days.
8. Choose the well or flask that contains the higher number of
plaques, detach cells by trypsinization and reseed all of them in
the same well or flask (1:1 trypsinization). Incubate for
2–3 days, or until infection is complete.
9. Detach the cells with a cell scraper and freeze the sample at
80 C to lyse the cells and release the intracellular recombi-
nant virus. Titer the lysate (see Subheading 3.5).
10. Extract the DNA from 200 to 300 μL of infected cell lysate of
the selected plaque-purified recombinants by using a Genomic
DNA Extraction kit. Confirm the presence of the transgene
(e.g., mIL12) by molecular assays.
3.3 Concentration The virion purification protocol entails a preliminary centrifugation

of Extracellular Virions in order to concentrate extracellular virions from the infected cell
by Ultracentrifugation medium, with near 100% recovery (see Note 5). Additional down-
stream purification steps may be included to decrease the amount of
contaminating cellular DNA and proteins.
1. Seed 11 T175 flasks with 1.8 107 SK-OV-3 cells in 25 mL
RPMI-GlutaMAX/10% FBSΔ per flask and incubate overnight
at 37 C in a CO2 incubator (see Note 6). Allow cells to become
80–100% confluent (it is not recommended to let cells become
over confluent).
2. Trypsinize one T175 flask and determine cell number. Proceed
if it is in the range of 1.8–2 107 cells/T175.
3. Infect the 10 T175 flasks at MOI 0.5 PFU/cell with the
plaque-purified recombinant virus (from Subheading 3.2,
step 9) in 7 mL of RPMI-GlutaMAX/2.5% FBSΔ per flask.
Incubate on a rocking platform for adsorption and entry at
37 C for 1.5 h.
4. Remove the viral inoculum and add 20–25 mL of RPMI-
GlutaMAX/2.5% FBSΔ per flask. Incubate at 37 C.
5. Observe the flasks daily for the presence of cytopathic effect
and the expression of a fluorescent reporter, if applicable (e.g.,
EGFP as in the case of R-115).
6. Two days after infection, check for full cytopathic effect
(rounded up or detached cells, see Note 7). Collect infected
cell medium and cells detached with a cell scraper. Distribute
the suspension in 50 mL conical tubes.
7. Spin down cells and debris by low-speed centrifugation, at
2000 g for 15–20 min at 4 C.
8. To pellet the virions, spin supernatant at 23,000 g for 1 h

10 min (see Note 8).
9. Remove carefully the supernatant, paying attention not to
touch or displace the virion pellet. Leave about 50 μL of
medium exactly on the virion pellet and let the tubes stand on
ice for about 30 min (see Note 9).
10. Resuspend the virion pellet by gentle pipetting (avoid vortex-
ing). Make small volume aliquots (50–100 μL) and store at
80 C. Thaw one aliquot and titer (see Subheading 3.5).
3.4 Purification This purification protocol includes an additional filtration step in

of Virions by Iodixanol order to separate the recombinant virions from cellular debris. The
Gradient ultracentrifugation is followed by an iodixanol gradient, where the
purified virions form a band which can be rescued. Purity is
improved at the expense of yield: the recovery of virions ranges
from 40% to 60% (see Note 5).
1. Seed 11 T175 with 1.8 107 SK-OV-3 cells in 25 mL RPMI-
GlutaMAX/10% FBSΔ per flask and incubate overnight at
37 C in a CO2 incubator (see Note 6). Allow cells to become
80–100% confluent (it is not recommended to let cells become
over confluent).
2. Trypsinize one T175 flask and determine the cell number.
Proceed if it is in the range of 1.8–2 107 cells/T175.
3. Infect the 10 T175 at MOI 0.1 PFU/cell with plaque-purified
recombinant virus (from Subheading 3.2, step 9) in 7 mL
RPMI-GlutaMAX/2.5% FBSΔ per flask. Incubate on a rocking
platform for adsorption and entry at 37 C for 1.5 h.
4. Remove the viral inoculum and add 25 mL of RPMI-Gluta-
MAX/2.5% FBSΔ per flask. Incubate overnight at 37 C.
5. The next day, move the flasks at 33 C and incubate for 4 addi-
tional days (total time of infection: 5 days) (see Note 10).
6. Observe the flasks daily for the presence of cytopathic effect
and the expression of a fluorescent reporter, if applicable.
7. Five days postinfection, check for full cytopathic effect
(rounded up or detached cells, see Note 7). Detach cells with
a scraper. Harvest infected cell medium and cells. Distribute the
suspension in 50-mL conical tubes.
8. Spin down cells and debris by low-speed centrifugation, at
2000 g for 15–20 min at 4 C.
9. Filter the supernatant through a sterile filter unit with cellulose
nitrate membrane, 0.8 μm pore size.
10. Meanwhile sterilize six 38.5-mL ultracentrifugation tubes: fill
with 70% ethanol, let stand for 15 min, wash five times with
sterile ddH2O and dry under laminar flow hood.
11. Transfer 1.5 mL of 50% iodixanol WS (solution C) into the

tubes (iodixanol cushion).
12. Carefully and very slowly, paying attention not to perturb the
iodixanol cushion, fill completely each tube with the filtered
supernatant from step 9, usually 37 mL (see Note 11).
13. Centrifuge at 121,300 g (max RCF) for 2 h to concentrate
the virus at the cushion–medium interface. Let the rotor stop
without brake.
14. Without disturbing the iodixanol cushion and the virus at the
interface, remove the upper layer (usually 35–36 mL), that is,
leave in the tube a volume equal to the volume of the cushion
(1.5 mL).
15. Mix the residual content of the tube. This will result in a
concentrated virus suspension in about 25% (w/v) of iodixanol
(solution E).
16. Distribute the suspension (usually about 18 mL) into smaller
5.1-mL ultracentrifuge quick seal tubes and fill, if necessary,
with 25% iodixanol (solution E).
17. Centrifuge at 1990 000 g (max RCF) overnight using a
vertical rotor, without brake for deceleration.
18. Secure the tubes on a metal stand (cannula) and harvest the
recombinant virus band with a syringe. Make small aliquots
(50–100 μL), store at 80 C. Thaw one aliquot and deter-
mine the recombinant virus titer (see Subheading 3.5).
3.5 Titration by Titration of the recombinant virus preparations is carried out in

Plaque Assay appropriate cells to determine the concentration of infectious viral
particles (as plaque-forming units [PFU]/mL). The protocol
below refers to a titration of R-115 in SK-OV-3 cell line.
1. Seed 5 105 cells in 1 mL RPMI-GlutaMAX/10% FBSΔ per
well of a 12-well cell culture plate (see Note 12). Incubate
overnight at 37 C in a CO2 incubator.
2. Prepare tenfold serial dilutions of recombinant virus in low
serum medium (RPMI-GlutaMAX/2.5% FBSΔ), in the
102–108 range (see Note 13).
3. Remove the medium from the wells of the 12-well plate and
infect the cell monolayers with 350 μL of the virus dilutions.
Incubate at 37 C for 1.5 h on a rocking platform for adsorp-
tion and infection.
4. Prepare the agarose overlay medium a few minutes before the
end of the virus adsorption period and keep it at 45 C to
prevent solidification (see Note 3). Replace the virus inoculum
with 1 mL/well of the agarose overlay. Keep the plates at RT
for 20 min to allow the agarose solidify. Incubate at 37 C for

4–5 days in a CO2 incubator.
5. Score the number of plaques using a microscope or stereomi-
croscope. If the virus expresses a fluorescent marker, use a
fluorescence microscope with the appropriate filters to score
the number of plaques. Only wells containing 10–100 plaques
are counted. Virus titer is expressed as PFU per mL (see Note
14).
If the plaques are not easily detectable (e.g., they are too
small), it is possible to perform an immunostaining of the
infected cell monolayers. In this case the agarose overlay must
be avoided, and replaced with other overlays suitable for pla-
ques formation. After steps 1–3, proceed with step 6.
6. Add the appropriate amount of neutralizing antibody to low
serum medium (e.g., RPMI-GlutaMAX/2.5% FBSΔ). For
R-115, 52S ascites (anti gH) is used at 1:10,000 dilution.
Alternatively, medium supplemented with 0.67% methyl cellu-
lose can be used. Replace the virus inoculum with 1 mL/well of
medium with antibody, and incubate at 37 C for 4–5 days in a
CO2 incubator (see Note 3).
7. Remove the medium and fix the cell monolayers with 500 μL of
a fixing reagent (e.g., methanol at 20 C for 10 min, 4%
paraformaldehyde in PBS at RT, or other reagents) (see Note
15). Wash the cell monolayers twice with 1 mL PBS.
8. To carry out the staining of an intracellular antigen, after fixing
with crosslinking reagents (e.g., paraformaldehyde) an extra
step is added to permeabilize the cells: incubate with
PBS + 0.1–1% Triton X-100 for 20 min, then wash twice with
1 mL PBS. This step can be avoided following fixing with
alcohols, that simultaneously fix and permeabilize cells, or if
the target antigen is displayed on the cell surface.
9. Primary antibody: incubate the cell monolayers with 350 μL
PBS + 20% FBS + primary antibody. For R-115 recombinant
virus, a 1:500 dilution of 52S antibody is used (see Note 15).
Incubate for 60 min at RT. Wash the cell monolayers twice with
1 mL PBS.
10. Secondary antibody: incubate the cell monolayers with 350 μL
PBS + 20% FBS + diluted secondary antibody for 60 min. Wash
the cell monolayers twice with 1 mL PBS.
11. Following fluorochrome-conjugated secondary antibody stain-
ing, use a fluorescence microscope with the appropriate filters
to score the number of plaques (as above, count wells contain-
ing 10–100 plaques). Following an incubation with an alkaline
phosphatase-conjugated secondary antibody, wash cell mono-
layers with 1 mL of AP buffer, then add 350 μL of AP sub-
strate. Incubate at 37 C for 30 min for a violet/gray stain to
develop, stop by washing with PBS and score the number of

plaques and calculate infectious recombinant virus titer (see
Note 14).
3.6 Titration by Viral particles can be titrated also by determination of the genome
qPCR: Determination copies (gc). From this value it is possible to calculate the gc/PFU
of Viral Genome Copies ratio. This parameter provides an estimate of the infectious to
encapsidated/enveloped noninfectious viral particles present in
the recombinant virus preparation. The ratio obtained for a certain
recombinant virus relative to that of the wild type virus is an indirect
indication of the amount of defective viral particles. Clearly, the
procedure illustrated below can be modified relative to the DNaseI
treatment and/or the employment of detergent in the resuspension
buffer. For example, by omitting the DNaseI treatment, one can
obtain a measure of the amount of unencapsidated/uneveloped
viral DNA. The protocol below refers to a titration of R-115.
1. Dilute virions 1:100 in resuspension buffer and add 50 U of
DNaseI to 100 μL of the dilution. Incubate 30 min at 37 C.
This step digests the nonencapsidated recombinant virus gen-
omes, and enables the gc quantification for encapsidated
virions only.
2. Stop the DNaseI digestion by adding 5 μL of 0.5 M EDTA and
incubating at 80 C for 20 min.
3. Add 45 μL of 0.2% SDS and 5 μL of 20 μg/μL Proteinase K to
50 μL of the previous solution. Vortex and incubate for 1 h at
56 C, then for 15 min at 95 C. Viral DNA is released in
solution.
4. Prepare tenfold serial dilutions of viral DNA in ddH2O, in the
102–104 range.
5. To make a standard curve, use ddH2O to dilute spectrophoto-
metrically quantified DNA of HSV-BAC 115 to 108 genomes/
μL. Prepare tenfold serial dilutions in ddH2O, to obtain
107–101 genomes/μL.
6. Use viral and HSV-BAC DNA dilutions in a qPCR reaction.
Five μL of each dilution are used as template for reactions run
in triplicate. For example, for R-115, a Taqman qPCR assay is
performed, using the primers DnapolFw (CATCACC-
GACCCGGAGAGGGAC) (forward), DnapolRev
(GGGCCAGGCGCTTGTTGGTGTA) (reverse), and DNA_-
Pol_PROBE (50 FAM–30 Tamra CCGCCGAACTGAGCAGA-
CACCCGCGC), annealing to HSV UL30 ORF (DNA
polymerase) [3].
7. Use the standard curve obtained with HSV-BAC DNA (ct vs
genome copies) to interpolate the values obtained for the serial
dilutions of virions. Calculate the average of values obtained
from the 102–104 dilutions. Express values as gc/mL, and

divide by the titer expressed as PFU/mL. Calculate the
gc/PFU ratio (see Note 16).
3.7 Detection This assay allows the detection of the transgenic protein encoded by
of Transgene the recombinant virus. The following protocol refers to an assay in
Expression SK-OV-3 cell line.
1. Seed a 12-well cell culture plate with 5 105 cells in 1 mL
RPMI-GlutaMAX/10% FBSΔ (see Note 12). Incubate over-
night at 37 C in a CO2 incubator.
2. Infect the cell monolayers with the recombinant virus expres-
sing the transgene (e.g., R-115 engineered to encode mIL12)
or with the control recombinant virus (e.g., R-LM113, same
backbone, but no transgene) at 0.1–1 PFU/cell in 350 μL of
low serum medium. Incubate at 37 C for 90 min on a rocking
shaker.
3. Replace the virus inoculum with 1.5 mL of low serum medium.
Incubate plates at 37 C for 3 days in a CO2 incubator.
Follow steps 4 and 5 for detection of transgene expression by
ELISA.
4. At 24, 48, and 72 h postinfection, withdraw an appropriate
volume (150–300 μL) of culture medium from each well, pellet
and discard any cell, recover the supernatant and snap freeze in
liquid nitrogen to avoid protein degradation.
5. Proceed with transgenic protein quantification, using a com-
mercial or in house ELISA kit. Express the concentration of
secreted protein as pg/mL. For example, to quantify mIL12
secreted by cells infected with R-115 recombinant virus,
150 μL of medium are taken from wells infected with R-115
or R-LM113 (control), at 24, 48, and 72 h after infection.
50 μL of each sample is used in ELISA, in duplicate, following
the manufacturer’s instructions. To eliminate matrix effect on
the values, averages of the replicates of the mIL12-positive
recombinant virus R-115 are subtracted of mIL12 background
values detected in the medium of the control mIL12-negative
recombinant virus (e.g., R-LM113 [4]).
Follow steps 6–10 for detection of transgene expression by
flow cytometry.
6. At 24, 48, and 72 h postinfection, remove the medium and
detach cells using a scraper, or by trypsinization.
7. Pellet cells at 400 g for 7 min, then resuspend the pellet in
50 μL of ice-cold FACS buffer to dissociate any clump. Keep
cells on ice for the rest of the experiment.
8. React cells with the appropriate dilution of fluorochrome-

conjugated antibody directed against the transgenic product.
Keep a sample unstained as negative control. Incubate on ice
for 30 min (see Note 17).
9. Wash cells twice with 1 mL of FACS buffer, pelleting at 400 g
for 7 min. Resuspend pellets in 300 μL of FACS buffer.
10. Acquire the sample data by flow cytometry (1–5 104 events
in the gate, per sample) with the appropriate filters. Express the
data as the mean intensity of the fluorescence signal of the
stained cells, after subtraction of the mean fluorescence inten-
sity of the cells reacted with the secondary antibody only.
Follow steps 11–13 for detection of transgene expression by
Western blot.
11. For a secreted transgene product, at 24, 48, and 72 h postin-
fection, take an aliquot of the medium. For an intracellular or
cell-associated transgene product, remove the medium and lyse
cells with 200 μL lysis buffer. Incubate on ice for 15 min. Pellet
cell debris at 11,000 g for 10 min and discard the pellets.
12. Measure protein concentration in the media or supernatants by
either direct fluorescence determination, Bradford or BCA,
using a standard curve with known concentrations of bovine
serum albumin.
13. Use the same amount of proteins (in the range of 10–250 μg)
or the same volume of medium (for secreted proteins) for SDS
polyacrylamide gel electrophoresis (SDS PAGE). Transfer the
proteins to a nitrocellulose or PVDF membrane and detect
transgenic product and control proteins (e.g., tubulin or
β-actin) with appropriate antibodies. Develop WB with ECL
reagents, detect and quantify signals as appropriate. For a
qualitative assay, compare cell lysates infected by transgene-
expressing or -non-transgene-expressing viruses. For a semi-
quantitative analysis, use known amounts of the purified trans-
genic product to create a standard curve in the blot. Use the
curve to calculate the amount of transgenic product expressed
by the infected cells.
3.8 Detection 1. At 24, 48, and 72 h postinfection, remove the medium and
of Transgene mRNA extract total RNA with a commercially available kit, according
Expression by to the manufacturer’s instructions. Determine RNA concen-
qRT-PCR tration with an UV spectrophotometer.
2. Use 2 μg of RNA for cDNA synthesis, with a retrotranscription
kit, according to the manufacturer’s instructions.
3. Dilute the cDNAs in ddH2O (1:5) and use 2 μL in a qRT-PCR
reaction. For the quantification of transgenic mIL12 expressed
from R-115-infected cells, a qRT-PCR assay is performed,
using the probes for mIL12 (Mm00434169_m1) and for a

housekeeping gene of SK-OV-3 cells (human gapdh, Taqman
assay Hs99999905_m1). Calculate results by means of Δct
method, comparing the expression of mIL12 in cells infected
with R-115- or the control mIL12-negative R-LM113 recom-
binant virus.
3.9 Extent 1. Seed a 24-well cell culture plate with the cell lines of choice (see
of Infection Note 12). Incubate at 37 C in a CO2 incubator.
2. Infect cells at 2–10 PFU/cell with the recombinant and the wt
control virus, or mock-infect. Infections are carried out in
200 μL of low serum medium. Incubate at 37 C for 90 min
on a rocking platform.
3. Replace the viral inoculum with 500 μL of fresh low serum
medium. Incubate for 24–48 h at 37 C in a CO2 incubator.
4. If the recombinant virus expresses a fluorescent marker, moni-
tor infection by fluorescence microscopy with the appropriate
filters. Otherwise, an immunostaining can be performed (see
Subheading 3.5, step 5).
5. To quantitatively measure the infected cells, analyze samples by
flow cytometry. After steps 1–3, remove the medium and
detach cells using a scraper, or trypsin–EDTA.
6. Pellet cells at 400 g for 7 min, then resuspend the pellet in
50 μL of ice-cold FACS buffer to dissociate any clumps. Keep
cells on ice for the rest of the experiment.
7. If recombinant virus expresses a fluorescent marker, go to step
9. Otherwise, select a virus-expressed protein, which is loca-
lized on the surface of the cell, and use the appropriate amount
of fluorochrome-conjugated antibody directed against this
protein (see Note 17). Incubate on ice for 30 min.
8. Wash cells two times with 1 mL of FACS buffer, pelleting at
400 g for 7 min. Resuspend in 300 μL of FACS buffer.
9. Acquire the sample with a flow cytometer with appropriate
filters for the fluorochrome (1–5 104 events in the gate, per
sample). Use the signal of the mock-infected cells to set the
“zero” of the fluorescence, and express the infection as the
percentage of infected cells.
3.10 Extent The protocol below refers to an assay carried out in SK-OV-3 cells
of Recombinant Virus to measure the kinetic of recombinant virus production in infected
Replication cells.
1. Seed 12-well cell culture plates with 5 105 cells in 1 mL
RPMI-GlutaMAX/10% FBSΔ (see Note 12). Incubate at
37 C in a CO2 incubator overnight. The number of plates
corresponds to the time points to be analyzed (usually at least

two, for 24 and 48 h).
2. Infect cells at 0.1–1 PFU/cell. Infections are carried out in
350 μL of low serum medium (RPMI-GlutaMAX/2.5%
FBSΔ). Incubate for adsorption and entry at 37 C for
90 min on a rocking shaker.
3. To inactivate unpenetrated recombinant virus, wash once with
PBS, then perform an acidic wash (pH 3 wash) for 1 min. Wash
twice with 1 mL of PBS. Then, add 1 mL/well of low serum
medium. Incubate at 37 C in a CO2 incubator.
4. Block the infections at the chosen time points (24 and 48 h) by
freezing the plate at 80 C.
5. Seed 12-well plates for titration (see Subheading 3.5).
6. Thaw the frozen plates on ice, scrape the bottom of each well
and collect the medium with the cell lysate in 2 mL Eppendorf
tubes.
7. Sonicate the content of the tubes to release the viral particles
from the cells.
8. Perform titration with serial dilutions as described (see Sub-
heading 3.5). Express results as PFU/mL or PFU/cell at
24 and 48 h.
4 Notes
1. When handling HSV-BAC DNA always use wide-orifice tips to

prevent DNA fragmentation.
2. For transfection of SK-OV-3 cells, which grow in medium
supplemented with 10% FBSΔ, serum is reduced to 2.5%. For
other cell lines, that normally require media containing 5%
FBS, serum may be reduced to 1% FBS.
3. The agarose layer blocks the diffusion of progeny virus in the
medium and allows viral spread only to adjacent cells. At suit-
able dilutions, every plaque derives from a single virion present
in the initial inoculum. Methyl cellulose has the same mechani-
cal effect on virus progeny diffusion. An equivalent result can
be obtained with neutralizing antibodies, which block progeny
virus released in the medium.
4. Infected cells display rounding (cytopathic effect, c.p.e.). At
late stages of infection they lyse. This phenomenon causes the
light passing through infected cells to refract differently than
the surrounding uninfected cells, and the plaque can be visua-
lized under the stereomicroscope as a darker zone, with possi-
bly a small hole at the center. If you do not feel confident, and if
the recombinant virus expresses a suitable reporter (e.g., EGFP
as in R-115), before picking up the plaques you can check

under the fluorescence microscope.
5. Take aliquots during the purification process for analysis and
titration to monitor recovery at every step.
6. This procedure is devised for the preparation of virions from
10 T175 flasks of SK-OV-3 cells. The protocol can be scaled up
or down depending on specific needs.
7. SK-OV-3 cells never detach completely from the flask, but all
cells should be rounded up.
8. Higher g-force can make virion resuspension difficult.
9. This will allow the virion pellet to resuspend more easily. It is
pivotal to avoid drying of the pellet during the incubation
on ice.
10. For the production of recombinant virions, which may repli-
cate more slowly than wt virus, lowering the temperature to
33 C slows down cell growth allowing more time to recombi-
nant virus replication and avoiding cells outgrowing the virus.
After 5 days, cells will look strongly altered, but will neverthe-
less give a good virus yield. For every combination of recombi-
nant virus and host cell line, it is worth comparing the
recombinant virus growth in standard conditions (2–3 days at
37 C) with the low temperature conditions (1 day at 37 C
followed by 4 days at 33 C).
11. To speed up the process, you can also first fill the tube with
supernatant and afterward add quickly 1.5 mL of 50% iodix-
anol WS going at the bottom of the tube.
12. As a general rule, for infection seed the wells with a number of
cells suitable to achieve 100% confluency after an overnight
incubation and do not exceed with the number of cells. In
particular, titration assays performed in highly dense mono-
layers can lead to underestimation of the actual recombinant
virus titer.
13. According to the expected titer and the quantity of recombi-
nant virus available, serial dilutions may start from 101, made
by adding 50 μL of recombinant virus to 450 μL of low serum
medium. For small amounts of concentrated recombinant
virus (usually virions) the first dilution is 102, made by adding
5 μL of recombinant virus to 495 μL of low serum medium. All
the subsequent tenfold dilutions are prepared by adding 50 μL
of the previous dilution to 450 μL of low serum medium.
14. Calculation of the titer: number of plaques
(PFU) 10(dilution)/0.35 mL. For example, 23 plaques in
dilution 8 correspond to 23 PFU 108/0.35 mL ¼ 6.6 109
PFU/mL. For accuracy and statistical significance, the titra-
tions should be carried out in duplicate or triplicate.
15. The choice of fixing solution depends on the primary antibody

to be used for the immunostaining. For different antigens, the
optimal combination of fixing conditions and working anti-
body concentration must be determined by the operator.
16. Recombinant virion preparations are typically in the range of
200–300 gc/PFU in SK-OV-3, which means one infectious
virion every 200–300 virions. This value indicates a great prev-
alence of nonencapsidated genomes (>99.5%) over the infec-
tious virions.
17. As an alternative to a fluorochrome-conjugated antibody
directed against the transgene product, it is possible to use a
primary antibody directed to the antigen of interest, followed
by a fluorochrome-conjugated secondary antibody. The opti-
mal working antibody concentrations must be determined by
the operator.
Acknowledgments
This work was supported by European Research Council (ERC)

Advanced Grant number 340060, VII framework program to G.
C.-F., by RFO (University of Bologna) to L.M. and T.G, and by
Fondi Pallotti to T.G.
Competing interests: G.C.-F. owns shares in Nouscom Srl. B.P. is
currently an employee of Nouscom Srl. G.C.-F. and L.M. receive
equity payments from Amgen. The funders had no role in study
design, data collection and analysis, decision to publish, or prepa-
ration of the manuscript.
References
1. Menotti L, Avitabile E, Gatta V, Malatesta P, Lollini PL, Casiraghi C, Campadelli-Fiume G

Petrovic B, Campadelli-Fiume G (2018) HSV (2018) A fully-virulent retargeted oncolytic
as A platform for the generation of retargeted, HSV armed with IL-12 elicits local immunity
armed, and reporter-expressing oncolytic and vaccine therapy towards distant tumors.
viruses. Viruses 10:pii:E352 PLoS Pathog 14:e1007209
2. Peng T, Ponce de Leon M, Novotny MJ, 4. Menotti L, Cerretani A, Hengel H, Campadelli-
Jiang H, Lambris JD, Dubin G, Spear PG, Fiume G (2008) Construction of a fully retar-
Cohen GH, Eisenberg RJ (1998) Structural geted herpes simplex virus 1 recombinant capa-
and antigenic analysis of a truncated form of ble of entering cells solely via human epidermal
the herpes simplex virus glycoprotein gH-gL growth factor receptor 2. J Virol
complex. J Virol 72:6092–6103 20:10153–10161
3. Leoni V, Vannini A, Gatta V, Rambaldi J,
Sanapo M, Barboni C, Zaghini A, Nanni P,
Chapter 9
CRISPR/Cas9-Based Genome Editing of HSV

Thilaga Velusamy, Anjali Gowripalan, and David C. Tscharke
Abstract
The CRISPR/Cas9 gene editing system is a robust and versatile technology that has revolutionized our
capacity for genome engineering and is applicable in a wide range of organisms, including large dsDNA
viruses. Here we provide an efficient methodology that can be used both for marker-based and for marker-
free CRISPR/Cas9-mediated editing of the HSV-1 genome. In our method, Cas9, guide RNAs and a
homology-directed repair template are provided to cells by cotransection of plasmids, followed by intro-
duction of the HSV genome by infection. This method offers a great deal of flexibility, facilitating editing of
the HSV genome that spans the range from individual nucleotide changes to large deletions and insertions.
Key words CRISPR/Cas9, Herpes simplex virus, Genome editing, Recombinant viruses, Homol-
ogy-directed repair
1 Introduction
The advent of molecular cloning and genetic engineering technol-

ogies has greatly accelerated basic biological research into herpes
simplex viruses (HSV). Until now, a variety of emerging technical
methods, including RNA interference, gene knockout, and heter-
ologous gene expression technologies, have been tailored to inves-
tigate HSV pathogenesis and exploit HSV as a possible
recombinant gene-delivery system. In addition, with the advent of
high-throughput sequencing technologies, the availability of
sequenced genomes of various HSV-1 strains has also continued
to expand, revealing the existence of various uncharacterized
HSV-1 genes and highlighting novel complexities in the organiza-
tion of HSV-1 genomes. These advancements provide great oppor-
tunities for understanding functional interactions between different
viral proteins, small noncoding RNAs and the viral genome itself, as
well as gaining further insights into the virus–host relationship.
However, although conventional methods are able to modify target
HSV genes, the editing efficiencies of these methods are relatively
low [1, 2]. As a consequence, small changes are difficult, if not
169
170 Thilaga Velusamy et al.
impossible unless accompanied by a marker gene and that is rarely

desirable. Further, screening for recombinants in a large back-
ground of nonrecombinant parent virus is laborious and purifica-
tion can take many rounds of plaque selection.
Recently, unparalleled advancements in genome engineering
technology have greatly improved the efficiency of generating
recombinant organisms, including HSV [3, 4]. Among these tech-
nologies is the CRISPR/Cas system, where CRISPR and Cas are
acronyms for “clustered regularly interspaced palindromic repeats”
and “CRISPR-associated (Cas) proteins,” respectively. The most
widely used variant of this technology is based on the type II
CRISPR system from Streptococcus pyogenes [5, 6]. This adapted
bacterial system consists of a single chimeric-guide RNA (sgRNA)
and the Cas9 nuclease. The sgRNA combines the function of two
smaller RNAs from the original bacterial system, namely the target-
recognizing CRISPR RNA (crRNA) and the auxiliary trans-
activating crRNA (tracrRNA), which facilitates binding to the
Cas9 protein. Following sgRNA binding, Cas9 catalyzes a
double-stranded break in the target genome [6, 7]. The location
of this break is conferred by complementarity between the crRNA
portion of the sgRNA and the target genome [7]. As sgRNA
sequences can be chosen with relatively few constraints, the
sgRNA-Cas9 complex is considered a programmable, sequence-
guided nuclease.
CRISPR/Cas9-mediated events take place inside intact cells,
allowing the Cas9-mediated genome break to be repaired by cellu-
lar repair mechanisms, such as nonhomologous end joining or
homology directed repair (HDR) [8–11]. Nonhomologous end
joining can introduce insertions or deletions at the target site and
so is useful for creating gene knockouts (generally through changes
to the reading frame). However, provision of a DNA fragment with
homology to the region spanning the Cas9 cut site allows cells to
repair the break using homologous recombination. This method
enables targeted changes to a genome to be made [12]. It is this
second repair method that we have found most useful for creating
HSVs for our research.
In the CRISPR/Cas9 context, concurrent expression of a Cas9
gene that has been engineered to include a nuclear localization
signal and sgRNAs are essential for genome editing. The method
described in this chapter makes use of a plasmid that simultaneously
expresses Cas9 and an sgRNA. This plasmid allows the insertion of
a 20-nucleotide sequence that becomes part of the sgRNA when
transcribed by a Polymerase III promoter and will guide Cas9 to
the desired location in the HSV genome. Cotransfection of 293A
cells with this CRISPR plasmid and a template for HDR, followed
by infection of transfected cells using HSV-1 that provides genomic
backbone for recombination, results in precise editing of the
HSV-1 genome [3]. This method can be used for accurate
CRISPR/Cas9-Based Editing of HSV 171
modification of short nucleotide sequences, as well as insertion,

replacement or deletion of genes or large DNA fragments in the
HSV-1 genome. Finally due to the high efficiency of the method,
screening of recombinant viruses can be performed using a poly-
merase chain reaction (PCR), circumventing the need for introdu-
cing a marker gene for selection or screening.
In the protocol that follows, we describe our entire approach,
from the standard molecular biology tasks required to make the
vectors needed for CRISPR/Cas9 engineering to the screening of
recombinants. We expect most readers will dip in for the CRISPR/
Cas9-specific details and bolster this protocol with their own pre-
ferred methods.
2 Materials
2.1 Reagents 1. Plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (hereafter

pX330; Addgene plasmid # 42230) (see Note 1).
2. HSV-1, KOS strain (see Note 1).
3. 293A cells. This is a subclone of HEK-293 that retains a stably
integrated copy of the Adenovirus E1 gene and can be pur-
chased from a variety of commercial suppliers (see Note 1).
4. Vero cells (ATCC CCL-81).
5. Lipofectamine 2000® (Thermo Fisher Scientific™).
6. High fidelity DNA polymerase (e.g., Phusion High fidelity
DNA polymerase; NEB).
7. Taq DNA polymerase with standard Taq buffer.
8. DNA markers (100 bp and 1.0 kb).
9. TAE electrophoresis buffer: 40 mM Trizma base, 20 mM gla-
cial acetic acid, and 1 mM EDTA in H2O.
10. UltraPure™ Agarose (Life Technologies).
11. In-Fusion PCR cloning kit (Clontech).
12. Restriction enzyme BbsI with 10 buffer 2.1 (NEB).
13. T4 DNA ligase and 10 reaction buffer.
14. One Shot™ Stbl3™ chemically competent E. coli (Invitrogen).
15. PBS (Sigma-Aldrich).
16. LB medium: 10 g/L tryptone (Bacto), 5 g/L yeast extract
(Bacto), 10 g/L sodium chloride in H2O.
17. LB Agar plates: 1.5% (w/v) agar (Bacto) in liquid LB medium.
18. Ampicillin, 100 mg/mL.
19. Gel extraction kit (e.g., Wizard SV Gel and PCR Cleanup
System, Promega).
20. Plasmid Miniprep Kit (e.g., AxyPrep, Axygen).

21. 3 M Sodium Acetate solution (NaOAc), pH 5.2.
22. 100%, 70% ethanol.
23. Proteinase K.
24. Proteinase K DNA prep mix: 10 μg/mL of proteinase K in 1
ThermoPol PCR buffer (New England Biolabs).
2.2 Cell Culture 1. D0 medium: Dulbecco’s Modified Eagle Medium (DMEM),

Media high glucose with phenol red and supplemented with 2 mM L-
glutamine. We do not add antibiotics.
2. D2 medium: Heat-inactivated fetal bovine serum (FBS) is
added at a concentration of 2% (v/v) to D0 medium.
3. D10 medium: 10% (v/v) heat-inactivated FBS in D0 medium.
4. M0 medium: MEM with phenol red, supplemented with
4 mM L-glutamine, 5 mM HEPES buffer and 50 μM
β-mercaptoethanol.
5. M2 medium: Heat-inactivated FBS is added at a concentration
of 2% (v/v) to M0.
6. CMC-MEM: 0.4% (w/v) carboxymethyl cellulose in M2
medium.
2.3 Equipment 1. Filtered sterile pipette tips.

2. 2 mL screw cap polypropylene tubes.
3. 0.5 μL PCR tubes.
4. 6- and 96-well tissue culture plates.
5. 25 and 75 cm2 tissue culture flasks.
6. Thermal cycler.
7. Desktop microcentrifuge.
8. Gel electrophoresis system.
9. GelDoc Ez™ digital gel imaging system (Bio-Rad), for stan-
dard visualization of agarose gels.
10. Blue-light transilluminator and protective orange filter goggles
to visualize bands on agarose gels (Thermo Fisher Scientific),
for visualization of agarose gels for purification of DNA
fragments.
11. NanoDrop™ 2000c UV spectrophotometer to determine
DNA concentration (Thermo Fisher Scientific).
12. Lightbox.
13. Laboratory water bath.
14. Shaking incubator.
15. Cell culture CO2 Incubator.
16. Class II biosafety cabinet.

17. Water bath.
18. Heat block.
19. Hemocytometer for counting cells.
21. Parafilm®.
22. Flow cytometer (optional).
3 Methods
3.1 Constructing Use pX330 as a parent plasmid to construct a targeted CRISPR/

a Guide RNA and Cas9- Cas9 system. It is a single expression vector with a cloning site at
Expressing Plasmid which DNA can be inserted into and driven by the U6 (Polymerase
III) promoter. The inserted DNA will encode the desired guide
RNA sequence. This vector also contains a human codon-
optimized spCas9 gene with nuclear localization signals driven by
the CBh promoter [7].
3.1.1 Design 1. Identify a place in the HSV genome with the sequence GG in
and Preparation close proximity to the desired genome modification site. If the
of the Targeting 21 nucleotides upstream from this site have characteristics
Oligodinucleotide Guide similar to a good PCR primer, this will form a suitable crRNA
portion for the sgRNA sequence (see Note 2). Note that this
sequence can be taken from either strand of the genome. The
20 nucleotides at the 50 end of this sequence should be added
to the vector, with one further condition: If the 50 end is not
a G, add an extra G to that end, which enhances the efficiency
of the U6 promoter and gives you a 21 nucleotide sequence (see
Fig. 1).
2. Once this 20 or 21 nucleotide sequence has been identified,
purchase complementary oligodeoxynucleotides (oligos) that
when annealed create a dsDNA carrying this sequence and have
overhangs compatible for cloning into pX330 at the BbsI cut
site. See Fig. 1 for an example.
3. Resuspend each oligo of the pair to a final concentration of
10 μM in H2O. Mix the complimentary oligos at the equimolar
ratio, typically by mixing 10 μL of each oligo in a 0.5 μL PCR
tube. Anneal the oligos by incubating the mixture at 95 C for
5 min in a heat block, followed by slow cooling at room
temperature.
Fig. 1 Designing HSV-1 appropriate CRISPR/Cas9-associated guide sequences. (1) Choosing a target site and
gRNA. Search the HSV-1 genome near the modification site for GG sequences (orange) and identify the 21 bp
sequence 50 to this motif. Check that this sequence would make a good primer. The first 20 bp of this
sequence is the template for the gRNA (purple), which needs to be inserted into a pX330 vector. Either strand
of the HSV genome can be used. (2) Identify the overhangs left by BbsI digestion of the pX330 vector.
(3) Design the dsDNA oligo. Append additional bases (blue) to the ends of each of the oligo such that once
annealed there are appropriate overhangs for ligation. If not already present, a guanine (grey) can be
appended to the 50 end of the 20 bp guide-encoding sequence to improve efficiency of the U6 promoter
3.1.2 Preparation 1. Digest the pX330 plasmid with BbsI. For this, mix together
of pX330 for Insertion of a 2.5 μg of plasmid, 50 units of BbsI enzyme, 1 buffer 2.1, and
Guide DNA Sequence H2O in a final volume of 125 μL. Gently mix and incubate the
reaction mixture at 37 C overnight.
2. Subject the restriction enzyme reaction mix to separation by
electrophoresis using a 1% (w/v) agarose gel. Visualize on a
lightbox (avoid using a UV-based dye/lightbox combination if
possible) and cut out a slice of gel containing the linearized
plasmid DNA fragment. Purify the DNA from the gel slice
using an appropriate gel purification kit and determine the
purified DNA concentration. This purified BbsI cut-plasmid
DNA can be stored at 20 C until further use.
3. Carry out a second round of restriction enzyme digestion
of the previously cut and purified plasmid DNA to make sure
that both BbsI sites in pX330 have been subjected to digestion
(see Note 3). For this, mix 50 ng of the previously cut plasmid,
1 buffer 2.1, 5 units of BbsI enzyme and H2O in a total

volume of 20 μL. Gently mix and incubate the reaction mix at
37 C for 1 h. Use this reaction mix directly for ligation
reactions.
3.1.3 Ligation of Guide 1. Add 1 μL of annealed oligo mix (see Subheading 3.1.1), 1.5 μL
DNA to Linearized pX330 of T4 DNA ligase enzyme and 2.5 μL of T4 DNA ligase buffer
to the restriction enzyme reaction described in the previous
step (see Subheading 3.1.2) to give a total reaction volume of
25 μL. Gently mix and incubate at 37 C for 1 h.
2. Additionally, set up a ligation without the annealed oligo to
control for the presence of incompletely cut vector.
3.1.4 Transformation 1. Typically, add 2 μL of the ligation mix to a vial of competent

and Screening for pX330 cells (e.g., One Shot™ Stbl3™ chemically competent E. coli).
Containing the Guide Insert Mix the contents gently by flicking the tube or swirling using a
sterile pipette (200 μL) tip. Incubate the cells on ice for 30 min,
followed by 45 s of heat shock at 42 C in a water bath. Cool
the tubes immediately on ice for 2 min with the subsequent
addition of 1 mL of prewarmed LB medium. Incubate the
tubes for a further 60 min in a shaking incubator set to 37 C
and 250 rpm.
2. Spread 100 μL of each lot of transformed cells onto LB agar
plates containing 100 μg/mL ampicillin and incubate over-
night at 37 C.
3. The following day, screen colonies by PCR for those containing
the desired plasmid. We simply emulsify a portion of a colony in
H2O, heat kill the bacterial cells at 95 C for 2 min and briefly
centrifuge to pellet the cell debris. We use 2 μL of the clear
lysate as template in a standard PCR, marking the plate to allow
identification. We use the oligo that formed the top strand of
the annealed dsDNA fragment as a forward primer with a
reverse primer that matches the vector (50 TAGATGTACTGC-
CAAGTAGGAA 30 ).
4. Culture the desired clone in 5 mL of LB broth with antibiotic
overnight at 37 C in a shaking incubator. Following this,
extract the plasmid DNA using a plasmid miniprep kit and
verify the sequence of the DNA insert.
3.2 Longer Double- Larger genetic modifications can be achieved through the genera-
Stranded DNA tion of long double-stranded DNA templates. For insertion or
Templates for HDR deletion of sizeable DNA fragments into genomes, it is preferable
to use double-stranded DNA templates with relatively long homol-
ogous arms, for instance, 500 bp each (see Fig. 2). We use the
In-Fusion cloning system to stitch together the homology arms,
desired DNA insert and vector backbone. This cloning system
allows the insertion of multiple DNA fragments into a linearized
Fig. 2 HDR repair template design. Cas9 typically catalyzes double-stranded breaks in DNA 4–5 bp upstream
of the GG motif (orange) and within the original target sequence (purple). Following cleavage, DNA is repaired
by HDR mechanisms when a repair template is available. These templates can come in the form of (a) long
dsDNA templates with large, 500 bp homology arms (teal), or (b) in the form of ssODN sequences when only
small changes are required. Longer templates are generally provided in the form of linearized plasmids and
are efficient for the introduction of large inserts or deletions. Note that the homology arms found within repair
templates may contain portions of the original guide sequence and/or the GG motif. Insertions are shown in
green. Ideally the homology arms will extend roughly equidistance from the expected cut site
vector based on 15 bp homologous overlapping segments in the

adjacent fragments. The overlapping segments facilitate directional
cloning of multiple fragments into the desired vector (see Note 4).
3.2.1 Generating an HDR 1. Amplify the right and left homology arms and any new
Template Plasmid sequence to be inserted into the virus by PCR using a high
fidelity DNA polymerase. It is also possible to obtain one or
more of these chemically synthesized DNA fragments from a
supplier.
2. Linearize a cloning vector of your choice by restriction enzyme
digestion, using two enzymes can improve efficiency by reduc-
ing the amount of residual uncut plasmid. Using the In-Fusion
PCR cloning kit (Clontech), clone the purified DNA fragments
into the vector backbone. For this, mix 5 In-Fusion HD
enzyme premix, linearized vector, purified PCR fragments,
comprising the homologous recombination arms and desired

insert, and H2O in a total volume of 10 μL. After gentle mixing
incubate the reaction mix at 50 C for 15 min, before cooling
and transforming into E. coli (as in Subheading 3.1.4).
3. Select the clones on an antibiotic-containing LB agar plate
suitable for the vector. Screen the clones using a method
appropriate for the size of the insert, grow plasmid minipreps
and confirm the sequence.
3.2.2 Preparation of HDR 1. The use of a linear HDR template is required for efficiency and
Template for Transfection to avoid the insertion of the entire plasmid via a single crossover
into just one of the two homology arms. Chose a restriction
enzyme that cuts in the plasmid backbone and digest the
plasmid made in Subheading 3.2.1. Use a portion of the diges-
tion reaction to test by agarose gel electrophoresis that cutting
has been efficient.
2. Clean up the remaining digested plasmid by precipitation by
adding 1/10 volume of 3 M NaOAC, pH 5.2, and two
volumes of 100% ethanol. Mix by inversion, leave for at least
15 min at room temperature, then recover by centrifugation at
top speed in a standard microcentrifuge for 20 min. Discard the
supernatant and wash the pellet once with 500 μL of 70%
ethanol before air drying, preferably in a class II biosafety
cabinet or other clean environment. This method tends to
produce better quality DNA for transfection at a good concen-
tration than most silica-based commercial clean-up kits.
3. Resuspend the DNA in an appropriate volume of sterile H2O
and determine the concentration of linearized plasmid DNA.
3.3 Single-Stranded For small edits in the HSV genome, ssODNs can be used as a HDR
Oligodeoxynucleotide template (see Fig. 2). To design ssODNs, select homology arms of
(ssODN) Templates 40–90 nucleotides on either side of the desired modification and
for HDR the CRISPR cut site. Either DNA strand can be chosen. We recom-
mend using third-base codon redundancy to add a translationally
silent restriction enzyme site in addition to the desired change
because this greatly facilitates screening of possible recombinant
viruses. Purchase the ssODNs directly from a preferred supplier and
dilute to a final concentration of 10 μM. Use 2 μL of this solution
per transfection reaction.
3.4 Transfection The key to the success of the method is achieving a very high
of 293A Cells transfection efficiency. We aim for >80% of the cells to be trans-
fected. Untransfected cells allow the replication of unmodified
parent HSV that contributes to the background from which recom-
binant viruses need to be identified and selected. We use Lipofec-
tamine 2000® for transfection of 293A cells, but have no reason to
think that other cells that support HSV replication or other
transfection reagents cannot be used, assuming equal transfection

efficiency. The following steps are done in a class II biosafety
cabinet and at room temperature unless specified otherwise.
1. Approximately 16–18 h prior to transfection seed a 6-well plate
with 293A cells at a density of 5 105 cells per well in 2.0 mL
D10 medium. Incubate the plate at 37 C and 5% CO2. On the
day of transfection, cells should be 70–80% confluent, which is
optimal for transfection efficiency (see Note 5).
2. (a) For long plasmid-based templates: Add equimolar amounts
of pX330 with a guide inserted (from Subheading 3.1) and the
linear HDR template plasmid (prepared in Subheading 3.2) to
a 2 mL polypropylene tube labeled “A.” Do not use more than
3 μg of DNA in total to minimize the amount of Lipofectamine
2000® required and hence toxicity associated with this reagent.
For each microgram of DNA, add M0 medium to a total
volume of 60 μL and mix thoroughly by pipetting. (b) For
short ssODN HDR templates, mix together 2 μL of 10 μM
ssODN and 2 μg of CRISPR-Cas9-guideRNA plasmid in a
total volume of 180 μL M0 medium, in a tube labeled “A”
(see Note 6).
3. Work out the amount of Lipofectamine 2000® required based
on the requirement for 2 μL of Lipofectamine 2000® for every
1 μg of DNA. Add the appropriate volume of Lipofectamine
2000® to a fresh 2 mL polypropylene tube marked “B” and
then add 58 μL of M0 medium for each 2 μL of Lipofectamine
2000® and mix by gentle pipetting. Leave this mixture for
5 min.
4. Add the contents of the tube B to tube A and mix very gently
by pipetting up and down slowly. Incubate this mixture for
20–25 min then gently dilute by the addition of M0 medium to
a final volume of 0.5 mL.
5. Replace the medium of the 6-well plate of 293A cells with
0.5 mL of prewarmed M0 (see Note 7). Gently add the trans-
fection mix dropwise to the appropriate well, rocking the plates
to distribute the transfection mix evenly (see Note 8). Care
must be taken to avoid detachment of 293A cells from the
plate. Repeat the above steps for each transfection (see Note 9).
6. Incubate the cells with the transfection reagent for 5 h at 37 C
and 5% CO2.
3.5 Infection of 293A 1. Following transfection, remove the medium with transfection
Cells with HSV-1 mix and replace it with 1 mL of M0 medium containing
1 104 PFU of HSV (to achieve approximately 0.01 PFU/-
cell). Incubate the cells for 2 h at 37 C and 5% CO2.
2. Remove the virus inoculum and replace it with fresh, pre-

warmed M2 medium. Incubate at 37 C and 5% CO2 and
after 3 days wash or scrape the cells into the medium and
collect. This can be stored at 80 C if required.
3.6 Isolation 1. Prepare 6-well plates of confluent Vero cells, one for each virus
of Recombinant Virus that you wish to isolate.
3.6.1 Collection 2. Break the cells collected after the transfection/infection in
of Recombinant Viruses Subheading 3.5 with three rapid freeze-thaw cycles then pre-
(Plaque Picking) pare 9 fivefold dilutions of each transfection-infection mix in a
final volume of 1.5 mL M0 medium.
3. Replace the medium in the wells of the 6-well plate of Vero cells
with 1 mL of the 54–59 dilutions prepared in the previous
step and incubate for 2 h at 37 C and 5% CO2.
4. Replace this inoculum with 2 mL of CMC-MEM. Incubate the
plate for 48 h at 37 C and 5% CO2.
5. Using an inverted microscope to visualize plaques, mark the
location of 24 plaques on the base of the plate with an indelible
marker, starting from the well with least plaques and choosing
plaques that are well dispersed. If the recombinant virus
includes a fluorescent or other marker for visual selection, use
this as an additional guide to selection.
6. To collect virus from these plaques place the tip of a micropi-
pette on the bottom of a well just above each mark and aspirate
10 μL of cells and medium, then eject it to 0.5 mL ice-cold D2
medium in a 2 mL polypropylene tube. Freeze and thaw three
times. This mixture is referred to as a “plaque pick.”
3.6.2 Preparation of DNA 1. Prepare a 96-well plate of confluent Vero cells.

for PCR Screening 2. Remove the medium from wells of the 96-well plate containing
of Plaques confluent Vero cells and replace it with 75–100 μL of the
appropriate plaque pick. Incubate the plate for 2 days at
37 C and 5% CO2.
3. After 2 days, discard the inoculum and wash the cells by adding
100 μL of PBS to each well. Remove the PBS and add 100 μL
of proteinase K DNA prep mix. Seal the plate using Parafilm®
and subject the plate to one freeze-thaw cycle. Then, remove
the Parafilm® and incubate the plate at 56 C for 25 min
followed by heat inactivation of proteinase K at 85 C for
15 min.
4. Subject the plate to centrifugation at 524 g for 10 min.
5. Use 2 μL of the supernatant as template for a standard PCR
reaction. Perform PCR using a range of primers to confirm the
presence of the recombinant virus, and for distinguishing
between this and parent virus (see Notes 10 and 11).
3.6.3 Plaque Purification 1. There is almost always evidence of parent virus contamination
of Recombinant Viruses in any plaque pick that contains the correct recombinant. Based
and Growing Stocks on the relative intensity of recombinant virus- and parent virus-
specific products on the gel, choose two or three plaques to
further purify.
2. Use the relevant plaque picks as an inoculum for a new round of
plaque picking and selection by PCR, as described in Subhead-
ings 3.6.1 and 3.6.2, respectively. Use the 51–56 dilutions of
a plaque pick.
3. Once a plaque pick shows no evidence of contamination with
parent virus by PCR and there has been at least a total of three
rounds of picking and selection, a recombinant virus can be
deemed to be clean (see Note 12).
4. To grow a seed stock, use 400 μL of a plaque pick to seed a
25 cm2 culture flask with confluent Vero cells and harvest cells
into the medium 72 h later. Collect the cells by centrifugation
at 524 g for 10 min at 4 C, resuspend in 0.5 mL of M2
medium and freeze and thaw three times to release the virus.
PCRs should be done on a sample from the seed stock to verify
that it remains clear of contamination with parent virus. The
sequence of the recombinant virus around the engineered
region, taking care to extend beyond the homology arms
used in the HDR template, should also be determined to
ensure fidelity to the initial design. Restriction enzyme digests
on the whole genome can be done to ensure there are no major
rearrangements in the genome.
5. The seed stock can then be used to grow master stocks (typi-
cally using 100 μL of the seed to infect a 75 cm2 flask of Vero
cells for 72 h). This stock should be titrated and then working
stocks grown using large flasks or roller bottles, as desired and
infecting them at low multiplicity as usual.
4 Notes
1. There are many similar plasmids to pX330 available, but we had

almost immediate success with this one and found no reason to
look further. Similarly, we have only used HSV-1 strain KOS
and for our purposes 293A cells proved to be appropriate for
this method. Other virus strains and cell lines including
other subclones of HEK293 were not investigated.
2. Design the guide template such that Cas9 will cut in close
proximity to the desired modification site in the genome.
This is necessary so that a HDR template can be easily designed
such that the two homology arms extend either side of both the
cut site and the site to be modified. If a region of the genome is
to be deleted, design the guide to cut within the sequences to
be deleted. Others also have recommended that the distance

between the HDR site and the double-stranded break site must
be less than 100 bp for efficient recombination [13, 14]. Our
experience is that sgRNA sequences with homopolymer runs
and other features that work against good sequence-specific
hybridization are to be avoided, but we have no formal or
systematic evidence that this is the case.
3. The CRISPR-Cas9 plasmid pX330 has two BbsI recognition
sites, both of which need to be cut by the enzyme for cloning of
the annealed guide DNA oligos. We find this enzyme to be
neither robust nor efficient and this is why we typically do two
sequential digestions as described. If cloning remains a prob-
lem, choose a different supplier for this enzyme.
4. The designing of primers with appropriate overlapping
sequences is vital for amplification of DNA fragments during
In-Fusion® cloning. The user should refer to the In-Fusion®
cloning manual for designing the overlapping primers. We
recommend performing an additional in silico experiment,
using a preferred cloning tool (example: Vector NTI), to verify
the directionality of the inserts in a given vector.
5. It is critical to transfect the cells when they are sub-confluent,
ideally 70–80% confluent, as it improves the efficiency of
transfection.
6. When using ssODNs for the HDR template, the cells may
dissociate and appear to reach full cytopathic effect within
48 h. In this case, the cells can be harvested before 3 days.
Nucleofection is commonly recommended for transfection of
ssODN, but we were able to isolate recombinant virus at an
efficiency of 5–10% using Lipofectamine-mediated
transfection.
7. The monolayer of 293A cells can easily dissociate from the plate
if care is not taken while adding reagents or medium. Do not
add cold medium or add medium directly to the cells, pipette
liquids gently down the sides of the well.
8. It is important to add the transfection reagent in drops that are
distributed across the well and to rock to mix every few drops.
The best method is to expel most of a drop from the pipette,
then touch it to the surface of the medium in the well just
before it falls. When rocking the plate, avoid swirling as this will
deposit the transfection mix in the middle of the well.
9. We perform transfections in duplicate so that we have two
independently derived lineages of recombinant viruses in case
there is a problem with one of these. When troubleshooting,
we also recommend a full set of controls, including wells where
(a) cells are transfected but not infected; (b) cells are infected
and not transfected; and (c) cells are transfected with a plasmid
that encodes a fluorescent marker to test efficiency (there are

pX330 variants with fluorescent markers, which make this con-
trol redundant).
10. It is possible to use the plaque picks themselves for PCR
analysis, for example, by taking a sample and using this either
directly as a template or after incubating with proteinase K first.
This seems an attractive approach because it cuts out the extra
two days to grow small cultures in 96 well plates. However we
have found that the additional time taken to grow better
samples for PCR analysis invariably pays off because the success
of reactions on this material is very high (well above 90%),
compared with direct analysis of plaque picks, which is highly
variable.
11. When designing PCR primers for these analyses, remember
that any sequence that is included in the HDR template may
be derived from your plasmid and not from the viral genome. If
insertions are large, it can be a good practice to verify that both
ends of the insertion produce fragments of the expected size.
To do this use sets of primers that make products extending
from the viral genome (outside the extent of the homology
flanks) into the foreign DNA that has been inserted on both
sides of the insertion. Finally for small changes, including a
restriction site (e.g., by third base redundancy) greatly facil-
itates screening as PCR products can be analyzed further by
restriction enzyme digestion.
12. If an attempt at plaque purification produces plaques that have
no evidence of purification (e.g., less of the correct virus
and/or more apparent parental contamination than was seen
in the previous round), it is generally best to abandon that
entire line of viruses and start fresh from another plaque
taken from the transfection mix.
Acknowledgments
D.C.T. is supported by an NHMRC (Australia) fellowship

(APP1104329) and project grants (APP1084342 and
APP1126599). We thank Matthew Witney for reading the
manuscript.
References
1. Tanaka M, Kagawa H, Yamanashi Y, Sata T, 2. Ramachandran S, Knickelbein JE, Ferko C,

Kawaguchi Y (2003) Construction of an excis- Hendricks RL, Kinchington PR (2008) Devel-
able bacterial artificial chromosome containing opment and pathogenic evaluation of recombi-
a full-length infectious clone of herpes simplex nant herpes simplex virus type 1 expressing two
virus type 1: viruses reconstituted from the fluorescent reporter genes from different lytic
clone exhibit wild-type properties in vitro and promoters. Virology 378:254–264
in vivo. J Virol 77:1382–1391
3. Russell TA, Stefanovic T, Tscharke DC (2015) homologous recombination. Biol Chem

Engineering herpes simplex viruses by 383:873–892
infection-transfection methods including 9. Pastwa E, Blasiak J (2003) Non-homologous
recombination site targeting by CRISPR/ DNA end joining. Acta Biochim Pol
Cas9 nucleases. J Virol Methods 213:18–25 50:891–908
4. Lin C, Li H, Hao M, Xiong D, Luo Y, 10. Ceccaldi R, Rondinelli B, D’Andrea AD
Huang C, Yuan Q, Zhang J, Xia N (2016) (2016) Repair pathway choices and conse-
Increasing the efficiency of CRISPR/Cas9- quences at the double-strand break. Trends
mediated precise genome editing of HSV-1 Cell Biol 26:52–64
virus in human cells. Sci Rep 6:34531 11. Jasin M, Haber JE (2016) The democratiza-
5. Makarova KS, Wolf YI, Koonin EV (2013) The tion of gene editing: Insights from site-specific
basic building blocks and evolution of cleavage and double-strand break repair. DNA
CRISPR-Cas systems. Biochem Soc Trans Repair 44:6–16
41:1392–1400 12. Sander JD, Joung JK (2014) CRISPR-Cas sys-
6. Mali P, Yang L, Esvelt KM, Aach J, Guell M, tems for editing, regulating and targeting gen-
DiCarlo JE, Norville JE, Church GM (2013) omes. Nat Biotechnol 32:347–355
RNA-guided human genome engineering via 13. Elliott B, Richardson C, Winderbaum J, Nick-
Cas9. Science 339:823–826 oloff JA, Jasin M (1998) Gene conversion
7. Cong L, Ran FA, Cox D, Lin S, Barretto R, tracts from double-stranded break repair in
Habib N, Hsu PD, Wu X, Jiang W, Marraffini mammalian cells. Mol Cell Biol 18:93–101
LA, Zhang F (2013) Multiplex genome engi- 14. Ran FA, Hsu PD, Wright J, Agarwala V, Scott
neering using CRISPR/Cas systems. Science DA, Zhang F (2013) Genome engineering
339:819–823 using the CRISPR-Cas9 system. Nat Protoc
8. van den Bosch M, Lohman PHM, Pastink A 8:2281–2308
(2002) DNA double-strand break repair by
Chapter 10
Latent/Quiescent Herpes Simplex Virus 1 Genome Detection

by Fluorescence In Situ Hybridization (FISH)
Camille Cohen, Armelle Corpet, Mohamed Ali Maroui, Franceline Juillard,
and Patrick Lomonte
Abstract
Fluorescence in situ hybridization (FISH) has been widely used to analyze genome loci at a single cell level
in order to determine within a cell population potential discrepancies in their regulation according to the
nuclear positioning. Latent herpes simplex virus 1 (HSV-1) genome remains as an episome in the nucleus of
the infected neurons. Accordingly, depending on the location of the viral genomes in the nucleus, they
could be targeted by different types of epigenetic regulations important for the establishment and stability
of latency, and ultimately for the capacity of HSV-1 to reactivate. Therefore, it is important to take into
consideration the interaction of the viral genomes with the nuclear environment to integrate this aspect in
the overall set of physiological, immunological, and molecular data that have been produced, and which
constitute the main knowledge regarding the biology of HSV-1. In this method chapter we describe in
detail the procedure to perform FISH for the detection of HSV-1 genomes particularly during latency and
also the combination of this approach with the detection of cellular and/or viral proteins.
Key words Fluorescence in situ hybridization (FISH), Immunofluorescence, Herpesvirus, HSV-1,

Latency, Promyelocytic leukemia nuclear bodies (PML NBs)
1 Introduction
One of the hallmarks of herpes simplex virus 1 (HSV-1) infectious

process is its capacity to colonize, from an initial infection in epi-
thelial cells at the periphery, different nervous ganglia, of which the
trigeminal ganglion (TG, also called Gasserian ganglion) remains
the main site of HSV-1 latency establishment. TGs are essentially
composed of sensitive neurons and satellite cells of glial origin.
Between 24,000 and 30,000 neurons compose the core of the
TG in mice and human, respectively [1–3]. In mice, TG neurons
are from different subtypes on the basis of the detection of different
carbohydrate moieties present at the plasma membrane [4]. This
means that the variety of neurons the virus infects is likely to
185
186 Camille Cohen et al.
determine the fate of latency and probably the likelihood of efficient

reactivation [5].
Many features drive the fate of an initial infection of a neuron
by HSV-1 at the physiological, immunological and molecular
levels. These parameters are as many barriers for the virus to over-
come to successfully infect its host. Establishment of latency is one
important aspect of the battle won by the virus against a hostile
environment. Latency is successful only if, and by definition, the
virus can reactivate to produce new progeny able to disseminate in
the microenvironment (from cell to cell) and macroenvironment
(from a host to another host).
At the genome-activity level HSV-1 latency is characterized by
a drastic decrease in the transcription of its genome resulting in the
repression of genes of the lytic program, which represent more than
80 loci encoding as many proteins (for review see [6]). This tran-
scriptional activity below a biological threshold is accompanied by
the abundant expression of a family of long noncoding RNAs called
latency associated transcripts (LAT) that signify the presence within
the tissue of latent virus. For long, it was considered that latent
viruses automatically, exclusively, and homogeneously within the
TG, switched from one mode (lytic program) to another (latent
program). Several studies performed in the mouse model as well as
in human challenged this view of latency and demonstrated that the
latency state, when analyzed at the level of the whole ganglion, is
not exempt of viruses undergoing reactivations albeit without clin-
ical symptoms [7–9]. It is also known for long that at the single cell
level latently infected neurons do not systematically express LAT
[1, 10–14]. Therefore it is becoming clear that latent HSV-1
genomes are targeted by some genetic and epigenetic regulation
constrains that are likely to determine their transcriptional state
within individual neurons of the same ganglion. Regarding the
epigenetic regulations of the transcriptional activity of latent
HSV-1 genome loci, one that was initially demonstrated was the
chromatin modifications at the level of some specific promoters
driving the expression and/or repression of lytic and/or latent
genes [15–17]. More recently our laboratory published a series of
studies analyzing the distribution and localization of the latent viral
genomes in the nucleus of infected neurons in latently infected mice
and in human TGs [18–20]. Probably one of the most striking
feature described was the variety of latent HSV-1 genome localiza-
tions in the nucleus of individually infected neurons, and the con-
sequences on the expression of the LAT [18]. Two of the main
nuclear domains to which HSV genomes were found to preferen-
tially associate during latency were the promyelocytic leukemia
nuclear bodies (PML NBs also known as ND10) and the centro-
meres [18]. These two specific nuclear localizations of latent
HSV-1 genomes were correlated with an absence of detection of
HSV-1 Genome Detection by FISH 187
the primary LAT transcript at least by fluorescence in situ hybridi-

zation (FISH).
Therefore, the 3D organization of the viral genomes and their
interactions with different nuclear structures are not without con-
sequences on the state of HSV-1 latency at least for the LAT
transcription. This peculiar aspect concerning LAT transcription is
likely not restricted to the sole expression of LAT and has probably
also consequences on the transcriptional capacity of other viral loci.
At the single viral genome level this could for example determine
the capacity of a genome to undergo a full transcriptional program
following a stress to initiate the exit of latency to optimize full
reactivation. The detection of latent HSV-1 genomes by visualiza-
tion techniques is thus important to characterize at the single cell
level and within a single nucleus how the viral genomes interact
with the nuclear environment. This helps to apprehend some
molecular aspects associated with the microenvironment in the
nucleus, in order to link them to the interactions with the macro-
environment inside the tissues, altogether determining the fate of
latency and reactivation.
In this method communication we will describe the technical
aspects that enable the detection of latent/quiescent HSV-1 gen-
omes by FISH and how to combine this technique with an immu-
nofluorescence approach to detect proteins. As far as detection of
viral DNA genomes is concerned we believe that the method could
be applied for all herpesviruses as well as other DNA viruses such as
HBV, HPV, and HIV provirus.
2 Materials
2.1 Biological 1. HSV-1 SC16 strain or other wild type strain suitable for mouse
Samples infections [21].
2. 6-week-old inbred female BALB/c mice.
3. Non-replicative HSV-1 in1374 mutant virus [22, 23].
4. Cryosections of HSV-1 latently infected mouse or human Tri-
geminal Ganglia (TG) [18, 19]
5. Foreskin fibroblast cells (BJ cells), lung fibroblast cells
(IMR-90), fetal foreskin fibroblast cells (HFFF-2), hepatocyte
cells (HepaRG, HPR101) [20]. The list of primary cells is not
exhaustive.
2.2 Cell Culture 1. Dulbecco’s Modified Eagle’s Medium (DMEM).

2. 10% fetal bovine serum.
3. L-Glutamine (1% v/v).
4. Penicillin 10 U/mL/Streptomycin 100 mg/mL.
2.3 DNA-FISH and 1. HSV-1 Cosmids 14, 28, and 56 [24].

Immunofluorescence 2. Large vector DNA purification kit.
Analysis
3. Nick-translation kit (Roche, 10-976-776-001). Respect this
reference for probes preparation as many other tested refer-
ences did not give satisfactory results.
4. dCTP-Cy3.
5. 0.5 M EDTA pH 8.0.
6. Tris–EDTA (TE) buffer, pH 8.0: 10 mL of 1 M Tris–HCl
(pH 8.0), 2 mL of 0.5 M EDTA, distilled water to 1 L.
7. Microspin G50 columns.
8. 1.5 mL Eppendorf tubes.
9. Salmon sperm DNA, 10 mg/mL.
10. 3 M sodium acetate, pH 5.2.
11. 100% ethanol, molecular biology grade; 70% ethanol.
12. Formamide, molecular biology grade.
13. Unmasking buffer: 100 mM sodium citrate pH 6.0 (stock
solution).
14. Citrate buffer, 10 mM, pH 6.0.
15. 20 saline sodium citrate (SSC): 3 M NaCl, 300 mM Na3C6,
H5O7, adjust pH to 7.0 with HCl.
16. 2 SSC, 0.2 SSC.
17. Glacial acetic acid.
18. Methanol, molecular biology grade.
19. Methanol-acetic acid-PBS mix 3:1:4, prepare fresh.
20. Methanol-acetic acid mix 3:1, prepare fresh.
21. Dextran sulfate, MW 500,000.
22. Denhardt’s solution (100).
23. 2 Hybridization buffer: add 4 g of dextran sulfate
(MW 500,000) to 10 mL of distilled water. Incubate for
3–4 h at 70 C under frequent agitation to dissolve the dextran
sulfate. Add 4 mL of 20 SSC and 400 μL of 100 Denhardt’s
solution. Complete to 20 mL with distilled water and mix well
using a vortex. Aliquots can be stored at 20 C.
24. Probing solution: for one slide mix 90 ng of Cy3-labeled
HSV-1 DNA probe (30 ng of probe for each cosmid) with
40 μL of formamide. Add 40 μL of 2 hybridization buffer.
Mix well by pipetting up and down several times; avoid air
bubbles.
25. Rubber Cement “FixoGum” (125 g tube).
26. 1 phosphate-buffered saline (PBS), pH 7.4: 2.7 mM KCl,
1.8 mM KH2PO4, 138 mM NaCl, 10 mM Na2HPO4, pH 7.4.
27. 4% paraformaldehyde (PFA).

28. 2% PFA in 1 PBS.
29. Triton X-100.
30. 0.5% Triton X-100 in 1 PBS.
31. Normal goat serum (NGS).
32. 1 PBS containing 3% NGS.
33. Primary antibodies.
34. Anti-human PML (H-238) antibody; rabbit polyclonal (Santa
Cruz, sc-5621).
35. Anti-human PML(PG-M3) antibody; mouse monoclonal
(Santa Cruz, sc-966).
36. Anti-UBN1 Zap1 antibody; mouse monoclonal (a kind gift
from Henri Gruffat/CIRI, ENS-Lyon, France).
37. Alexa Fluor-conjugated secondary antibodies.
38. 40 ,6-Diamidino-2-phenylindole, dihydrochloride (DAPI),
0.1 μg/mL.
39. Fluoromount G mounting medium.
2.4 Equipment 1. Millicell EZ slides (Merck/Millipore, Ref PEZGS0816).

Respect this reference as many other tested references did not
give satisfactory results.
2. Superfrost glass slides.
3. Microwave oven.
4. Coplin Jar (Dominique Dutscher, Ref 68512).
5. Staining glass container (Dominique Dutscher, Ref 68506).
6. Incubator slide moat (Boekel Scientific, Ref 240000).
7. Fluorescence microscope.
3 Methods (See Note 1)
3.1 HSV-1 Probe 1. Cosmids 14, 28, and 56 containing approx. 30 kb portions of
Labeling the HSV-1 strain 17 genome [24] are prepared using purifica-
tion columns suitable for large plasmid preparation (e.g., large
vector DNA purification kit, Qiagen) (see Note 2).
2. Two micrograms of each cosmid is labeled with Cy3-dCTP
using a nick-translation kit according to the manufacturer’s
guidelines. Perform labeling with a reaction mix containing
only Cy3-dCTP and no unlabeled dCTP (see Table 1). Incu-
bate at 15 C for 2.5 h.
Table 1
Reagents for FISH probes labeling
Cos14-cy3 Cos28-cy3 Cos56-cy3

DNA (2 μg) 1 μL 1 μL 1 μL
Buffer 10 (1) 4 μL 4 μL 4 μL
dATP 0.4 mM (40 μM) 4 μL 4 μL 4 μL
dGTP 0.4 mM (40 μM) 4 μL 4 μL 4 μL
dTTP 0.4 mM (40 μM) 4 μL 4 μL 4 μL
dCTP-cy3 (40 μM) 1.6 μL 1.6 μL 1.6 μL
DNA pol I/DNase I 4 μL 4 μL 4 μL
Ultrapure water 17.4 μL 17.4 μL 17.4 μL
Total 40 μL 40 μL 40 μL
3. Stop the reaction by adding 3 μL of 0.5 M EDTA pH 8.0, and

heating at 70 C for 10 min. Keep on ice and adjust the volume
to 50 μL with TE buffer, pH 8.0.
4. Insert one Microspin G50 column/probe in an Eppendorf
1.5 mL tube. Centrifuge for 1 min at 1000 g to remove
excess of storage buffer. Apply the 50 μL of the solution probe
on the dried out Microspin G50 column. Insert the column in
a 1.5 mL Eppendorf tube. Centrifuge for 2 min at 1000 g.
Adjust the volume of each sample/probe to 100 μL with TE
buffer (pH 8.0). Add 150 μg of salmon sperm DNA. Add
15 μL of sodium acetate 3 M pH 5.2. Add 500 μL of 100%
ethanol to precipitate the probe over-night at 20 C. Centri-
fuge at 13,000 g for 15 min at 4 C. The DNA pellet should
be pink due to Cy3 incorporation. Wash the pellet with 500 μL
of 70% ethanol. Centrifuge at 13,000 g for 5 min at 4 C.
Remove as much ethanol as possible with a pipette. Do not let
the pellet dry completely.
5. Dissolve the pellet with 100 μL of deionized formamide per
2 μg of DNA template (probe concentration: 20 ng/μL). Store
at 20 C.
3.2 DNA-FISH See Fig. 1 for illustration.

If not otherwise mentioned, all incubations are performed at
room temperature.
Day 1:
1. For cryosections: remove slides from the freezer and let the
sections dry for 10 min. Circle the sections with a hydrophobic
pen. Rehydrate the sections in 1 PBS for 10 min.
Fig. 1 FISH detection of HSV-1 genomes (red) in the nucleus (blue, DAPI) of
infected neurons from latently infected mouse TGs. Two main patterns are
observed in the detection of viral genomes either as a single spot (Single, a)
or multiple spots (Multiple-latency, b). Green channel was activated to show the
natural autofluorescence of the neurons, which helps delineating the cell body.
The dashed line delineates the nucleus. Bars represent 10 μm
2. For cryosections and infected cell cultures (see Note 3): per-
meabilize the cells/tissue with 0.5% Triton X-100 in 1 PBS
for 10 min. Wash three times for 5 min with 2 SSC, and keep
in 2 SSC until the sodium citrate (unmasking) buffer is
heated (see below).
3. For unmasking (antigen retrieval procedure), prepare a glass
slide tray with lid (20 slides capacity) filled with 200 mL of
10 mM sodium citrate buffer (pH 6.0). Place the tray with lid
in a larger container filled with distilled water half height of the
tray. Put the tray with lid and water container in the microwave
oven until the sodium citrate buffer reaches boiling tempera-
ture (around 8 min at 800 W). Stir the buffer to homogenize
the buffer temperature. Reheat the buffer until boiling (around
30 s). Remove the lid and place the slides in the preheated
citrate buffer-containing tray. Confirm that the slides are
completely covered with buffer. Replace the lid. Heat for
about 20–30 s until the buffer reaches boiling temperature
(small bubbles visible). Cool down for 2 min. Repeat the heat-
ing cycle six times (seven heating cycles in total). Cool down
2 min and transfer the slides into 2 SSC for 5 min at RT, then
in 1 PBS at RT. Excessive boiling could result in tissue loss
and damaged cells. For each heating pulse, the appearance of
boiling is carefully watched, and heating should be stop at first
signs of boiling (see Note 4).
4. Incubate the slides in a methanol–acetic acid–PBS mix (3:1:4)
for 15 min, then in a methanol–acetic acid mix (3:1) for 15 min
(Important: prepare these solutions right before use, and
manipulate under a fume hood with protection). Dehydrate
the tissue sections/cells by successive incubations in ethanol

solutions: 1 5 min in 70% ethanol, and then twice for 5 min
in 100% ethanol. Let dry at room temperature for 10 min. Keep
dry until probing.
5. Drop 80 μL/slide of probing solution onto the dried tissue
sections/cells. Cover gently with a 22 50 mm glass coverslip
in order for the probing solution to spread over the entire
surface of the tissue sections/cells without bubbles. Seal the
coverslip using rubber cement and let it dry. Keep the slides in
the dark at room temperature for at least 2 h for optimal
diffusion of the probe in the samples and optimal hybridization
signal throughout the slide.
6. Place the slides into an 80 C slide incubator for 5 min in order
to allow denaturation. Quickly transfer the slides onto a metal-
lic tray placed on ice for 2 min. Transfer the slides at 37 C in a
slide heater for overnight hybridization.
Day 2:
7. Peel off the rubber cement with forceps while holding the slide
onto the heater to keep the section at 37 C. Remove the
coverslip gently with the tip of a scalpel blade. If required
2 SSC can be added on the side of the slide to help removing
the coverslip.
8. Wash 3 times for 5 min at 37 C with 2 SSC and three times
for 5 min at 37 C with 0.2 SSC. Wash once for 5 min at
room temperature with 2 SSC.
9. (a) Stain nuclei for 10 min with DAPI (0.1 μg/mL) in 2 SSC
for 10 min. Wash three times for 2 min with 2 SSC. Drain as
much liquid as possible from the slide. (b) Alternatively, stain
nuclei using a mounting medium containing DAPI and pro-
ceed with step 11.
10. Add 80–100 μL of mounting medium containing an antifading
agent onto one end of the slide.
11. Cover the sections with a high-quality optical coverslip (n 1.5
glass).
12. Seal coverslip with nail polish and store at 4 C in a dark
slide box.
13. Direct observation of DNA-FISH signal of latent HSV-1 gen-
omes requires a 60 or higher magnification oil immersion
objective with high numerical aperture (for example 60–63
N.A 1.4, 100 N.A 1.3) and an excitation light source of at
least equivalent to a 100 W mercury lamp.
Fig. 2 Detection of proteins (green) and HSV-1 genomes (red) in the nucleus
(blue, DAPI) of latently infected human primary cells. Left panels (a and c)
resulted from the procedure described in Subheading 3.3 (combined immuno-
fluorescence assay-DNA FISH). Right panels (b and d) resulted from the proce-
dure described in Subheading 3.4 (DNA FISH-immunofluorescence assay). Both
approaches allow detection of PML, whereas UBN1 can be detected using the
anti-UBN1 Zap1 mouse monoclonal antibody only when DNA FISH is performed
before immunofluorescence analysis (see Subheading 3.4). Insets represent
selected areas (dashed squares) with split channels for separate visualization
of HSV-1 and protein signals. Bars represent 5 μm
3.3 Combined See Figs. 2 and 3 for illustration.

Immunofluorescence
Analysis-DNA FISH Day 1:
(See Note 5)
1. Perform steps 1–3 of the DNA-FISH protocol (Subheading
3.2).
2. Incubate the slides for 30 min in 1 PBS containing 3% NGS.
3. Incubate the slides for 24 h at 4 C with the primary antibody
diluted in 1 PBS containing 3% NGS. Reduced incubation
times at RT can be used to shorten the protocol and depending
on the affinity of the primary antibody.
Fig. 3 Detection of viral DNA-containing PML nuclear bodies (vDCP NB) in HSV-1
latently infected mouse (a) or human (b) TGs. PML (green) and HSV-1 genomes
(red) are detected using the combined immunofluorescence assay-DNA FISH
approach (Subheading 3.3). Dashed line delineates the nucleus. Bars represent
10 μm
Day 2:
4. Wash three times for 5 min with 1 PBS.

5. Incubate 1 h with an Alexa Fluor-conjugated secondary anti-
body diluted at 1/500 in 1 PBS containing 3% NGS. Wash
three times for 5 min with 1 PBS.
6. Postfix for 10 min with 2% PFA in 1 PBS. Wash three times
for 5 min with 1 PBS (see Note 6).
7. Proceed with DNA-FISH protocol (Subheading 3.2) from
step 4 onward. Duration of the immuno-DNA-FISH is typi-
cally 3 days, with the first antibody incubated overnight.
3.4 Combined DNA See Figs. 2 and 3 for illustrations.

FISH-
1. Perform steps 1–8 of the DNA-FISH protocol (Subheading
Immunofluorescence
3.2).
Analysis
2. Perform steps 2–5 of Subheading 3.3 (see Note 7).
3. Proceed with the DNA-FISH protocol (Subheading 3.2) from
step 9 onward.
4 Notes
1. We deliberately did not focus on the animal infection proce-

dures to establish latent HSV-1 infection. For a detailed proto-
col on animal models handling, TG harvesting and embedding,
and preparation of cryosections of tissues from mouse and
human TG, we suggest the reading of our previously published
studies [18, 19, 25].
2. The labeled probe used for the DNA-FISH protocol can be

prepared in large quantity and stored frozen for several
months/years at 20 C.
3. For cell infections with HSV-1 in 1374, we suggest the reader
to consult ref. 20 for technical details (open access).
4. The unmasking procedure is one of the most critical steps in
the FISH procedure. The microwave oven, tray, container and
volume of buffer in the tray and water in the container should
be kept identical for reproducibility of unmasking. Once
set-up, unmasking appears robust and reproducible. Citrate-
based unmasking was found to consistently provide good FISH
signal using infected tissues or cells from various laboratories
and animal models [18]. Absence or failure in performing
unmasking does not allow the detection of latent viral
genomes.
5. In combined immunofluorescence and FISH procedures, in
general, it is advised to perform first the immunofluorescence,
since the DNA FISH procedure may denature epitopes and
prevent the protein detection by antibodies. However, our
experience shows that some antibodies work only if immuno-
fluorescence is performed after the FISH procedure (compare
panels c and d of Fig. 2). This should be determined on an
antibody to antibody base.
6. For the Immunofluorescence-DNA FISH procedure, it is nec-
essary to covalently link the antibodies used to reveal the anti-
gens in order to preserve the immunofluorescence signal on the
sample during the DNA-FISH procedure (Subheading 3.3,
step 6). Postfixation is a critical step in immunofluorescence-
DNA FISH, and requires careful setup. The stronger the post-
fixation, the better the IF signal and the lower the DNA-FISH
efficiency.
7. For the DNA FISH-immunofluorescence analysis, postfixation
is not required after immunolabeling as the samples will not
sustain further treatments that affect the immunofluorescence
signal.
Acknowledgments
The development of the technical approaches described in this

chapter was performed in studies funded by grants from CNRS
(http://www.cnrs.fr), INSERM (https://www.inserm.fr), Univer-
sity Claude Bernard Lyon 1 (https://www.univ-lyon1.fr), French
National Agency for Research-ANR (PL, EPIPRO, ANR-18-
CE15-0014-01, http://www.agence-nationale-recherche.fr),
LabEX DEVweCAN (PL, CC, ANR-10-LABX-61, http://www.
agence-nationale-recherche.fr), La Ligue contre le cancer and the

FINOVI foundation (grant #142690).
We are grateful to many colleagues for material transfer, scientific
discussions, and experimental contributions, and to the Centre
Technologique des Microstructures (CTμ) and the Centre d’Ima-
gerie Quantitative Lyon Est (CIQLE) of the Université Claude
Bernard Lyon 1 for the confocal microscopy facilities.
References
1. Sawtell NM (1997) Comprehensive quantifica- herpes simplex virus sequences in trigeminal
tion of herpes simplex virus latency at the ganglia of latently infected mice. Virology
single-cell level. J Virol 71:5423–5431 206:633–640
2. LaGuardia JJ, Cohrs RJ, Gilden DH (2000) 11. Chen X-P, Mata M, Kelley M, Glorioso JC,
Numbers of neurons and non-neuronal cells Fink DJ (2002) The relationship of herpes sim-
in human trigeminal ganglia. Neurol Res plex virus latency associated transcript expres-
22:565–566 sion to genome copy number: a quantitative
3. Thompson RL, Sawtell NM (2001) Herpes study using laser capture microdissection. J
simplex virus type 1 latency-associated tran- Neurovirol 8:204–210
script gene promotes neuronal survival. J 12. Proenca JT, Coleman HM, Connor V, Winton
Virol 75:6660–6675 DJ, Efstathiou S (2008) A historical analysis of
4. Bertke AS, Patel A, Imai Y, Apakupakul K, herpes simplex virus promoter activation
Margolis TP, Krause PR (2009) Latency- in vivo reveals distinct populations of latently
associated transcript (LAT) exon 1 controls infected neurones. J Gen Virol 89:2965–2974
herpes simplex virus species-specific pheno- 13. Proenca JT, Coleman HM, Nicoll MP,
types: reactivation in the guinea pig genital Connor V, Preston CM, Arthur J, Efstathiou
model and neuron subtype-specific latent S (2011) An investigation of HSV promoter
expression of LAT. J Virol 83:10007–10015 activity compatible with latency establishment
5. Bertke AS, Swanson SM, Chen J, Imai Y, reveals VP16 independent activation of HSV
Kinchington PR, Margolis TP (2011) immediate early promoters in sensory neu-
A5-positive primary sensory neurons are non- rones. J Gen Virol 92:2575–2585
permissive for productive infection with herpes 14. Edwards TG, Bloom DC (2019) Lund human
simplex virus 1 in vitro. J Virol 85:6669–6677 mesencephalic (LUHMES) neuronal cell line
6. Roizman B, Knipe DM, Whitley RJ (2007) supports HSV-1 latency in vitro. J Virol
Herpes simplex viruses, vol 5. Lippincott Wil- 93:02210–02218
liams and Wilkins, Philadelphia, PA, pp 15. Bloom DC, Giordani NV, Kwiatkowski DL
2501–2602 (2010) Epigenetic regulation of latent HSV-1
7. St Leger AJ, Peters B, Sidney J, Sette A, Hen- gene expression. Biochim Biophys Acta
dricks RL (2011) Defining the herpes simplex 1799:246–256
virus-specific CD8+ T cell repertoire in 16. Kristie TM, Liang Y, Vogel JL (2010) Control
C57BL/6 mice. J Immunol 186:3927–3933 of alpha-herpesvirus IE gene expression by
8. van Velzen M, Jing L, Osterhaus ADME, HCF-1 coupled chromatin modification activ-
Sette A, Koelle DM, Verjans GMGM (2013) ities. Biochim Biophys Acta 1799:257–265
Local CD4 and CD8 T-cell reactivity to HSV-1 17. Knipe DM, Lieberman PM, Jung JU, McBride
antigens documents broad viral protein expres- AA, Morris KV, Ott M, Margolis D, Nieto A,
sion and immune competence in latently Nevels M, Parks RJ, Kristie TM (2013) Snap-
infected human trigeminal ganglia. PLoS shots: chromatin control of viral infection.
Pathog 9:e1003547 Virology 435:141–156
9. Bloom DC (2016) Alphaherpesvirus latency: a 18. Catez F, Picard C, Held K, Gross S,
dynamic state of transcription and reactivation. Rousseau A, Theil D, Sawtell N,
Adv Virus Res 94:53–80 Labetoulle M, Lomonte P (2012) HSV-1
10. Mehta A, Maggioncalda J, Bagasra O, genome subnuclear positioning and associa-
Thikkavarapu S, Saikumari P, Valyi-Nagy T, tions with host-cell PML-NBs and centromeres
Fraser NW, Block TM (1995) In situ DNA regulate LAT locus transcription during latency
PCR and RNA hybridization detection of in neurons. PLoS Pathog 8:e1002852
19. Maroui M-A, Callé A, Cohen C, 22. Jamieson DR, Robinson LH, Daksis JI, Nicholl
Streichenberger N, Texier P, Takissian J, MJ, Preston CM (1995) Quiescent viral gen-
Rousseau A, Poccardi N, Welsch J, Corpet A, omes in human fibroblasts after infection with
Schaeffer L, Labetoulle M, Lomonte P (2016) herpes simplex virus type 1 Vmw65 mutants. J
Latency entry of herpes simplex virus 1 is deter- Gen Virol 76(Pt 6):1417–1431
mined by the interaction of its genome with the 23. Preston CM, Nicholl MJ (1997) Repression of
nuclear environment. PLoS Pathog 12: gene expression upon infection of cells with
e1005834 herpes simplex virus type 1 mutants impaired
20. Cohen C, Corpet A, Roubille S, Maroui M-A, for immediate-early protein synthesis. J Virol
Poccardi N, Rousseau A, Kleijwegt C, Binda O, 71:7807–7813
Texier P, Sawtell N, Labetoulle M, Lomonte P 24. Cunningham C, Davison AJ (1993) A cosmid-
(2018) Promyelocytic leukemia (PML) nuclear based system for constructing mutants of her-
bodies (NBs) induce latent/quiescent HSV-1 pes simplex virus type 1. Virology
genomes chromatinization through a PML 197:116–124
NB/histone H3.3/H3.3 chaperone axis. 25. Catez F, Rousseau A, Labetoulle M, Lomonte
PLoS Pathog 14:e1007313 P (2014) Detection of the genome and tran-
21. Labetoulle M, Maillet S, Efstathiou S, scripts of a persistent DNA virus in neuronal
Dezelee S, Frau E, Lafay F (2003) HSV1 tissues by fluorescent in situ hybridization
latency sites after inoculation in the lip: assess- combined with immunostaining. J Vis Exp
ment of their localization and connections to 83:e51091
the eye. Invest Ophthalmol Vis Sci
44:217–225
Chapter 11
Oligonucleotide Enrichment of HSV-1 Genomic DNA from

Clinical Specimens for Use in High-Throughput Sequencing
Mackenzie M. Shipley, Molly M. Rathbun, and Moriah L. Szpara
Abstract
To date more than 400 genomes of herpes simplex virus 1 (HSV-1) and the distantly related HSV-2 have
been examined using deep sequencing techniques. This powerful approach has been especially useful for
revealing the global genetic diversity that exists within and between strains of each virus species. However,
most early methods for high-throughput sequencing required the input of abundant viral genomic DNA to
enable the successful production of sequencing libraries, and the generation of sufficient short-read
sequencing data for de novo genome assembly and similar applications. Therefore, the majority of
sequenced HSV strains have been cultured and expanded in vitro prior to genomic analysis, to facilitate
isolation of sufficient viral DNA for sequencing-library preparation. Here, we describe an in-solution
targeted enrichment procedure for isolating, enriching, and sequencing HSV genomic DNA directly
from clinical specimens. When this enrichment technique is combined with traditional sequencing-library
preparation procedures, the need for in vitro culturing, expansion, and purification of viral DNA is
eliminated. Furthermore, enrichment reduces the large amount of nonviral DNA that is typically present
in specimens obtained directly from natural infections, thereby increasing the likelihood of successful viral
genome sequencing and assembly. We have used this approach to prepare viral DNA libraries from clinical
specimens derived from skin swabs, saliva, blood, and similar sources. We then use these libraries for deep
sequencing and successful de novo assembly of the ~152 kb viral genomes, at coverage depths exceeding
100–1000, for both HSV-1 and HSV-2.
Key words Oligonucleotide enrichment, Deep sequencing, Virus, Clinical, Low-input, Herpes sim-
plex virus, Oral, Genital, Swab
1 Introduction
Next-generation sequencing (NGS) is a powerful technique that

facilitates the investigation of genetic information from organisms
ranging from humans and other mammals, to bacteria, fungi, and
viruses [1, 2]. Successful application of this technology depends on
the purity and the amount of genetic material present in a sample,
which is often limited in the case of clinical specimens such as those
collected from patients infected with herpes simplex virus 1 and
2 (HSV-1 and HSV-2). Traditionally, this problem has been
199
200 Mackenzie M. Shipley et al.
circumvented through initial culturing and expansion of the virus in

an in vitro environment (i.e., in cell culture). However, this in vitro
expansion can skew the genetic makeup of the pathogen in a
manner that may not be representative of the original in vivo infec-
tion [3–8]. Implementing a targeted oligonucleotide-based enrich-
ment approach enables capture of HSV (or any other pathogen’s)
genetic material directly from clinical specimens. The success of this
methodology has been demonstrated for a number of different
viruses, including multiple herpesviruses such as human cytomega-
lovirus (HCMV), varicella zoster virus (VZV), Epstein–Barr virus
(EBV), HSV-1, and HSV-2 [3, 9–14]. This method was originally
optimized in our laboratory for enriching and sequencing HSV
viral DNA directly from mucosal swabs obtained from the human
oral and/or genital tract. However, we have used the same
approach successfully for other biological sample types (i.e.,
blood, saliva, cerebrospinal fluid). Additionally, it is feasible to use
this method for enrichment of other herpesviruses, using oligonu-
cleotide baits targeted to the virus genome(s) of interest. Assembly
of whole viral genomes directly from minimal quantities of viral
DNA without initial culture is advantageous for a multitude of
applications, including clinical diagnostics, forensic comparisons,
analysis of ancient and/or degraded samples, and evolutionary
studies.
The protocol presented here is based on several commercially
available methods [15–20], which we have optimized based on our
insights and experience for successful generation of sequencing
libraries prepared from HSV-1 DNA that has been extracted
directly from clinical specimens. It should be noted that similar
outcomes could be achieved using commercial kits from other
manufacturers and/or with generic reagents. Additionally, multiple
platforms have been demonstrated to work for the oligonucleotide
enrichment portion of this protocol [3, 10, 13]. In our lab, we have
successfully applied the protocol below to achieve enrichment of
HSV-1 DNA from clinical specimens using Roche-Nimblegen Seq-
Cap® baits and more recently, Arbor Biosciences myBaits® [3].
There are three main sections detailed in this protocol for
preparing sequencing libraries of enriched HSV-1 or HSV-2 viral
DNA directly from clinical specimens (see Fig. 1). The protocol
begins with the isolation of total sample DNA using traditional
phenol-chloroform organic extraction techniques and overnight
precipitation of DNA. Following DNA isolation, the sample is
sheared into fragments and processed through a series of steps
to generate a sequencing library. This requires creating blunt
fragment ends on the sheared DNA, adding deoxyadenosine
50 -monophosphate (dAMP) to the 30 ends, ligating the fragment
ends to platform-specific sequencing adapters, and amplifying the
library DNA by PCR. Next, the library DNA fragments are hybri-
dized with the HSV-specific oligonucleotide baits, which selectively
Oligonucleotide Enrichment of HSV-1 DNA 201
Methods Workflow*:
3.1 3.2 3.3
Library Oligonucleotide
DNA Extraction Quantitate Preparation Quantitate Enrichment Quantitate Sequencing
i. Organic Extraction & i. Qubit i. DNA Shearing i. Qubit i. Bait Hybridization i. Qubit Per Illumina or
Overnight Precipitation ii. qPCR ii. End Repair & A-Tailing ii. qPCR ii. Target Capture ii. qPCR Alternative
ii. DNA Recovery & iii. Adapter Ligation iii. Reaction Clean-up iii. Agilent Manufacturer
Resuspension iv. Reaction Clean-up iv. PCR Amplification Bioanalyzer Protocol
v. PCR Amplification
i. 45-60 min; ON** i. 5-10 min i-iii. 90-210 min i. 5-10 min i. 30 min i. 5-10 min
ii. 90 min ii. 45-60 min iv-v. 2-3 hr ii. 45-60 min ii. 40-48 hr ii. 45-60 min
iii-iv. 2-4 hr iii. 45-60 min
*Total time to complete depends on the number of samples being processed and their ligation time. **ON = Overnight.
Fig. 1 Overview of methods. This flowchart provides an overview of the steps and the timing involved in
Subheadings 3.1, 3.2, and 3.3 of the protocol for oligonucleotide enrichment of viral DNA for use in high-
throughput sequencing
target and bind the viral DNA in a sequence-specific manner. The

oligonucleotide baits are biotinylated, which enables the user to
isolate the baits and the targeted viral DNA on streptavidin-coupled
magnetic beads, while using multiple wash steps to remove a large
portion of unbound, non-viral DNA from the immobilized library.
The result of this protocol is a DNA sequencing library that has
been enriched for HSV DNA and is ready to undergo deep
sequencing following appropriate quality control measurements.
2 Materials
2.1 DNA Extraction 1. Extraction Buffer (see Note 1): 10 mM Tris–HCl (pH 8),
10 mM EDTA, 100 mM NaCl, 2% SDS. To make 50 mL of
Extraction Buffer, combine 500 μL of 1 M Tris–HCl (pH 8.0),
500 μL of 1 M EDTA, 5 mL of 1 M NaCl, 10 mL of 10% SDS
w/v, and 34 mL of ddH2O. Store at room temperature.
2. Proteinase K: 20 mg/mL concentration, measure 200 mg Pro-
teinase K powder, dissolve in 10 mL ddH2O, store at 20 C
(see Note 1).
3. Thermomixer or heat block (set to 56 C).
4. 2 mL Phase-lock gel (PLG) Heavy tubes (Quanta Bio).
5. Buffered phenol–chloroform–isoamyl alcohol solution
(pH 8.0).
6. Microcentrifuge.
7. 1.5 and 2 mL Eppendorf tubes.
8. Linear polyacrylamide (LPA) (Alfa Aesar): 5 mg/mL stock
concentration, dilute 1:5 in ddH2O and store aliquots of
1 mg/mL at 20 C until ready for use.
9. 3 M sodium acetate solution (pH 5.2).
10. Ethanol: 100% (ice cold) and 70% (room temperature).

11. Vacuum centrifuge.
12. Resuspension Buffer: 10 mM Tris–HCl (pH 8.5). Take 500 μL
of 1 M Tris–HCl (pH 8.0), and add 40 mL ddH2O. Adjust pH
to 8.5 and then adjust to final volume of 50 mL with ddH2O as
needed.
13. Qubit fluorimeter version 2.0 or later.
14. Qubit-compatible 500 μL tubes.
15. Qubit dsDNA quantitation assay reagent kit: High Sensitivity
(for samples <600 ng/mL) or Broad Range (for samples
>600 ng/mL).
2.2 Library 1. 1.5 mL Eppendorf DNA LoBind tubes.

Preparation 2. 0.2 mL PCR tubes.
3. Life Technologies DynaMag-2 magnet compatible with
1.5 mL tubes.
4. Beckman Coulter AMPure XP Solid Phase Reversible Immobi-
lization (SPRI) magnetic beads (see Note 2).
5. 80% ethanol: combine 8 mL of 100% ethanol with 2 mL
ddH2O (see Note 3).
6. Thermocycler.
7. Covaris sonicator.
8. Covaris microTube Adaptive Focused Acoustics® (AFA®) Fiber
Pre-slit Snap-caps.
9. AFA®-grade H2O.
10. KAPA HyperPrep Library Kit with PCR reagents, compatible
with Illumina® indices and reagents.
11. Illumina® TruSeq DNA Single Index sets A and B.
12. Resuspension Buffer: 10 mM Tris–HCl (pH 8.5)—see Sub-
heading 2.1, step 12.
2.3 Oligonucleotide 1. 1.5 mL Eppendorf DNA LoBind tubes.

Enrichment 2. 0.2 mL PCR tubes.
3. Life Technologies DynaMag-2 magnet compatible with
1.5 mL tubes.
4. Beckman Coulter AMPure XP (SPRI) beads (see Note 2).
5. 80% ethanol: combine 8 mL of 100% ethanol with 2 mL
ddH2O (see Note 3).
6. Thermocycler.
7. Benchmark myBlock Mini Dry Bath or similar
instrumentation.
8. Heat block: set to 65 C.

9. Arbor Biosciences myBaits® Target Capture Kit (see Note 4).
10. Arbor Biosciences Hybridization Master Mix: 9.25 μL/sample
reagent N, 3.5 μL/sample reagent D, 0.5 μL/sample reagent S
(see Note 5), and 1.25 μL/sample reagent R.
11. Arbor Biosciences Blockers Master Mix: 0.5 μL/sample Block
reagent A, 2.5 μL/sample Block reagent C, and 2.5 μL/sample
Block reagent O.
12. Arbor Biosciences myBaits® custom HSV oligonucleotide
probes bound to biotin. Note that others can order our current
HSV oligonucleotide bait set directly from Arbor Biosciences.
13. Wash Buffer X: Combine 400 μL Arbor Biosciences Hybridi-
zation reagent S + 10 mL Arbor Biosciences Wash
Buffer + 39.6 mL ddH2O. Aliquot 1 mL of Wash Buffer X
into 1.5 mL Eppendorf tubes and store at 20 C. Warm
aliquots to 65 C for 30 min prior to beginning oligo-
enrichment process (see Note 6).
14. Tween Resuspension Buffer: 10 mM Tris–HCl with 0.05%
Tween 20 (pH 8.0–8.5). Prepare 50 mL of 10 mM Tris–HCl
(pH 8.5) as directed in Subheading 2.1, step 12. Add 25 μL of
Tween 20 solution and adjust the pH if necessary. Vortex the
solution to mix and aliquot into 1.5 mL Eppendorf tubes and
store at room temperature.
2.4 Quantitation 1. Qubit® Fluorimeter version 2.0 or later.

and Quality Control 2. Qubit-compatible 500 μL tubes.
Measurements (See
3. Qubit DNA quantitation assay reagent kit: High Sensitivity
Note 7)
(for samples <600 ng/mL) or Broad Range (for samples
>600 ng/mL).
4. qPCR instrument and compatible reagents for estimation of
HSV genome copy number (see Note 8).
5. Agilent 2100 Bioanalyzer instrument. Agilent Bioanalyzer
DNA electrophoresis chips: DNA 1000 (for samples
>10 ng/μL) or DNA High Sensitivity (for samples <10 ng/
μL). Agilent Bioanalyzer DNA reagent kit: DNA 1000 or DNA
High Sensitivity.
6. Real-time qPCR assay for quantitating total DNA library con-
centration compatible with Illumina indices.
3 Methods
3.1 DNA Extraction 1. Assuming 300 μL starting material, add 600 μL Extraction
Buffer and 24 μL Proteinase K stock (20 mg/mL) to each
3.1.1 Extraction
sample in a 1.5 mL Eppendorf tube (see Notes 9 and 10).
and Overnight Precipitation
2. Incubate samples at 56 C for 15 min (see Note 11) in a
thermomixer set at ~400 rpm. Then transfer the sample con-
tents to a 2 mL PLG tube (see Note 12).
3. Add equal volume (924 μL) of buffered (pH 8.0) phenol/
chloroform/isoamyl alcohol solution to each sample and invert
to mix. Do not vortex when using PLG tubes. Centrifuge at
maximum speed for 10 min in a microcentrifuge at room
temperature.
4. Transfer the upper, aqueous phase of each sample to a new,
labeled 2-mL Eppendorf tube containing 10–20 μg LPA (see
Note 13).
5. Add 94 μL (1:10 ratio) of 3 M sodium acetate (pH 5.2) solu-
tion to each sample and invert to mix.
6. Add 1 mL ice cold 100% ethanol to each sample and precipitate
at 20 C overnight.
3.1.2 DNA Recovery, 1. Recover precipitated DNA by centrifuging at maximum speed

Resuspension, for 30 min in a microcentrifuge at room temperature.
and Quantitation 2. Quickly pour off the supernatant (see Note 14) and add 1 mL
room temperature 70% ethanol to each sample and invert. It is
likely that no DNA pellet will be visible at this time.
3. Centrifuge samples again at maximum speed for 20 min.
4. Pour off supernatant (see Note 14).
5. Evaporate supernatant and dry down DNA pellets in a vacuum
centrifuge with no heat or pulse vent applied (15–30 min).
6. Resuspend each DNA sample in 30 μL of 10 mM Tris–HCl
(pH 8.5).
7. Quantitate DNA concentration using Qubit fluorimeter with
High Sensitivity dsDNA Assay for quantifying total DNA (see
Note 15).
8. Quantitate approximate HSV genome copy number by qPCR
(see Note 8).
9. Estimate the percent (%) HSV for each sample using Qubit and
qPCR data with the following conversion of ng/μL to HSV
genomes/μL (Fig. 2).
sample conc.:
# HSV -9 23
genomes =
per μL
( ng
μL
) (
×
10 g
1 ng
× ) (
1 mole DNA bp
650 g
× ) (
6.022×10 molecules
1 mole
×
1 HSV genome
152,000 bp
) ( )
Fig. 2 Equation to estimate viral DNA from Qubit and qPCR data. This equation is used to estimate the percent
(%) HSV for each sample, by using measurements from Qubit and qPCR, and converting ng/μL to HSV
genomes/μL
3.2 Library 1. Bring up total volume of each DNA sample to 52.5 μL using
Preparation Resuspension Buffer (10 mM Tris–HCl, pH 8.5) and transfer
to a Covaris glass tube (see Note 16).
3.2.1 DNA Shearing, End
Repair + A-Tailing, 2. Shear total DNA into approximate 750 bp fragments (see
and Adapter Ligation Note 17) using Covaris sonicator with the following settings:
10% duty, power 60, 200 cycles/burst for 60 s at 4 C. Transfer
sheared DNA into labeled 0.2 mL PCR tubes.
3. Process sheared DNA through combined End Repair and
A-tailing reactions (KAPA Hyperprep Library Kit).
4. Make a master mix of 7 μL of KAPA End Repair and A-Tailing
Buffer with 3 μL of KAPA End Repair and A-Tailing Enzyme
Mix per sample.
5. Aliquot 10 μL of master mix into each sample and gently
pipette up and down to mix.
6. Set samples in thermocycler with the following settingsa:
Temperature, C Time, min Comments

20 30 End repair
65 30 A-Tailing
4 Hold –
Perform program with thermocycler lid set to 85 C

a
7. Collect End-repaired and A-tailed DNA samples for immediate

adapter ligation with Illumina TrueSeq DNA single indices (see
Note 18).
8. Add 5 μL of Illumina adapters (15 μM concentration) to each
sample.
9. Make a master mix of 5 μL ddH2O, 30 μL ligation buffer, and
10 μL DNA ligase enzyme per sample. Aliquot 45 μL of master
mix into each DNA sample. Gently pipette up and down
to mix.
10. If samples contain 10% HSV DNA, perform ligation for up to
2 h at 20 C.
11. If samples contain <10% HSV DNA, perform ligation at 4 C
overnight (see Note 19).
3.2.2 Ligation Clean Up 1. Aliquot 140 μL of AMPure XP (SPRI) beads per sample and
and PCR Amplification equilibrate to room temperature prior to use (see Note 2).
2. Aliquot 800 μL per sample of fresh 80% ethanol.
3. Following adapter ligation, perform ligation cleanup using
AMPure XP (SPRI) beads at 0.8 the starting volume.
4. Combine 110 μL adapter-ligated DNA sample + 88 μL
AMPure XP beads in a 1.5 mL Eppendorf DNA LoBind tube.
5. Incubate beads with sample for 15 min at room temperature.
6. Pellet beads on the DynaMag-2 magnet for 1–2 min and
discard supernatant.
7. Wash beads containing bound DNA library with 200 μL of 80%
ethanol and let incubate in the ethanol on the magnet for 1 min
8. Remove ethanol and repeat step 7 for a total of two washes.
9. Place DynaMag-2 magnet and tubes with bead-bound DNA
libraries in a fume hood to dry for 2–5 min at room tempera-
ture (see Note 20).
10. Remove the sample tubes via the plastic tube framework from
the DynaMag-2 magnet and resuspend each AMPure XP bead-
bound DNA library in 21 μL of Resuspension Buffer (10 mM
Tris–HCl, pH 8.5). Incubate the samples at room temperature
for 2 min, to enable DNA dissociation from the beads.
11. Place the plastic framework containing the resuspended beads
and dissociated DNA back on the DynaMag-2 magnet and
allow the beads to pellet for 1–2 min. While being careful not
to disrupt the bead pellet, transfer 20 μL of each DNA library
into a labeled 0.2 mL PCR tube for downstream PCR amplifi-
cation (see Note 21).
12. Make a master mix of KAPA HyperPrep kit amplification reagents
for PCR based on the number of samples you have. Add 5 μL
of KAPA Library Amplification Primer Mix (10) per sample
and 25 μL of KAPA Hi-Fi HotStart Ready Mix (2) per sample.
13. Aliquot 30 μL of master mix into each 0.2 mL PCR tube
containing a DNA library.
14. Amplify DNA libraries by PCR using the following thermo-
cycler settingsa:
Temperature, C Time Comments

98 45 s
98 15 s
60 30 s 1–14 cycles (see Note 22)
72 45 s
72 60 s
4 Hold
Perform program with thermocycler lid set to 105 C

a
15. Following amplification of each DNA library by PCR, perform

a 1 ligation cleanup using AMPure XP (SPRI) beads.
16. Combine 50 μL adapter-ligated DNA library + 50 μL AMPure
XP beads in 1.5 mL Eppendorf DNA LoBind tubes.
18. Pellet the beads on the DynaMag-2 magnet for 1–2 min and
discard the supernatant.
19. Wash the beads containing the bound DNA library with
200 μL of 80% ethanol and incubate in the ethanol on the
magnet for 1 min at room temperature.
20. Remove the ethanol and repeat step 19 to achieve a total of
two washes.
21. Place the DynaMag-2 magnet and tubes with bead-bound
DNA libraries in a fume hood to dry for 2–5 min at room
temperature (see Note 20).
bound DNA library in 14.5 μL of ddH2O. Incubate at room
temperature for 2 min, to enable DNA dissociation from the
beads.
allow the beads to pellet for 1–2 min. Collect 7 μL of each
DNA library in ddH2O for downstream oligonucleotide
enrichment.
24. Keep the remaining ~7 μL of each DNA library for QC
analyses. Perform QC analyses (Qubit and qPCR assays as in
next steps) prior to moving forward with the enrichment
process.
25. Quantitate DNA concentration using a Qubit fluorimeter (see
Note 23).
26. Quantitate approximate HSV genome copy number using a
qPCR assay for UL27 (gB) or similar [21]. See Note 8, and
Subheading 3.1.2, step 9 above for the equation used to
estimate genome copy number.
3.3 Oligonucleotide 1. Prepare Arbor Biosciences Hybridization Master Mix and

Enrichment Blockers Master Mix for hybridization reaction setup based
on the total number of samples being processed.
3.3.1 Bait Hybridization
2. Aliquot 5 μL of diluted Arbor Biosciences HSV-specific oligo-
nucleotide baits into individual 0.2 mL PCR tubes, with the
appropriate dilution for each sample (see Note 24). Then add
13.5 μL of the Hybridization Master Mix to each tube contain-

ing baits.
3. Pipet 5 μL of Blockers Master Mix into separate 0.2 mL PCR
tubes containing each individual DNA library (7 μL), for a total
reaction volume of 12 μL.
4. Set up the following program on a thermocycler and load
samples as describeda:

95 5 min See Subheading 3.3.1, step 5
65 5 min See Subheading 3.3.1, step 6
65 HOLD See Subheading 3.3.1, step 7 and
40–48 h Note 25
Set thermocycler lid is set to 105 C

a
5. Heat only the DNA libraries + Blockers Master Mix at 95 C for

5 min.
6. Wait for the thermocycler to get down to 65 C before pausing
the program and adding the PCR tubes containing the HSV
baits + Hybridization Master Mix. Tubes containing the DNA
libraries + Blockers Master Mix will remain in the thermocycler.
Heat both sets of tubes at 65 C for 5 min.
7. When there are <5 s remaining in the 5 min 65 C heating
period, pause the program and combine 18 μL of HSV
baits + Hybridization Mix into 12 μL of DNA libraries + Block-
ers Mix. Resume the program, and leave the samples in the
thermocycler overnight holding at 65 C prior to transferring
to a mini dry heat block if applicable.
3.3.2 Target Capture, 1. Prepare an aliquot of AMPure XP beads, enough for 50 μL per
Clean Up, and PCR sample. Equilibrate to room temperature prior to beginning
Amplification Day 3 of the oligo-enrichment process.
2. Prepare an aliquot of fresh 80% ethanol, enough for 400 μL per
sample.
3. Prepare aliquots of Wash Buffer X by warming them at 65 C
for 30 min—1.5 mL Wash Buffer X needed per sample.
4. Prepare an aliquot of Arbor Biosciences streptavidin magnetic
beads, enough for 30 μL per sample for HSV DNA binding and
target capture. A single 1.5 mL Eppendorf DNA LoBind tube
can hold a master mix of streptavidin beads for up to eight
samples.
5. Pellet streptavidin beads on DynaMag-2 magnet for 1–2 min
and remove and discard the supernatant.
6. Wash streptavidin beads with 200 μL Arbor Biosciences Bind-

ing Buffer per sample. Be sure to scale up the amount of buffer
needed if making a master mix of beads for multiple samples.
Briefly vortex and re-pellet the beads in Binding Buffer for
1–2 min (see Note 26). Remove supernatant.
7. Repeat Subheading 3.3.2, step 6 twice, for a total of three
washes.
8. Resuspend streptavidin beads in 70 μL Binding Buffer per
sample or appropriate volume for master mix. Aliquot 70 μL
beads into an individual 1.5 mL Eppendorf DNA LoBind tube
for each sample.
9. Heat streptavidin bead aliquots in a heat block at 65 C for
5 min.
10. After 5 min, combine each sample and bait hybridization reac-
tions with each streptavidin bead aliquot and pipet to mix.
11. Maintain the mixture of samples, baits, and streptavidin beads
at 65 C for 5 additional minutes to facilitate capture of target
fragments. After 2.5 min, briefly agitate samples by vortexing.
12. Pellet streptavidin beads on DynaMag-2 magnet for 1–2 min
and discard supernatant (see Note 26).
13. Wash streptavidin beads and captured target fragments with
375 μL of Wash Buffer X heated to 65 C.
14. Vortex samples and incubate in heat block at 65 C for 5 min.
15. After 2.5 min, briefly agitate samples by vortexing.
16. Repeat steps 12–14 for a total of three washes.
17. Pipet off all remaining liquid in each sample tube and dry
samples in a fume hood for 5–10 min (see Note 27).
18. Resuspend each pelleted mixture of streptavidin beads and
target fragments in 20 μL Tween Resuspension Buffer
(10 mM Tris–HCl with 0.05% Tween 20, pH 8.0–8.5) for
PCR amplification (see Note 28).
19. Make a master mix of KAPA amplification reagents for PCR
based on the number of samples you have. Add 5 μL KAPA
Library Amplification Primer Mix (10) per sample and 25 μL
KAPA Hi-Fi HotStart Ready Mix (2) per sample. Aliquot
30 μL of the master mix into each 0.2 mL PCR tube containing
an individual mixture of beads and target fragments.
20. Perform PCR amplification of each mixture of streptavidin
beads and target fragments using the following thermocycler
programa:

98 2 min
98 20 s
60 30 s
72 45 s 14 cycles (see Note 29)
72 5 min
8 Hold
Perform program with heated lid set to 105 C

a
21. Following PCR, gently resuspend the streptavidin beads and

amplified, enriched DNA library and transfer each solution to a
new, labeled 1.5 mL Eppendorf DNA LoBind tube.
22. Pellet the streptavidin beads on the DynaMag-2 magnet for
1–2 min.
23. Keep and transfer the supernatant of each sample to a new,
labeled 1.5 mL Eppendorf DNA LoBind tube. Discard the
streptavidin beads.
24. Perform a 1 ligation cleanup of each amplified, enriched
DNA library using AMPure XP (SPRI) beads.
25. Combine each 50 μL amplified, enriched DNA library with
50 μL AMPure XP beads in 1.5 mL Eppendorf DNA LoBind
tubes.
27. Pellet beads on DynaMag-2 magnet for 1–2 min and discard
the supernatant.
28. Wash beads containing the bound, enriched DNA libraries
with 200 μL of 80% ethanol and incubate in the ethanol on
the magnet for 1 min at room temperature.
29. Remove ethanol and repeat step 28 again for a total of two
washes.
30. Place DynaMag-2 magnet and tubes with bead-bound
enriched DNA libraries in a fume hood to dry for 2–5 min at
room temperature (see Note 20).
bound DNA library in 31 μL of Resuspension Buffer (10 mM
Tris–HCl, pH 8.5). Incubate at room temperature for 2 min,
to enable DNA dissociation from the beads.
allow the beads to pellet for 1–2 min. Collect 20 μL of each
enriched DNA library for downstream next-generation

sequencing.
33. Keep remaining 10 μL of each DNA library for QC analyses
(Qubit, HSV-qPCR, Bioanalyzer, and Illumina-qPCR below).
Perform QC analyses prior to moving forward with next-
generation sequencing.
34. Quantitate DNA concentration using a Qubit fluorimeter (see
Note 30).
35. Quantitate HSV genome copy number using a qPCR assay for
UL27 (gB) or similar [21]. See Note 8 and Subheading 3.1.2,
step 9 above for the equation used to estimate genome copy
number.
36. Analyze average DNA fragment size of enriched libraries using
Agilent 2100 Bioanalyzer (see Note 31).
37. Quantitate enriched DNA libraries using real-time qPCR assay
compatible with Illumina indices, to determine the nanomolar
(nM) concentration of each enriched DNA library, taking into
account average fragment size.
4 Notes
1. Can be scaled up or down, depending on number of samples

being processed. Extraction Buffer may need to be heated in a
water bath or heat block at 37 C for 5–10 min prior to use if
the SDS has precipitated out of solution.
2. The AMPure XP Solid Phase Reversible Immobilization (SPRI)
beads are only used for size-selection cleanup purposes in this
protocol. The size selection is based on the ratio of sample
DNA to polystyrene beads coated with carboxyl groups. The
concentration of the “crowding agent”—polyethylene glycol
(PEG) and salt (NaCl) in the bead solution determines the
relative sizes of DNA fragments that bind to the beads, versus
those that will be discarded during cleanup stages
[22, 23]. Allow an aliquot of SPRI beads that is sufficient for
all cleanup steps to equilibrate at room temperature for ~1–2 h
prior to use. Always mix SPRI beads thoroughly before
aliquoting.
3. Make 80% ethanol fresh for use each day.
4. The Target Capture Kit includes streptavidin-bound magnetic
beads that are only used during the enrichment stage of the
protocol. These beads enable physical isolation and enrichment
of the biotin-labeled HSV probes bound to viral DNA of
interest.
5. The SDS content in Hybridization reagent S results in a white

precipitate when stored at 4 C. Heat Hybridization reagent S
at 60 C in a heat block or thermomixer for 5–10 min to
dissolve the precipitate into solution prior to use. Note that
the Hybridization Master Mix may also need to be heated at
60 C if a precipitate forms after adding Hybridization
reagent S.
6. Can make Wash Buffer X aliquots in advance (days to weeks) of
beginning oligo-enrichment process. Only remove enough ali-
quots for 3 375 mL washes per sample, leaving the remainder
of the aliquots at 20 C. Can refreeze any unused Wash
Buffer X, but limit the number of freeze-thaws per aliquot to
2.
7. Quality control measurements are critical to perform prior to,
during, and following all of the procedures presented here.
Total DNA quantification via Qubit and HSV genome copy
number quantification via qPCR is recommended following
each major step outlined here (i.e., DNA isolation, library
preparation, and oligonucleotide enrichment). We recommend
against using Nanodrop or similar spectrophotometric devices
for DNA quantitation, as we have found it to be far less accu-
rate and sensitive; resulting in overestimation of the true quan-
tity of DNA present in a sample compared to fluorescence-
based DNA quantitation via Qubit. Bioanalyzer nucleic acid
electrophoresis and fragment analysis as well as total DNA
library quantification by real-time qPCR only need to be per-
formed following oligonucleotide enrichment.
8. We use type-common qPCR primers that amplify both HSV-1
and HSV-2 UL27 (gB) [21]. This assay has been well-
characterized by prior authors and is used in diagnostic and
research settings for the detection of HSV DNA [13, 21,
24–26]. Because the quantitative estimation of HSV genome
copy number can be achieved using any of several qPCR-based
metrics, we do not specify any single assay here.
9. Adjust volumes of Extraction Buffer (2:1 ratio) and Proteinase
K solution (1:12.5 ratio) as needed, depending on initial sam-
ple volume. If starting with >300 μL starting material, either
divide sample in half and process halves separately, or process in
15 mL conical tubes (this requires the availability of 15 mL
PLG tubes). If starting with <300 μL starting material—such
as DNA isolation from a piece of swab or Whatman card, use a
minimum of 300 μL Extraction Buffer and 12 μL Proteinase K
stock solution.
10. We recommend processing no more than six samples at once,
due to the time needed to process each sample.
11. The incubation period is flexible and dependent on sample

type. If beginning the DNA extraction protocol with dry sam-
ples such as a piece of swab or Whatman card, extend the
incubation period to overnight at 56 C.
12. Label 2-mL Eppendorf PLG tubes for each sample during the
15-min incubation period at step 3 (Subheading 3.1.1).
13. We recommend adding 10–20 μg of carrier DNA in the form
of linear polyacrylamide (LPA) if the sample is predicted to
have low DNA yields (100 ng total DNA). In our hands,
clinical specimens such as mucosal swabs or Whatman card
samples typically yield far less total DNA than blood samples,
for example.
14. While working quickly, gently pour off the supernatant from
each sample. Be sure not to wait too long to pour off the
supernatant as the DNA pellet can dislodge from the bottom
of the tube over time. Do not shake or “pour” tubes more than
once. There will still be supernatant remaining at the bottom of
the tube (~50–100 μL) following each ethanol wash and this
is okay.
15. Qubit Broad Range dsDNA assay may be substituted if
necessary.
16. If using this protocol in conjunction with Illumina®-compati-
ble reagents and sequencing instrumentation, the “Resuspen-
sion Buffer” that is commonly supplied with Illumina® library
kits can also be used in place of the 10 mM Tris–HCl (pH 8.5)
solution named “Resuspension Buffer” where listed through-
out this protocol.
17. Following DNA shearing, we achieve fragment sizes that range
from 500–1000 bp in length. While Illumina recommends an
average fragment size of 550 bp, we observe success with larger
input DNA fragments with regard to sequencing and de novo
genome assembly.
18. If using a non-Illumina platform for sequencing-library prepa-
ration, adjust step 8 (Subheading 3.2.1) to include platform-
appropriate adapters.
19. When ligating adapters overnight, adapter dimers may form. If
this occurs, reduce ligation time and/or optimize adapter con-
centration. It is also feasible to perform an optional second
cleanup following ligation to eliminate any adapter dimers,
although this may result in substantial loss of sample material.
20. Be careful not to overdry the beads, as this can result in DNA
loss. The beads should no longer appear “shiny,” but will begin
to have a “cracked-earth” appearance when they have been
dried too long.
21. Protocol can be stopped at this point in time and DNA libraries
stored at 20 C until ready to proceed to PCR amplification.
22. Amplifying the total pool of DNA when there are relatively low
quantities of viral DNA compared to nontarget host or micro-
bial DNA can result in the loss of targeted viral DNA, potential
distortion of the viral population, and/or PCR bias. Therefore,
it is best to perform the minimum number of PCR cycles
needed to produce sufficient DNA and viral material for oligo-
nucleotide enrichment. 0–4 cycles of PCR are recommended
for samples with >700 ng total DNA, 4–8 cycles of PCR are
recommended for samples with >50 ng total DNA, and 8–-
14 cycles of PCR are recommended for samples with <50 ng
total DNA.
23. We typically use Qubit dsDNA Broad Range assay for quantify-
ing total DNA obtained following library preparation and PCR
amplification.
24. We recommend using 100–250 ng (1–2.5 μL) of oligonucleo-
tide baits per sample to achieve enrichment. The optimal con-
centration will depend on bait source. Dilute baits in
ddH2O. For samples with abundant total DNA (>500 ng),
use 250 ng baits. Add oligonucleotide baits separately from
Hybridization Master Mix if samples require different concen-
trations of baits.
25. We perform the first 12–24 h of the hybridization reaction at
65 C in a thermocycler to assist with temperature ramping.
These reactions can then be quickly transferred to a mini dry
heat block set to 65 C with a heated lid to finish the hybridiza-
tion period and free up the thermocycler for other users.
26. Streptavidin beads may not pellet well and samples may appear
cloudy in the Eppendorf DNA LoBind tubes even after a few
minutes on the DynaMag-2 magnet. If this occurs, use a
P1000 micropipette and pull up the supernatant from the
tube and pipet it directly back into the tube to disperse and
pellet any streptavidin beads that may have been suspended in
solution.
27. As the Wash Buffer X contains no ethanol and may take a while
to completely dry in the fume hood, an alternative drying
method is to use aspirating pipettes and a vacuum line to dry
the samples and get rid of any remaining liquid. Be extremely
careful not to dislodge the pellet or overdry the beads as
mentioned above for the AMPure XP beads. See Note 20 for
additional details regarding bead drying.
28. It is recommended to amplify targeted DNA fragments directly
“on the bead” if using KAPA HiFi HotStart polymerase, to
eliminate any possible loss associated with eluting DNA off of

the beads. If not using KAPA HiFi HotStart polymerase for
PCR reactions, it is recommended to first elute targeted DNA
fragments off the streptavidin beads by heating the sample at
95 C for 5 min.
29. Due to the large quantity of human and/or microbial DNA
present in clinical specimens, the total amount of DNA remain-
ing in the enriched samples following target capture with HSV
baits will be substantially lower. Therefore, it is recommended
to perform more PCR cycles at this stage, in order to have
sufficient viral material for next-generation sequencing.
30. We typically use Qubit dsDNA Broad Range assay for quantify-
ing total DNA obtained following library preparation and PCR
amplification.
31. We typically use the Bioanalyzer DNA 1000 electrophoresis
chip and reagents.
Acknowledgments
We thank members of David Bloom’s lab for sharing their protocols

for oligonucleotide enrichment with us, as well as Chris Bowen,
Chad Kuny, and members of the Szpara lab for feedback on these
protocols. The authors acknowledge support from the Eberly Col-
lege of Science and the Huck Institutes of the Life Sciences at
Pennsylvania State University, as well as NIH R21 AI140443
(M.L.S.). M.M.S. was supported by the Tershak Graduate Fellow-
ship from Pennsylvania State University. MMR was supported by
NIH 5T32 GM 102057-5. This research was funded, in part,
under a grant from the Pennsylvania Department of Health
CURE program (M.L.S.). The Department specifically disclaims
responsibility for any analyses, interpretations, or conclusions.
References
1. Margulies M, Egholm M, Altman WE, RF, Rothberg JM (2005) Genome sequencing
Attiya S, Bader JS, Bemben LA, Berka J, in microfabricated high-density picolitre reac-
Braverman MS, Chen Y-J, Chen Z, Dewell tors. Nature 437:376–380
SB, Du L, Fierro JM, Gomes XV, Godwin 2. Shendure J, Ji H (2008) Next-generation
BC, He W, Helgesen S, Ho CH, Irzyk GP, DNA sequencing. Nat Biotechnol
Jando SC, Alenquer MLI, Jarvie TP, Jirage 26:1135–1145
KB, Kim J-B, Knight JR, Lanza JR, Leamon 3. Shipley MM, Renner DW, Ott M, Bloom DC,
JH, Lefkowitz SM, Lei M, Li J, Lohman KL, Koelle DM, Johnston C, Szpara ML (2018)
Lu H, Makhijani VB, McDade KE, McKenna Genome-wide surveillance of genital herpes
MP, Myers EW, Nickerson E, Nobile JR, simplex virus type 1 from multiple anatomic
Plant R, Puc BP, Ronan MT, Roth GT, Sarkis sites over time. J Infect Dis 218:595–605
GJ, Simons JF, Simpson JW, Srinivasan M, Tar-
taro KR, Tomasz A, Vogt KA, Volkmer GA, 4. Dargan DJ, Douglas E, Cunningham C,
Wang SH, Wang Y, Weiner MP, Yu P, Begley Jamieson F, Stanton RJ, Baluchova K,
McSharry BP, Tomasec P, Emery VC,
Percivalle E, Sarasini A, Gerna G, Wilkinson 13. Greninger AL, Roychoudhury P, Xie H,

GWG, Davison AJ (2010) Sequential muta- Casto A, Cent A, Pepper G, Koelle DM,
tions associated with adaptation of human Huang M-L, Wald A, Johnston C, Jerome KR
cytomegalovirus to growth in cell culture. J (2018) Ultrasensitive capture of human herpes
Gen Virol 91:1535–1546 simplex virus genomes directly from clinical
5. Boyer M, Azza S, Barrassi L, Klose T, samples reveals extraordinarily limited evolu-
Campocasso A, Pagnier I, Fournous G, tion in cell culture. mSphere 3:
Borg A, Robert C, Zhang X, Desnues C, e00283–e00218
Henrissat B, Rossmann MG, La Scola B, 14. Tu C, Zeng Z, Qi P, Li X, Yu Z, Guo C,
Raoult D (2011) Mimivirus shows dramatic Xiong F, Xiang B, Zhou M, Gong Z (2017)
genome reduction after intraamoebal culture. Genome-wide analysis of 18 Epstein-Barr
Proc Natl Acad Sci 108:10296–10301 viruses isolated from primary nasopharyngeal
6. Murphy E, Yu D, Grimwood J, Schmutz J, carcinoma biopsy specimens. J Virol 91:
Dickson M, Jarvis MA, Hahn G, Nelson JA, e00301–e00317
Myers RM, Shenk TE (2003) Coding potential 15. GE Healthcare, Whatman. Reliable extraction
of laboratory and clinical strains of human of DNA from Whatman FTA cards – organic
cytomegalovirus. Proc Natl Acad Sci extraction of DNA application note 28-9822-
100:14976–14981 22 AA
7. Bradley AJ, Lurain NS, Ghazal P, Trivedi U, 16. KAPA Biosystems. KAPA LTP library prepara-
Cunningham C, Baluchova K, Gatherer D, tion kit KR0453 – v5.16
Wilkinson GWG, Dargan DJ, Davison AJ 17. Roche NimbleGen. SeqCap EZ library SR
(2009) High-throughput sequence analysis of user’s guide v4.2
variants of human cytomegalovirus strains 18. KAPA Biosystems. KAPA HyperPrep Kit
Towne and AD169. J Gen Virol KR0961 – v5.16
90:2375–2380
19. MYcroarray. MYbaits in-solution sequence
8. Wilkinson GWG, Davison AJ, Tomasec P, capture for targeted high-throughput sequenc-
Fielding CA, Aicheler R, Murrell I, ing user manual v3.02
Seirafian S, Wang ECY, Weekes M, Lehner PJ,
Wilkie GS, Stanton RJ (2015) Human cyto- 20. Arbor Biosciences. myBaits hybridization cap-
megalovirus: taking the strain. Med Microbiol ture for targeted NGS manual v4.01
Immunol 204:273–284 21. Ryncarz AJ, Goddard J, Wald A, Huang M-L,
9. Hage E, Wilkie GS, Linnenweber-Held S, Roizman B, Corey L (1999) Development of a
Dhingra A, Suárez NM, Schmidt JJ, high-throughput quantitative assay for detect-
Kay-Fedorov PC, Mischak-Weissinger E, ing herpes simplex virus DNA in clinical sam-
Heim A, Schwarz A, Schulz TF, Davison AJ, ples. J Clin Microbiol 37:1941–1947
Ganzenmueller T (2017) Characterization of 22. DeAngelis MM, Wang DG, Hawkins TL
human cytomegalovirus genome diversity in (1995) Solid-phase reversible immobilization
immunocompromised hosts by whole-genome for the isolation of PCR products. Nucleic
sequencing directly from clinical specimens. J Acids Res 23:4742–4743
Infect Dis 215:1673–1683 23. Fisher S, Barry A, Abreu J, Minie B, Nolan J,
10. Depledge DP, Palser AL, Watson SJ, Lai IY-C, Delorey TM, Young G, Fennell TJ, Allen A,
Gray ER, Grant P, Kanda RK, Leproust E, Ambrogio L, Berlin AM, Blumenstiel B,
Kellam P, Breuer J (2011) Specific capture Cibulskis K, Friedrich D, Johnson R, Juhn F,
and whole-genome sequencing of viruses Reilly B, Shammas R, Stalker J, Sykes SM,
from clinical samples. PLoS One 6:1–7 Thompson J, Walsh J, Zimmer A, Zwirko Z,
11. Depledge DP, Gray ER, Kundu S, Cooray S, Gabriel S, Nicol R, Nusbaum C (2011) A scal-
Poulsen A, Aaby P, Breuer J (2014) Evolution able, fully automated process for construction
of cocirculating varicella-zoster virus genotypes of sequence-ready human exome targeted cap-
during a chickenpox outbreak in guinea- ture libraries. Genome Biol 12:R1
Bissau. J Virol 88:13936–13946 24. Jerome KR, Huang M-L, Wald A, Selke S,
12. Koelle DM, Norberg P, Fitzgibbon MP, Rus- Corey L (2002) Quantitative stability of DNA
sell RM, Greninger AL, Huang M-L, after extended storage of clinical specimens as
Stensland L, Jing L, Magaret AS, Diem K, determined by real-time PCR. J Clin Microbiol
Selke S, Xie H, Celum C, Lingappa JR, Jerome 40:2609–2611
KR, Wald A, Johnston C (2017) Worldwide 25. Johnston C, Zhu J, Jing L, Laing KJ, McClur-
circulation of HSV-2 HSV-1 recombinant kan CM, Klock A, Diem K, Jin L, Stanaway J,
strains. Sci Rep 7:44084 Tronstein E, Kwok WW, Huang M -l, Selke S,
Fong Y, Magaret A, Koelle DM, Wald A, Corey
L (2014) Virologic and immunologic evidence detection of herpes simplex virus (HSV) DNA
of multifocal genital herpes simplex virus on mucosal surfaces: comparison with HSV
2 infection. J Virol 88:4921–4931 isolation in cell culture. J Infect Dis
26. Wald A, Huang M-L, Carrell D, Selke S, Corey 188:1345–1351
L (2003) Polymerase chain reaction for
Chapter 12
HSV Mutant Generation and Dual Detection Methods

for Gaining Insight into Latent/Lytic Cycles In Vivo
Nancy M. Sawtell and Richard L. Thompson
Abstract
Two important components of a useful strategy to examine viral gene function, regulation, and pathogen-
esis in vivo are (1) a highly efficient protocol to generate viral mutants that limits undesired mutation and
retains full replication competency in vivo, and (2) an efficient system to detect and quantify viral promoter
activity and gene expression in rare cells in vivo and to gain insight into the surrounding tissue environment.
Our strategy and protocols for generating, characterizing, and employing HSV viral promoter/reporter
mutants in vivo are provided in this two-part chapter.
Key words Herpes simplex virus, Viral mutant, Promoter/reporter, Viral DNA, Plaque purification,
Replication kinetics, Tissue culture, Transfection, Selection marker, Marker rescue, Trigeminal gan-
glion, Immunohistochemistry, Histochemistry, Sensory neuron, Whole tissue, E. coli β-galactosidase,
Latency, Lytic infection, Viral gene expression, Local host cellular response
1 Introduction
Acquiring information on the regulation of gene expression in

individual rare cells within a tissue remains a challenge. This type
of information can be critical, however, in understanding disease
processes resulting from residency of certain chronic or latent
pathogens, including herpes simplex virus. Our laboratories focus
on molecular mechanisms regulating herpes simplex virus (HSV) in
the nervous system. HSV is a neurotropic DNA virus infecting
humans. During the acute stage of infection, viral replication at
the mucosal site of infection is associated with virion transport into
the nervous system through the innervating sensory nerve endings
[1, 2]. In the neuron, transcriptional activity from the viral genome
can be (1) largely repressed, resulting in latent infection and sur-
vival of the neuron or (2) fully activated generating infectious virus
and death of the neuron [3–5]. Insight into the regulation of this
critical “decision” is key to the rationale design of antiviral strate-
gies. While ex vivo models can provide insight, the signals
219
220 Nancy M. Sawtell and Richard L. Thompson
impinging on the cells are unlikely to represent the integration of

the complex interplay between host and virus signals as the infec-
tion moves through time and distinct tissue/cell types in vivo.
Importantly, the local tissue responses to the viral activity is likely
to be central in modulating viral activity and ultimately to disease
outcome.
1.1 Generation Common HSV laboratory isolates as well as low passage clinical
of Promoter/Reporter HSV isolates vary widely in important biological properties includ-
HSV Mutants ing neurovirulence and the capacity to reactivate from latency. For
those studies involving animal models, the phenotypic properties
such as replication efficiency, neuroinvasiveness, and virulence in
the species and even strain of the experimental animal should be
considered. Highly neurovirulent isolates such as McKrae have
been extensively employed in rabbit studies and tend to reactivate
from latency with higher frequencies in that model [6, 7]. Smaller
species such as rats and mice are more susceptible to infection. In
these animals therefore procedures that decrease the variability of
infection between animals such as scarification of the cornea cannot
be employed with highly virulent virus isolates because too many
animals succumb to infection. The use of passive antibody adminis-
tration or antiviral therapy to modulate disease can be employed
[8], but may confound interpretation of results [9]. Several labora-
tory isolates of intermediate virulence have been employed to
generate mutants including 17syn+, Strain F, and SC16. Very
avirulent strains such as KOS are an advantage in moderately or
highly susceptible mouse strains but this strain has a defective US9
gene (required for axonal transport) and truncated US8A [10]. It
should also be noted that virus strains obtained from different
sources can display different biological phenotypes. This variability
is sometimes due to misidentification and can be due in part to
genetic drift, founder effects that can occur when the isolates are
plaque purified, and/or diverse viral passage histories. More
recently, clinical isolates have been used to address basic questions.
The use of uncharacterized clinical isolates is reasonable to address
certain questions, for example survey studies comparing virulence
properties in animal models [11]. However, how these isolates can
be distributed to other investigators as well as points brought up in
the following paragraph must be considered. It should be noted
that sequence variability between most laboratory strains and the
hundreds of variant HSV genomes recently sequenced is not
greater than the variability between the early passage isolates them-
selves. Thus laboratory isolates represent the virus in the wild with
great fidelity, unlike the situation with other herpesviruses such
as CMV.
Once the appropriate viral strain(s) has been selected, it should
be plaque purified unless the researcher is absolutely certain that it
is a largely homogeneous isolate from very early passage post plaque
HSV Mutant Generation and Dual Latent/Lytic Marker Detection 221
P.P. P.P. P.P.
a b c d
Phenotype of original Phenotypes of early Insert eGFP Insert LATpLacZ
multipassaged stock passage plaque isolates
Isolates phenotypically 2-3 isolates 3 isolates

“wild-type” are selected phenotypically phenotypically
“wild-type” are “wild-type” are
selected selected for in vivo
expression studies
Fig. 1 Any phenotype displayed by a virus is actually the average measure of a spherical cloud of mutants in
the viral stock. (a) The point in the center of the cloud is the measure of a phenotype in this hypothetical viral
stock. Viruses that display variations from this idealized central point preexist in the stock (grey circle).
(b) Plaque purification (PP) represents a bottle neck that reduces the volume of the spherical cloud of each
plaque isolate, but the phenotypes of the viral isolates obtained may drift in any direction from that of the
original stock (smaller grey circles). (c) A plaque-purified isolate with the desired properties is employed to
generate insertional mutants expressing the enhanced green fluorescent protein (eGFP) which supplies color
selection. This round of plaque purification results in multiple independently derived isolates with similar
phenotypes, but undesired drift may be observed in some isolates (red lines). (d) Several green parental strains
with the desired phenotypes are employed to generate LAT promoter/LacZ reporter virus using reverse color
selection
purification. Over the years we have obtained laboratory isolates

from numerous investigators, and with rare exceptions, all have had
multiple quasi-species of virus in the stock. For example, the origi-
nal stock of strain 17syn+ we obtained from the MRC virology unit
in Glasgow contained variants with deletions in what is now known
to be the ICP34.5 gene and the packaging sequences at the termini
of the terminal and internal repeat sequences known as “A”
sequences. This is not unusual as any virus stock may correctly be
considered a cloud of related viral mutants and as the stock under-
goes successive passages, the cloud becomes more diverse (see
Fig. 1). Researchers often signify their specific plaque isolates by
altering the name of the virus. For instance the strain of KOS we
employ we plaque purified and named KOS(M), whereas other
subisolates of the same original KOS isolate are termed KOS1.1,
KOS2.1. It has been our experience that most viral mutants
obtained from others contain more than one major genotype, and
some stocks of viral mutants actually still contain the wild-type
parental strain. This latter finding is very significant because, as
discussed further below, the only way to screen for potential second
site mutations that might affect results is to rescue the mutant
genome back to wild type for analysis. If wild-type virus preexists
in the stock, this test is no longer valid.
We generate viral mutants by cotransfecting viral DNA with a

mutagenized DNA fragment, a method with distinct advantages
over the use of bacterial artificial chromosomes (BACs). An increas-
ingly popular method for generating HSV viral mutants is the use
of infectious BACs containing the entire infectious viral genome.
These BACs can be mutagenized using commercially available
RED/ET recombination procedures, but care should be taken
when using these procedures with HSV. We find this latter proce-
dure is not suitable for use when the resulting mutants are intended
for in vivo analysis. Of the 13 independent infectious BACs of strain
17syn+ we generated and tested, none behaved like their wild type
parent in vivo, all being significantly less neuroinvasive, although
variably so, and displaying reduced capacity to reactivate from
latency in vivo. Many (11/13) contained detectable genomic rear-
rangements such as the loss or mutation of the OriL region, and/or
permutations in the repetitive sequences in the terminal and inter-
nal repeat regions of the viral genome (unpublished findings).
Others have reported similar findings with infectious HSV-1
BACs resulting in altered and generally reduced pathogenic phe-
notypes [12]. While still others have reported success with the BAC
based mutagenesis approach for in vivo studies, at least when gain
of function phenotypes are examined [13]. Regardless of the
method employed to generate a viral mutant, it is of the utmost
importance that the mutant genome be restored to wild type to
ensure any phenotypic variation observed is the result of the engi-
neered mutation, and not some unknown second sight mutation.
Unfortunately, it has become common practice for mutagenized
BACs to be restored to wild type by repairing the mutagenized
BAC instead of the mutant virus. The mutant virus arises from a
single BACmid of greater than 150 kb which may or may not have a
sequence identical to the “average” sequence of the “cloud” in the
BACmid stock. Thus, the genomically rescued isolate is not actually
derived from the mutant virus, and so this control, which is of
paramount importance, is not actually performed. Conclusions
drawn from such studies should be viewed with a heightened
degree of skepticism.
Color selection is an advantage in selecting mutants, particu-
larly when subtle mutations are planned. We have generated a series
of GFP expressing parent strains that facilitate the generation of
viral mutants at diverse loci throughout the viral genome. Here we
describe methods to insert a GFP gene in the intergenic region
between glycoprotein J (gJ) and gD (see Fig. 2). This mutant is then
employed as a parental strain to generate promoter/reporter
mutants in which the latency associated transcript (LAT) promoter
is employed to drive the expression of the Escherichia coli LacZ
gene, which encodes a beta-galactosidase enzyme useful for analyz-
ing viral gene regulation during the transition from lytic to latent
infection, or vice versa.
Generation of promoter reporter mutants
TRL UL IRL/IRS US TRS
EcoRI 2999
HindIII 3520
NdeI 690 BamHI 1963 HindIII 4386
Step 1. Insertion of eGFP into the PacI+PmeI

intergenic region between gJ and gD. ampR gG gJ eGFP b-actin gD ampR
eGFP provides color selection for SV40A+
subsequent mutant selection.
HindIII 5772
PstI 5969
KpnI 6736
HindIII 7065
NarI 742 EcoRI 2484 KpnI 5569 HindIII 7931
Step 2. Replacement of the eGFP

cassette with a LAT promoter/LacZ ampR gG gJ LATp gD ampR
reporter cassette. SV40A+ LacZ
Fig. 2 Generation of promoter/reporter mutants. Schematic representation of the HSV-1 genome with the
unique long (UL), unique short (US) and terminal and internal repeats indicated (TRL, IRL, TRS, IRS). Step
1. The plasmid construct employed to insert GFP in the intergenic region between gJ and gD is shown as
linearized with ScaI, which cleaves in the ampicillin resistance gene of the plasmid backbone. Step 2. The
plasmid construct employed to insert the LAT promoter/LacZ reporter into the same region is shown
1.2 Dual Detection In vivo infection by HSV spans multiple tissues sites, and the times
of Promoter/Reporter post infection of greatest interest can be those when a small sub-
and Protein population of cells within a given tissue are infected, for example
sensory neuronal bodies in the ganglia innervating the surface site
of infection. An important companion approach to the promoter/
reporter mutant is a method to detect not only the promoter/
reporter activity but also specific viral and/or host cell proteins of
interest. The method provided was adapted from a method to
detect viral protein in whole ganglia [14, 15] to accommodate
the dual detection of the reporter histochemically and additional
protein immunohistochemically in whole tissue.
2 Materials
Prepare solutions using ultrapure water and analytical grade reagents.

Buffers and solutions are autoclaved and stored at room tempera-
ture, unless indicated otherwise. Follow all relevant institutional
personal protection procedures and waste disposal guidelines.
2.1 Generation 1. 10% SDS: Dissolve 10 g sodium dodecyl sulfate in 80 ml H2O

of HSV Mutants and mix. Bring volume to 100 ml with H2O. Do not autoclave.
The solution can be sterile filtered.
2. 1 M Tris, pH 8.0: Dissolve 272 g Tris in 800 ml H2O. Adjust

pH to 8.0 with HCl and bring volume to 1000 ml with H2O.
3. 0.5 M EDTA, pH 8.0: Dissolve 186.12 g of EDTA disodium
salt in 800 ml H2O. Adjust pH to 8.0 with HCl and bring
volume to 1000 ml.
4. TE, pH 8.0: Add 10 ml 1 M Tris–HCl, pH 8.0 to 988 ml of
H2O. Then add 2 ml 0.5 M EDTA pH 8.0 and mix.
5. Lysis buffer. To 49 ml TE pH 8.0 buffer, add 1 ml 10% SDS,
and 10 μg/ml DNase free RNase A, mix. Do not autoclave.
6. Storage buffer: To 50 ml glycerol, add 1 ml of 1 M Tris–HCl
pH 8.0, and 0.29 g CaCl2. Bring to 100 ml with H2O.
7. Proteinase K solution: Add 100 mg Proteinase K (PK) to 10 ml
of storage buffer. Store at 20 C.
8. 5 M NaCl: Dissolve 292.7 g NaCl in 700 ml H2O. Bring
volume to 1000 ml with H2O.
9. Phenol–chloroform–isoamyl alcohol (25:24:1).
10. Chloroform–isoamyl alcohol (24:1).
11. Cell culture medium: Dependent on tissue culture cells
employed. For rabbit skin cells (RSC) we use autopow MEM
(Fisher) supplemented with 5% calf serum, 1 glutamine, and
1 antibiotic + antimycotic. Trypsin solution.
12. T-175 tissue culture flasks, 6-, 12-, and 24-well tissue culture
plates.
13. Carboxymethylcellulose, 2%: Add slowly 20 g carboxymethyl-
cellulose (low viscosity, Sigma) to 1 l boiling H2O and stir on a
hotplate until fully dissolved. Sterilize the solution in an auto-
clave. Dilute 1:1 with 2 complete cell culture medium to a
final concentration of 1%.
14. Dialysis tubing (28.6 mm 12,000 mw cut off; Fisher). Hydrate
30 min in H2O prior to use.
15. Saline Sodium Citrate (SSC) buffer (20, Fisher).
16. Southern hybridization Kit (Fisher) with the following
required accessories: Horizontal gel electrophoresis apparatus;
DC power supply; water bath (65 C); visualization and photo
documentation system (white and UV light); staining tray and
net; NaCl, NaOH, concentrated HCl; 250 ml beakers or flasks;
10 ml glass graduated cylinder; 100 ml graduated cylinder;
distilled or deionized H2O; microwave, hot plate, or Bunsen
burner; small plastic box or tray; forceps; random priming kit
(Fisher), alpha p32 dCTP (PerkinElmer).
2.2 Histochemical 1. 10 phosphate buffered saline (PBS): To 800 ml H2O add
and Immunohisto- 80 g NaCl, 2 g KCl, 6.1 g Na2HPO4, and 2 g KH2PO4, mix,
chemical Staining and bring volume to 1 l with H2O; autoclave. The pH of 10
solution should be ~6.45. To prepare a 1 solution, add

100 ml of 10 PBS to 900 ml H2O. Mix, autoclave, and
store at room temperature. This will be pH ~7.2.
2. Methanol-free formaldehyde, 4%: Taking necessary precau-
tions, weigh out 20 g of paraformaldehyde, add powder to
~450 ml of 1 PBS, and stir on low heat (45 C) overnight
or until solution turns from milky white to clear. Bring volume
to 500 ml with 1 PBS, mix, and filter (Whatman 1). To make
a 0.5% solution, add 100 ml of the 4% solution to 700 ml 1
PBS. Store in refrigerator (see Notes 1 and 2).
3. X-gal buffer: 5 mM K-ferricyanide, 5 mM K-ferrocyanide,
2 mM MgCl2 in 1 PBS. To prepare a 100 (500 mM)
stock solution, add 4.9 g of K3Fe(CN6) or 6.3 g of K4Fe
(CN6).3H2O to 45 ml H2O, mix, add H2O to 50 ml, and
sterile filter. Store in dark. To make up 100 MgCl2 add 0.95 g
to 45 ml water, mix, add water to 50 ml and sterile filter. To
make 1 X-gal buffer, add 5 ml of each 100 solution to
450 ml of 1 sterile PBS, mix and add sterile PBS to 500 ml.
Protect from light.
4. X-gal: Dissolve 100 mg of X-gal (Gold Biotechnology) in 1 ml
of DMSO. Aliquot in 50 μl portions and store at 80 C.
5. Dent’s fixative: Mix 400 ml absolute methanol and 100 ml
DMSO. Store at room temperature protected from light.
6. Dent’s bleach: 600 μl Dent’s fixative + 300 μl 30% H2O2. Make
up just before use.
7. Antibody diluent for whole tissue (WTD): 1 sterile PBS
containing 2% bovine serum albumin (fraction V), 5% normal
horse serum (NHS), and 5% DMSO. Weigh out 1 g of BSA
into a sterile 50 ml tube. Add 35 ml of sterile PBS, cap, and mix
using Nutator or similar agitation. Add 2.5 ml of NHS and
2.5 ml of DMSO to the BSA/PBS solution and bring volume
to 50 ml with 1 sterile PBS. Mix, aliquot, and store at
20 C.
8. Glucose oxidase kit: To make up 1 ml of 1000 Na Azide (use
appropriate precautions), add 130 mg of Na Azide to 1 ml
sterile H2O2, mix and aliquot 100 μl/tube. To make up 100
glucose, add 1.8 g of β-D(+) glucose to 5 ml sterile water H2O2,
mix and aliquot 1 ml/tube. To make up 500 glucose oxidase,
add 50 mg of glucose oxidase to 1 ml sterile PBS, mix, and
aliquot 50 μl/tube. Store one tube of each reagent at 20 C.
Store the remaining aliquots at 80 C. Just before use, make
up the enzyme reagent by adding the appropriate volume of
each component to 1 sterile PBS to make a 1 solution.
9. Primary antibody: Rabbit anti-HSV (Accurate) detects a broad
range of HSV proteins and is thus a sensitive marker for
Fig. 3 Examples of (a) infiltrating immune cells detected in the whole ganglia, (b) post hoc analysis of
reactivating neuron revealing dense cellular cuff around neuron, and (c) whole ganglion X-gal staining
followed by HSV protein and cresyl violet staining post sectioning. (a) In this example, HSV expressing
beta-galactosidase from the VP16 promoter (blue neurons) are being surrounded by CD45RB expressing
immune cells. (b) In this example, the HSV protein positive neuron (undergoing viral reactivation) was
identified in whole ganglia, and the infiltrate visualized using cresyl violet after embedding and sectioning
of the whole ganglion. (c) In this example, beta-galactosidase expression (indicating virally infected neuron)
was identified in whole ganglion (black arrow). HSV protein was detected in sectioned ganglion (orange
arrows), and cresyl violet staining (red arrows) revealed neuronal nuclei and support cells
detecting the viral lytic cycle. Dilute 1:1000–1500 in WTD.

There are antibodies available that detect specific HSV proteins
and also antibodies that detect host cell proteins of interest.
Here we also include rabbit anti CD45RB (16A) (Santa Cruz
sc-18846) (diluted 1:500) to illustrate detection of infiltrating
immune cells in the whole ganglion format infected with HSV
in which β-gal is driven by the VP16 promoter (see Fig. 3).
10. Secondary antibody: Goat anti-rabbit HRP (Vector), diluted
1:500 in WTD.
11. Chromogenic substrate: Add 2.5 μg 3,30 -diaminobenzidine,
DAB (Aldrich) to 10 ml 100 mM Tris–HCl, pH 8.2. Mix,
then add 1.5 μl 30% H2O2 and use immediately.
12. Glycerol (Sigma), autoclave.
13. 50%, 70%, 95%, and 100% ethanol.
14. Xylene.
15. Xylene–100% ethanol (1:1).
3 Methods
3.1 Generation 1. Infect a 175 cm2 tissue culture flask with the virus isolate with a
and Preliminary multiplicity of infection (MOI) of 5 (we use a plaque purified
Characterization 17syn+ isolate).
of HSV Mutants 2. At 15–20 h post infection (p.i.), remove the medium from the
3.1.1 Preparation of Viral
flask, add 5 ml lysis buffer, and shake the flask to lyse the cells.
DNA for Transfection (See
The liquid will be quite thick due to proteins still associated
Note 3)
with the DNA (see Note 4).
3. Add 10 μl of proteinase K (PK) solution, and incubate the
DNA at 55 C for 2 h. Add another 10 μl aliquot of PK and
incubate for an additional 1 h.
4. Extract the DNA solution twice with phenol–chloroform–isoa-
myl alcohol. Do not vortex the solution to avoid shearing of
the DNA. The solution can be gently mixed on a rocking
platform or alternately taped to the top of a vortexer set at its
slowest setting and shaken gently for 5 min.
5. Extract the DNA once with chloroform–isoamyl alcohol.
6. Transfer the aqueous phase to dialysis tubing and dialyze
against 4 l of 0.2 SSC, changing the buffer three times over
a period of 12 h. The DNA can be stored in aliquots in a frost-
free 20 C freezer. Repeated freeze–thaw cycles should be
avoided.
3.1.2 Assessing 1. Plate cells into six-well plates to achieve ~70% confluency the
the Quality of the Viral DNA next day.
2. Test duplicate wells of 2, 5, 10, 15, and 30 μl of the viral DNA
per well according to the transfection reagent manufacturer’s
instructions (see Note 5).
3. After incubation for 4 h at 37 C in a CO2 incubator, the
transfection medium is removed and replaced with an overlay
containing 1% carboxymethylcellulose.
4. Plaques will develop over a period of 2–3 days. Stain and count
the plaques using standard protocols. About 0.1–0.2 μg of
transfection DNA (about 10 μl) should yield several hundred
plaques per well. Choose an amount of DNA that results in
several hundred plaques per well, but that is still well short of
the maximum. This allows for the addition of the mutagenesis
DNA in subsequent cotransfections.
3.1.3 Cotransfection 1. Plate cells into six-well plates to achieve ~70% confluency the
to Generate eGFP Parental next day.
Viral Strain 2. Set up six independent single well cotransfections with the
empirically determined optimized amount of viral DNA and
10, 20, 30, 40, 50, and 60 ng of mutagenesis DNA.
3. The mutagenesis plasmid should be linearized, but it is not

necessary to separate out the plasmid backbone. To provide for
adequate recombination frequency, the construct should be
designed so that there is about 500–1000 bp of flanking
sequence homologous to the each side of the site of insertion
or mutagenesis. In the example shown in Fig. 2, we engineered
a “parental” strain that expresses eGFP from the beta-actin
promoter inserted into the intergenic region between glyco-
protein J (gJ) and gD [16]. Proper polyadenylation of both the
eGFP and gJ genes was assured by the use of bidirectional
SV40 polyadenylation signals. We have employed this muta-
genized but still phenotypically wild type parent to generate
diverse insertion mutants including promoter/reporter viruses
as previously described [16–18]. Recently we modified the
eGFP gene by inserting restriction endonuclease sites for the
enzymes PacI and PmeI upstream of the eGFP ORF. These
enzymes recognize eight base pair sites that are A + T rich and
are not present in either the HSV-1 or HSV-2 genomes. This
permits cleavage of the viral genome selectively at the site of the
future planned mutagenesis experiment and greatly expedites
mutant selection.
4. Incubate the plates until the cytopathic effect (cpe) is complete.
5. Harvest the mini-stocks of virus and freeze-thaw three times.
6. Pellet the cell debris, and infect wells of a six-well plate with
serial tenfold dilutions.
7. After a 1 h adsorption period, remove the inoculum and overlay
the monolayers with culture medium containing 1%
carboxymethylcellulose.
8. Keep a record of which plaques came from each well of the
original transfection plate so that six independently derived
mutants obtained from separate transfections can be purified.
9. The day before the plaques are large enough to pick (usually
2–3 days p.i.) split cells into 24-well plates to receive the
plaques.
10. Use an inverted (cell culture) microscope equipped with
appropriate fluorescent optics to identify green plaques. Pick
the plaques directly under the microscope using a 10 μl pipet-
tor set to 3 μl, taking care to minimize contamination from
surrounding “clear” plaques.
11. Place each 3 μl aliquot into a separate well of a 24-well plate. It
is best to pick at least six “green” plaques from each original
stock to insure that at least one plaque isolate is largely
“green.”
12. Monitor the plates as cpe progresses, marking those wells that
have the highest percentage of green vs. clear plaques. When
the cpe is complete, select six independently derived isolates

from wells that have the highest percentage of green vs. clear
plaques and harvest the virus, freeze-thaw three times, and
store at 80 C.
3.1.4 Plaque Purification The following procedures are employed to purify and characterize
by Limiting Dilution the original parental virus if required (see Subheading 1 for a dis-
and Preliminary cussion of purity of the parental strain).
Characterization
1. Prepare a small stock of each of the six potential parental
of the “Green” Parental
“green” viruses by infecting wells of a six-well plate using
Virus Strain
standard procedures. It is possible to skip this step if sufficient
virus was obtained from the wells of the 24-well plates har-
vested in Subheading 3.1.3, step 12).
2. Pellet cellular debris to help ensure that subsequent infection
results from a single virion, and titer the stock on cell mono-
layers using standard techniques.
3. Prepare two 48-well plates of cells for each virus isolate to be
plaque purified. We seed rabbit skins cells at 1 105 cells per
well (see Note 6).
4. The next day dilute the virus stock to 1 pfu/ml in 40 ml of cell
culture medium in a sterile 50 ml tube. Make three additional
serial twofold dilutions by adding 20 ml of this dilution to
20 ml of medium and repeat this step twice.
5. Remove the culture media from the cell plates, and infect
24 wells of a 48-well plate with 0.5 ml of each of the four
dilutions. In theory this should be an inoculation titer of about
0.5, 0.25, 0.125, and 0.063 pfu/well, respectively.
6. Allow the infection to proceed until there is a significant
amount of cpe visible in the infected wells. Monitor the wells,
mark those that are infected, and estimate the percentage of
green vs. clear plaques until the cpe is well advanced. This
usually takes about 4 days. If needed additional culture
medium can be added to the wells taking care not to introduce
cross contamination.
7. Starting with the wells infected with the most diluted virus
stock, examine each well microscopically and mark those with
any virus induced cpe (green or clear).
8. To proceed, select wells infected with a high percentage of
“green” virus from dilutions in which fewer than six of the
twenty four wells contain evidence of cpe. This helps to ensure
that the wells were not initially infected with more than one
plaque. We usually pick at least four and preferably six wells to
store, and proceed with one isolate from each original
transfection well.
9. Allow the cpe to go to completion and harvest the wells into

separate sterile 1.5 ml tubes. Freeze and thaw the samples three
times.
10. Pellet the cell debris, and titer the samples on cell monolayers.
Monitor the plaques as they develop to determine the percent-
age of green vs. clear plaques.
11. Choose six independently derived isolates from those samples
that have the highest percentage of green plaques, and perform
a second round of limiting dilution purification by repeating
steps 2–10.
12. If the titration of the isolates from the second limiting dilution
appear pure (100% green plaques). Perform one additional
limiting dilution by repeating steps 2–10. However, if one or
more of the samples contain clear plaques, then more than one
additional limiting dilution will be required to purify that
isolate (see Note 7).
13. Once suitable “green” potential parental virus isolates are pur-
ified, proceed to examine their biological properties and geno-
mic structures as described below.
3.1.5 Characterization 1. Infect a single well of duplicate six-well plates with each pur-
of Purified “Green” Isolates ified “green” isolate. One plate is employed for the generation
to Identify “Parental” Virus of the virus stocks for characterization of replication, and the
other is used to isolate DNA for viral genome analysis as
described in Subheading 3.1.6.
2. When the cpe is complete, harvest each well (medium and cells)
of those to be employed as a source of virus.
3. Subject the stock to three cycles of freezing–thawing, and titer
each mini-stock.
4. Perform standard multistep and single-step replication analyses
on the isolates. Employ the original virus stock as a control (see
Note 8).
5. For single-step kinetics, plate out cells in 24-well plates (the
number is dependent on the number of samples to be tested).
6. Trypsinize the cells in one well, and count them with a hemo-
cytometer or cell counter.
7. Infect the remaining wells at an MOI of 5 pfu/cell in 200 μl of
complete cell culture medium.
8. After 1 h, remove the inoculum and feed the cells with 1 ml of
cell culture medium.
9. Harvest triplicate wells at 2, 4, 6, 8, 12, and 24 h p.i.
10. Titer virus in each harvested well separately, and plot the titer
plus or minus the standard error.
11. For multistep replication kinetics, infect cell monolayers in a

12-well plate with 500 pfu/well. It is important to titer the
inoculum at the time of plating to detect any errors in dilution
which may invalidate the assay.
12. Harvest triplicate wells at 24, 48, 72, and 96 h p.i. Obtain the
titer of each well independently, and plot the titer plus or minus
the standard error.
13. Compare the replication kinetics to that of the original stock,
and select several isolates as the potential parent strain. Both
the peak titers obtained and the slope of the replication kinetics
are important parameters (see Note 8).
3.1.6 Virus Genome 1. For isolating DNA from infected cell cultures, add 0.5 ml of
Analysis (See Note 9) lysis buffer to each well of the infected six-well plate and rapidly
lyse the cells by scraping with a cell scraper or the back of a
p-1000 pipette tip. Use a separate tip or scrapper for each well
to avoid cross contamination of samples.
2. Place each sample in a 1.5 ml tube and add 1 μl of proteinase K
(PK) solution. Incubate 1 h at 55 C.
3. Extract the samples twice with phenol–chloroform–isoamyl
alcohol and twice with chloroform–isoamyl alcohol.
4. Add 1/10 volume 5 M NaCl and 2 volumes 100% ethanol,
vortex and pellet DNA 10 min at 12,000 g.
5. Air dry the pellet briefly and dissolve DNA in 100–200 μl TE
buffer. Dissolving the DNA may be facilitated with incubation
at 55 C.
6. Southern blot analysis: Use the available genome sequence data
as a guide to select relevant restriction endonucleases to
employ. Enzymes which cut the genome frequently such as
BamHI are the most useful. We routinely employ five enzymes
for such an analysis.
7. Set up the digests, run the agarose gels, and photograph the
gels. To make it easier to line up positive bands with size
markers make copies of the gels by placing plastic wrap on
top of the gel on a UV transilluminator. Mark the gel wells
and as many of the bands as possible (especially the marker
lanes) with a permanent marker. Be sure to shield your eyes and
skin from the UV irradiation. In a standard 14 lane gel one can
load high and low molecular weight markers on each side and
ten lanes of test samples, so five enzyme digests can be tested. A
total of 20 blots will be required to test four wild-type or
mutant isolates with five different probes spanning the entire
genome.
8. Denature and neutralize the gels, and blot the DNA onto
membranes according to the kit instructions. Employ the
original virus to generate control DNA and load alternate lanes

(i.e., enzyme 1, test, control; enzyme 2, test, control). Make
one copy of the blot for each probe to be employed.
9. Using either a hybridization oven or shaking water bath set at
48 C, prehybridize the blots for about 1 h. If hybridization
buffers without formamide are employed higher temperatures
(~65 C) will be required. More than one blot (at least six) can
be placed in each hybridization bottle or bag if several isolates
are to be screened with the same probe.
10. During this time the probes should be labeled. We employ a
random priming kit and alpha P32 dCTP, but other methods
including nick translation and/or nonradioactive probes are
also suitable. It is not necessary in most cases to purify the
probe insert DNA from the plasmid backbone.
11. Add the labeled probes, hybridize for several hours to over-
night, wash and expose the blots to X-ray film or to a phosphor
screen according to the kit instructions.
12. Analyze the blot patterns by comparing test lanes to the control
lanes, size markers and predicted sizes. Some variation in the
sizes of bands containing repetitive elements in the terminal
and internal repeat regions of the genome will probably be
noted. Pay special attention to those fragment sizes predicted
to contain the OriL, OriS, and terminal and internal “a”
sequences, as these regions accumulate mutations more rapidly
than other regions of the viral genome. Mutations in these
regions often do not greatly affect replication in culture cells,
but do often cause defects in replication in vivo.
13. If viral mutants are to be generated for use in animal models,
potential parental strains should be analyzed in vivo. Three
isolates that have the correct genomic structure and replicate
like wild type in cells in culture should be analyzed for
their ability to replicate in vivo as detailed [4, 5, 15, 16,
19–22]. Isolates that (a) replicate efficiently at the body sur-
face; (b) enter and replicate efficiently in the peripheral nervous
system; (c) display the appropriate level of neurovirulence;
(d) establish latency equivalently to the parent in terms of the
number of neurons latently infected and the range and mean of
the number of viral genome individual latently infected neu-
rons contain; (e) and reactivate in similar numbers of neurons
in vivo following hyperthermic stress are suitable as parental
isolates. Detailed methods on these procedures are beyond the
scope of this chapter and are detailed in the literature cited
above. Unfortunately, many groups do not characterize their
parental, mutant, and genomically restored isolates adequately.
In addition, some models involve more expensive animals like

inbred strains of mice, rabbits, guinea pigs, and complete
characterization of even very basic properties such as viral
replication efficiency in the peripheral and central nervous
systems are not performed. Many conflicting reports in the
literature are almost certainly due to the failure to properly
characterize virus isolates in vivo.
3.1.7 Generation of LAT 1. Once parental isolates are selected, an elite stock of each should
Promoter/LacZ Reporter be prepared. Flasks of tissue culture cells are infected at a low
Mutants multiplicity of infection (MOI ¼ 0.01) and when CPE is com-
plete the virus stock is harvested, aliquoted, and stored at
80 C for future use (see Note 10).
2. Generate a working stock of the selected “green” parental
isolates.
3. Follow the steps in sections above to generate the promoter/
reporter mutants using a mutagenesis construct as shown sche-
matically in Fig. 2. In this case reverse color selection is
employed to isolate the potential reporter mutants.
4. If the eGFP gene employed was modified to contain PacI and
PmeI sites, precipitate 1 ml of the viral DNA, rehydrate the
DNA in 50 μl of TE pH 8.0 buffer, add 5 μl of the appropriate
10 restriction enzyme buffer, and 20 units each of PacI and
PmeI. Incubate for several hours at 37 C. Extract the solution
once with chloroform–isoamyl alcohol, dilute to 1 ml with
0.2% SSC and heat to 80 C for 15 min to evaporate the
residual chloroform–isoamyl alcohol. The DNA is now ready
to employ.
5. One caveat is that there is no selective pressure to maintain a
functional eGFP gene or protein. Therefore, clear plaques may
arise through mutation at the eGFP locus. If possible, design
PCR primers that span the junction between the promoter and
reporter gene and assay the plaque picks at an early stage to
help insure the clear plaque picks contain the transgene
construct.
The procedures described may appear daunting, but mutant
generation is greatly expedited by color selection. In practice it is
possible to generate, purify, and characterize potential viral mutants
in vitro in about 6 weeks to 2 months with these procedures. If the
parental strain contains the PacI and PmeI sites most of the plaques
generated will be recombinant and clear. Characterization of the
mutants in vivo requires an additional 8–10 weeks.
3.2 Dual Detection 1. Infect confluent monolayers of susceptible cells at low MOI,
of Promoter Reporter 0.001–0.01 pfu/cell, or at an alternate appropriate MOI (see
and Protein Note 6).
3.2.1 Validation
2. To fix the infected cells after appropriate incubation, carefully
of Promoter/Reporter rinse cell monolayer with PBS, and add 4% formaldehyde
in Cultured Cell Monolayers (methanol free). Incubate at room temperature for 8 min.
(See Note 11)
Remove formaldehyde (dispose of according to institutional
guidelines), and carefully rinse cells with PBS, twice for 3 min
(see Note 12).
3. Histochemical detection of β-gal: Add 5 μl of 100 mg/ml X-gal
solution to 1 ml of X-gal buffer (final concentration 0.5 mg/
ml). Make enough substrate to cover cell monolayers (approxi-
mately 150 μl per well for 24 well plate), and gently rock the
plate 37 C. Monitor the color reaction, and remove substrate
when blue color of medium intensity (still transparent). Rinse
and store in sterile PBS (see Notes 13 and 14).
4. Immunohistochemistry (IHC): Remove PBS and replace with
the primary antibody (rabbit anti-HSV diluted to the appropri-
ate concentration). If a plate rocker is used, 150 μl/well in a
24-well plate is an adequate volume. It is important to make
sure that cells are covered and that drying of the monolayer
does not occur. Incubate in the primary antibody for
30–60 min at room temperature. Remove antibody (avoid
drying of cells) and rinse in PBS 3 10 min. Add secondary
antibody (HRP-labeled goat ant-Rabbit), incubate 45 min.
Remove secondary antibody, rinse three times for 10 min
with PBS, and add chromogenic substrate (e.g., DAB kit,
Vector). Monitor color development carefully, and stop the
reaction by rinsing in H2O when the chromogen intensity is
compatible with visualizing the presence of the blue X-gal
precipitate (see Notes 15 and 16).
3.2.2 In Vivo Infected 1. Tissues: Infected eyes, trigeminal ganglia, or other tissue are
Tissues dissected and drop fixed in 0.5% formaldehyde for 2 h (timing
is critical) at room temperature with mixing (Nutator) (timing
is critical) (see Notes 17 and 18).
2. Tissues are rinsed once with PBS, PBS is removed and replaced
with 0.5 mg/ml X-gal in X-gal buffer and incubated at 37 C
for 3–12 h. X-gal is removed, and tissue is rinsed twice for
15 min in PBS. It can be helpful to photograph tissue at this
time (see Note 19).
3. PBS is removed and replaced with Dent’s fixative for 12 h at
room temperature with mixing (Nutator or similar).
4. Remove fixative and incubate in Dent’s bleach for 1 h at room
temperature.
5. Rinse tissue twice for 20 min in methanol to remove bleach.

Tissue is placed in fresh absolute methanol and stored at
80 C for a minimum of 24 h (can be stored indefinitely).
6. Remove tissue from 80 C and let warm briefly, remove
methanol, and rehydrate three times for 15 min in PBS.
7. Incubate tissue at 37 C for 2 h in 1 glucose oxidase solution
(see Note 20).
8. Rinse twice for 15 min in PBS.
9. Incubate primary antibody diluted in WTD at 37 C overnight
with mixing (primary antibody should be pretested for speci-
ficity and diluted to optimum working dilution).
10. Remove primary antibody solution and rinse three times for
2.5 h in PBS.
11. Incubate secondary antibody (HRP labeled goat anti-rabbit
IgG diluted 1:500 or appropriate other antibody) overnight
at room temperature with mixing.
12. Remove secondary antibody solution and rinse three times for
2.5 h in PBS.
13. Make up chromogenic substrate (e.g., DAB): Add 2.5 μg DAB
to 10 ml 100 mM Tris–HCl, pH 8.2, mix. Remove PBS from
tissue, add 1.5 μl 30% H2O2 to DAB solution, mix, and imme-
diately add to tissue.
14. Monitor carefully under dissecting microscope. Stop by remov-
ing DAB solution and rinsing twice for 30 min in distilled
H2O.
15. Rinse with glycerol and mount between glass slides. Visualize
under microscope and photograph.
3.2.3 Post-Hoc Following data analysis, additional information regarding the tissue
Embedding, Sectioning, can be obtained by paraffin embedding, sectioning, and examining
and Counterstaining tissue sections for morphological features including infiltrating
cells. The X-gal reaction product and the DAB IHC are both stable
during this process.
1. After data is collected and recorded from whole mounted
tissue, remove from slide and rinse twice in sterile PBS, incu-
bate in sterile PBS overnight (see Note 21).
2. Dehydrate tissue by removing PBS and adding 50% ethanol for
20 min, remove 50% ethanol and add 70% ethanol twice for
20 min, remove 70% ethanol and add 95% ethanol twice for
30 min, remove 95% ethanol and add 100% ethanol three times
for 30 min, remove 100% ethanol and add xylene–100% etha-
nol mixture for 20 min, remove xylene–100% ethanol and add
xylene twice for 20 min. Tissue should be translucent. Remove
residual xylene with cotton swab, add melted wax to tube, and
place in 60 C oven overnight.
(a) Embed ganglia or other tissue (this may require practice).
(b) Serial section at 5–8 μm.
(c) Screen to localize sections with promoter activity or viral
protein expression and lightly stain with cresyl violet.
DAB is compatible with cresyl violet, x-gal “blue” is easily
masked, so be cautious. Combined staining for HSV pro-
tein, X-gal and cresyl violet is shown in Fig. 3c.
(d) Select slides that contain regions of interest. Examine
region around the reactivating neuron, or other cells of
interest.
4 Notes
1. E. coli beta-galactosidase activity is inactivated by methanol.

Formaldehyde-containing methanol should not be used for
the initial fixation step.
2. The idea that formaldehyde made from paraformaldehyde is
unstable and needs to be made up at the time of use or stored
frozen is now commonly found on the internet. This is not our
experience, although we do avoid the use of high heat and
NaOH in preparation. In a published report measuring pH
and formic acid levels (as indicators of instability) over time,
it was concluded that formaldehyde prepared from paraformal-
dehyde remains stable for considerable periods of time [23].
3. Early protocols suggested isolated virion DNA, or gradient
purifying the viral DNA was required for efficient transfection,
but those steps are not actually necessary. A relatively crude
DNA prep is all that is required.
4. We have had only limited success with many different commer-
cial genomic DNA isolation kits for generating high quality
DNA for transfection.
5. We use the Lipofectamine Plus transfection protocol as sug-
gested by the manufacturer but other commercially available
transfection reagents should also work well.
6. Many different tissue culture cell types have been employed to
culture and titer HSV-1 including RSC, Vero, and Hela cells.
7. It is absolutely necessary to plaque purify virus stocks and/or
mutants by limiting dilution as described in Subheading 3. The
older recommended method of plating viruses under a soft agar
overlay and picking plaques off a plate is not sufficient to
generate pure stocks.
8. The resulting “green” viruses should be compared to the origi-

nal “parental strain.” Plaque purifying the initial “parental”
strain is important because it shrinks the volume of the cloud
of phenotypes present in the stock, which helps to ensure that
the resulting eGFP expression viruses have the desired pheno-
types. If the volume of the cloud was not reduced, one could
easily end up with something quite different in biological prop-
erties when compared to those of the original cloud as a whole,
as is shown schematically in Fig. 1.
9. The advent of relatively cheap deep sequencing makes it practi-
cal to obtain the DNA sequence of about 90% of the viral
genome. However, many important regions of the genome
contain repetitive elements and high G + C content DNA
which makes sequencing these regions problematic. As of this
writing, analysis of the genomes by DNA (Southern) blotting is
still the most practical approach. Sets of clones that include the
entire viral genome of several strains are available for use as
probes. We routinely employ a set of five cosmid clones that
cover the entire 17syn+ genome which we obtained from
Andrew Davison [24].
10. This elite stock should be only be used to generate working
stocks employed for experiments. In this way, the working
stock is always just one passage away from the elite stock.
11. Consideration should be given to develop a strategy to validate
the reporter in the context of established expression kinetics.
For example, lytic phase promoters should be expressed with
the expected kinetics, whereas latent phase promoters are
repressed during lytic infection of cultured cells.
12. To avoid dislodging cells, dispense PBS washes from a clean
wash bottle with a widened nozzle and squirt to the side of the
well and not directly onto the monolayer.
13. Staining that is too dark will mask presence of the second
chromogen.
14. In some cases, after performing the histochemistry in the
whole tissue, it may be desirable to perform the IHC on
sectioned material. This allows for multiple antibodies to be
used on serial sections and can be useful if examining host cell
factors which would be more broadly expressed in the tissue.
Because the X-gal reaction product is quite stable in alcohols, it
works well to dehydrate and paraffin embed the tissue without
loss of the reaction product. The time in xylene should be
limited, however, since prolonged incubation in this organic
can reduce the amount of the X-gal product in the tissue. Keep
in mind that the ideal intensity of blue (and thus the incubation
time in X-gal) is greater than for dual staining in the whole
tissue because the amount of product (and thus intensity of
blue) will be limited to the precipitate in the thickness of the

section, and not integrated over the entire cell thickness as is
the case for staining in the whole tissue.
15. The example we provide include the LAT promoter, which fails
to express during lytic infection. The appropriate dilution of
the primary antibodies is determined empirically. There are
numerous examples on line explaining how to do this. Confirm
specificity of antibodies by Western blot (infected and unin-
fected cell lysates) as well as in infected and uninfected cells.
16. Blocking steps (for endogenous peroxidase and nonspecific
protein binding) can be included before adding the primary
antibody if needed. We find these steps unnecessary in cultured
cells when effective primary antibodies are appropriately
diluted.
17. Mice are infected according to investigator’s protocol. There
are a number of inoculation strategies in use. The time points
selected for analysis will be dictated by the research questions
being addressed. This method is particularly well suited for
early times post infection or during reactivation when the
number of infected sites is limited. Always include positive
and negative controls. Negative controls should include rele-
vant tissue from mock infected animals. Positive control tissue
should include tissue harvested at times of peak viral
replication.
18. The extent of formaldehyde fixation is important for down-
stream IHC. Overfixation will result in failure of the antibodies
to penetrate the tissue. The timing is based on fixation at room
temperature.
19. The ideal time for the histochemical development is deter-
mined in a preliminary experiment. Select a time such that
the intensity of blue is consistent with visualizing combined
blue and brown staining in the cell. Extremely dark blue will
mask brown. It is our experience that the LAT promoter
requires an ON incubation whereas the VP16pLacZ or the
ICP0pLacZ reporters (during acute infection) require a much
shorter incubation time (~3 h).
20. Incubation in glucose oxidase is an additional endogenous
peroxidase blocking step. This step facilitates the removal of
additional background staining inherent in thick tissue
specimens.
21. While compression of the tissue results in effectively thicker
tissue sections, orientation is maintained simplifying identifica-
tion of the area of interest.
References
1. Whitley RJ (2001) Herpes simplex viruses. In: genome silencing and increases virulence of
Howley PM, Knipe DM (eds) Field’s virology. herpes simplex virus. Proc Natl Acad Sci U S
Lippincott Williams & Wilkins, Philadelphia, A 107(36):15904–15909
PA, pp 2461–2510 14. Sawtell NM (2003) Quantitative analysis of
2. Whitley RJ (2002) Herpes simplex virus infec- Herpes simplex virus reactivation in vivo
tion. Semin Pediatr Infect Dis 13(1):6–11 demonstrates that reactivation in the nervous
3. Wagner EK, Bloom DC (1997) Experimental system is not inhibited at early times postinoc-
investigation of herpes simplex virus latency. ulation. J Virol 77(7):4127–4138
Clin Microbiol Rev 10(3):419–443 15. Sawtell NM (2005) Detection and quantifica-
4. Sawtell NM (1998) The probability of in vivo tion of the rare latently infected cell under-
reactivation of herpes simplex virus type going herpes simplex virus transcriptional
1 increases with the number of latently infected activation in the nervous system in vivo. Meth-
neurons in the ganglia. J Virol 72 ods Mol Biol 292:57–72
(8):6888–6892 16. Thompson RL, Preston CM, Sawtell NM
5. Sawtell NM, Thompson RL (1992) Rapid (2009) De novo synthesis of VP16 coordinates
in vivo reactivation of herpes simplex virus in the exit from HSV latency in vivo. PLoS
latently infected murine ganglionic neurons Pathog 5(3):e1000352
after transient hyperthermia. J Virol 66 17. Thompson RL, Sawtell NM (2006) Evidence
(4):2150–2156 that the herpes simplex virus type 1 ICP0 pro-
6. Rock DL et al (1987) Detection of latency- tein does not initiate reactivation from latency
related viral RNAs in trigeminal ganglia of in vivo. J Virol 80(22):10919–10930
rabbits latently infected with herpes simplex 18. Thompson RL, Shieh MT, Sawtell NM (2003)
virus type 1. J Virol 61(12):3820–3826 Analysis of herpes simplex virus ICP0 promoter
7. Wechsler SL et al (1988) Fine mapping of the function in sensory neurons during acute infec-
latency-related gene of herpes simplex virus tion, establishment of latency, and reactivation
type 1: alternative splicing produces distinct in vivo. J Virol 77(22):12319–12330
latency-related RNAs containing open reading 19. Sawtell NM (1997) Comprehensive quantifica-
frames. J Virol 62(11):4051–4058 tion of herpes simplex virus latency at the
8. Shimeld C et al (1989) An improved model of single-cell level. J Virol 71(7):5423–5431
recurrent herpetic eye disease in mice. Curr Eye 20. Thompson RL, Sawtell NM (2000) Replica-
Res 8(11):1193–1205 tion of herpes simplex virus type 1 within tri-
9. LeBlanc RA et al (1999) Treatment of HSV-1 geminal ganglia is required for high frequency
infection with immunoglobulin or acyclovir: but not high viral genome copy number
comparison of their effects on viral spread, latency. J Virol 74(2):965–974
latency, and reactivation. Virology 262 21. Thompson RL, Sawtell NM (2011) The herpes
(1):230–236 simplex virus type 1 latency associated tran-
10. Negatsch A, Mettenleiter TC, Fuchs W (2011) script locus is required for the maintenance of
Herpes simplex virus type 1 strain KOS carries a reactivation competent latent infections. J
defective US9 and a mutated US8A gene. J Neurovirol 17(6):552–558
Gen Virol 92(Pt 1):167–172 22. Catez F et al (2012) HSV-1 genome subnu-
11. Pandey U et al (2017) Inferred father-to-son clear positioning and associations with host-cell
transmission of herpes simplex virus results in PML-NBs and centromeres regulate LAT locus
near-perfect preservation of viral genome iden- transcription during latency in neurons. PLoS
tity and in vivo phenotypes. Sci Rep 7 Pathog 8(8):e1002852
(1):13666 23. Helander KG (2000) Formaldehyde prepared
12. Gierasch WW et al (2006) Construction and from paraformaldehyde is stable. Biotech His-
characterization of bacterial artificial chromo- tochem 75(1):19–22
somes containing HSV-1 strains 17 and KOS. J 24. Cunningham C, Davison AJ (1993) A cosmid-
Virol Methods 135(2):197–206 based system for constructing mutants of her-
13. Du T et al (2010) Disruption of HDAC/CoR- pes simplex virus type 1. Virology 197
EST/REST repressor by dnREST reduces (1):116–124
Chapter 13
Phenotypic and Genotypic Testing of HSV-1 and HSV-2

Resistance to Antivirals
Andreas Sauerbrei and Kathrin Bohn-Wippert
Abstract
Resistance testing of antivirals to herpes simplex virus type 1 (HSV-1) and type 2 (HSV-2) can be done by
phenotypic and genotypic methods. The determination of a resistant phenotype is based on the calculation of
inhibitory concentrations for the antiviral drug, which should be tested. The main advantage of this resistance
test is a clear interpretation of laboratory findings, but the method is time-consuming and a considerable
experience is required by handling infectious virus. Genotypic resistance testing is based on the detection of
resistance-related mutations in viral genes encoding the thymidine kinase and DNA polymerase, which need to
be amplified and sequenced. This approach has the advantage of being faster, but only frameshift mutations,
stops of translation, and amino acid substitutions described in the literature can be interpreted without doubt.
By contrast, numerous novel amino acid substitutions are diagnostically less conclusive.
Key words Herpes simplex virus, Phenotypic resistance, Genotypic resistance, Thymidine kinase,
DNA polymerase
1 Introduction
Phenotypic methods are considered as the gold standard for the

determination of herpes simplex virus type 1 (HSV-1) and type
2 (HSV-2) resistance to acyclovir (ACV), penciclovir (PCV), and
foscarnet (FOS) [1]. The analysis of HSV-1 and HSV-2 resistance
phenotype is mostly performed using the plaque reduction assay as
reference technique [2] or the dye uptake method [3]. These tests
allow a clear interpretation of laboratory findings on basis of inhibi-
tory concentrations, which are determined for the antiviral drugs
tested. However, they are time-consuming and take about
7–10 days because of the necessity to isolate viral strains in cell
culture, and thus the adaptation of the antiviral treatment according
to the in vitro susceptibility may be delayed. Even though 50%
inhibitory concentrations of 2 μg/mL are often used as breakpoint
[4], a general problem is that cut-off levels for antiviral drugs, in
241
242 Andreas Sauerbrei and Kathrin Bohn-Wippert
particular for acyclovir (ACV), still need international

standardization.
Consequently, genotypic tests have been developed to detect
resistant viruses on basis of resistance-associated mutations in viral
genes encoding the two targets of antiviral drugs, namely, the
thymidine kinase (TK, UL23) and the DNA polymerase (pol,
UL30), within a short time. However, it has to be considered that
both genes of HSV-1 and HSV-2 have an uncommonly high natu-
ral polymorphism [5, 6]. A study with 56 HSV-1 and 12 HSV-2
strains sensitive to ACV revealed on average 5 (HSV-1) or 2.8
(HSV-2) nonsynonymous mutations in the TK gene and 5.7
(HSV-1) or 4.7 (HSV-2) amino acid substitutions in the DNA
pol gene [7]. Most of polymorphism-associated mutations
(96%) are located outside active gene centers, but only few of
them involve conserved gene regions [8]. Concerning mutations
related to resistance, previous studies revealed that 95% of clinical
isolates exhibiting ACV resistance carry amino acid changes in the
TK gene and in only 5% resistance is mediated by substitutions in
the DNA pol gene [2, 9, 10]. According to a recent study, ACV
resistance of HSV-1/2 is caused in about 50–60% by single amino
acid substitutions and the remaining part is due to stop codons,
amino acid frameshifts and amino acid additions or deletions in the
TK [8]. Nearly two thirds of these resistance mutations are located
outside of active or conserved gene regions causing alterations, loss
of enzyme activity or changes of substrate specificity. In the DNA
pol, resistance to ACV and foscarnet is mostly associated with single
amino acid substitutions, which are usually situated in conserved
gene regions and in rare cases caused by amino acid frameshifts or
stop codons [8]. To date, frameshift mutations and only amino acid
substitutions, that are known to be associated with resistance, can
be interpreted without doubt. Nevertheless, several substitutions
are diagnostically less conclusive due to presence of additional
uncharacterized amino acid changes. Moreover, the analysis of
genotypic resistance may be difficult when a mixture of viral strains
with different genotypes is present. For better interpretation of
genotypic findings, a database on natural polymorphisms and
resistance-related nonsynonymous mutations in TK and DNA pol
genes of HSV-1 and HSV-2 has been published recently [8].
Here, we describe a routine diagnostic method for characteri-
zation of HSV-1 and HSV-2 resistance phenotype using the tetra-
zolium reduction assay, which is a modified dye uptake method.
Furthermore, methods about genotypic resistance characterization
using TK and DNA pol gene amplification and sequencing are also
presented. Due to the reported limitations, both methods should
be performed in virological laboratories for testing HSV-1/2 resis-
tance to antivirals. Experienced researchers will take 10–14 days to
propagate the virus and to perform the phenotypic resistance assay,
Phenotypic and Genotypic Testing of HSV-1 and HSV-2 Resistance to Antivirals 243
a further 2–3 days to isolate the viral DNA and to amplify and
sequence the TK and DNA pol genes. A few hours are necessary to
analyze the sequenced genes.
2 Materials
2.1 Cell Culture 1. Cell cultures: human embryonic lung fibroblasts (HELF) Wi38
Passage and Viral cell line (European Collection of Authenticated Cell Cultures,
Growth Public Health England, Salisbury, UK).
2. Cell culture medium: Eagle’s minimum essential medium
(EMEM), 1 nonessential amino acids, 2 mM L-glutamine,
25 mM HEPES, 1 mg ciprofloxacin hydrochloride, 10% fetal
calf serum (FCS).
3. Phosphate buffered saline (PBS): 40.0 g NaCl, 1.0 g KCl, 5.7 g
Na2HPO4, 1.0 g KH2PO4, make up to 5 L with distilled water,
adjust pH to 7.4, sterilize, store at 4 C.
4. Trypsin.
5. CO2 incubator.
6. T25 cell culture flasks.
7. Cell culture tubes with 10 cm2 incubation surface.
8. 5 and 15 mL tubes.
10. 96-well flat-bottomed microtiter plates.
2.2 Phenotypic 1. Antivirals: acyclovir (ACV) (GlaxoSmithKline, Uxbridge, UK),

Resistance Testing brivudin (BVDU) (Berlin-Chemie AG, Berlin, Germany), pen-
(See Note 1) ciclovir (PCV) (GlaxoSmithKline, Uxbridge, UK), trisodium
phosphonoformate (Foscarnet, FOS) (Cayman Chemicals,
Hamburg, Germany), and cidofovir (CDV) (Vistide®, Cayman
Chemicals, Hamburg, Germany).
2. Wi38 cells and cell culture medium (see Subheading 2.1, items
1 and 2).
3. Cell culture medium: see Subheading 2.1, item 2.
4. EMEM.
5. PBS: see Subheading 2.1, item 3.
6. 96-well flat-bottomed microtiter plate.
8. Hemocytometer.
9. 5 mL tubes for dilution of antivirals and virus isolates.
10. CO2 incubator.
11. Tetrazolium salt WST-1 (WST-1 solution).
12. Repetitive dispensing pipette.

13. Software SigmaStat, Version 1.01 (Jandel Corporation, San
Rafael, CA, USA).
14. Orbital plate shaker.
15. Microplate reader SpectraFlour (Tecan).
2.3 Genotypic 1. QIAmp® DNA Blood Mini Kit (Qiagen).

Resistance Testing 2. Proteinase K.
2.3.1 Isolation 3. Heating block (56 C).
of Viral DNA 4. 1.5 and 2 mL tubes.
5. 96–100% ethanol.
6. Microcentrifuge.
2.3.2 Amplification 1. HotStar HiFidelity Polymerase Kit (Qiagen), alternative: Hot-

of Viral Genes StarTaq® DNA polymerase Kit (Qiagen).
2. 0.5 mL PCR tubes.
3. 50 μL (50–250 ng/μL) DNA from viral isolate or patient
sample.
4. Thermocycler.
5. High Fidelity PCR Enzyme Mix (Fermentas).
2.3.3 Agarose Gel 1. Agarose.

Electrophoresis 2. 1 Tris-borate-ethylenediaminetetraacetic acid (EDTA)
(TBE) buffer prepared from 5 TBE buffer: 54 g Tris,
27.5 g boric acid, 4.65 g EDTA, make up to 1 L with distilled
water, adjust pH to 8.1.
3. Microwave oven.
4. Ethidium bromide stock solution: 1 mg ethidium bromide per
1 mL distilled water, store at 4 C.
5. Gel casting tray and combs.
6. 0.5 M EDTA buffer, adjust pH to 8.0.
7. 1 M Tris–HCl (pH 8.0): Dissolve 272 g Tris in 800 mL dis-
tilled water. Adjust pH to 8.0 with HCl, and bring volume
to 1,000 mL with distilled water.
8. Tris–EDTA (TE) buffer: 10 mL 1 M Tris–HCl (pH 8.0), 2 mL
0.5 M EDTA, make up to 1 L with distilled water.
9. Electrophoresis chamber (Hoefer® HE 33, Hoefer Inc., Hol-
liston, Massachusetts, USA).
10. Loading buffer: 40% (v/v) glycerol, 0.1% (v/v) EDTA, 0.1%
(w/v) sodium dodecyl sulfate (SDS), 0.2% (w/v) bromophe-
nol blue in distilled water, store at 4 C.
11. 1.5 mL tubes without lid.

12. DNA molecular weight marker HyperLadder I (Bioline
GmbH, Luckenwalde, Germany).
13. Power supply.
14. Nitrile gloves.
15. UV transilluminator BioDoc Analyze (Biometra Analytik
GmbH, Göttingen, Germany).
2.3.4 Purification of DNA 1. QIAquick PCR Purification Kit (Qiagen).

Fragments 2. 1.5 and 2 mL tubes.
3. Microcentrifuge.
4. Scalpel.
5. UV transilluminator BioDoc Analyze (Biometra Analytik
GmbH, Göttingen, Germany).
6. Heating block (50 C).
7. QIAquick Gel Extraction Kit (Qiagen).
8. 100% isopropanol.
2.3.5 Quantification 1. UV spectrophotometer NanoDrop ND-1000 (Peqlab Bio-

of Amplified Viral DNA technologie GmbH, Erlangen, Germany).
2. Sterile cellulose.
2.3.6 Sequencing of DNA 1. GenomeLabTM DTCS-Quick Start Kit (Beckman Coulter

Fragments Inc., Fullerton, CA, USA).
2. Thin-walled 0.5 mL tubes.
3. Dimethyl sulfoxide (DMSO).
4. Thermocycler.
5. 3.5 M sodium acetate (pH 5.2).
6. 100 mM EDTA.
7. Glycogen.
8. Ethanol (80%, 100%, v/v).
9. Microcentrifuge.
10. Vacuum dryer.
11. Sodium loading solution (Beckman Coulter).
12. DNA sequencer CEQTM 8000 Genetic Analysis System
(Beckman Coulter GmbH, Krefeld, Germany).
13. Sequence data from HSV-1 strain 17 (GenBank Accession
no. X14112) [11] and HSV-2 strain HG52 (GenBank Acces-
sion no. Z86099) [12].
14. Sequencing analysis software Mega 5 (Center for Evolutionary

Medicine and Informatics, The Biodesign Institute, Tempe,
AZ, USA).
3 Methods
Cell culture and virus procedures should be carried out at room

temperature using a biological safety cabinet. Cell culture medium
and components have to be lukewarm. The propagated virus
should be kept on ice.
3.1 Passage of Wi38 1. Remove medium from T25 flask containing a cell monolayer.
Cells (See Note 2) 2. Rinse the cell monolayer with 5 mL PBS, and aspirate fluid.
3. Add 2 mL trypsin and swirl gently to ensure that all cells are
covered with solution.
4. Incubate for 5–15 min at 37 C.
5. Tap side of flask to dislodge cells.
6. Mix cell culture medium and add it to cells.
7. Check cell suspension with an inverted light microscope to
ensure that cells are in a single-cell status. If not, resuspend
cell suspension carefully.
8. Passage cell suspension at a ratio of 1:2. Each T25 flask should
contain a final volume of 5 mL.
9. The content of one T25 flask can be used for the preparation of
four small cell culture tubes with 10 cm2 incubation surface.
10. Incubate cells at 1% CO2 and 37 C until cell monolayer is
confluent (2 days).
3.2 Virus 1. Aspirate medium from the tube containing 10-cm2 cell mono-
Propagation layer and add the same volume of EMEM without FCS.
(See Note 3) 2. For viral culture from a patient sample, flask with cell mono-
layer and 2 mL EMEM is inoculated with approximately
0.2 mL of viral transport medium containing patient sample.
3. Using viral stocks, the inoculum should contain a concentra-
tion of 106–108 cell culture infective dose 50% (TCID50)
per mL.
4. Incubate cell culture at 1% CO2 and 37 C and check daily
using an inverted light microscope.
5. When 75–100% of cells show cytopathic changes (cytopathic
effect, cpE: 3–4), freeze and thaw flasks, and suspend cells by
shaking slowly.
6. Transfer flask contents to a 15 mL tube and centrifuge for

10 min at 900 g.
7. Store supernatants in cryotubes at 80 C.
3.3 Determination 1. Prepare 96-well microtiter plate by seeding 105 Wi38 cells in
of Virus Titer 0.2 mL EMEM containing 10% FCS in each well and incubate
them at 1% CO2 and 37 C for 24 h.
2. Aspirate medium and add 100 μL EMEM without FCS in
each well.
3. Prepare serial tenfold dilution up to 1010 of viral stocks in
EMEM without FCS; keep on ice.
4. Mark rows of the plate for virus dilutions to be plated, and
mark eight negative wells, which will not be infected.
5. Start with highest virus dilution, add 0.1 mL of virus dilution
to each well of the appropriate dilution row.
6. Add 0.1 mL of EMEM to the control well.
7. Incubate the plate at 37 C and 1% CO2, and monitor cpE daily
using an inverted light microscope for a period of 1 week.
8. Record number of positive and negative wells. Calculate
TCID50 per mL according to the method described by Spear-
man [13] and K€arber [14].
3.4 Phenotypic 1–7. See Subheading 3.1, steps 1–7.

Characterization 8. Determine the number of viable cells using a hemocytometer
of Resistance and prepare a 96-well plate by seeding all internal wells from
3.4.1 Preparation of Cell
B2-B11 to G2-G11 with 105 Wi38 cells in 0.2 mL EMEM
Culture and Virus Infection containing 10% FCS (see Subheading 2.1). Add 200 μL PBS to
Resistance all peripheral wells.
9. Incubate cells for 24–48 h at 37 C and 1% CO2.
10. Check cells daily for their confluence using an inverted light
microscope.
11. After aspiration of cell growth medium and PBS, add 100 μL of
EMEM without FCS in internal horizontal wells from B3-B10
to G3-G10 (wells for dilution rows of antivirals), 150 μL in
vertical wells from B11 to G11 (virus control), and 200 μL in
vertical wells from B2 to G2 (cell control). All peripheral wells
are filled with 200 μL of EMEM (Fig. 1).
12. Prepare fourfold concentrated half-log dilutions of antivirals in
EMEM without FCS in 5 mL tubes. Final dilutions for ACV,
BVDU, PCV and CDV should range between 0.06 and
8.0 μg/mL and for FOS between 8.0 and 128.0 μg/mL.
13. Add 50 μL of virus at a concentration of 103 TCID50 per mL
(corresponding to a multiplicity of infection of 0.01) to hori-
zontal wells from B3-B11 to G3-G11 and 50 μL of diluted
100 µl medium + 50 µL antiviral drug + 50 µL virus dilution
Dilution of antiviral drug

(e.g. acyclovir) in µg/mL: 8 4 2 1 0.5 0.25 0 .12 0 .06
1 2 3 4 5 6 7 8 9 10 11 12
B
200 µL medium
(cell control)
C
200 µL medium 150 µL medium + 50 µL virus dilution (virus control)
Fig. 1 Pipetting scheme of a 96-well microtiter plate for phenotypic resistance testing of HSV-1 or HSV-2; light
grey wells: cell control; black wells: virus control; white wells: dilution of antiviral drug
antiviral compounds to horizontal wells from B3-B10 to

G3-G10.
14. Incubate plates at 37 C and 1% CO2 for 5 days.
3.4.2 Determination 1. Monitor cpE using an inverted light microscope.

of Inhibitory Concentrations 2. Add 10 μL of WST-1 solution to each internal well using a
repetitive dispensing pipette. One external cavity serves as
“blank” and should also be filled with 10 μL WST-1 solution.
3. Mix plate gently for 1 min on an orbital plate shaker and
incubate at 37 C and 1% CO2 for 2–4 h.
4. Measure absorbance values using a microplate reader at a wave-
length of 450 nm and a reference wavelength of 620 nm.
5. Calculate percentages of antiviral activities of drugs from
measured optical density values according to Pauwels
et al. [15].
6. Compute substance concentrations at half-maximum virus
inhibition (IC50) from dose-response curves by linear regres-
sion analysis using Software SigmaStat, Version 1.01.
7. Calculate drug resistance as follows: A viral strain is regarded as

resistant against ACV, BVDU, PCV, and CDV if mean IC50 is
calculated as five times the mean value of HSV-1 or HSV-2
control strain [16]. Concerning FOS, HSV-1 and HSV-2
strains with IC50 100 μg/mL (330 μM) are defined as
resistant [17].
3.5 Genotypic Viral DNA is isolated from patient sample or a viral isolate using
Characterization QIAmp® DNA Blood Kit (Qiagen, Hilden, Germany) according to
of Resistance modified “Blood and Body Fluid Spin Protocol.”
3.5.1 Isolation of Viral 1. Pipette 20 μL protease or proteinase K on the bottom of a
DNA (See Note 4) 1.5 mL microcentrifuge tube and add 200 μL of the sample as
well as 200 μL buffer AL.
2. Vortex the tube for 15 s, and incubate the sample for 10 min at
56 C using a heat block.
3. Spin the tube briefly to remove drops from inside of lid and add
200 μL of 96–100% ethanol to each sample to stop lytic reac-
tion. Vortex again for 15 s.
4. Carefully apply the mixture to a QIAamp spin column and spin
at 6000 g for 1 min. Place the QIAamp spin column in a
clean 2 mL tube and discard the filtrate. Add 500 μL of buffer
AW1 and spin again at 6000 g for 1 min. Place the QIAamp
spin column in a clean 2 mL tube and discard the filtrate.
5. Add 500 μL of buffer AW2 and spin at 6000 g for 1 min.
6. Place the QIAamp spin column in a new 2 mL tube and discard
the filtrate. Spin at full speed for 1 min.
7. Place the QIAamp spin column in a clean 1.5 mL tube, discard
filtrate, and add 50 μL of buffer AE. Incubate samples at room
temperature for 5 min and then spin at 6000 g for 1 min.
8. Store samples at 20 C until use.
3.5.2 Amplification 1. Pipette following components (HotStar HiFidelity Polymerase

of Viral Thymidine Kinase Kit, Qiagen, Hilden, Germany) in a 0.5 mL PCR tube and
Gene (UL23) (See Note 5) adjust to a final volume of 50 μL using aqua bidest:
l 5 HotStar HiFidelity PCR buffer with 1.5 mM dNTP and
7.5 mM MgSO4.
l 10 μM forward primer and reverse primer each (Figs. 2
and 3, Tables 1 and 2).
l 2.5 U HotStar HiFidelity DNA polymerase.
l DNA template (50–250 ng/μL).
2. Using a thermocycler amplify DNA fragments by following
PCR steps:
l Initial denaturation for 5 min at 95 C.
30 cycles with:
Fig. 2 Location of primers for amplification and sequencing of HSV-1 thymidine kinase gene
Fig. 3 Location of primers for amplification and sequencing of HSV-2 thymidine kinase gene
l Denaturation for 15 s at 94 C.
l Annealing for 1 min at 55 C.
l Elongation for 1 min at 72 C.
Final:
l Elongation at 72 C for 10 min.
3.5.3 Amplification 1. Pipette following components of the High Fidelity PCR

of HSV DNA Polymerase Enzyme Mix in a 0.5 mL PCR tube and adjust to a final volume
Gene (UL30) (See Note 6) of 50 μL using aqua bidest.:
l 10 High Fidelity PCR buffer with 15 mM MgCl2.
Fig. 4 Location of primers for amplification of HSV-1 DNA polymerase gene
Fig. 5 Location of primers for amplification of HSV-2 DNA polymerase gene
l 2 mM dNTPs.
l 10 μM forward primer and reverse primer each (Figs. 4
and 5, Tables 1 and 2).
l 5 U High Fidelity PCR Enzyme Mix (Taq).
l DNA template (50–250 ng/μL).
Table 1
Primers for amplification (black) and sequencing (red) of thymidine kinase (TK) and DNA polymerase
(pol) genes of HSV-1
HSV-1 DNA fragment Name Sequence 5’>3` Nucleotides

(size in bp) of HSV-1
genome
TTTTATTCTGTCCTTTTATTGC 46607-
TK-1
HSV-1 TK Fragment 1 (398 CGTCA 46634
bp) CGTGCCGCCCCAGGGTGCC 47005-
TK-R5
GAGC 46983
CACGTTATACAGGTCGCCGT 46882-
TK-4
HSV-1 TK Fragment 2 (426 TGG 46904
bp) CATCGCCGCCCTCCTGTGCT 47308-
TK-R2
ACCC 47285
ACGATGTTTGTGCCGGGCAA 47192-
TK-2
HSV-1 TK Fragment 3 (368 GGTC 47215
bp) ACCCGAGCCGATGACTTACT 47560-
TK-R4
GGCG 47537
GCATGCCCATTGTTATCTGG 47412-
TK-5
HSV-1 TK Fragment 4 (495 GC 47433
bp) CGAGCGACCCTGCAGCGACC 47907-
TK-R1
CGCT 47884
ATCCGCCAGACAAACAAGGC 62655-
Pol-1
CCTT 62678
HSV-1 DNA pol Fragment 1 TGCACGACGGTCACCTCAAG 63087-
Pol-4-1
(1040 bp) CGC 63109
CCCCACCCTCGTACTTCTTGA 63695-
Pol-R4
TGG 63672
GTCCGAAGCGGGCGTGTGCT 63623-
Pol-2
GTCG 63646
HSV-1 DNA pol Fragment 2 TCATGACCCTTGTGAAACAGT 64155-
Pol-5-1
(1032 bp) CACC 64178
Pol- CCGTTCATGCGGCCGTACCC 64290-
Br1 GTC 64268
GGCCGTCGTAGATGGTGCGG 64655-
Pol-R2
GTG 64633
CCATCTGGAGCTCTCGGCCG 64588-
Pol-3
TCGC 64611
HSV-1 DNA pol Fragment 3 TTCGACTTTGCCAGCCTGTAC 64952-
Pol-6-1
(1156 bp) CC 64974
CGTAAAACAGCAGGTCGACC 65744-
Pol-R3
AGGG 65721
GTAAGATGCTCATCAAGGGC 65649-
Pol-4a
GTGGATC 65675
Pol- GATGCGCCGATGGGCGTCTA 65869-
HSV-1 DNA pol Fragment 4 Cr1 CGAG 65846
(1045 bp) Pol-7- GGAGAAGTAATAGTCCGTGT 66295-
1R TCA 66263
Pol- GGCTCATAGACCGGATGCTC 66694-
R1a AC 66673
Table 2
Primers for amplification (black) and sequencing (red) of thymidine kinase (TK) and DNA polymerase
(pol) genes of HSV-2
HSV-2 DNA fragment Name Sequence 5’>3` Nucleotides

(size in bp) of HSV-2
genome
TTTTATTCTGTCCTTTTATTGC 46805-
TK-1
HSV-2 TK Fragment 1 (428 CGTCA 46831
bp) GCGGGAGGACTGGGGCCGG 47233-
TK-R7
CTGAC 46210
AACAGCGTGTCCTCGATGCG 47122-
TK-6
HSV-2 TK Fragment 2 (381 GG 47153
bp) TATCGCCTCCCTGCTGTGCT 47503-
TK-R3
ACCC 47480
ACCAGGTTCGTGCCGGGCGC 47387-
TK-3
HSV-2 TK Fragment 3 (360 GGTC 47410
bp) CGATGACTTACTGGCAGGTG 47747-
TK-R6
CTGG 47724
CTGGTCATTACCACCGCCGC 47630-
TK-7
HSV-2 TK Fragment 4 (475 CTC 47652
bp) CGAGCGGACCCTGCAGCGA 48105-
TK-R1
CCCGCT 48082
CCCGGGCGCGGGTCCGCCG 63124-
Pol-1
GTCCG 63147
HSV-2 DNA pol Fragment 1 TGTACGACATCCTGGAGCAC 63713-
Pol-5-2
(571 bp) GTG 63735
Pol-8- GTCAGACCCAGAAGCGTGAT 63695-
2R GAC 63672
GTGCGAAGCGGGCGCGCGC 63623-
Pol-2
TGGCC 63646
HSV-2 DNA pol Fragment 2 TGACCTTCGTCAAGCAGTAC 64619-
Pol-6-2
(1502 bp) GGC 64641
Pol- GTTCATGCGCCCGTACCCGT 64749-
Br2 CG 64728
GGATCTGCTGGCCGTCGTAT 65125-
Pol-R2
ATGG 65102
GGATCTGAGCTACCGCGACA 65588-
Pol-11
TC 65610
GCGAGAGCCTGCTGAGCATC 64952-
Pol-7-2
HSV-2 DNA pol Fragment 3 CTG 64974
(752 bp) Pol- GCAGGGCAGAAGACCGTGCT 65769-
Cr2 GCAC 65746
Pol- TGCGCCGATGGGCGTCTACG 66340-
10R AG 66319
TCATCAAGGGCGTGGATCTG 66131-
Pol-4
HSV-2 DNA pol Fragment 4 GTGCG 66155
(1036 bp) GGCTCATCGATCGGATGCTG 67167-
Pol-R1
AC 67146
2. Amplify DNA fragments by following PCR steps:

44 cycles with:
l Annealing for 50 s at 55 C.
l Elongation for 90 s at 72 C.
Final:
3.5.4 Agarose Gel 1. Add 0.5 g of agarose powder to a 100 mL flask.

Electrophoresis (See 2. Add 50 mL of 1 TBE buffer and swirl the flask gently. Total
Note 7) gel volume will vary depending on size of the casting tray.
3. Melt agarose in a microwave oven until the solution becomes
clear.
4. Let the solution cool down to approximately 40–50 C by
swirling the flask occasionally.
5. Add 7 μL of ethidium bromide stock solution to the lukewarm
liquid agarose gel and mix by swirling flask gently.
6. Place a comb and pour the melted agarose solution into a gel
casting tray. Bubbles in gel can be removed using a pipette tip.
Let the agarose gel cool down until it is solid, and color is milky
white.
7. Pull out the comb carefully.
8. Place the agarose gel in an electrophoresis chamber and add
sufficient buffer (1 TBE) to submerse the gel.
9. Mix loading puffer 1:1 with TE buffer.
10. Pipette 10 μL of the loading/TE buffer mixture and 2 μL of
the sample in a 1.5 mL tube without lid. Mix the solution by
pipetting repeatedly.
11. Repeat the procedure with all other samples.
12. Pipette 10 μL of each sample/loading buffer/TE buffer mix-
ture carefully into separate slots of gel.
13. Pipette 2 μL undiluted molecular weight marker HyperLadder
I into at least one slot of each row of gel.
14. Place the lid on the electrophoresis chamber and connect
electrodes.
15. Connect electrode wires to the power supply and make sure
that the positive (red electrode) and the negative wire (black
electrode) are correctly connected.
16. Turn on the power supply and set to approximately 90 V. The

maximal voltage depends on size of the electrophoresis
chamber used.
17. Make sure that the current is running through the buffer by
looking for bubbles forming on each electrode and by observ-
ing the movement of the blue loading dye (this will take a
couple of minutes).
18. Let the power run for approximately 45 min until the blue dye
approaches the end of the gel.
19. Thereafter, turn off the power, disconnect wires from the
power supply and remove the lid of the electrophoresis
chamber.
20. Use nitrile gloves to remove the gel from TBE buffer.
21. Analyze the gel by using an UV transilluminator and take a
photo.
3.5.5 DNA Purification Tests are carried out according to instructions for use (IFU) with
Using the QIAquick PCR minor modifications.
Purification Kit (See Note 8)
1. Add 5 volumes of the PB buffer from the QIAquick PCR
Purification Kit to 1 volume of the PCR sample and mix.
2. Place a QIAquick spin column in a 2 mL tube.
3. Pipette the whole sample to a QIAquick column and spin the
sample for 1 min at 16,060 g using a microcentrifuge.
Discard the flow-through and place the column back in the
same tube, which can be reused.
4. Add 0.75 mL PE wash buffer to the column and incubate for
5 min at room temperature. Then spin the sample for 1 min at
16,060 g.
5. Discard the flow-through again, place the column back into the
tube and spin for an additional 1 min at 16,060 g.
6. Place the column in a sterile and labeled 1.5 mL tube and add
30 μL EB buffer to the center of the QIAquick membrane.
7. Incubate samples for 15 min at room temperature.
8. Spin the column for 1 min at 16,060 g.
9. Discard the column and store the 1.5 mL tube containing the
DNA at 20 C until next use.
3.5.6 DNA Purification Tests are carried out according to the IFU with minor
Using QIAquick Gel modifications.
Extraction Kit
1. Using a clean scalpel, cut the specific DNA fragment out of the
agarose gel under UV illumination. In order to minimize the
size, cut very closely to the DNA; estimate the gel volume.
2. Place the gel into a sterile 2 mL tube and add 3 volumes of QG

buffer from the QIAquick Gel Extraction Kit per gel volume.
3. Incubate the 2 mL tube in a 50 C heat block until the gel has
completely dissolved (approximately 10 min). To resolve the
gel, vortex the tube occasionally.
4. As soon as the gel is completely resolved, add 1 gel volume of
100% isopropanol to the sample if the size of fragments is
<500 bp.
5. Place a QIAquick spin column in a 2 mL tube and pipette not
more than 0.75 mL of the sample to the column; spin for 1 min
at 16,060 g. If samples contain more than 0.75 mL, simply
load and spin again.
6. Discard the flow-through and place the column back in
the tube.
7. For washing, add 0.5 mL of QG buffer to the column and spin
again for 1 min at 16,060 g.
8. Continue with step 4 of the QIAquick PCR Purification Kit
protocol (Subheading 3.5.5.).
3.5.7 Quantifying 1. Pipette 1.5 μL of water on the sensor of UV spectral

of Purified DNA Fragments photometer.
2. Clean the sensor with sterile waterlogged cellulose and add
1.5 μL of EB buffer (component of the QIAquick PCR Purifi-
cation Kit) on the sensor. The EB buffer serves as blank
control.
3. Clean the senor again and pipette 1.5 μL of the purified DNA
sample on the sensor of the UV spectral photometer.
4. Note the DNA content (ng/μL) of the sample and clean the
sensor again.
3.5.8 Sequencing 1. Pipette the following components of the GenomeLabTM

Polymerase Chain Reaction DTCS-Quick Start Kit into a 0.5 mL thin-walled PCR tube
(See Note 9) and adjust to a final volume of 10 μL using aqua bidest:
l 4 μL DTCS Quick-Start Mix.
l 1 μL DMSO.
l 0.5 μL 10 μM forward or reverse primer (Figs. 6 and 7,
Tables 1 and 2).
l 0.5–4.5 μL of the purified DNA template (the amount
depends on DNA content: 100 ng ¼ 0.5 μL, 90–
100 ng ¼ 0.75–1 μL, 80–89 ng ¼ 1.5 μL, 70–79 ng ¼ 2 μL,
60–69 ng ¼ 2.5 μL, 45–59 ng ¼ 3–4 μL, <44 ng ¼ 4.5 μL).
2. Using a thermocycler amplify DNA fragments by following
PCR steps:
Fig. 6 Location of primers for sequencing of HSV-1 DNA polymerase gene
Fig. 7 Location of primers for sequencing of HSV-2 DNA polymerase gene

34 cycles with:
l Annealing for 20 s at 50 C.
3.5.9 Precipitation 1. After sequencing PCR is completed, add 2 μL of 3.5 M sodium

of DNA acetate (pH 5.2), 2 μL of 100 mM EDTA, 1 μL of glycogen,
and 60 μL of 100% ethanol to 10 μL PCR mixture and
mix well.
2. Align centrifuge tubes in the same orientation in the centrifuge
so that the DNA pellet forms at the same location of the tubes;
spin tubes for 15 min at 16,060 g using a microcentrifuge.
3. Be careful not to dislodge pellets during the next working
steps. First, discard supernatants using a pipette and add
200 μL of 80% ethanol.
4. Spin the tubes for 5 min at 16,060 g aligning centrifuge
tubes in the same manner as in step 2.
5. Discard supernatants using a pipette.
6. Spin the mixture for 1 min at 16,060 g aligning centrifuge
tubes in the same manner as in step 2.
7. Carefully discard the remaining ethanol with a pipette.
8. Air-dry the pellet for approximately 30 min or use a vacuum
dryer for 5–10 min.
9. Resuspend the pellet in 30 μL of sodium loading solution for
immediate sequencing or store the sample at 20 C for
later use.
3.5.10 Sequencing 1. Analyze whole sample of 30 μL from Subheading 3.5.9, step 9,

and Data Analysis using automated DNA sequencer (e.g., CEQTM 8000 Genetic
and Interpretation (See Analysis System). Operation and addition of samples are based
Note 10) on the manufacturer’s protocol from Beckmann Coulter.
2. After separation of the sample in the DNA sequencer, raw data
are evaluated using sequencing analysis software Mega 7. To
create a sequence alignment, HSV-1 strain 17 (GenBank
Accession no. X14112) [11] and HSV-2 strain HG52 (Gen-
Bank Accession no. Z86099) [12] are used as references.
3. For determination of genotypic resistance, the amino acid sub-
stitutions, frameshift mutations, and stops of translation have
to be analyzed and defined. Resistance-associated gene varia-
tions must correlate with resistance phenotype or should be
verified by the use of functional TK or DNA pol assays
[18–21]. Amino acid substitutions associated with natural
gene polymorphisms are designated when they lead to a change
in amino acid code but functionality of protein is not affected

[7]. A database to summarize resistance- and polymorphism-
related TK and DNA pol mutations is available in the
literature [8].
4 Notes
1. Instead of WST-1, the cell proliferation assay Cell Counting

Kit-8 (Dojindo Laboratories, Kumamoto, Japan) can be used
according to the manufacturer’s instructions [22].
2. There are some variations to this procedure, depending on the
laboratory. It is essential to culture the feeder cells carefully to
prevent them from overgrowing. Make sure that the medium is
not depleted of nutrients or too acidic.
3. When the first passage of patient sample is negative for HSV-1
and HSV-2, two further passages of the inoculated cell culture
should be performed.
4. It is recommended to detect HSV-1 and HSV-2 using routine
diagnostic PCR [23]. For determination of genotypic resis-
tance, the number of viral copies should be at least 104 per mL.
5. The TK gene of HSV-1 or HSV-2 cell culture isolates can be
amplified as one fragment with a size of 1273 base pairs
(bp) using the primers TK1 and TKR1, whereas the TK gene
of nonviable (patient sample) strains has to be divided into four
fragments with a size of approximately 400 bp each for ampli-
fications (Figs. 2 and 3). All oligonucleotide primers based
on the reference strains HSV-1 17 (GenBank Accession
no. X14112) [11] or HSV-2 HG52 (GenBank Accession
no. Z86099) [12] were modified according to studies pub-
lished previously [8, 24].
6. The DNA pol gene of HSV-1 and HSV-2 strains has to be
amplified in at least four distinct fragments (Figs. 4 and 5). This
is possible in viable, but usually not in nonviable strains because
of the limited amount and quality of viral DNA.
7. The gel can be made 2–3 days prior use and can be stored in
plastic wrap (without combs) in the fridge.
8. DNA fragments should only be purified with the QIAquick
PCR Purification Kit when samples are visualized as one clear
fragment in the agarose gel. If additional nonspecific DNA
fragments can be detected, the QIAquick Gel Extraction Kit
has to be used for purification.
9. Use only one primer (forward or reverse primer) for PCR. The
selected primer should overlap fragments by 50 bp. This facil-
itates sequence analysis. The TK gene of HSV-1 or HSV-2
culture isolates can be sequenced using primers TK1 and TKR1

as well as in combination with intermediate primers TK2 and
TKR2 (HSV-1) or TK3 and TKR3 (HSV-2).
10. If no automated sequencer is available, sequencing of amplified
and purified DNA fragments of TK and DNA pol genes can
also be carried out as contract sequencing by external
companies.
References
1. Frobert E, Cortay JC, Ooka T et al (2008) 10. Larder BA, Darby G (1985) Selection and
Genotypic detection of acyclovir-resistant characterisation of acyclovir-resistant herpes
HSV-1: characterization of 67 ACV-sensitive simplex virus type 1 mutants inducing alterated
and 14 ACV-resistant viruses. Antivir Res DNA polymerase activities. Virology
79:28–36 146:262–271
2. Morfin F, Thouvenot D (2003) Herpes sim- 11. McGeoch DJ, Dolan A, Donald S et al (1985)
plex virus resistance to antiviral drugs. J Clin Sequence determination and genetic content of
Virol 26:29–37 the short unique region in the genome of her-
3. Stránská R, Schuurman R, Scholl DR et al pes simplex virus type 1. J Mol Biol 181:1–13
(2004) ELVIRA HSV, a yield reduction assay 12. McGeoch DJ, Moss HW, McNab D et al
for rapid herpes simplex virus susceptibility (1987) DNA sequence and genetic content of
testing. Antimicrob Agents Chemother the Hind III 1 region in the short unique
48:2331–2333 component of the herpes simplex virus type
4. Bacon TH, Levin MJ, Leary JJ et al (2003) 2 genome: identification of the gene encoding
Herpes simplex virus resistance to acyclovir glycoprotein G, and evolutionary comparison.
and penciclovir after two decades of antiviral J Gen Virol 68:9–38
therapy. Clin Mcrobiol Rev 16:114–128 13. Spearman C (1908) The method of ‘right and
5. Morfin F, Souillet G, Bilger K et al (2000) wrong cases’ (‘constant stimuli’) without
Genetic characterization of thymidine kinase Gauss’s formulae. Br J Psychol 2:227–242
from acyclovir-resistant and -susceptible herpes 14. Kaerber G (1931) Beitrag zur Kollektiven
simplex virus type 1 isolated from bone marrow Behandlung Pharmakologischer Reihenver-
transplant recipients. J Infect Dis 182:290–293 suche [A contribution to the collective treat-
6. Burrel S, Deback C, Agut H et al (2010) Geno- ment of a pharmacological experimental
typic characterization of UL23 thymidine series]. Arch Exp Path Pharmakol
kinase and UL30 DNA polymerase of clinical 162:480–483
isolates of herpes simplex virus: natural poly- 15. Pauwels R, Balzarini J, Baba M et al (1988)
morphism and mutations associated with resis- Rapid and automated tetrazolium-based color-
tance to antivirals. Antimicrob Agents imetric assay for the detection of anti-HIV
Chemother 54:4833–4842 compounds. J Virol Methods 20:309–321
7. Bohn K, Zell R, Schacke M et al (2001) Gene 16. Sauerbrei A, Deinhardt S, Zell R et al (2010)
polymorphism of thymidine kinase and DNA Phenotypic and genotypic characterization of
polymerase in clinical strains of herpes simplex acyclovir-resistant clinical isolates of herpes
virus. Antiviral Ther 16:989–997 simplex virus. Antivir Res 86:246–252
8. Sauerbrei A, Bohn-Wippert K, Kaspar M et al 17. Safrin S, Crumpacker C, Chatis P et al (1991)
(2016) Database on natural polymorphisms A controlled trial comparing foscarnet with
and resistance-related non-synonymous muta- vidarabine for acyclovir-resistant mucocutane-
tions in thymidine kinase and DNA polymerase ous herpes simplex in the acquired immunode-
genes of herpes simplex virus type 1 and 2. J ficiency syndrome. The AIDS Clinical Trials
Antimicrob Chemother 71:6–16 Group. N Engl J Med 325:551–555
9. Bestman-Smith J, Schmitt I, Papadopoulou B 18. Sauerbrei A, Liermann K, Bohn K et al (2012)
et al (2001) Highly reliable heterologous sys- Significance of amino acid substitutions in
tem for evaluating resistance of clinical herpes the thymidine kinase gene of herpes simplex
simplex virus isolates to nucleoside analogues. J virus type 1 for resistance. Antivir Res
Virol 75:3105–3110 96:105–107
19. Brunnemann AK, Liermann K, Deinhardt- 22. Schubert A, Gentner E, Bohn K et al (2016)
Emmer S et al (2016) Recombinant herpes Single nucleotide polymorphisms of tymidine
simplex virus type 1 strains with targeted muta- kinase and DNA polymerase genes in clinical
tions relevant for acyclovir susceptibility. Sci herpes simplex virus type 1 isolates associated
Rep 6:29903 with different resistance phenotypes. Antivir
20. Kaspar M, Bohn-Wippert K, Bellstedt P et al Res 107:16–22
(2017) Stepwise characterization of 23. Sauerbrei A, Eichhorn U, Hottenrott G et al
non-synonymous mutations in the HSV-1 thy- (2000) Virological diagnosis of herpes simplex
midine kinase gene by different functional encephalitis. J Clin Virol 17:31–36
assays. J Virol Methods 247:51–57 24. Suzutani T, Ishioka K, De Clercq E et al (2003)
21. Brunnemann AK, Hoffmann A, Deinhardt- Differential mutation patterns in thymidine
Emmer S et al (2018) Relevance of kinase and DNA polymerase genes of herpes
non-synonymous thymidine kinase mutations simplex virus type 1 clones passaged in the
for antiviral resistance of recombinant herpes presence of acyclovir or penciclovir. Antimi-
simplex virus type 2 strains. Antivir Res crob Agents Chemother 47:1707–1713
152:53–57
Chapter 14
Using Primary SCG Neuron Cultures to Study Molecular

Determinants of HSV-1 Latency and Reactivation
Hui-Lan Hu, Kalanghad Puthankalam Srinivas, Ian Mohr,
Tony T. Huang, and Angus C. Wilson
Abstract
We describe a primary neuronal culture system suitable for molecular characterization of herpes simplex
virus type 1 (HSV-1) infection, latency, and reactivation. While several alternative models are available,
including infections of live animal or explanted ganglia, these are complicated by the presence of multiple
cell types, including immune cells, and difficulties in manipulating the neuronal environment. The highly
pure neuron culture system described here can be readily manipulated and is ideal for molecular studies that
focus exclusively on the relationship between the virus and host neuron, the fundamental unit of latency. As
such this model allows for detailed investigations of both viral and neuronal factors involved in the
establishment and maintenance of HSV-1 latency and in viral reactivation induced by defined stimuli.
Key words HSV-1, Latency, Reactivation, SCG neuron culture, In vitro system, Lentiviral delivery,
RNA interference
1 Introduction
Despite years of investigation, our understanding of the molecular

mechanisms underlying the establishment of HSV-1 latency and
reactivation remains incomplete [1–3]. Animal models have proved
invaluable for defining the roles of viral gene products and the host
immune system in controlling latency but continued progress is
hampered by the involvement of host proteins essential for organ-
ismal viability, contributions from multiple other cell types in addi-
tion to neurons and the interconnected nature of physiological
networks governing latency, cell homeostasis and immune func-
tion. This complexity has made it extremely difficult to parse out
the precise molecular signals that prevent or induce reactivation
within the host neuron itself, the fundamental unit of the virus–h-
ost interaction. As revealed by a number of recent studies, neurons
impose a significant degree of control over viral activity in the
absence of other cell types [1, 4, 5]. To fully tease out these
263
264 Hui-Lan Hu et al.
neuron-autonomous signals, we have refined a simple primary

neuronal culture system [5] that is based on pioneering studies by
Christine Wilcox, Eugene Johnson, and colleagues in the late
1980s [6, 7]. For the most part we use sympathetic neurons
isolated from prenatal rat superior cervical ganglia (SCG), but the
general protocol can be adapted to neurons isolated from other
ganglia including those of sensory nerves [6, 8, 9] or to sensory and
sympathetic neurons from postnatal mice [10]. Although sensory
neurons are the most frequent site of latency in humans, HSV-1
latency is clearly documented in sympathetic ganglia [11–13], and
the SCG is preferable for in vitro use because it yields extremely
pure cultures of nerve growth factor (NGF)-responsive TrkA-posi-
tive neurons capable of establishing latency with wild type viruses at
high efficiency. Access to cultures free of other cell-types, especially
CD8+ T cells, is of great benefit when focusing on the interplay
between the virus and host neuron. All of the key hallmarks of
HSV-1 latency as defined in live animal models are recapitulated
with SCG cultures, most notably the absence of infectious virus
particles, abundant expression of both the latency associated tran-
script (LAT) and viral latency microRNAs, and most importantly,
the ability of viruses to reactivate in response to defined stresses or
disruption of important signaling pathways [4, 14–17]. From the
experimental standpoint, this neuronal infection system is especially
appealing because it can be easily manipulated using molecular
techniques such as RNA interference or gene delivery via adenoviral
or lentiviral vectors, as well as by treatment with a wide range of
pharmacological reagents including compounds that are too toxic
or difficult to administer for effective use in live-animals. The purity
and accessibility of the system allows for targeted studies of neuron-
autonomous signaling as well as in depth exploration of viral gene
functions. Experiments using pure neuron cultures require a
shorter turnaround time than with live-animal models (as short as
15 days compared to 30 or more days) and can be monitored in
real-time using genetically modified HSV-1 expressing fluorescent
proteins.
In this chapter, we describe how to isolate and culture primary
SCG neurons, establish HSV-1 latency, induce viral reactivation
and lastly, use lentiviral vectors to deliver functional RNAs or
recombinant proteins into neurons that are already latently
infected. In just the last few years, studies using this highly versatile
system have greatly advanced our knowledge of the molecular basis
of latency control and reactivation, and it is our hope that the
model will be embraced and further embellished by others to
explore important aspects of the HSV-1 life cycle such as the role
of innate defense mechanisms, the contribution of neuronal archi-
tecture, the influence of neuronal activity, and the consequences of
neuronal damage response and repair pathways.
In Vitro Model of HSV-1 Latency/Reactivation 265
2 Materials
2.1 Dissecting 1. Timed pregnant (Sprague-Dawley™) rats at embryonic day 21.

Superior Cervical 2. CO2 supply and CO2 chamber.
Ganglia from E21 Rat
3. 15-cm petri dish.
Embryos
4. Hemostats/forceps.
5. Dissection scissors, surgical grade.
6. Laminar flow hood.
7. Dissection microscope.
8. Light source.
9. Dissection tray: A Styrofoam block covered with
aluminum foil.
10. 23G (1) syringe needles.
11. Straight-edge dissection forceps.
12. 70% ethanol for sterilization.
13. Kimwipes.
14. 15-mL conical tube.
15. L-15 medium: 500 mL of Leibovitz’s L-15 medium with L-
glutamine supplemented with 5 mL of 40% D-glucose. Filter-
sterilize. Store at 4 C.
2.2 Dissociating, 1. 1. 96- or 24-well culture plates.

Seeding and Culturing 2. Rat tail collagen type I: To prepare a working stock solution,
SCG Neurons onto 96- dilute in sterile H2O to a final concentration of 0.66 mg/mL.
or 24-Well Plates Store at 4 C.
3. Laminin from Engelbreth-Holm-Swarm murine sarcoma base-
ment membrane: For a working stock solution, dilute in sterile
H2O to a final concentration of 2 μg/mL.
4. Hank’s balanced salt solution (HBSS): 500 mL without phenol
red, calcium or magnesium.
5. 2.5% Trypsin (10) without EDTA or phenol red.
6. Collagenase: Prepare 10 mg/mL stock in HBSS. Store at
20 C.
7. C-medium: Into 500 mL of minimum essential medium
(MEM) with Earle’s salt and L-glutamine, add 5.5 mL of 40%
D-glucose, 50 mL of FBS, 5.5 mL of 200 mM L-glutamine.
Filter to sterilize and store at 4 C.
8. NGF: Prepare a 50 μg/mL stock solution by dissolving 1 mg
NGF in 20 mL sterile 1 HBSS. Store at 80 C.
9. 5 mL syringes.
10. 21G (1½) syringe needle.
11. 23G (1) syringe needle.

12. 70 μm nylon filter cell strainer.
13. Hemocytometer.
14. Trypan blue solution.
15. Complete neurobasal medium (NBM): To prepare a working
stock, mix 500 mL neurobasal™ medium with 5.2 mL of 40%
D-glucose, 5.2 mL of L-glutamine, and 10 mL of B-27 supple-
ment. Filter to sterilize and store at 4 C.
16. 5-Fluorouracil (FU): To prepare a 20 mM stock solution,
dissolve 100 mg 5-fluoro-20 -deoxyuridine in 20.3 mL MEM.
Filter to sterilize and store at 20 C.
17. Aphidicolin: To prepare a 10 mM stock solution, dissolve 1 mg
aphidicolin in 300 μL DMSO. Store at 20 C.
18. Neuronal culture establishment medium: NBM supplemented
with 50 ng/mL of NGF, 5 μM aphidicolin, and 20 μM 5-FU.
2.3 Establishment 1. Acyclovir: For a 100 mM stock solution, dissolve 25 mg acy-

and Reactivation clovir in 1.11 mL DMSO. Store at 20 C.
of HSV-1 in SCG 2. Latency establishment medium: Complete NBM supplemen-
Neurons ted with 50 ng/mL NGF and 300 μM acyclovir. Prepare on the
same day as use.
3. HSV-1 virus stock: Experiments described below used the
HSV-1 GFP-Us11 (strain Patton) recombinant virus [14, 15].
4. NBM, see Subheading 2.2.
5. NGF, see Subheading 2.2.
6. LY294002: Resuspend 5 mg LY294002 in 1.62 mL DMSO
for a 10 mM stock solution and store at 20 C in the dark.
7. Reactivation medium: Complete NBM supplemented with
50 ng/mL NGF and 10–20 μM LY294002. Prepare on the
same day as use.
8. Inverted microscope equipped for the visualization of green
fluorescence and for either phase contrast (PC) or differential
interference contrast (DIC) microscopy. Ideally with a 4
objective lens.
9. RNeasy Mini Kit for RT-qPCR.
10. RNase-free DNase I for RT-qPCR.
11. SuperScript III Reverse Transcriptase for RT-qPCR.
12. FastStart Universal SYBR Green Master (Rox) for RT-qPCR.
13. RT-qPCR primer sets optimized for the detection of the
HSV-1 ICP27, UL30, and UL36 mRNAs in the context of
the rat neuronal transcriptome [5, 16] are as follows:
ICP27 FW 50 -TTTCTCCAGTGCTACCTGAAGG-30 .
ICP27 RV 50 -TCAACTCGCAGACACGACTCG-30 .
UL30 FW: 59-CGCGCTTGGCGGGTATTAACAT-39.

UL30 RV: 59-TGGGTGTCCGGCAGAATAAAGC-39.
UL36 FW 50 -CGCTGCACGAATAGCATGGAATC-30 .
UL36 RV 50 -CCAGCTCCCCGGAACACATTTA-30 .
14. RT-qPCR primers for detection of 18S ribosomal RNA used to
normalize samples are as follows:
18S-FW 50 -AGGAATTGACGGAAGGGCACCA-30 .
18S-RV 50 -TTATCGGAATTAACCAGACAAATCG-30 .
15. Plaque assay overlay medium: 2 MEM, 1% agarose in H2O.
16. Vertical gel tank and electrotransfer apparatus with power
sources for SDS polyacrylamide gel electrophoresis
(SDS-PAGE) and immunoblotting.
17. Glass coverslips or glass-bottomed culture dishes suitable for
indirect immunofluorescence microscopy. Prior to use, clean
the glass surface by soaking in 1 N HCl then rinse thoroughly
with sterile water. Coat with poly-D-lysine dissolved in PBS.
18. 4% paraformaldehyde in 20% sucrose/1 PBS for indirect
immunofluorescence microscopy.
19. 1% bovine serum albumin (BSA) dissolved in PBS for indirect
immunofluorescence microscopy.
20. 1 μg/mL 40 ,6-diamino-2-phenylindole (DAPI nuclear stain)
dissolved in 1% BSA for indirect immunofluorescence
microscopy.
21. Primary monoclonal or polyclonal antibodies against HSV-1
antigens of choice and appropriate conjugated secondary anti-
bodies for indirect immunofluorescence microscopy.
2.4 Transduction 1. 293LTV cell line.

of Latent SCG Neurons 2. 293LTV growth medium: 1 DMEM supplemented with 10%
with Lentivirus FBS, 2 mM L-glutamine, and 0.1 mM MEM nonessential
amino acids (NEAA).
3. Lipofectamine 2000 transfection reagent.
4. 1 Opti-MEM.
5. Lentiviral packaging (e.g., pCMV-dR8.91 and pMD2.G) and
vector plasmids (e.g., pLKO.1).
6. Millex-HV syringe filter unit with 0.45 μm pore PVDF
membrane.
7. Syringes.
8. NBM, see Subheading 2.2.
9. NGF, see Subheading 2.2.
10. Acyclovir, see Subheading 2.3.
3 Methods
3.1 Dissecting SCGs 1. Prior to use, coat 96- and/or 24-well plates by filling each well
with a 0.66 mg/mL solution of rat-tail collagen, and then
remove the collagen solution immediately. Leave the plates
open in a running laminar flow hood to allow the wells to dry
completely. Drying will take approximately 10 min for smaller
wells but closer to 45 min for larger wells. After the wells are
completely dry, wash once with sterile H2O, and then fill each
well with a 2 μg/mL solution of laminin. Store the laminin-
filled plates at 37 C until the SCG neurons are ready to be
seeded (see Notes 1–4).
2. Euthanize the pregnant female rat(s) on embryonic day 21 by
CO2 asphyxiation. Spray the animal(s) with 70% ethanol, make
a U-shaped incision and fold back the skin away from the
abdominal cavity. Carefully cut through the abdominal muscu-
lature to reveal the uterus and unborn pups. Remove the entire
uterus, being careful to not injure the pups, and place in a
15-cm dish. Remove each pup from the uterus and embryonic
sac, cut the umbilical cord and clean using 70% ethanol and
Kimwipes.
3. Sacrifice one pup at a time by decapitation using a pair of
dissecting scissors to cut just above the shoulders at the base
of the neck. Mount the severed head on the dissection tray. Pin
the exposed spinal cord with a 23G needle. Pull the anterior
skin over the nose away from the carotid arteries and hold the
skin down using a second 23G needle. Push the esophagus and
trachea away from the carotid arteries and place a third 23G
needle through the esophagus and trachea (Fig. 1).
4. The two SCGs can be found by first locating the two carotid
arteries (Fig. 1). Gently pulling up one artery at a time with a
pair of straight edge dissection forceps will reveal a bifurcation
in the blood vessel. The SCG sits at the branching point of the
artery and is a light, almond-shaped tissue that is less yellow
than the surrounding adipose tissue (Fig. 1b). Remove each
SCG by gently pulling it away from the artery and place it in a
15-mL conical tube filled with 12 mL of L-15 medium.
Isolated ganglia are approximately 2-mm in length (Fig. 1c).
5. Repeat steps 3 and 4 in Subheading 3.1 for each of the pups.
3.2 Dissociating, 1. Centrifuge the SCGs for 1 min at 133 g and remove the
Plating, and Culturing medium (see Note 5).
SCG Neurons 2. Resuspend the ganglia in 1 mL of L-15 medium containing
0.25% trypsin and collagenase (1 mg/mL) and incubate at
37 C for 10–15 min, agitating approximately every 2–3 min
(see Note 6).
Fig. 1 Landmarks used to locate the superior cervical ganglia. (a) Schematic representation of a prenatal rat
head viewed from the ventral side showing the recommended placement of the three pins or syringe needles
used to immobilize the head and to pin back the esophagus and the trachea (described in Subheading 3.1).
(b) The superior cervical ganglion (SCG) is an almond-shaped, semitransparent structure that appears almost
colorless compared to surrounding tissues and is found above the branch point of the carotid arteries.
(c) Isolated ganglion placed next to a ruler to illustrate the size (scale in mm)
3. Add 10 mL of C-medium and centrifuge for 1 min at 133 g.

4. Remove the medium and resuspend cells in 1 mL of
C-medium. To dissociate the cells, pass the tissue through a
21G needle using a 5 mL syringe until clumps are not seen,
usually about 8–10 times. Then repeat three times using a
smaller bore 23G needle (see Note 7).
5. Filter the dissociated cells through a 70 μm nylon filter to
remove any remaining clumps.
6. Remove 10 μL of cell suspension and mix with trypan blue.
Count the live cells that are able to exclude the dye, and
calculate the concentration of the cell suspension.
7. Remove the laminin solution from the wells and, without
allowing the plate to dry, immediately add cells in C-medium
supplemented with 50 ng/mL of NGF to the wells (see
Notes 4 and 8).
(a) 96-well plate: Add 5–6 103 cells/well in a final volume
of 50–100 μL/well.
(b) 24-well plate: Add 4–5 104 cells/well in a final volume
of 500 μL/well.
The seven steps up to plating of the dissociated ganglia are
referred to as day in vitro (DIV) 0 (Fig. 2a).
8. The next day, DIV 1, remove the C-medium and replace with
the equivalent volume of neuronal culture establishment
medium. The NGF will sustain the postmitotic neurons and
the other compounds will kill any dividing cells (see Notes 9
and 10).
Fig. 2 Reactivation of latent HSV-1 GFP-Us11 by lentivirus-mediated knockdown of the neuronal Ku70 protein.
(a) Temporal outline of a typical reactivation experiment. Neuron were prepared and cultured as outlined in
Subheadings 3.1 and 3.2 and then infected with a wild-type HSV-1 reporter virus (HSV-1 GFP-Us11) that
expresses a fluorescent EGFP-Us11 fusion protein upon the onset of viral DNA replication, at an m.o.i. of 1, as
described in Subheading 3.3. Cultures were maintained in medium containing 100 μM acyclovir for a further
6 days to allow the virus to establish latency. After refeeding with fresh medium lacking acyclovir, the cells
were coinfected with lentiviruses expressing either a short hairpin (sh) RNA targeting the rat Ku70 mRNA or a
nontargeting control as outlined in Subheading 3.4. As a positive control for reactivation, a parallel culture was
treated with 20 mM LY294002, a potent phosphatidylinositol 3-kinase inhibitor (Subheading 3.3) [5]. (b) Green
fluorescence (GFP) and differential interference contrast (DIC) imaging of latently infected neurons 3 days after
lentiviral infection or LY294002 treatment. Scattered clusters of neurons are shown, a few of which display
strong EGFP-Us11 accumulation in the cell body indicative with the onset of viral genome amplification and
productive reactivation
3.3 Establishment 1. On DIV 6, the day before HSV-1 infection, refeed the neuron
of Latency cultures with medium containing acyclovir at a final concentra-
and Reactivation tion of 100 μM (see Note 11). Acyclovir is a chain-terminator
of HSV-1 in SCG that blocks any low level of HSV-1 lytic replication in the
Neurons culture, allowing infected neurons to establish latency.
(a) 96-well plate: Add 25 μL of latency establishment
medium to each well to a final volume of 75 μL.
(b) 24-well plate: Add 100 μL of latency establishment

medium to each well for a final volume of 600 μL.
2. The next day (DIV 7), infect the neurons with HSV-1 at a
multiplicity of infection (m.o.i) corresponding to 1–2 plaque
forming units per neuron (see Note 12), by adding an appro-
priate amount of virus diluted in NBM. This point in the
protocol is referred to as 0 days postinfection (0 d.p.i.). Mock
and/or an acute infection (omitting acyclovir) should be
included as control(s).
3. After incubating the neurons with virus for 2–3 h at 37 C,
gently remove and replace the medium with NBM supplemen-
ted with 50 ng/mL NGF and 100 μM acyclovir (see Note 13).
4. Allow the virus to establish latency by incubating the neurons
at 37 C for the next 7 days. Occasionally, monitor the health
of the cultures using light microscopy (Fig. 2). If a virus that
expresses a fluorescent protein as a lytic gene is being used (e.g.,
HSV-1 GFP-Us11), cultures can be checked for fluorescence
indicative of unwanted reactivation or a failure to establish
latency.
5. On DIV 14, induce reactivation by very carefully replacing the
medium with NBM containing 50 ng/mL NGF and
10–20 μM LY294002, a PI3-kinase inhibitor that serves as a
potent inducer of reactivation (Fig. 2a). DMSO, the vehicle,
can be used as a negative control.
6. Incubate LY294002 treated cultures for 20 h at 37 C, and
then gently remove the medium and replace with NBM sup-
plemented with 50 ng/mL NGF (see Note 14).
7. Measure viral reactivation using one of the followings assays:
(a) RT-qPCR: Detect and quantitate viral productive cycle
transcripts such as the ICP27/UL54 (immediate-early
gene), DNA polymerase/UL30 (early gene), and/or
large tegument protein/UL36 (true-late gene) mRNAs.
Approximately 105 neurons are required per sample
(RNeasy Mini Kit). Treat the RNA with DNase I to
eliminate contaminating DNA, and then synthesize
cDNA using SuperScript III Reverse Transcriptase follow-
ing the manufacturer’s guidelines. Perform RT-qPCR
with FastStart Universal SYBR Green Master (Rox) or
equivalent. Sequences of primer sets to detect ICP27,
UL30, and UL36 mRNAs are shown in Subheading 2.3,
step 13.
(b) Monitor fluorescent protein expression: Using an inverted
fluorescent microscope, count the number of wells with
one or more neurons expressing the fluorescent protein
expressed by the virus. Calculate the efficiency of
reactivation by dividing this number by the total number

of wells per condition.
(c) Plaque assay: Collect the neurons in the growth medium
2–7 days after inducing reactivation. Dissociate the virus
from cell debris by freezing/thawing, make serial dilu-
tions and perform plaque assays on monolayers of Vero
cells or another permissive cell line.
(d) Western Blot Analysis: Collect the neurons in 1 SDS
sample buffer, heat denature and resolve on a
SDS-PAGE gel prior to immunoblotting for viral antigens
using appropriate primary and secondary antibody com-
binations. Approximately 105 cells are required per sam-
ple. For details on how to prepare and probe
immunoblots see refs. 17, 18.
(e) Indirect immunofluorescence microscopy: In situ detec-
tion of viral proteins may be a useful measure of reactiva-
tion efficiency. Neurons should be plated onto glass
coverslips or glass-bottomed culture chambers. Prior to
use, coverslips should be cleaned with 1 N HCl, rinsed
with H2O, and sterilized. Coat with poly-D-lysine, colla-
gen, and laminin. After thorough washing and blocking,
stain neurons with primary antibodies against viral pro-
teins and appropriate secondary antibodies. Counterstain
the nucleus with DAPI. Include a specificity control by
omitting the primary antibody.
Neurons are notoriously difficult to transfect and conventional

methods are likely to trigger reactivation of latent HSV-1 (our
unpublished observations). Fortunately, neurons are amenable to
lentiviral transduction allowing for the efficient delivery of a variety
of bioactive molecules. It is possible to deplete host or viral proteins
using appropriate short-hairpin RNAs (shRNAs) (Fig. 2b) or to
overexpress wild type or mutant proteins [4, 5, 16, 19]. Introduc-
tion of the lentivirus can occur either before or after infection of
HSV-1, enabling the researcher to selectively study the impact on
latency establishment, maintenance and reactivation. Methodology
to prepare and infect SCG neurons with lentiviral-based vectors is
described below.
3.4 Preparation 1. Transfect one 10-cm plate of 90% confluent 293LTV producer
of Lentivirus Stocks cells with a total of 24 μg of an equimolar mix of the packaging
and vector plasmids using Lipofectamine 2000 reagent (day 0)
according to the manufacturer’s guidelines. Incubate the cul-
ture overnight at 37 C. The packaging plasmids should pro-
vide the HIV gag, pol, and rev proteins and the Vesicular
stomatitis Indiana virus (VSIV) envelope glycoprotein
(VSVG).
2. The next day (day 1), gently remove the medium and add 7 mL
fresh 293LTV growth medium.
3. 2 days posttransfection (day 2), carefully collect the lentivirus-
containing medium into a 15 mL conical tube and store at
4 C. Refeed the cells with 7 mL 293LTV growth medium, and
then incubate the cells overnight at 37 C.
4. 3 days posttransfection (day 3), gently remove the medium and
pool with the lentivirus harvest from day 2.
5. Centrifuge for 10 min at 1200 g, 4 C, to pellet cell debris
and carefully filter the lentivirus preps through a 0.45 μm
PVDF filter. Discard the pellet.
6. Aliquot the filtrate into 1.5 mL cryostorage tubes and store at
80 C.
3.5 Transduction 1. On DIV 12–DIV 14 (see Fig. 2a), corresponding to either 5 or

of Latently Infected 7 days after HSV-1 infection, coinfect the neurons with lentivi-
SCG Neurons rus diluted into latency establishment medium. The volume of
with Lentivirus a particular lentivirus stock that is added to the neurons must
be tested empirically (see Note 15). This can be done on
neurons without HSV-1 infection (see Note 16). Below are
suggested ranges for lentivirus made using the above protocol:
(a) 96-well plate: Add 0.5–25 μL lentivirus/well diluted in a
final volume of 50 μL/well.
(b) 24-well plate: Add 2.5–125 μL lentivirus/well in a final
volume of 500 μL/well.
2. Incubate infected cultures overnight at 37 C and then gently
remove the medium and replace with latency establishment
medium.
3. Maintain the SCG neurons at 37 C for 2–5 days. The exact
time will depend on the efficiency of expression or knockdown
required or other aspects of the experimental design.
4. The SCG neurons may be tested for lentivirus-induced reacti-
vation. An example of this using an shRNA specific for the
Ku70 subunit of DNA-PK, which regulates Akt activation
[19], and monitoring EGFP-Us11 expression is shown in
Fig. 2b. Carefully remove the medium and replace with NBM
supplemented with 50 ng/mL NGF and omitting the acyclovir
to allow viral DNA replication. Incubate at 37 C and analyze
by one of methods described in Subheading 3.3, step 7.
5. Alternatively, if the goal is to investigate the role of neuronal
or viral factors on the establishment of latency, lentiviruses
can also be provided before infection with HSV-1 (see
Note 17).
4 Notes
1. As with any work with vertebrate animals, prior regulatory

approval must be obtained in accordance with institutional
policies.
2. Allow collagen to dry completely on plates before rinsing with
H2O. Since the collagen is H2O soluble, rinsing the plates with
H2O before drying may cause the collagen to wash off and
SCG neurons to detach from the plates later on.
3. It is possible to reuse collagen to coat plates (maximum of five
times), but generally coating with fresh collagen gives better
adherence.
4. Remove the laminin solution used to coat plates just before the
neurons are to be plated. Doing this too early may cause the
laminin to dry and precipitate.
5. Do not centrifuge the SCGs faster than the recommended
speed of 133 g, because the ganglion can be damaged,
reducing the number of viable neurons.
6. Incubate SCGs in trypsin collagenase for approximately 12 min
(range 10–15). Excessive incubation will unduly stress the
neurons reducing survival.
7. Pass the SCGs gently through the syringes since neurons may
be stressed and not survive.
8. Seed SCG neurons at a recommended density. Plating a fewer
number of the neurons results in unhealthy cultures.
9. While changing the medium, it is advised to be extremely
careful and gentle. Do not use an aspirator. Discard and replen-
ish individual wells for 24-well plates using a pipette and
one-row by one-row for 96-well plates using a multichannel
pipette. SCG neurons may come off from the plates otherwise.
10. By DIV 2 or 3, newly plated SCG neurons should have
extended viable axons. Typically, neuronal cell bodies will
form small clusters of 5–10 cells, the remainder of the plate
surface being covered by an extensive network of axons and
dendrites.
11. Avoid adding an acyclovir stock solution directly to SCG neu-
rons because this can overly stress the neurons. Instead dilute
the stock solution in NBM before adding to the well. Neurons
should be treated with acyclovir for at least 6 h before HSV-1
infection. Overnight treatment is recommended.
12. The maximum amount of HSV-1 (highest m.o.i.) that cultures
can tolerate may vary slightly between different viruses or virus
preparations and this needs to be determined empirically.
Stocks at a titer of 107 plaque forming units (pfu) per mL
(as determined in Vero cells) or greater is recommended, but a

titer of 106 may be sufficient.
13. Similar protocols have been used successfully that include α-, β-
or γ-interferon (typically within a range of 100–250 U/mL) in
addition to acyclovir [10]. Interferon likely provides more
effective suppression of unwanted viral productive replication
[20]. The need to supplement acyclovir may depend on the
strain background of the virus to be used. Supplemental anti-
virals should be used with caution because the effects on later
reactivation may not be fully understood.
14. Sometimes the neurons at the outer edges of a well, where the
cell density is often lowest, will become detached but will
usually reattach if left undisturbed.
15. Each reactivation inducer must be tested to determine the
optimal amount of time of exposure to the cells. Some inducers
may be left on the cells throughout the experiment but others
may interfere with important cellular functions such as gene
expression or metabolic homeostasis leading to detachment
from the plate, retraction of axons or even cell death and may
be detrimental to replication of reactivated virus. That said,
toxic compounds such as global protein synthesis inhibitors
[4], or DNA damaging agents [19], can still be used as indu-
cers if they are added and then removed within a suitable time
frame. This should be addressed empirically.
16. The amount of lentivirus may need to be adjusted, either to
optimize knockdown or maximize recombinant protein
expression. Lentivirus exposure should be balanced against
the impact on the health of the culture. Toxicity due to the
lentivirus infection or presence of contaminants in the lentivi-
rus stock can manifest as changes in neuronal morphology
(often most evident as changes in the cell body or soma) or
reduced attachment to the substrate.
17. Infections with HSV-1 and lentiviruses do not seem to inter-
fere with each other and thus the order of addition can be
arranged to selectively investigate the role of viral or neuronal
proteins in either the establishment of latency rather than
maintenance/reactivation. To precondition the neuronal envi-
ronment prior to HSV-1 infection, add the lentivirus at DIV
6 at the same time as the acyclovir and perform the HSV-1
infection at DIV 7.
Acknowledgments
We thank past members of the Mohr and Wilson Labs for establish-
ing these protocols as well as Moses Chao for his continuous
support of our latency studies and for teaching us about the role
of nerve growth factor in sustaining sympathetic neurons. This

work was funded by NIH grants GM107257 (T.T.H.),
GM056927, AI073898 (I.M.), AI130618 (A.W.), and funds
from the V Foundation for BRCA Cancer Research to T.T.H.
References
1. Wilson AC, Mohr I (2012) A cultured affair: TM, Deshmukh M (2015) Neuronal stress
HSV latency and reactivation in neurons. pathway mediating a histone methyl/phospho
Trends Microbiol 20:604–611. https://doi. switch is required for Herpes simplex virus
org/10.1016/j.tim.2012.08.005 reactivation. Cell Host Microbe 18:649–658.
2. Wagner EK, Bloom DC (1997) Experimental https://doi.org/10.1016/j.chom.2015.11.
investigation of herpes simplex virus latency. 007
Clin Microbiol Rev 10:419–443 11. Warren KG, Brown SM, Wroblewska Z, Gilden
3. Bloom DC (2016) Alphaherpesvirus latency: a DH, Koprowski H, Subak-Sharpe J (1978)
dynamic state of transcription and reactivation. Isolation of latent herpes simplex virus from
Adv Virus Res 94:53–80. https://doi.org/10. the superior cervical and vagus ganglions of
1016/bs.aivir.2015.10.001 human beings. N Engl J Med
4. Kobayashi M, Wilson AC, Chao MV, Mohr I 298:1068–1069. https://doi.org/10.1056/
(2012) Control of viral latency in neurons by NEJM197805112981907
axonal mTOR signaling and the 4E-BP trans- 12. Price RW, Katz BJ, Notkins AL (1975) Latent
lation repressor. Genes Dev 26:1527–1532. infection of the peripheral ANS with herpes
https://doi.org/10.1101/gad.190157.112 simplex virus. Nature 257:686–688
5. Camarena V, Kobayashi M, Kim JY, Roehm 13. Bustos DE, Atherton SS (2002) Detection of
PC, Perez R, Gardner J, Wilson AC, Mohr I, herpes simplex virus type 1 in human ciliary
Chao MV (2010) Nature and duration of ganglia. Invest Ophthalmol Vis Sci
growth factor signaling through receptor tyro- 43:2244–2249
sine kinases regulates HSV-1 latency in neu- 14. Benboudjema L, Mulvey M, Gao Y, Pimplikar
rons. Cell Host Microbe 8:320–330. https:// SW, Mohr I (2003) Association of the herpes
doi.org/10.1016/j.chom.2010.09.007 simplex virus type 1 Us11 gene product with
6. Wilcox CL, Smith RL, Freed CR, Johnson EM the cellular kinesin light-chain-related protein
(1990) Nerve growth factor-dependence of PAT1 results in the redistribution of both poly-
herpes simplex virus latency in peripheral sym- peptides. J Virol 77:9192–9203
pathetic and sensory neurons in vitro. J Neu- 15. Pourchet A, Copin R, Mulvey MC, Shopsin B,
rosci 10:1268–1275 Mohr I, Wilson AC (2017) Shared ancestry of
7. Wilcox CL, Johnson EM (1988) Characteriza- herpes simplex virus 1 strain Patton with recent
tion of nerve growth factor-dependent herpes clinical isolates from Asia and with strain
simplex virus latency in neurons in vitro. J Virol KOS63. Virology 512:124–131. https://doi.
62:393–399 org/10.1016/j.virol.2017.09.016
8. Roehm PC, Camarena V, Nayak S, Gardner JB, 16. Kim JY, Mandarino A, Chao MV, Mohr I, Wil-
Wilson A, Mohr I, Chao MV (2011) Cultured son AC (2012) Transient reversal of episome
vestibular ganglion neurons demonstrate latent silencing precedes VP16-dependent transcrip-
HSV1 reactivation. Laryngoscope tion during reactivation of latent HSV-1 in
121:2268–2275. https://doi.org/10.1002/ neurons. PLoS Pathog 8:e1002540. https://
lary.22035 doi.org/10.1371/journal.ppat.1002540
9. Kuhn MA, Nayak S, Camarena V, Gardner J, 17. Harlow E, Lane D (1988) Antibodies, a labo-
Wilson A, Mohr I, Chao MV, Roehm PC ratory manual. Cold Spring Harbor Press, Cold
(2012) A cell culture model of facial palsy Spring Harbor, NY
resulting from reactivation of latent herpes sim- 18. Sambrook J, Fritsch EF, Maniatis T (1989)
plex type 1. Otol Neurotol 33:87–92. https:// Molecular cloning: a laboratory manual, 2nd
doi.org/10.1097/MAO.0b013e31823dbb20 edn. Cold Spring Harbor Press, Cold Spring
10. Cliffe AR, Arbuckle JH, Vogel JL, Geden MJ, Harbor, NY
Rothbart SB, Cusack CL, Strahl BD, Kristie
19. Hu H-L, Shiflett LA, Kobayashi M, Chao MV, 20. Linderman JA, Kobayashi M, Rayannavar V,
Wilson AC, Mohr I, Huang TT (2019) TOP2- Fak JJ, Darnell RB, Chao MV, Wilson AC,
ß-dependent nuclear DNA damage shapes Mohr I (2017) Immune escape via a transient
extracellular growth factor responses via gene expression program enables productive
dynamic AKT phosphorylation to control replication of a latent pathogen. Cell Rep
virus latency. Mol Cell 74:1–15. https://doi. 18:1312–1323. https://doi.org/10.1016/j.
org/10.1016/j.molcel.2019.02.032 celrep.2017.01.017
Chapter 15
Characterization of Extracellular HSV-1 Virions by

Proteomics
Roger Lippé
Abstract
The analysis of HSV-1 mature extracellular virions by proteomics requires highly enriched samples to limit
false-positives and favor the detection of true components. The protocol described below involves the
removal of highly contaminating serum proteins and purification of the virions by a series of differential and
density centrifugation steps. In addition, L-particles, which are viral particles devoid of a genome and capsid
but present in the extracellular milieu, are depleted on Ficoll 400 gradients. As previously reported, the
resulting viral particles are free of most contaminants and suitable for mass spectrometry.
Key words HSV-1, Herpes, Simplex, Proteomics, Mass spectrometry, Protein composition, Virions,
Viral particle
1 Introduction
The proper identification of viral particle content is essential for a

deep understanding of viral particles’ assembly, egress, and matura-
tion. It is also ultimately needed to characterize the function of
these structural components within mature virions or during the
viral life cycle. Finally, this is required to characterize the complex
host–pathogen interactions and potentially lead to novel antiviral
drugs [1–3]. Classical approaches to study viral protein contents
have typically relied on the analysis of individual proteins by meth-
ods such as Western blotting, immuno-EM, and coimmunopreci-
pitation. While instrumental to confirm suspected proteins, these
antibody-dependent techniques are largely impractical to identify
new molecules unless a random screen is performed using a wide
panoply of reagents. Thus, for a complete view, a systematic and
more global approach is needed. In recent years, proteomics has
become an approach of choice to pursue such a goal. Already,
proteomics has successfully been used to characterize numerous
viruses [4–6].
279
280 Roger Lippé
Herpes simplex virus type 1 (HSV-1) is among the most com-

plex human viruses. These 250 μm particles are composed of a
DNA core contained in an icosahedral capsid assembled from 8 to
10 viral components, a multiprotein tegument layer and a host-
derived envelope containing over a dozen additional proteins.
Given that the complete assembly and maturation of novel HSV-1
virions is poorly understood, it is crucial to identify all of their
components to ultimately understand how individual components
are recruited, interact with one another and what function they
might serve in the virions. Already, the protein contents of various
herpesviruses, including HSV-1, PRV, HCMV, MCMV, EBV,
KSHV, murine HV-68, rhesus CMV, and alcelaphine, have been
reported using mass spectrometry [5, 7–9]. These proteomics
studies uncovered novel viral components but also revealed the
incorporation of numerous cellular proteins that are partly shared
among the herpesviral family [7]. For instance, 49 distinct host
proteins were identified in mature HSV-1 virions [10], many of
which partially have been shown to modulate the viral life cycle
[11, 12]. A parallel proteomics study probed posttranslational
modifications of HSV-1 proteins within infected cells, which
should be useful to assess their role during the viral life cycle
[13]. This suggests that proteomics may be a particularly useful
approach to identify novel modulators of herpesviruses.
Given the high sensitivity of mass spectrometry, one important
limitation of proteomics is the identification of contaminants pres-
ent in the samples. Moreover, these irrelevant molecules may also
mask low abundance proteins of interest. In this context, purity
becomes a critical aspect when performing proteomics studies.
While absolute purity is impossible to attain, significant efforts
must nonetheless be devoted to develop an optimal experimental
design. The objective of the present chapter is to provide technical
details regarding the purification of HSV-1 extracellular virions
suitable for mass spectrometry, as outlined in Fig. 1. Albeit not
the focus of this chapter, some information is also given regarding
the final preparation and analysis of the samples by mass
spectrometry.
2 Materials
1. Adherent HeLa cells (see Note 1).

2. Tittered stock of HSV-1 virus of the desired wild type or
mutant strain.
3. RPMI/BSA: 0.22 μm filtered RPMI 1640 supplemented with
0.1% BSA.
4. Complete medium: 0.22 μg filtered DMEM complemented
with 10% fetal bovine serum, 1% Pen/Strep, and 1% L-Glu.
MS Analysis of Mature HSV-1 Virions 281
Fig. 1 Purification scheme to enrich for extracellular HSV-1 virions (Reproduced with permission from [10]
[Copyright © 2008, American Society for Microbiology, Journal of Virology, Vol. 82, 2008, p. 8605–8618, doi:
https://doi.org/10.1128/JVI.00904-08])
5. Serum free medium: 0.22 μm filtered serum-free DMEM con-

taining 1% Pen/Strep and 1% L-Glu (see Note 2).
6. 0.22 μm filtered MNT buffer: 30 mM MES, 100 mM NaCl,
20 mM Tris, pH 7.4.
7. PBS: 136.9 mM NaCl, 2.7 mM KCl, 10.1 mM NaH2PO4,
1.8 mM KH2PO4, pH 7.4.
8. DNase I solution: 10 mg/ml stock (20,000 units/ml) DNase I
in 20 mM Tris–HCl, 1 mM MgCl2, 50% (w/v) glycerol,
pH 7.5; keep at 20 C.
9. 0.45 μm filter.
10. Sonic Dismembrator Model 100, Fisher Scientific coupled to a
micro cup horn.
11. A good mass spectrometrist!
12. SDS-PAGE gels.
13. Fixing solution: 5% acetic acid–50% methanol solution.
14. 0.02% thiosulfate sodium.
15. 0.1% silver nitrate.
16. Silver reaction buffer: 0.04% formaldehyde and 2% carbonate
sodium.
282 Roger Lippé
17. Silver stopping buffer: 5% acetic acid.

18. Destain solution: 15 mM potassium ferricyanide K3Fe(CN)6,
50 mM sodium thiosulfate (prepare fresh prior to use since it is
unstable).
19. Reducing solution: 10 mM DTT diluted in 50 mM
NH4HCO3.
20. Alkylating solution: 55 mM iodoacetamide prepared in 50 mM
NH4HCO3.
21. Trypsin: 2 mg/ml of sequencing or proteomics grade trypsin
diluted in 50 mM NH4HCO3.
22. Extraction buffer: 90% acetonitrile/0.5 M Urea.
3 Methods
3.1 Infection 1. Seed cells into in complete medium in 576 cm2 plates 24 h
(See Note 3) before the infection (see Note 4). With our current batch of
cells, we routinely dilute them three fold to reach a ~80–90%
confluence at the moment of the infection (see Note 5).
2. The next day, remove the supernatant and keep at 37 C
(conditioned medium).
3. Wash cells twice with warm PBS.
4. Prepare enough RPMI/BSA to get 10 ml for each plate.
5. Calculate the appropriate amount of virus to dilute in RPMI/
BSA for a multiplicity of infection (MOI) of five (see Note 6).
6. Add 10 ml of the viral inoculum per plate and adsorb to the
cells in a tissue culture incubator for 1 h under gentle shaking
(see Note 7).
7. Add 60 ml of conditioned medium to the plate (total of 70 ml).
8. At 6 h postinfection (hpi), remove medium and wash twice
with warm PBS to remove all traces of serum (see Note 8).
9. Replace by 50–70 ml of serum-free DMEM per plate and
incubate a further 18 h for a final 24 hpi prior to harvesting
(see Note 9).
3.2 Harvesting 1. Pool the extracellular medium from all the plates.
and Virion Purification 2. Centrifuge at 300 g and 4 C for 10 min to pellet large debris
(See Note 10) and cells that might have detached from the plates.
3. Filter the supernatant through a 0.45 μm filter to remove
smaller debris and keep the flow through (see Note 11).
4. Pellet virus at high-speed centrifugation (20,000 g; 30 min,
4 C) (see Note 12).
5. Remove the supernatant (see Note 13).
6. Resuspend the virus in a small volume of 0.2 μm filtered

DMEM (e.g., 1 ml of serum free medium for 12 plates).
7. Transfer the virus to an Eppendorf tube.
8. Add DNase I solution to the sample (final concentration of
500 units/ml) and incubate for 30 min at 4 C (see Note 14).
9. Sonicate the virus 10 1 s at power 8 on ice.
10. Top load the virus onto a 10% Ficoll 400 step gradient
prepared in serum-free DMEM by overlaying the above 1 ml
(equivalent to 12 large plates) onto a single gradient of
9–10 ml (see Note 15).
11. Centrifuge at 26,000 g for 2 h at 4 C.
12. Wash pellet (mature virions) in cold MNT, spin and resuspend
in circa 15 μl of MNT (see Note 16).
13. Measure the protein yield by determining the protein concen-
tration with your favorite protein kit.
14. If desired, freeze sample and keep at 80 C.
3.3 Preparation 1. Run a SDS-PAGE as usual using the proper gel concentration
of Samples for Mass (e.g., 8–15% gradient).
Spectrometry (See 2. To silver stain the gel (see Note 18) to evaluate the overall
Note 17) purity and abundance of the sample (see Note 19), fix the gel
in fixing solution.
3. Rinse many times in distilled water for 30 min.
4. Incubate in 0.02% thiosulfate sodium solution for 1 min.
5. Briefly wash the gel with distilled water for 2 min.
6. Incubate in 0.1% silver nitrate solution for 20 min.
7. Rinse gel in distilled water.
8. Incubate in silver reaction buffer until you get nicely stained
bands and a minimal background signal.
9. Stop the reaction with silver stopping solution.
10. Cut evenly spaced gel slices from the top to the bottom of the
separating gel (10–15 slices for a mini gel) (see Note 20).
11. Incubate each slice with 100 μl of destain solution for 5 min
(see Note 21).
12. Wash 3 5 min in water.
13. Treat each slice with 100 μl of acetonitrile for 10 min.
14. Reduce and alkylate the gel slices to respectively break up the
disulphide bonds and prevent their reformation by soaking
each gel slice in 50–100 μl of reducing solution and incubate
at 56 C for 30 min to 1 h.
284 Roger Lippé
15. Let cool to RT and replace the DTT solution with 50–100 μl/
gel slice of alkylating solution. Incubate in the dark for 30 min
to 1 h at room temperature.
16. Remove excess liquid and wash for 10 min with 100 μl of
50 mM NH4HCO3.
17. Dehydrate the gel pieces with 50% 50 mM NH4HCO3/50%
acetonitrile then pure acetonitrile for a few minutes.
18. Remove the excess liquid and air-dry.
19. Rehydrate gel slices for 5–10 min with 200 ng of sequencing or
proteomics grade trypsin diluted in 100 μl of 50 mM
NH4HCO3. Digest for at least 4 h at 37 C.
20. Remove supernatant by centrifugation at the top speed of a
microcentrifuge and transfer the digested solution to a fresh
0.5 ml Eppendorf tube.
21. Add 50 μl of extraction buffer to each gel slice to extract the
remaining peptides for 15 min at room temperature. Spin again
and pool supernatant in the above tube. Repeat this extraction
step twice.
22. Dry the samples in a speed-vac, avoiding over drying and store
at 20 C.
23. Analyze the samples in a mass spectrometer (see Note 22).
24. Identify peptides with the common Mascot software or equiv-
alent (X! Tandem, MaxQuant, etc. [14, 15]) (see Note 23).
25. Decipher role of the identified proteins (see Note 24)!
3.4 Limitations While mass spectrometry is a vital tool to identify novel protein
components from complex samples, the high sensitivity of the
approach will unfortunately lead to the detection of copurifying
contaminants (i.e., false positives). Examples of contaminants may
be cell-associated viral intermediates (e.g., nucleocapsids or cyto-
plasmic viral particles) that could be released into the medium upon
virus-induced cell lysis, as well as large cellular entities such as
mitochondria or ribosomes. A good purification protocol is there-
fore critical and great care should be devoted to monitor all purifi-
cation steps and potential contaminants. For example, one useful
trick to detect contaminating immature nuclear capsids is to probe
for pre-VP22a, a protein precursor absent in the mature C-capsids
that constitute mature virions. Similarly, contamination from leaky
cells should be monitored with a battery of antibodies directed
against various cellular organelles. Another caveat is that improp-
erly assigned peptides may occur, leading to a different type of false
positives. Only the top hits (minimum of 2 peptides and 95%
confidence) should be considered, despite the fact that lower hits
may be biologically relevant. Finally, mass spectrometry is partially
dependent on relative abundance, implying that any substantial
contaminant or protein of interest may hinder the detection of

other proteins and lead to false negatives. Consequently, mass
spectrometry, as most methods, should be followed by an indepen-
dent validation method. One option is Western blotting, but it is
also prone to detect the same contaminants. A better option is to
directly test the presence of candidate proteins on virions by
immuno-EM. One final consideration is the likelihood that the
composition of mature virions is partly defined by the cell type
used to produce them. Ultimately, this parameter should be
addressed for a more complete picture.
4 Notes
1. Other permissive cell lines may be used but an analysis of the

proper infection kinetics should be performed to optimize the
best viral output with minimal cell lysis [10]. The critical points
are to use a permissive cell line and to have enough material for
mass spectrometry after the purification. In the past, we typi-
cally provided 20–25 μg of purified material to our mass spec-
trometry service unit, an amount that will surely be reduced
with instruments that are more sensitive (As little as 1 μg may
be sufficient). In choosing a host cell line, one should take into
consideration if you wish to identify cellular proteins that might
be incorporated into the virions. If so, a human cell line is
highly recommended, given the existence of a complete
human tryptic database. This will insure the assignment of
tryptic fragments to the right host proteins.
2. Other medium may be employed if another cell line is used.
However, a serum-free version of that medium is necessary to
avoid contamination of the mass spectrometry by the proteins
found in the serum.
3. For quantitative mass spectrometry, we suggest a SILAC or
related protocol. Protocols to that effect are widely available
elsewhere.
4. We routinely use 12 576 cm2 plates. If available and amena-
ble to the particular cells used, suspension culture or roller
bottles can alternatively be used.
5. It is critical to balance the need for as many cells as possible at
the moment of the infection for higher yields with the need of
actively replicating cells to have a productive infection.
6. A high MOI allows a synchronous and single replication cycle.
Since an exact MOI is not critical (anything from one to ten will
do), we routinely assume that 1.8–2.0 108 cells are present
on each 576 cm2 plate when initiating the infection, but this
286 Roger Lippé
should at least be checked once in your own laboratory

settings.
7. Depending on your physical set up, this can also be done on the
bench, sealing the plates to avoid drastic changes to the pH due
to the lack of CO2 or by using CO2 independent medium.
8. This is essential as abundant serum protein can otherwise mask
proteins of interest.
9. The appropriate timing should be optimized for your cell type
or batch of cells. The aim is to get 90–100% cytopathic effect
and harvest the virus from the extracellular milieu before the
cells substantially lyse.
10. Ten-microliter aliquots should be taken throughout the proto-
col to monitor the purification (by silver staining, Western
blotting and/or EM).
11. In our hands, the 250 nm viruses efficiently pass through
0.45 μm filters with minimal losses in yields.
12. In our lab, we use a JA25.50 rotor. This is to concentrate the
virus prior to DNase I digestion and loading of the subsequent
Ficoll gradient.
13. The most effective way is to pour out the DMEM and leave the
tube upside down until all liquid is dried up, drying the rim of
the cell wall with a Kimwipes to save time. The viral pellet
should firmly stay attached to the tube. We do not recommend
using suction since the pellet can be very small and aspirated.
14. This is necessary to digest any genomic DNA (cellular and
viral) that may have been released upon cell lysis and which
can cause significant viscosity in the sample. While the enzyme
works best at 37 C, we found that it is nevertheless active at
4 C, an optimal temperature to preserve the samples. Alterna-
tively, 10 C may also be used.
15. We use a SW41 rotor for this step. In the traditional protocol
using a 5–15% Ficoll linear gradient, the light and heavy parti-
cles form two bands (top and bottom respectively) [16]. In the
present modified step gradient, L-particles float at the interface
of the overlay and the Ficoll while the heavier virions end up in
the pellet.
16. If using a traditional 5–15% Ficoll gradient, the virions (lower
band) should be collected and pelleted at 20,000 g for 30 min
before the next step.
17. These procedures are best done by your local mass spectrome-
try service because of standardized gels, automated gel cutting,
and preestablished treatment conditions. If desired, one can
still run and stain gels and hand out cut bands to a proteomics
service unit. In that case, great care should be used to avoid the
all too common skin/hair contamination (use of hair net,

white coat, gloves and clean bench).
18. We use a fast silver nitrate staining protocol [17]. Avoid the
silver ammonia protocols since they are apparently incompati-
ble with mass spectrometry. More recently, we directly analyze
the samples by liquid chromatography without resorting
to gels.
19. Viral capsid components should be visible (e.g., VP5, VP19c,
and VP23).
20. Gel slicing is required since extracellular virions are complex
samples from which you want to identify all proteins. As men-
tioned above, this is best done by a robotic system at your local
MS facility.
21. As silver staining interferes with mass spectrometry, destaining
is essential. One efficient protocol is the one described by
Gharahdaghi et al. using ferricyanidethiosulfate [18].
22. These instruments are ever evolving and becoming more sensi-
tive. Talk to your local MS people!
23. If you are interesting in identifying the total protein content of
the virions, including host proteins that may be incorporated in
the viral particles, a combined tryptic nonredundant human
and HSV-1 database should be used for the best possible
peptide assignments.
24. Scaffold (Proteome Software Inc.) is a useful format to get your
data back from the mass spectrometry service unit. Thereafter,
you will need to perform an analysis of the identified samples to
define the next experimental steps and ultimately validate the
protein hits. At the moment, we use the Ingenuity Pathways
Analysis software and database (Ingenuity® Systems) [7]. How-
ever, many other ever evolving bioinformatics tools exist (e.g.,
KEGG, Gene Ontology, DAVID, MetaCore, GproX, Perseus,
and many others) [19–22].
Acknowledgments
This work was supported by grants from the Canadian Institutes of

Health Research (MOP 82921 and MOP 258030). Special thanks
to Kerstin Radtke and Nabil El Bilali for proofreading and Christina
Bell for the mass spectrometry protocols.
References
1. Viswanathan K, Fruh K (2007) Viral proteo- interaction with the host. Expert Rev Proteo-
mics: global evaluation of viruses and their mics 4:815–829
288 Roger Lippé
2. Munday DC, Surtees R, Emmott E et al 1-infected cells reveals dynamic changes of viral
(2012) Using SILAC and quantitative proteo- protein expression, ubiquitylation and phos-
mics to investigate the interactions between phorylation. J Proteome Res 12:1820–1829
viral and host proteomes. Proteomics 14. Cox J, Mann M (2008) MaxQuant enables
3. Ma-Lauer Y, Lei J, Hilgenfeld R et al (2012) high peptide identification rates, individualized
Virus-host interactomes–antiviral drug discov- p.p.b.-range mass accuracies and proteome-
ery. Curr Opin Virol 2:614–621 wide protein quantification. Nat Biotechnol
4. Zhou S, Liu R, Zhao X et al (2011) Viral 26:1367–1372
proteomics: the emerging cutting-edge of 15. Cox J, Matic I, Hilger M et al (2009) A practi-
virus research. Sci China Life Sci 54:502–512 cal guide to the MaxQuant computational plat-
5. Leroy B, Gillet L, Vanderplasschen A et al form for SILAC-based quantitative
(2016) Structural proteomics of Herpes- proteomics. Nat Protoc 4:698–705
viruses. Viruses 8 16. Szilagyi JF, Cunningham C (1991) Identifica-
6. Greco TM, Cristea IM (2017) Proteomics tion and characterization of a novel
tracing the footsteps of infectious disease. Mol non-infectious herpes simplex virus-related
Cell Proteomics 16:S5–S14 particle. J Gen Virol 72:661–668
7. Lippé R (2012) Deciphering novel host–her- 17. Chevallet M, Luche S, Rabilloud T (2006)
pesvirus interactions by virion proteomics. Silver staining of proteins in polyacrylamide
Front Microbio 3:1–14 gels. Nat Protoc 1:1852–1858
8. Malouli D, Nakayasu ES, Viswanathan K et al 18. Gharahdaghi F, Weinberg CR, Meagher DA
(2012) Reevaluation of the coding potential et al (1999) Mass spectrometric identification
and proteomic analysis of the BAC-derived of proteins from silver-stained polyacrylamide
rhesus cytomegalovirus strain 68-1. J Virol gel: a method for the removal of silver ions to
86:8959–8973 enhance sensitivity. Electrophoresis
9. Engel EA, Song R, Koyuncu OO et al (2015) 20:601–605
Investigating the biology of alpha herpes- 19. Nikolsky Y, Nikolskaya T, Bugrim A (2005)
viruses with MS-based proteomics. Proteomics Biological networks and analysis of experimen-
15:1943–1956 tal data in drug discovery. Drug Discov Today
10. Loret S, Guay G, Lippé R (2008) Comprehen- 10:653–662
sive characterization of extracellular herpes 20. Kanehisa M, Goto S, Furumichi M et al (2010)
simplex virus type 1 virions. J Virol KEGG for representation and analysis of
82:8605–8618 molecular networks involving diseases and
11. Stegen C, Yakova Y, Henaff D et al (2013) drugs. Nucleic Acids Res 38:D355–D360
Analysis of virion-incorporated host proteins 21. Ashburner M, Ball CA, Blake JA et al (2000)
required for herpes simplex virus type 1 infec- Gene ontology: tool for the unification of biol-
tion through a RNA interference screen. PLoS ogy. The gene ontology consortium. Nat
One 8:e53276 Genet 25:25–29
12. Khadivjam B, Stegen C, Hogue-Racine MA 22. Huang d W, Sherman BT, Lempicki RA (2009)
et al (2017) The ATP-dependent RNA helicase Systematic and integrative analysis of large gene
DDX3X modulates herpes simplex virus type lists using DAVID bioinformatics resources.
1 gene expression. J Virol 91:e02411–e02416 Nat Protoc 4:44–57
13. Bell C, Desjardins M, Thibault P et al (2013)
Proteomics analysis of herpes simplex virus type
Chapter 16
Analysis and Sorting of Individual HSV-1 Particles

by Flow Virometry
Bita Khadivjam, Nabil El Bilali, and Roger Lippé
Abstract
Flow cytometry has been instrumental in characterizing normal and infected cells. However, until recently,
it was not possible to use such an approach to analyze small entities such as bacteria, let alone viruses, owing
to the 0.5 μm resolution of most instruments. To circumvent this limitation, some laboratories decorate
pathogens with antibodies or nanoparticles. Our laboratory instead exploits an alternative approach that
relies on the staining of internal viral constituents with permeable SYTO dyes or the fluorescent tagging of
individual viral proteinaceous components, whether capsid, tegument or glycoproteins. This opens up a
range of new research avenues and, for example, enabled us to characterize individual herpes simplex virus
type 1 particles, discern their different subpopulations, measure the heterogeneity of mature virions in
terms of protein content, sort these viral particles with >90% purity and, for the first time, directly address
the impact of this heterogeneity on viral fitness. This approach, coined flow virometry or nanoscale flow
cytometry, allows for the study of a wide variety of pathogens with high statistical significance and the
potential discovery of novel virulence factors.
Key words HSV-1, Herpes, Flow cytometry, Flow virometry, Nanoscale flow cytometry, Sorting,
Purification, Analysis
1 Introduction
Infecting cells with a virus generally leads to the production of a

variety of viral particles, many of which are defective [1, 2]. Among
infectious virions, one can additionally note heterogeneity in terms
of their protein content [3–6]. Given that this can influence viral
fitness, it is a definite advantage to individually monitor viral parti-
cles. However, typical assays that define the composition of viruses
such as Western blotting or classical biochemical purification meth-
ods traditionally probe bulk populations. On the other hand, while
one can discern viral particles by immunofluorescence or electron
microscopy, it is not possible to ascertain their respective biological
activities. Consequently, a correlation between finite protein
289
290 Bita Khadivjam et al.
content variations and fitness has been difficult to evaluate in the

past and rather relied on deletion mutants.
A powerful approach to study individual cells is flow cytometry.
It has been instrumental in characterizing and sorting, for example,
subpopulations of immune cells to reveal their specific functions
[7]. Until recently, flow cytometry was deemed impractical with
viruses due to the stated limits of most flow cytometers, often in the
half-micron range, which is above the size of most viruses. How-
ever, recent developments and novel labeling methods have
stretched this lower limit of detection and now enable viral particle
characterization [8]. Here we report methods to analyze and sort
individual viral particles by flow cytometry, a technique also
referred to as flow virometry or nanoscale flow cytometry
[9, 10]. The nascent and expanding posting of papers in PubMed
using this technology suggests it will be a method of choice to
individually characterize small pathogens and particles (i.e.,
exosomes).
Several key features of flow virometry are relevant. Most criti-
cally, one can readily distinguish fluorescent viral particles from the
similarly sized background elements. It is also a powerful method
for a single-step purification of specific viral particles to high purity
(>90%), for example specific viral intermediates or subgroups
[11, 12] (Khadivjam et al. personal communication). Moreover,
the heterogeneity of individual viral particles or their maturation
can be assessed with high statistical accuracy as hundreds of
thousands of individual viral particles can be processed [6, 9,
13–16]. Perhaps most importantly, the method preserves the via-
bility of the samples and thus accesses the infectivity of specific
subgroups of viral particles [6, 11, 12]. Finally, it can be performed
on standard flow cytometers present in most facilities [8]. Some
limitations may also be noteworthy to mention, for instance some
sample loss caused by the sorting process and the inability to
precisely size these small particles or define the absolute stoichiom-
etry of fluorescently tagged viral components.
Flow virometry can be undertaken with a variety of approaches.
For instance, some protocols externally decorate viruses with anti-
bodies or nanoparticles, but this can impact their infectivity [9, 12,
14–18]. To minimize this issue, we instead rely on viral genomes
that are stained with the SYTO 13 or 61 nuclei acid dyes or on viral
particles expressing genetically labeled constituents (e.g., fluores-
cently tagged capsid, tegument, or envelope proteins) [6, 11]
(El Bilali et al. submitted). This chapter details the aforementioned
methods including the preparation of samples, labeling of the viral
particles with fluorescent dyes and analysis/sorting on a standard
BD FACSAria II flow cytometer. This chapter also pinpoints some
technical aspects to reduce the background signals associated with
the small particles found in the sheath fluid and samples to enable
the positive identification of the viral particles (i.e., prefiltration,
gating strategy; Fig. 1). It also reports the means to probe
Characterization of HSV-1 Particles by Flow Virometry 291
Fig. 1 Analysis of individual viruses by flow cytometry. Several steps are critical for the analysis of individual
viral particles by flow cytometry. Following the infection of cells in tissue culture dishes, the cells or medium
are harvested and the viral particles partially enriched and concentrated. For nuclear capsids, this typically
involves a 20%–50% sucrose gradient to separate A-, B-, and C-nuclear capsids, while for the extracellular
virions, the samples are filtered through a 0.45 μm filter and concentrated by ultracentrifugation. Samples are
coincidental events to insure that single viral particles are moni-

tored (diluted samples, low flow rate and pressure, large nozzle)
and measure the thermal stability of the virions (heating of sam-
ples). Interestingly, the proposed methods herein work equally well
with enveloped and nonenveloped viral particles [6, 11]. Further-
more, while focusing on herpes simplex virus type 1 (HSV-1), they
should be adaptable to other viruses with either RNA or DNA
based genomes and thus be useful to various virology fields.
2 Materials
It is preferable that the HSV-1 stocks be relatively fresh (i.e., a

maximum of a few days before sorting) as this improves final yields.
The infection step for preparing either extracellular virions or
nuclear capsids is identical and therefore requires the same
materials.
2.1 Generation 1. Cells (see Note 1).

of HSV-1 Extracellular 2. RPMI-1640 medium supplemented with 0.2 μm filtered 0.1%
Virions and Nuclear bovine serum albumin (BSA).
Capsids
3. HSV-1 wild-type or recombinant virus (optionally expressing a
fluorescent structural protein (see Note 2)).
4. Complete DMEM: Dulbecco Modified Eagle’s Medium
(DMEM), high-glucose supplemented with 1% L-glutamine,
5% HI-FBS, and 1% penicillin–streptomycin antibiotics. Store
at 4 C.
5. Phosphate-buffered saline (PBS 1): 137 mM NaCl, 2.7 mM
KCl, 2 mM KH2PO4, 10 mM Na2HPO4. Adjust the pH to 7.4
and filter through a 0.2 μm filter. Autoclave and store at 4 C.
6. 0.45 μm pore size Millex-HV Syringe Driver Filter Unit.
7. DNase I solution: 10 mg/mL DNase I prepared in 20 mM
Tris–HCl, 1 mM MgCl2, and 50% glycerol, pH 7.5.
8. RNase A solution: Prepare a stock solution of 25 mg/mL
RNase A from bovine pancreas in molecular grade water.
9. MNT buffer: 30 mM MES, 100 mM NaCl, 20 mM Tris–HCl
(pH 7.4), 0.2 μm filtered. Autoclave and store at 4 C.
ä
Fig. 1 (continued) then appropriately diluted to ensure limited events/s through the flow cytometer and
low-pressure conditions used to minimize simultaneous events and maximize detection. Gating is critical to
eliminate the background signal, as is the positive selection of the GFP or SYTO 13-labeled viral particles. An
optional strategy makes use of a dual GFP/SYTO 61 labeling to remove light viral particles, which are
biologically active but devoid of viral DNA and capsids [19]. Most important, sorted particles retain their
activity and can be tested using a variety of assays, including those that monitor viral fitness (e.g., plaque
assays). The critical steps of this protocol are indicated in green in the figure
10. Pretreated MNT buffer: Add the DNase I at the final concen-
tration of 500 U/mL and the RNase A at the final concentra-
tion of 2 mg/mL to MNT buffer and incubate at 37 C for
15 min. Store at 4 C (see Note 3).
11. Lysis buffer: 10 mM Tris (pH 7.4), 150 mM NaCl, 2 mM
MgCl2, 1 mM EDTA, 1% Igepal, 5 mM dithiothreitol (DTT),
and protease inhibitors as per the manufacturer’s instructions
(see Note 4).
12. Modified TNE: 20 mM Tris (pH 7.5), 150 mM NaCl, 1 mM
EDTA, 0.2 μm filtered. Store at 4 C (see Note 5).
13. Sucrose solutions: 20%, 35%, and 50% (w/w) sucrose in mod-
ified TNE, 0.2 μm filtered. Store at 4 C.
14. Gradient forming apparatus. We use a Biocomp Instruments
gradient maker.
15. Cup horn ultrasonic homogenizer.
16. Pierce™ BCA Protein Assay Kit.
17. Polyallomer centrifuge tubes.
18. Ultracentrifuge.
2.2 Staining 1. SYTO 13 or 61 fluorescent nucleic acid stains (5 mM in

of the Viral Particles DMSO) (see Note 6).
with SYTO 2. Pretreated MNT buffer.
2.3 Sorting of HSV-1 1. BD FACSAria II cell sorter (or equivalent).

Virions and Capsids 2. Falcon round-bottom polystyrene tubes.
3. Ultracentrifuge.
4. MNT buffer.
2.4 Electron 1. Fixation buffer: 2% glutaraldehyde in 0.1 M sodium phosphate

Microscopy of Sorted buffer (PB, pH 7.3).
Particles 2. 13 mm Swinney stainless steel filter holder (EMD Millipore).
3. 0.1 μm pore size Omnipore PTFE hydrophobic membrane
filter (EMD Millipore).
4. Post-fixation buffer: 1% OsO4 in PB (pH 7.3).
5. Hexagonal 200-mesh Nickel (Ni) grids (Canemco-Marivac).
6. Epon 812 resin (Mecalab).
7. Ultracut S ultramicrotome (Leica).
8. Negative staining solution: 3% w/v uranyl acetate aqueous
solution (Mecalab).
9. Transmission electron microscope (we have a Philips CM100
transmission electron microscope equipped with an AMT
XR80 digital camera).
3 Methods
When working with infectious viral particles, all steps need to be

carried out under a biosafety level 2 certified biological hood.
Where possible freeze–thaw cycles of viral stocks should be avoided.
We use two different approaches to fluorescently label the particles.
In the first case, we employ viruses that genetically code for fluores-
cent virion components (e.g., GFP capsid, tegument, or envelope
proteins). In the second scenario, we label the viral genome with a
SYTO dye after the particles have been produced and immediately
prior to FACS analysis or sorting. Note that it is possible to perform
a dual labeling (GFP and SYTO) depending on your experimental
needs. In that case, the proper SYTO should be chosen to avoid
overlapping excitation/emission spectra. As SYTO dyes are mem-
brane permeable, one can use them with unenveloped and envel-
oped viral particles.
3.1 Infection 1. One day before the infection, seed cells in a concentration that
with HSV-1 will yield enough cells at the time of infection (see Note 7).
2. Warm up the PBS 1 and RPMI-0.1% BSA in a 37 C water
bath for 15–30 min.
3. Dilute the appropriate virus stock with a known titer in RPMI-
0.1% BSA to infect the cells at the multiplicity of infection
(MOI) of 5 (see Note 8).
4. Wash the cells twice with PBS 1.
5. Add the RMPI-0.1% BSA containing virus on the cells in a
dropwise manner and incubate them at 37 C with gentle
shaking for an hour to allow the adsorption of the virus.
6. Twenty minutes before the end of adsorption, warm up the
complete DMEM to 37 C.
7. At the end of the adsorption period, add the warmed up
complete DMEM to the cells and incubate at 37 C for 24 h.
8. The next day, carefully examine the infected cells under a light
microscope and take note of signs of infection (see Note 9).
3.2 Purification 1. Collect the cell medium without disrupting the cell layer and
of Extracellular Viral spin at 500 g for 5 min at 4 C to remove the cell debris.
Particles (If Desired) 2. Transfer the supernatant to a new tube and filter through a
0.45 μm filter (see Note 10).
3. Spin the filtered supernatant at 20,000 g for 1 h at 4 C.
4. Carefully remove the supernatant by inverting the tube, keep
the tube inverted for a few seconds to entirely remove the
supernatant.
5. Resuspend the pellet in a minimum amount of MNT or pre-

treated MNT depending on whether you are concentrating
a wild-type or a fluorescently tagged virus, respectively (see
Notes 11 and 12).
6. Incubate the tubes at 4 C overnight (see Note 13).
7. Transfer the resuspension containing virus to a new tube.
8. Sonicate the virus stock to break up all the aggregates (see
Note 14).
9. Aliquot the stock in small sample sizes. Store at 80 C.
10. Titer the stock, as described in Chapter 3 of this book, to
measure the level of infectious particles in the prepared viral
stocks.
3.3 Extraction 1. Remove the supernatant and wash the cells in cold PBS
of Nuclear Capsids 1 once.
(If Desired) 2. Scrape the cells in cold PBS 1 and count them using a
hemocytometer.
3. Spin the cells at 500 g for 5 min at 4 C.
4. Resuspend the pellet in the lysis buffer at the concentration
of 107 cells/mL and incubate on ice for 15 min (see Notes 15
and 16).
5. Pellet the nuclei at 500 g for 10 min at 4 C.
6. Resuspend the nuclear pellet in 10 mL of modified TNE and
transfer to a new tube (see Note 17).
7. Perform three freeze–thaw cycles to break the nuclei open.
8. Pass the nuclear lysate through an 18 G1/2 needle once and
then three times through a 27 G1/2 needle to shear the
genomic DNA.
9. If very viscous, mildly sonicate the nuclear extract to shear the
DNA (see Notes 14 and 18).
10. Treat the nuclear extract with DNase I (500 U/mL) and
incubate for 1 h at 10 C (see Note 19).
11. Spin the nuclear extract at 2500 g for 10 min at 4 C. The
supernatant contains the capsid mixture.
12. Overlay the 10 mL of capsid mixture on 1.5 mL of 35% w/w
sucrose cushion and spin at 100,000 g for 1 h at 4 C.
13. Resuspend the pellet in 200–400 μL of MNT.
14. Make a continuous 20–50% w/w sucrose gradient with a gra-
dient maker apparatus (see Note 20).
15. Overlay the resuspended pellet from step 13 on the sucrose
gradient and centrifuge at 100,000 g for 1 h at 4 C.
16. Harvest the three bands corresponding to A-, B-, and

C-capsids (see Note 21).
17. Add at least an equal volume of MNT to dilute the sucrose.
18. Spin the diluted bands at 100,000 g for 1 h at 4 C to
concentrate the capsids and remove the excess of sucrose.
19. Resuspend the capsids in 20–40 μL of MNT and incubate at
4 C overnight.
20. Perform BCA protein assays as per the manufacturer’s instruc-
tions to determine the concentration of capsid stocks (see
Note 22).
21. Aliquot the stock in small sample sizes. Store at 80 C.
3.4 Staining 1. Briefly spin the tube containing the SYTO dye and take the
of Capsids or desired volume.
Extracellular Viruses 2. Dilute the SYTO stain in pretreated MNT (RNA and DNA
with SYTO Dyes free) in a 1:10 ratio and store on ice (Note 23).
(Optional) 3. If staining extracellular virions, dilute the extracellular viral
stock containing 108 PFU in 499 μL with pretreated MNT. If
staining capsids, dilute each 8 μg of C-capsids in 499 μL with
pretreated MNT. Store the samples on ice.
4. Add 1 μL of the 1:10 diluted SYTO stain to the viral or capsid
suspension and gently mix up and down several times, avoiding
vortexing as it might disrupt the viral particles.
5. Incubate the tubes on ice for an hour in the dark (see Notes 24
and 25).
6. In parallel, dilute 1 μL of 1:10 SYTO in 499 μL of pretreated
MNT and incubate on ice for an hour. This will serve as a
negative control to set the parameters later in FACS.
3.5 Preparation 1. Extracellular viral stocks that contain an already tagged virus
of Virus Expressing (see Note 26) should be 108 PFU in 500 μL MNT. Store
a Fluorescently on ice.
Tagged Protein 2. An untagged extracellular viral stock should be diluted at the
(Alternative to SYTO) same concentration in MNT as a negative control.
3.6 FACS Analysis/ 1. The analysis is performed on a FACSAria II sorter

Sorting of Viral (BD Biosciences) equipped with a 100 μm nozzle and
Particles 405, 488, and 633 nm lasers.
2. Analysis and sorting are done in PBS 1 at low pressure
(23 psi) and a flow rate between 1 and 3 for a maximum of
3000 events/s to minimize coincidental events.
3. A minimal threshold of 200 for the SSC channel should be
applied to remove the background signal (see Note 27).
4. Viral particles (capsids or extracellular virions) are initially ana-

lyzed by light scattering, where the forward scatter (FSC) is an
indication of the size of the particles and side scatter (SSC)
indicates the granularity and the internal complexity of these
particles.
5. A gate should be applied on the bulk of the particles (>95%) to
exclude large aggregates.
6. A second gate should next be applied to sort the fluorescent
particles (see Note 28).
7. To favor the sorting of single particles, a purity mask of
16 should be applied (i.e., sorting in purity mode).
8. Analyze the data with FlowJo software (TreeStar) (see
Note 29).
3.7 Analysis When analyzing or sorting samples by flow cytometry, one must
of Coincidental Events ensure that single cells or particles are characterized. Proper sample
preparation and gating are critical to avoid aggregates and doublets,
as is the use of the purity mode when sorting. To control for the
passage of two particles at the same time in the flow cytometer,
diluting the samples is an effective method, hence our limit of 3000
events/s. A classical assay to monitor coincidental events is to
perform a dilution analysis [6, 20]. The assumption is that coinci-
dental events will have higher fluorescence than single events. In
contrast, while diluting single particles will reduce their frequency
(detection), it should not affect their mean fluorescence.
1. Make twofold dilutions of a viral sample (e.g., 1:50 to 1:400)
in MNT.
2. Analyze all the dilutions on a flow cytometer as usual, limiting
the analysis to 1 min per sample.
3. Plot the number of events per minute and the mean fluores-
cence intensity of the particles for each dilution (see Note 30
and Fig. 2).
3.8 Electron Electron microscopy is likely the best way to ascertain the quality of
Microscopy sorting and should routinely be used. This monitors the presence of
of the Sorted Viral aggregates or even doublets of viral particles as well as the presence
Particles of cellular debris. When probing viral intermediates such as the
different HSV-1 nuclear capsids, one can readily evaluate sample
purity.
1. Fix an aliquot of the sorted viral particles using a fresh solution
of fixation buffer and incubate on ice for 1 h.
2. Concentrate the particles by passing them through a 13 mm
Swinney stainless steel holder containing a 0.1 μm Omnipore
PTFE hydrophobic membrane filter.
Fig. 2 Analysis of coincidental events. Twofold dilutions (1:50 to 1:400 in MNT)

of two different viral preparations were analyzed by FACS, limiting the analysis to
1 min per sample. The number of events per minute and the mean fluorescence
intensity (MFI) of the particles at each dilution were plotted using GraphPad
Prism version 6 (Reprinted with permission from [6] [Copyright © 2017, Ameri-
can Society for Microbiology, Journal of Virology, Vol. 91, 2017, p. e00320–17,
doi: https://doi.org/10.1128/JVI.00320-17])
3. Open the Swinney stainless steel holder and take off the filter
containing the sorted particles.
4. Wash the filter with PB and incubate it in postfixation buffer for
1 h at 4 C.
5. Rinse the filter with PB.
6. Dehydrate the filter using increased concentrations of ethanol.
7. Embed the filter in Epon 812 resin.
8. Make ultrathin sections of filter containing viruses using a
microtome.
9. Place the filter on naked nickel grids.
10. Contrast the grids using negative staining solution.
11. Examine samples on a transmission electron microscope.
3.9 Thermostability Sorting of different viral subpopulations such as viruses containing

of the Sorted Viral high or low amounts of a given constituent (e.g., capsid, tegument,
Particles or envelope protein) brings up the question as to whether they may
exhibit different stability. In the case of fully assembled virions, it is
readily possible to test this scenario by heating the samples. While
Fig. 3 Thermostability of the viral particles. Wild type extracellular virions

expressing GFP-VP22 (a tegument protein) were sorted for the high or low
content. Each was further divided into 3 fractions. The fractions were
incubated as follows: at 4 C (untreated samples), 37 C (test samples) or
60 C (inactivating controls) for an hour. The samples were then titrated on
Vero cells to assess their stability. As expected, no infectivity was recorded at
60 C (data not shown). The recovery of the two samples was identical at
83%–85% (37 C/4 C). The lower infectivity of the two samples reflects the
impact of VP22 on viral fitness, as previously reported [6]
heating does reduce the viability of a viral sample, if two samples

behave the same in that assay, then they are equally stable. Figure 3
shows the result of such an assay for viruses selected for their high
or low content of one of the viral tegument proteins.
1. Sort viral particles as detailed in the above sections.
2. Divide each sample into 3 fractions.
3. Incubate each fraction for an hour at 4 C (untreated samples),
37 C (test samples) or 60 C (inactivating controls).
4. Titrate the fractions as usual.
4 Notes
1. Given the higher viral productivity in Vero or BHK cells, we

typically use these cells to produce our viral stocks. However, if
the experiment requires the analysis of human proteins
incorporated by viral particles, we instead resort to HeLa cells.
2. When infecting cells to prepare nuclear capsids use a wild-type

virus. Later, you must perform SYTO staining to distinguish
between the capsids containing the viral DNA (C-capsids) and
the ones devoid of the viral genomic material (A- and
B-capsids).
3. Pretreatment of MNT with DNase and RNase A ensures the
elimination of potential nucleic acid residues in the buffer
which otherwise cause false positives during FACS analysis.
4. Add the 5 mM DTT and the proper concentration of protease
inhibitors to the lysis buffer immediately before use.
5. Conventional TNE solutions contain 500 mM NaCl salt, how-
ever, following the optimization of our nuclear capsid purifica-
tion procedure we have determined that this salt concentration
can lead to the loss of tegument proteins during the extraction.
Therefore, we have switched to a milder concentration of NaCl
(150 mM) and called the solution modified TNE.
6. Following the optimization of our labeling technique using
different dyes, we have found that staining the viral genomic
material with SYTO 13 (green fluorescent) or SYTO 61 (red
fluorescent) provides a better signal-to-noise ratio compared to
Hoechst, DAPI, propidium iodine or other SYTO stains. We
typically freshly prepare the SYTO dyes.
7. As mentioned earlier in Note 1, viral yield varies depending on
the type of cells used to produce the viral stocks. We have
determined that about 1.5 108 Vero cells can produce suffi-
cient amounts of extracellular virus or capsids for FACS analy-
sis. However, if you are using HeLa cells 3 108 are required
to produce enough viral particle for sorting. If one decides to
use another cell line other than the ones mentioned, the opti-
mal number of cells have to be determined empirically.
8. The formula is:
Volume required ðmLÞ ¼ ðQuantity of cells MOIÞ=Viral titer ðPFU=mLÞ
9. Signs of infection include rounding of cells, the presence of
intracellular granules, irregular shape nuclei and detachment of
the cells from the tissue culture plate.
10. Filtering the supernatant through a 0.45 μm filter significantly
reduces the amount of debris that could later interfere with the
flow cytometer and result in unwanted background signal. This
also leads to cleaner preparations.
11. Minimum amount of MNT for resuspension is a volume suffi-
cient to cover the area where viral pellet is expected to be
present. Note that this pellet is generally not visible and the
position of pellet depends on the whether a fixed angle or a
swinging bucket rotor was used for centrifugation.
12. If the SYTO staining of the viral particles is required, DNase I

and RNase A treatment of MNT is necessary to remove all free-
floating nucleic acids as they will be labeled with the dye and
result in a background signal. Conversely, if the viral particles
encode a fluorescent tag, DNase I and RNase A treatments are
optional but not mandatory.
13. Incubating the pellet overnight with resuspension buffer
ensures an optimal resuspension and increases yields.
14. We are using the Fisherbrand sonicator with Micro Cup Horn
(intensity 8) and sonicate our stocks for 1 s, ten times on ice. If
you are using a different device, you might need to adjust the
parameters empirically.
15. Gently perform several ups and downs when resuspending the
cell pellet in the lysis buffer until no clumps are visible. Avoid
rapid up and down motions as the presence of detergent (Ige-
pal) in the lysis buffer can cause foaming.
16. Verify the cell lysis every 5 min under a light microscope by
placing 10 μL of the lysate on a microscopic slide. The nucleus
should remain intact throughout the lysis procedure.
17. It is possible to pause the experiment at this point. The nuclear
stocks should be snap-frozen in liquid nitrogen and conserved
at –80 C for several weeks.
18. It has been shown that 3 s of sonication can lead to partial
tegument loss [21]. When capsid yields are already low, which
depends on the type of cell used to produce the stocks as
mentioned in Note 7, sonication can be problematic. There-
fore if the focus of the study is the tegument layer and one is
using a cell line with low viral productivity, the sonication step
should probably be skipped.
19. Modified TNE contains EDTA that chelates bivalent ions.
Therefore, when treating with DNase I, add 20 mM MgCl2
as the Mg2+ ions are required for DNase I activity.
20. Use thin transparent wall tubes compatible for ultracentrifuga-
tion as these tubes enable the visualization of capsid bands.
21. When collecting the capsid bands, extra care should be taken to
minimize the contamination of each band by the other bands.
It is possible to harvest these bands by puncturing the tube
with a syringe and needle. Another method to collect the bands
is using a peristaltic pump. In the latter case, it is preferable to
use a separate set of tubing for each band to avoid cross
contamination.
22. The expected yields are around 100 μg of C capsids from
1.5 108 Vero cells and 60 μg from 3 108 HeLa cells.
However, this varies for each preparation (the ratio of A, B,
and C made by virus) and viral strains.
23. SYTO dyes bind to both RNA and DNA, hence the need for
RNase treatments.
24. Since SYTO dyes are fluorescent entities, samples should be
protected from light to avoid photobleaching.
25. It is not necessary to wash out the unbound SYTO as it emits
very little fluorescence when unbound to nucleic acid.
26. The tagged virus can be a virus expressing a fluorescently
tagged capsid, tegument or an envelope protein.
27. For analyses, we typically scrutinize 100,000 particles. For
purification purposes, it may take several hours of sorting
depending on the planned use (plaque assays, mass spectrome-
try). This must be defined empirically.
28. It is possible to specifically gate out L-particles, which are
devoid of capsids and viral genomes [22], by gating on particles
that are stained with SYTO and labeled for a tegument or
envelope component [6].
29. We have found that when staining a GFP-tagged virus with
SYTO dyes more than 90% of the GFP-positive population is
also positive for SYTO, which shows the high efficiency of this
staining technique.
30. A flat line for the mean fluorescence intensity (MFI) strongly
argues against coincidental events (as illustrated in Fig. 2).
Acknowledgments
This work was supported by grants from the Canadian Institutes of

Health Research (MOP 82921). Special thanks to Diane Gingras
for the optimization of the EM protocol and Annie Gosselin for her
help with the flow cytometry section. We are also indebted to
Daniele Gagné, who initially worked out the protocol on the BD
FACSAria sorter.
References
1. Klasse PJ (2015) Molecular determinants of virions determines the distribution of the
the ratio of inert to infectious virus particles. copy number of proteins in herpes simplex
Prog Mol Biol Transl Sci 129:285–326 virus particles. Biophys J 93:1329–1337
2. Rezelj VV, Levi LI, Vignuzzi M (2018) The 5. Bohannon KP, Jun Y, Gross SP et al (2013)
defective component of viral populations. Curr Differential protein partitioning within the
Opin Virol 33:74–80 herpesvirus tegument and envelope underlies
3. Taha MY, Brown SM, Clements GB (1988) a complex and variable virion architecture.
Neurovirulence of individual plaque stocks of Proc Natl Acad Sci U S A 110:E1613–E1620
herpes simplex virus type 2 strain HG 52. Arch 6. El Bilali N, Duron J, Gingras D et al (2017)
Virol 103:15–25 Quantitative evaluation of protein heterogene-
4. Clarke RW, Monnier N, Li H et al (2007) ity within herpes simplex virus 1 particles. J
Two-color fluorescence analysis of individual Virol 91:e00320–e00317
7. Trabanelli S, Gomez-Cadena A, Salome B et al dengue virions with flow virometry. Virology

(2018) Human innate lymphoid cells (ILCs): 488:20–27
toward a uniform immune-phenotyping. Cyto- 16. Arakelyan A, Fitzgerald W, Zicari S et al (2017)
metry B Clin Cytom 94:392–399 Flow virometry to analyze antigenic spectra of
8. Lippé R (2018) Flow virometry: a powerful virions and extracellular vesicles. J Vis Exp
tool to functionally characterize viruses. J (119)
Virol 92. pii: JVI.01765-01717 17. Landowski M, Dabundo J, Liu Q et al (2014)
9. Arakelyan A, Fitzgerald W, Margolis L et al Nipah virion entry kinetics, composition, and
(2013) Nanoparticle-based flow virometry for conformational changes determined by enzy-
the analysis of individual virions. J Clin Invest matic virus-like particles and new flow virome-
123:3716–3727 try tools. J Virol 88:14197–14206
10. Tang VA, Renner TM, Fritzsche AK et al 18. Musich T, Jones JC, Keele BF et al (2017)
(2017) Single-particle discrimination of retro- Flow virometric sorting and analysis of HIV
viruses from extracellular vesicles by nanoscale quasispecies from plasma. JCI Insight 2:
flow cytometry. Sci Rep 7:17769 e90626
11. Loret S, El Bilali N, Lippé R (2012) Analysis of 19. Dargan DJ, Subak-Sharpe JH (1997) The
herpes simplex virus type I nuclear particles by effect of herpes simplex virus type 1 L-particles
flow cytometry. Cytometry A 81:950–959 on virus entry, replication, and the infectivity of
12. Gaudin R, Barteneva NS (2015) Sorting of naked herpesvirus DNA. Virology
small infectious virus particles by flow virome- 239:378–388
try reveals distinct infectivity profiles. Nat 20. Nolan JP (2015) Flow cytometry of extracellu-
Commun 6:6022 lar vesicles: potential, pitfalls, and prospects.
13. Tang VA, Renner TM, Varette O et al (2016) Curr Protoc Cytom 73:13.14.11–13.14.16
Single-particle characterization of oncolytic 21. Newcomb WW, Brown JC (2010) Structure
vaccinia virus by flow virometry. Vaccine and capsid association of the herpesvirus large
34:5082–5089 tegument protein UL36. J Virol
14. Arakelyan A, Fitzgerald W, King DF et al 84:9408–9414
(2017) Flow virometry analysis of envelope 22. Szilagyi JF, Cunningham C (1991) Identifica-
glycoprotein conformations on individual tion and characterization of a novel
HIV virions. Sci Rep 7:948 non-infectious herpes simplex virus-related
15. Zicari S, Arakelyan A, Fitzgerald W et al (2016) particle. J Gen Virol 72:661–668
Evaluation of the maturation of individual
Chapter 17
Isolation/Analysis of Extracellular Microvesicles

from HSV-1-Infected Cells
Raquel Bello-Morales and José Antonio López-Guerrero
Abstract
Extracellular vesicles (EVs) are secreted membrane vesicles, derived from endosomes or from the plasma
membrane, which have been isolated from most cell types and biological fluids. Although EVs are highly
heterogeneous and their classification is complex, two major categories can be distinguished: microvesicles
(MVs), which derive from the shedding of the plasma membrane, and exosomes, which correspond to
intraluminal vesicles released to the extracellular milieu upon fusion of multivesicular bodies (MVBs) with
the plasma membrane. Cells infected with viruses may secrete MVs containing viral proteins, RNAs and, in
some instances, infectious virions. A recent study carried out by our laboratory has shown that MVs released
by cells infected with HSV-1 contained virions and were endocytosed by naı̈ve cells leading to a productive
infection. This suggests that HSV-1 may use MVs for spreading, expanding its tropism and evading the host
immune response. Here we describe in detail the methods used to isolate and analyse the MVs released from
HSV-1-infected cells.
Key words HSV-1, Extracellular vesicles, Microvesicles, Differential centrifugation protocols
1 Introduction
Extracellular vesicles (EVs) are membrane vesicles secreted by most

cell types and isolated from most biological fluids that play signifi-
cant roles in intercellular communication and also in numerous
physiological and pathological processes, such as viral infections
and immune responses [1–6]. EVs are highly heterogeneous and,
therefore, their classification and nomenclature is complex. How-
ever, two major categories can be distinguished: microvesicles
(MVs)—derived from the shedding of the plasma membrane
[7–9] and exosomes—the intraluminal vesicles released to the
extracellular space upon fusion of multivesicular bodies (MVBs)
with the plasma membrane [2, 7]. Regarding the size, exosomes
are typically 30–100 nm in diameter while MVs have a more
heterogeneous size, spanning from 100 nm to 1 μm in diameter
[5, 10].
305
306 Raquel Bello-Morales and José Antonio López-Guerrero
Exosomes are enriched in tetraspanins such as CD9, CD63,

and CD81, and also in endosomal markers such as ALIX and
TSG101, whereas MVs are enriched in lipid raft proteins such as
flotillin-1 and expose phosphatidylserine on the outer leaflet of the
membrane [11–14].
Due to their common biogenesis pathways, EVs and viruses
have been considered close relatives [15] and, certainly, EVs seem
to function as an important system of intercellular communication
between infected and uninfected cells, acting as relevant elements in
the course of viral infections [3, 4, 16–20]. During the viral life
cycle, EVs may perform processes with contrasting effects, such as
the inhibition or the promotion of infection, and they may also
modulate the immune responses [3]. EVs may also transport viral
genomes to target cells and interfere with cell physiology to facili-
tate infection [21].
The production of secreted vesicles by cells infected with
HSV-1 has been well described. The first to be discovered were
the L-particles, vesicles similar to virions but lacking the viral
nucleocapsid and genome [22]. Although L-particles are noninfec-
tious, they seem to facilitate HSV-1 infection, since these particles
deliver viral proteins and cellular factors required for virus replica-
tion and immune evasion [23, 24]. On the other hand, cells
infected with HSV-1 may secrete exosomes carrying viral RNA
and stimulator of IFN genes (STING) to uninfected cells [25]. A
recent study carried out in our laboratory [26] has shown that MVs
released by HSV-1-infected cells contained virions and were endo-
cytosed by naı̈ve cells—even in the absence of specific viral recep-
tors—leading to a productive infection. This suggests that HSV-1
may use MVs for dissemination, expanding its tropism, and evading
the host immune responses. Here we describe in detail the methods
to isolate MVs secreted by HSV-1 infected cells and the different
approaches to analyse them.
2 Materials
2.1 Viral Infections 1. Fetal bovine serum (FBS), sterile filtered.

2. Millex sterile syringe filters, 0.22 μm (Millipore).
3. Sterile Falcon Tissue Culture Flasks (175 cm2), polystyrene,
vented cap.
4. Growth medium (GM): Dulbecco’s Modified Eagle’s Medium
(DMEM) low glucose supplemented with 1000 mg/l glucose,
L-glutamine, 50 U/ml penicillin, 50 μg/ml streptomycin,
3.57 g/l HEPES, 1.5 g/l sodium bicarbonate, and 10% FBS.
5. Differentiation medium (DM): Low-glucose DMEM contain-
ing 50 U/ml penicillin, 50 μg/ml streptomycin, 50 μg/ml
Microvesicles from HSV-1-Infected Cells 307
apo-transferrin, 0.5 mg/l insulin, 30 nM triiodothyronine

(T3), 30 nM sodium selenite, and 16.1 mg/l putrescine.
Briefly before use, add 3-isobutyl-1-methylxanthine (IBMX)
and dibutyryl cyclic-AMP (dbcAMP)—an inhibitor of cAMP
and cGMP phosphodiesterases—to a final concentration of
0.5 mM each.
6. PBS: 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and
1.8 mM KH2PO4; pH 7.4.
7. HSV-1 strain F [26].
2.2 Isolation of MVs 1. Allegra X-12R swinging-bucket rotor (Beckman Coulter).

2. Polycarbonate bottles with screw cap (30 ml).
3. F0630 fixed-angle rotor (Beckman Coulter).
2.3 Analysis of MVs 1. Micro tubes, 2 ml.

by Nanoparticle 2. Hank’s Balanced Salt Solution (HBSS).
Tracking Analysis
3. NanoSight LM10 system (NanoSight, Wiltshire, UK),
(NTA)
equipped with fast video capture and particle-tracking soft-
ware. Videos are collected and analysed using the NTA soft-
ware, version 2.3.
4. BD Emerald™ 2 ml syringe.
2.4 Analysis of MVs 1. RIPA buffer: 50 mM Tris–HCl pH 7.4, 150 mM NaCl, 1%

by SDS-PAGE NP-40, 0.5% sodium deoxycholate, 0.1% SDS.
2. Materials (reagents, instruments, and equipment) for SDS–po-
lyacrylamide gel electrophoresis (SDS-PAGE) as described
[27, 28].
3. Fixed-angle Eppendorf™ microcentrifuge 5424 R.
4. 5 Laemmli buffer: 10% SDS, 50% glycerol, 0.25% bromophe-
nol blue, and 250 mM Tris–HCl pH 6.8. Before use add
2-mercaptoethanol to a final concentration of 12.5%.
5. Phenylmethanesulfonyl fluoride (PMSF).
6. Protease inhibitor cocktail in DMSO.
7. Micro tubes, 1.5 ml.
2.5 Staining MVs 1. PKH26 Red Fluorescence Cell Linker Mini Kit for General Cell
with PKH26 Membrane Labelling (Sigma).
2. Sterile 5 ml test tubes.
3. Round glass coverslips ;12 mm.
4. 4% paraformaldehyde (PFA).
5. Sterile 24-well tissue culture plates.
2.6 Electron 1. 5 mM EDTA in PBS.

Microscopy 2. 2% PFA in PBS.
3. Glow-discharged collodion/carbon coated copper grids.
4. 1% uranyl acetate in distilled H2O.
5. 0.1% saponin in PBS.
6. Rabbit polyclonal anti-HSV-1 antibody.
7. Protein A-gold, 10 nm (Cell Microscopy Center, Utrecht
University, The Netherlands).
8. 1.8% methyl cellulose in distilled H2O.
9. 4% PFA and 2% glutaraldehyde in 0.1 M phosphate buffer
(PB) pH 7.4.
10. 1% osmium tetroxide (OsO4) and 1% potassium ferricyanide
(K3Fe(CN)6) in distilled H2O.
11. Epoxy, TAAB 812 Resin (TAAB Laboratories).
12. 0.1% lead citrate.
3 Methods
According to previous studies, the relative centrifugal force set to

isolate MVs ranges from 10,000 to 20,000 g [29–31]. In our
study, we have followed a widely used protocol based on a centrifu-
gation step of 10,000 g for 30 min [32–36]. All experiments
described here correspond to the first studies carried out in our
laboratory, performed with an oligodendroglial model: the HOG
cell line. To induce differentiation, these cells were cultured in
differentiation medium (DM). Nevertheless, the isolation method
described here can equally be performed using other culture media.
It is important to note that the presence of FBS might alter the
results. The DM lacks FBS, therefore contamination of our MVs
preparation with EVs present in the serum is prevented. To isolate
MVs from other cell lines, such as Hela or MeWo, DMEM supple-
mented with 1% exosome-depleted FBS can be used. This FBS is
commercially available from a number of suppliers. Otherwise, to
eliminate EVs, FBS can be centrifuged at 4 C for 18 h at
100,000 g [37]. The EVs-depleted FBS should be, in addition,
filtered through a 0.22 μm Millex sterile syringe filter.
3.1 Viral Infections 1. Two days prior to the infection, plate 1 107 HOG cells in
each of 4 175 cm2 Falcon flasks (see Note 1). The number of
cells may vary between different cell lines. Culture cells in GM
supplemented with 10% FCS.
2. The day before infection, change the GM to DM. To culture in
differentiation conditions, wash cells with serum-free GM and
culture for 24 h with DM (see Note 2). This step should be
omitted for other cell lines that do not need to be

differentiated.
3. The day of infection, prepare the viral inoculum. The final
volume of the inoculum will be calculated as 1 ml per 25 cm2
of culture surface. Thus, for each 175 cm2 flask the final volume
will be 7 ml. Add 15 ml of serum-free GM (corresponding
to two flasks) to a 50 ml Falcon conical centrifuge tube (see
Note 3) and then, add the corresponding amount of HSV-1
stock to the medium as to infect at a multiplicity of infection
(moi) of 1 TCID50 per cell (see Note 4). Prepare a second
Falcon tube with 15 ml of serum-free GM (for each 175 cm2
tissue culture flask) without the virus as the mock control.
4. Wash the cells with serum-free GM (see Note 5), add the
inoculum, and incubate the flasks for 1 h at 37 C in an
atmosphere of 5% CO2 (see Note 6) for viral adsorption.
5. After adsorption, remove the viral inoculum and the
corresponding mock-inoculum, and wash twice with 10 ml of
serum-free GM (see Note 7). Add 15 ml of fresh DM per flask
or, alternatively, 1% exosome-depleted culture medium for
other cell lines.
6. Incubate the flasks for 24 h at 37 C in an atmosphere of 5%
CO2.
3.2 Isolation of MVs EVs isolated from infected cells may be similar in size to viruses and,
therefore, it may be very difficult to separate virions from vesicles.
In general, the complete separation of vesicles and viruses accord-
ing to their density and diameter is not yet possible, due to the
heterogeneity of all parameters involved in differential centrifuga-
tion [15, 38, 39]. Indeed, our results have indicated that MV
fractions isolated from infected HOG cells are not free of HSV-1
virions [26]. Therefore, in order to design appropriate controls, it is
necessary to quantify the number of virions remaining in the MV
fraction by titration. To design this control, the difference between
the viral titers before and after the 10,000 g centrifugation step is
calculated, which allows to determine the number of infectious
virions that had been pelleted along with the MVs.
Perform all centrifugations and isolation steps at 4 C.
1. After step 6 of Subheading 3.1, collect the supernatants at 24 h
p.i. from infected and mock-infected flasks (30 ml for each
experimental point) and transfer them to one each (infected
and mock-infected) 50 ml Falcon tube. Centrifuge the tubes at
400 g for 10 min in a swinging-bucket rotor and transfer the
supernatant to another 50 ml Falcon tube (see Note 8).
2. Centrifuge the tube at 2500 g for 15 min and transfer the
supernatant to 30 ml polycarbonate bottles. Save 100 μl of
supernatant for titration (Titer 1).
3. Centrifuge the polycarbonate bottles at 10,000 g for 30 min

in a fixed-angle centrifuge. Discard the supernatant—saving
100 μl for titration (Titer 2)—and resuspend the pellet,
which contains the MVs, in 10 ml of PBS (see Note 9). Centri-
fuge again at 10,000 g for 30 min and process the pellet for
the corresponding experiment (see Note 10).
4. Titer the supernatants by standard procedures. The number of
infectious virions that had been pelleted along with the MVs
will be V ¼ Titer 1 Titer 2 (see Note 11).
3.3 Analysis of MVs This assay aims to quantify the concentration and size of MVs by
by Nanoparticle Nanoparticle Tracking Analysis (NTA).
Tracking Analysis
1. Resuspend the pellet containing the MVs—obtained as
(NTA) described in Subheading 3.2—in 2 ml of serum-free DMEM
in a 2 ml microcentrifuge tube and keep it at 4 C until NTA.
2. Dilute 0.5 ml of each sample in 1.5 ml of HBSS to prepare a 1:4
dilution. Inject these 2 ml of diluted samples in the NanoSight
LM10 chamber using a 2 ml syringe without needle (see
Note 12). For each measurement, ambient temperature will
be recorded manually.
3. Analyse the samples and record 4 videos per sample (see
Note 13).
3.4 Analysis of MVs MVs are lysed in RIPA buffer and the samples analysed by
by SDS-PAGE SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Through-
out the lysis of the MVs suspension, all steps must be performed
in ice or at 4 C.
1. Resuspend the pellet containing the MVs—obtained as
described in Subheading 3.2—in 200 μl ice-cold RIPA buffer
with freshly added PMSF and protease inhibitor cocktail. Leave
the MVs suspension on ice for 15 min.
2. Centrifuge the lysate at 15,000 g for 10 min at 4 C to pellet
the cell debris and then transfer supernatant to a new tube (see
Note 14).
3. Add 50 μl of 5 Laemmli buffer to the lysate and mix well.
Depending on the primary antibody, perform SDS-PAGE
under nonreducing conditions.
4. Boil the samples at 95 C in a heat block for 5 min.
5. Subject the samples (30 μl) to SDS-PAGE in 10% acrylamide
gels as described [26] and then transfer the proteins to PVDF
membranes.
6. Incubate blots with shedding MV markers, such as integrin β-1
and flotillin-1, and complete the immunoblot assay as
described [26].
3.5 Staining MVs To analyze whether MVs can be endocytosed by naı̈ve cells, MVs
with PKH26 are isolated from noninfected HOG cells as described above and
then stained with the red dye PKH26 following the manufacturer’s
instructions. Finally, the stained MVs are added to naı̈ve cells. After
incubation of the cell–MV mixture, the cells are washed, fixed, and
stained for visualization by confocal fluorescence microscopy. All
staining steps are performed in sterile conditions and at ambient
temperature (20–25 C).
1. The day before the staining experiment, plate 2 105 HOG
cells per well of a 24-well tissue culture plate (Falcon) contain-
ing round glass coverslips. 24 h later, the cells should have a
confluency of 80%. Culture cells in GM with 10% FBS.
2. The day of the staining experiment, aspirate the supernatant of
the polycarbonate 30 ml tube containing the MVs pellet—
obtained as described in Subheading 3.2—without disturbing
the pellet.
3. Add 1 ml of diluent C—the aqueous labeling vehicle provided
in the PKH26 Red Flourescence Cell Linker Mini Kit—(2
cell suspension) to the pellet and resuspend it carefully.
4. Dilute 4 μl of PKH26 ethanolic dye solution into 1 ml of
diluent C (2 dye solution) in a 5 ml tube and mix well to
disperse.
5. Add the 1 ml 2 cell suspension to the 1 ml of 2 dye and
incubate it for 5 min (see Note 15).
6. Quench the staining reaction by addition of 2 ml of FBS.
7. Divide the labeled sample into 2 ml tubes and centrifuge them
at 10,000 g for 30 min in a fixed-angle microcentrifuge at
4 C.
8. Aspirate the supernatant and resuspend the pellet of each tube
in 200 μl of DMEM with 10% FBS.
9. Aspirate the medium of the wells containing HOG cells
cultured over coverslips and add the MVs to the cells. Include
a control without MVs (see Note 16).
10. Incubate the mixture of cells and MVs for 2 h at 37 C.
11. Aspirate the mixture, wash cells with PBS and fix them with 4%
PFA in PBS for 15 min. After that, aspirate the PFA and wash
twice with PBS.
12. Stain cells with an antibody that allows visualizing the bound-
aries of the cells—such as phalloidin—conjugated with a green
or far-red fluorophore (see Note 17); perform the immunoflu-
orescence assay as described elsewhere [26] and observe the
specimen by confocal microscopy.
3.6 Electron 1. Resuspend the MV pellet obtained as described in Subheading

Microscopy 3.2 in 40 μl of PBS containing 5 mM EDTA.
3.6.1 Negative Staining 2. Add an equal volume of 2% PFA for fixation. MVs in 2% PFA
can be stored up to 1 week at 4 C before proceeding further.
3. Adsorb 10 μl of this fraction onto glow-discharged collodion/
carbon coated copper grids for 10 min.
4. Float the grids on a small drop of 1% aqueous uranyl acetate for
45 s.
5. Let the samples air dry before observation under the TEM.
6. Alternatively, grids can be contrasted and embedded with
methyl cellulose-uranyl acetate [37] as follows.
7. Transfer grids to a 100-μl drop of a mixture of 1.8% methylcel-
lulose and 0.4% uranyl acetate, incubating on ice for 10 min.
8. Remove the grids with a stainless steel loop and blot excess
fluid by pushing the loop sideways on Whatman filter paper n
50 so that a thin film is left behind over the sample side of the
grid. Let the samples air dry before observation under
the TEM.
3.6.2 Immunoelectron Perform immunogold labeling of MVs at room temperature unless

Microscopy indicated otherwise.
1. Permeabilize the MV pellet obtained as described in Subhead-
ing 3.2 with 0.1% saponin for 5 min.
2. Incubate at room temperature with a rabbit polyclonal anti-
HSV-1 antibody conjugated with 10 nm protein A-gold
diluted 1:500 in PBS containing 5% FBS for 45 min. After
immunolabeling, wash the samples in distilled H2O and
embed them in a mixture of 1.8% methyl cellulose and 0.4%
uranyl acetate at 4 C.
3. To examine grids, we have used a Jeol JEM-1010 electron
microscope at 80 kV and, to record images, a TemCam-F416
(4K 4K) digital camera from TVIPS.
3.6.3 Conventional TEM To study the endocytosis of MVs, conventional Epon embedding
with Methylcellulose/ methods can be used. To that aim, MVs isolated from infected cells
Uranyl Acetate are layered onto HOG cells—cultured in a 24-well plate—and
incubated with cells before fixation and processing for electron
microscopy.
1. The first day of the experiment, plate cells in 175 cm2 Falcon
flasks as in step 1 of Subheading 3.1. Proceed as described in
Subheading 3.1 to isolate the MVs.
2. The third day (see Note 18), plate 2 105 HOG cells in a
24-well tissue culture plate. 24 h later, the cells should have a
confluency of 80%.
3. The fourth day, isolate the MVs by centrifugation as described

in Subheading 3.1. Then, resuspend the MVs in 200 μl of
serum-free DM and layer them onto the HOG cells seeded in
the 24-well plate the day before (see Note 19).
4. Incubate the plate for 1 h at 4 C to avoid internalization of
MVs (see Note 20). Then, shift to 37 C for 15 min to allow the
first stages of endocytic processes, aspirate the medium of the
wells, and fix the mixture cells/MVs with 4% PFA and 2%
glutaraldehyde in 0.1 M PB, pH 7.4 for 90 min at RT.
5. Carry out post-fixation with 1% OsO4 and 1% K3Fe(CN)6 at
4 C for 1 h.
6. Dehydrate samples with ethanol and flat-embed them in situ in
Epoxy, TAAB 812 Resin according to standard procedures.
7. After polymerization for 48 h at 60 C, detach the resin blocks
containing the cell monolayers from the wells and mount them
on the microtome to obtain orthogonal (from the bottom to
the top of the cell) 80-nm ultrathin sections. Deposit the
sections onto slot grids and stain them with uranyl acetate
and lead citrate as previously described [40].
4 Notes
1. The number of flasks used for MV isolation is limited only by

handling reasons and, thus, the experiment should not exceed a
manageable number of flasks.
2. Cells can also be cultured with other standard media, such as
DMEM or RPMI, with 1% exosome-depleted FBS.
3. Infections with serum-free cell culture medium avoid the varia-
bility of serum and enable to standardize the cell culture
conditions.
4. The moi ¼ 1 has been chosen in order to get a high amount of
EVs from infected cells vs. from uninfected ones.
5. Cells may also be washed with PBS. However, washing with
serum-free medium will imply less modification in culture
conditions.
6. During viral adsorption, rock the flasks gently every 15 min to
prevent the cells from drying out.
7. This washing step is important in order to minimize the pres-
ence of virions derived from the viral stock in the EV fraction.
8. It is important not to disturb the pellet when transferring the
supernatant. To meet that, do not transfer the whole volume
(30 ml) of supernatant to the next tube but, instead, transfer
only 29.5 ml, leaving 500 μl behind.
9. If the cells have been cultured without FBS, this wash step can
be omitted. With each centrifugation step, a small fraction of
MVs may be lost.
10. Depending on the number of flasks and the secretory capacity
of the cells, the total amount of isolated MVs can vary consid-
erably and, therefore, the pellet obtained might be difficult to
see. Thus, immediately after taking out the centrifuged sam-
ples, it is recommended to mark the centrifuge tube with a
marker at the region where the pellet is expected (the tube
bottom in case of a swinging bucket-rotor or the tube wall
opposite to the rotation axis in case of a fixed-angle rotor). In
addition, it is also critical to avoid disturbing the MV pellet.
11. Although calculating the number of infectious virions pelleted
along with the MVs is not necessary for many assays—such as
the protein profile analysis by SDS-PAGE, the NTA, or the
electron microscopy of virions enclosed in MVs—this data
might be necessary as a control for other types of experiments.
Therefore, if it is not necessary, this step can be omitted.
12. MV fractions isolated from infected cells are not free of HSV-1
virions, but the difference in size between HSV-1 virions
(<250 nm) and MVs (up to 1000 nm) permits to solve this
situation. Thus, the Nanoparticle Tracking Analysis will be
performed establishing a threshold of 250 nm, to analyse
only the particles with a size larger than 250 nm and, excluding
therefore, the presence of isolated virions in the MVs fraction.
13. For each experimental condition, at least two samples are
analysed. For each sample, four videos of 90 s are recorded to
obtain replicate histograms that are averaged.
14. The cell lysate can be stored at 20 C or at 80 C.
15. Do not add ethanolic PKH26 dye directly to the 2 cell sus-
pension in diluent C.
16. Cells incubated in 200 μl of DMEM containing 10% FBS serve
as mock-control.
17. Do not use a red fluorophore, since PKH26 emits a red signal
with an excitation and emission maximum of 551 and 567 nm,
respectively. Use green or far-red fluorophores such as Alexa
488 or Alexa 647.
18. Since the differentiation step can be omitted, the experiment
can be shorter. Thus, the first day, the cells are plated; the
second day, the cells are differentiated; the third day, the cells
are infected; the fourth day, the MVs are isolated by centrifu-
gation and, then, layered onto HOG cells cultured in 24-well
plates. However, if the differentiation step (second day) is
omitted, the experiment takes only 3 days.
19. Cells incubated in 200 μl of DMEM containing 0% FBS serve

as mock-control.
20. During adsorption of MVs, rock the flasks gently every 15 min
to prevent the cells from drying out.
Acknowledgments
We thank Marı́a Teresa Rejas, Technical Director of the Electron

Microscopy Facility (CBMSO), for her support with the electron-
microscopy protocols.
Funding: Fundación Severo Ochoa-Aeromédica Canaria provided
financial support. The funders had no role in study design, decision
to publish, or preparation of the manuscript.
References
1. Meldolesi J (2018) Exosomes and Ectosomes 5. Raposo G, Stoorvogel W (2013) Extracellular
in intercellular communication. Curr Biol 28 vesicles: exosomes, microvesicles, and friends. J
(8):R435–R444. https://doi.org/10.1016/j. Cell Biol 200(4):373–383. https://doi.org/
cub.2018.01.059 10.1083/jcb.201211138
2. Yañez-Mo M, Siljander PR, Andreu Z, Zavec 6. Bello-Morales R, Lopez-Guerrero JA (2018)
AB, Borras FE, Buzas EI, Buzas K, Casal E, Extracellular vesicles in herpes viral spread and
Cappello F, Carvalho J, Colas E, Cordeiro-da immune evasion. Front Microbiol 9:2572.
Silva A, Fais S, Falcon-Perez JM, Ghobrial IM, https://doi.org/10.3389/fmicb.2018.02572
Giebel B, Gimona M, Graner M, Gursel I, 7. Cocucci E, Meldolesi J (2015) Ectosomes and
Gursel M, Heegaard NH, Hendrix A, exosomes: shedding the confusion between
Kierulf P, Kokubun K, Kosanovic M, Kralj- extracellular vesicles. Trends Cell Biol 25
Iglic V, Kramer-Albers EM, Laitinen S, (6):364–372. https://doi.org/10.1016/j.tcb.
Lasser C, Lener T, Ligeti E, Line A, Lipps G, 2015.01.004
Llorente A, Lotvall J, Mancek-Keber M, 8. Colombo M, Raposo G, Thery C (2014) Bio-
Marcilla A, Mittelbrunn M, Nazarenko I, genesis, secretion, and intercellular interactions
Nolte-’t Hoen EN, Nyman TA, O’Driscoll L, of exosomes and other extracellular vesicles.
Olivan M, Oliveira C, Pallinger E, Del Portillo Annu Rev Cell Dev Biol 30:255–289.
HA, Reventos J, Rigau M, Rohde E, https://doi.org/10.1146/annurev-cellbio-
Sammar M, Sanchez-Madrid F, Santarem N, 101512-122326
Schallmoser K, Ostenfeld MS, Stoorvogel W,
Stukelj R, Van der Grein SG, Vasconcelos MH, 9. Cocucci E, Racchetti G, Meldolesi J (2009)
Wauben MH, De Wever O (2015) Biological Shedding microvesicles: artefacts no more.
properties of extracellular vesicles and their Trends Cell Biol 19(2):43–51. https://doi.
physiological functions. J Extracell Vesicles org/10.1016/j.tcb.2008.11.003
4:27066. https://doi.org/10.3402/jev.v4. 10. Budnik V, Ruiz-Canada C, Wendler F (2016)
27066 Extracellular vesicles round off communication
3. Wurdinger T, Gatson NN, Balaj L, Kaur B, in the nervous system. Nat Rev Neurosci 17
Breakefield XO, Pegtel DM (2012) Extracellu- (3):160–172. https://doi.org/10.1038/nrn.
lar vesicles and their convergence with viral 2015.29
pathways. Adv Virol 2012:767694. https:// 11. Andreu Z, Yañez-Mo M (2014) Tetraspanins
doi.org/10.1155/2012/767694 in extracellular vesicle formation and function.
4. Raab-Traub N, Dittmer DP (2017) Viral Front Immunol 5:442. https://doi.org/10.
effects on the content and function of extracel- 3389/fimmu.2014.00442
lular vesicles. Nat Rev Microbiol 15 12. Kowal J, Arras G, Colombo M, Jouve M, Mor-
(9):559–572. https://doi.org/10.1038/ ath JP, Primdal-Bengtson B, Dingli F, Loew D,
nrmicro.2017.60 Tkach M, Thery C (2016) Proteomic compari-
son defines novel markers to characterize
heterogeneous populations of extracellular ves- 1 infection: an inquire. Virol J 13:63. https://

icle subtypes. Proc Natl Acad Sci U S A 113(8): doi.org/10.1186/s12985-016-0518-2
E968–E977. https://doi.org/10.1073/pnas. 24. Dargan DJ, Subak-Sharpe JH (1997) The
1521230113 effect of herpes simplex virus type 1 L-particles
13. Willms E, Johansson HJ, Mager I, Lee Y, on virus entry, replication, and the infectivity of
Blomberg KE, Sadik M, Alaarg A, Smith CI, naked herpesvirus DNA. Virology 239
Lehtio J, El Andaloussi S, Wood MJ, Vader P (2):378–388. https://doi.org/10.1006/viro.
(2016) Cells release subpopulations of exo- 1997.8893
somes with distinct molecular and biological 25. Kalamvoki M, Du T, Roizman B (2014) Cells
properties. Sci Rep 6:22519. https://doi.org/ infected with herpes simplex virus 1 export to
10.1038/srep22519 uninfected cells exosomes containing STING,
14. Wei X, Liu C, Wang H, Wang L, Xiao F, Guo Z, viral mRNAs, and microRNAs. Proc Natl Acad
Zhang H (2016) Surface phosphatidylserine is Sci U S A 111(46):E4991–E4996. https://doi.
responsible for the internalization on microve- org/10.1073/pnas.1419338111
sicles derived from hypoxia-induced human 26. Bello-Morales R, Praena B, de la Nuez C, Rejas
bone marrow mesenchymal stem cells into MT, Guerra M, Galan-Ganga M, Izquierdo M,
human endothelial cells. PLoS One 11(1): Calvo V, Krummenacher C, Lopez-Guerrero
e0147360. https://doi.org/10.1371/journal. JA (2018) Role of microvesicles in the spread
pone.0147360 of herpes simplex virus 1 in oligodendrocytic
15. Nolte-’t Hoen E, Cremer T, Gallo RC, Mar- cells. J Virol 92(10). https://doi.org/10.
golis LB (2016) Extracellular vesicles and 1128/JVI.00088-18
viruses: are they close relatives? Proc Natl 27. Kurien BT, Scofield RH (2015) Multiple
Acad Sci U S A 113(33):9155–9161. https:// immunoblots by passive diffusion of proteins
doi.org/10.1073/pnas.1605146113 from a single SDS-PAGE gel. In: Kurien BT,
16. Meckes DG Jr, Raab-Traub N (2011) Micro- Scofield RH (eds) Western blotting. Methods
vesicles and viral infection. J Virol 85 and protocols, Methods in molecular biology,
(24):12844–12854. https://doi.org/10. vol 1312. Springer Science+Business Media,
1128/JVI.05853-11 New York, pp 77–86. https://doi.org/10.
17. Alenquer M, Amorim MJ (2015) Exosome 1007/978-1-4939-2694-7_11
biogenesis, regulation, and function in viral 28. Kurien BT, Scofield RH (2015) Western blot-
infection. Viruses 7(9):5066–5083. https:// ting: an introduction. In: Kurien BT, Scofield
doi.org/10.3390/v7092862 RH (eds) Western blotting. Methods and pro-
18. Altan-Bonnet N (2016) Extracellular vesicles tocols, Methods in molecular biology, vol
are the Trojan horses of viral infection. Curr 1312. Springer Science+Business Media,
Opin Microbiol 32:77–81. https://doi.org/ New York, pp 17–30. https://doi.org/10.
10.1016/j.mib.2016.05.004 1007/978-1-4939-2694-7_5
19. Anderson MR, Kashanchi F, Jacobson S 29. Witwer KW, Buzas EI, Bemis LT, Bora A,
(2016) Exosomes in viral disease. Neurothera- Lasser C, Lotvall J, Nolte-’t Hoen EN, Piper
peutics 13(3):535–546. https://doi.org/10. MG, Sivaraman S, Skog J, Thery C, Wauben
1007/s13311-016-0450-6 MH, Hochberg F (2013) Standardization of
20. Meckes DG Jr (2015) Exosomal communica- sample collection, isolation and analysis meth-
tion goes viral. J Virol 89(10):5200–5203. ods in extracellular vesicle research. J Extracell
https://doi.org/10.1128/JVI.02470-14 Vesicles 2. https://doi.org/10.3402/jev.v2i0.
20360
21. van Dongen HM, Masoumi N, Witwer KW,
Pegtel DM (2016) Extracellular vesicles exploit 30. Thery C, Ostrowski M, Segura E (2009) Mem-
viral entry routes for cargo delivery. Microbiol brane vesicles as conveyors of immune
Mol Biol Rev 80(2):369–386. https://doi. responses. Nat Rev Immunol 9(8):581–593.
org/10.1128/MMBR.00063-15 https://doi.org/10.1038/nri2567
22. Szilagyi JF, Cunningham C (1991) Identifica- 31. Gould SJ, Raposo G (2013) As we wait: coping
tion and characterization of a novel with an imperfect nomenclature for extracellu-
non-infectious herpes simplex virus-related lar vesicles. J Extracell Vesicles 2. https://doi.
particle. J Gen Virol 72(Pt 3):661–668. org/10.3402/jev.v2i0.20389
https://doi.org/10.1099/0022-1317-72-3- 32. Clancy JW, Sedgwick A, Rosse C,
661 Muralidharan-Chari V, Raposo G, Method M,
23. Kalamvoki M, Deschamps T (2016) Extracel- Chavrier P, D’Souza-Schorey C (2015) Regu-
lular vesicles during herpes simplex virus type lated delivery of molecular cargo to invasive
tumour-derived microvesicles. Nat Commun
6:6919. https://doi.org/10.1038/ dynamics. J Cell Biol 214(2):197–213.

ncomms7919 https://doi.org/10.1083/jcb.201601025
33. Haraszti RA, Didiot MC, Sapp E, Leszyk J, 37. Thery C, Amigorena S, Raposo G, Clayton A
Shaffer SA, Rockwell HE, Gao F, Narain NR, (2006) Isolation and characterization of exo-
DiFiglia M, Kiebish MA, Aronin N, Khvorova somes from cell culture supernatants and
A (2016) High-resolution proteomic and lipi- biological fluids. Curr Protoc Cell Biol.
domic analysis of exosomes and microvesicles Chapter 3:Unit 3 22. https://doi.org/10.
from different cell sources. J Extracell Vesicles 1002/0471143030.cb0322s30
5:32570. https://doi.org/10.3402/jev.v5. 38. Yuana Y, Sturk A, Nieuwland R (2013) Extra-
32570 cellular vesicles in physiological and pathologi-
34. Muralidharan-Chari V, Clancy J, Plou C, cal conditions. Blood Rev 27(1):31–39.
Romao M, Chavrier P, Raposo G, D’Souza- https://doi.org/10.1016/j.blre.2012.12.002
Schorey C (2009) ARF6-regulated shedding 39. van der Pol E, Boing AN, Harrison P, Sturk A,
of tumor cell-derived plasma membrane micro- Nieuwland R (2012) Classification, functions,
vesicles. Curr Biol 19(22):1875–1885. and clinical relevance of extracellular vesicles.
https://doi.org/10.1016/j.cub.2009.09.059 Pharmacol Rev 64(3):676–705. https://doi.
35. Heijnen HF, Schiel AE, Fijnheer R, Geuze HJ, org/10.1124/pr.112.005983
Sixma JJ (1999) Activated platelets release two 40. Yamashita S (2016) Post-embedding mamma-
types of membrane vesicles: microvesicles by lian tissue for immunoelectron microscopy: a
surface shedding and exosomes derived from standardized procedure based on heat-induced
exocytosis of multivesicular bodies and alpha- antigen retrieval. In: Schwartzbach S, Skalli O,
granules. Blood 94(11):3791–3799 Schikorsk T (eds) High-resolution imaging of
36. Sinha S, Hoshino D, Hong NH, Kirkbride KC, cellular proteins, Methods Mol biol, vol 1474.
Grega-Larson NE, Seiki M, Tyska MJ, Weaver Springer Science+Business Media, New York,
AM (2016) Cortactin promotes exosome pp 279–290. https://doi.org/10.1007/978-
secretion by controlling branched actin 1-4939-6352-2_18
Chapter 18
Conformational Change in Herpes Simplex Virus Entry

Glycoproteins Detected by Dot Blot
Tri Komala Sari, Katrina A. Gianopulos, and Anthony V. Nicola
Abstract
Conformational changes in viral membrane proteins drive membrane fusion, a critical step in virus entry and
infection. Here we describe a simple and rapid virus blotting immunoassay to define conformational
changes with a panel of monoclonal antibodies to distinct sites across a viral glycoprotein. This dot blot
technique has been utilized to define low pH-triggered changes in the prefusion form of the herpesviral
fusogen gB. At pH of <6.2 there are specific changes in herpes simplex virus 1 gB domains I and V. This
corresponds broadly to host cell endosomal pH. Many of the identified changes are at least partially
reversible. This method can be adapted to document changes in viral proteins that are not fusion proteins,
including those induced by alternate triggers such as receptor-binding or protease cleavage.
Key words Immunoassay, Dot blot, Antibodies, Nitrocellulose membrane, Virus entry, Glycopro-
teins, Herpesvirus, Herpes simplex virus, Conformational change, Membrane fusion, Low pH
1 Introduction
Virus entry is a key process in the viral replication cycle by which the
incoming viral particle gains initial access to the host cell. All
enveloped viruses must fuse with the target cell membrane to
initiate successful entry [1]. The energetically unfavorable merging
of two stable lipid bilayer membranes is thought to be driven by the
conformational transition from prefusion to postfusion forms of
the viral fusion glycoprotein. This major structural rearrangement,
or conformational change, results in exposure of hydrophobic
fusion peptide sequences. The exposed hydrophobic regions then
interact with lipids of the target membrane, which is an essential
destabilizing step in the fusion reaction [2]. Conformational
changes in viral fusion proteins can be triggered by host cell cues,
the most common of which is the low pH environment of an
endosomal compartment. Enfuvirtide, a HIV antiviral, blocks a
critical conformational change in the viral fusion protein gp41 [3].
319
320 Tri Komala Sari et al.
There are biochemical, biophysical, and structural approaches to

detecting and evaluating protein conformational change. The bind-
ing of a specific monoclonal antibody, for example, can depend on the
primary, secondary, or quaternary structure of the antigen. Thus
antigenicity as defined by antibody reactivity can be employed to
distinguish different conformations of a single protein. Antibody–
antigen interactions can be assessed by many immunological techni-
ques, including flow cytometry, enzyme-linked immunosorbent assay
(ELISA), Western blotting, and dot blotting.
The Herpesviridae family of large, enveloped DNA viruses
causes significant morbidity and mortality. Many different virus-
encoded membrane proteins, glycosylated and nonglycosylated,
decorate the surface of herpesvirions. They comprise the multicom-
ponent machinery that orchestrates receptor-binding, membrane
fusion, and entry. Glycoprotein B (gB) is the core fusion protein,
but it typically requires two or more additional viral membrane
proteins to execute fusion. Glycoprotein B is thought to undergo
major structural rearrangements during membrane fusion. The
other required glycoproteins play critical triggering and regulatory
roles and may also assume multiple conformations, particularly
when comparing prefusion and postfusion states. In addition to
gB, the gH/gL heterodimer and gD are necessary for herpes
simplex virus (HSV) entry and membrane fusion [4–8].
Here we describe a rapid virus blotting (dot blot) immunoassay
to define conformational changes with a panel of monoclonal anti-
bodies to distinct sites across a viral glycoprotein. Scientists have
taken experimental advantage of the ability of proteins to bind to
nitrocellulose membranes for many years. In the simplest example
of a dot blot, a protein is added to the membrane substrate and
passively binds. The dot blot method (also known as slot blot)
mirrors Western blotting (or immunoblotting), except that pro-
teins are not first separated by electrophoresis. Thus dot blot may
allow proteins to be analyzed in a more native state.
The prefusion form of HSV-1 gB undergoes low pH-triggered
conformational changes that are thought to be fusion-associated
[9–12]. These changes are at least partially reversible. In addition to
the dot blot approach, gB conformation changes have been
detected by polyacrylamide gel electrophoresis, tryptophan fluores-
cence spectroscopy, and immunofluorescence microscopy
[13–17]. The dot blot approach described here can be adapted to
document changes in viral proteins that are not fusion proteins,
including those induced by alternate triggers such as receptor-
binding or protease cleavage.
Dot Blot Detection of Conformational Change 321
2 Materials
1. Dot blot apparatus (such as Minifold I Dot-Blot System,

Schleicher and Schuell).
2. Nitrocellulose membrane (such as Protran Nitrocellulose Blot-
ting Membrane, 0.45 μM pore size).
3. Filter paper (such as Whatman 3MM Chromatography Paper).
4. Vacuum source (central or pump) (see Note 1).
5. Source of virus antigen (such as extracellular HSV-1 strain KOS
virions, ~105–106 PFU per dot).
6. Mildly acidic pH medium: Dulbecco’s modified Eagle’s
medium (DMEM) (bicarbonate-free) solid, 0.2% bovine
serum albumin (BSA), 5 mM succinate, 5 mM 2-(N-morpho-
lino)ethanesulfonic acid (MES), 5 mM HEPES. Make up to
1 L with sterile, cell-culture grade water. Filter and store at
4 C.
7. Laboratory vortex mixer.
8. Laboratory rocker.
9. Primary antibody (monoclonal or polyclonal) to viral envelope
protein. Mouse monoclonal antibodies to HSV gB, H126, and
H1817 (Virusys) are examples used here.
10. Horseradish peroxidase (HRP)-conjugated secondary anti-
body (e.g., goat anti-mouse HRP).
12. PBS-T wash buffer: 0.2% Tween 20 in PBS.
13. Blocking buffer: 5% nonfat dry milk prepared in PBS-T. Pre-
pare just prior to use.
14. Distilled water.
15. 0.05 N HCl.
16. 0.05 N NaOH.
17. Water bath, 37 C.
18. Chemiluminescence substrate for HRP.
19. Film cassette.
20. X-ray film.
21. Plastic transparency sheets, tweezer, cutting board, and
low-lint, delicate task wipes.
22. Automatic film developer in darkroom.
3 Methods
3.1 Assembly of Dot 1. Measure and cut nitrocellulose membrane to the desired size.
Blot Apparatus Handle membrane with forceps and gloved hands.
2. Place nitrocellulose membrane in a clean dish, and add PBS to
activate.
3. Rock membrane for 20 min at room temperature.
4. Wet filter paper with PBS.
5. Attach filtration plate to vacuum plenum (Fig. 1). Back the
nitrocellulose membrane with filter paper and place on top of
the filtration plate. Place sample well plate with silicone O-rings
facing down on top of the membrane. Clamp the sandwich in
place with the adjustable latches (see Note 2).
6. Attach vacuum hose to the vacuum plenum on the assembled
dot blot apparatus (see Note 3).
7. Turn vacuum on for 2 min to test. Turn off vacuum. Remove
the sample plate, and verify that there are uniform O-ring
indentations on the membrane. This is an indication that
proper filtration is achieved.
8. Turn vacuum off until samples are ready to be applied.
Fig. 1 Schematic of assembly for dot blot immunoassay of conformational change of viral entry glycoproteins
3.2 Antigen 1. Adjust mildly acidic pH medium to the target pH by adding a

Preparation predetermined volume of 0.05 N HCl (see Note 4).
2. Add HSV-1 to adjusted pH medium to a final concentration of
~105 PFU per 200 μL sample to be dotted. Vortex briefly.
3. Incubate pH-treated virus in 37 C water bath for 10 min.
4. To measure for reversibility of conformational changes, add
predetermined amount of 0.05 N NaOH (see Note 5), then
incubate virus for another 10 min in a 37 C water bath.
Otherwise, virus is added to nitrocellulose membrane directly.
3.3 Antigen Blotting 1. Turn the vacuum on. Vortex samples briefly and apply sample
(200–500 μL) to appropriate well.
2. Add 200 μL of sample per dot using a micropipette to allow
rapid and even dispersal of sample to the membrane.
3. Let sample sit with vacuum on while preparing to add blocking
buffer.
3.4 Membrane 1. Turn off vacuum. Disassemble dot blot apparatus. Release
Blocking latches, and remove the sample well plate. With forceps, trans-
fer nitrocellulose membrane to parafilm. Clean the apparatus
properly (see Note 6).
2. On a clean cutting board, use scalpel and ruler to trim mem-
brane as necessary. Mark with pencil to orient the position of
samples.
3. Transfer nitrocellulose to a clean dish. Add blocking buffer to
cover the surface of the membrane (see Note 7).
4. Place dish on a rocker, and rock for at least 20 min at room
temperature.
3.5 Addition 1. Prepare primary antibody dilution in blocking buffer. Dilution

of Primary (ascites or serum) is to be determined empirically, and can
and Secondary range from 1:500 to 1:30,000. If using purified IgG, optimal
Antibody concentration must also be determined.
2. Replace blocking buffer with primary antibody solution.
3. Place dish on a rocker and rock overnight at room temperature.
4. Discard primary antibody. Perform 3–4 initial washes, by
quickly adding and replacing PBS-T wash buffer.
5. Wash the membrane by adding wash buffer to dish and rocking
for 10 min at room temperature. Remove buffer, and repeat
three times.
6. Prepare secondary (HRP-conjugated) antibody dilution in
blocking buffer. Dilutions typically range from 1:10,000 to
1:30,000. Add sufficient volume to cover surface of nitrocellu-

lose membrane.
7. Rock for 20–30 min at room temperature.
8. Discard secondary antibody. Perform 3–4 initial washes, by
quickly adding and replacing PBS-T wash buffer.
9. Wash the membrane, by adding PBS-T wash buffer to dish and
rocking for 10 min at room temperature. Remove buffer, and
repeat three times.
3.6 Developing Blot 1. Immediately prior to use, prepare chemiluminescence HRP

substrate according to manufacturer’s instructions. Prepare
~20 μL substrate per dot.
2. Discard wash buffer. Using forceps, gently blot membrane with
wipe to remove excess substrate.
3. Transfer membrane to a plastic transparency sheet.
4. Pipette substrate evenly across the surface of membrane.
5. Quickly place another transparency sheet on top, and use
gloved fingers to press across the membrane gently and thor-
oughly to allow even distribution of substrate. Avoid air
bubbles.
6. With forceps, transfer membrane to between two new trans-
parency sheets. Place in film cassette.
7. In darkroom, place film on top and seal cassette. Expose for
desired period of time. Develop film in automatic processor.
8. Completed dot blot experiments have indicated that HSV-1 gB
undergoes conformational changes in response to mildly acidic
pH (Fig. 2), and that these changes are partially reversible
(Fig. 3).
Fig. 2 Dot blots of HSV-1 strain KOS probed with monoclonal antibodies to
gB. Virions were treated for 10 min at 37 C with medium buffered to the
indicated pHs and were blotted immediately to membrane. Blots were probed at
neutral pH with the indicated gB-specific antibodies, followed by horseradish
peroxidase-conjugated goat secondary antibody. Decreased reactivity of acid-
treated HSV with H126 indicates conformational change (see Note 8)
(Reproduced from ref. 9 with permission from the American Society for
Microbiology)
Fig. 3 Dot blot illustrating partial reversibility of conformational change in HSV-1

gB. HSV-1 KOS virions were treated with medium buffered to pH 7.2 or 5.5. For
the indicated samples, pH was neutralized back to 7.2 for 10 min at 37 C.
Membranes were probed at neutral pH with the indicated antibodies, followed by
horseradish peroxidase-conjugated secondary antibody (Reproduced from ref. 9
with permission from the American Society for Microbiology)
4 Notes
1. A reliable, strong vacuum source is recommended for quality

dots that are well-defined and reproducible.
2. Adjust the tightness of the latches so proper tension is
achieved. Overtightening or undertightening will affect how
the vacuum is distributed to the sample well plate.
3. Before blotting samples, apply a volume of PBS to a control
well to verify that vacuum filtration is working properly.
4. Prior to experiment, determine the volume of 0.05 N HCl
necessary to adjust the medium to the pH to be tested.
5. Prior to experiment, determine the volume of 0.05 N NaOH
necessary to return the sample to the initial pH, typically
pH 7.2–7.6.
6. Rinse wells thoroughly with 70% ethanol using a squirt bottle.
Wash thoroughly with soapy water. Do not soak, as warping of
plates and O-rings may occur. Rinse thoroughly with distilled
water. Air-dry apparatus.
7. Use as small a container as possible to reduce the volume of
antibody solution needed. This will increase the liquid to
membrane surface ratio.
8. Immunoassays such as the dot blot benefit greatly from mono-
clonal antibody development efforts and extensive epitope
mapping studies (see ref. 18).
Acknowledgments
This work was supported by Public Health Service grants

AI119159 and GM008336 from the National Institutes of Health.
References
1. Nicola AV, Aguilar HC, Mercer J, Ryckman B, triggers an irreversible conformational change
Wiethoff CM (2013) Virus entry by endocyto- in the fusion domain of herpes simplex virus
sis. Adv Virol 2013:469538 1 glycoprotein B and inactivation of viral entry.
2. White JM, Whittaker GR (2016) Fusion of J Virol 91(5)
enveloped viruses in endosomes. Traffic 17 12. Nicola AV (2016) Herpesvirus entry into host
(6):593–614 cells mediated by endosomal low pH. Traffic
3. Warnke D, Barreto J, Temesgen Z (2007) 17(9):965–975
Antiretroviral drugs. J Clin Pharmacol 47 13. Siekavizza-Robles CR, Dollery SJ, Nicola AV
(12):1570–1579 (2010) Reversible conformational change in
4. Cai WH, Gu B, Person S (1988) Role of glyco- herpes simplex virus glycoprotein B with
protein B of herpes simplex virus type 1 in viral fusion-from-without activity is triggered by
entry and cell fusion. J Virol 62(8):2596–2604 mildly acidic pH. Virol J 7:352
5. Forrester A et al (1992) Construction and 14. Dollery SJ, Wright CC, Johnson DC, Nicola
properties of a mutant of herpes simplex virus AV (2011) Low-pH-dependent changes in the
type 1 with glycoprotein H coding sequences conformation and oligomeric state of the pre-
deleted. J Virol 66(1):341–348 fusion form of herpes simplex virus glycopro-
6. Johnson DC, Ligas MW (1988) Herpes sim- tein B are separable from fusion activity. J Virol
plex viruses lacking glycoprotein D are unable 85(19):9964–9973
to inhibit virus penetration: quantitative evi- 15. Weed DJ, Dollery SJ, Komala Sari T, Nicola AV
dence for virus-specific cell surface receptors. (2018) Acidic pH mediates changes in anti-
J Virol 62(12):4605–4612 genic and oligomeric conformation of herpes
7. Nicola AV, Straus SE (2004) Cellular and viral simplex virus gB and is a determinant of cell-
requirements for rapid endocytic entry of her- specific entry. J Virol 92(17)
pes simplex virus. J Virol 78(14):7508–7517 16. Wudiri GA, Schneider SM, Nicola AV (2017)
8. Weed DJ, Nicola AV (2017) Herpes simplex Herpes simplex virus 1 envelope cholesterol
virus membrane fusion. Adv Anat Embryol facilitates membrane fusion. Front Microbiol
Cell Biol 223:29–47 8:2383
9. Dollery SJ, Delboy MG, Nicola AV (2010) 17. Dollery SJ, Lane KD, Delboy MG, Roller DG,
Low pH-induced conformational change in Nicola AV (2010) Role of the UL45 protein in
herpes simplex virus glycoprotein B. J Virol herpes simplex virus entry via low
84(8):3759–3766 pH-dependent endocytosis and its relationship
to the conformation and function of glycopro-
10. Roller DG, Dollery SJ, Doyle JL, Nicola AV tein B. Virus Res 149(1):115–118
(2008) Structure-function analysis of herpes
simplex virus glycoprotein B with fusion- 18. Bender FC et al (2007) Antigenic and muta-
from-without activity. Virology 382 tional analyses of herpes simplex virus glyco-
(2):207–216 protein B reveal four functional regions. J Virol
81(8):3827–3841
11. Weed DJ, Pritchard SM, Gonzalez F, Aguilar
HC, Nicola AV (2017) Mildly acidic pH
Chapter 19
BioID Combined with Mass Spectrometry to Study

Herpesvirus Protein–Protein Interaction Networks
Mujeeb R. Cheerathodi and David G. Meckes Jr.
Abstract
Herpes viruses are important human pathogens that cause a wide range of diseases from skin lesions to
malignancies. Protein interactions drive many cellular events and mediate a number of biochemical path-
ways leading to different physiological outcomes. Protein interactions between viral proteins and host
proteins play significant roles in viral entry, replication and suppression of host-immune responses. There-
fore, the study of virus–host interactions promises significant advancement in designing therapeutics to
control infection and disease. Various approaches are employed in the field to study and identify protein
interactions that combine affinity purification along with different detection methods. Advancements in
protein purification and high-throughput detection methods have resulted in an unprecedented level of
discovery. Here we detail the use of proximity dependent biotinylation (BioID) as a means of affinity
purification coupled with the use of LC-MS/MS for the detection and identification of protein–protein
interaction networks.
Key words Proteomics, Mass spectrometry, Biotin ligase, BioID, Affinity purification, Herpesvirus
1 Introduction
Multiprotein complexes are essential mediators of biological pro-

cesses. During infection, herpes viral proteins interact with host
proteins and other viral proteins to perform complex tasks like
entry into the host cell, genome replication, evasion of the immune
system, and virus egress. Therefore, a key goal for many herpes
virologists is to define and characterize the composition of protein
complexes to better understand viral replication mechanisms and
discover potential therapeutic targets. The study of viral host inter-
actions has also generated important advancements in other fields
such as immunology, cell biology and cancer research. Recent
developments in protein-tagging technology, protein isolation
techniques, and mass spectrometry have led to an explosion of
newly identified viral protein–protein interactions. However,
numerous false-positive interactions are frequently identified due
327
328 Mujeeb R. Cheerathodi and David G. Meckes Jr.
to the sensitivity and resolution of modern mass spectrometers.

These interactions include proteins that bind nonspecifically to
the affinity matrix or proteins introduced into the system from
the environment. Thus, it is imperative to validate putative interac-
tions through detailed molecular characterization and determina-
tion of their biological relevance. Because of the cost and time
involved with these downstream analyses, most researchers focus
on potential interactions with the highest probability of signifi-
cance. The introduction provides a brief overview of the steps
involved in identifying novel herpesvirus protein interactions
using affinity purification and mass spectrometry with a goal of
reducing false-positive results. Detailed methods are then included
in later sections.
1.1 Affinity Tags Affinity purification techniques typically employ a fusion protein
consisting of a bait protein attached to an epitope tag which shows
high affinity toward a solid resin or is biologically active
[1, 2]. These affinity-tagged fusion proteins are expressed in appro-
priate cellular systems to identify interaction partners in vivo or are
purified and added to cell lysates to identify interaction partners
following cell lysis. A number of epitope tags are currently in use
such as FLAG, His6x, HA, Myc, and GST [3–5]. All these fusion
epitopes work as a strong link between the bait protein and the
immobilized resin, while the bait protein brings with it the physi-
cally associated protein complexes. Some other tags are functional
and biologically active proteins that can stably modify the interact-
ing proteins. Examples of this category include BirA based Bio-ID
[6, 7] and peroxidase-based methods [8–10].
Adding an affinity tag to the bait protein can have positive
effects like improved protein yield, resistance to proteolytic cleav-
age and increased solubility. While potential negative effects include
modification in protein conformation and biological function,
altered enzymatic activity and interference during structural stud-
ies. Therefore, careful analyses should be performed when choosing
appropriate tags for the affinity purification experiments [11].
1.2 BioID: Expression This chapter describes the use of the biotin ligase-based labeling or
and Validation BioID method for affinity-based isolation of interacting protein
of Fusion Protein and their identification using mass spectrometry (Fig. 1). The
original BioID method was described by Roux et al. and has
continued to gain popularity within the scientific community
since its publication [6, 12]. BioID offers many advantages over
the traditional affinity methods for identifying interacting proteins.
For example, biotin labeling takes place inside the cells, under
physiological conditions. This helps harness the transient and
weak interactions between the proteins prior to cell lysis. BioID
can also be used under in vitro conditions following cell lysis.
Furthermore, using specifically designed plasmids, this method is
BioID to Study Herpesviral Protein Interactions 329
Fig. 1 BioID workflow for the identification of direct and proximal protein–protein interactions
suitable for analyzing the interactome of proteins within various

subcellular compartments [12]. By exploiting the BioID technique
our lab has recently published the interactome of Epstein–Barr
virus (EBV) Latent Membrane Protein 1 (LMP1). This study
resulted in the identification of more than one thousand potential
direct or proximal interaction partners involved in various cellular
functions [13]. For generating BioID constructs, vectors are avail-
able from Addgene or other commercial sources. While BioID
vectors encode a biotin ligase protein (BirA) with 321 amino
acids, BioID2 encodes a relatively smaller form of 233 amino
acids, enabling the identification of additional proximal protein
interactions [14]. Once the fusion construct with the bait protein
is generated, it can be introduced into the cell line of choice, either
transiently or stably. Stable transfection is often preferred when
experiments warrant high quantities of materials. However, for
BioID experiments, transient expression may reduce protein cyto-
toxic effects on cells due to long-term expression and biotinylation.
Before starting large-scale experiments for mass spectrometry-
based identification of interacting proteins, it is imperative to vali-
date functional integrity of the BioID fusion proteins. This can be
achieved by analyzing the protein expression level and biotinylation
efficiency using western blot and immunofluorescence. Protein
localization and other known functions of the protein can also be
verified by using standard methods. Once the fusion protein has
been functionally analyzed, performing a small-scale pull-down and
western blotting using streptavidin–HRP and other know interac-

tors can be helpful in determining the pull-down and biotinylation
efficiencies.
1.3 Cell Lysis For identification of interacting proteins using the BioID method,
our laboratory uses harsh conditions for cell lysis. BioID lysis buffer
is a strong lysis buffer with high concentrations of detergents and
salts. Cells resuspended in lysis buffer are further disrupted by
means of sonication. This will give a near complete lysis with a
minimum insoluble pellet remaining following centrifugation. In
certain cases, the remaining material is very viscous and cannot be
easily pipetted. In such cases the lysates should be passed through a
needle several times depending upon the materials. One of the
advantages of such strong lysis conditions is that it will expose the
biotinylated proteins from the cell membrane and compartments
that are resistant to standard lysis conditions used in traditional
co-IP experiments. Such strong lysis conditions can be employed
with the BioID approach because biotinylation is a covalent modi-
fication and the strong binding affinity of the streptavidin–biotin
interaction. This is particularly significant since biotin labeling is a
dynamic process occurring throughout multiple stages following
protein synthesis. During the life of a protein, some of the inter-
acting proteins may translocate to subcellular compartments,
including the nucleus following biotinylation. Therefore, a com-
plete lysis will allow for the purification and identification of nearly
all potential interactions in a given study. Taken together, BioID is
an excellent method to identify direct, transient, and weak interac-
tions and protein complexes not easily solubilized using other
methods.
2 Materials
2.1 Transfection, 1. Viral gene encoding desired bait protein cloned from viral
Biotin Labeling, Cell genome or other source (e.g., plasmid DNA) using standard
Lysis, and Affinity methods into pcDNA3.1mycBioID plasmid.
Purification 2. DNA transfection reagent.
3. Human Embryonic Kidney 293 (HEK293) cells cultured in
medium composed of Dulbecco’s Modified Eagle’s medium
(DMEM) supplemented with 10% fetal bovine serum (FBS),
2 mM L-glutamine, 100 IU/ml penicillin, and 100 μg/ml
streptomycin at 37 C with 5% CO2.
4. Phosphate Buffered Saline (PBS): 137 mM NaCl, 2.7 mM
KCl, 10 mM Na2HPO4, 2 mM KH2PO4.
5. Cell scraper.
6. Streptavidin magnetic beads and magnetic racks that support

1.5 ml tubes and 15 ml tubes.
7. 20 stock biotin solution: 1 mM biotin. Dissolve 12.2 mg of
biotin in 50 ml serum-free DMEM. Filter-sterilize through a
0.2 μm filter into a new sterile tube.
8. BioID lysis buffer: 50 mM Tris pH 7.6, 500 mM NaCl, 0.4%
SDS, 5 mM EDTA, 2% Triton X-100. Just before use add DTT
to a final concentration of 1 mM and protease inhibitor cocktail
to 1 final. This will be diluted after lysis and before
centrifugation.
9. 50 mM Tris pH 7.6.
10. Wash buffer 1: 2% SDS (w/v) in HPLC grade water.
11. Wash buffer 2: 0.1% (w/v) deoxycholic acid, 1% (w/v) Triton
X-100, 1 mM EDTA, 500 mM NaCl, and 50 mM Hepes
pH 7.5.
12. Wash buffer 3: 0.5% (w/v) deoxycholic acid, 0.5% (w/v)
NP40, 1 mM EDTA, 250 mM LiCl, and 10 mM Tris pH 7.4.
13. Wash buffer 4: 50 mM Tris pH 7.6, 50 mM NaCl.
14. Elution buffer: Biotin saturated (100 μM) Laemmli SDS sam-
ple buffer.
15. Sonicator.
16. 0.05% sodium azide.
17. Thermomixer.
18. Tube rocker.
19. Microcentrifuge.
2.2 SDS-PAGE 1. 4–20% precast SDS-PAGE gels.

and Tryptic Digestion 2. SDS-PAGE gel electrophoresis equipment.
of Proteins
3. SDS-PAGE running buffer: 25 mM Tris, 192 mM glycine,
0.1% SDS, pH 8.3.
4. Protein ladder molecular weight standards.
5. Staining trays.
6. Fixing solution: 50% ethanol–7% acetic acid.
7. Staining solution: 40% methanol, 3% (v/v) phosphoric acid,
17 g ammonium sulfate, and 0.07 g of Coomassie G-250.
Make up volume to 100 ml using milliQ water.
8. Light box.
9. Speed vacuum concentrator (SpeedVac).
10. Clean sterile 1.5 ml tubes.
11. Solution 1: HPLC grade water.
12. Solution 2: 50 mM ammonium bicarbonate solution in 50%

methanol.
13. Solution 3: 50 mM ammonium bicarbonate solution in 50%
acetonitrile.
14. Solution 4: 100% acetonitrile.
15. Solution 5: 25 mM DTT in 50 mM ammonium bicarbonate
solution.
16. Solution 6: 55 mM iodoacetamide in 50 mM ammonium
bicarbonate solution.
17. Solution 7: 0.01% protease max surfactant in 50 mM ammo-
nium bicarbonate solution.
18. Solution 8: Trypsin gold (12 ng/μl) in solution 7.
19. Water bath sonicator.
20. 2.5% trifluoroacetic acid (TFA).
21. Scalpel, razor, or GridCutter.
22. Orbital shaker.
23. Thermomixer.
24. Gel imaging equipment.
25. Vortexer.
3 Methods
3.1 Sample 1. Clone the HSV-1 gene encoding desired viral bait protein from
Preparation viral genome or other DNA source (e.g., plasmid containing
gene of interest) into the BioID vector using standard methods
[13]. Vectors for both N-terminal BirA and C-terminal BirA
are available from Addgene (see Note 1).
2. Plate cell line of choice (e.g., HEK293) at a rate of 2.5 million
cells per 10 cm plate, three plates per experimental condition
3. Approximately 24 h after plating, when cells reach ~70% con-
fluency, replace the culture medium with fresh culture medium
containing 50 μm of biotin. Transfect the cells with BirA fusion
constructs using appropriate transfection reagent according to
the manufacturer’s instructions.
4. Incubate the cells for an additional 24 h. The cells should reach
90% to 100% confluency by the time of lysis (see Note 4).
5. Remove growth medium from plates by aspiration and wash
plates with 10 ml of PBS followed by aspiration.
6. Repeat the PBS wash and aspiration procedures in step 5
above.
7. Add 5 ml PBS to each plate and using a clean cell scraper, scrape
the cells from the plates, transfer into 15 ml conical tubes, one
tube per treatment.
8. Add 5 ml PBS again to the plates, remove any cells still in the
plates by pipetting and transfer solution to the 15 ml conical
tube containing the cell suspension from step 7 above.
9. Centrifuge at 1000 g for 10 min at 4 C to pellet the cells.
10. Aspirate PBS from the tubes using a Pasteur pipette leaving
some PBS above the pellet.
11. Gently use a 200 μl pipette to remove any residual wash buffer
in the tube.
12. Keep the pellets on ice and proceed to lysis step (see Note 5).
3.2 Cell Lysis 1. Thaw the cells on ice if frozen.

2. Add 1.8 ml of BioID lysis buffer containing freshly added DTT
and protease inhibitor cocktails.
3. Gently pipette up and down a few times until the pellet is
uniformly suspended. Do not vortex or let the solution froth.
4. Keep on ice for 15 min for complete lysis of cells.
5. Sonicate in a water bath sonicator for 20 min using a 30 s on
30 s off cycle on high (see Note 6).
6. Repeat sonication as necessary until all cell clumps have gone
into the solution and the viscosity of the solution has been
reduced for pipetting (see Note 7).
7. Add an equal volume of 50 mM Tris pH 7.6 to dilute the
detergent concentration facilitating affinity capture.
8. Using a precooled tabletop microcentrifuge, centrifuge at
20,000 g for 15 min at 4 C to pellet insoluble material (see
Note 8).
9. Carefully transfer the top 90% of the supernatant into another
clean tube and label appropriately. At this point, the superna-
tant can be used or stored at 20 C for later use.
3.3 Affinity Pulldown 1. Obtain protein concentration of lysate using appropriate

and SDS-PAGE method (see Note 9).
2. Transfer cell lysates corresponding to 2.5 mg of protein into a
clean microcentrifuge tube and keep on ice.
3. Equilibrate streptavidin beads using 200 μl of streptavidin
magnetic beads per sample (see Note 10).
4. Transfer the equilibrated beads to the cell lysates. Incubate
with end-over-end mixing at room temperature for 1–2 h or
keep at 4 C for overnight incubation.
5. Transfer the tubes into a magnetic rack and wait for 3–5 min
until all the beads are settled to the magnet and the lysate looks
clear. Carefully remove the supernatant from the tubes and save
labeled flow-through (see Note 11).
6. Wash the beads using wash solution 1. Add 1 ml of wash
solution 1 and rock on a revolving rocker for 5 min. Transfer
the tubes into the magnetic rack and wait for 3–5 min until the
solution is clear. Carefully remove the supernatant without
disturbing the beads. Repeat this step one more time.
7. Repeat wash steps one time each using wash solution 2 then
3, and then twice using wash solution 4 for a total of 4 addi-
tional washes.
8. Remove supernatant and add 200 μl of wash solution 4. Keep
the tubes on ice and let the beads settle to the bottom of
the tube.
9. Centrifuge the tubes at 5000 g for 5 min. Immediately
remove all the supernatant solution. If you wait, the pellet
will dislodge and beads may be lost.
10. Elute the bound proteins using the elution buffer. Add 30 μl of
elution buffer to the tubes and mix well. Boil the beads on a
heat block at 95 C for 5 min. Repeat the elution using 20 μl
of elution buffer and combine with the previous elution (see
Note 12).
11. Resolve the eluted proteins on a 4–20% polyacrylamide
SDS-PAGE gradient gel (see Note 13).
3.4 Protein Staining 1. Once SDS-PAGE running has finished, gently remove the gel
and place into a clean container restricted to Coomassie stain-
ing use for proteomics only (see Note 14).
2. Wash the gel with HPLC grade water for 10 min with gentle
rocking on an orbital shaker.
3. Fix the gel using fixing solution: add sufficient amount of fixing
solution to cover the gel with gentle rocking for 1 h to
overnight.
4. Wash the gel three times 30 min each using ultrapure water
with gentle rocking on an orbital shaker. Use an abundant
amount of water.
5. Stain the gel: add sufficient amount of colloidal Coomassie
staining solution and incubate with a gentle rocking on an
orbital shaker for at least 1 h.
6. Destain in ultrapure water for 30 min and remove the water.
Repeat washing by placing some Kimwipes in the corner of
the tray and then shake gently overnight. The next day, remove
Kimwipes and replace the wash solution with fresh solution. If
necessary, continue rocking until gel is clear of nonspecific

staining.
7. Image the gel on an ImageQuant LAS 4000 (GE) or similar gel
imaging system.
8. Proceed to gel processing, step 1 in Subheading 3.5 (see
Note 15).
3.5 In-Gel Trypsin 1. Cut the Coomassie stained gel lanes into equal fractions using a
Digestion clean razor or commercially available metal grids (GridCutter).
Each fraction should be further cut into smaller pieces of
1 mm3 in size (see Notes 16 and 17).
2. Transfer the slices into a clean 1.5 ml tube containing 750 μl of
solution 1.
3. Wash the gel slices for 30 s with gentle shaking or vortexing.
4. Once settled, remove the water, using long tips (typically used
for loading samples into SDS-PAGE gels). Destain the gel slices
by adding 500 μl of solution 2 per slice. Incubate 10 min with
gentle shaking as before (see Note 18).
5. Remove the solution, and repeat step 4 several times until
complete destaining is achieved.
6. Add 500 μl per of solution 3 to each tube and place on a shaker
for 5 min.
7. Dehydrate the gel slices by adding 200 μl of solution 4 for
1 min. The dehydrated slices should now be translucent, whit-
ish, and hard. Hold the gel pieces up to the light to ensure that
no blue stain remains. Repeat this step if needed.
8. Remove acetonitrile by pipetting, and further dry the slices in
a SpeedVac with precooled evaporation trap for 10 min (see
Note 19).
9. Reduction: Add 100–200 μl per slice of freshly made solution
5 (enough to cover the gel slices once they rehydrate) (see
Note 20). Incubate at 56 C for 20 min in thermomixer set
to 500 RPM. Turn on the SpeedVac cooling trap.
10. Alkylation: Remove the DTT and add the same volume of
freshly made solution 6. Incubate in the dark at room temper-
ature for 20 min (see Note 21).
11. Remove iodoacetamide solution and wash with 500 μl per slice
of ultrapure water by vortexing briefly. Discard supernatant
and repeat wash step twice.
12. Remove water and wash slices again with 200 μl per slice of
solution 3 for 5 min with shaking.
13. Discard supernatant and dehydrate gel slices with 200 μl per
slice of solution 4 for 5 min with shaking.
14. Remove supernatant and then dry the gel slices again in the
SpeedVac for 10 min at room temperature.
15. Place the tubes on ice (or freeze the samples at 80 C to use
later).
16. Make fresh solution 7 and solution 8. The working concentra-
tion of ProteaseMax solution is 0.01% (solution 7) should be
kept on ice and used within several hours (i.e., it is not very
stable); any excess should be discarded, do not freeze. The final
concentration of Trypsin Gold is 12 ng/μl (see Note 22). Add
100 μl of solution 8 to each tube. Keep the tubes on ice for
5 min. Solution 8 must cover the gel slices after they rehydrate.
Otherwise add sufficient amount of solution 8.
17. Overlay with 50 μl of solution 7 per tube, and place in thermo-
mixer for 3 h at 37 C with shaking at 500 rpm (see Note 23).
18. Quench the trypsin by adding TFA to a final concentration of
0.5%. Mix and keep the tubes on ice.
19. Once digestion is complete, transfer the digestion mixture
containing peptides into a clean 1.5 ml tube.
20. Add 200 μl of solution 3 into the tubes containing gel slices
and sonicate for 5–10 min. (This will facilitate the maximum
recovery of digested peptides.) Transfer the peptide solution
into the tube containing previous digests.
21. Centrifuge at 21,000 g for 5 min to remove ProteaseMax
polymers (see Note 24).
22. Transfer supernatant into new 0.6 ml tubes.
23. Snap-freeze samples in dry ice and then dry in a SpeedVac to
completion at room temperature (~2–3 h). Do not over dry
samples as peptides may be lost.
24. Wrap tubes with Parafilm and store samples at 80 C until
mass spectrometry analyses are performed.
3.6 Mass Investigators may use any mass spectrometer available to their
Spectrometry and Data studies, but we recommend using more advanced and sensitive
Analysis machines like an Orbitrap or better. We use an Orbitrap-QExactive
mass spectrometer from Thermofisher. The sensitivity of the mass
spectrometer is highly significant as biotin labeling is extremely
efficient to tag even weak interactors. Therefore, a number of true
interacting proteins can be present in low stoichiometry. Proteome
discoverer from Thermofisher is a powerful platform that allows
researchers to utilize multiple search algorithms to maximize the
number of protein identifications. Nevertheless, the use of a single
search programs like Sequest or Mascot can reveal a significant
number of potential protein interactions. Researchers can also cus-
tomize the search algorithms and analysis programs based on their
needs and downstream use of the data generated.
One method to identify less abundant proteins is more

in-depth fractionation of the sample. Instead of cutting gels into
five equal parts, using an approach based on the intensity of Coo-
massie staining to take additional fractions will help decrease the
complexity of the samples prior to mass spectrometry analysis and
help to introduce fewer unique peptides in each LC-MS/MS run.
This will aid in the detection of less abundant peptides as most
acquisition methods select the most abundant peptides in a sample
for further analysis. This type of approach will generate hundreds
and sometimes thousands of protein identifications, some of which
can be contaminating proteins including those that bind nonspe-
cifically to the affinity matrix. Therefore, to focus on the potential
interactions with the highest probability of being significant and
biologically relevant, quantitative proteomics techniques like label-
free spectral counting or isotope labeling-based approaches are
frequently used [15, 16]. With these approaches, peptide ratios
are obtained for each protein identified in the target protein com-
plex compared to the control. Those proteins with the highest
ratios are more likely to be specific interactors. The details for
quantitative proteomics and 2D LC-MS/MS go beyond the
scope of this chapter but excellent articles on this topic exist and
the methods can be easily added to the workflow presented in this
chapter [17, 18].
4 Notes
1. When using BioID to identify interactions of cellular bait pro-

teins, it is recommended to genetically delete the endogenous
gene before the expression of the BirA-fusion protein. Simi-
larly, to study viral protein–protein interactions in context of
virus infection, the BirA gene should be cloned into the virus or
the gene of interest should be deleted in the viral genome prior
to expression of the exogenous fusion protein (see Chapter 8 of
this book) [19, 20]. Taking these steps will ensure the biotiny-
lation of maximum available interactors by the fusion protein
because the fusion protein will not need to compete with the
endogenous counterpart. Careful consideration should be
taken when knocking out the genes. For example, if CRISPR
technology is used to modify the gene of interest (see Chapter 9
of this book), the exogenous DNA containing the fusion con-
struct may be targeted if the genomic DNA sequences are not
mutated.
2. Approximately 3.0 mg of total protein per treatment group is
expected from three plates. If more or less protein is desired
adjust the number of plates accordingly.
3. It is difficult to determine the best control for BioID experi-

ments. Traditionally, the expression of the fusion tag alone has
been used as a control. However, the mutated BirA constructs
lack natural specificity toward the substrates and can freely
diffuse anywhere in the cell. Since BioID also includes proxim-
ity dependent labeling, there could be a high level of false
positives in transfected cell lines. To control for nonspecific
protein binding to the beads, we use untransfected HEK293
cells treated with biotin as a control. Additional controls could
include a mutant of the protein under investigation with locali-
zation or phenotypic defects.
4. An average 16–24 h of biotin incubation will result in excellent
biotinylation efficiency. However, incubation time may need to
be adjusted depending on the potential effect of overexpressed
protein on cell survival and physiology. Additionally, cell seed-
ing densities and incubation times may need to be adjusted
based on the doubling time of the cell line used in the study.
5. If you plan to process the sample later, flash-freeze the cell
pellet using liquid nitrogen or dry ice. Cell pellets can be
saved in 80 C until ready to use.
6. The use of a probe type sonicator is not recommended, as this
will lead to excessive frothing of the liquid and sample loss.
7. Depending on the quantity and viscosity of material, samples
may need to be passed through a fine needle (18.5 G to
23.5 G) multiple times to aid in sample disruption.
8. Make sure the solution is clear. A visible pellet may be present
in the bottom of the tube. If the solution is not clear of
insoluble particulates or the pellet detaches, centrifuge the
sample again to obtain a particulate free supernatant. Any
insoluble material carried through to future steps will bind to
the beads and generate false positive results.
9. Commercially available standard protein assays are available.
We routinely use the Pierce 660 protein assay for quantitation
of cell lysates. For samples with low protein quantities we
utilize a sensitive fluorescent-based protein assay from Invitro-
gen (EZQ).
10. Equilibrate the beads by adding 1 ml of BioID lysis buffer
diluted using equal volume of 50 mM Tris pH 7.6. Incubate
rotating end-over-end (using a Labnet Revolver or equivalent)
for 5 min. Then keep on magnetic racks for 5 min to settle the
beads. Then remove 1 ml of clear solution without disturbing
the beads. Repeat the process once. Then keep the tubes on ice.
11. Flow-through can be used to check the pull-down efficiency by
performing western blots using Streptavidin–HRP antibodies.
12. Save 20% of the pull-down for determining the biotinylation

and pull-down efficiency using western blots before processing
the Coomassie stained gel for mass spectrometry.
13. A precast gel is preferred, as it will reduce the potential for
contaminant proteins introduced during gel casting.
14. Keratin proteins are common contaminants identified in mass
spectrometry based proteomics. In order to minimize keratin
contamination, make sure all the reagents are ultrapure (HPLC
or mass spectrometry grade) and glassware and utensils are
properly cleaned; always wear a clean lab coat and nitrile gloves,
and whenever possible use a HEPA filtered clean PCR or
proteomics grade hood for processing the samples.
15. The gel can be stored for a few weeks at 4 C with the addition
of 0.05% sodium azide to prevent microbial growth and
contamination.
16. Wear a lab coat and make sure there is no gap between your
coat sleeve and the gloves (lab tape works well). Consider all
sources of keratin and minimize likelihood of contamination
(wool sweaters, long hair, dusty equipment, etc.)
17. Gently place the gel on the small (cleaned) light box in the
hood. Isolate the lane of interest and cut into 5 equal parts,
vertically, using a scalpel. Then, further cut each slice into
1 mm3 cubes. Using a pick or tweezers, place the 1 mm3
fractions into proteomics-grade, 1.6 ml microfuge tubes.
Care should be taken not to mix control lane with experimental
lane. Avoid cutting unstained areas. Make sure 1 mm3 size
fragments do not remain stuck on the utensils or on the sides
of 1.5 ml tubes.
18. Always use fresh stocks of ammonium bicarbonate to ensure
that the pH will be consistent and correct. At this point turn on
the SpeedVac refrigeration unit for the condensation trap (nor-
mally it will take around 30 min to cool down).
19. Place the microcentrifuge tubes with lid open. Care should be
taken while removing the tubes as the dried gel pieces will pop
out and may be lost or mix with other samples. It is recom-
mended to close all the tubes before they are pulled out of the
rotor to prevent the possibility of sample loss.
20. DTT is a reducing agent used to break down disulfide bonds
between cysteine residues.
21. Iodoacetamide alkylates free cysteines which prevents reforma-
tion of disulfide bonds.
22. Solution 7 contains ProteaseMax surfactant (Promega) that
will facilitate the efficient removal of digested peptides from
the gel slices, and Solution 8 contains solution 7 with proteo-
lytic enzyme Trypsin Gold.
23. Alternatively, if you have a larger sample size, tubes can be

incubated at 37 C in a heat block/tissue culture incubator.
24. You will not see a pellet. Aspirate against the opposite wall as
the pellet (where the pellet would be) and transfer digestion
reaction with extracted peptides into a new 0.6 ml
microcentrifuge tube.
Acknowledgments
Special thanks to Mark Rider initiating the use of the BioID

method in the lab. The method described in this chapter was
developed with the support of grants from the National Institutes
of Health (CA204621 and CA188941) awarded to D.G.M.
References
1. de Boer E, Rodriguez P, Bonte E, Krijgsveld J, domains. PLoS One 9(3):e93054. https://doi.
Katsantoni E, Heck A, Grosveld F, Strouboulis org/10.1371/journal.pone.0093054
J (2003) Efficient biotinylation and single-step 9. Li XW, Rees JS, Xue P, Zhang H, Hamaia SW,
purification of tagged transcription factors in Sanderson B, Funk PE, Farndale RW, Lilley
mammalian cells and transgenic mice. Proc KS, Perrett S, Jackson AP (2014) New insights
Natl Acad Sci U S A 100(13):7480–7485. into the DT40 B cell receptor cluster using a
https://doi.org/10.1073/pnas.1332608100 proteomic proximity labeling assay. J Biol
2. Meckes DG (2014) Affinity purification com- Chem 289(21):14434–14447. https://doi.
bined with mass spectrometry to identify her- org/10.1074/jbc.M113.529578
pes simplex virus protein-protein interactions. 10. Rees JS, Li XW, Perrett S, Lilley KS, Jackson AP
Methods Mol Biol 1144:209–222. https:// (2015) Protein neighbors and proximity prote-
doi.org/10.1007/978-1-4939-0428-0_14 omics. Mol Cell Proteomics 14
3. Zhao X, Li G, Liang S (2013) Several affinity (11):2848–2856. https://doi.org/10.1074/
tags commonly used in chromatographic puri- mcp.R115.052902
fication. J Anal Methods Chem 2013:581093. 11. Arnau J, Lauritzen C, Petersen GE, Pedersen J
https://doi.org/10.1155/2013/581093 (2006) Current strategies for the use of affinity
4. Kimple ME, Sondek J (2004) Overview of tags and tag removal for the purification of
affinity tags for protein purification. Curr Pro- recombinant proteins. Protein Expr Purif 48
toc Protein Sci. Chapter 9:Unit 9.9. https:// (1):1–13. https://doi.org/10.1016/j.pep.
doi.org/10.1002/0471140864.ps0909s36 2005.12.002
5. Kimple ME, Brill AL, Pasker RL (2013) Over- 12. Kim DI, Roux KJ (2016) Filling the void:
view of affinity tags for protein purification. proximity-based labeling of proteins in living
Curr Protoc Protein Sci 73.:Unit 9.9. cells. Trends Cell Biol 26(11):804–817.
https://doi.org/10.1002/0471140864. https://doi.org/10.1016/j.tcb.2016.09.004
ps0909s73 13. Rider MA, Cheerathodi MR, Hurwitz SN,
6. Roux KJ, Kim DI, Raida M, Burke B (2012) A Nkosi D, Howell LA, Tremblay DC, Liu X,
promiscuous biotin ligase fusion protein iden- Zhu F, Meckes DG (2018) The interactome
tifies proximal and interacting proteins in of EBV LMP1 evaluated by proximity-based
mammalian cells. J Cell Biol 196(6):801–810. BioID approach. Virology 516:55–70.
https://doi.org/10.1083/jcb.201112098 https://doi.org/10.1016/j.virol.2017.12.
7. Fairhead M, Howarth M (2015) Site-specific 033
biotinylation of purified proteins using BirA. 14. Kim DI, Jensen SC, Noble KA, Kc B, Roux
Methods Mol Biol 1266:171–184. https:// KH, Motamedchaboki K, Roux KJ (2016) An
doi.org/10.1007/978-1-4939-2272-7_12 improved smaller biotin ligase for BioID prox-
8. Miyagawa-Yamaguchi A, Kotani N, Honke K imity labeling. Mol Biol Cell 27
(2014) Expressed glycosylphosphatidylinosi (8):1188–1196. https://doi.org/10.1091/
tol-anchored horseradish peroxidase identifies mbc.E15-12-0844
co-clustering molecules in individual lipid raft
15. Sardiu ME, Cai Y, Jin J, Swanson SK, Conaway 18. Perez-Hernandez D, Gutiérrez-Vázquez C,
RC, Conaway JW, Florens L, Washburn MP Jorge I, López-Martı́n S, Ursa A, Sánchez-
(2008) Probabilistic assembly of human pro- Madrid F, Vázquez J, Yáñez-Mó M (2013)
tein interaction networks from label-free quan- The intracellular interactome of tetraspanin-
titative proteomics. Proc Natl Acad Sci U S A enriched microdomains reveals their function
105(5):1454–1459. https://doi.org/10. as sorting machineries toward exosomes. J Biol
1073/pnas.0706983105 Chem 288(17):11649–11661. https://doi.
16. Selbach M, Mann M (2006) Protein interac- org/10.1074/jbc.M112.445304
tion screening by quantitative immunoprecipi- 19. Warden C, Tang Q, Zhu H (2011) Herpesvirus
tation combined with knockdown (QUICK). BACs: past, present, and future. J Biomed Bio-
Nat Methods 3(12):981–983. https://doi. technol 2011:16. https://doi.org/10.1155/
org/10.1038/nmeth972 2011/124595
17. Miteva YV, Budayeva HG, Cristea IM (2013) 20. Richards AL, Sollars PJ, Smith GA (2016) New
Proteomics-based methods for discovery, tools to convert bacterial artificial chromo-
quantification, and validation of protein- somes to a self-excising design and their appli-
protein interactions. Anal Chem 85 cation to a herpes simplex virus type
(2):749–768. https://doi.org/10.1021/ 1 infectious clone. BMC Biotechnol 16
ac3033257 (1):64–64. https://doi.org/10.1186/
s12896-016-0295-4
Chapter 20
Preparation of Herpes Simplex Virus-Infected Primary

Neurons for Transmission Electron Microscopy
Monica Miranda-Saksena, Ross A. Boadle, and Anthony L. Cunningham
Abstract
Transmission electron microscopy (TEM) provides the resolution necessary to identify both viruses and
subcellular components of cells infected with many types of viruses, including herpes simplex virus.
Recognized as a powerful tool in both diagnostic and research-based virology laboratories, TEM has
made possible the identification of new viruses and has contributed to the elucidation of virus life cycle
and virus–host cell interaction.
While there are many sample preparation techniques for TEM, conventional processing using chemical
fixation and resin embedding remains a useful technique, available in virtually all EM laboratories, for
studying virus/cell ultrastructure. In this chapter, we describe the preparation of herpes simplex virus
infected primary neurons, grown on plastic coverslips, to allow for sectioning of neurons and axons in their
growth plane. This technique allows for TEM examination of cell bodies, axons, growth cones and
varicosities, providing powerful insights into virus–cell interaction.
Key words Transmission electron microscopy, Neurons, Herpes simplex virus, Axons, Growth cones
1 Introduction
For decades, transmission electron microscopy (TEM) has been a

powerful tool in medical virology for the discovery of many viruses
and the diagnosis of known and new viral infections. In recent
years, TEM has also been both essential and complementary to
other imaging techniques (fluorescence microscopy, confocal
microscopy, and live-imaging microscopy), for investigations of
the mechanisms of virus infection of human, animal, and plant
cells, including virus entry and replication within the host cell and
virus–host cell interactions [1].
TEM utilizes similar optics and principles as a compound
microscope [2, 3]. Both microscopes use a system of condenser
lenses to converge electromagnetic radiation from a tungsten fila-
ment onto a specimen. The illumination transmitted through the
specimen is focused into an image that is subsequently magnified
343
344 Monica Miranda-Saksena et al.
first by an objective lens system followed by further magnification

by a series of intermediate and projector lenses [2]. The resolution
of a compound microscope is limited to half of the wavelength of
the radiation used for imaging. Resolution refers to the ability to
discriminate two closely placed structures that may otherwise
appear as one. When visible light with wavelength of 400–800 nm
is used, the maximum resolution achieved is approximately
200 nm. On the other hand, TEM can achieve over one thousand
times the resolution of the compound microscope with a resolution
of approximately 0.1 nm in standard instruments (aberration cor-
rected microscopes can achieve resolution in the order of 0.05 nm)
[2, 3]. The TEM offers superior resolving power because it uses a
high voltage electron beam to project electrons through very thin
sections of tissue or cells to create a two-dimensional transmitted
image on a phosphorescent screen. The wavelength of electrons is
approximately 0.005 nm, which is about 100,000 times shorter
than the wavelength of visible light photons used in light or com-
pound microscopes. The beam of electrons in TEM goes through
electromagnetic fields generated by solenoids, which work as lenses
to focus the electron beam under high vacuum [2, 3].
All biological specimens, tissues or cells for examination under
TEM require preparation as they will be subjected to high vacuum
and the quality of the final images is dependent upon each of the
steps involved in the preparation procedure. Tissue preparation for
TEM is generally divided into eight main steps: primary fixation,
washing, secondary fixation or postfixation, dehydration, infiltra-
tion with transitional solvents, infiltration with resin, embedding,
and curing.
For potentially infectious materials, chemical fixation with glu-
taraldehyde or formaldehyde (or a combination of both) is most
commonly used. The main purpose of fixation is to preserve the
size, shape, and internal three-dimensional structure or organiza-
tion of the living tissue with minimal alteration from the living
state. Fixation is also critical to protect the tissue against disruption
during the processing steps and subsequent exposure to the elec-
tron beam [2, 4]. Osmium tetroxide prepared in physiological
buffers is generally used for the secondary or post-fixation step.
Osmium tetroxide works as a lipid fixative and stain to provide
density and contrast to the specimen in addition to stabilizing
proteins during the dehydration steps [2].
Dehydration of the specimen is performed to replace water
within the cell or tissue with a dehydrating agent such as ethanol
or acetone which acts as an intermediate solution between the
hydrophobic embedding solutions and the aqueous component
of the cells or tissues. Dehydration for TEM is usually performed
gradually after post-fixation through a series of solutions of graded
ethanol and/or acetone.
Preparation of HSV-1 Infected Neurons for TEM 345
Infiltration of the tissue with resin is also performed gradually

to replace the ethanol or acetone with resin monomers. In our
studies, we use a two-step infiltration process by first infiltrating
the cells or tissue with resin and ethanol at a 1:1 ratio, followed by a
gradual infiltration with a low-viscosity resin to allow for rapid
embedding of the tissue. The tissue is then placed in molds and
embedded in liquid resin, which will be polymerized to form a solid
matrix that should thoroughly permeate the tissue. After polymeri-
zation, the tissue will be solid and stable indefinitely at room
temperature.
In this chapter, we describe the processing of primary neuronal
cultures in situ on plastic Thermanox coverslips for TEM and ultra-
thin sectioning of cultures in their growth plane to yield longitudi-
nal sections of axons and neurons. This technique allows for the
visualization of viral capsids and enveloped virions in long regions of
mid-distal axons and clearly identifies axonal varicosities and growth
cones. We have used this technique in order to examine herpes
simplex virus type 1 (HSV-1) retrograde and anterograde axonal
transport, virus entry, assembly, and egress from mid to distal
regions of both human fetal and rat neonate sensory axons [5–8].
2 Materials
Prepare all solutions in a fume cabinet using dH2O at room tem-

perature and store solutions at 4 C (unless specified otherwise).
Many of the materials used for electron microscopy are toxic
and/or carcinogenic; therefore, wear suitable protective clothing
and follow material safety data sheets for handling and disposal of
waste. Label and date solutions, and note that some solutions will
expire within 1–4 weeks. The regulations regarding disposal of
hazardous substances varies between countries. Check local regula-
tions regarding disposal of any unused or spent reagents used in this
method.
2.1 Cells, Viruses, 1. Biological safety cabinet (Class II).

and Cell Culture 2. Primary cultures of neurons: Any type of neurons, that is,
Materials dorsal root ganglia or superior cervical ganglia (dissociated or
explanted) from chick, rat, mouse, or human can be used for
this technique. Grow the neuronal cultures on Thermanox
plastic coverslips (11–13 mm diameter) inside 24-well tissue
culture plates (see Note 1). For our studies, neuronal cultures
are prepared accordingly to Saksena et al. [5] (see Fig. 1).
3. Herpes simplex virus: Any strain, wild type or deletion mutant
viruses, can be used (see Note 2).
4. Thermanox plastic coverslips (see Note 1).
5. 24-well tissue culture plates.
Coverslips with DRG cultures in situ are

fixed and processed to epoxy resin
Areas of interest such as mid to distal axons

are selected, sectioned, and placed on grids
Fig. 1 Schematic diagram showing the fixation and processing of DRG cultures in
situ for TEM. DRG cultures on coverslips are fixed using modified Karnovsky’s
fixative and then processed with epoxy resin. Following resin polymerization,
specific areas in the blocks (such as mid to distal axons) are selected, trimmed
to a suitable size for ultrathin sections, and collected on suitable grids for
ultrastructural examination (Adapted with permission from [5])
6. Neuronal medium: Any suitable growth medium for culture of

primary neurons. This will depend on the type of neurons you
are using. For our studies, we prepare Neurobasal® Medium
(Life Technologies) plus 2% B-27 supplement (Life Technolo-
gies), 200 mM L-glutamine, 100 ng/ml of 7S nerve growth
factor, and 5 ng/ml brain-derived neurotrophic factor.
2.2 Solutions 1. Combined aldehyde fixative (Karnovsky-modified): Combine

for Electron 20 ml of 25% glutaraldehyde (EM grade), 30 ml of 16% form-
Microscopy aldehyde (EM grade), 20 ml of 1 M MOPS buffer stock solu-
tion, and 100 ml of dH2O. Adjust the pH of the solution to 7.4
with 1.0 M NaOH, and the final volume to 200 ml with
dH2O. Store at 4 C and discard any unused solution after
5 days.
2. 1 M 3-(N-morpholino)propane sulfonic acid (MOPS) buffer
stock solution: Weigh 209.27 g of C7H14NO4SNa and 0.8 g of
sodium azide (NaN3) and dissolve in 1 L of dH2O. Store at
4 C.
3. MOPS buffer working solution: Add 100 ml of MOPS buffer
stock solution to 800 ml of dH2O. Adjust pH to 7.4 with 1 M
NaOH and make up to 1 l with dH2O. Store at 4 C.
4. 1 M sodium cacodylate buffer stock solution: Weigh 53.5 g of
sodium cacodylate to 200 ml of dH2O. Mix the solution gently
and adjust the final volume to 250 ml. Store the solution at
4 C.
5. 5% osmium tetroxide stock solution: In a fume hood, add 2 g
of osmium tetroxide crystal to 40 ml of dH2O. Mix gently and
leave in the fume cabinet for 1 day. Store at 4 C. The solution

is stable while it retains a straw-like color and must be stored in
a second unbreakable container with an O-ring cap.
6. 2% osmium tetroxide in 0.1 M cacodylate buffer: Combine
4 ml of 5% osmium tetroxide stock solution, 1 ml of 1 M
sodium cacodylate buffer stock buffer, and 0.62 ml of 0.1 M
hydrochloric acid. Make up the final volume to 10 ml with
dH2O. Store the solution at 4 C. The solution remains stable
while it retains a straw-like color and must be stored in a second
unbreakable container with an O-ring cap.
7. 2% aqueous uranyl acetate: Add 0.5 g of uranyl acetate to 25 ml
of dH2O. Mix the solution on a magnetic stirrer until dissolved
and store at 4 C, protected from light.
8. 50% ethanol plus 0.1% NaCl: Add 0.5 g of NaCl to 250 ml of
dH2O and mix well. Then, add 250 ml of absolute ethanol.
Mix well and store in a low-density polyethylene solvent vent-
ing wash bottle at room temperature.
11. Absolute ethanol (see Note 3).
12. Low-viscosity epoxy resin of medium hardness: Prepare resin
according to manufacturer’s instruction given in the kit. This
usually involves mixing the components of the kit in the speci-
fied order. Store at 20 C in an amber, screw top glass bottle
for 2 weeks (the viscosity of the resin increases with time even
at low temperatures) (see Note 4).
13. Resin/ethanol mixture: Mix equal volumes of resin and abso-
lute ethanol and mix well by gentle inversion. Polymerize
unused solution in the oven at 70 C before discarding (see
Note 4).
14. 1% methylene blue in 1% borax: Add 10 g of methylene blue
and 10 g of sodium tetraborate to 1000 ml of dH2O. Filter
through a fluted filter paper and store in a stock bottle at room
temperature.
15. 4% uranyl acetate solution: Add 2 g of uranyl acetate to 50 ml
of dH2O in a glass beaker. Add a stirring bar, place on a
magnetic stirrer and cover with aluminum foil. Mix until the
mixture goes into solution. Transfer the solution to an amber,
screw top glass bottle and store at 4 C.
16. 2% uranyl acetate in 50% ethanol: Mix 0.5 ml of 4% uranyl

acetate solution and 0.5 ml of absolute ethanol in an Eppen-
dorf tube. Centrifuge at 7000 g in a microcentrifuge for 60 s
to remove any precipitate. Prepare the solution immediately
before use and discard remaining unused solution.
17. Reynolds lead citrate solution: Add 1.33 g of lead citrate [PB
(NO3)2] and 1.76 g of trisodium citrate
[Na3(C6H5O7)·2H2O] to 30 ml of sterile dH2O in a 50 ml
volumetric flask. Shake the solution vigorously for 1 min and
then allow it to stand for 30 min with intermittent shaking to
allow for the complete conversion of lead nitrate to lead citrate.
Add 8 ml of freshly prepared 1 M sodium hydroxide, mix the
solution gently, and observe that the solution becomes clear.
Make the volume to 50 ml with sterile dH2O and mix the
solution by inversion. Store in a septum closed bottle at 4 C.
Discard after 6 months.
2.3 Equipment 1. Nonrecirculating fume cabinet.

and Components 2. Laboratory oven.
for Electron
3. Wheaton vials with caps.
Microscopy
4. 40 mm petri dishes (plastic or glass).
5. Chien molds (Ted Pella, CA, USA) (can also use any silicon
mold that can sit under the coverslip).
6. Emery board.
7. Acrylic mounting cylinders or stubs (Ted Pella, CA, USA).
8. Quick setting epoxy adhesive.
9. Single-edge razor blade.
10. Dumont #4 fine forceps.
11. Ultramicrotome holder.
12. Ultramicrotome.
13. Glass knives for trimming and semithin sectioning.
14. Microscope glass slides.
15. Hot plate for glass slides (set at 80 C).
17. Microcentrifuge.
18. Eppendorf tubes.
19. 35 or 45 diamond knife for ultrathin sectioning.
20. EM grids (i.e., 300/400 mesh thin bar copper grid).
21. Whatman filter paper, grade 50, round 42.5 mm.
22. Chemical resistant containers.
23. Corn oil (see Note 5).
3 Methods
3.1 Processing 1. This method is design for processing neuronal cultures for
of Neuronal Cultures TEM to visualize neurons in their growth plane (i.e., in longi-
for Infiltration tudinal sections). For this, the neuronal cultures need to be
with Epoxy Resin grown on Thermanox plastic coverslips (11–13 mm diameter)
inside 24-well tissue culture plates (Fig. 1) (see Note 1).
2. Inside a biological safety cabinet (Class II), fix cultures on
coverslips by removing the culture media and washing the
cultures twice with 1 ml of MOPS buffer per well. Then, add
1 ml of modified Karnovsky’s fixative per well and leave for 1 h
at room temperature or overnight at 4 C.
3. Wash twice in MOPS working buffer solution. Transfer the
culture plates to a fume cabinet to carry out all the subsequent
steps.
4. Remove MOPS buffer and add 0.5 ml of 2% buffered solution
of osmium tetroxide (in cacodylate buffer) per well and leave
for 2 h.
5. Remove the osmium tetroxide and rinse each well in 1 ml of
dH2O. The used osmium solution should be discarded as
hazardous waste (see Note 5).
6. Add 0.5 ml of 2% aqueous uranyl acetate per well for 1 h.
Protect from light by covering the plate with a black cardboard
or aluminum foil. Remove the uranyl acetate solution and
discard as hazardous waste in a chemical resistant container
with leak proof cap according to local regulations.
7. Dehydrate the cultures in ethanol series. Add 1 ml of 50%
ethanol containing 0.1% NaCl per well and leave for 10 min.
Then, remove the 50% ethanol solution and add 1 ml of 70%
ethanol plus 0.1% NaCl per well and leave for 10 min. Repeat
with 95% plus 0.1% NaCl and twice with 100% ethanol each for
10 min.
8. Infiltrate the cultures with ethanol–epoxy resin mixture (see
Note 4). Prepare a 1:1 mixture of absolute ethanol–resin in a
Wheaton glass vial (see Note 4). Remove ethanol from step 7
and add 1 ml of ethanol–resin (1:1) mixture to each well. Leave
for 1 h at room temperature. Then, transfer the coverslips (cells
side up) to a clean 24-well plate containing 0.5 ml of absolute
resin per well. Place the plate in a sealed tin, transfer to an oven,
and incubate at 70 C for 10 min (see Note 6). Remove the
resin and add another 0.5 ml of prewarmed (at 70 C) resin per
well. Incubate as before at 70 C for 10 min. Repeat for a total
of three times.
9. Prepare flat silicone or Chien embedding molds by filling each
mold with 100% resin. Depending on the size of the mold, you
may need to trim the coverslips so they fit inside the mold (see
Note 7). Embed each coverslip by transferring each coverslip
with cell side up into resin prefilled molds. Make sure that the
coverslips go all the way down to the bottom of the mold and
you have no air bubbles.
10. Place the molds inside a sealed can and transfer to an oven to
polymerize the resin at 70 C for 10 h (see Note 6).
11. After polymerization, transfer the tin to the fume cabinet and
leave the molds inside the fume cabinet overnight. Remove the
embedded blocks from the mold and transfer to prelabeled
plastic or glass petri dishes or plastic bags for storage.
3.2 Coverslip 1. Before sectioning of the resin blocks can begin, the resin blocks
Removal need to be placed on acrylic mounting cylinders or stubs. To
and Ultramicrotomy facilitate the mounting of the resin block to the stub, use an
emery board to abrade the side of the resin block opposite to
the side containing the coverslip with cultures and also one side
of the stub (see Note 8).
2. Add quick setting epoxy adhesive to the abraded sides on the
resin block and stub. Place the resin block on top of the stub
and allow the two pieces to bond overnight in the fume
cabinet.
3. Place the resin block into a suitable ultramicrotome holder.
Using a clean single-edge razor blade, trim and shape the
resin block to form a trapezoid.
4. Once you have shaped the block, the coverslip edge, embedded
in the resin, is visible. Gently remove the excess resin on top of
the coverslip using the same blade and expose the coverslip. For
best results, place the edge of the blade directly on top of the
edge of the coverslip visible on the resin block.
5. Gently peel off the coverslip using a #4 forceps. The coverslip
usually peels off in one piece leaving the cells in the resin block.
Alternatively, you can use a glass knife to section the coverslip
(see Note 9).
6. Using a glass knife cut one or two semithin sections (150 nm
thick), place the sections on a microscope glass slide, and allow
to dry on a hot plate (set at 80 C) for 30 min.
7. Stain the sections with 1% methylene blue in 1% borax for
2 min at 80 C in a hot plate. Examine the sections using a
light microscope to visualize the neuronal cell bodies or axonal
processes (see Note 10).
8. Select the area of interest and further trim the face of the resin
block to a size suitable for ultrathin sections (Fig. 1).
9. Cut ultrathin sections (70–80 nm) using a 35 or 45 diamond

knife and collect the sections on suitable grids (300/400 mesh
thin bar copper grids) (see Fig. 1).
10. Stain the sections on droplets of 2% uranyl acetate in 50%
ethanol solution protected from light for 10 min. Wash in a
stream of dH2O for ~20 s.
11. Stain with Reynold’s lead citrate for 4 min. Wash in a stream of
dH2O for ~20 s. Dry grids on #50 Whatman filter paper and
store in a petri dish until ready for ultrastructural examination.
3.3 Ultrastructural In culture, dorsal root ganglia neurons extend axons that are tipped
Examination of HSV-1 by growth cones. Axons frequently branch and extend, forming
Infected Neuronal axonal swellings, or varicosities, along their length, often in bifur-
Cultures cations. When neuronal cultures are sectioned in growth plane and
examined by TEM, axons with varicosities and growth cones can be
clearly identified by their morphology. The varicosities and growth
cones show a disruption in microtubules, have few microtubule
bundles and contain numerous vesicles of various types and sizes.
Growth cones consist of a central region containing a high concen-
tration of heterogeneous vesicles (clear and dense core vesicles),
mitochondria, and a peripheral domain rich in actin filaments
[9–12].
HSV-1 capsids, with or without an envelope, in infected axons,
neuronal cell body and nonneuronal cells can be identified by
electron microscopy because of their distinct morphology. How-
ever, as numerous membranous vesicles are also present in axons,
varicosities, and growth cones, we follow a set of specific criteria in
order to clearly identify and distinguish viral capsids from membra-
nous vesicles (Fig. 2) [5, 6].
Capsids without an envelope can be distinguished on the basis
of their size (approximately 125 nm in diameter) [13], thicker
structure of the viral capsid compared to vesicle walls, and
electron-dense DNA cores (Fig. 2) [5, 6]. A viral capsid has a
complex internal structure, whereas a membranous axonal vesicle
has a homogeneously dense center surrounded by a clear halo and is
enclosed in a single membrane [14]. Enveloped capsids are identi-
fied based on their size (170 to 220 nm in diameter) [15], an
electron-dense core or capsid, a well-developed tegument layer,
and two distinct membranes, representing the viral envelope and
the membrane of the enclosing vesicle (Fig. 2) [5, 6].
Overall, the methodology described in this chapter can be used
for the ultrastructural examination of any type of cell culture in
their growth plane and allows for the investigation of various events
in virus life cycle and virus–cell interactions, especially in specialized
cells like neurons.
Fig. 2 Electron micrographs of HSV-1 particles in dorsal root ganglia axons sectioned in growth plane. (a) Low
magnification of distal axons containing an enveloped (arrow with an asterisk) and an unenveloped capsid
(arrowhead) inside an axonal varicosity and numerous extracellular viral particles (arrows). (b) Enlargement of
(a) showing the viral particles inside the varicosity. (c) Unenveloped capsids (white arrowheads) in an axon and
in a varicosity (black arrowheads). (d) Enlargement of (c) showing the viral particles. Bars, 200 nm
4 Notes
1. The coverslips used in our studies are Thermanox plastic cover-

slips, which are resistant to the chemicals used in processing for
electron microscopy and can withstand the temperatures
required for resin polymerization. These coverslips have the
advantage that they can be sectioned using an ultramicrotome
or can be peeled off the resin without the need to use solvents.
2. For our studies, neuronal cultures are infected with HSV-1
after 4–5 days in culture with 5 105 PFU/0.5 ml per well.
After 2 h, the virus inoculum is removed and the cultures are
washed twice with fresh medium. The cultures are incubated at
37 C with 5% CO2 for times ranging between 2–4 and or

16–30 h post infection before fixation.
3. The absolute ethanol must be anhydrous for embedding of
cells or tissue using epoxy resins. You can add type 3A molecu-
lar sieves to the stock bottle. In addition, store absolute ethanol
in small volumes (i.e., 200–400 ml) in screw cap bottles.
4. For our studies, we use a low-viscosity epoxy resin of medium
hardness. As epoxy resins are hazardous substances, use or
prepare a minimal amount as needed. It is important to note
that the viscosity of the resin increases with time even at low
temperatures hence discard after 2 weeks once prepared. Waste
resin should be polymerized before discarding.
5. Used or spent osmium tetroxide should be discarded by mixing
with corn oil (one part osmium to three parts corn oil) in a
chemical resistant container with a leak proof cap. The waste
bottle should be clearly labeled and disposed by an approved
waste contractor according to local regulations.
6. Refer to the manufacturer’s instructions for storage conditions
and optimal polymerizing temperature of the resin. Set the
oven temperature and time accordingly.
7. The coverslips can be trimmed with curved scissors to fit the flat
embedding mold prior to using them for culturing neurons.
The coverslips can also be trimmed prior to the resin-
embedding step (see Subheading 3.1, step 9); however, it is
harder to do at this step as the coverslips are slippery and can be
easily dropped.
8. For our studies, we first trim the resin block with a fine jeweler’s
saw to select the areas of interest in the neuronal cultures such
as distal axons (see Fig. 1) [5]. Trimming the resin block
reduces the size of the resin block to facilitate the mounting
onto stubs. The flat embedding molds used in our studies are
approximately 13 mm in diameter whereas the stubs are 6 mm
in diameter. In addition, this step will also facilitate the shaping
and trimming of the resin block during ultramicrotomy. Take
care to avoid breathing the fine resin filings when sawing resin
blocks. The resin filings should be carefully collected and
disposed.
9. You can section the coverslip using a glass knife but this needs
to be done slowly by setting the ultramicrotome to cut 150 nm
thick sections. Careful attention is needed not to section into
the cells.
10. This method involves sectioning neuronal cultures in the
growth plane and the axonal processes are much thinner than
the cell bodies or ganglia (if explants are used) and are often in
a separate plane from cell bodies. Therefore, it is best to cut one
or two semithin sections at a time until you see the first profiles
of axonal processes. Then, cut several ultrathin sections for
ultrastructural examination.
Acknowledgments
This work was supported by the Australian National Health and

Medical Research Grants (402457 and 570849), the Westmead
Millennium Institute, and the Westmead Medical Research
Foundation.
References
1. Roingeard P (2008) Viral detection by electron herpes simplex virus 1 pUS9 in virus antero-
microscopy: past, present and future. Biol Cell grade axonal transport and final assembly in
100:491–501 growth cones in distal axons. J Virol 90
2. Bozzola J, Russell LD (1999) Electron mircro- (5):2653–2663. https://doi.org/10.1128/
scopy. Principles and techniques for biologist, JVI.03023-15
2nd edn. Jones and Bartlett Publishers, 9. Tennyson VM (1970) The fine structure of the
Burlington axon and growth cone of the dorsal root ner-
3. Egerton RF (2008) Physical principles of urobalst of the rabbit embryo. J Cell Biol
ELectron microscopy. An introduction to 44:62–79
TEM, SEM and AEM. Springer, New York 10. Nakata T, Terada S, Hirokawa N (1998) Visu-
4. Griffiths G (1993) Fine structure immunocy- alization of the dynamics of synaptic vesicle and
tochemistry. Springer-Verlag, Berlin plasma membrane proteins in living axons. J
Heidelberg Cell Biol 140:659–674
5. Saksena MM, Wakisaka H, Tijono B, Boadle 11. Goldberg JL (2003) How does an axon grow?
RA, Rixon F, Takahashi H, Cunningham AL Genes Dev 17:941–958
(2006) Herpes simplex virus type 1 accumula- 12. de Kort EJ, Gribnau AA, van Aanholt HT,
tion, envelopment, and exit in growth cones Nieuwenhuys R (1985) On the development
and varicosities in mid-distal regions of axons. of the pyramidal tract in the rat. I. The mor-
J Virol 80:3592–3606 phology of the growth zone. Anat Embryol
6. Miranda-Saksena M, Boadle RA, Aggarwal A, (Berl) 172(2):195–204
Tijono B, Rixon FJ, Diefenbach RJ, Cunning- 13. Zhou ZH, Dougherty M, Jakana J, He J, Rixon
ham AL (2009) Herpes simplex virus utilizes FJ, Chiu W (2000) Seeing the herpesvirus cap-
the large secretory vesicle pathway for antero- sid at 8.5 A. Science 288:877–880
grade transport of tegument and envelope pro- 14. Holland DJ, Miranda-Saksena M, Boadle RA,
teins and for viral exocytosis from growth Armati P, Cunningham AL (1999) Antero-
cones of human fetal axons. J Virol grade transport of herpes simplex virus proteins
83:3187–3199 in axons of peripheral human fetal neurons: an
7. Aggarwal A, Miranda-Saksena M, Boadle RA, immunoelectron microscopy study. J Virol
Kelly BJ, Diefenbach RJ, Alam W, Cunning- 73:8503–8511
ham AL (2012) Ultrastructural visualization 15. Grunewald K, Desai P, Winkler DC, Heymann
of individual tegument protein dissociation JB, Belnap DM, Baumeister W, Steven AC
during entry of herpes simplex virus 1 into (2003) Three-dimensional structure of herpes
human and rat dorsal root ganglion neurons. simplex virus from cryo-electron tomography.
J Virol 86:6123–6137 Science 302:1396–1398
8. Miranda-Saksena M, Boadle RA, Diefenbach
RJ, Cunningham AL (2015) Dual role of
Chapter 21
Transmission Immunoelectron Microscopy of Herpes

Simplex Virus-1-Infected Dorsal Root Ganglia Neurons
Sectioned in Growth Plane
Monica Miranda-Saksena, Ross A. Boadle, and Anthony L. Cunningham
Abstract
Transmission immunoelectron microscopy allows for the ultrastructural detection and localization of
herpes simplex virus-1 (HSV-1) particles and viral proteins within the infected cell and their relation to
the cell cytoskeleton, cellular proteins, vesicles, membranes, and organelles. For the successful application
of immunoelectron microscopy, preservation of cell ultrastructure and of epitope antigenicity is essential
during sample preparation. This chapter describes the use of chemical fixation followed by rapid cooling of
HSV-1 infected sensory neurons in the presence of sucrose as a cryoprotectant to achieve optimal preserva-
tion of cell morphology and the use of freeze substitution and resin polymerization at low temperatures for
preservation of protein antigenicity. In order to examine HSV-1 infection in the specialized compartments
of the neurons (cell body, axons, and growth cones), neurons cultured on plastic coverslips are flat
embedded prior to resin polymerization. Overall, this method allows for the ultrathin sectioning and
immunogold labeling of the neurons and their axons in growth plane.
Key words Neurons, Herpes simplex virus-1, Transmission immunoelectron microscopy, Freeze
substitution, Flat embedding, Immunolabeling
1 Introduction
HSV-1 has evolved mechanisms for its efficient and active transport
along sensory nerves during primary and recurrent infection. This
virus transport is mediated by the interaction of viral proteins with
cellular proteins involved in intracellular trafficking and the cellular
cytoskeleton. This chapter describes the use of freeze substitution
and flat embedding approach to process lightly chemically fixed
cultures of primary sensory dorsal root ganglia grown on plastic
coverslips for examination of longitudinal sections of sensory axons
in growth plane by transmission immunoelectron microscopy
[1, 2]. This approach allows for immunolabeling studies for the
visualization of viral and cellular proteins and their association with
viral particles and vesicles along sensory axons.
355
Freeze substitution is a process which allows the

low-temperature resin embedding and polymerization of rapidly
cryoimmobilized cells and tissues for ultrastructural and immuno-
labeling studies by transmission and scanning electron microscopy
[3–6].
During freeze substitution, samples are dehydrated by
exchange of “frozen” cell water molecules for organic solvents
such as methanol at very low temperatures ( 90 C). After the
substitution process is complete usually after 30–40 h, the samples
are gradually warmed-up (still at low temperatures of 45 or
50 C) for resin embedding and polymerization. The main advan-
tage of freeze substitution is that dehydration and polymerization
steps occur at temperatures below 70 C preventing the forma-
tion of ice crystals and reducing the occurrence of morphological
and epitope changes resulting from dehydration at room tempera-
ture and heat polymerization.
Lowicryl HM20 is the embedding resin used in the freeze
substitution process described here. Lowicryl HM20 is a hydro-
phobic low-viscosity resin ideal for preservation of protein antige-
nicity when resin infiltration and polymerization are performed at
low temperatures. This resin is also suitable for flat embedding of
samples which is required for sectioning of sensory neurons and
their axons in growth plane [7].
Overall, the freeze substitution and flat embedding approach
described in this chapter provides good preservation of ultrastruc-
ture and retention of antigenicity of sensory neurons. In addition,
this methodology allows for the immunolabeling of sections of
neuronal cells and their processes in the growth plane and is also
applicable to studies utilizing any adherent cell type. This method-
ology can be adapted for single or dual immunolabeling with various
size of immunogold labeled antibodies. The immunolabel protocol
can be extended to include ultrasmall gold particles with silver
enhancement steps for both single and dual antibody combinations.
2 Materials
Freshly prepare all solutions in a fume cupboard using dH2O at

room temperature Most of the materials for electron microscopy
are toxic and/or carcinogenic; therefore, wear suitable protective
clothing and follow material safety data sheets for handling and
disposal of waste. Dispose any unused or spent solutions according
to local regulations.
2.1 Cells, Viruses, 1. Biological safety cabinet (class II).

and Cell Culture 2. Primary culture of neurons (e.g., explanted or dissociated
Materials derived from chick, mouse, rat or human embryonic or
TIEM of HSV-1 Infected Neurons 357
neonatal dorsal root ganglia). These can be grown on Therma-

nox plastic coverslips or ACLAR film (cut to size to fit multi-
well plates).
3. Herpes simplex virus: Any strain, wild-type or fluorescently
tagged or untagged.
4. Thermanox coverslips (any size to fit multiwell plates).
5. Neuronal medium: Any suitable growth medium for culture of
primary neurons. This will depend on the type of neurons you
are using. For our studies, we prepare Neurobasal® Medium
(Life Technologies) plus 2% B-27 supplement (Life Technolo-
gies), 200 mM L-glutamine, 100 ng/mL of 7S nerve growth
factor, and 5 ng/mL brain-derived neurotrophic factor.
2.2 Solutions, 1. Sterile Dulbecco’s phosphate buffered saline (PBS).

Buffers, and Fixatives 2. 4.1% formaldehyde/glutaraldehyde fixative: Combine 10 mL
for Immunoelectron of 16% paraformaldehyde (EM grade), 0.16 mL of 25% glutar-
Microscopy aldehyde (EM grade), and 28 mL of PBS. Adjust the pH of the
solution to 7.4 and the final volume to 40 mL. Use
immediately.
3. 10% gelatin solution: Dissolve 1 g of gelatin (Merck 4070) in
50 mL of warm ddH2O. Store the solution at 4 C to cool
rapidly. Cover with cold ddH2O and store overnight at 4 C.
Discard the ddH2O and warm the solution to liquefy and
aliquot.
4. 2.3 M Baker’s sucrose solution: Combine 78.73 g of
sucrose (Baker 4072), 0.2 g sodium azide (NaN3), and
60 mL PBS.
5. Anhydrous methanol.
6. Lowicryl HM20 Polar Embedding Medium Mono step resin.
7. 1% methylene blue in 1% borax: Combine 5 g of methylene
blue, 5 g of sodium tetraborate, and 500 mL of ddH2O. Filter
the solution.
8. Formvar–pioloform: Combine 0.12 g of formvar 15/95E
resin, 0.12 g of pioloform resin, and 100 mL of dry chloro-
form. Protect from light.
9. 2% aqueous uranyl acetate: Add 0.5 g of uranyl acetate to
25 mL dH2O. Mix the solution on a magnetic stirrer until
dissolved and store at 4 C, protected from light.
10. 1% aqueous uranyl acetate in 50% ethanol.
11. Reynolds lead citrate: Combine 1.33 g of lead nitrate [PB
(NO3)2], 1.76 g of trisodium citrate [Na3(C6H5O7) · 2H2O],
and 30 mL of dH2O. Mix by shaking vigorously and allow to
stand for full conversion to lead citrate. Add 8.0 mL of NaOH
and adjust volume to 50 mL.
12. 0.05 M glycine: Dissolve 0.039 g of glycine and 15 mL of PBS

and then make up the volume of the solution to 25 mL
with PBS.
13. Blocking buffer for immunolabeling: Combine 2.5 g bovine
serum albumin (BSA), 2.5 mL goat serum, 100 μL of cold-
water fish skin gelatin, 2.5 mL sodium azide (from a 200 mM
stock), and 30 mL of PBS. Adjust pH of solution to 7.4 and the
volume to 50 mL with PBS.
14. Antibody dilution buffer: 1.0 of BSAc (acetylated), 2.5 mL
sodium azide (from a 200 mM stock), and 35 mL of PBS.
Adjust pH to 7.4 and the volume to 50 mL with PBS.
15. 2% glutaraldehyde: Combine 0.8 mL 25% of glutaraldehyde
and 19.2 mL PBS. Adjust pH to 7.4.
2.3 Equipment 1. Liquid nitrogen.

for Immunoelectron 2. Leica EM AFS2 freeze substitution system.
Microscopy
3. Nonrecirculating fume cabinet.
4. Laboratory oven.
5. Leica Flat embedding molds.
6. Casting wax sheets.
7. 35 and 60 mm plastic petri plates.
8. Leica flow-through capsules.
9. Stainless-steel thimbles (12 mm diameter 15 mm depth).
10. Epoxy coated fine forceps (#3 or 4).
11. Eppendorf tubes, 0.5 mL.
12. Acrylic stubs (Ted Pella, CA, USA).
13. Glass slides.
14. Emery board.
16. Quick setting epoxy adhesive.
17. Single-edge razor blade.
18. Ultramicrotome.
19. Hot plate for glass slides (set at 80 C).
20. Gilder nickel grids.
21. #50 Whatman filter paper.
22. 60-well Terasaki plates.
23. Teflon coated glass slides with wells (Leica Microsystems).
24. Leica IGL automated immunolabeling system.
25. Glass knife.
26. Diamond knife.
3 Methods
This chapter describes the freeze substitution of chemically fixed

mock and HSV-1 infected DRG cultures grown on Thermanox
coverslips. The entire process takes around 6 days in which cultures
are rapidly frozen in liquid nitrogen followed by dehydration of the
tissue in methanol at 90 C, substitution of the methanol to
HM20 Lowicryl resin and subsequent resin polymerization at
45 C. The process is described here day-by-day following the
fixation of HSV-1 infected DRG cultures.
3.1 Freeze 1. Fix cultures using 4.1% formaldehyde/glutaraldehyde fixative

Substitution for 1 h at room temperature inside a biological class II cabinet.
Remove the fixative and wash the cells with PBS. The cultures
3.1.1 Day 1: Cell
can be stored at 4 C for couple of days until ready to start the
Fixation, Gelatin
freeze-substitution process.
Encapsulation,
and Sucrose Protection 2. Place coverslips cell side up in a 60 mm plastic petri plate
containing PBS. Cut coverslips into rectangular strips to fit
completely inside flat embedding molds (Fig. 1 step A) (see
Note 1).
3. Make a cut on the right-hand corner of the coverslip to indicate
which side the cells are up (Fig. 1 step A) (see Note 2).
4. Drain the coverslip strips by gently tapping on to filter paper
and dip them into an Eppendorf tube containing 10% gelatin in
PBS (Fig. 1 step B).
5. Drain the excess gelatin by gently tapping onto filter paper and
place the coverslip strips (cell side up) on a casting wax sheet cut
to fit inside a large petri dish. Place some wet paper on a side
and cover with lid to create a humidity chamber. Leave at room
temperature for 20 min. Store at 4 C for couple of hours.
6. Transfer the coverslip strips to Eppendorf tubes containing
2.3 M Baker’s sucrose and leave at room temperature for at
least 1 h. Store at 4 C overnight (see Note 3).
3.1.2 Day 2: Freezing 1. Prepare the Leica EM AFS2 according to manufacturer’s

of Samples instructions. Briefly, the AFS2 is filled with liquid nitrogen
and then the system is warmed up to 50 C to dry away any
moisture. The AFS2 is programmed to cool down to 90 C.
Once the AFS reaches 90 C, the machine is placed on Pause
(see Note 4).
2. Place chamber for capsules (provided with the AFS2 system)
containing flow-through capsules inside the AFS. Fill the flow-
through capsules with absolute methanol and allow to cool for
30 min (see Note 5).
A B C
G F E
Fig. 1 Schematic diagram showing the processing of DRG cultures in situ for immunolabeling using freeze
substitution. (a) After fixation, DRG cultures on coverslips are trimmed into strips and the cell side is marked
with a cut on the right-hand side of the strip. (b) The strips are placed inside Eppendorf tubes containing
gelatin and sucrose for cryoprotection. (c) The trips are rapidly plunged into liquid nitrogen inside a small
stainless-steel thimble. (d) The frozen strips are then transferred inside the Leica AFS2 where the samples are
dehydrated in methanol (at 90 C) and infiltrated with Lowicryl HM20 resin (at 45 C). (e) The strips are
then transferred to flat embedding molds where the resin is polymerized under UV-light inside the Leica AFS2.
(f) Following resin polymerization, the coverslip is removed and the block trimmed to a suitable size for
ultrathin sections and (g) collected on Gilder nickel grids for immunolabeling
3. While the methanol is cooling, place a dry stainless-steel thim-

ble inside a foam cup containing liquid nitrogen. Using pre-
cooled fine forceps hold the strip by the handling edge and
rapidly plunge into liquid nitrogen inside the thimble. Release
the strip from the forceps by gentle tapping (Fig. 1 step C).
4. Transfer the coverslip strip into a flow-through capsule using
precooled forceps. Repeat steps 3 and 4 for each coverslip strip
(Fig. 1 step D).
5. Once all the samples have been transferred to the AFS2, the
machine can be set to start the freeze substitution program.
Our substitution program takes place according to the follow-
ing protocol: 0.5 h at 50 C, 40 h at 90 C (in methanol), 9 h
from 90 C to 45 C (rate: 5 C/h), 18–20 h at 45 C
(methanol to resin changes), 48 h at 45 C
(UV polymerization).
3.1.3 Day 3: Infiltration 1. Once the temperature of the AFS has reached 45 C, remove
with Resin the methanol and replace with fresh precooled methanol. Leave
for 30 min.
2. Start the infiltration process by removing the methanol and
then adding precooled HM20 Lowicryl resin in a grade mix-
ture of 2-parts methanol:1-part HM20 resin for 2 h, 1-part
methanol:1-part HM20 resin for 2 h and absolute resin over-
night at 45 C. Remember to precool each solution first.
3.1.4 Days 4–6: UV 1. Replace with fresh precooled HM20 Lowicryl resin for 30 min.
Polymerization Then, transfer the coverslip strips (cell side up) to a precooled
specimen chamber containing flat embedding molds filled with
fresh absolute HM20 Lowicryl resin (Fig. 1 step E). Polymer-
ize using the UV lamp for 48 h at 45 C (see Note 6).
2. Remove the coverslip strips now polymerized in molds and
place them inside a fume cabinet for at least 24 h under the
cabinet lights.
3.2 Coverslip 1. Place the resin blocks on acrylic stubs. Using an emery board,
Removal abrade the surface of the resin block which is opposite to the
and Ultramicrotomy coverslip and do the same with one surface of a stub.
2. Add quick setting epoxy adhesive to the abraded sides on the
resin block and stub. Place the resin block on top of the stub
and allow the two pieces to bond overnight in the fume hood
(Fig. 1 Step F).
3. Place the resin block into a suitable ultramicrotome holder.
Using a clean single-edge razor blade, trim and shape the
resin block to form a trapezoid.
4. Remove the excess resin on top of the coverslip using the same
blade and expose the coverslip strip.
5. Using a glass knife, slowly make 150 nm thick sections through
the coverslip.
6. Cut one or two semithin sections, place the sections on a glass
slide, and allow to dry on a hot plate for 10 min.
7. Stain the sections with 1% methylene blue in 1% borax for
1 min at ~80 C. Examine the sections using a light microscope
to visualize the neuronal cell bodies or axonal processes (see
Note 7).
8. Select the area of interest and further trim the face of the resin
block to a size suitable for ultrathin sections.
9. Cut ultrathin sections (70–100 nm) using a 35 diamond knife
and collect the sections on formvar/pioloform-coated Gilder
nickel grids (Fig. 1 step G).
10. Store the grids on #50 Whatman filter paper in a 35 mm petri
dish until ready for immunolabeling.
3.3 Immunolabeling For our immunolabeling experiments, most steps are performed
using the Leica EM IGL, an automated immunolabeling system in
which grids are placed onto droplets of solutions (i.e., antibody
incubation or washing buffers) on Teflon coated glass slides in
individual humidified slide carriers. The grids are moved from
drops to drops by a magnetic grid holder. All washing steps, sec-
ondary antibody incubation, and postfixation are performed using
the Leica EM IGL. Incubation with blocking buffer and primary
antibody are done manually using multiwell Terasaki plates.
1. Place grids with sections face down onto 10 μL drops of

0.05 M glycine in a 60-well Terasaki plate. Incubate for
30 min at room temperature (see Note 8).
2. Wash the grids twice by transferring onto 10 μL drops of PBS.
3. Transfer the grids to drops of blocking buffer and incubate for
30 min.
4. Transfer grids to drops of primary antibody diluted in antibody
dilution buffer and incubate overnight at 4 C. Place the Ter-
asaki plate inside a 60 mm petri dish with moist filter paper to
serve as a humidifying chamber (see Note 9).
5. The following day, load the Leica IGL automated system with
the required number of humidified slide carriers with Teflon-
coated glass slides according to the desired immunolabeling
protocol. For our studies, we load the Leica IGL with 19 humi-
dified slide carriers in the following order: 6 carriers with
30 μL drops of PBS (see Note 10), 1 carrier with 5 μL
drops of secondary antibody diluted in antibody dilution
buffer, 6 carriers with 30 μL drops of PBS, 1 carrier with
30 μL drops of 2% glutaraldehyde in PBS, 2 carriers with
30 μL drops of PBS, 3 carriers with 30 μL drops of ddH2O.
6. Transfer the grids onto the EM IGL magnetic grid holder cell
side facing down and place the magnetic grid holder in the
system according to manufacturer’s instruction (see Note 11).
7. Start the predefined program. For our studies, the immunola-
beling protocol is as follows: five washes in PBS for 5 min each,
90 min incubation in secondary antibody, five washes in PBS
for 5 min each, 5 min in 2% glutaraldehyde, two washes in PBS
for 5 min each, three washes in ddH2O for 5 min each.
8. Once the program has been completed, transfer the grids to
petri dishes containing #50 Whatman filter paper.
9. Stain the sections on droplets of 1% uranyl acetate in 50%
ethanol protected from light for 1 min. Wash in a stream of
dH2O for ~20 s.
10. Stain with Reynold’s lead citrate for 1 min. Wash in a stream of
dH2O for ~20 s. Dry grids on #50 Whatman filter paper and
store in a petri dish until ready for examination.
4 Notes
1. Make sure to keep the coverslips wet at all times while cutting.
Do not allow to dry.
2. Marking the cell side is necessary because you will not be able
to tell once the coverslip is embedded in resin. This also pro-
vides an area for handling the coverslip strip with forceps.
3. Baker’s sucrose to our experience appears to provide cryopro-

tection that leads to more uniformly frozen samples that have
been gelatinized.
4. Flow-through capsules, embedding molds and specimen cham-
bers should be dry thoroughly by placing in oven at 50 C for
1 h.
5. Everything required for freeze substitution must be precooled
inside the AFS2 for at least 30 min prior to use. This includes
specimen chambers, flow-through capsules, thimbles, embed-
ding molds, forceps, methanol, and HM20 resin.
6. Small volumes of Lowicryl and flat embeddings (no more than
3 mm thick) should be used because penetration of UV light
can be affected by the specimen itself.
7. It is best to cut one or two semithin sections at a time until you
see the first profiles of axonal processes.
8. Controls for antibody specificity are needed for each immuno-
labeling run. These include a primary antibody omission con-
trol and mock infected controls (for antibodies against viral
proteins).
9. If performing dual immunolabeling, you can incubate both
antibodies at the same time provided that they are from differ-
ent species (i.e., mouse and rat). This applies to both primary
and secondary antibody incubations.
10. Fill all the extra wells of the Teflon coated-glass slide with PBS
or dH2O when using only a few grids. This is necessary to make
sure all the grids sit on top of the same volume of solution.
11. Make sure to load the EM-IGL with all the required slide
carriers containing drops of solutions before you load the
grids on the magnetic grid holder. This is to make sure that
the grids do not dry out.
Acknowledgments

Medical Research Grants (APP1069193 and APP1130512).
References
1. Miranda-Saksena M, Boadle RA, Aggarwal A, 2. Aggarwal A, Miranda-Saksena M, Boadle RA,
Tijono B, Rixon FJ, Diefenbach RJ, Cunning- Kelly BJ, Diefenbach RJ, Alam W, Cunningham
ham AL (2009) Herpes simplex virus utilizes the AL (2012) Ultrastructural visualization of indi-
large secretory vesicle pathway for anterograde vidual tegument protein dissociation during
transport of tegument and envelope proteins entry of herpes simplex virus 1 into human and
and for viral exocytosis from growth cones of rat dorsal root ganglion neurons. J Virol 86
human fetal axons. J Virol 83(7):3187–3199. (11):6123–6137. https://doi.org/10.1128/
https://doi.org/10.1128/JVI.01579-08 JVI.07016-11
3. Shiurba R (2001) Freeze-substitution: origins 6. Jesus DM, Moussatche N, Condit RC (2016)

and applications. Int Rev Cytol 206:45–96 An improved high pressure freezing and freeze
4. Skepper JN, Powell JM (2008) Immunogold substitution method to preserve the labile vac-
staining following freeze substitution and low cinia virus nucleocapsid. J Struct Biol 195
temperature embedding after chemical fixation (1):41–48. https://doi.org/10.1016/j.jsb.
or after cryoimmobilization for transmission 2016.05.001
electron microscopy (TEM). CSH Protoc 7. van Lookeren Campagne M, Oestreicher AB,
2008:pdb prot5017. https://doi.org/10. van der Krift TP, Gispen WH, Verkleij AJ
1101/pdb.prot5017 (1991) Freeze-substitution and Lowicryl
5. Skepper JN, Powell JM (2008) Immunogold HM20 embedding of fixed rat brain: suitability
staining of epoxy resin sections for transmission for immunogold ultrastructural localization of
electron microscopy (TEM). CSH Protoc 2008: neural antigens. J Histochem Cytochem 39
pdb prot5015. https://doi.org/10.1101/pdb. (9):1267–1279. https://doi.org/10.1177/39.
prot5015 9.1833448
Chapter 22
Multifluorescence Live Analysis of Herpes Simplex Virus

Type-1 Replication
Michael Seyffert and Cornel Fraefel
Abstract
The possibility to label specific viral and cellular structures with live cell markers such as autofluorescent
proteins has greatly contributed to our understanding of diverse steps of the virus life cycle, as it allows for
monitoring virus replication in a spatial and temporal fashion. Here, we describe the multifluorescent live
analysis of the multicompartment Herpes Simplex Virus Type-1 (HSV-1) by live cell confocal laser scanning
microscopy.
Key words Live cell imaging, Multifluorescent recombinant HSV-1, Confocal laser scanning micros-
copy, Image processing
1 Introduction
Live cell imaging has become an important tool to study cellular

mechanisms, including vesicle trafficking, DNA replication and
transcription. In this context, establishment of versatile methods
to stain cellular structures with fluorescent dyes without disrupting
cellular physiology and therefore maintaining homeostasis and via-
bility has facilitated this approach enormously (Reviewed in [1]).
Similarly, methods to tag specific viral structures, such as viral
nucleic acids and proteins, with fluorescent proteins have contrib-
uted greatly to our understanding of where and how viruses repli-
cate in the infected cell (Reviewed in [2]). For instance,
herpesviruses that encode individual capsid proteins, tegument
proteins, or glycoproteins fused with fluorescent markers, such as
eCFP, eYFP, or mRFP, have been useful tools to study virus traf-
ficking and assembly in a spatial and temporal fashion. Here, we
describe a detailed protocol to study HSV-1 infection dynamics
using a triple-fluorescent recombinant HSV-1 (rHSV-RYC). This
fully replication-competent recombinant virus simultaneously
encodes the VP26 capsid protein fused with a red fluorescent
protein (mRFP), the VP16 tegument protein fused with a cyan
365
366 Michael Seyffert and Cornel Fraefel
fluorescent protein (eCFP) and the envelope glycoprotein H fused

with a yellow fluorescent protein (eYFP) [3]. The protocol is
divided into three sections: (1) cell culture and infection, (2) confo-
cal microscopy, and (3) image processing. The procedures
described in this protocol are based on studies described in de
Oliveira et al. [3].
2 Materials
2.1 Cell Culture 1. Cells: African green monkey kidney cells (Vero) (see Note 1).
and Infection 2. Virus: rHSV-RYC: for a detailed description of the virus refer
to de Oliveira et al. [3].
3. Cell culture medium: Dulbecco’s modified Eagle medium
(DMEM), 1 g/L Glucose, +Pyruvate, supplemented with
10% fetal bovine serum (FBS), 100 units/mL penicilin G,
100 μg/mL streptomycin, and 0.25 μg/mL amphotericin B.
4. 0.05% trypsin–EDTA (1).
5. Infection medium: DMEM, 1 g/L glucose, +pyruvate, supple-
mented with 2% FBS, 100 units/mL penicillin G, 100 μg/mL
streptomycin, 0.25 μg/mL amphotericin B, and 25 mM
HEPES.
6. Hank’s balanced salt solution (HBSS).
8. Probes to stain for cellular structures (see Table 1).
9. Round 35 mm cell culture dishes with 0.17 mm cover glass on
the bottom (e.g., MatTekwell P35G-1.5-14-C (NUNC™)) or
chambered cover glasses with 0.17 mm cover glass bottoms
(e.g., Lab-Tek chambered #1.0 Borosilicate Cover glass System
(NUNC™) or 15 μ-Slide 2 Well (ibidi)).
10. Tissue culture flask (e.g., Tissue Culture Flask 75 (TPP)).
11. 50 mL Falcon tubes.
12. CO2 incubator (e.g., HERACELL 240i (Thermo Scientific)).
13. Parafilm.
2.2 Confocal 1. Confocal laser scanning microscope (CLSM) (e.g., TCS SP8
Microscopy and Live (Leica)).
Cell Imaging 2. Confocal microscope software (e.g., Leica Application Suite
X).
3. Incubator system for the confocal microscope (e.g., TCS SP8
consisting of: The Box (incubation box housing the micro-
scope), The Cube (temperature regulation device (Life Imaging
Services, LIS)) and The Brick (gas regulation unit (Life Imaging
Services, LIS))).
Live Analysis of HSV-1 Replication 367
Table 1
Selected staining components for cellular structures
Cellular
structures Staining components
Nucleus Hoechst dye is the most common dye used to stain cellular chromatin (e.g., Hoechst
33342 (Invitrogen))
ER Members of the Dapoxyl dye family are most recommended for live cell imaging (e.g.,
ER-Tracker Blue-White DPX, or Glibenclamide (glyburide))
Golgi Any probes are suitable targeting either lectin (e.g., Lectin HPA from Helix pomatia)
or human Golgi-resident enzyme N-acetylgalactosaminyltransferase-2 (e.g.,
CellLight™ Golgi-GFP/RFP)
Lysosomes Acidotropic dyes that selectively accumulate in acidic vesicles are useful markers for
endosomes and lysosomes (e.g., LysoTracker-Red or LysoTracker Green
(Invitrogen) or Lyso-ID Green (Enzo Life Sciences))
Mitochondria Probes for mitochondria that are linked to wide range of fluorophores are available
(e.g., MitoTracker probes (Invitrogen))
Cytoskeleton Fluorescent dyes that have the same fluorescent excitation or emission wavelength as
the multifluorescent rHSV-RYC should be avoided in live cells (e.g., Tubulin Tracker
Green; Oregon Green 488 Taxol, bis-acetate (Invitrogen))
Fluorescent dyes that have the same fluorescent excitation or emission wavelength as the multifluorescent rHSV-RYC
should be avoided
4. 63 objective (e.g., HCX PL APO lbd.BL 63.0 1.40 oil

objective).
5. Immersion oil.
2.3 Image 1. Imaris® software (Bitplane) (see Note 2).

Processing 2. High performance personal computer: for system requirements
of the software refer to the home page of the developer of
Imaris® (http://www.bitplane.com).
3 Methods
Live cell imaging is performed under optimal growth conditions.

Temperature and atmosphere need to be controlled throughout
the experiment using an incubator system also for the microscope.
In order to obtain the adequate environment for imaging cells and
for efficient laser conditions, microscope equipment should be
switched on at least 1 h before imaging.
3.1 Cell Culture 1. The day before infection, the cells are passaged as follows
and Infection (Subheading 3.1, steps 2–9).
2. Aspirate the cell culture medium from the flask.
3. Wash the cells 1 with 5 mL PBS.

4. Add 2 mL prewarmed (37 C) 0.05% trypsin–EDTA.
5. Incubate 5 min at 37 C.
6. Tap the flask gently to detach any remaining cells at the bottom
of the flask.
7. Add 8 mL of prewarmed (37 C) cell culture medium and mix
by pipetting up and down 5–10 times.
8. Leave 2 mL of cell suspension in the flask and transfer the
remaining cells into a 50 mL Falcon tube.
9. Add 10–13 mL of cell culture medium to the flask and transfer
the cells back to the incubator.
10. Plate an adequate number of Vero cells, collected in step 8 in
Subheading 3.1, into a chosen cell culture dish (e.g.,
6 105 cells in a 35 mm plate (cell culture medium volume:
2 mL)).
11. Incubate the cells overnight at 37 C and 5% CO2 (see Note 3).
12. At the day of infection, dilute the virus in chilled infection
medium in a total volume of 1 mL per plate to obtain an
MOI of 18–20 (see Notes 4 and 5).
13. Aspirate the cell culture medium from the cells and wash 1
with chilled PBS.
14. Remove PBS from the cells and add the virus dilution prepared
in step 12 in Subheading 3.1.
15. Incubate the plate at 4 C or on ice for 15 min to allow the
virus to attach to the cell surface (see Note 6).
16. Transfer the cell culture plate to an incubator set at 37 C and
5% CO2 for 1–2 h (see Note 7).
17. Optional: labeling of cellular structures (e.g., nucleus, ER,
Golgi, lysosomes, mitochondria or cytoskeleton). Remove the
medium from the cell culture dish and wash the cells once with
PBS. Remove PBS and incubate the cells with prewarmed
infection medium containing the probe (diluted in HBSS) for
15–45 min at 37 C and 5% CO2. The medium containing the
probe is replaced with fresh, prewarmed infection medium, and
the cells are incubated for another 30 min at 37 C and 5% CO2
(see Note 8).
18. Optional: seal the lid of the plate with Parafilm (see Note 9).
3.2 Confocal 1. Load the confocal software and initialize the hardware compo-
Microscopy nents of the microscope. Make sure to turn on the
and Imaging Resonant mode.
2. Choose a high magnification objective (e.g., 63) with a high
numerical aperture (e.g., >1.2) and apply a drop of immersion
oil onto the lens (see Note 10).
3. Place the cell culture dish from step 16 in Subheading 3.1

carefully onto the specimen stage of the microscope and bring
the objective in close proximity to the bottom of the cell
culture dish until the drop of immersion oil on the objective
is in contact with the glass.
4. Switch the microscope to fluorescent mode and choose a suit-
able fluorescent filter (see Note 11).
5. Find the cell layer and adjust the focus.
6. Cycle through each relevant fluorescent channel to confirm
proper staining of the specimen and to find the cells of interest
(see Note 12).
7. Set the adequate scanning configurations in the confocal soft-
ware and record the images as described in the following steps
8–21, Subheading 3.2.
8. Turn on the lasers using the microscope software (Configura-
tion ! Laser Configuration) (see Note 13).
9. Activate the chosen lasers in the laser user interface.
10. Activate two HyD and one PMT detectors and assign each
fluorophore correspondingly with the appropriate detection
range (see Note 14).
11. Optional: add a transmission light detector (TLD) in order to
acquire brightfield images (see Note 15).
12. Set the scan mode to xyt and the scan direction to unidirec-
tional (see Note 16).
13. Set the scan speed to 8000 Hz (see Note 17).
14. For optimal image resolution, set the confocal pinhole to
1 Airy unit (AU) (see Note 18).
15. Set each laser to 1% laser intensity and adjust the laser and
detector settings for each fluorophore separately in the Live
scanning mode. Test the settings by acquiring test-scan images
(see Note 19).
16. While scanning, readjust the xy-plane and the zoom factor for
the chosen area (see Note 20).
17. Stop the Live scanning mode.
18. Open the Sequential Scan tab and select between lines scanning
(see Note 21).
19. Add all detection channels chosen in step 10 in Subheading
3.2 into the sequential scanning mode window and determine
the scanning sequence (see Note 22).
20. Determine the time-course settings (see Note 23).
21. Acquire the scans by hitting the Start button. The acquired
images of the time-lapse experiment are saved in the .lif-file
format.
3.3 Image The following protocol describes a basic approach to edit the
Processing confocal time-lapse images acquired in Subheading 3.2 using the
with Imaris® Imaris® software (Bitplane). For further information about Imaris®
and to learn how to use the complete image processing capacity of
the software, please visit the developer’s home page (http://www.
bitplane.com) (see Note 2).
1. Open a .lif-file acquired in step 21 in Subheading 3.2 with the
Imaris® software by pressing the Open-button. The files are
transferred to Imaris® automatically and appear in the image
selection window (see Note 24).
2. Navigate to the desired image series-file within the popup
window containing all files collected in Subheading 3.2 and
press Ok (see Note 25).
3. Adjust the images (contrast, brightness and opacity) as follows
(steps 4–8, Subheading 3.3).
4. Open the display adjustment window (Edit ! Show Display
Adjustment, or press Ctrl + D). Each channel is represented as a
channel bar within the display adjustment window.
5. Select the channel to be processed by activating the check mark
box within the channel bar.
6. Click the channel name to open the color palette.
7. Choose a color and press Ok (see Note 26).
8. Adjust contrast, brightness, and opacity by clicking and drag-
ging the corresponding arrow in the channel bar. The channel
color may be adjusted to improve visibility of cellular structures
(see Note 27).
9. Analysis of the edited images (steps 10–14, Subheading 3.3).
10. To evaluate fluorescent colocalization, change to the Coloc
view mode. Select the desired channels and determine the
threshold. Directly read the degree of colocalization [%] in
the statistics panel (see Note 28).
11. Optional: take pictures of individual time points using the
Snapshot function (steps 12 and 13, Subheading 3.3).
12. Navigate to the desired time frame using the time course
navigation panel at the bottom of the image window.
13. Define the image output directory and the image type under
File ! Snapshot. Save the image by hitting the Snapshot-button
14. Crate a movie of the time course by hitting the Record-button
located under the image next to the timeline (see Note 31).
4 Notes
1. Vero cells are maintained in a tissue culture flask 75 with

12–15 mL cell culture medium at optimal growth condition
(37 C and 5% CO2). They are passaged twice a week at a ratio
of 1:5. Other cell lines may be used as well, such as HeLa,
HEK293, or similar.
2. For the protocol described here, we used the Imaris® software
(Version 9.2.0.) which can be purchased on the developer’s
home page (http://www.bitplane.com). The developers pro-
vide campus licenses and most of the Universities and training
schools provide such licenses. Moreover, make sure your com-
puter provides the minimal hardware requirements to run the
program properly (for detailed instructions, see the developer’s
home page (http://www.bitplane.com)). We recommend run-
ning Imaris® with a high-end graphics card. We would like to
point out that this tutorial is specific for the images taken in
Subheading 3.2 and does not represent a complete tutorial on
the software. For a full tutorial, see the developer’s home page
(http://www.bitplane.com).
3. Make sure that the cells are kept under optimal conditions at all
times. The importance of healthy cells used for microscopy
(i.e., for live cell imaging) is often underestimated. For the
protocol described here, the cells should not reach 100% con-
fluency as this may result in poor sample quality due to mem-
brane deformations. We recommend growing the cells to
80–90% confluency.
4. Thaw the virus stock right before infecting the cells, as storing
periods longer than 12 h at 4 C may result in reduced virus
titers.
5. High MOIs are necessary to obtain a high frequency of infected
cells and meaningful live cell imaging results.
6. Adsorption on ice for 20–30 min improves the infection effi-
ciency of HSV-1 significantly.
7. The incubation time may vary depending on the viral and
cellular functions or structures to be observed. If very early
steps of the infection cycle are examined, the cells can be
transferred directly to the microscope after virus incubation at
4 C. However, we recommend determining the optimal incu-
bation time empirically.
8. Staining for cellular structures can be very useful to obtain
spatial information. However, the probes used for this should
be nontoxic and should not interfere with the infection pro-
cess. We recommend using one such probe at a time.
9. Sealing the lid of the plate is optional and depends on the type
of cell culture plate. In general, sealing the lid for live cell
microscopy prevents drying of the specimen. However it also
blocks CO2-flow to the specimen. To circumvent this issue we
recommend using petriperm foil, which allows full access of
CO2 while blocking water evaporation. At this point, we would
like to emphasize again the importance of cell viability for live
cell imaging: carefully control the temperature, humidity, and
CO2-concentration throughout the experiment. To avoid dry-
ing of the cells, we suggest placing a jar with clean ddH2O in
the incubation box of the microscope, especially when the cell
culture dish is not sealed.
10. We recommend using a 63 (water or oil) objective, but other
high magnification objectives (e.g., 100) may be used as well.
The numerical aperture (NA) of an objective has a direct
impact on the resolution of the recorded image. The higher
the NA, the better the resolution.
11. We recommend using the filter for the brightest fluorescent
signal first (e.g., eYFP or any DNA-staining dye, if applicable).
12. In order to scan the specimen for infected cells, we recommend
using the fluorophore that is most abundant.
13. Depending on the fluorescent setup of the specimen and the
laser equipment of the microscope, you do not need to activate
all lasers available. To detect the triple-fluorescent rHSV-RYC,
the following lasers are required: 405 nm (eCFP), 488 nm
(eYFP) and 552 nm (mRFP).
14. The detection range should be at least 10 nm from any excita-
tion line in order to minimize crossover (spectral bleed-
through). This is especially critical in multiple fluorescence
applications as the emission wavelength of one fluorophore
may overlap with and therefore excite another fluorophore in
the same sample (Stokes shift). In order to avoid channel
overlap, blue and red channels may be recorded simultaneously
while the yellow/green channels may be recorded separately. If
HyD detectors are used, make sure to uncheck the Maximum
Integration Time setting.
15. Brightfield images can be collected in different forms including
phase-contrast, DIC, polarized light, or dark field. A real-color
transmitting light detector enables recording of a true bright-
field image. Overlaying such images with fluorescent channels
provides more precise spatial and temporal information.
16. The default scan mode is xyz when collecting z-stacks for a 3D
reconstitution image and xyt or xyzt for time course series or
3D time course series, respectively. The unidirectional scan
mode acquires more precise images with the cost of slow scan
speed. Bidirectional scanning is used for time course series, as it
doubles the scan speed. However, the synchronization (“phase

correction”) of the scans in each direction should be checked
first, as it might account for distorted images. Here, we suggest
choosing the xyt scan mode together with unidirectional
scanning.
17. Slower scan speeds give better signal to noise ratios, but may
cause photobleaching. Fast scans are used when photobleach-
ing is an issue during a series acquisition. For time series in
particular, it might be important to reduce the minimum time
between frames during image acquisition. This can be achieved
by choosing a faster scan speed: however, it might be necessary
for the scanner to zoom in (>700 Hz), thereby reducing image
resolution. Very fast biological processes require high-speed
imaging systems. Resonance scanning systems allow line fre-
quencies of up to 16 kHz.
18. Some confocal scanning microscopes automatically set the pin-
hole diameter to 1 Airy unit (AU) by default. The AU value
refers to the diameter of the airy disk of a fluorophore, which is
the inner, intense light circle of the diffraction pattern from this
source of light. A good setting can be calculated as the airy disk
diameter. AU ¼ 1.21 l/NA which resembles the area inside
the first zero of the diffraction pattern generated by a circular
aperture. Closing the pinhole decreases the section thickness
and brightness, but increases resolution to a certain point.
Opening the pinhole allows to detect even lower intensities of
fluorescent signals, but decreases resolution dramatically.
19. We recommend reducing the transmitted laser intensity for
imaging as much as possible to avoid bleaching, especially
when taking time series or z-stack series for 3D reconstruc-
tions. The minimal laser intensity required to acquire optimal
fluorescent intensity has to be determined empirically by start-
ing with 1%. HyD detectors are very sensitive and do not
require laser intensities above 5%. In addition, line averaging
can help reducing noise and increasing the fluorescent inten-
sity. Choose averaging, particularly if using weak fluorophores,
to significantly reduce noise without affecting the genuine
signal, thereby improving signal to noise ratio. The number
of line acquisitions and line averaging has to be determined
empirically. We recommend performing a test scan to deter-
mine the number of scans per line and series. To do so, set a
high number for line and series averaging (e.g., 10) and per-
form a test scan of an irrelevant area in the specimen. While
scanning, the number of repeats can be determined as the point
from which the image resolution is not further improved with
additional scans.
20. Avoid oversampling, as the same user-defined resolution will

be used to scan the specific area (e.g., 512 512 pixels). In
particular, the use of zoom-in to select scan areas may lead to
oversampling (i.e., capturing an image at a resolution that is
beyond the optical capabilities of the microscope). Usually, for
visible light and high NA objectives (NA > 0.8), the pixel size
of ~0.1–0.2 μm is ideal. We recommend using zoom factors of
2–8 at the most.
21. The use of sequential rather than simultaneous scanning
diminishes the bleed-through between the channels during
acquisition, as each fluorophore is excited and recorded
separately.
22. When using multiple fluorescent color detection channels, we
recommend setting the scanning sequence according to the
detected wavelength, starting with the most sensitive fluoro-
phores in the red spectrum and ending with the UV-light
channels for Hoechst or DAPI followed by the transmitting
light channel. Turn off all irrelevant lasers. Only one laser
should be on at a time for each sequential scan in order to
avoid bleed through.
23. We suggest collecting time lapse series (xyt-scan mode) of a
defined area of infected cells, as this provides reliable data on
temporal dynamics and spatial organization of HSV-1 proteins
during the course of infection. When performing longer time-
course scans (e.g., 12–24 h), it might be necessary to turn on
the autofocus mode. We do not recommend to make 3D scans
using z-stacks during time-course experiments. The photo-
toxic burden is too high and bleaching occurs very rapidly.
24. Every .lif-file is associated with a corresponding metafile con-
taining the meta data. If you move .lif-files from one folder to
another, make sure to copy the corresponding meta file too.
25. The selected image is appearing in the Easy 3D view by default.
Imaris® will open all associated fluorescent channels at the
same time, if the sample was taken with the sequential mode
(see step 18 in Subheading 3.2). If not, the corresponding
channels can be added (Edit ! Add channels, or by pressing
Ctrl + Shift + A). In addition, the time course series will appear
in Imaris® with a time course navigator at the bottom of the
images, allowing cycling through all the pictures. This allows to
review the entire time course experiment a first time.
26. The colors for each channel used here should represent the
emission color of the fluorophore used in the study to avoid
confusion (e.g., blue for the DAPI channel). However, if more
than three colors are needed, we recommend using white or
purple in addition to the three colors blue, yellow/green,
and red.
27. This function is used to improve the visibility of fluorescent

channels and should not be exploited to generate
manipulated data.
28. A very common method to determine colocalization is to set
the pseudo colors with base colors from the RGB color palette
for each channel and assess the degree of colocalization by
estimating the additive property of the colors (e.g.,
green + red ¼ yellow). We strongly do not recommend this
method, as such datasets lead to misinterpretations and false
positive results. Instead we suggest using a software function
such as the Coloc from Imaris®. However, there are a couple of
issues, which have to be considered when performing coloca-
lization analysis: avoid bleed-through of the channels when
scanning the sample, avoid oversampling, and keep the signal
to noise ratio as low as possible. Thresholding of each channel
enables “gating” of the pixels exhibiting colocalization and is
the crucial step in this process. Imaris® provides a function to
determine the thresholds automatically. We recommend that
beginners use this feature. Resolution limitations have to be
considered when interpreting colocalization data, in particular
the axial dimension (axial resolution is typically 500 nm only,
which is insufficient to resolve lower distances, e.g. structures
of 100 nm in diameter). This issue can be countered by decon-
volution of the acquired images. We suggest using the Huy-
gens Professional deconvolution tool (v.18.10). Overall, we
strongly recommend visiting the developer’s home page
(http://www.bitplane.com) for a detailed tutorial on colocali-
zation measurements.
29. We suggest saving the images as TIFF-files, as this format
retains the highest resolution and is the preferred format for
most journals.
30. Every channel should be saved as an individual file, but addi-
tional merged images provide helpful illustrations of certain
features (e.g., colocalization and spatial organization). In addi-
tion, the complete scene can be saved as .ims- or .imx-files
(File ! Export Scene, or by pressing Ctrl + E). These file
formats allow opening the entire scene created with the sample
picture(s) without losing any settings and adjustments per-
formed previously.
31. We recommend saving as H264 movies in the .mp4-format
using the highest quality. This will create rather large movie
files, but it helps in maintaining the resolution necessary to
visualize the small structures in the specimen.
References
1. Walker-Daniels J, Faklaris O (2012) Live cell 3. De Oliveira AP, Glauser DL, Laimbacher AS et al
imaging methods review. Mater Methods 2:124 (2008) Live visualization of herpes simplex virus
2. Witte R, Andriasyan V, Georgi F et al (2018) type 1 compartment dynamics. J Virol
Concepts in light microscopy of viruses. Viruses 82:4974–4990
10(4):202
Chapter 23
Expression, Purification, and Crystallization of HSV-1

Glycoproteins for Structure Determination
Ellen M. White, Samuel D. Stampfer, and Ekaterina E. Heldwein
Abstract
Herpes simplex viruses utilize glycoproteins displayed on the viral envelope to perform a variety of functions
in the viral infectious cycle. Structural and functional studies of these viral glycoproteins can benefit
from biochemical, biophysical, and structural analysis of purified proteins. Here, we describe a general
protocol for expression and purification of viral glycoproteins from insect cells based on those developed for
the HSV-1 gB and HSV-2 gH/gL ectodomains as well as the protocol for crystallization of these
glycoproteins. This protocol can be used for generating milligram amounts of wild-type (WT) or mutant
gB and gH/gL ectodomains or can be adapted to produce purified ectodomains of glycoproteins from
HSV or other herpesviruses for biochemical and structural studies.
Key words Herpes simplex viruses, Glycoproteins, Viral entry, Ectodomain, Crystallography, Protein
purification
1 Introduction
Herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) are envel-
oped viruses that display 12 glycoproteins and three nonglycosy-
lated proteins on their surface. These proteins perform a variety of
functions in the viral infectious cycle, including entry into the host
cell by mediating membrane fusion, cell–cell spread, viral egress,
and other yet unclear roles [1–3]. Being surface exposed, they also
modulate the immune response, and some generate neutralizing
antibodies [4, 5]. Their surface exposure and essential functions
make them promising targets for the development of drugs and
vaccines.
HSV glycoproteins gD, gH, gL, and gB are necessary [6–9]
and sufficient [10] for viral entry into the host cell. The receptor-
binding protein gD binds one of its three cellular receptors, which
determines viral tropism [1, 11]. Binding to a cognate receptor
triggers a conformational change in gD that is thought to lead to
the activation of gH/gL and, ultimately, gB during the host cell
377
378 Ellen M. White et al.
fusion process [11, 12]. While the specific role of the heterodimer
gH/gL in the membrane fusion process is unknown, it is thought
to activate gB in response to an activating signal from gD [13, 14]
and may function as a fusion adaptor protein [15]. gB is a class III
viral fusogen [16] that undergoes a conformational rearrangement
from the prefusion to the postfusion form [17, 18].
Most HSV glycoproteins are anchored to the membrane by at
least one transmembrane region. The presence of a transmembrane
anchor presents many challenges to isolation of glycoproteins.
While detergents have successfully been used to solubilize integral
membrane proteins, solubilization of membrane proteins contain-
ing large external portions has remained challenging. Thus, isola-
tion of glycoprotein ectodomains has great appeal.
The ectodomains of several HSV glycoproteins, gD, gB, and
the gH/gL heterodimer, have been successfully produced as pur-
ified proteins, which has been critical for understanding how they
work. In particular, the ability to produce large quantities of
homogenous proteins has allowed the determination of their crystal
structures. The crystal structures of gD alone and bound to two
different receptors have provided detailed knowledge of gD/recep-
tor interactions [12, 19–22]. The crystal structures of gB and
gH/gL, determined in our laboratory, have led us to propose
that gB functions as a viral fusion protein [17] whereas gH/gL
serves a fusion activator [23] during cell entry and cell–cell fusion,
which was confirmed in subsequent studies. The structures of all
four proteins have also aided the mapping of their functional
regions [11]. Finally, the ability of purified gD and gH/gL ecto-
domains to function in cell–cell fusion assays, albeit with reduced
efficiency, suggested that membrane anchoring is not essential for
the function of these proteins during cell fusion [13, 24], consis-
tent with their regulatory roles.
The ectodomains of gD, gH/gL, and gB were produced as
secreted proteins in insect cells infected with recombinant baculo-
viruses. The use of baculovirus expression vector systems (BEVS)
technology for expression of recombinant proteins, including gly-
coproteins, has been described elsewhere (e.g., [25]), and will not
be covered here. The advantage of using insect cells is that unlike
in bacterial cells, proteins expressed in insect cells can be properly
folded, posttranslationally modified (glycosylated or proteolytically
processed), and trafficked [25]. Insect cells are also relatively simple
to propagate, can be easily grown in suspension cultures, and
protein expression can be easily scaled up to large volumes at
significantly lower cost than in mammalian cells. Finally, BEVS
utilizes baculoviruses, which are easily manipulated and relatively
safe to use. Using BEVS, recombinant genes of interest are
expressed under the control of the polyhedrin promoter of baculo-
virus. To ensure that the glycoproteins are transported to the cell
membrane or extracellular space after expression, their genes must
Expression, Purification, and Crystallization of HSV Glycoprotein Ectodomains 379
include an endogenous or heterologous signal sequence, e.g.,

from honeybee melittin. Detailed instructions for recombinant
baculovirus generation are listed in the Bac-to-Bac™ Baculovirus
Expression System manual [26]. We typically expand the initial
baculovirus stock in two passaging steps. The resulting passage
3, also referred to as P3, can be used to infect insect cells for protein
production. While the protocol described here uses Sf9 insect cells,
Sf21 or High Five™ insect cells can also be used.
Prior to expression, DNA fragments encoding the protein
region of interest must be subcloned into a plasmid vector suitable
for baculovirus generation. Although there are several BEVS sys-
tems currently on the market, we use the Bac-to-Bac™ Baculovirus
Expression System (Thermo Fisher Scientific) [26] due to its sim-
plicity and relative speed of generating recombinant baculoviruses
because it does not require the use of a plaque assay. For the HSV-1
gB ectodomain, henceforth referred to as gB730, DNA encoding
residues 31-730 was subcloned into pFastBac™ vector (Thermo
Fisher Scientific), with the honeybee melittin signal sequence.
Wild-type gB730 and several mutants and derivatives have been
purified using this strategy [27–29], yielding 0.5–2 mg of purified
protein per liter of insect cell culture.
The gH and gL glycoproteins must be co-expressed for proper
complex formation [7, 23, 30]. Therefore, gH and gL were sub-
cloned into the pFastBacDual™ vector (Thermo Fisher Scientific)
that allows for expression of two genes from separate late baculo-
virus promoters. Two versions of the soluble gH/gL complex have
been expressed using this approach: gH803-H6/gL, which con-
tains the entire gH ectodomain, residues 19-803, with a C-terminal
His6 tag and full-length gL, residues 1-224, [29]; and Δ48gH803-
H6/gL, which lacks residues 19-47 of gH but is otherwise identical
to gH803-H6/gL [23]. Δ48gH803-H6/gL is the only HSV
gH/gL complex crystallized thus far [23] whereas both gH803-
H6/gL and Δ48gH803-H6/gL have been used in functional assays
[13, 31]. Each complex was produced using the same protocol that
yields ~250 μg of homogeneous complex per liter of insect cell
culture.
Here, we describe a general protocol for expression and purifi-
cation of glycoproteins in Sf9 cells based on those developed for the
ectodomains of HSV-1 gB730 (residues 31-730) and HSV-2
gH803-H6/gL (residues 19-803 of gH and full-length gL). gB is
used as an example of a glycoprotein purified using immunoaffinity
while gH/gL is an example of a glycoprotein purified through the
use of an affinity tag. In this case, we used immobilized metal-ion
affinity chromatography (IMAC) purification via a hexahistidine
tag. Although yields of pure protein per liter of insect cells vary
for the three glycoproteins, from 250 μg for gH/gL to 2 mg for gB
to 10 mg for gD, all three have been produced in the amounts
sufficient for crystallization and functional assays. Crystallization
and freezing of crystals of HSV-1 WT gB730 and HSV-2

Δ48gH803-H6/gL (the construct described above, missing the
first 47 residues of gH) is also described.
These protocols can be used for the production of the WT or
mutant constructs of gB or gH/gL for biochemical, structural, or
functional use. With slight modification, these protocols can be
adapted for the production of other HSV glycoproteins or glyco-
proteins from other viruses.
2 Materials
2.1 Protein 1. A setup for growing insect cells in suspension in spinner flasks
Expression (see Note 1), including several 3-L spinner flasks with a 2-port
airflow assemblies, a magnetic stir plate for spinner flasks, an air
pump, a gas blending stand, ¼00 inner diameter autoclavable
plastic tubing, and 0.2 μm air filter units (Millex-FG50 or
similar). Available as a kit from Bellco or may be purchased
separately.
2. Refrigerated incubator set to 27 C.
3. Laminar flow hood (biosafety cabinet) for sterile work.
4. Sf9 cells adapted to growth in suspension culture in serum-free
insect cell media.
5. Serum-free insect cell growth medium (e.g., Sf-900 II SFM).
6. Pen-Strep solution: 10,000 IU penicillin, 10,000 μg/mL
streptomycin in 100 mL of distilled water.
7. P3 stock of recombinant baculovirus encoding the glycopro-
tein gene of interest (see Note 2).
8. Trypan blue solution: 0.4% trypan blue (w/v) in PBS.
2.2 Protein 1. Assembled tangential flow filtration (TFF) system (see Note 3).
Purification 2. 1-L bottle top 0.22 μm filters and 1- or 2-L compatible bottles.
3. Empty 10-mL chromatography column (e.g., Bio-Rad Poly-
Prep® chromatography columns).
4. Small peristaltic pump (capable of 0.1–20 mL/min flow rates).
5. PBS buffer: phosphate-buffered saline pH 7.4.
6. TN Buffer: 20 mM Tris-HCl pH 8.0, 150 mM NaCl.
7. TNE Buffer: 20 mM Tris-HCl pH 8.0, 150 mM NaCl,
1 mM EDTA.
8. Phenylmethylsulfonyl fluoride (PMSF) solution: 100 mM
PMSF in isopropanol (caution: cytotoxic, use eye protection).
9. Superdex 200 10/300 GL column or a similar size-exclusion
column.
10. Amicon Ultra-15 50K concentrator (Millipore) or a similar

concentrator.
concentrator.
12. 0.1 μm PVDF centrifugal filter.
13. Immunoaffinity column prepared by conjugating 10–15 mg of
purified IgG to 1 mL of CNBr-Activated Sepharose™ 4B
(GE Healthcare) or a similar resin following the manufacturer’s
instructions and then packed into an empty 10-mL chroma-
tography column. For purification of HSV-1 gB730, we typi-
cally use monoclonal antibody DL16 [32].
14. AB-W buffer: 10 mM Tris-HCl pH 8.0, 500 mM NaCl.
15. Potassium thiocyanate (KSCN) solution: 3 M KSCN in dis-
tilled water.
16. Sodium azide solution: 0.025% sodium azide in distilled water.
17. IMAC resin: Ni Sepharose Excel (GE Healthcare Life
Sciences), Nickel Sepharose 6 Fast Flow (GE Healthcare Life
Sciences), or a similar Ni resin (see Note 4).
18. Nutating shaker.
19. Ni-B buffer: 20 mM Tris-HCl pH 8.0, 150 mM NaCl, 20 mM
imidazole.
20. Ni-W buffer: 20 mM Tris-HCl pH 8.0, 500 mM NaCl, 40 mM
imidazole.
21. Ni-E buffer: 20 mM Tris-HCl pH 8.0, 150 mM NaCl,
300 mM imidazole.
22. Imidazole stock solution: 4 M imidazole in distilled water.
23. EDTA solution: 0.5 M EDTA pH 8.0 in distilled water.
2.3 Crystallization 1. 24-well pregreased crystallization plates (Hampton Research).

2. 22 mm siliconized circle cover slides (Hampton Research).
3. Aerosol duster (Thermo Fisher Scientific) or in-house air.
4. Stereomicroscope for crystal observation.
5. gB crystallization solution: 15% PEG (polyethylene glycol)
4000 (w/v), 200 mM NaCl, 100 mM Na citrate pH 5.5, sterile
filtered.
6. gH/gL crystallization solution: 20% PEG 4000 (w/v),
100 mM Na citrate pH 4.5, sterile filtered.
7. CryoLoops (Hampton Research).
8. Cryo storage vials with compatible mounting bases (e.g., Crys-
talCap Copper Magnetic [Hampton Research]).
9. CrystalWand handling tool and a vial clamp (Hampton
Research).
10. CryoCanes and CryoSleeves for storage of cryo storage vials

(Hampton Research).
11. 0% mesoerythritol gB cryopreservation (cryo) solution: 15%
PEG 4000 (w/v), 350 mM NaCl, 100 mM Na citrate pH 5.5.
12. 5% mesoerythritol gB cryo solution: 5% mesoerythritol (v/v),
15% PEG 4000 (w/v), 350 mM NaCl, 100 mM Na citrate pH
5.5.
13. 10% mesoerythritol gB cryo solution: 10% mesoerythritol
(v/v), 15% PEG 4000 (w/v), 350 mM NaCl, 100 mM Na
citrate pH 5.5.
14. 15% mesoerythritol gB cryo solution: 15% mesoerythritol
(v/v), 15% PEG 4000 (w/v), 350 mM NaCl, 100 mM Na
citrate pH 5.5.
15. gH/gL cryo solution: 20% xylitol (w/v), 20% PEG 4000
(w/v), 150 mM NaCl, 100 mM Na citrate pH 4.5.
16. Liquid nitrogen.
17. Liquid nitrogen Dewar flasks for crystal freezing and tempo-
rary crystal cane storage (Hampton Research).
3 Methods
3.1 Protein 1. Wash, assemble, and autoclave 3-L spinner flasks and the
Expression 2-port airflow assemblies with 0.2 μm air filters as per the
manufacturer’s instructions (see Note 5).
2. Expand Sf9 cells to obtain appropriate volume of suspension
culture in log phase at a density of 2 106 cells/mL using
SF900II SFM plus Pen-Strep solution. The viability should be
97% or above as determined by trypan blue staining (see Note
6). Cell culture volume should be calculated based on the
required amount of pure protein and the expected yield.
1–1.6-L cultures can be grown in a 3-L flask. Our typical yields
are ~2 mg HSV-1 gB730 per liter of culture or 250 μg HSV-2
gH803-H6/gL per liter of culture.
3. In a laminar flow biosafety cabinet, infect Sf9 cells with recom-
binant baculovirus by adding 4–10 mL of P3 per 1 L of cells (see
Note 7).
4. Incubate infected cells for 72 h at 27 C, with a spinner setting
of 75–90 rpm and with airflow adjusted to prevent excessive
bubble accumulation (see Note 8).
3.2 Removal 1. Harvest the cell culture supernatant containing secreted pro-
of Medium tein by centrifuging the cell suspension at 3725 g for 35 min
Components from at 4 C. Discard the pellet. For this and all subsequent steps, a
Insect Cell sterile environment is not required.
Supernatants
2. During the centrifugation step, begin flushing the TFF system

with distilled water according to the manufacturer’s instruc-
tions. After flushing the TFF system with water, equilibrate the
TFF filter with PBS for at least 15 min at 4 C in a cold room
(see Note 9).
3. Vacuum filter the supernatant through a 1-L 0.22 μm bottle-
top filter.
4. Add PMSF solution to a final concentration of 0.1 mM to
inhibit proteases. Take out a 50 μL aliquot of this sample to
monitor protein loss during purification.
5. Transfer the filtered supernatant to a cold room. All
subsequent steps must be done at 4 C to reduce protein
degradation.
6. Properly position the tubing of the TFF system prior to start-
ing TFF. Place the end of the large feed flow tube into the
bottle containing the supernatant; this bottle will act as the feed
tank (Fig. 1). Thread the rest of the large feed flow tube
through the Easy-Load peristaltic pump. Direct the end of
the retentate tube (coming out of the edge of the top surface
of the TFF filter) back into the feed tank. Direct the permeate
tube into a waste container (Fig. 1). Turn on the pump and
adjust the hosecock clamp on the retentate tube to achieve the
desired pressure to drive filtration (see Note 10).
Fig. 1 A schematic of the tangential flow filtration (TFF) setup described in Note 3. The supernatant is pumped
into a pressurized filter. The filtrate (permeate) is removed, and the retentate is recirculated. Buffer can be
added to replace lost medium. Arrows indicate the direction of the flow and the tubing
7. Once the supernatant is reduced to the desired volume

(we typically use 350–550 mL: 200–400 mL in the bottle
and 150 mL in the tubing of the TFF system), begin buffer
exchange (see Note 11).
8. Set up Exponential Buffer Exchange: First measure the amount
of permeate being produced, in mL/min. Then set up a small
peristaltic pump to add the desired buffer (PBS for gB730, or
TN for gH/gL) to the supernatant at the same rate that
permeate is being removed. This is the quickest way to do
buffer exchange but is not suitable for all preparations (see
Note 12).
9. Perform buffer exchange until the percentage of original media
in the retentate has been reduced to the desired amount: 0.5%
for gB730 and 0.2% for gH803-H6/gL (see Note 13).
10. When finished concentrating the supernatant or performing
buffer exchange, place the feed flow tubing in a bottle that
contains 200–300 mL of PBS (the retentate tubing should
remain in the feed tank). Loosen the hosecock clamp on the
retentate tubing and pump the PBS through the TFF filter
until the PBS has flowed through the TFF system but stopping
before air gets pumped through the TFF filter. Do this even if
buffer exchange is not performed to help remove residual
protein that may be on the TFF filter.
11. Add PMSF solution to a concentration of 0.1 mM and save
50 μL aliquots of the TFF retentate and permeate to monitor
protein loss during purification.
12. For gB and other proteins purified using immunoaffinity, go to
Subheading 3.3. For gH/gL and other proteins purified by Ni
IMAC, go to Subheading 3.4. Purification using other affinity
tags will require protocol modification based on the affinity
resin manufacturer’s instructions.
3.3 Immunoaffinity 1. Equilibrate the immunoaffinity column in AB-W buffer using a

Purification peristaltic pump. This and all subsequent purification steps are
done at 4 C.
2. Load the TFF retentate onto the immunoaffinity column using
a small peristaltic pump and adjust the flow rate such that the
retentate will bind the column overnight. Save a 50 μL aliquot
of the flow through to monitor protein loss during purification.
3. Wash the column with ~70 column volumes (CV) of AB-W
buffer to remove nonspecifically bound proteins and other
molecules. This step should be optimized for optimal protein
purity and yield. Save a 50 μL aliquot of the wash fraction.
4. Add 20 μL of PMSF solution to an empty tube and elute into

that tube at 1 mL/min with 20 CV of KSCN solution. Save a
50 μL aliquot of the eluate fraction. Concentrate the eluate to
1 mL or less in an Amicon-15 concentrator prior to further
purification by size-exclusion chromatography. Go to Sub-
heading 3.5 for the next step: size-exclusion chromatography.
5. Wash the column with 75 CV of AB-W buffer plus sodium
azide solution to prevent microbial growth and seal it for
storage.
3.4 IMAC Purification 1. To reduce nonspecific binding to the Ni resin, 20 mM imidaz-

ole should be added to the TFF retentate containing gH/gL
(see Note 14). This step should be optimized for optimal
protein purity and yield.
2. Capture gH/gL on Ni resin in a batch-binding mode by incu-
bating 0.5 mL of Ni resin with 45 mL TFF retentate in a 50 mL
conical tube for 1 h at 4 C on a nutating shaker (see Note 15).
This and all subsequent steps are done at 4 C.
3. Recover the Ni resin containing bound gH/gL by centrifuging
the 50 mL conical tube at 1000 g for 5 min. Remove the
supernatant and collect it in a container labeled flow through.
Repeat steps 2 and 3 until all the TFF retentate containing
gH/gL has been mixed with the Ni resin for binding. We
recommend saving all flow through in this and subsequent
steps for SDS-PAGE analysis.
4. Resuspend the Ni resin with 5 mL Ni-B buffer in the 50 mL
conical tube and then transfer it to an empty 10 mL chroma-
tography column. Rinse the 50 mL conical tube with 2–3 mL
of Ni-B buffer to collect residual Ni resin from the sides of the
tube and add it to the chromatography column. Allow the Ni-B
buffer to flow through the column and collect in container
labeled wash 1. We recommend using gravity flow for gH/gL
purification (see Note 16).
5. Wash the column with 10 column volumes (CV) of Ni-B buffer
(see Note 17) and continue to collect the flow through in the
container labeled wash 1.
6. Wash the column with 10 CV of Ni-W buffer and collect the
flow through in a container label wash 2. This step is required
for gH/gL to remove a 43 kDa cathepsin contaminant (see
Note 18).
7. Prepare a 15 mL conical tube containing 20 μL of PMSF
solution and 100 μL of EDTA solution. Elute into this tube
using 10 CV of Ni-E buffer (see Note 19). Imidazole concen-
trations and the volume of Ni-E buffer should be optimized.
Concentrate the eluate to 1 mL or less in an Amicon-15
concentrator. Further purification is then done using size-

exclusion chromatography, as described in Subheading 3.5.
3.5 Size-Exclusion 1. Load the concentrated protein purified by IMAC or immu-

Chromatography noaffinity chromatography into a 0.1 μm PVDF centrifugal
filter and centrifuge the protein at 17,000 g and 4 C for
10 min to remove any particulates. Load the protein onto a
size-exclusion column (e.g., Superdex S200 10/30 GL) equi-
librated in TNE buffer and collect the peak corresponding to
monodisperse protein. gB730 elutes ~2.5 mL after the void
volume while gH/gL elutes ~5.5 mL after the void volume on
a Superdex S200 10/30 GL column.
2. Concentrate the protein to 3.5–4.5 mg/mL (gB730) or
1.4–1.8 mg/mL (gH803-H6/gL) using an Amicon Ultra-4
concentrator. Concentrations of 4–6 mg/mL are recom-
mended for initial crystallization trials on other glycoproteins.
3.6 Crystallization 1. Use a pipette tip to make a notch in the grease ring around the
edge of each well in a pre-greased 24-well plate.
2. Add 750 μL of filtered crystallization solution to each well that
will be used (see Note 20).
3. Briefly spray a siliconized glass cover slip with air, and put it face
up on a clean work surface. Add 1 μL crystallization solution
and 1 μL protein to the center of the cover slip; then flip it over
and use it to seal the well. Use the back of a 1 mL pipet tip to
press the cover slip down evenly without smudging it. Repeat
these steps with additional crystal setups.
4. Store the crystal plate in a vibration-free environment at a
constant temperature. gB crystals appear as hexagonal rods
after 3–6 days and grow to their final sizes of 0.1–0.5 mm
after 2–4 weeks. It is normal for some granular precipitate to
appear within 48 h. gH/gL crystals are tetragonal and appear
after 4–5 days, growing to their final size of 0.1–0.2 mm after
2–3 weeks (Fig. 2).
5. Freezing gH/gL crystals. Working at the microscope, place a
2 μL drop of gH/gL cryo solution on a new siliconized glass
cover slide. Carefully remove the cover slide with the crystal
drop from the well and flip it over. Use a mounted cryoloop of
appropriate size (slightly larger than the crystal) on the end of
the long crystal wand to scoop up a crystal and place it in the
drop of cryo solution briefly (10 s to 5 min), and then plunge
the crystal into liquid nitrogen (see Note 21). Use the vial
clamp to place the vial on the crystal cap without removing
either from liquid nitrogen. Store vials long term in CryoCanes
surrounded by cryosleeves in a liquid nitrogen Dewar flask or
collect data on them immediately.
Fig. 2 (a) Elongated trigonal crystals of HSV-1 gB730. (b) a tetragonal crystal of HSV-2 Δ48gH803/gL
6. Freezing gB crystals. gB crystals are not all grown under the

same crystal conditions. The cryo solution for gB should match
the well solution in which the crystals grew plus an extra
150 mM NaCl to account for NaCl present in the protein
solution and 15% mesoerythritol as a cryoprotectant. gB
requires stepwise addition of cryoprotectant, so cryo solutions
containing 0%, 5%, 10%, and 15% mesoerythritol should be
made prior to freezing crystals. Initially transfer the crystal
into a 2 μL drop of 0% mesoerythritol gB cryo solution. Then
add 2 μL of the 5% mesoerythritol gB cryo solution drop and
remove 2 μL of liquid from the other side of the drop, watching
carefully to avoid pipetting up the crystal. Repeat this with the
10% and 15% gB cryo solutions. Finally, transfer the crystal
briefly to a drop of 15% mesoerythritol gB cryo solution, and
then plunge into liquid nitrogen and proceed as described for
gH/gL crystals.
4 Notes
1. Use of aeration is necessary for growing insect cells in volumes

of 1 L and above. Insect cells can also be grown in shaker flasks,
but that method is not described here.
2. The recombinant baculovirus used for gB730 expression
encodes HSV-1 gB residues 31-730 with a melittin signal
sequence, described previously [17, 32]. The HSV-2
Δ48gH803-His6/gL construct used for crystallization
encodes all of gL and the N-terminally truncated gH ectodo-
main 48-803, as well as the gH N-terminal signal sequence,
residues 1-18, also described previously [23].
3. Several complete TFF systems are available on the market.
Nevertheless, due to its reliability and low cost, we recommend
assembling a basic TFF system from separate components,
which include an Easy-Load Peristaltic Pump (Millipore
XX80EL000) with dedicated 3/800 inner diameter tubing

(Millipore XX802GS25), a pressure gauge (Millipore
YY1301015) with fittings for 5/1600 inner diameter tubing, a
Prep/Scale 30 kDa TFF Filter (Millipore), a ring stand and
clamps to hold the system in place, 3/1600 inner diameter
tubing (Millipore XX8000T24) (for permeate), 5/1600 inner
diameter tubing (for retentate), fuel hose clamps, and a hose-
cock clamp (Fisher 05-847Q). The TFF system should be
assembled as follows: Connect 4 ft of the large feed flow tubing
used for the Easy-Flow Pump (3/800 inner diameter) to the
pressure gauge via the fittings. Seal the connection by wrapping
the connected end of the tubing (over the fitting) with two
layers of paper towel and tightening a fuel hose clamp around
the paper towel. Repeat this method to connect the other end
of the pressure gauge to the feed port on the bottom of the
TFF filter; use paper towel plus fuel hose clamps to tighten the
tubing at both the fitting on the pressure gauge and at the feed
port on the TFF filter. Connect ~3 ft of 5/1600 diameter tubing
to the retentate port on the TFF filter; connect ~4 ft of 3/1600
tubing to the permeate port in the middle of the top of the TFF
filter. Place a hosecock clamp on the retentate tubing near its
connection to the TFF filter. Flush with distilled water at 20 psi
for at least 2 min to ensure that there are no leaks (loosen or
tighten fuel hose clamps to eliminate leaks). See Fig. 1 and the
TFF filter documentation for additional details.
4. Use of the Ni Sepharose Excel resin eliminates the need for
buffer exchange before binding the protein to the Ni resin
because this resin is more resistant to being stripped by the
metal-chelating agents in the cell media, so the filtered super-
natant can be applied directly to the resin.
5. Spinner flasks should be autoclaved twice. For the first auto-
clave cycle, use a 20 min liquid cycle without attaching air filters
and with ~100 of distilled water at the bottom of the flask. After
the first cycle, empty the water from the flask and attach the air
filters to airflow ports on the flask. Then cover all caps, airflow
ports, and filters on the flask with aluminum foil. For the
second autoclave cycle, use a 30- or 40 min gravity cycle.
6. Take a 1 mL sample of the insect cell suspension culture. Mix
10 μL of the insect cell suspension culture sample with 10 μL of
trypan blue solution to make a 1:1 dilution of the cell suspen-
sion in trypan blue. Load 10 μL of the cell suspension with the
trypan blue onto a hemocytometer. Cells that appear blue are
dead and cells that appear white are living. Count the living and
the dead cells (separately) in one 1 1 mm square of the
hemocytometer. The viability can be determined by dividing
the number of living cells by the total number of cells.
7. It is not necessary to determine the titer of baculovirus stocks

used for protein expression because the amount of baculovirus
necessary to achieve optimal protein expression is best deter-
mined experimentally. In our experience, using 4–10 mL of P3
stock per 1 L cells at a density 2 106 cells/mL is typically a
good starting point regardless of the glycoprotein nature and
often does not require further optimization. During optimiza-
tion of protein expression, we find it helpful to monitor cells
death during expression. If excessive cell death, viability of 60%
or less, is observed after 3 days, the amount of P3 used for
infection should be decreased. If protein expression is low, the
amount of P3 used for infection should be increased. Volumes
within a 1–20 mL range have been used successfully.
8. Air settings of 25–50 mL/min are often used for 1 L cultures
and of 50–100 mL/min for 1.6 L cultures, but airflow should
be adjusted to minimize frothing on the surface of the culture
(no more than a thin layer of bubbles and should not appear
foamy).
9. The TFF system may be flushed with distilled water at either
room temperature or at 4 C. However, it is ideal to equilibrate
the system with PBS at 4 C. To equilibrate the TFF system in
PBS the inlet tubing, waste tubing, and retentate tubing all go
into the “feed tank” bottle of 400 mL of PBS so that the PBS is
recycled as it flows through the system. Refer to Fig. 1.
10. We recommend using the maximum pressure that will not
damage the filter. We use 10 psi. Higher pressures provide
faster filtration but may promote protein aggregation.
11. Buffer exchange only needs to be done for immunoaffinity
purification or if using standard Ni resin for purification. Lon-
ger time for TFF and buffer exchange may lead to protein
aggregation on the TFF filter.
12. Exponential buffer exchange works quickly because, at every
moment, the highest possible fraction of supernatant is
replaced by buffer. However, it is done at low volume (high
protein concentration) and high pressure; some proteins may
aggregate under these conditions. In that case, either try expo-
nential buffer exchange at a higher static volume (500 mL or
more instead of 350 mL) or do buffer exchange by iterative
dilution: pouring in 1 L buffer every time the total volume
drops to the desired low point (350 mL, which is 200 mL in
the bottle and 150 mL in the TFF system).
13. For exponential buffer exchange, the percent of original media
components still present in the retentate can be calculated by
using the “continuously compounded interest” equation
b ¼ ae ð v Þt , where b is the current percent of original media,
r
a is the original percent (100, unless some buffer exchange was

done previously), r is the permeate flow rate (mL/min), v is the

retentate volume, and t is the time (minutes). For iterative
dilution buffer exchange (see Note 12), the equation used for
each dilution is ¼ aVV dc , where b is the current percent of original
media after the retentate has been diluted, a is the percent prior
to dilution, and Vc and Vd are the volumes of retentate both
before and after dilution (which includes the approximately
150 mL of retentate circulating through the TFF system). We
find that 0.5% works well for gB and recommend this value for
other proteins purified using immunoaffinity chromatography.
gH/gL requires more extensive TFF, to 0.2% or less original
media, due to presence of cobalt in the insect cell medium
possibly interfering with binding of the His6-tag on gH/gL
to Ni resin. This step should be optimized for different con-
structs, and especially for different affinity tags. Contact the
manufacturer of the insect cell medium to find out which
components may interfere with the specific affinity purification.
14. For some His-tagged proteins, addition of 10 mM imidazole
or leaving out imidazole helps improve binding.
15. Batch binding is required for effective binding of gH/gL to Ni
resin. Several 50 mL conical tubes with Ni resin may be used to
speed up the binding process. Other proteins may efficiently
bind Ni resin using gravity or peristaltic pump-aided flow.
16. For gH/gL, yield of monodisperse protein is improved slightly
when using gravity flow instead of pumps. Peristaltic flow at
2 mL/min can be used to accelerate purification during all
steps and typically works well with other proteins.
17. Longer wash with Ni-B buffer may be necessary depending on
the preparation size. The amount of washing and imidazole
concentration may need to be optimized for other proteins.
For His-tagged proteins other than gH/gL, we recommend
starting with a 10 mM imidazole concentration in the initial
wash buffer.
18. Longer wash with Ni-W buffer may be necessary. Imidazole
concentration, salt concentration, and the amount of washing
may need to be optimized for other proteins. For His-tagged
proteins other than gH/gL, we recommend starting with a
20 mM imidazole and 100–150 mM NaCl in the Ni-W buffer.
19. To increase gH/gL purity, 140 mM imidazole can be used
during the elution step because several contaminants bind Ni
resin more tightly than gH/gL.
20. gH/gL crystallizes with 20% PEG 4000 and 100 mM Na
citrate, pH 4.5. Optimization of these conditions did not
improve crystals in our experience. Crystal reproducibility is
low, and we recommend setting up multiple identical crystalli-
zation drops for gH/gL. gB crystallizes under multiple
conditions [17, 27, 28] but most easily under 15% PEG 4000,
200 mM NaCl, and 100 mM Na citrate, pH 5.5. Larger
crystals can often be obtained by reducing PEG 4000 concen-
tration to 10% or lower. gB crystallization can be optimized by
a grid screen of 0.1, 0.2, 0.3, 0.4, and 0.5 M NaCl versus 1%
increments of PEG 4000 from 6% to 15%.
21. Crystal drops will begin to dry out once exposed to air. 2 μL of
well solution may be added to the drop to prevent crystal
degradation short-term, up to 30 min, although doing so
may compromise the drop if the coverslip is resealed onto the
well for later use.
Acknowledgments
We acknowledge the contributions of the laboratory of Roselyn

Eisenberg and Gary Cohen toward the development of the initial
purification protocols of HSV-1 gB730 and HSV-2 gH803/gL
produced using recombinant baculoviruses. We also thank Tiru-
mala K. Chowdary and Sapna Sharma for their work in establishing
and optimizing these protocols in our laboratory. Finally, we thank
past and present members of the Heldwein lab for helpful advice
and discussions.
References
1. Heldwein EE, Krummenacher C (2008) Entry 6. Davis-Poynter N, Bell S, Minson T, Browne H
of herpesviruses into mammalian cells. Cell (1994) Analysis of the contribution of herpes
Mol Life Sci 65(11):1653–1668. https://doi. simplex virus type 1 membrane proteins to the
org/10.1007/s00018-008-7570-z induction of cell-cell fusion. J Virol
2. Johnson DC, Baines JD (2011) Herpesviruses 68:7586–7590
remodel host membranes for virus egress. Nat 7. Roop C, Hutchinson L, Johnson DC (1993) A
Rev Microbiol 9(5):382–394. https://doi. mutant herpes simplex virus type 1 unable to
org/10.1038/nrmicro2559 express glycoprotein L cannot enter cells, and
3. Johnson DC, Huber MT (2002) Directed its particles lack glycoprotein H. J Virol 67
egress of animal viruses promotes cell-to-cell (4):2285–2297
spread. J Virol 76(1):1–8 8. Ligas MW, Johnson DC (1988) A herpes sim-
4. Cairns TM, Huang ZY, Whitbeck JC, Ponce de plex virus mutant in which glycoprotein D
Leon M, Lou H, Wald A, Krummenacher C, sequences are replaced by b-galactosidase
Eisenberg RJ, Cohen GH (2014) Dissection of sequences binds to but is unable to penetrate
the antibody response against herpes simplex into cells. J Virol 62:1486–1494
virus glycoproteins in naturally infected 9. Cai WH, Gu B, Person S (1988) Role of glyco-
humans. J Virol 88(21):12612–12622. protein B of herpes simplex virus type 1 in viral
https://doi.org/10.1128/JVI.01930-14 entry and cell fusion. J Virol 62(8):2596–2604
5. Cairns TM, Huang ZY, Gallagher JR, Lin Y, 10. Rogalin HB, Heldwein EE (2016) Characteri-
Lou H, Whitbeck JC, Wald A, Cohen GH, zation of vesicular stomatitis virus pseudotypes
Eisenberg RJ (2015) Patient-specific neutraliz- bearing essential entry glycoproteins gB, gD,
ing antibody responses to herpes simplex virus gH, and gL of herpes simplex virus 1. J Virol 90
are attributed to epitopes on gD, gB, or both (22):10321–10328. https://doi.org/10.
and can be type specific. J Virol 89 1128/JVI.01714-16
(18):9213–9231. https://doi.org/10.1128/
JVI.01213-15
11. Eisenberg RJ, Atanasiu D, Cairns TM, Galla- 21. Lee CC, Lin LL, Chan WE, Ko TP, Lai JS,
gher JR, Krummenacher C, Cohen GH (2012) Wang AH (2013) Structural basis for the anti-
Herpes virus fusion and entry: a story with body neutralization of herpes simplex virus.
many characters. Viruses 4(5):800–832. Acta Crystallogr D Biol Crystallogr 69
https://doi.org/10.3390/v4050800 (Pt 10):1935–1945. https://doi.org/10.
12. Krummenacher C, Supekar VM, Whitbeck JC, 1107/S0907444913016776
Lazear E, Connolly SA, Eisenberg RJ, Cohen 22. Lu G, Zhang N, Qi J, Li Y, Chen Z, Zheng C,
GH, Wiley DC, Carfi A (2005) Structure of Gao GF, Yan J (2014) Crystal structure of
unliganded HSV gD reveals a mechanism for herpes simplex virus 2 gD bound to nectin-1
receptor-mediated activation of virus entry. reveals a conserved mode of receptor recogni-
EMBO J 24(23):4144–4153. https://doi. tion. J Virol 88(23):13678–13688. https://
org/10.1038/sj.emboj.7600875 doi.org/10.1128/JVI.01906-14
13. Atanasiu D, Saw WT, Cohen GH, Eisenberg 23. Chowdary TK, Cairns TM, Atanasiu D, Cohen
RJ (2010) Cascade of events governing cell-cell GH, Eisenberg RJ, Heldwein EE (2010) Crys-
fusion induced by herpes simplex virus glyco- tal structure of the conserved herpesvirus
proteins gD, gH/gL, and gB. J Virol 84 fusion regulator complex gH-gL. Nat Struct
(23):12292–12299. https://doi.org/10. Mol Biol 17(7):882–888. https://doi.org/
1128/JVI.01700-10 10.1038/nsmb.1837. nsmb.1837 [pii]
14. Atanasiu D, Saw WT, Eisenberg RJ, Cohen 24. Cocchi F, Fusco D, Menotti L, Gianni T,
GH (2016) Regulation of HSV glycoprotein Eisenberg RJ, Cohen GH, Campadelli-Fiume
induced cascade of events governing cell-cell G (2004) The soluble ectodomain of herpes
fusion. J Virol 90:10535. https://doi.org/10. simplex virus gD contains a membrane-
1128/JVI.01501-16 proximal pro-fusion domain and suffices to
15. Stampfer SD, Heldwein EE (2013) Stuck in mediate virus entry. Proc Natl Acad Sci U S A
the middle: structural insights into the role of 101(19):7445–7450
the gH/gL heterodimer in herpesvirus entry. 25. Kost TA, Condreay JP, Jarvis DL (2005) Bacu-
Curr Opin Virol 3(1):13–19. https://doi.org/ lovirus as versatile vectors for protein expres-
10.1016/j.coviro.2012.10.005 sion in insect and mammalian cells. Nat
16. Backovic M, Jardetzky TS (2009) Class III viral Biotechnol 23(5):567–575. https://doi.org/
membrane fusion proteins. Curr Opin Struct 10.1038/nbt1095
Biol 19(2):189–196. https://doi.org/10. 26. Bac-to-Bac Baculovirus Expression System
1016/j.sbi.2009.02.012. S0959-440X(09) (2018) Bac-to-Bac Baculovirus Expression Sys-
00031-1 [pii] tem. User guide. Revision B. Thermo Fisher
17. Heldwein EE, Lou H, Bender FC, Cohen GH, Scientific, Waltham, MA
Eisenberg RJ, Harrison SC (2006) Crystal 27. Stampfer SD, Lou H, Cohen GH, Eisenberg
structure of glycoprotein B from herpes sim- RJ, Heldwein EE (2010) Structural basis of
plex virus 1. Science 313(5784):217–220 local, pH-dependent conformational changes
18. Fontana J, Atanasiu D, Saw WT, Gallagher JR, in glycoprotein B from herpes simplex virus
Cox RG, Whitbeck JC, Brown LM, Eisenberg type 1. J Virol 84(24):12924–12933. https://
RJ, Cohen GH (2017) The fusion loops of the doi.org/10.1128/JVI.01750-10
initial prefusion conformation of herpes sim- 28. Vitu E, Sharma S, Stampfer SD, Heldwein EE
plex virus 1 fusion protein point toward the (2013) Extensive mutagenesis of the HSV-1
membrane. MBio 8(4):e01268-17. https:// gB ectodomain reveals remarkable stability of
doi.org/10.1128/mBio.01268-17 its postfusion form. J Mol Biol 425
19. Carfi A, Willis SH, Whitbeck JC, (11):2056–2071. https://doi.org/10.1016/j.
Krummenacher C, Cohen GH, Eisenberg RJ, jmb.2013.03.001
Wiley DC (2001) Herpes simplex virus glyco- 29. Hannah BP, Cairns TM, Bender FC, Whitbeck
protein D bound to the human receptor HveA. JC, Lou H, Eisenberg RJ, Cohen GH (2009)
Mol Cell 8(1):169–179 Herpes simplex virus glycoprotein B associates
20. Di Giovine P, Settembre EC, Bhargava AK, with target membranes via its fusion loops. J
Luftig MA, Lou H, Cohen GH, Eisenberg Virol 83(13):6825–6836. https://doi.org/10.
RJ, Krummenacher C, Carfi A (2011) Struc- 1128/JVI.00301-09. JVI.00301-09 [pii]
ture of herpes simplex virus glycoprotein D 30. Hutchinson L, Browne H, Wargent V, Davis-
bound to the human receptor nectin-1. PLoS Poynter N, Primorac S, Goldsmith K, Minson
Pathog 7(9):e1002277. https://doi.org/10. AC, Johnson DC (1992) A novel herpes sim-
1371/journal.ppat.1002277 plex virus glycoprotein, gL, forms a complex
with glycoprotein H (gH) and affects normal
folding and surface expression of gH. J Virol (2):e00046–13. https://doi.org/10.1128/

66:2240–2250 mBio.00046-13
31. Atanasiu D, Cairns TM, Whitbeck JC, Saw WT, 32. Bender FC, Whitbeck JC, Ponce de Leon M,
Rao S, Eisenberg RJ, Cohen GH (2013) Reg- Lou H, Eisenberg RJ, Cohen GH (2003) Spe-
ulation of herpes simplex virus gB-induced cell- cific association of glycoprotein B with lipid
cell fusion by mutant forms of gH/gL in the rafts during herpes simplex virus entry. J Virol
absence of gD and cellular receptors. MBio 4 77(17):9542–9552
Chapter 24
Expression, Purification, and Crystallization of Full-Length

HSV-1 gB for Structure Determination
Rebecca S. Cooper and Ekaterina E. Heldwein
Abstract
HSV glycoproteins play important roles in the viral life cycle, particularly viral cell entry. Here we describe
the protocol for expression, purification, and crystallization of full-length HSV-1 glycoprotein B. The
protocol provides a framework for incorporating transmembrane domain-stabilizing amphipols into the
crystallization setup and can be adapted to isolate other complete HSV glycoproteins.
Key words Herpes simplex viruses, Glycoproteins, Viral entry, Ectodomain, Crystallography, Protein
purification, Membrane protein
1 Introduction
Herpes Simplex Viruses Type 1 and 2 (HSV-1 and HSV-2) are

enveloped viruses that must fuse their surrounding membrane with
those of target cells to cause infection. Of the approximately dozen
glycoproteins that stud a virion’s surface, just four—gD, the
gH/gL heterodimer, and gB—are required for this entry process
[1, 2]. These proteins may act in series to effect fusion, beginning
with the binding of gD to one of its three cellular receptors
[3]. Receptor binding triggers a conformational change in gD
that facilitates its interaction with gH/gL [4]. Activated gH/gL
can then initiate the refolding of gB, a class III fusogen, from its
prefusion to postfusion form [5–7]. This conformational change in
gB is expected to be a dramatic and thermodynamically favorable
rearrangement, providing the energy to merge the membranes
surrounding the HSV virion and its target cell [8]. While gD is
encoded only by α-herpesviruses—β- and γ-herpesviruses rely upon
unrelated glycoproteins to engage receptors—the gB fusogen is
highly conserved amongst all herpesviruses. gB may utilize the
gH/gL heterodimer, which is also present in all herpesviruses but
has a comparatively more variable sequence and domain
395
396 Rebecca S. Cooper and Ekaterina E. Heldwein
arrangement, to act as an adaptor to this diverse pool of receptor-

binding proteins [9]. Given its universal role, structural informa-
tion on gB is potentially relevant to the treatment of many herpes-
viruses, including the design of vaccines and therapies for human
cytomegalovirus [10, 11].
Many HSV glycoproteins possess at least one transmembrane
region, but due to the difficulty of extracting these proteins from
the membrane, most studies have focused on their soluble ectodo-
mains. The ectodomains of several HSV glycoproteins, gD
[3, 12–15], gB [5, 16], and the gH/gL heterodimer [17], have
been expressed as secreted proteins and crystallized. These struc-
tures have provided a wealth of information on these proteins,
identifying their functional domains and how gD interacts with its
receptors [2].
Yet despite the advances made through these ectodomain stud-
ies, there are compelling reasons to study HSV glycoproteins as
full-length constructs. First, of the four essential entry glycopro-
teins, only gD functions efficiently as a soluble or generically
anchored construct [4, 18]. In gH/gL, the apparent simplicity of
the complex’s single-pass transmembrane helix and unstructured
tail belie the latter’s critical role in triggering fusion. Fusion is
progressively reduced by shortening this tail, which may interact
with the internal cytoplasmic domain (cytodomain) of the gB
fusogen itself [19]. This large, trimeric domain requires contact
with anionic membranes to fold and is a key regulator of the
ectodomain fusion machinery [20, 21]. The cytodomain is effec-
tively responsible for maintaining gB in its prefusion state, the
architecture of which remains unknown, and engineered and clini-
cally isolated mutations in the cytodomain lower the energetic
barrier to fusion [22]. These mutations coincide with its key struc-
tural features and points of interdomain contact in the recently
solved full-length gB structure [23]. Strategies for trapping the
elusive prefusion conformation or investigating how input from
gH/gL is registered will benefit from this more complete picture
of gB. Additionally, exploration of how cytodomain changes are
transmitted to the ectodomain requires structural knowledge of the
intervening transmembrane and membrane proximal regions.
Insect cells infected with recombinant baculovirus were used to
produce gBd71 (HSV-1 gB 72-904), a construct in which the
native signal sequence is replaced by a melittin signal sequence
and a portion of the flexible N-terminus prone to degradation is
omitted. Unlike proteins produced in bacterial cells, proteins
expressed in insect cells can be properly folded, posttranslationally
modified (glycosylated or proteolytically processed), and trafficked
to produce soluble or membrane-embedded products [24]. Insect
cells are also relatively simple to grow, and protein expression can be
easily scaled up to large volumes at significantly lower cost than in
mammalian cells. Finally, the baculoviruses used in baculovirus
Expression, Purification, and Crystallization of HSV-1 gB 397
expression vector systems (BEVS) are easily manipulated and rela-

tively safe to use.
The use of BEVS technology for expression of recombinant
proteins, including glycoproteins, is described elsewhere [24]
and will not be discussed in detail here. Although there are several
BEVS systems currently on the market, we use the Bac-to-Bac®
Baculovirus Expression System (Invitrogen) [25] due to its simplic-
ity and relative speed of generating the required recombinant bacu-
loviruses. Briefly, DNA fragments encoding the protein region of
interest are subcloned into a plasmid vector suitable for baculovirus
generation. The protein is then expressed from a strong lytic pro-
moter of baculovirus. Inclusion of a native or borrowed protein
signal sequence, such as honeybee melittin for gBd71, ensures that
it is targeted to the proper cellular location. We typically expand the
initial baculovirus stock in two passaging steps. The resulting pas-
sage 3, also referred to as P3, can be used to infect insect cells for
protein production.
Here, we describe a general protocol for expression, purifica-
tion, and crystallization of gBd71 expressed in SF9 cells and
extracted from the membrane using n-Dodecyl-β-D-Maltopyrano-
side (DDM). The resulting crystal structure of gBd71 (PDB ID
5V2S) has been reported [23]. While the protocol described here
uses Sf9 insect cells, Sf21 or High Five insect cells can also be used.
The immobilized metal ion affinity chromatography (IMAC) puri-
fication process for gBd71 uses its C-terminal hexahistidine tag,
and yields ~0.7 mg of protein per liter of culture. Recommenda-
tions for adding amphipathic polymers to further stabilize the
transmembrane region, as well for exchanging the protein into an
alternative detergent, are given.
2 Materials
2.1 Protein 1. A setup for growth of insect cells in suspension in spinner flasks
Expression (see Note 1), including several 3-L spinner flasks with a 2-port
airflow assembly, a magnetic stir plate for spinner flasks, an air
pump, a gas blending stand, ¼00 inner diameter autoclavable
plastic tubing, and 0.2 μm air filter units (Millex-FG50 or
similar). Available as a kit from Bellco (1965-86115) or may
be purchased separately.
2. Refrigerated incubator set to 27 C.
3. Laminar flow hood for sterile work.
4. Sf9 cells adapted to growth in suspension culture in serum-free
insect cell media.
5. Serum-free insect cell growth medium (e.g., Sf-900 II SFM).
6. Pen-Strep solution: 10,000 IU penicillin and 10,000 μg/mL

streptomycin in 100 mL of distilled water.
7. Recombinant baculovirus from P3 encoding gBd71 (see
Note 2).
8. Trypan blue solution: 0.4% trypan blue (w/v) in PBS.
2.2 Protein 1. Empty 10-mL chromatography column.

Purification 2. M-110S microfluidizer (Microfluidics).
3. Phenylmethylsulfonyl fluoride (PMSF) solution: 100 mM
PMSF in isopropanol (caution: cytotoxic, use eye protection).
4. n-Dodecyl-β-D-Maltopyranoside (DDM) (see Notes 3 and 4).
5. Roche protease inhibitor cocktail tablet, EDTA free.
6. Resuspension buffer (RB): 50 mM Tris-HCl pH 8.0, 150 mM
NaCl, 10% glycerol, 0.1 mM PMSF (see Note 5).
7. Lysis buffer (LB): 50 mM Tris-HCl pH 8.0, 150 mM NaCl,
10% glycerol, 1 mM PMSF, 1 Roche EDTA-free protease
inhibitor cocktail.
8. Solubilization buffer (SB): 600 mg of DDM dissolved in
20 mL of RB, prepared in a 50 mL tube.
9. 15 mL dounce homogenizer.
10. Nickel Sepharose 6 Fast Flow (GE Healthcare) or a similar
resin.
11. 1 M imidazole stock in water, filtered to 0.22 μM.
12. Wash buffer 1 (WB1): 20 mM Tris-HCl pH 8.0, 150 mM
NaCl, 5% glycerol, 0.05% DDM, 20 mM imidazole.
13. Wash buffer 2 (WB2): 20 mM Tris-HCl pH 8.0, 150 mM
NaCl, 5% glycerol, 0.05% DDM, 35 mM imidazole.
14. Elution buffer (EB): 20 mM Tris-HCl pH 7.5, 150 mM NaCl,
5% glycerol, 0.05% DDM, 300 mM imidazole.
15. Gel filtration buffer (GF): 20 mM Tris-HCl pH 7.5, 150 mM
NaCl, 5% glycerol, 0.05% DDM, filtered to 0.22 μM.
concentrator.
concentrator.
18. Centrifugal filter for aggregate removal.
19. Spectrophotometer for protein absorbance measurement.
20. Superdex 200 10/300 GL column (GE Healthcare).
21. Amphipol A8-35 (Anatrace, A835).
2.3 Crystallization 1. 24-well pregreased crystallization plates (Hampton Research).

2. 22-mm siliconized circle cover slides (Hampton Research).
3. Aerosol duster or in-house air.
4. Stereomicroscope for crystal observation.
5. A8-35 amphipol solution: 20 mM Tris-HCl pH 7.5, 150 mM
NaCl, 5% glycerol, 0.5% A8-35, filtered to 0.22 μM.
6. Crystallization solution: 16% PEG-3350, 100 mM HEPES pH
7.2, and 150 mM sodium formate, filtered to 0.22 μM.
7. Cryoprotection solution: 3 parts gB crystallization solution
with 2 parts 50% glycerol (see Note 18).
8. ALS-style crystal pucks, puck wand, puck separator tools,
shelved puck shipping cane, and bent cryo tongs.
9. Assorted cryo loops, ranging from 0.05 to 0.3 μM in size
(Hampton Research).
10. ALS-style puck compatible mounting bases (e.g., CrystalCap
ALS (Hampton Research)).
11. CrystalWand handling tools (Hampton Research).
12. Acupuncture or another micro-needle.
13. Filtered 50% glycerol.
14. Liquid nitrogen.
15. Liquid nitrogen dewars for crystal freezing and temporary
puck storage (Hampton Research).
3 Methods
3.1 Protein 1. Wash, assemble, and autoclave 3-L spinner flasks and the
Expression 2-port airflow assembly with 0.2 μm air filters as per the man-
ufacturer’s instructions (see Note 1).
2. Expand Sf9 cells to obtain an appropriate volume of suspension
culture in log phase at a density of 2 106 living cells/mL
using Sf9 cell culture medium. The viability should be at least
97% as determined by trypan blue staining (see Note 6). Cell
culture volume should be calculated based on the required
amount of pure protein and expected yield. 1–1.6 L cultures
can be grown in a 3-L flask. We typically use a 1.4 L culture and
obtain ~0.7 mg HSV-1 gBd71 per liter of culture.
3. In a tissue culture hood, infect the Sf9 cells with recombinant
baculovirus by adding 10 mL of P3 per 1 L of cells (see Note 7).
4. Incubate infected cells for 60–72 h at 27 C with a spinner
setting of 75 rpm and the airflow adjusted to prevent excessive
bubble accumulation (see Note 8).
5. Harvest the cell culture pellet containing membrane proteins

by centrifugation for 30 min at 4 C and 4000 g. Discard the
supernatant. For this and all subsequent steps, a sterile envi-
ronment is not required.
6. Resuspend the pelleted cells in 90 mL RB by stirring or gently
swirling the bottles. Transfer the suspension to 50 mL Falcon
tubes.
7. Pellet the cells at 4000 g for 10 min and pour off the buffer.
8. Proceed with the purification or store the cell pellets at 80 C
for up to 3 months (see Note 9).
3.2 Crude Membrane 1. Thaw the pellets and resuspend them at 4 C in 35 mL of LB by

Preparation rotating and lightly vortexing them. Try to minimize foaming.
and Solubilization 2. Rinse the fluidizer with LB or RB and chill the outlet coil in an
ice bath. Lyse the cells with three passes through the fluidizer at
80 psi, using an additional 10 mL of LB or RB to recover all
lysate from the machine. Transfer the lysate to a 50 mL tube
and adjust the final volume to 50 mL with LB or RB, reserving
a 50 μL aliquot for analysis (see Note 10).
3. Clarify the lysate with a 25 min spin at 4000 g and 4 C.
4. Transfer the clarified lysate to two 50.2 Ti polycarbonate cen-
trifuge bottles or the equivalent, avoiding as much of the loose
cell debris pellet as possible. Add RB to bring the weight of the
tube + clarified lysate + cap assembly to 55 g (approximately
50 mL).
5. Centrifuge the lysate at 145,000 g for 1.5 h at 4 C (see
Note 11).
6. Remove the supernatant (soluble proteins) promptly to pre-
vent “melting” of the gB-containing crude membrane pellet.
7. Homogenize each pellet in 10 mL RB using 30 strokes of a
chilled homogenizer. Transfer the suspension to a 50 mL Fal-
con tube on ice.
8. Pour the crude membrane suspension into 20 mL of SB (see
Note 12).
9. Increase the total volume of the crude membrane/detergent
mixture to 50 mL with RB and invert gently to mix. Divide the
mixture evenly between the detergent and membrane tubes.
10. Rotate the tubes gently at 4 C for 2 h, minimizing foaming, to
solubilize the protein from the membrane.
11. Transfer the crude membrane-detergent mixture to ultracen-
trifuge tubes as in step 4 in Subheading 3.2 and centrifuge at
4 C, 145,000 g for 45 min to remove residual membrane.
12. Add 10 mM imidazole to the solubilized protein (supernatant,

see Note 13) and combine it with 1 mL Ni Sepharose 6 Fast
Flow resin.
13. Rock or rotate gently overnight at 4 C.
3.3 IMAC Purification 1. Load the Ni-NTA resin-solubilized protein mixture into an
empty gravity column. This step and the remainder of the
IMAC purification should be completed at 4 C.
2. Allow the unbound protein to drain through the column.
3. Wash the resin with 15 mL WB1 (see Note 14).
4. Wash the resin with 25 mL of WB2 (10 + 10 + 5 mL).
5. Elute the gBd71 into a fresh beaker or tube with 15 mL EB.
6. Measure the A280 of the eluate.
7. Concentrate the protein to 1 mL using a 100-kDa concentra-
tor at 2000 g and 4 C. To minimize precipitation, mix
frequently (5 min) but gently (see Note 15).
8. Pass the concentrated protein through a centrifugal filter or
centrifuge it for 10 min at maximum speed in a 4 C benchtop
centrifuge.
3.4 Size-Exclusion 1. Slowly load the protein into a 1 mL syringe, taking care to expel
Chromatography any bubbles. Plunger adjustments should be minimized to
control aggregation.
2. Run the protein through a Superdex 200 10/300 GL column
that has been equilibrated at 4 C with GF buffer. Collect
0.5 mL fractions starting at the void (~8 mL) and continuing
for 6 mL thereafter. If the gB construct is substantially short-
ened, a later collection window may be needed. A typical
chromatogram and SDS-PAGE result for gBd71 are shown in
Fig. 1a, b.
3. Concentrate the protein from the peak fraction to 3–4 mg/mL
as in step 7 in Subheading 3.3.
3.5 Crystallization 1. Add A8-35 amphipol solution to a final concentration of 0.01%

(w/v) and pipet gently to mix (see Note 16). Incubate the
sample at room temperature for 30 min to allow the amphipol
and detergent molecules to equilibrate around the protein.
2. Use a pipet tip to make a notch in the grease ring around the
edge of each well in a pregreased 24-well plate.
3. Add 750 μL of filtered crystallization solution to each well that
will be used.
4. Briefly spray a siliconized glass cover slip with air, and put it face
up on a clean work surface. Add 1 μL crystallization solution
followed by 1 μL protein to the center of the cover slip; then
Fig. 1 (a) A gel filtration chromatogram of gBd71 in 0.05% n-Dodecyl-β-D-

Maltopyranoside (DDM) reveals a trimer with an apparent molecular weight of
415 kDa. Vo void volume. (b) SDS-PAGE protein stain analysis of the peak
fractions separated from aggregated protein. (c) P321 gBd71 crystals in
0.05% DDM and 0.01% A8-35 amphipol. (d) Representative H32 crystals of
gBd71 in 0.075% n-undecyl-β-D-maltopyranoside (UM) detergent and 0.0075%
A8-35 amphipol. Figure is reproduced from [23]
use tweezers to flip it over and seal the well. Use the back of a
1 mL pipet tip to press the cover slip down evenly without
smudging it. Repeat these steps with additional crystal setups.
5. Store the crystal plate in a vibration-free environment at a
constant temperature (RT for gBd71). gBd71 crystals in
DDM/A8-35 appear as tapered wedges (orzo-shaped in pro-
file) after 3–4 weeks and grow to their final sizes of
100–200 μm over the next week (Fig. 1c). Other detergent/
amphipol combinations yield different gemlike shapes on a
similar time scale (Fig. 1d). Crystals will likely grow within a
heavy layer of precipitate.
3.6 Freezing gB 1. Remove a cover slip containing a drop of interest and invert it
Crystals under the microscope (see Note 17).
2. Add a 1 μL drop of cryoprotection solution (see Note 18) to a
free area of this cover slip, or on a second adjacent coverslip.
3. Use a needle to gently free crystals from the cover slip and/or
surrounding precipitate.
4. Transfer each crystal to the cryoprotection drop and incubate
for 15 s to 1 min.
5. Retrieve the crystals from the cryoprotection drop, plunge
freeze in LN2, and insert into the puck.
4 Notes
1. Spinner flasks should be autoclaved twice. In the first round,

use a liquid cycle without attaching air filters and with ~100
distilled water at the bottom of the flask. In the second time,
use a gravity cycle with attached air filters, no water in the flask,
and cover all caps on the flask as well as the airflow ports and
filters with aluminum foil.
2. The flexible N-terminus of gB has a role in receptor binding,
but it is slowly degraded after purification, causing variability in
the timing of crystallization. Removing residues 30-71 stan-
dardized the onset of crystal formation to 3–4 weeks. Although
residues 72-103 were also unresolved in our structure and
sometimes proteolytically cleaved, they were found to be essen-
tial to the stability of the protein during purification. The
recombinant baculovirus used for gBd71 expression encodes
HSV-1 gB residues 72-904 with a melittin signal sequence
described previously [5, 26].
3. High-purity, low-α isomer, Anagrade detergent must be used
in the later purification stages and GF buffer to ensure that the
detergent micelles have a homogeneous composition that is
amenable to crystallization. If desired, a solubilization grade
detergent with greater α content (e.g., Anatrace D310S) can be
used during the solubilization step and exchanged for Ana-
grade detergent in the IMAC wash step.
4. This protocol describes purification and crystallization using
DDM, but gBd71 can be crystallized in other detergents like n-
undecyl-β-D-maltopyranoside (UM). Detergent choice can
impact crystal morphology and unit cell type, influencing
which regions of the structure are well-resolved. As a starting
point, detergents should be tested at ~10 their CMC for
solubilization and ~3–5 their CMC for subsequent stabiliza-
tion, depending on the ease of accurately weighing the needed
quantities [27]. A rough detergent swap can be performed by
simply substituting the new detergent for DDM in the GF

buffer. However, exchange is most thoroughly accomplished
by incorporating the new detergent at an earlier stage, substi-
tuting it for DDM in an additional IMAC wash step and in all
subsequent buffers. The DDM can be added to purification
buffers up to a few days beforehand, which allows bubbles to
subside in the filtered GF buffer.
5. Stock buffer solutions containing Tris-HCl, NaCl, glycerol and
imidazole can be prepared and pH adjusted after equilibrating
to 4 C. The PMSF and protease inhibitor tablet should be
added directly before use to maximize their activity.
6. Take a 1 mL sample of the insect cell suspension culture using a
sterile pipet. Mix 10 μL of the insect cell suspension culture
sample with 10 μL of trypan blue solution to make a 1:1
dilution of the cell suspension in trypan blue. Load 10 μL of
the cell suspension with the trypan blue onto a hemocytometer.
Cells that appear blue are dead and cells that appear white are
living. Count the living and the dead cells (separately) in one
1 1 mm square of the hemocytometer. The viability can be
determined by dividing the number of living cells by the total
number of cells.
7. It is not necessary to determine the titer of baculovirus stocks
used for protein expression because the amount of baculovirus
necessary to achieve optimal protein expression has to be deter-
mined experimentally. In our experience, using 4–10 mL of P3
stock per 1 L cells at a density 2 106 cells is typically a good
starting point regardless of which glycoprotein is expressed.
Although further optimization is usually not required, volumes
within a 1–20 mL range have been used successfully. During
optimization of protein expression, we find it helpful to moni-
tor cell death during expression. If excessive cell death, viability
of 60% or less, is observed after 3 days, the amount of P3 used
for infection should be decreased. If protein expression is low,
the amount of P3 used for infection should be increased.
8. Use of aeration is necessary for growing insect cells in volumes
of 1 L and above. Insect cells can also be grown in shaker flasks,
but that method is not described here. Air settings of
25–50 mL/min are often used for 1 L cultures and of
50–100 mL/min for 1.6 L cultures, but airflow should be
adjusted to minimize frothing on the surface (no more than a
“single” layer of bubbles).
9. Storage at 80 C did not have an adverse effect on gBd71.
However, purifying from fresh cells should be tried if aggrega-
tion or instability is observed with other constructs.
10. Samples for SDS-PAGE and Western blot analysis should be
collected throughout the purification. Western blot analysis is
particularly helpful for gauging the efficiency of solubilization
and resin binding, stages of purification where many contami-

nant proteins are also present, or for quantifying gB loss during
resin washes. SDS-PAGE analysis is useful for assessing the
purity of the purified protein and may be sufficient once the
purification process becomes routine. To compare protein
quantities at different purification stages, it can be helpful to
adjust samples to an even dilution level. This can be done by
collecting a volume in microliters equal to the prep volume in
milliliters and diluting those sample to the same total volume.
For example, the amount of gB present at the solubilized
protein stage (50 mL) can be compared to the amount of gB
retained in the eluate (15 mL) by collecting a 50 μL sample of
the former and a 15 μL sample of the latter to which 35 μL of
buffer is added. Samples can then be further diluted by a
universal factor to facilitate better observation by SDS-PAGE
protein stain or Western blot.
11. This speed of 145,000 g is equivalent to ~40,000 rpm in a
Type 50.2 Ti rotor.
12. This amount of DDM produces a final detergent concentration
of ~1.2% in the 50 mL solubilization stage, adequate for the
2.5–3.0 g of crude membrane in our standard 1.4 L culture.
For markedly different cell culture volumes (e.g., a doubled
2.8 L culture), optimization of the detergent concentration or
adjustment of the solubilization stage volume is
recommended.
13. Adding 10 mM imidazole minimizes nonspecific binding of
contaminants to the resin. However, it may impair binding of
some target proteins and should be omitted in these cases.
14. The imidazole content and wash volumes of WB1 and WB2
may need to be optimized for other proteins. For untested
His-tagged proteins, we recommend starting with a 10 mM
imidazole concentration for WB1 and 30 mM for WB2.
15. In general, gB should not be concentrated beyond 5 mg/mL
to avoid aggregation. The molecular weight of gBd71 (ungly-
cosylated, with the C-terminal “GSHHHHHH” linker-His6
tag) is 94,376 Da and the extinction coefficient is
94,255 m1 cm1, so a 1 mg/mL solution has an A280 of ~1.
16. The relative amounts of amphipol and detergent, as well as the
timing of amphipol addition, should be optimized. We found
that crystals could be obtained over an amphipol:detergent
range of 1:10 to 1:5. gB in pure A8-35 formed oils rather
than crystals, which may be the result of charge repulsion or
steric hinderance by the bulky, anionic amphipol [28].
17. Crystal drops will begin to dry out once exposed to air. 1 μL of
well solution may be added to the drop to delay crystal degra-
dation, but the best diffracting crystals tend to be the initial
ones pulled from the drop, before supplementation. Although
a well can be resealed by replacing the cover slip, we have found

that crystal quality is greatly reduced in these drops.
18. The composition of the cryo solution for gB should match the
composition of the hanging drop in which the crystals grew—
the “mother liquor”—as closely as possible, in addition to
having the cryoprotectant. In a typical vapor-diffusion hang-
ing-drop crystallization setup, a 2 μL hanging drop equilibrates
to 1 μL, and the resulting mother liquor solution contains the
sum of solute concentrations in the reservoir and protein solu-
tions. However, owing to the presence of glycerol and deter-
gent, 2 μL gBd71 hanging drops instead tend to expand in
volume to ~4 μL, as measured by pipetting. An artificial mother
liquor solution containing 20% glycerol as a cryoprotectant is
obtained by adding 50 μL of 50% glycerol to 75 μL of reservoir
solution.
Acknowledgments
We thank past and present members of the Heldwein lab for helpful
advice and discussions. We also acknowledge the contributions of
Samuel D. Stampfer, who coauthored the Chapter “Expression,
Purification, and Crystallization of HSV-1 Glycoproteins for Struc-
ture Determination” in the previous edition.
References
1. Heldwein EE, Krummenacher C (2008) Entry structure of glycoprotein B from herpes sim-
of herpesviruses into mammalian cells. Cell plex virus 1. Science 313(5784):217–220
Mol Life Sci 65(11):1653–1668. https://doi. 6. Atanasiu D, Whitbeck JC, Cairns TM, Reilly B,
org/10.1007/s00018-008-7570-z Cohen GH, Eisenberg RJ (2007) Bimolecular
2. Eisenberg RJ, Atanasiu D, Cairns TM, Galla- complementation reveals that glycoproteins gB
gher JR, Krummenacher C, Cohen GH (2012) and gH/gL of herpes simplex virus interact
Herpes virus fusion and entry: a story with with each other during cell fusion. Proc Natl
many characters. Viruses 4(5):800–832. Acad Sci U S A 104(47):18718–18723.
https://doi.org/10.3390/v4050800 https://doi.org/10.1073/pnas.0707452104.
3. Krummenacher C, Supekar VM, Whitbeck JC, [0707452104 pii]
Lazear E, Connolly SA, Eisenberg RJ, Cohen 7. Atanasiu D, Whitbeck JC, de Leon MP, Lou H,
GH, Wiley DC, Carfi A (2005) Structure of Hannah BP, Cohen GH, Eisenberg RJ (2010)
unliganded HSV gD reveals a mechanism for Bimolecular complementation defines func-
receptor-mediated activation of virus entry. tional regions of Herpes simplex virus gB that
EMBO J 24(23):4144–4153. https://doi. are involved with gH/gL as a necessary step
org/10.1038/sj.emboj.7600875 leading to cell fusion. J Virol 84
4. Atanasiu D, Saw WT, Cohen GH, Eisenberg (8):3825–3834. https://doi.org/10.1128/
RJ (2010) Cascade of events governing cell-cell JVI.02687-09, JVI.02687-09 [pii]
fusion induced by herpes simplex virus glyco- 8. Harrison SC (2015) Viral membrane fusion.
proteins gD, gH/gL, and gB. J Virol 84 Virology 479-480C:498–507. https://doi.
(23):12292–12299. https://doi.org/10. org/10.1016/j.virol.2015.03.043
1128/JVI.01700-10 9. Stampfer SD, Heldwein EE (2013) Stuck in
5. Heldwein EE, Lou H, Bender FC, Cohen GH, the middle: structural insights into the role of
Eisenberg RJ, Harrison SC (2006) Crystal the gH/gL heterodimer in herpesvirus entry.
Curr Opin Virol 3:13. https://doi.org/10. 19. Rogalin HB, Heldwein EE (2015) The inter-
1016/j.coviro.2012.10.005 play between the HSV-1 gB cytodomains and
10. Burke HG, Heldwein EE (2015) Crystal struc- the gH cytotail during cell-cell fusion. J Virol
ture of the human cytomegalovirus glycopro- 89:12262. https://doi.org/10.1128/JVI.
tein B. PLoS Pathog 11(10):e1005227. 02391-15
https://doi.org/10.1371/journal.ppat. 20. Chowdary TK, Heldwein EE (2010) Syncytial
1005227 phenotype of C-terminally truncated herpes
11. Chandramouli S, Ciferri C, Nikitin PA, Calo S, simplex virus type 1 gB is associated with
Gerrein R, Balabanis K, Monroe J, Hebner C, diminished membrane interactions. J Virol 84
Lilja AE, Settembre EC, Carfi A (2015) Struc- (10):4923–4935. https://doi.org/10.1128/
ture of HCMV glycoprotein B in the postfu- JVI.00206-10
sion conformation bound to a neutralizing 21. Silverman JL, Greene NG, King DS, Heldwein
human antibody. Nat Commun 6:8176. EE (2012) Membrane requirement for folding
https://doi.org/10.1038/ncomms9176 of the herpes simplex virus 1 gB cytodomain
12. Carfi A, Willis SH, Whitbeck JC, suggests a unique mechanism of fusion regula-
Krummenacher C, Cohen GH, Eisenberg RJ, tion. J Virol 86(15):8171–8184. https://doi.
Wiley DC (2001) Herpes simplex virus glyco- org/10.1128/JVI.00932-12
protein D bound to the human receptor HveA. 22. Chen J, Zhang X, Jardetzky TS, Longnecker R
Mol Cell 8(1):169–179 (2014) The Epstein-Barr virus (EBV) glyco-
13. Di Giovine P, Settembre EC, Bhargava AK, protein B cytoplasmic C-terminal tail domain
Luftig MA, Lou H, Cohen GH, Eisenberg regulates the energy requirement for
RJ, Krummenacher C, Carfi A (2011) Struc- EBV-induced membrane fusion. J Virol 88
ture of herpes simplex virus glycoprotein D (20):11686–11695. https://doi.org/10.
bound to the human receptor nectin-1. PLoS 1128/JVI.01349-14
Pathog 7(9):e1002277. https://doi.org/10. 23. Cooper RS, Georgieva ER, Borbat PP, Freed
1371/journal.ppat.1002277 JH, Heldwein EE (2018) Structural basis for
14. Zhang N, Yan J, Lu G, Guo Z, Fan Z, Wang J, membrane anchoring and fusion regulation of
Shi Y, Qi J, Gao GF (2011) Binding of herpes the herpes simplex virus fusogen gB. Nat Struct
simplex virus glycoprotein D to nectin-1 Mol Biol 25(5):416–424. https://doi.org/10.
exploits host cell adhesion. Nat Commun 1038/s41594-018-0060-6
2:577. https://doi.org/10.1038/ 24. Kost TA, Condreay JP, Jarvis DL (2005) Bacu-
ncomms1571 lovirus as versatile vectors for protein expres-
15. Lu G, Zhang N, Qi J, Li Y, Chen Z, Zheng C, sion in insect and mammalian cells. Nat
Gao GF, Yan J (2014) Crystal structure of Biotechnol 23(5):567–575. https://doi.org/
herpes simplex virus 2 gD bound to nectin-1 10.1038/nbt1095
reveals a conserved mode of receptor recogni- 25. Invitrogen (2010) Bac-to-Bac® Baculovirus
tion. J Virol 88(23):13678–13688. https:// Expression System. Version F. Invitrogen,
doi.org/10.1128/JVI.01906-14 Carlsbad, CA
16. Stampfer SD, Lou H, Cohen GH, Eisenberg 26. Bender FC, Whitbeck JC, Ponce de Leon M,
RJ, Heldwein EE (2010) Structural basis of Lou H, Eisenberg RJ, Cohen GH (2003) Spe-
local, pH-dependent conformational changes cific association of glycoprotein B with lipid
in glycoprotein B from herpes simplex virus rafts during herpes simplex virus entry. J Virol
type 1. J Virol 84(24):12924–12933. https:// 77(17):9542–9552
doi.org/10.1128/JVI.01750-10 27. Newby ZE, O’Connell JD III, Gruswitz F,
17. Chowdary TK, Cairns TM, Atanasiu D, Cohen Hays FA, Harries WE, Harwood IM, Ho JD,
GH, Eisenberg RJ, Heldwein EE (2010) Crys- Lee JK, Savage DF, Miercke LJ, Stroud RM
tal structure of the conserved herpesvirus (2009) A general protocol for the crystalliza-
fusion regulator complex gH-gL. Nat Struct tion of membrane proteins for X-ray structural
Mol Biol 17(7):882–888. https://doi.org/ investigation. Nat Protoc 4(5):619–637.
10.1038/nsmb.1837. nsmb.1837 [pii] https://doi.org/10.1038/nprot.2009.27
18. Jones NA, Geraghty RJ (2004) Fusion activity 28. Zoonens M, Popot JL (2014) Amphipols for
of lipid-anchored envelope glycoproteins of each season. J Membr Biol 247
herpes simplex virus type 1. Virology 324 (9-10):759–796. https://doi.org/10.1007/
(1):213–228 s00232-014-9666-8
Chapter 25
The Use of Microfluidic Neuronal Devices to Study

the Anterograde Axonal Transport of Herpes Simplex Virus-1
Kevin Danastas, Anthony L. Cunningham, and Monica Miranda-Saksena
Abstract
Understanding how herpes simplex virus-1 (HSV-1) interacts with different parts of the neuron is funda-
mental in understanding the mechanisms behind HSV-1 transport during primary and recurrent infections.
In this chapter, we describe a unique neuronal culture system that is capable of compartmentalizing
neuronal cell bodies from their axons to study the transport of HSV-1 along axons. The ability to separate
neuronal cell bodies and axons provides a unique model to investigate the mechanisms used by HSV-1 for
viral transport, assembly, and exit from different parts of the neuron.
Key words Microfluidics, Neurons, Herpes simplex virus, Axons, Transport
1 Introduction
One of the major features of herpes simplex virus (HSV) 1 and 2 is

the ability of the virus to infect neuronal cells and undergo retro-
grade transport along axons to establish a life-long latent infection
in the cell body of sensory neurons. Upon cellular stresses, the
latent virus can then be reactivated and following replication,
undergo anterograde transport back along the axons to reinfect
epithelial cells causing recurrent infections. Given the length of
neuronal axons, the virus must interact with host cytoskeletal
structures and host cellular proteins to be actively transported
along these axons during both primary and recurrent infections
[1, 2]. Therefore, understanding the mechanisms behind viral
transport and the interactions between viral and host proteins are
imperative for developing new antiviral strategies targeting these
processes.
This chapter will focus on the use of microfluidic neuronal
devices (Xona Microfluidics, USA) composed of a silicon polymer
(polydimethylsiloxane) for studies on HSV-1 infection of sensory
neurons in a compartmentalized culture system. Microfluidics
involves the use of small volumes of liquid (in the micrometre
409
410 Kevin Danastas et al.
Fig. 1 Schematic diagram showing the layout of the neuronal devices. The
neuronal device is divided into two compartments (shown in orange and green),
each made up of two circular wells connected by a main channel. These two
compartments are connected by microgrooves, which allow the growth of axons
from the cell body side (orange) to the axonal side (green). If set up correctly, the
cell body side is fluidically isolated from the axonal side
range) in a multicompartment system, which allows the separation

of neuronal cell bodies from axons [3, 4]. In the system described
here, two compartments are separated by microgrooves, which
allow the growth of axonal processes across the compartments
(Fig. 1). The major advantage of this system is that if set up
correctly, the two compartments are fluidically isolated which
allows separate physical and chemical treatment of each neuronal
compartment [5]. This provides a unique approach in isolating
axons from the originating cell body to study both the anterograde
and retrograde transport of HSV-1 [6–9].
These neuronal devices are also suitable for microscopy as they
are optically transparent. The neuronal devices are placed on a cover
glass, allowing for immunofluorescence staining and imaging of the
neuronal cell bodies and axons in each compartment. The neuronal
devices can be set up in different ways best suited for the experi-
ments being conducted. One method, which is described in this
chapter, involves exposing the neuronal device and a cover glass to
oxygen plasma, to render the neuronal device sterile and to form an
irreversible bond [10]. This forms a tight seal to prevent leakage
and makes the neuronal device hydrophilic, which aids in the
addition of liquids. However, the neuronal devices cannot be sepa-
rated from the cover glass and therefore immunofluorescence stain-
ing has to be performed with the neuronal device intact.
Alternatively, the neuronal device can be reversibly bonded to the
cover glass (i.e., through magnetic bonding) [10]. While reversible
bonding allows the neuronal device to be detached if necessary for
downstream applications, the neuronal devices remain hydrophobic
making the addition of liquids difficult. Furthermore, the bond
Preparation of Neuronal Devices to Study HSV-1 Transport 411
between the neuronal device and the cover glass could be easily
detached if jolted and leaking may occur.
In this chapter, we describe the procedure used to set up the
neuronal devices for the growth of sensory neurons (isolated from
rat dorsal root ganglia) for studies on the mechanisms of HSV-1
infection, axonal transport, and exit from neurons [11, 12]. This
technique allows the analysis of HSV-1 transport along axons and
how viral transport can be modulated by the addition of inhibitors
or other compounds targeted against different viral and/or host
cellular processes. In addition to neurons, nonneuronal cells (e.g.,
Vero cells) can be added to the axonal chamber 24 h prior to
infection to study the transport of the virus from axons to adjacent
cells. For our studies, plasma bonding is performed to ensure there
is no leakage of liquids between the two compartments. Once
bonded, the neuronal devices are coated with poly(D)lysine (PDL)
and laminin to aid in cell attachment. Primary dissociated neurons
are added to the cell body compartment and incubated at 37 C and
5% CO2 until sufficient axon growth is observed in the axonal
compartment, usually after 3–4 days in our system.
2 Materials
2.1 Materials to Set 1. Class II biological safety cabinet.

Up Neuronal Devices 2. Plasma cleaning system (Pelco EasyGlow™ Glow discharge
Cleaning System, Ted Pella, Inc., USA).
3. Sterile 60 and 100 mm plastic petri dishes.
4. Sterile forceps #1 or 4.
5. No. 1 24 mm 40 mm cover glass.
6. Neuronal devices. For our studies, 450 μm neuronal devices
(Xona Microfluidics, USA) were used.
7. Borate buffer: 52 mM boric acid, 12.4 mM sodium tetraborate
in dH2O. pH adjusted to 8.5. Store at 4 C.
8. 0.5 mg/mL Poly(D)Lysine (PDL): Make fresh each time by
dissolving 5 mg of lyophilized PDL in 10 mL of borate buffer.
9. 10 μg/mL laminin: Make fresh each time by diluting in sterile
dH2O.
10. Incubator set at 37 C and 5% CO2.
11. Ultrasonic cleaner.
2.2 Cells, Viruses 1. Class II biological safety cabinet.

and Cell Culture 2. Primary culture of neurons (e.g., dissociated neurons derived
Materials from Wistar rat neonatal dorsal root ganglia).
3. Herpes simplex virus (any strain, wild-type or deletion mutant

virus can be used).
4. Complete Neurobasal medium (variable depending on the type
of neurons being used). Neurobasal medium (Life Technolo-
gies, Australia) supplemented with 1 B-27 supplement,
200 mM L-glutamine, 5 ng/mL brain-derived neurotrophic
factor, and 100 ng/mL of 7S nerve growth factor.
5. Nonneuronal cell line (e.g., Vero cells; if required).
2.3 Fixatives 1. Sterile Dulbecco’s phosphate buffered saline (PBS).

and Buffers 2. 3% paraformaldehyde (PFA) solution: made up in sterile PBS
from a 16% stock solution.
3. 0.1% Triton X solution: made up in sterile PBS.
4. Blocking buffer: 5% BSA, 5% goat serum, 0.2% cold water fish
skin (CWSF) gelatin, 5% sodium azide in PBS. Store at 20 C.
5. Antibody dilution buffer: 2% acetylated BSA (BSAc), 5%
sodium azide in PBS. Store at 20 C.
6. Fluoromount-G™ mounting liquid.
3 Methods
3.1 Setup 1. Place the neuronal device and a cover glass into the plasma
of Microfluidic cleaner and expose to plasma for 45 s under 0.39 m Bar (see
Neuronal Devices Note 1). Using sterile forceps, bond the neuronal device to the
cover glass by placing the surface of the neuronal device
exposed to the plasma face-down on the exposed surface of
the coverslip, pushing down gently with the forceps to form a
tight bond. After plasma bonding, the neuronal device is sterile
and will remain hydrophilic for 10 min (see Note 2).
2. Place and transport the bonded neuronal devices inside a sterile
60 mm plastic petri dish to a biological safety cabinet, add
200 μL of 0.5 mg/mL PDL to the top left (cell body side)
and top right (axonal side) wells, and allow the liquid to flow
through the channels into the bottom wells (see Fig. 1). Top up
the wells by adding a further 200 μL of 0.5 mg/mL PDL to the
top left and right wells (see Note 3).
3. Place the 60 mm plastic petri dish inside a 100 mm petri dish to
limit evaporation, and incubate the neuronal devices for
24–48 h at 37 C and 5% CO2.
4. Remove excess PDL from all the wells, add 200 μL of sterile
dH2O to the top left, and right wells and allow the liquid to
flow through the channels into the bottom wells.
5. Add a further 200 μL of sterile dH2O to the top left and right
wells, and allow the liquid to flow through the channels into
the bottom wells.
6. Remove all the dH2O from the bottom left and right wells, and
add a further 200 μL of sterile dH2O to the top left and right
wells.
7. Repeat steps 5 and 6 two more times to ensure all traces of
borate buffer are removed from the channels (see Note 4).
8. Remove excess dH2O, add 200 μL of 10 μg/mL laminin to the
top left and right wells, and allow the liquid to flow through the
channels into the bottom wells. Top up the wells by adding a
further 200 μL to the top left and right wells and incubate
overnight, or for a minimum of 3 h at 37 C and 5% CO2.
3.2 Growth 1. Remove excess laminin from the wells, add 200 μL of complete
of Neuronal Cells Neurobasal medium to the top left and right wells, and allow
in Neuronal Devices the liquid to flow through the channels into the bottom wells.
Top up the wells by adding a further 200 μL of complete
Neurobasal medium to the top wells (see Note 5). Incubate at
37 C and 5% CO2 until ready to load the neuronal cells.
2. Remove all medium from the wells in the cell body compart-
ment, ensuring to remove as much medium as possible to
facilitate the addition of cells.
3. The required density of dissociated neuronal cells should be
resuspended in a maximum volume of 5 μL per compartment
and slowly pipetted directly into the channel while keeping the
neuronal device at an approximate 45 angle (see Note 6).
Maintain the neuronal device at this angle for 20 min to ensure
the neuronal cells settle as close to the microgrooves as possible
(Fig. 2a).
4. Gently add 200 μL of complete Neurobasal medium to the top
well in the cell body compartment, and allow the liquid to flow
through.
5. Top up by adding a further 200 μL of complete Neurobasal
medium to the top well.
6. Remove medium from the axonal compartment, add 200 μL of
fresh complete Neurobasal medium to top well, and allow the
liquid to flow through.
7. Top up by adding a further 200 μL of complete Neurobasal
medium to the top well.
8. Incubate the neuronal devices at 37 C and 5% CO2 for
3–4 days to allow sufficient axonal growth into the micro-
grooves and into the axonal compartment prior to HSV-1
infection (Fig. 2b).
Fig. 2 Images of neuronal devices of the cell body compartment at the time of
cell seeding showing the neurons settling close to the microgrooves (a) and the
axonal compartment after 3 days incubation showing the growth of branching
axons (b). Scale bar ¼ 100 μm
3.3 Addition of Vero 1. Remove all medium from the wells in the axonal compartment,
Cells to Axonal ensuring to remove as much medium as possible to facilitate
Compartment the addition of cells (see Note 7).
(Optional) 2. Resuspend 50,000 Vero cells in a maximum volume of 5 μL per
compartment, and slowly pipette directly into the channel as in
Subheading 3.2.
3. Gently add 200 μL of complete Neurobasal medium to each
well in the axonal compartment as in Subheading 3.2.
4. Incubate at 37 C and 5% CO2 for 24 h prior to HSV-1
infection.
3.4 Infection 1. Remove medium from the cell body compartment, add 175 μL
of Neuronal Cells of fresh complete Neurobasal medium containing the desired
strain and MOI of virus, and allow the liquid to flow through
the channels into the bottom wells. Top up the wells by adding
a further 175 μL of fresh complete Neurobasal medium. In our
studies, HSV-1 was added at a MOI of 10 (see Note 8).
2. At 2 h post infection (hpi), remove the inoculum from the wells
of the cell body compartment, and wash the neurons by adding
200 μL of complete Neurobasal medium to the top wells.
3. Allow the liquid to flow through the channel into the bottom
well, and top up the wells by adding a further 200 μL of
complete Neurobasal medium to the top well.
4. Remove all the medium from the bottom well of the cell body
compartment, and add a further 200 μL of complete Neuro-
basal medium, allowing the liquid to flow through into the
bottom well.
5. Repeat steps 3 and 4 once more to ensure all free virus is
removed from the cell body compartment.
6. Incubate at 37 C plus 5% CO2.
3.5 Fixation 1. In our studies, the neurons were fixed between 28 and 30 hpi.
of Neurons For fixation, remove medium from all wells, and add 200 μL of
sterile PBS to the top left and right wells.
2. Allow the liquid to flow through the channels into the bottom
wells. Add a further 200 μL of sterile PBS to the top wells.
3. Remove all the PBS from the bottom left and right wells, and
add a further 200 μL of sterile PBS to the top left and right
wells.
4. Repeat steps 2 and 3 once more to ensure all traces of medium
are removed from the channels.
5. Remove all PBS from the wells, add 200 μL of 3% PFA to the
top left and right wells, and allow the liquid to flow through the
channels into the bottom wells. Add a further 200 μL of 3%
PFA to the top wells.
6. Incubate the neuronal devices for 30 min at room temperature
to allow for sufficient fixation of the cells and virus particles.
7. Remove excess PFA from the wells, add 200 μL of sterile 0.1%
Triton X to the top left and right wells, and allow the liquid to
flow through the channels into the bottom wells.
8. Incubate the neuronal devices for 4 min at room temperature
to allow for sufficient permeabilization of the neurons.
9. Remove excess 0.1% Triton X from all the wells, add 200 μL of
sterile PBS to the top left and right wells, and allow the liquid
to flow through the channels to the bottom wells.
10. Add a further 200 μL of sterile PBS to the top left and right
wells, and allow the liquid to flow through the channels into
the bottom wells.
add a further 200 μL of sterile PBS to the top left and right
wells.
12. Repeat steps 10 and 11 two more times to ensure all traces of
0.1% Triton X are removed from the channels (see Note 9).
13. The neuronal devices can then be stored in PBS at 4 C until
ready for staining.
3.6 Staining of Cells 1. Remove all PBS from the wells, add 200 μL of blocking buffer
in Neuronal Device to the top left and right wells, and allow the liquid to flow
through the channels into the bottom wells. Top up the wells
by adding a further 200 μL of blocking buffer to the top wells.
2. Incubate at room temperature for 30 min.
3. Remove all blocking buffer from the wells, add 150 μL of
primary antibody made up in antibody dilution buffer, and
allow the liquid to flow through the channels into the bottom
wells.
4. Incubate at 4 C overnight.
5. Remove all primary antibody from the wells, and add 200 μL of
PBS to the top left and right wells.
wells. Add a further 200 μL of PBS to the top wells.
add a further 200 μL of PBS to the top left and right wells.
8. Repeat steps 6 and 7 four more times to wash all unbound
antibody from the main channel.
9. Remove all PBS from the wells, add 150 μL of secondary
antibody made up in antibody dilution buffer, and allow the
liquid to flow through the channels into the bottom wells.
10. Incubate at room temperature for 90 min.
11. Remove all secondary antibody from the wells, and add 200 μL
of PBS to the top left and right wells.
wells. Adding a further 200 μL of PBS to the top wells.
add a further 200 μL of PBS to the top left and right wells.
14. Repeat steps 12 and 13 four more times to wash all unbound
antibody from the main channel.
15. Remove all PBS from the wells and slowly add 100 μL of
Fluoromount-G to each top well, allowing the mounting
medium to flow into the channels.
16. Add a further 100 μL of Fluoromount G to each bottom well.
17. Store the neuronal devices at 4 C until ready for imaging.
4 Notes
1. Cover glasses need to be cleaned using an ultrasonic cleaner for

15 min at room temperature to ensure they are free of dust and
debris. The feature side of the neuronal device (the side con-
taining the channels and microgrooves) must also be free of
debris to ensure a proper seal is formed.
2. Ensure the feature side is face-up when placed into the plasma
cleaner, as this is the side that is exposed to the plasma and will
be bonded to the cover glass. It is important to note that this
bonding is permanent and cannot be reversed.
3. It is important to avoid introducing bubbles into the channels
at any stage during the process as they are difficult to remove
and will compromise the neuronal device.
4. Borate buffer can be absorbed into the neuronal device’s poly-
mer and can become toxic to cultured cells. Therefore, all traces
of borate buffer must be removed to ensure the cells are not
affected.
5. The addition of complete Neurobasal medium allows the neu-
ronal device to equilibrate to the culture conditions of the
neuronal cells.
6. Cell density will need to be optimised depending on the type of
cell used and its source. In our study, approximately
40,000–50,000 dissociated neurons derived from rat dorsal
root ganglia were added to each cell body compartment.
Ensure the cells are pipetted directly into the channel, not
into the well. Keeping the neuronal devices at an angle helps
the neurons settle as close as possible to the microgrooves for
the axons to grow through into the axonal compartment.
7. The addition of Vero cells to the axonal compartment should
be done 24 h prior to infection.
8. Once the virus has been added, it is important to ensure that
the liquid in the cell body and axonal compartments are main-
tained at the same volumes. This will ensure that the two
compartments remain fluidically isolated and that there is no
leakage of the virus from the cell body compartment to the
axonal compartment.
9. Prolonged exposure to 0.1% Triton X will damage the cells and
can be detrimental to staining.
Acknowledgments

Medical Research Grants (APP1069193 and APP1130512).
References
1. Miranda-Saksena M, Denes CE, Diefenbach RJ neuron cell bodies into initial axon segments.
et al (2018) Infection and transport of herpes J Virol 8:403–441
simplex virus type 1 in neurons: role of the 8. Howard PW, Wright CC, Howard T et al
cytoskeleton. Viruses 10:e92 (2014) Herpes simplex virus gE/gI extracellu-
2. Denes CE, Miranda Saksena M, Cunningham lar domains promote axonal transport and
AL et al (2018) Cytoskeletons in the closet: spread from neurons to epithelial cells. J Virol
subversion in alphaherpesvirus infections. 88:11178–11186
Viruses 10:e79 9. Dohner K, Ramos-Nascimento A, Bialy D et al
3. Taylor AM, Rhee SW, Tu CH et al (2003) (2018) Importin alpha1 is required for nuclear
Microfluidic multicompartment device for import of herpes simplex virus proteins and
neuroscience research. Langmuir capsid assembly in fibroblasts and neurons.
19:1551–1556 PLoS Pathog 14:e1006823
4. Whitesides GM (2006) The origins and the 10. Neto E, Leitao L, Sousa DM et al (2016)
future of microfluidics. Nature 442:368–373 Compartmentalized microfluidic platforms:
5. Taylor AM, Rhee SW, Jeon NL (2006) Micro- the unrivaled breakthrough of in vitro tools
fluidic chambers for cell migration and neuro- for neurobiological research. J Neurosci
science research. In: Microfluidic techniques: 36:11573–11584
reviews and protocols. Humana Press, Totawa, 11. Miranda-Saksena M, Boadle RA, Diefenbach
NJ RJ et al (2016) Dual role of herpes simplex
6. Liu WW, Goodhouse J, Jeon NL et al (2008) A virus 1 pUS9 in virus anterograde axonal trans-
microfluidic chamber for analysis of neuron-to- port and final assembly in growth cones in
cell spread and axonal transport of an alpha- distal axons. J Virol 90:2653–2663
herpesvirus. PLoS One 3:e2382 12. Diefenbach RJ, Davis A, Miranda-Saksena M
7. Howard PW, Howard TL, Johnson DC (2013) et al (2016) The basic domain of herpes sim-
Herpes simplex virus membrane proteins plex virus 1 pUS9 recruits kinesin-1 to facilitate
gE/gI and US9 act cooperatively to promote egress from neurons. J Virol 90:2102–2111
transport of capsids and glycoproteins from
Chapter 26
A Model of In Vivo HSV-1 DNA Transport Using Murine

Retinal Ganglion Cells
Jennifer H. LaVail
Abstract
Mammalian nervous tissues are heterogeneous. The retina, brain, spinal cord, and peripheral sensory and
autonomic ganglia are each composed of neuronal and glial cell partners embedded in a connective tissue
bed and supplied by vascular and immune cells. This complicated structure presents many challenges to
neuroscientists and cell biologists (e.g., how to carry out a quantitative study of neurons surrounded by the
hormonal and immune stimuli of supporting cells). A reductionist view has led investigators to study tissue
slices and cultures of isolated neurons in vitro, subtracting the immune and vascular components to simplify
the problem. Recently, investigators have extended the approach and produced organoids which are derived
from embryonic neurons from induced pluripotent stem cells (Muffat et al., Proc Natl Acad Sci U S A
115:7117–7122, 2018).
Using this approach advances have been made in the study of viral infections of the nervous system. For
example, by using a genetically modified carrier virus, they can compare the effect of different viral envelope
proteins on viral tropism and viral response pathways. However, the timed delivery of hormonal stimuli and
interactions with immune cells remain problematic.
We present an alternative method for studying these issues using the axonal transport of Herpes simplex
virus in mature retinal neurons in vivo. Using genetically identical mice and carefully controlling the
delivery of virus, an investigator can obtain insight into the transport of virus to and from the neuron cell
body within the cellular environment of an intact, mature animal. This allows confirmation and extension of
results seen in vitro.
Key words HSV-1, Axonal transport, Retinal ganglion cell, DNA, In vivo assay
1 Introduction
One of the defining features of Herpes simplex virus (HSV) infec-

tions is the intracellular and bidirectional spread of virus in neurons.
In the case of human ocular infections, HSV particles spread
between epithelial cells of the ocular mucous membrane to the
trigeminal nerve endings and then they are transported retrograde
within the neuron axon back to cell bodies of the trigeminal gan-
glion (Fig. 1). After replication newly synthesized viral components
travel anterograde within the same axon to the peripheral sensory
419
420 Jennifer H. LaVail
Fig. 1 Bidirectional spread of HSV in the course of infection of a sensory neuron. HSV replicates in skin or
mucosal epithelial cells. Virus is released by these cells and binds to and enters sensory nerve endings. The
viral envelope is lost in the endings and viral capsids and particular tegument proteins are transported in a
retrograde direction within the peripheral nerve. The DNA is delivered to the sensory neuron’s nucleus. After
new viral DNA and enveloping proteins are synthesized, the HSV is retransported in an anterograde direction
within the peripheral nerve to the sensory nerve endings in the mucous membranes. It may also be
transported centrally to the CNS where it can be released for transneuronal spread [1]
endings and then to mucous membrane epithelial cells (Fig. 1). In

addition, they may travel within the central axonal branch of the
trigeminal ganglion neuron to enter the CNS with more severe
consequences.
Although HSV infections of the trigeminal ganglia are clinically
important, the study of viral transport in this system is complicated
by the bidirectional and in some case simultaneous transport
(to and from the ganglion cell body) after a single infection. To
simplify the study of HSV transport, we have chosen to employ the
retinal ganglion cell as a model for the anterograde transport phase
of viral reinfection.
Historically the retinal ganglion cell has been a model of choice
for study of anterograde axonal transport [2]. Weiss demonstrated
protein transport in optic nerves in 1965 [3]. Grafstein demon-
strated two waves of protein delivery in fish [4] and then later in the
mouse retinal ganglion cells [5]. This cell type continues to remain
a popular cell model for study [6]; for example, currently 617 papers
are listed in the National Library of Medicine database.
Within retinal ganglion cells models, mouse cells have been
favorable models for several reasons. Isogenic mouse strains provide
immunologically and genetically comparable mice; variations in
candidate genetic strains can be used to identify genes that resemble
human diseases [7]. The murine retinal ganglion cell bodies are
concentrated within the limits of the orbit (Fig. 2). Thus, the
deposition of virus in the intravitreal portion of the eye limits its
spread to the optic nerve head. There are approximately 45,000
murine retinal ganglion cells and they represent about 41 4% of
the density of total neurons in the retina [8]. A much smaller subset
of retinal neurons, displaced amacrine cells, also provide axons to
Transport and Isolation of HSV-1 DNA in Retinal Ganglion Cell Axons In Vivo 421
Fig. 2 Retinal ganglion cells can be infected without direct damage to the
neurons. GCL, retinal ganglion cell layer; L, lens; R, retina; V, vitreous
chamber; ∗, tip of injection needle
the optic nerve. The remaining retinal cells include photoreceptor

cells, bipolar cells, horizontal cells, Müller glial cells, and vascular
cells; none of these contributes cellular processes to the optic
pathway [9].
After intraocular injection, new virus is made essentially syn-
chronously by retinal ganglion cells and then transported from cell
body toward terminals via their axons. The axons of retinal gan-
glion cells bundle to form the optic nerve (ON) and ultimately the
optic tract (OT) (Fig. 3). The axons supply terminals and synaptic
ending on neurons of the lateral geniculate nucleus (LGN) and
superior colliculus.
The murine optic nerve model also has some limitations. The
retinal axons are enwrapped in glial cells and supplied by vascular
cells in the nerve. Thus, any leakage of virus from the nerves to glial
cells, although slower than transport, can complicate a quantitative
analysis of viral transport within the nerves. Any leakage of virus
from the vasculature can also be a problem. We have adopted a
pharmacological approach to limit these complications. We deliver
the antiviral drug Valacyclovir in the drinking water 24 h after initial
infection. This reduces both the vascular and intercellular spread
and reduces secondary replication in periaxonal glial cells [10].
In a previous publication, we compared the strengths and
weaknesses of many of the experimental approaches used to study
the anterograde axonal transport of herpesviruses [11]. Other
review articles have concentrated on the steps necessary to isolate
and maintain neurons in an in vitro chamber and to study viral
transport in them [10]. In this chapter, I have concentrated on the
steps to use mouse retinal ganglion cells for in vivo study of antero-
grade transport. I describe in detail the steps to be followed to
study the axonal transport of HSV DNA in murine retinal ganglion
cell bodies from their cell bodies in the orbit to the distal portion of
axons in the OT. The OT is a 6 mm section of tissue that begins
central to the optic chiasm (OC) and extends to the entry point at
the dorsal thalamus (Fig. 3).
Fig. 3 The anterograde transport of virus can be assayed from retinal ganglion
cell bodies, in the optic nerve (ON), in the optic chiasm (OC), and in the optic tract
(OT) to the site of termination in the lateral geniculate nucleus of the thalamus
This procedure has been used in a number of applications

[7, 11]. It can be used to assay the anterograde axonal transport
of viral DNA, viral proteins, viral RNA in both wt and genetically
distinct mouse strains [12–14]. Modifications have also been used
to compare the efficiency of transport of different viral strains in
mice of identical genetic backgrounds [14] and the ratio of ipsilat-
eral to contralateral projecting axons in the optic path [7]. The
basic advantage of the technique is that one can study the delivery
of each component in intact whole neurons in situ.
The chapter is divided into four parts: (1) the assembly of the
injection apparatus; (2) the loading of the pump and tubing; (3) the
dissection of the optic pathway, and (4) a summary of the steps to
isolate and quantify the concentration of viral DNA in the OT.
2 Materials
2.1 Delivery of Viral 1. Male BALB/c mice, 5-to-6-weeks-old (see Note 1).
Solution 2. Anesthetic: Avertin [15].
to the Posterior
3. Analgesic: proparacaine–atropine (1:1) eye drops.
Chamber of the Eye
4. Sterile cotton swabs.
5. The F (wt) strain of HSV-1, diluted in minimal essential
medium to a concentration of approximately 107 plaque form-
ing units (see Note 2).
6. Hamilton repeater pump (P8-600) (Fig. 4a) and Hamilton
microliter syringe, 25 μL volume (Hamilton #705) (Fig. 4b).
7. 27.5 gauge needles, intact (Fig. 4c).
8. PE tubing (Intramedic) Clay Adams (I.D. 038 mm; O.D,
1.09 mm) (Fig. 4d).
Fig. 4 Components of the assembled injection apparatus. Hamilton repeater

pump (a); Hamilton 25 μL syringe (b); PE tubing attached to syringe via the
plastic collar (c); the PE tubing (d); the 27.5 gauge needle broken from collar and
the blunt end inserted into the distal end of tubing (e)
9. 27.5 gauge needles separated from plastic collar (Fig. 4e) (see
Note 3).
10. 1 mL tuberculin syringe.
11. Hemostat.
12. Valacyclovir Hydrochloride (Valtrex, Glaxo Wellcome, Inc.,
Greenville, NC): Crushed Valtrex tablets are diluted in water
to final concentration of 1 mg/mL.
2.2 Anesthesia, 1. Avertin [15].

Intracardiac Perfusion, 2. Saline solution: (0.9% NaCl).
Sample Preparation,
3. 30 mL syringe.
and Analysis
4. 20 gauge needle.
5. 96 well plates.
6. Autoclaved surgical instruments (#5 Dumont forceps and sur-
gical scissors).
7. Applied Biosystems 7500 Real-Time PCR system.
8. PicoPure DNA extraction kit with 1 mg/mL proteinase K
(supplied in kit).
9. Quant PicoGreen solution, including Lambda DNA standard
(supplied in kit).
10. Nuclease-free H2O.
11. Stock TE buffer (20): 10 mM Tris–HCl, 1 mM EDTA, pH
7.5.
12. Dilute TE buffer (1 part diluted into 19 mL of Nuclease free

H2O) in a 50 mL Falcon tube. Total volume of solution
needed is dependent upon the number of samples.
13. Aluminum foil.
14. Two 15 mL Falcon tubes.
15. 1.5 mL sterile Eppendorf tubes.
16. Branson 2510 ultrasonic water bath.
17. Primers and probes specific for sequences within the HSV-1
thymidine kinase gene:
forward 50 -AAA ACC ACC ACC ACG CAA CT-30 , reverse
5 -TCA TCG GCT CGG GTA CGT A-30 , probe 50 -FAM-TG
0
GGT TCG CGC GAC GAT ATC G-TAMRA-30 .

18. Taqman Universal PCR Master Mix.
19. Purified HSV-1 DNA.
3 Methods
3.1 Preparation 1. Insert an intact needle into one end of a 30 mm length of the
of Viral Solution PE tubing (Fig. 4c). Attach the collar of the needle to a 1 mL
and Loading tuberculin syringe. Draw up distilled water into the PE tubing
the Injection and rinse several times. Fill the tubing with water. Remove
Apparatus 1 mL syringe.
2. Draw water into the Hamilton repeater syringe.
3. Attach the collar of the needle on the filled tubing to the
Hamilton repeater pump and expel all of the water possible
by pressing in the plunger. Pull back gently on the plunger to
get a small air bubble in the end of the tubing. This bubble will
serve as a marker for the limit of fill of the viral solution.
4. Draw up virus into the tubing by pulling on Hamilton syringe
plunger. Monitor how much is loaded by the movement of the
bubble and the number of “clicks” available on the plunger. Do
not allow the virus to flow into the Hamilton syringe.
3.2 Viral Injection 1. Anesthetize the mouse with an intraperitoneal injection of

into the Vitreal Avertin (~0.2 mL) per 10 g body weight. The mouse will be
Chamber asleep in about 5 min. Place a drop of the atropine: propara-
caine mixture on the cornea of each eye for 10 s. Wipe the eyes
with a sterile cotton swab.
2. Hold the shank of the needle in a hemostat with the bevel
down. Insert about 3 mm of the needle into each eye at the
limbus (Fig. 2). Press pump 4 times, that is, deliver 4 μL. Check
that the bubble in the tubing moves with the click. Hold in
place for at least 30 s and withdraw (see Note 4).
3. Provide a fresh solution of Valacyclovir to the mice 24 h after

viral infection and then every day thereafter at approximately
the same time.
4. Reserve an uninfected mouse as a control.
3.3 Dissection 1. Anesthetize the mouse by intraperitoneal injection of fresh

of the Optic Tract Avertin. Perfuse the mouse intracardially with normal saline
( See Note 5) delivered through a 20 gauge needle attached to a 30 mL
syringe.
2. The retina may be isolated at this time to include this portion of
the optic path in the analysis [16]. Retina can be collected, but
the amount of viral DNA in retinal ganglion cells will be only a
portion of the DNA detected because HSV-1 will replicate in
other cell populations.
3. Remove the skin from the head. Using blunt scissors cut the
cranium along the midline and separate the frontal bones to
reveal the brain (Fig. 5a). Lift the two cerebral hemispheres
slowly until the two (ON) can be identified (Fig. 5b). Using
surgical scissors cut the two nerves as near as possible to the
points where they enter the orbital foramen. The brain can be
flipped over by pulling back the frontal lobes. The ON will fall
onto the ventral surface of the brain (Fig. 5c) and the OC (∗)
and two OT will be exposed. Use #5 forceps to pull back the
temporal lobe of the brain to expose the OT extension to the
thalamus. Cut as close to the thalamus as possible (Fig. 5d).
Lastly, cut the OT at the OC (see Note 6). Gently peel off each
OT from the brain tissue.
3.4 DNA Extraction 1. Deposit both OT into 155 μL of PicoPure DNA extraction
and Total DNA buffer containing 1 mg/mL proteinase K. Sonicate for 15 min,
Quantification incubate samples for 3 h at 65 C, then for 10 min at 95 C.
(See Note 7) 2. Dilute the PicoGreen solution with TE and protect from light
by wrapping tubes in aluminum foil.
3. Serially dilute the lambda DNA supplied in the kit with the
dilute TE buffer. A series from 10 ng/μL to 10 pg/μL should
be prepared.
4. Plate the samples in duplicate in 96 well plates and analyze
using the Real-Time PCR system.
5. The resulting fluorescence data is normalized against a stan-
dard curve of lambda DNA with an R2 greater than 0.98.
3.5 Determination 1. Mix Taqman Universal PCR Master mix containing forward
of Viral Copy Number and reverse primers, and fluorescent probe with 5 μL of each
by Quantitative PCR OT sample.
Fig. 5 Exposure of the brain and optic pathway of mouse. (a) The dorsal surface
of the brain is exposed and the cerebral hemispheres (CH) lie on either side of
the midline (m). The cerebellum can be seen at the top of the photo. (b) The
cerebral hemispheres (CH) are reflected up to expose the optic chiasm (∗) and
optic nerves (ON) (arrow). The ON extend laterally to the optic foramina. At the
opposite end of the ON, the ON is continuous with the optic chiasm (OC). The
right trigeminal ganglion (tg) can be seen just lateral to the ON. (c) The two ON
are cut near the optic foramina and lie on the undersurface of the CH (arrow). The
ON, OC (∗) and OT (arrow) can be seen. The temporal lobe of the CH covers the
distal part of the OC. (d) Carefully dissect the OT away from the temporal lobe.
Cut the OT at the point where it bifurcates at entry to the thalamus (at tip of
forceps). Bar ¼ 2.5 mm (see Note 6)
2. Run samples in duplicate using the Real-Time PCR system

under standard cycle conditions.
3. Plot a standard curve based on tenfold dilutions of purified
HSV-1 DNA from 101 to 107 copies of genome.
4. To compare the number of copies of viral DNA in individual
experiments, measure the copies of viral DNA in each sample
and divide that by the total viral and cellular DNA for the same
sample. This ratio can be expressed as copies of viral DNA/ng
total DNA in each sample (see Note 6).
4 Notes
1. We use male mice of standard age (5–6 week-old) and strain

(BALB/c) and from a single breeder (Simonsen Laboratories,
Gilroy, CA). Avoid older mice, because the rates of transport
vary with animal age [7]. There are also strain differences in the
immune response to HSV-1 [17]. We use BALB/c mice for

their intermediate resistance to HSV-1 infection; the strain is
susceptible, but not so susceptible as to produce very rapid and
widespread HSV-1 infection. It is important to include an
uninfected mouse for each experiment as a negative control.
2. The stock solution of F strain of HSV-1 is propagated in
African green monkey kidney (Vero) cells as described previ-
ously [9]. Viral titers are determined in triplicate by standard
plaque purification assay [18].
3. To prepare the needle, grip the metal part of the needle with a
hemostat at the junction of the metal needle and plastic collar.
Hold the plastic part and rock the part back and forth while
twisting it at the same time. The needle should break off at the
plastic mount. Check that the needle end is patent. Prepare
several needles for use at one time.
4. Clean the pump system after each use by rinsing with distilled
water and 100% ethanol. Separate tubing and needles are used
for each viral stock.
5. Autoclave surgical instruments before dissections of each ani-
mal for DNA analysis. Use separate autoclaved #5 Dumont
forceps and surgical scissors for each OT of each animal.
6. The optic tract is cut slightly distal to the optic chiasm. Some of
the axons of retinal ganglion cells innervate the hypothalamus
at this region. To avoid contamination of retinal axons with
hypothalamic neurons, we cut the OT from the optic chiasm
for OT dissections.
7. This ratio can be used to compare HSV-1 transport rapidly in
different strains of mice as well as different mutant strains of
virus in one strain of mouse. A more complete description of
the DNA analysis has been published [12].
Acknowledgments
I thank the artist Ms. Suling Wang and Drs. Kimberly Topp and
Jolene Draper at UCSF and Dr. Judy Garner at USC for their help
in developing the procedure. This work was supported by PHS
grants EY008773, EY019159, and EY002162 and by funds from
That Man May See, San Francisco, CA and by an unrestricted grant
from Research to Prevent Blindness.
References
1. Margolis TP, LaVail JH, Setzer PY, Dawson 2. LaVail JH, Draper JM, Chang WC, Sretavan
CR (1989) Selective spread of herpes simplex DW (2011) The anterograde axonal transport
virus in the central nervous system after ocular of herpesviruses: a review of experimental
inoculation. J Virol 63(11):4756–4761 approaches. In: Diefenbach RJ, Cunningham
AL (eds) Viral transport, assembly and egress. directional infection by alpha herpesviruses.
Research Signpost, Kerala, India, pp 1–20 Curr Protoc Cell Biol 43:26.24.21–26.24.23
3. Taylor AC, Weiss P (1965) Demonstration of 11. Garner JA, LaVail JH (1999) Differential
axonal flow by the movement of tritium- anterograde transport of HSV type 1 viral
labeled protein in mature optic nerve fibers. strains in the murine optic pathway. J Neuro-
Proc Natl Acad Sci U S A 54:1521–1527 virol 5:140–150
4. Grafstein B (1967) Transport of protein by 12. Draper JM, Huang G, Stephenson GS, Bertke
goldfish optic nerve fibers. Science AS, Cortez DA, LaVail JH (2013) Delivery of
157:196–198 Herpes simplex virus to retinal ganglion cell
5. Grafstein B, Murray M, Ingoglia NA (1972) axon is dependent on viral protein Us9. Invest
Protein synthesis and axonal transport in reti- Ophthalmol Vis Sci 54(2):962–967
nal ganglion cells of mice lacking visual recep- 13. Harrabi O, Tauscher AN, LaVail JH (2004)
tors. Brain Res 44:37–48 Temporal expression of herpes simplex virus
6. Yu DY, Cringle SJ, Balaratnasingam G, Mor- type 1 mRNA in murine retina. Curr Eye Res
gan WH, Yu PK, Su EN (2013) Retinal gan- 29(2-3):191–194
glion cells: energetics, compartmentation, 14. LaVail JH, Tauscher AN, Hicks JW, Harrabi O,
axonal transport, cytoskeletons and vulnerabil- Melroe GT, Knipe DM (2005) Genetic and
ity. Prog Retin Eye Res 36:217–246 molecular in vivo analysis of herpes simplex
7. LaVail J, Nixon R, Sidman R (1978) Genetic virus assembly in murine visual system neurons.
control of retinal ganglion cell projection. J J Virol 79(17):11142–11150
Comp Neurol 182(3):399–422 15. Lumb WV (1963) Small animal anesthesia. Lea
8. Jeon C-J, Stretto E, Masland RH (1998) The and Febiger, Philadelphia, PA
major cell populations of the mouse retina. J 16. Winkler BS (1972) The electroretinogram of
Neurosci 18(21):8936–8946 the isolated rat retina. Vision Res
9. LaVail JH, Tauscher AN, Aghaian E, 12:1183–1198
Harrabi O, Sidhu SS (2003) Axonal transport 17. Lopez C (1975) Genetics of natural resistance
and sorting of herpes simplex virus compo- to herpesvirus infections in mice. Nature
nents in mature mouse visual system. J Virol 258:152–153
77(11):6117–6127 18. Burleson FG, Chambers T, Wiedbrauk DL
10. Curanović D, Ch’ng TH, Szpara M, Enquist L (1992) Virology: a laboratory manual. Aca-
(2009) Compartmented neuron cultures for demic Press, Inc., San Diego, CA
Chapter 27
The Murine Intravaginal HSV-2 Challenge Model

for Investigation of DNA Vaccines
Joshua O. Marshak, Lichun Dong, and David M. Koelle
Abstract
DNA vaccines have been licensed in veterinary medicine and have promise for humans. This format is
relatively immunogenic in mice and guinea pigs, the two principle HSV-2 animal models, permitting rapid
assessment of vectors, antigens, adjuvants, and delivery systems. Limitations include the relatively poor
immunogenicity of naked DNA in humans and the profound differences in HSV-2 pathogenesis between
host species. Herein, we detail lessons learned investigating candidate DNA vaccines in the progesterone-
primed female mouse vaginal model of HSV-2 infection as a guide to investigators in the field.
Key words Herpes simplex virus, Animal model, DNA vaccine, Antibody, Polymerase chain reaction,
Latency, Dorsal root ganglia
1 Introduction
There is no licensed vaccine for herpes simplex virus type

1 (HSV-1) or herpes simplex virus type 2 (HSV-2). Inbred mice
do not recapitulate some of the features of HSV infections in
humans. For example, murine infections tend to be either fatal at
high inoculum or fail to establish themselves at low inoculum, while
human primary infections are rarely fatal. The infectious inoculum
dose is not known in humans. Additionally, humans have sponta-
neous reactivations leading to shedding of infectious virus at epi-
thelial surfaces [1, 2] while mice at best have rare molecular
evidence of reactivation, even when stressed or immune suppressed,
and seldom reactivate all the way to shedding of infectious virus
[3, 4]. Nonetheless, both species exhibit the establishment of HSV
latency in dorsal root ganglia (DRG) that innervate sites of epithe-
lial inoculation, and both show worsening of disease course with
immune suppression. Recently, epigenetic or signaling pathway
drugs have shown some activity for inducing recurrence in murine
ganglia [5]. Full recurrences have been achievable in some HSV-1
mouse models, and are beginning to be studied in combination
429
430 Joshua O. Marshak et al.
with vaccines [6]. The animal efficacy phase of the preclinical study
of a candidate HSV vaccine typically sequences murine immunoge-
nicity and then protection studies and then progresses to guinea pig
and first-in-human stages [7].
Un-manipulated female mice have a 4 day estrus cycle and are
refractory to vaginal HSV-2 inoculation. Exogenous progesterone
pretreatment alters vaginal physiology [8], HSV receptor levels [9],
and perhaps immune mechanisms [10] to render animals more
susceptible. Animal age [8] and strain [11] are other critical vari-
ables for HSV susceptibility for some viral strains and routes of
inoculation. Balb/c mice tend to be more susceptible to virus
challenge [11], and in general are easier to handle. However,
C57BL/6 mice have a thoroughly characterized CD8 T-cell
response [12, 13], HSV TCR transgenics [14], and many genetic
variants such that they may be preferable for some experiments.
1.1 DNA Vaccines At the time of writing there is no DNA vaccine licensed for use in
and Vaccination humans. Despite this, DNA vaccines continue to be attractive.
Advantages are the ability to produce broad immune responses
including CD4, CD8, and antibody [15], storage and shipping
stability, ease of production, predictable cost, the potential for
in vivo posttranslational modification of vaccine product, and a
long duration of antigen presentation. Sequences can be modified
to reflect microbial strain changes, to target the MHC class I
pathway through the addition of ubiquitin or other motifs, to
optimize codon utilization, or to include immunostimulatory
CpG motifs. DNA vaccines can also be delivered by diverse routes
and in concert with adjuvants or enhancers aimed at increasing the
uptake or protein expression or creating an immunogenic microen-
vironment [16, 17].
In mice, vaccine route can be varied to mimic potential human
delivery routes, or to target different immune pathways. With
intramuscular (IM) injections of DNA vaccine, antigen processing
and immune priming likely occur in the draining lymph nodes. In
contrast, antigen-presenting cells (APC) in the immediate area are
thought to play a key role in the immune response to DNA vaccines
delivered to the dermis [2, 18]. Additionally, vaccination in the skin
has been reported to be up to tenfold more potent than the IM
route [2] and therefore to have the potential for dose-sparing.
DNA vaccines can be prepared in-house or manufactured by
third party contractors. In general these vaccines consist of (1) a
bacterial plasmid backbone with an antibiotic resistance gene and
bacterial origin of replication, (2) a strong eukaryotic promoter,
and (3) a DNA-coded vaccine insert. Our group’s experience with
the pVAX1 vector, manufactured by Invitrogen, is detailed herein.
This nonproprietary molecule is commercially available but other
vectors with similar features can also be used. pVAX1 is specifically
designed for DNA vaccine development with a CMV promoter,
DNA Vaccines and HSV-2 Mouse Vaginal Infection Model 431
multiple cloning site, and kanamycin resistance for selection in

E. coli. It is recognized that DNA vaccines for clinical trial adminis-
tration to humans typically lack antibiotic resistance markers. A
strategic decision is required as to whether to move directly to
one of these proprietary vectors for preclinical testing Plasmid
backbones without antibiotic resistance genes are now technically
compatible for large scale manufacturing and are beginning to be
used in murine HSV studies and human trials [19, 20]. When
producing vaccine in-house, make enough vaccine to complete
your studies. With vaccine doses as high as 100 μg each, a 100 ani-
mal study with two doses/animal could easily require over 20 mg of
vaccine. Outsourcing can be attractive but requires additional deci-
sions concerning good manufacturing process (GMP) specifica-
tions and costs. Special efforts must be made to monitor the
purity and identity of DNA vaccines. We recommend resequencing
the final vaccine construct and checking for expression of the bona
fide protein as outlined below. In situations where we have not had
a mAb, we have used polyclonal human immune sera or human
CD8 T-cell clones specific for the HSV-2 gene of interest
[15]. E. coli strains typically used to manufacture plasmid are deri-
vatives of the “safe” lab strain K-12 but still have an altered endo-
toxin. This TLR4 agonist that could have an unrecognized
adjuvant effect and level should be carefully monitored.
There are several design considerations for DNA vaccines. HSV
sequences are GC rich and some coding regions have repeat ele-
ments; these features can lead to cloning difficulties or instability.
Codon optimization is important in some viral systems and has
been reported for HSV-2 [21, 22]. Intellectual property, institu-
tional review board (ethics), and cost considerations may favor
synthesis of the gene of interest or routine PCR cloning to obtain
the initial HSV-2 inserts. The relatively fast turn-around time, well-
defined clinical and immune end points, and the consistency of the
vaginal HSV-2 challenge model have made it attractive for testing
various types of molecular adjuvants encoded by DNA and chemi-
cal or mechanical gene delivery enhancers. Examples include
plasmid-encoded cytokines [23], cationic lipids with known cellular
DNA delivery properties [16], electroporation [24], microparticle
delivery [25], and percutaneous microneedles [2].
1.2 Virus and Virus Several challenge strains of HSV-2 are in use. A nearly complete
Challenge genome is available (GenBank JX112656.1) for the virulent strain
186. The prototype strain HG52 has mutations rendering it less
virulent [26] and is therefore disfavored. Some researchers are
using low-passage, near wild-type strains in animal HSV-2 research
and finding them more challenging to obtain protection. While we
have not yet applied this to DNA vaccines, this is a quite rational
reality check [27, 28].
Sequence matching between vaccine and challenge strain is

important when working with candidates, such as DNA vaccines,
that present only a limited amount of the HSV proteome. In our
work, we sequenced strain 186 and wild-type HSV-2 tegument
genes UL46 and UL47, found consistent differences compared to
HG52, and therefore chose to match DNA vaccines to the wild-
type consensus and the challenge strain [15]. Over the last several
years, hundreds of full-length and near full-length HSV-2 and
HSV-1 genomes have become available [29–32]. These should be
consulted during the design phase of subunit vaccines using nucleic
acid or other formats. Some genes, such as UL23, show high
variability, while others, such as US6 encoding vaccine candidate
glycoprotein D, show very little. Complexity is added by the fre-
quent detection of HSV-2 clinical strains that are HSV-2 HSV-1
interspecies recombinants [33, 34].
We use a replication-competent, attenuated HSV-2 strain deliv-
ered vaginally as positive control vaccine. We selected a strain based
on availability [35] and a track record of near-sterilizing, durable
immunity that appears to depend on CD4 T-cells [36]. This atte-
nuated strain is made from HSV-2 strain 333, which also has a
GenBank sequence. The relatively minor differences between
186 and 333, in the context of the large overall proteome do not
preclude protection. Diverse attenuated strains bridging the spec-
trum between replication-competent and replication-incompetent
are available and suitable as vaccine positive controls
[28, 37]. These are also helpful for studying immune responses in
infection versus vaccination to compare the two contexts. Live
attenuated vaccines set a high bar and help to differentiate simple
survival from higher levels of protection. One disadvantage of the
TK-minus positive control is that the establishment of DRG
latency, making DRG HSV DNA measures a problematic vaccine
end point.
1.3 Murine Challenge When HSV-2 strain 186 is introduced vaginally to progesterone-
End Points treated mice and infection establishes itself as indicated by local
lesions and viral replication, death usually occurs by day 6–8. There
1.3.1 Survival
is a very narrow window near the 50% lethal dose (LD50) within
which some animals seroconvert but survive. With specific criteria
for euthanasia, including hind limb paralysis, ataxic gait, immobil-
ity, or dehydration, survival is a relatively objective and unambigu-
ous end point. Very occasionally, challenged mice treated with
negative control vaccines have survived to 21 days. To determine
infection, we compare preinfection and day 21 serum from survivor
mice in a simple ELISA using whole UV-inactivated HSV-2 as a
coating antigen and survivor animal serum at 1:100 and 1:300
dilution as detailed elsewhere [15]. A threefold increase in OD450
is consistent with infection. Mice that fail to mount specific anti-
body responses could have either had sterilizing immunity or been
improperly inoculated. Attention to detail in progesterone treat-

ment, vaginal inoculation, and the titration and storage of chal-
lenge virus are important to minimize this ambiguous situation. To
study anamnestic immunity that is primed by vaccine and boosted
by infection in mouse groups not expected to survive, we will
sometimes include additional mice for sacrifice on day 6 after chal-
lenge to permit both immune boosting and survival end points.
1.3.2 Clinical Score Many HSV-2 murine challenge models use a 0–4 scoring scale.
Scores of 3 or 4, as detailed below, trigger humane euthanasia.
Mice typically show few symptoms through day 5, but their condi-
tion can deteriorate rapidly thereafter and twice daily monitoring is
appropriate. Scores provide a continuous variable of overall efficacy
to distinguish otherwise similar vaccines.
1.3.3 Vaginal HSV-2 DNA Measure of microbial titer is a regular part of preclinical vaccine
Copy Number Assessed by studies and many groups have used plaque assays to titer vaginal
Quantitative PCR swabs and other tissues after HSV-2 challenge. We prefer PCR
based on cost and the local availability of a sensitive and accurate
assay [38]. The main value is ranking of test vaccines that lead to
100% survival. Many HSV-2 vaccines are based on glycoprotein D
(gD, encoded by gene US6), known for several years to lead to
complete mouse protection when administered as a DNA vaccine
[39]. The failure, to date, of gD2 vaccines in humans is another
story altogether [40, 41]. A measure of vaginal replication such as
PCR can distinguish vaccines leading to survival only from vaccines
that decrease early mucosal replication. Day 1 (24 h) vaginal HSV-2
DNA copy number is correlated with survival [2] and DRG HSV-2
DNA load at latent time points in survivor mice (Koelle et al.
unpublished). The useful TK-minus positive control typically
leads to near-sterilizing immunity, especially by day 5 [21].
1.3.4 Specific Immunity Antibody and T-cell assays are typically used to confirm immuno-
genicity and the delivery of the desired antigen. It is less clear that
we have a good correlate of efficacy for mouse survival, and as no
vaccine has consistently worked in humans, targeting of such assays
is still uncertain. Pure antigen is best to detect specific antibodies,
and given the multiple protein targets available within HSV-2 and
the proprietary nature of some candidate protein antigens [40] this
may be difficult to obtain. We have substituted commercially avail-
able gD1 for the desired gD2 in some work [2, 16], and used
relatively crude HSV-2 protein made by eukaryotic host cell tran-
sient transfection for tegument proteins [15]. T-cell responses
mediated by CD4 and CD8 T-cells are widely sought after and
can be detected by several methods. One can consult the literature
for commonly used HSV-2 proteins such as gD2, recalling that
epitopes are mouse H-2 haplotype-specific. To test other HSV-2
proteins, preliminary vaccine-only (no challenge) experiments are
done in which immune splenocytes are tested for interferon-γ

responses to overlapping peptide sets covering the HSV-2 protein
(s) of interest. The phenotype (CD4 versus CD8) of responding
cells are established in depletion studies as detailed [15]. It is
helpful to independently establish that the same T-cell epitopes
are also recognized by immune splenocytes in the context of actual
HSV-2 infection. The attenuated TK-minus HSV-2 strain is used
for this purpose [15]. We specifically note that splenocytes har-
vested from noninfected mice sometimes show high background
in IFN-γ ELISPOT. This problem has occurred in temporal waves
in our animal facility and while likely related to inflammation or
infection, veterinary care staff can have difficulty identifying a dis-
crete problem that can be fixed. Detailed antibody and T-cell assay
methods are not addressed herein but myriad primary or methods
sources are available.
It is now appreciated that vaccine protection against HSV
inoculated via skin or the reproductive tract may be mediated by
tissue resident-memory T cells (TRM), as recently reviewed [42],
and indeed the flank scarification model of HSV-1 was instrumental
in the modern definition of TRM [43]. In the context of candidate
HSV vaccines tested in mice, the measurement of HSV-specific T
cells in the female reproductive tract (FRT) after enzymatic diges-
tion, using genetically marked T cells or functional assays, is an
attractive end point. This has been performed for various vaccine
platforms [44–46] and is rational for DNA vaccines as well. Simi-
larly, antibody levels and functional antibody titers can be measured
in FRT specimens, and HSV-specific B cells can be enumerated at
anatomically relevant sites [47–49]. These local immunity measures
are technically difficult but likely more physiologically relevant than
blood or splenocytes-based assays.
1.3.5 HSV-2 Latency Controversy exists as to whether HSV-2 vaccines for human use
in DRG should be sterilizing, preventing local infection and the establish-
ment of DRG latency, or merely ameliorate disease [7]. HSV-2
does establish latency in mice, and careful dissection followed by
explant culture or PCR can detect and measure this variable. While
explant culture proves infectious virus, we prefer PCR for the
reasons outlined above. Animal models support the contention
that DRG HSV-2 load is related to reactivation [50]. There is a
learning curve in establishing the dissection method, throughput is
limited even for skilled operators, and the TK-minus positive con-
trol virus leads to positive DRG PCR such that this end point is not
useful for this vaccine unless a strain-specific PCR is designed. We
generally measure the number of HSV-2 genomes present and the
number of mouse genomes present using GAPDH as a diploid
housekeeping gene. Results are expressed as HSV-2 DNA copy
number per million mouse cells [16]. Regarding timing, most
investigators wait between 60 and 100 days after inoculation,

although valuable immunology research has been done in latently
infected DRG at 30 days [51].
2 Materials
Materials and reagents comparable to the standards in our lab can

be used at the discretion of the specific lab.
2.1 Mice Female Balb/c or C57BL/6 mice at sexual maturity, age 5–6 weeks
(see Note 1).
2.2 Vaccines and Vaccine composition and route will be tailored to specific research.
Vaccine Delivery We include as gold standard positive control a replication-
competent HSV-2 strain attenuated through deletion of part of
gene UL23 encoding thymidine kinase (TK). This TK-minus virus
requires specific institutional approval. Though it is less virulent
than wild-type HSV-2, TK-minus strains are acyclovir resistant,
leading to occupational health concerns (see Note 2).
1. Positive control TK-minus HSV-2 strain at a titer of
108 PFU/mL or higher.
2. Positive control amino acids 1-340 glycoprotein D (gene US6)
of HSV-2 cloned into commercially available pVAX1 (Invitro-
gen) described below. This is an alternative positive control.
3. Negative control pVAX1 plasmid.
4. Researcher-selected and -sourced test vaccine(s) with or with-
out adjuvants, excipients, stabilizers, preservatives, etc.
5. Appropriate negative controls for test vaccines, typically con-
taining the same buffers, adjuvants, etc. but no active com-
pound. Note that TLR agonists delivered locally can protect
the vagina [52]. Innate immunity-stimulating adjuvants, if
used, should therefore be incorporated into controls.
6. TK-minus positive control virus: Seed stocks were obtained
from Dr. Greg Milligan at the University of Texas Medical
Branch, Galveston, Texas and originally published by Stanberry
et al. [35]. Stocks should be regrown in Mycoplasma negative
Vero or similar cells, tittered by standard plaque assay, and
stored in single-use aliquots at 80 C. We confirmed deletion
within UL23 by PCR comparing virulent strain 186 and
TK-minus using PCR primers at the 50 and 30 ends of the
coding region followed by agarose gel electrophoresis and
sequencing. Strain 186 lead to a product of approximately
1.1 kb while product from the TK-minus strain was consider-
ably shorter, reflecting internal deletion.
7. pVAX1-gD2 positive control vaccine: Please see our publica-

tion for details [2]. Briefly, gD2 amino acids 1-340 were cloned
by PCR from a random clinical HSV-2 isolate into pVAX1
(Invitrogen). Similar results have been obtained by gene syn-
thesis. pVAX1 expresses the insert under the control of a CMV
promoter. Plasmid was harvested from small scale E. coli cul-
tures under kanamycin selection and sequenced to prove iden-
tity. Seed was provided to a commercial DNA manufacturer for
near-GMP material for pVAX1 and PVAX1-gD2 at 1 mg/mL
with defined endotoxin levels. With regard to amount, three
IM injections of 10 μg per mouse at 21 day intervals lead to
solid protection. Plan ahead and make a single large batch for
the positive control group. The gD2 construct is predicted not
to localize to cell membranes due to deletion of the C-terminal
transmembrane domain within amino acids 341-393 [53]. To
check expression of gD2 we used flow cytometry [2]. Briefly,
vaccine from the manufacturer was transfected into Cos-7 cells
(obtained from ATCC) with Fugene 6 (Roche) per the package
insert. After 48 h cells were permeabilized with Cytoperm/
Cytofix (Pharmingen) per the manufacturer’s instructions and
stained for flow cytometry using as first antibody, mouse anti-
gD mAb 2C10 (Santa Cruz Technologies), and as secondary
antibody allophycocyanin-labeled goat anti-mouse IgG (Biole-
gend). The result was that pVAX-1 control-transfected Cos-7
were negative for specific fluorescence while pVAX-1-gD2-
transfected cells were 20–40% positive. Vaccine stocks were
stored at 20 C until use.
8. pVAX1 empty vector control: Prepare identically to pVAX1-
gD2.
9. Test vaccines: Prepare investigator-specific DNA vaccines, opti-
mally in a manner similar to that of a positive control DNA
vaccine such as the one discussed above. Regarding amount,
plan for in the range of 10–100 μg per mouse per vaccination
and two to three vaccinations per mouse. Single large batches
are therefore preferable. We have found that Qiagen “Endo-
Free” Midi- or Maxi-prep kits are adequate if one is not using a
commercial vendor. In addition to sequencing the final vaccine,
it is preferable to verify expression of the bona fide HSV-2
protein. The use of a specific mAb as outlined for gD2 can be
pursued if such a reagent is available. In our work with DNA
vaccines encoding HSV-2 tegument proteins, we used both
humoral and cellular human immunology probes. VM92 cells
were transfected with the candidate DNA vaccines and super-
natants collected and plated onto ELISA plates, and probed
with pooled human serum obtained either from HSV-2-
infected persons or HSV-1/HSV-2 dually seronegative per-
sons. Specific binding of only the immune sera was observed
for each HSV-2 protein tested [15]. For CD8 T-cell tests,
Cos-7 cells were cotransfected with both the test vaccine and
the relevant HLA class I heavy chain cDNA and coincubated
with CD8 T-cell clones specific for the HSV-2 protein under
study, as detailed in a previous methodology paper [54]. The
expected result is that only cells transfected with both the HLA
and HSV-2 protein trigger specific interferon-γ release [15].
2.3 Intramuscular 1. 70% Ethanol.

(IM) Vaccine Delivery 2. 200 200 Gauze sponges.
to the Rectus Femoris
3. Vaccine and diluent such as PBS (40 g NaCl, 1 g KCl, 5.7 g
Quadriceps Muscle Na2HPO4, 1 g KH2PO4, add H2O to a final volume of
5000 mL, adjust pH to 7.4, autoclave, store at 4 C).
4. 29 Gauge, ½00 , 0.3 cm3 insulin syringes (see Note 3).
2.4 Intradermal (ID) 1. Anesthetic: Ketamine–xylazine anesthetic. Ketamine is

Vaccine Delivery to the obtained from the clinical pharmacy at 100 mg/mL and xyla-
Pinna (Ear) zine at 20 mg/mL. Please note that xylazine stocks also come
at 100 mg/mL and care is required to check each bottle. Both
are stored at room temperature. A premix is made and stored at
room temperature for up to 28 days. Mix 0.65 mL (100 mg/
mL) ketamine with 0.22 mL (20 mg/mL) xylazine and
9.13 mL sterile saline. The final solution contains 6.5 mg/
mL ketamine and 0.44 mg/mL xylazine and is dosed at
20 μL/g of body weight (see Notes 4 and 5).
2. Needle and syringe 25 gauge 5/800 Safety-Lok™ syringes (Bec-
ton Dickinson) for intraperitoneal (IP) injection of anesthesia.
3. Vaccine and diluent such as PBS (see Subheading 2.3, item 2).
4. Optional: Blu-Tack™ (manufactured by Bostik) (see Note 6).
5. 30 gauge, ½00 , 0.3 cm3 ultrafine insulin syringe (Becton Dick-
inson #328280). One per ear to be injected. We recommend
this specific product for this application.
2.5 Virus Challenge Virus culture/preparation is not detailed herein. Researchers

should be competent in virus handling and growth at BSL-2 levels.
We use Mycoplasma-negative stocks of Vero cells originally obtained
from the American Type Culture Collection (ATCC) to grow virus.
Obtain institutional approvals for each strain used including the
TK-minus strain if appropriate. Store stocks in small ~100 μL ali-
quots at 80 C in screw-cap, O-ring style tubes.
1. Biosafety cabinet certified to BSL-2.
2. Medroxyprogesterone 150 mg/mL. This is obtained from the
clinical pharmacy as Depo-Provera™. Amount needed is
2 mg/animal. Also required prior to TK-minus virus immuni-
zation used for positive vaccine control.
3. 1 mL sterile syringes 25 gauge 5/800 Safety-Lok™ syringes

(Becton Dickinson) for medroxyprogesterone injection, one
per animal.
4. HSV-2 strain 186 or other virulent strain with titer of
108 PFU/mL or higher (see Note 7).
5. Normal mouse serum prepared from naı̈ve animals 0.1% solu-
tion in PBS (see Note 8).
6. Sterile 1.7 mL DNase/RNase-free microfuge polypropylene
conical-bottom tubes for virus dilution.
7. Ketamine–xylazine anesthetic premix (see Subheading 2.4,
item 1).
8. Sterile syringes for anesthetic (see Subheading 2.4, item 2).
9. Calcium alginate swab (Fisher), one per animal.
10. 2–20 μL range adjustable pipette and sterile nuclease-free filter
pipette tips.
11. 10% bleach in water.
2.6 Challenge Study 1. Record keeping materials in animal facility.

End Points 2. Excel spreadsheet with two columns for each day (morning and
2.6.1 Survival evening) and one row per animal.
3. Institutionally and facility approved method for getting paper
data out of animal room, for example plastic bags with disin-
fectant spray to outside of bag.
2.6.2 Clinical Score 1. Record keeping materials in animal facility.

2. Excel spreadsheet with two columns for each day (morning and
evening) and one row per animal.
3. Reference sheet/card with disease score criteria for disease
score 0–4.
2.6.3 Vaginal Swab for 1. 2 mL Polypropylene sterile O-ring tubes (Sarstedt) with 1 mL
HSV-2 DNA Copy Number PCR digestion buffer, one tube per animal per day. Prelabel
via PCR tube with animal ID number and day.
2. Digestion buffer is 100 mM KCl, 10 mM Tris–HCl pH 8.0,
25 mM EDTA, 0.5% Nonidet P-40. Store at room temperature
prior to use. Digestion buffer can be made as a 5 solution.
For 5, 3.7 g KCl, 50 mL Tris–HCl, 1 M, pH 8.0250 mL
EDTA, 0.5 M, pH 8.0, 50 mL Igepal CA-630 and bring
volume up to 1000 mL with deionized molecular biology
grade water. Dilute 1:5 to make working solution. Note that
Ipegal CA-630 (Sigma-Aldrich) is chemically indistinguishable
from Nonidet P-40, which is no longer commercially available.
3. Sterile mini-tip urethral swabs (Copan), one per animal per day.
4. Small sharp scissors.
2.6.4 Blood Collection for 1. Ketamine–xylazine anesthetic (see Subheading 2.4, item 1).
Serologic End Points (See 2. Glass Natelson blood capillary collection tubes (Fisher),
Note 9) nonsterile.
3. 200 200 Gauze sponges (Fisher).
4. Blood collection: “Microtainer™” nonsterile serum separator
tubes (Becton Dickinson) or sterile Eppendorf tubes if down-
stream cell-culture based assays such as neutralization assays
that require sterility are anticipated.
5. Optional: Artificial tears ointment sterile ophthalmic petrola-
tum and mineral oil lubricant (NDC).
6. Disposable plastic 3 mL transfer pipettes with bulb that can be
trimmed away.
7. Benchtop microcentrifuge with capability up to 9300 g.
2.6.5 DRG Dissection 1. Dissecting scope such as SMZ-800 Zoom stereo (Nikon).
2. Light source such as NI-30 single gooseneck illuminator
(Nikon).
3. Low quality dissection forceps.
4. Low quality dissection scissors.
5. Student Vannas spring scissors for laminectomy (Fine Science
Tools #91500-09). We specifically recommend this item.
6. Vannas spring scissors for DRG excision and lower spine lami-
nectomy (Fine Science Tools #15012-12). We specifically rec-
ommend this item.
7. Two of each high quality forceps (Fine Science Tools #11271-
30 and #11272-30). We specifically recommend these items.
8. Dry ice.
9. Acceptable surface on which to perform dissections such as
disposable dissecting board or dense sturdy Styrofoam covered
with Kimtech science benchtop protector (Fisher); one piece
large enough to cover the dissection work surface for each
animal.
10. Sterile O-ring cryovials (2 mL, Sarstedt), one per animal,
prelabel.
11. Digestion Buffer 150 μL/animal: 10 mM Tris–HCl, 25 mM
EDTA, 10 mM KCl, 1% Igepal C-630.
12. 20 Gauge syringe needles.
13. 70% Ethanol in water.
14. 10% Bleach in water.
3 Methods (See Note 10)
3.1 Mouse Restraint 1. Place the mouse on a surface it can grasp.

2. Gently pull on mouse tail and maintain light pressure; the
mouse will try to pull away.
3. Grasp the scruff of the neck with the thumb and the forefinger
of the other hand.
4. Maintain hold of tail.
5. A mouse can be restrained with one hand large/flexible
enough to hold the tail against the pad of the hand with the
little finger while scruffing the neck with the thumb and the
forefinger. This causes hand fatigue over time.
3.2 Mouse 1. Ensure that institutional approval is in place.

Husbandry 2. Follow facility/institutional requirements concerning work
with HSV-2. In the USA, HSV-2 is a biosafety level
2 (BSL-2) agent. Nomenclature may vary internationally.
Comply with housing and procedure room standards at all
steps after mice are vaccinated with attenuated HSV-2 positive
control, if used, or challenged with live HSV-2.
3. Order mice through your commercial vendor, or source mice
according to your study design. Adjust age at purchase to allow
1-week acclimatization for animals before starting study (see
Note 11).
3.3 IM Vaccine 1. This requires two persons and is frequently done the same day
Delivery as blood collection (see Note 12).
2. The first person restrains the mouse using standard neck
scruff/tail method.
3. The hind leg to be injected must also be held fully extended by
person 1. The leg should be held extended in a natural direc-
tion, neither straight back nor straight out perpendicular to the
spine. Leaving the leg slightly loose makes it easier to pinch and
locate the quadriceps muscle.
4. Person 1 holds the mouse so that its ventral side faces person 2.
5. Person 2 wipes the anterior of the mouse thigh with 70%
ethanol applied with the 2 2 gauze. Be careful to avoid
genital/rectal areas as this will agitate the animal.
6. Person 2 gently squeezes the quadriceps femoris muscle group
with the thumb and the forefinger.
7. Person 2 inserts needle and injects while maintaining gentle
pressure on muscle with the thumb and the forefinger. The
muscle should feel like a large round grain of rice. On second
and later injections, it will feel and possibly look larger. As you
push the syringe plunger you should feel the muscle swell and
stay swollen. If you do not feel this, you have missed. Practice
with dye if allowed by your institution including dissection of
leg to locate the injection point to gain skill at IM injections.
Use a sharp/new needle at least every four injections. We
typically inject bilaterally 50 μL per side per injection; thus,
we use a new needle every two mice.
8. Remove needle and discard in appropriate sharps container.
3.4 ID Vaccine 1. Anesthetize mouse using ketamine–xylazine mouse mix (see

Delivery to the Ear Note 13)
Pinna 2. Place a small amount of Blu-Tack on forefinger or middle
finger.
3. Place mouse prone (face down) in front of you.
4. Using the thumb, gently press the inner, ventral of the mouse
ear against the Blu-Tack so that pinna is as flat and planar as
possible with no wrinkles or folds.
5. With the bevel of the syringe-mounted 30 gauge needle facing
up very carefully push the needle tip into the dermis. Catch the
skin and then slide gently until the beveled tip and 1 mm of the
shaft of the needle are completely covered by skin. The needle
tip should still be visible through the very thin skin even
though it is intradermal (see Note 14).
6. Gently and slowly push on the syringe plunger to form a small
bleb of vaccine in the pinna. The maximum volume is 10 μL.
7. Slowly without shaking remove the syringe from the ear.
8. Gently remove ear from Blu-Tack and finger to prevent vaccine
from being pushed or squeezed out.
9. Discard sharp in appropriate sharps container.
10. Use a new sharp needle for each ear.
3.5 Virus Challenge 1. Six days prior to wild type virus challenge or administration of
TK-minus vaccine virus, mice will be treated with 2 mg/animal
3.5.1 Administration of
of medroxyprogesterone.
Medroxyprogesterone
2. Dilute medroxyprogesterone to 20 mg/mL in sterile PBS on
the day of administration.
3. Administer 100 μL (2 mg) subcutaneously. Holding the awake
mouse by the loose skin on the back of the neck with the thumb
and the index finger/forefinger, insert the needle into the
subcutaneous space between the back of the mouse’s head
and your fingers. Inject 100 μL of 20 mg/mL medroxyproges-
terone solution (see Note 15).
3.5.2 Establish the 50% It is necessary to establish the LD50 for each specific viral challenge
Lethal Dose (LD50) strain, virus batch, mouse strain, and mouse chronologic age prior
to carrying out experiments with vaccines (see Note 16).
3.5.3 Live Virus Set up your work area as to eliminate unwanted spread of virus and
Challenge to maintain workflow (see Note 17).
1. Dilute virus in PBS/0.1% naı̈ve mouse serum so the desired
inoculum is in 10 μL (see Note 18).
2. Chose the desired challenge dose(s) based on the scientific
goals of the study. We typically challenge at 50–100 LD50.
To differentiate between moderately and highly active vaccines,
some studies may use a dose range including lower or higher
challenges. In our hands, effective DNA vaccines can provide
100% protection at up to 500 LD50 [21]. Some investigators
use a two-dimensional matrix in which both vaccine dose and
HSV-2 challenge dose are independently varied to rank vaccine
candidate efficacy.
3. Anesthetize mice. We prefer ketamine–xylazine as isoflurane
will not keep mice motionless long enough to ensure vaginal
residence of the inoculum.
4. Avoid handling mice for 5 min after they have been inoculated
to minimize the amount of inoculum that exits the vagina.
5. Scruff anesthetized mice such that spine is straight and
stretched to full length without hunching, holding the tail
with the little finger.
6. Remove mucus from the vaginal introitus. Using a calcium
alginate swab, clean the vagina. Thick, even gelatinous mucus
is normal. Often gently rotating the swab a few times can wind
up the mucus to ease removal.
7. Draw 10 μL of diluted virus into a filter-tip 2–20 μL pipette tip.
8. Gently insert pipette tip into mouse vagina.
9. Slowly push pipette plunger. If you see inoculum spilling out,
readjust pipette tip or your restraint of the mouse. A fully
stretched out mouse optimizes retention of the inoculum.
10. Place pipette tip in bleach gently pipet up and down.
11. Discard pipette tip in sharps container.
12. Gently place mouse supine (face up) in cage to sleep for
5–15 min.
13. Observe that all mice are awake prior to leaving area.
3.6 Challenge Study 1. Check mice according to your protocol and animal care and use
End Points standards. We are generally required to check mice twice per
day for 21 days.
3.6.1 Survival
2. It is best for consistency if one researcher completes all animal
evaluations for premorbid conditions requiring euthanasia.
3. Humanely euthanize animals showing premorbid grade 3 or
4 changes (see Subheading 3.6.2 and Note 19).
3.6.2 Clinical Score 1. It is best for consistency if one researcher completes all animal
evaluations.
2. Gently grab mouse by tail taking care not to startle. Lift by the
tail so that the anal/genital region is visible and note of any
abnormal appearance.
3. Asses fur, posture, gait, and hydration level.
4. Assign a score based on appearance of animal and disease
scoring criteria.
5. Disease score:
0—Normal.
1—Perianal/genital erythema.
2—Perianal swelling and erythema. May have slightly ataxic
gait and/or slightly ruffled coat. The normal mouse coat
is glossy and shiny.
3—purulent lesions, partial or complete paralysis in one or
both hind limbs, visible weight loss or dehydration, very
poor grooming, perianal urine staining due to loss of blad-
der control.
4—immobile, complete hind limb paralysis, severe dehydra-
tion, little or no grooming.
3.6.3 Vaginal HSV-2 DNA 1. Aliquot 1 mL digestion buffer to each prelabeled 2 mL sterile,
Measurement by PCR ( See nuclease-free O-ring cryovial tube.
Note 20) 2. Restrain the nonanesthetized mouse using the one-hand
method (see Subheading 3.1). Turn mouse supine so that the
head is away from you and the tail is toward you. Having two
persons, one holding and the other taking the sample, enables
less operator hand fatigue but is overall more challenging.
3. Gently insert sterile swab into mouse vagina and rotate swab
360 within 2 s. The main difficulty is inadequate restraint or a
hunched mouse posture. Inflammation should not be limiting
on days 1–5. The entire cotton tip of the swab should be
inserted.
4. Place swab in designated tube with digestion buffer.
5. Use scissors to trim plastic handle of swab, leaving the swab tip
behind in the tube. Trim enough that you can be sure to close
the tube. Scissors should be sharp and tubes in a secure holder
to avoid recoil and spilling after swab snipping.
6. Secure cap onto tube.
7. Store samples at 20 C until they are ready for processing
for PCR.
3.6.4 Blood Collection 1. Obtain institutional approval for all bleeds including schedule.
(See Note 21) Ensure operators are trained.
2. Anesthetize animals using ketamine-xylazine mouse mix or
isoflurane. Do not anesthetize too many animals with mouse
mix or some may awaken too early. Generally ten animals
anesthetized at a time will sleep long enough for a less skilled
operator to bleed them all.
3. Place mouse on its side, on a clean, cushioned, and thermal
neutral or warmed surface so all four legs point toward you. As
you will alternate left and right eye with serial blood collec-
tions, mice laying on their right flank for the initial collection
will be lying on their left flank for the next collection. We
generally limit the total number of retro-orbital bleeds to four
in the life of the mouse, two from each side, with an interval of
at least 2 weeks between bleeds from any one eye.
4. The head should be oriented toward your dominant side and
the hand you will use to collect blood. Keep mice warm; if slow
to awaken, rewarm. Some twitching is normal during anesthe-
sia but they should not withdraw to noxious forepaw stimula-
tion, it is often associated with lighter anesthesia or with an
early waking state.
5. Using your thumb and forefinger to gently pull the skin above
and below the eye away from the eye. The forefinger is above
the eye and the thumb below.
6. The eye should be slightly protruding from the socket.
7. Gently and decisively push blood capillary collection tube
behind the eye between the upper eyelid and the top of the
eyeball. The tip of the capillary tube is puncturing the capillary
bed behind the eye.
8. Hold capillary tube in place until the blood flows up to the
point where you have predetermined your collection volume.
9. Using 200 200 gauze, gently close the eye and hold pressure for
several seconds.
10. Place capillary tube into blood collection tube. Using your
trimmed transfer pipette, apply pressure to push the blood
into the BD separator tube (nonsterile) or sterile
microcentrifuge tube. Work quickly before the blood clots in

the capillary tube.
11. Apply ophthalmologic ointment to the eye (optional).
12. Allow blood to clot in the secondary collection tube at least
13. Spin samples at approximately 9300 g, which is the equiva-
lent of about 10,000 rpm on a standard small benchtop micro-
centrifuge for 10 min.
3.6.5 Lumbosacral DRG 1. Euthanize mice using CO2 overdose or another approved non-
Dissection ( See Note 22) physical method (see Note 23).
2. Spray carcass completely with 70% ethanol to constrain hair and
particulates.
3. Completely remove skin. Make a small incision in the skin of
mouse flank using common dissecting scissors. Gently grasp
the skin on either side of the incision, pull toward the head and
tail until the skin is mostly removed.
4. Use common dissecting scissors to trim away skin (see
Note 24).
5. Remove all thoracic and abdominal viscera using common
forceps and scissors.
6. Trim away the most ventral portion of the rib cage using
common scissors (see Note 25).
7. Label mice so you can track animal identity. Store in an airtight
container at 4 C to prevent drying of carcasses.
8. Pin mouse down on dissection surface ventral side down. Pin
hind legs out from body fully extended at about a 45 angle
from spine in the caudal direction. 20 Gauge syringe needles
work well. Pins directly through the middle of the footpads will
hold the best.
9. Pin the front legs. Gently pull on them so the entire spine is
stretched out.
10. Using the student Vannas scissors carefully cut through the
muscle on either side of the spine down the length of the spine
(see Note 26).
11. Carefully fillet away the muscle from the dorsal bony spinal
column.
12. Place prelabeled sample tube in dry ice and remove cap
(no buffer).
13. Locate the first or second thoracic vertebrae finding the first or
second most rostral sets of ribs.
14. Using the student Vannas scissors make a cut into the spine,
perpendicular to the length of the spine. This cut should be a
half cross section. You are cutting only through the dorsal part
of the spinal column. The ventral half of the bony spinal
column should be left intact (see Note 27).
15. Alternating between sides, cut at about the dorsal/ventral
margin down the spine toward the tail (see Note 28)
16. As you cut the spine away you can excise the DRG or you can
wait until you complete the laminectomy to excise them all
at once.
17. Gently grasp the nerve fiber on either side of the DRG using
either of the fine science tools forceps. Using the finer Vannas
spring scissors trim the nerve fiber away from either side best
you can (see Note 29).
18. Carefully place the DRG into the labeled tube that is resting in
dry ice. The moist tissue should stick to the very cold tube wall.
19. Remove all DRG that are relevant to your study design. We
typically aim for 10–14 DRG from each side from the lumbo-
sacral region.
20. Cap tube and spin at high speed in a microcentrifuge to get all
DRG to the bottom of the sample tube.
21. Add 150 μL of PCR digestion buffer.
22. Store at 20 C until delivery to the PCR lab.
4 Notes
1. Purchase females from commercial vendors or breed HLA or

other transgenics [55] at your facility. Animals born the same
day are more expensive than animals within an age range. We
usually tolerate a small range and buy animals at sexual maturity
at 5–6 weeks. Adjust age at purchase to allow 1 week acclima-
tization prior to vaccination, and so that the age at HSV-2
challenge corresponds to that age at which the LD50 was
established. Strain is important. Balb/c mice tend to be more
susceptible to HSV. We use this strain to set a higher bar for
survival and allow lower viral inoculums. CD4 and CD8 epi-
topes in selected HSV-2 proteins have been identified in some
strains but not others, thus influencing strain choice depending
on the ORF under study. Balb/c mice are behaviorally easier to
manipulate than are C57BL/6 mice in the nonanesthetized
state. C57BL/6 mice have a thoroughly characterized CD8
T-cell response [12], HSV TCR transgenics, and many genetic
variants such that they may be preferable for some experiments.
The number of mice per experimental group is a critical param-
eter set in consultation with a biostatistician based on prelimi-
nary data from the user’s lab and/or the literature, the
expected effect size, and the desired degree of certainty

concerning the results. At our institution, ethical committee
approval includes group size. Small groups may lead to failure
to detect differences while large groups lead to unnecessary
animal suffering.
2. A variety of replication-competent attenuated or replication-
incompetent HSV-2 strains can be used in the place of
TK-minus if available to the investigator. We also include a
DNA vaccine positive control containing partial-length gene
US6, encoding glycoprotein D of HSV-2, detailed herein.
Acyclovir in drinking water at 1 mg/mL is an alternative posi-
tive control. Acyclovir requires daily drug dilution and water
bottle changes for 21 days. Obtain acyclovir for intravenous
injection from a clinical pharmacy at 50 mg/mL, and hold
concentrated drug at room temperature. Each day, dilute to
1 mg/mL in sterile water and refill water bottles. The cost is
low. There is less protection of the DRG than with effective
vaccines. Occasional late deaths have been noted after day
21 for acyclovir.
3. Typically 50 μL is the maximum dose that can be administered
to the quadriceps, or 100 μL/mouse if injected bilaterally. If
multiple injections with a single syringe are permitted we do
not recommend more than four per needle, as the needles dull
quickly. When using this method, fill syringes to 200 μL.
4. The amount needed is 300–350 μL per mouse per anesthesia
depending on weight and age. We estimate weight visually. We
typically use 300 μL for younger Balb/c mice for the first and
second administration, but by the age of challenge, typically
10–12 weeks, we use 350–400 μL. Follow institutional guide-
lines concerning controlled substance licensing, storage, dis-
posal, and frequency of administration. Animals may develop
tolerance if used too frequently. In our experience, C57BL/6
mice have less development of tolerance and we use 300 μL/
dose and 350 μL at challenge. In general, if at the last adminis-
tration prior to challenge seems at all inadequate, increase the
dose for challenge. Do not exceed 400 μL of drug/mouse.
Overdose is possible and generally lethal. Ketamine will not
inhibit the hind leg withdrawal reflex. Use forepaw withdrawal
to noxious stimulation to test the depth of anesthesia.
5. We typically draw 600–800 μL per syringe/needle and reuse
for two mice total per syringe/needle.
6. The optional nature of this product is partly a safety issue. The
alternative to using Blu-Tack™ is to use only a gloved finger.
7. Stocks may lose titer at 80 C at the rate of about 0.3 log10/
year and should be periodically retitrated. LD50 will need to be
pre-established by titration in mice of the same strain and target
age in prior experiments. While stocks are being grown and

titrated, observe microscopically for large syncytia formation.
Scattered syncytia are normal for strain 186 but very large
syncytia may indicate mutations that can influence virulence.
8. This is used at 0.1% in PBS to dilute virus prior to inoculation.
9. We use commercially available truncated glycoprotein D of
HSV-1 as test antigen when we use test vaccines that contain
gD2 as a protein or DNA construct. gD1 and gD2 have highly
similar amino acid sequences. ELISA details are published
[2]. For other test vaccines, investigator-specific ELISA anti-
gens will be required. Neutralizing antibody titers are also
frequently performed, especially if the test vaccines contain
the glycoproteins typically associated with HSV neutralizing
antibodies: gB, gD, and/or gH/gL. Neutralizing assays are
not detailed herein.
10. The outline of animal procedures is not a substitute for ade-
quate hands-on training. Follow all institutional requirements
regarding training for specific procedures, such as retrobulbar
bleeds, subcutaneous, intramuscular, intradermal, and intra-
peritoneal injections, use of anesthetics and restraint and
euthanasia techniques. Follow institutional guidelines and pre-
ferences regarding housing, restraint, blood sampling, anesthe-
sia and euthanasia. Training in vaginal inoculation, vaginal
swabs, and DRG collection may not be available from your
institution and practice animals, if allowed, may be reasonable.
11. Consider ordering a few extra animals for critical studies as
some may die due to shipping stress. Stressed animals may
impact on study outcomes. Observe each mouse for inflamma-
tion or irregular health before beginning study. Young Balb/c
can be very skittish, jump from great heights and run away.
Therefore operate with extreme care.
12. It is best to do IM injection before retrobulbar blood collec-
tion requiring anesthesia, or when animals are awake enough
to crawl around after blood collection. Animals with quadri-
ceps muscle tone are much easier for IM injection as one can
find the muscle and also palpate the expected small swelling
after successful injection.
13. Isoflurane will not work mice because need to be under anes-
thesia for at least a couple minutes. It is best to have two
persons with one giving anesthesia and the second giving
vaccine.
14. It is very helpful to pay attention to the reflectivity of the
needle. Depending on operator’s vision the only difference
you may see between a needle lying flat on mouse ear and a
needle that is properly inserted intradermal is that the inserted
needle will have a “matte” appearance in comparison.
15. This is difficult for one person with skittish C57BL/6 mice.
One person can restrain and another inject. An alternate injec-
tion site of loose skin on the rump can be used. If there is
significant visible leakage of drug, repeat the procedure with
estimation of the amount of leakage and record the extra
injection. We prefer to use a single needle/syringe for every
two animals. Preparing multiple syringes ahead of time does
not work well because the drug is formulated as a suspension
that settles out very rapidly. The master concentrate and
diluted drug vials should be swirled prior to each use. Two
operators are therefore preferable.
16. In brief, mice are obtained or aged in the facility to reach the
proper age and then inoculated with virulent HSV-2 vaginally
as Subheading 3.5.3, after medroxyprogesterone pretreat-
ment. Typically we range from 10 pfu to 10,000 pfu/mouse
in ½ log10 increments and test 8–10 animals per dose. We have
found that the LD50 is typically between 100 and 1000 pfu/
mouse dependent on virus strain and batch and mouse strain.
LD50 values in our hands are typically moderately (three- to
fivefold) higher for C57BL/6 mice than for Balb/c mice; that
is, Balb/c mice are moderately more susceptible. Specific insti-
tutional approval is required at our institution prior to carrying
out LD50-finding studies. We use the same end points for
humane euthanasia for LD50-finding studies that are used in
vaccine studies.
17. This is much easier with two operators. One person can anes-
thetize, clean the vaginal area and/or bleed while the second
person performs the inoculation. Diluted virus, bleach, and a
sharps container should be accessible to the person doing
inoculations. Space for at least one mouse cage should also be
available within reach. Pretear the paper off the back of the
individual paper pouches of the cleaning swabs so that the ends
are accessible.
18. Transport virus to animal room on dry ice and thaw gently at
room temperature. Then place leftover concentrated virus on
wet ice. Dilute by two- to tenfold dilutions using a fresh pipette
tip each time and gentle vortexing. Dilute the virus in a PBS
0.1% normal mouse serum. Diluted virus can be used over
1–2 h held at room temperature. We dilute enough virus for
about 40 mice. If the experiment is larger, we go back to the
concentrated stock held on wet ice and prepare a second work-
ing tube. Wear personal protective equipment.
19. Operators should become certified in and comfortable with
one or more modes or humane euthanasia following institu-
tional guidelines and preferences. We use CO2 overdose fol-
lowed in some instances by cervical dislocation.
20. Perform this procedure on the days that are appropriate for
your study. We generally study days 1, 3, and 5 after inocula-
tion. This allows differentiation of vaccines that allow survival
but still permit brisk local replication from vaccines that pro-
vide sterilizing or near-sterilizing local protection in addition
to survival.
21. General instructions are given here for retro-orbital bleed.
Operators should be trained and certified at their local facility.
The maximum volume we obtain by this method is 1% of body
weight every 2 weeks. For a 20 g mouse this is 200 μL. The
amount needed per antigen for ELISA is generally on the order
to 10 μL depending on starting dilution and number of Ig
types tested. It is always a good idea to use artificial tears when
using ketamine anesthesia as mouse eyes remain open and will
dry out. This increases the risk of eye bleed complications. It is
very important to place pressure on eye both to stop bleeding
and prevent blood from building up behind the eye. This
increases the risk of eye loss or scaring.
22. Detailed photomicrographs and a protocol are available
[56]. Perform this procedure on a limited number of mice
per day and increase as experience builds. There is a steep
learning curve, especially for those unaccustomed to micro-
scope work. This work requires sitting still for long periods of
time. Make the workstation as comfortable as possible, opti-
mizing chair height, bench height, microscope eye piece angle,
and distance from edge of bench to work area. Breaks, stretch-
ing, and eye exercise (distant focus) reduce fatigue. While
HSV-2 is not thought to disseminate or to cause latent or
lytic infection outside of the DRG in mice at late time points,
the entire dissection should be performed carefully using per-
sonal protective equipment. The initial dissection of skin and
viscera removal should be performed in a BSL-2 biosafety
cabinet.
23. Do not use cervical dislocation or a guillotine. Nonphysical
methods are preferred to maintain the spinal integrity. This is
especially important for the spinal cord dissection. The pinning
of the carcass to the dissection board will be simpler and the
intact spine makes the laminectomy much easier.
24. When you remove the skin from the legs by the pulling, be
especially careful, particularly with the front legs. It is possible
to pull too hard and disrupt the integrity of the joints. Gently
grasp the leg near the shoulder or hip and using your other
hand pull the skin down the leg.
25. Removal of the ventral portion of the rib cage allows the carcass
to lie flat during dissection. It is helpful to leave most of the rib
cage intact however as the ribs can be used as reference points

to locate specific DRG levels.
26. At this point it is important to be mindful of not cutting
through any bone. The idea of this step is to fillet the muscle
away from the spine making it more accessible for a clean
dissection. Especially for beginners, the more muscle that is
removed from the dorsal and lateral sides of the spine the easier
the laminectomy will be to perform.
27. A laminectomy is much easier to perform when the ventral half
of the spine is intact. An intact ventral portion of the spine
stabilizes the carcass during dissection.
28. Depending on comfort with this procedure and eyesight this
step may be done without a microscope. When performing
several of these dissections, rest breaks are advisable. It may
be helpful to visualize cutting the entire dorsal half of the bony
spinal canal off, leaving behind the intact spinal cord, DRG,
and nerves cradled in the ventral half of the spinal column. If
you imagine that the spinous processes (the most dorsal verte-
bral processes) are in the 12 o’clock position, the DRG are
located at about 4 and 8 o’clock on either side of the spine. At
the lumbosacral transition the spine curves ventral and the hips
can get in the way of your scissors. Go slowly and carefully,
from this point on in the caudal direction it is easy to lose DRG
as they are smaller and the dissection trickier. After passing this
little transition the finer Vannas spring scissors are better suited
for the laminectomy. This portion of the laminectomy is easiest
performed with the microscope.
29. The nerve fibers can be fairly elastic. If the fiber wraps up
around the DRG it may be difficult to untangle the DRG
from the fiber. Take care to avoid tangling nerve fibers. This
can be slightly exacerbated by the fact that even the fine forceps
may not provide a solid grip on the nerve tissue.
References
1. Tronstein E, Johnston C, Huang ML, Selke S, molecular reactivation of herpes simplex virus
Magaret A, Warren T, Corey L, Wald A (2011) type 1 latency in mice. Proc Natl Acad Sci U S
Genital shedding of herpes simplex virus A 99:978–983
among symptomatic and asymptomatic per- 4. Freeman ML, Sheridan BS, Bonneau RH,
sons with HSV-2 infection. JAMA Hendricks RL (2007) Psychological stress
305:1441–1449 compromises CD8+ T cell control of latent
2. Kask AS, Chen X, Marshak JO, Dong L, herpes simplex virus type 1 infections. J Immu-
Saracino M, Chen D, Jarrahian C, Kendall nol 179:322–328
MA, Koelle DM (2010) DNA vaccine delivery 5. Cliffe AR, Wilson AC (2017) Restarting lytic
by densely-packed and short microprojection gene transcription at the onset of herpes sim-
arrays to skin protects against vaginal HSV-2 plex virus reactivation. J Virol 91:e01419-16
challenge. Vaccine 28:7483–7491 6. Roy S, Coulon PG, Srivastava R, Vahed H, Kim
3. Feldman LT, Ellison AR, Voytek CC, Yang L, GJ, Walia SS, Yamada T, Fouladi MA, Ly VT,
Krause P, Margolis TP (2002) Spontaneous BenMohamed L (2018) Blockade of LAG-3
immune checkpoint combined with therapeu- 17. Sin JI, Kim JJ, Zhang D, Weiner DB (2001)
tic vaccination restore the function of tissue- Modulation of cellular responses by plasmid
resident anti-viral CD8(+) T cells and protect CD40L: CD40L plasmid vectors enhance
against recurrent ocular herpes simplex infec- antigen-specific helper T cell type 1 CD4+ T
tion and disease. Front Immunol 9:2922 cell-mediated protective immunity against her-
7. Johnston C, Koelle DM, Wald A (2011) pes simplex virus type 2 in vivo. Hum Gene
HSV-2: in pursuit of a vaccine. J Clin Invest Ther 12:1091–1102
121:4600–4609 18. Chen X, Kask AS, Crichton ML, McNeilly C,
8. Parr MB, Kepple L, McDermott MR, Drew Yukiko S, Dong L, Marshak JO, Jarrahian C,
MD, Bozzola JJ, Parr EL (1994) A mouse Fernando GJ, Chen D, Koelle DM, Kendall
model for studies of mucosal immunity to vag- MA (2010) Improved DNA vaccination by
inal infection by herpes simplex virus type skin-targeted delivery using dry-coated
2. Lab Invest 70:369–380 densely-packed microprojection arrays. J Con-
9. Linehan MM, Richman S, Krummenacher C, trol Release 148:327
Eisenberg RJ, Cohen GH, Iwasaki A (2004) In 19. Dutton JL, Woo WP, Chandra J, Xu Y, Li B,
vivo role of nectin-1 in entry of herpes simplex Finlayson N, Griffin P, Frazer IH (2016) An
virus type 1 (HSV-1) and HSV-2 through the escalating dose study to assess the safety, toler-
vaginal mucosa. J Virol 78:2530–2536 ability and immunogenicity of a Herpes Sim-
10. Cherpes TL, Busch JL, Sheridan BS, Harvey plex Virus DNA vaccine, COR-1. Hum Vaccin
SA, Hendricks RL (2008) Medroxyprogester- Immunother 12:3079–3088
one acetate inhibits CD8+ T cell viral-specific 20. Dutton JL, Li B, Woo W-P, Marshak JO, Xu Y,
effector function and induces herpes simplex Huang M-L, Dong L, Frazer IH, Koelle DM
virus type 1 reactivation. J Immunol (2013) A novel DNA vaccine technology con-
181:969–975 veying protection against a lethal herpes sim-
11. Lopez C (1975) Genetics of natural resistance plex challenge in mice. PLoS One 8:e76407
to herpes virus infections in mice. Nature 21. Dutton J, Li B, Woo W-P, Marshak K, Xu Y,
258:1352–1353 Huang ML, Dong L, Frazer I, Koelle D (2012)
12. St Leger AJ, Peters B, Sidney J, Sette A, Hen- Protection against viral challenge in a murine
dricks RL (2011) Defining the herpes simplex model of HSV-2 infection conferred by mixed
virus-specific CD8+ T cell repertoire in DNA vaccines. Presented at 37th International
C57BL/6 mice. J Immunol 186:3927–3933 Herpesvirus Workshop, 37th International
Herpesvirus Workshop, Calgary, Alberta,
13. Treat BR, Bidula SM, Ramachandran S, Canada, Abstract 6.52
St Leger AJ, Hendricks RL, Kinchington PR
(2017) Influence of an immunodominant 22. Liu W, Gao F, Zhao KN, Zhao W, Fernando
herpes simplex virus type 1 CD8+ T cell epi- GJ, Thomas R, Frazer IH (2002) Codon mod-
tope on the target hierarchy and function of ified human papillomavirus type 16 E7 DNA
subdominant CD8+ T cells. PLoS Pathog 13: vaccine enhances cytotoxic T-lymphocyte
e1006732 induction and anti-tumour activity. Virology
301:43–52
14. Gebhardt T, Whitney PG, Zaid A, Mackay LK,
Brooks AG, Heath WR, Carbone FR, Mueller 23. Sin J-I, Weiner DB (2000) Improving DNA
SN (2011) Different patterns of peripheral vaccines targeting viral infection. Intervirology
migration by memory CD4+ and CD8+ T 43:233–246
cells. Nature 477:216–219 24. Bagley KC, Schwartz JA, Andersen H, Eldridge
15. Muller WJ, Dong L, Vilalta A, Byrd B, Wilhelm JH, Xu R, Ota-Setlik A, Geltz JJ, Halford WP,
KM, McClurkan CL, Margalith M, Liu C, Fouts TR (2017) An interleukin 12 adjuvanted
Kaslow D, Sidney J, Sette A, Koelle DM herpes simplex virus 2 DNA vaccine is more
(2009) Herpes simplex virus type 2 tegument protective than a glycoprotein d subunit vac-
proteins contain subdominant T-cell epitopes cine in a high-dose murine challenge model.
detectable in BALB/c mice after DNA immu- Viral Immunol 30:178–195
nization and infection. J Gen Virol 25. Braun RP, Dong L, Jerome S, Herber R,
90:1153–1163 Roberts LK, Payne LG (2008) Multi-antigenic
16. Shlapobersky M, Marshak JO, Dong L, Huang DNA immunization using herpes simplex virus
ML, Wei Q, Chu A, Rolland A, Sullivan S, type 2 genomic fragments. Hum Vaccin
Koelle DM (2012) Vaxfectin-adjuvanted plas- 4:36–43
mid DNA vaccine improves protection and 26. Everett RD, Fenwick ML (1990) Comparative
immunogenicity in a murine model of genital DNA sequence analysis of the host shutoff
herpes infection. J Gen Virol 93:1305–1315 genes of different strains of herpes simplex
virus: type 2 strain HG52 encodes a truncated
UL41 product. J Gen Virol 71 36. Nakanishi Y, Lu B, Gerard C, Iwasaki A (2009)

(Pt 6):1387–1390 CD8(+) T lymphocyte mobilization to virus-
27. Dudek TE, Torres-Lopez E, Crumpacker C, infected tissue requires CD4(+) T-cell help.
Knipe DM (2011) Evidence for differences in Nature 462:510–513
immunologic and pathogenesis properties of 37. Halford WP, Puschel R, Gershburg E,
herpes simplex virus 2 strains from the United Wilber A, Gershburg S, Rakowski B (2011) A
States and South Africa. J Infect Dis live-attenuated HSV-2 ICP0 virus elicits 10 to
203:1434–1441 100 times greater protection against genital
28. Petro CD, Weinrick B, Khajoueinejad N, herpes than a glycoprotein D subunit vaccine.
Burn C, Sellers R, Jacobs WR Jr, Herold BC PLoS One 6:e17748
(2016) HSV-2 DeltagD elicits FcgammaR- 38. Magaret AS, Wald A, Huang ML, Selke S,
effector antibodies that protect against clinical Corey L (2007) Optimizing PCR positivity
isolates. JCI Insight 1:e88529 criterion for detection of herpes simplex virus
29. Renner DW, Szpara ML (2018) Impacts of DNA on skin and mucosa. J Clin Microbiol
genome-wide analyses on our understanding 45:1618–1620
of human herpesvirus diversity and evolution. 39. McClements WL, Armstrong ME, Keys RD,
J Virol 92:e00908-17 Liu MA (1996) Immunization with DNA vac-
30. Greninger AL, Roychoudhury P, Xie H, cines encoding glycoprotein D or
Casto A, Cent A, Pepper G, Koelle DM, glycoprotein B, alone or in combination,
Huang ML, Wald A, Johnston C, Jerome KR induces protective immunity in animal models
(2018) Ultrasensitive capture of human herpes of herpes simplex virus-2 disease. Proc Natl
simplex virus genomes directly from clinical Acad Sci U S A 93:11414–11420
samples reveals extraordinarily limited evolu- 40. Belshe RB, Leone PA, Bernstein DI, Wald A,
tion in cell culture. mSphere 3:e00283-18 Levin MJ, Stapleton JT, Gorfinkel I, Morrow
31. Casto AM, Roychoudhury P, Xie H, Selke S, RL, Ewell MG, Stokes-Riner A, Dubin G, Hei-
Perchetti GA, Wofford H, Huang ML, Verjans neman TC, Schulte JM, Deal CD (2012) Effi-
GMGM, Gottlieb GS, Wald A, Jerome KR, cacy results of a trial of a herpes simplex
Koelle DM, Johnston C, Greninger AL vaccine. N Engl J Med 366:34–43
(2019) Large, stable, contemporary interspe- 41. Cattamanchi A, Posavad CM, Wald A, Baine Y,
cies recombination events in circulating human Moses J, Higgins TJ, Ginsberg R, Ciccarelli R,
herpes simplex viruses. J Infect Dis. pii: jiz199. Corey L, Koelle DM (2008) Phase I study of a
doi: 10.1093/infdis/jiz199. [Epub ahead of herpes simplex virus type 2 (HSV-2) DNA vac-
print] PMID: 31016321 cine administered to healthy, HSV-2-seronega-
32. Johnston C, Magaret A, Roychoudhury P, Gre- tive adults by a needle-free injection system.
ninger AL, Reeves D, Schiffer J, Jerome KR, Clin Vaccine Immunol 15:1638–1643
Sather C, Diem K, Lingappa JR, Celum C, 42. Masopust D, Soerens AG (2019) Tissue-
Koelle DM, Wald A (2017) Dual-strain genital resident t cells and other resident leukocytes.
herpes simplex virus type 2 (HSV-2) infection Annu Rev Immunol 37:521
in the US, Peru, and 8 countries in sub-Saharan 43. Allan RS, Smith CM, Belz GT, van Lint AL,
Africa: a nested cross-sectional viral genotyping Wakim LM, Heath WR, Carbone FR (2003)
study. PLoS Med 14:e1002475 Epidermal viral immunity induced by CD8al-
33. Koelle DM, Norberg P, Fitzgibbon MP, Rus- pha+ dendritic cells but not by Langerhans
sell RM, Greninger AL, Huang ML, cells. Science 301:1925–1928
Stensland L, Jing L, Magaret AS, Diem K, 44. Shin H, Iwasaki A (2012) A vaccine strategy
Selke S, Xie H, Celum C, Lingappa JR, Jerome that protects against genital herpes by estab-
KR, Wald A, Johnston C (2017) Worldwide lishing local memory T cells. Nature
circulation of HSV-2 x HSV-1 recombinant 491:463–467
strains. Sci Rep 7:44084 45. Iijima N, Iwasaki A (2014) T cell memory. A
34. Burrel S, Boutolleau D, Ryu D, Agut H, local macrophage chemokine network sustains
Merkel K, Leendertz FH, Calvignac-Spencer protective tissue-resident memory CD4 T cells.
S (2017) Ancient recombination events Science 346:93–98
between human herpes simplex viruses. Mol 46. Srivastava R, Roy S, Coulon PA, Vahed H,
Biol Evol 34:1713–1721 Prakash S, Dhanushkodi N, Kim GJ, Fouladi
35. Stanberry LR, Kit S, Myers MG (1985) Thy- MA, Campo J, Teng AA, Liang X, Schaefer H,
midine kinase-deficient herpes simplex virus BenMohamed L (2019) Therapeutic mucosal
type 2 genital infection in guinea pigs. J Virol vaccination of HSV-2 infected guinea pigs with
55:322–328 the ribonucleotide reductase 2 (RR2) protein
boosts antiviral neutralizing antibodies and 51. Khanna KM, Bonneau RH, Kinchington PR,
tissue-resident CD4(+) and CD8(+) TRM Hendricks RL (2003) Herpes simplex virus-
cells associated with protection against recur- specific memory CD8(+) T cells are selectively
rent genital herpes. J Virol 93:e02309-18 activated and retained in latently infected sen-
47. Xia J, Veselenak RL, Gorder SR, Bourne N, sory Ganglia. Immunity 18:593–603
Milligan GN (2014) Virus-specific immune 52. Herbst-Kralovetz MM, Pyles RB (2006)
memory at peripheral sites of herpes simplex Quantification of poly(I:C)-mediated protec-
virus type 2 (HSV-2) infection in guinea pigs. tion against genital herpes simplex virus type
PLoS One 9:e114652 2 infection. J Virol 80:9988–9997
48. Milligan GN, Meador MG, Chu CF, Young 53. Strasser JE, Arnold RL, Pachuk C, Higgins TJ,
CG, Martin TL, Bourne N (2005) Long-term Bernstein DI (2000) Herpes simplex virus
presence of virus-specific plasma cells in sensory DNA vaccine efficacy: effect of glycoprotein D
ganglia and spinal cord following intravaginal plasmid constructs. J Infect Dis
inoculation of herpes simplex virus type 2. J 182:1304–1310
Virol 79:11537–11540 54. Koelle DM (2003) Expression cloning for the
49. Petro C, Gonzalez PA, Cheshenko N, Jandl T, discovery of viral antigens and epitopes recog-
Khajoueinejad N, Benard A, Sengupta M, Her- nized by T-cells. Methods 29:213–226
old BC, Jacobs WR (2015) Herpes simplex 55. Laing KJ, Dong L, Sidney J, Sette A, Koelle
type 2 virus deleted in glycoprotein D protects DM (2012) Immunology in the Clinic Review
against vaginal, skin and neural disease. Elife 4 Series; focus on host responses: T cell responses
50. Lekstrom-Himes JA, Pesnicak L, Straus SE to herpes simplex viruses. Clin Exp Immunol
(1998) The quantity of latent viral DNA corre- 167:47–58
lates with the relative rates at which herpes 56. Malin SA, Davis BM, Molliver DC (2007) Pro-
simplex virus types 1 and 2 cause recurrent duction of dissociated sensory neuron cultures
genital herpes outbreaks. J Virol and considerations for their use in studying
72:2760–2764 neuronal function and plasticity. Nat Protoc
2:152–160
INDEX
A F
Adjuvants .......................31–47, 112, 125, 430, 431, 435 Flat embedding ................. 353, 355, 356, 358–361, 363
Affinity purification .............................328, 329, 331, 390 Flow
Amplicon vector analysis ............................................................ 289–302
helpervirus-free ..................................... 112, 116, 128 cytometry
Animal models............................................... v, 21–23, 36, nano ................................................................... 290
43–45, 75, 194, 195, 220, 232, 263, 264, 434 sorting............................................................. 289–302
Antibody ..................................................... 24, 32–34, 36, virometry ........................................................ 289–302
37, 42–45, 47, 103, 116, 124–127, 161, 164, Fluorescence in situ hybridization (FISH)......... 185–195
165, 168, 189, 193–195, 220, 225, 226, 234, Freeze-substitution ............................................. 355, 356,
235, 238, 272, 308, 310–312, 320, 321, 358–361, 363
323–325, 356, 358, 361–363, 381, 412, 416,
430, 432–434, 436, 448 G
Antigens................................................18, 24, 33, 35, 37, galK recombineering ...................................131–150, 153
38, 40–47, 112, 116, 126, 127, 132, 161, 168, Gene
191, 195, 267, 272, 320, 321, 323, 430, 432, therapy .......................................................v, 73–88, 93
433, 448, 450
transfer .................................................................91, 92
Assay Genital ...................................................v, 3, 4, 31–33, 35,
in vivo ............................................................. 421, 430 38, 39, 42–44, 47, 200, 440, 443
Genome editing .................................. 131–150, 169–182
B
BioID .................................................................v, 327–340 H
Biotin ligase .......................................................... 328, 329 Herpes simplex virus (HSV)
Blot biology .......................................................v, 1–26, 132
dot................................................................... 319–325 glycoprotein
immuno .........................................112, 155, 322, 329
ectodomain ..............................378, 379, 387, 396
growth ................................................57–72, 355–363
C
latency ......................................... v, 18, 21, 24, 76, 77,
Clinical .......................................................3–5, 31–33, 39, 185–187, 220, 222, 232, 263–275, 429, 434
42–45, 80, 186, 199–215, 220, 242, 431–433, life cycle ..........................................................v, 1, 3, 4,
436, 438, 443, 447 75, 279, 280, 306, 351
Conformational changes..............................319–325, 395 reactivation ................................................ v, 4, 18, 21,
CRISPR/Cas9..............................................169–182, 337 22, 24, 34, 38, 39, 92, 186, 187, 226,
263–275, 429, 434
D recombinant
Deep sequencing .................................................. 201, 237 multi-fluorescent .......................................365–375
Differential centrifugation ............................................ 309 rescue ............................................. 132, 137, 153–168
type 1 ........................................................v, 1, 91–108,
DNA polymerase .......................................... 18, 161, 171,
176, 242, 244, 249–254, 257, 271 111, 241, 280, 292, 345, 365–375, 377–391
Herpesvirus................................................v, 1, 3, 5, 8, 16,
E 18, 21, 25, 32, 73, 327–340
Homology directed repair (HDR)............ 170, 175–178,
Escherichia coli 180–182
β-galactosidase ....................................... 222, 226, 236
vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2, © Springer Science+Business Media, LLC, part of Springer Nature 2020
455
HERPES SIMPLEX VIRUS : METHODS AND PROTOCOLS
456 Index
I O
Image processing......................................... 366, 367, 370 Oligonucleotide enrichment ............................... 199–215
Immuno Oncolytic virotherapy ................................................... 131
assay ...............................................194, 320, 322, 325 Oral ........................................................3, 4, 57, 127, 200
fluorescence ................................................... 112, 115,
121, 122, 126, 187–189, 193–195, 267, 272, P
289, 311, 320, 410 Polycistronic transgene cassette ..................................112,
histochemistry (IHC) .....................87, 234, 235, 237
119–121, 124, 125
labeling .......................................................... 195, 355, Polymerase chain reaction (PCR) .......................... 77, 84,
356, 358, 360–363 87, 133–135, 137, 139, 141, 143–146, 149,
Innate immunity ...............................23, 35–36, 132, 435
150, 156, 171, 200, 202, 205–211, 232, 244,
Interleukin 12 245, 249, 250, 255, 256, 258, 259, 339, 423,
mouse....................................................................... 137 425, 431, 433–436, 438, 443, 444, 446
In vitro system.................................................36, 74, 137, Promoter-reporter............................................... 220–223,
200, 232, 241, 264, 269, 328, 421
228, 232, 234–236
Protein
L
composition........................................... 285, 289, 327
Lentiviral delivery........................................ 264, 270, 272 crystallography ........................................................ 396
Low membrane .................................................6, 16, 20, 21
input.................................................................. 72, 150 purification ..................................................... 380, 397
pH ................................................................... 319, 320 Proteomics.............................. v, 279–287, 334, 337, 339
Lytic infections.................... 4, 19, 25, 75, 237, 238, 450
R
M
Resistance
Marker rescue ....................................................... 132, 133 genotypic ........................................................ 241–260
Mass spectroscopy ................................................ 327–340 phenotypic ...................................................... 241–260
Membrane RNA interference ................................................. 169, 264
fusion ............................. 3, 16, 20, 21, 320, 377, 378
nitrocellulose ................................. 156, 164, 320–324 S
Microfluidics................................................ 398, 409, 411 Selection marker..................................132, 133, 170, 179
Microscopy Swabs ................................................. 200, 212, 213, 236,
confocal laser scanning .................................. 115, 366
422, 424, 433, 438, 442, 443, 448, 449
live cell imaging............................. 365–367, 371, 372
transmission electron T
immuno .....................................................355–363
T cells ................................. 24, 32–45, 47, 264, 433, 434
N Thymidine kinase (TK)......................................... 4, 8, 19,
242, 249, 250, 252, 253, 424, 435
Neuron
Tissue culture ............................................. 58, 59, 62–65,
axon 67, 69, 70, 74, 81–83, 96, 97, 101–106, 108,
transport ........................... 75, 220, 345, 409–417 120, 122, 123, 128, 156–158, 172, 224, 227,
dorsal root ganglia (DRG) ............................. 33, 345,
232, 236, 282, 291, 300, 306, 307, 309, 311,
351, 352, 355–363, 411, 417, 429 312, 340, 345, 349, 366, 371, 399
growth cones .................................................. 345, 351 Transfection................................................ 81, 82, 92–94,
retinal ganglion cells ...................................... 419–427 101, 104, 107, 108, 114, 119–121, 128, 132,
sensory .....................................................3, 47, 57, 75,
153, 154, 156, 157, 166, 177–179, 181, 182,
219, 221, 264, 345, 355, 356, 409, 411, 420 227, 228, 236, 267, 273, 329, 331, 332, 433
trigeminal ganglion (TG) ..................... 185, 419, 426 Transgene expression ................. 132, 149, 155, 163–164
Nomenclature............................................ 5–15, 305, 440
HERPES SIMPLEX VIRUS : METHODS AND PROTOCOLS
Index 457
V entry.................................... 8, 42, 319–325, 343, 345
growth
Vaccine curve ....................................................... 62, 69, 70
development ................................ v, 5, 32, 33, 47, 430 plaque
DNA .................................................. 33, 46, 429–451 assay ....................................................... 61, 67, 69,
Varicella..................................................3, 32, 33, 73, 200 71, 160–162, 267, 272, 292, 302, 379, 433,
Vesicles 435
extracellular .................................................v, 305–315 purification .. 157, 158, 180, 182, 220, 221, 228,
micro ......................................................... 86, 305–315 230, 427
Viral titration .............................................61, 62, 67, 69
DNA ...............................................................v, 2, 3, 6, production ........................................... 76, 79, 85, 165
17–20, 75, 81, 84, 92, 161, 187, 194, 200, purification ......................................77, 80, 84, 87, 88
201, 205, 211, 214, 222, 227, 232, 236, recombinants ............................................... 33, 81–84,
243–245, 249, 259, 270, 273, 292, 300, 420, 88, 103, 107, 132, 133, 153, 156–161, 163,
422, 425, 426 165–167, 171, 177, 179–181, 266, 292, 365
entry ............................................................3, 322, 377 replication kinetics .................................................. 231
gene expression ................................... 17, 18, 22, 132 stock .......................................................58, 63–70, 82,
mutants ............................................17, 221, 222, 232 84–88, 103, 107, 126, 221, 228, 230, 232,
particles ......................................................75, 85, 160, 236, 266, 294, 295, 371
161, 166, 279, 284, 289–291, 293, 294, vectors ............................................................... 78, 105
296–301, 319, 352, 355 Virus-like particles (VLPs).................................. 111, 112,
Virion 115, 123–125, 129
purification ..................................................... 158, 282
Virus W
arming..................................... 22, 134, 139, 144, 177
engineering ....................... 73–88, 132, 133, 169–171 Whole tissue ........................................221, 225, 237, 238

Herpes Simplex Virus: Methods and Protocols

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Herpes Simplex Virus: Methods and Protocols

Uploaded by

Copyright:

Available Formats

Methods in

Molecular Biology 2060

For further volumes:

Methods and Protocols

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Sydney, NSW, Australia Russell J. Diefenbach

1 Tour de Herpes: Cycling Through the Life and Biology of HSV-1 . . . . . . . . . . . . 1

13 Phenotypic and Genotypic Testing of HSV-1 and HSV-2

26 A Model of In Vivo HSV-1 DNA Transport Using Murine

RAQUEL BELLO-MORALES Departamento de Biologı́a Molecular, Universidad Autonoma de

VALENTINA GATTA Department of Experimental, Diagnostic and Specialty Medicine,

JOSÉ ANTONIO LÓPEZ-GUERRERO Departamento de Biologı́a Molecular, Universidad

Tour de Herpes: Cycling Through the Life and Biology

Herpes simplex virus type 1 (HSV-1) is a prevalent and important

The Herpesviridae family within the order Herpesvirales includes a

see refs. 2, 3). The genomes of herpesviruses range in size from

is a relatively unstructured layer known as the tegument, which

3 The HSV-1 Life Cycle In Vivo

HSV-1 is carried by 45–90% of the population, with the higher

The most common clinical signs of HSV-1 infection are the

demands the development of new therapeutics. For recent reviews

5 The HSV-1 Replication Cycle in Cultured Cells

HSV-1 provides an excellent model for the study of herpesvirus

5.1 The HSV-1 HSV-1 has a double-stranded DNA genome of approximately

1 (TRM1) terminase subunit 1

duplicated and not distinguished by this annotation. Some genes

trigger fusion between the viral and cellular membranes. Once

It interacts with components of the cellular basal transcription

also encodes several proteins involved in nucleotide metabolism,

example, envelope protein gE requires binding of tegument pro-

6 Latent and Quiescent HSV-1 Infections

Latency is the hallmark of herpesvirus biology, enabling a viral

model of latent HSV-1 infection will support future research in this

7 Antiviral Defenses and Viral Countermeasures

This section provides an overview of the three major arms of

these cases the restriction can be overcome by high input doses of

Clinically, HSV-1 is an important human pathogen, widely preva-

and viral mechanisms to overcome the cellular response. The fol-

This work was funded by the UK Medical Research Council (to R.

silencing by the CoREST/REST/HDAC 97. Tavalai N, Stamminger T (2008) New insights

Vaccines for Herpes Simplex: Recent Progress Driven

different goals and different challenges. Prophylactic vaccines must

neutralizing antibody titers, whereas HSV2 neutralizing antibody

probably due to the following factors: (1) prevention of primary

2 Immune Control of HSV

that have defective NK cell activity have increased susceptibility to

neutralizing antibodies reduced transmission of virus from axons to

phenomenon has been observed in mice where the T cells control

3 Using Knowledge of Natural Immunity to Design a Vaccine

3.1 Prophylactic Prophylactic vaccines need to stimulate primary immune responses

restimulate already existing memory T cell responses through “sec-

Although these studies seem to indicate the importance of

protection against HSV2 intravaginal challenge than intramuscular,

3.4 Vaccine As discussed above, in contrast to live attenuated vaccines, vaccines

adjuvants that act as agonists of TLR3, TLR4, TLR7/8, and TLR9

such safety signals have been observed. Continuing postmarketing

Newer-generation vaccines aim to use adjuvants to advantageously

in rhesus macaques and highly efficacious in (Suppl 1):S22. https://doi.org/10.1093/

83. Nakanishi Y, Lu B, Gerard C et al (2009) 93. Milman N, Zhu J, Johnston C et al (2016) In

Herpes Simplex Virus Growth, Preparation, and Assay

to the infection of neighboring cells. Other virus strains can pass

2.2 Limiting Dilution 1. Incubator.

2.3 Preparation 1. Incubator.

RAQUEL BELLO-MORALES Departamento de Biologı́a Molecular, Universidad Autonoma de