Hayes 2019

Behaviour 156 (2019) 1–36 brill.
com/beh
Male group members are costly to plurally breeding

Octodon degus females
Loren D. Hayes a,∗ , Loreto A. Correa b,c , Sebastian Abades d ,

Cuilan L. Gao e and Luis A. Ebensperger b
a
Department of Biology, Geology, and Environmental Sciences, University of Tennessee at
Chattanooga, Chattanooga, TN 37403, USA
b
Departamento de Ecología, Facultad de Ciencias Biológicas, Pontificia Universidad
Católica de Chile, Santiago, Chile
c
Escuela de Medicina Veterinaria, Facultad de Ciencias. Universidad Mayor, Camino la
Pirámide 5750, Huechuraba, Santiago, Chile
d
GEMA Center for Genomics, Ecology & Environment, Universidad Mayor, Huechuraba,
Santiago, Chile
e
Department of Mathematics, University of Tennessee at Chattanooga, Chattanooga, TN
37403, USA
* Corresponding author’s e-mail address: loren-hayes@Utc.edu
Received 25 June 2018; initial decision 14 October 2018; revised 19 October 2018;
accepted 24 October 2018; published online 17 December 2018
Abstract
We report the results of a 6-year study of social (number of adult males/females, relatedness of
females, communal litter size) and ecological (mean/CV of food abundance, soil hardness, burrow
openings) factors influencing the direct fitness of plurally breeding degu (Octodon degus) females.
The best fit models for per capita offspring weaned and standardized variance in direct fitness
(within-group variation) included the number of adult males per group. Per capita number of
offspring weaned decreased and standardized variance in direct fitness increased with increasing
number of adult males per group. Thus, females experience a cost associated with males that is
not shared equally. Standardize variance in direct fitness decreased with increasing communal
litter size. All other factors were not significant predictors of direct fitness variation. Our study
suggests that plural breeding may not be as egalitarian as previously thought. Consequences of
plural breeding may be influenced by intra- and inter-sexual conflict.
Keywords
males, plural breeding, standardized variance, Octodon degus.
© Koninklijke Brill NV, Leiden, 2019 DOI 10.1163/1568539X-00003525
Downloaded from Brill.com11/12/2020 10:56:47AM

via San Francisco State University
2 Costly males in a plural breeder
1. Introduction
Plural breeding — a social strategy in which multiple same-sex individuals in
a group breed (Brown, 1978) — occurs in some birds (Vehrencamp & Quinn,
2004; Macedo, 2016; Rubenstein, 2016; Shen et al., 2016) and mammals
(Ebensperger et al., 2012; Lukas & Clutton-Brock, 2012; Silk & Kappeler,
2017; Smith et al., 2017). Among the plural breeders, there is considerable
diversity in the social organization and extent of communal offspring care
(Kappeler & van Schaik, 2002; Vehrencamp & Quinn, 2004; Silk, 2007).
Group size and composition vary widely, ranging from large and complex
social groups consisting of breeders and non-breeders to relatively small
groups of breeding adults (Nutt, 2007; Shen et al., 2012). Kin composition
also varies among plural breeders, with some species associating closely
with kin and others with non-kin or a mixture of kin and non-kin (Lukas &
Clutton-Brock, 2011; Riehl, 2013). Communal care of offspring is observed
in some plural breeders but not others (Silk, 2007). Given this diversity,
an important question is ‘How does the size and composition of groups
influence direct fitness of plurally breeding females?’
The relationship between group size and reproductive success varies con-
siderably in plural breeders (Ebensperger et al., 2012; Rubenstein et al.,
2016). In mammals, neutral and negative covariation is common in plural
breeders with and without communal care of offspring, though relationships
are also sensitive to the fitness metric reported (Ebensperger et al., 2012).
Rubenstein et al. (2016) reported that the proportion of females within a
group that breed increases with increasing number of adult females per group
in plurally breeding birds, but not in plurally breeding mammals. Based on
these observations, it seems that the association between group size and di-
rect fitness among plural breeders is taxon-specific. Other social factors, such
as the age, sex, relatedness, and dominance status of adult group members
(Kappeler & van Schaik, 2002) and age of offspring in communal litters
(Mennella et al., 1990; Hodge et al. 2009) may have a greater impact on di-
rect fitness than group size per se (Silk 2007). To advance our understanding
of the adaptive significance of plural breeding, it is critical that we examine
how group composition influences the direct fitness of plural breeders.
Unfavorable breeding conditions caused by variable or low mean rainfall
can influence the availability or predictability of critical resources such as
food or places to rear offspring (Ebensperger et al. 2014). Under these harsh

L.D. Hayes et al. / Behaviour 156 (2019) 1–36 3
conditions, cooperation could enhance reproductive success of plural breed-

ers (Rubenstein, 2011; Shen et al., 2012; Ebensperger et al., 2014) either by
reducing energetic costs on individual breeders and/or increasing total care
of offspring. Testing this hypothesis is challenging because the extent of eco-
logical harshness may depend on the mean or variance (or unpredictability)
in conditions (Ebensperger et al., 2014). The extent to which direct repro-
duction is influenced by harsh ecological conditions may also depend on
species- or population-specific life histories (Gonzalez et al., 2013; Lukas &
Clutton-Brock, 2017). In iteroparous birds, cooperative care by non-breeders
reduces lifetime variance in breeder fecundity when predictability of rainfall
is low (Rubenstein, 2011; Koenig & Walters, 2015). There is also evidence
that cooperation is most beneficial when ‘average’ or mean conditions are
unfavorable in plural breeders with iteroparous (Shen et al., 2012) and ef-
fectively semelparous (Ebensperger et al., 2014) breeding strategies. Thus,
both mean and variable ecological conditions need to be considered when
determining how ecology shapes the reproductive consequences of plural
breeding. We expect that mean ecological conditions experienced during
breeding play a greater role compared with variance in ecological condi-
tions in species in which breeding is restricted mostly to a single main event
over lifetime. Compared with longer lived social species, the fitness conse-
quences of group-living and cooperation in mostly semelparous species are
rarely reported.
The aim of this study was to determine how social organization, commu-
nal litter size, and local ecological conditions influence the direct fitness of
females in a plural breeder that is effectively semelparous. Since sociality-
direct fitness relationships often vary based on the fitness metric reported
(Ebensperger et al., 2012; Koenig & Walters, 2015), we quantified two esti-
mates of direct fitness: per capita offspring weaned by females and the stan-
dardized variance in direct fitness of females in the same groups. Per capita
offspring weaned provides an estimate of the average reproductive success
of plurally breeding females. Direct fitness may not be shared equally by
plurally breeding females. In some species, the proportion of females that do
not breed can exceed 50% (Rubenstein et al. 2016) and successful breeders
in the same group can experience substantial differences in individual di-
rect fitness (de Luca & Ginsberg 2001; Packer et al. 2001). In species with
high mortality and low reproductive output, such differences could have sig-
nificant evolutionary consequences. Determining the social and ecological

conditions underlying variation in direct fitness among breeding females in

the same social group, and not just the proportion of females that breed,
is critical to understanding the evolutionary significance of plural breeding.
Thus, we also estimated the standardized variance in direct fitness (variance
in direct fitness of adult females in a group/mean in direct fitness of adult
female group members2 ), an index of the extent to which the number of off-
spring weaned by females differs between females within plurally breeding
groups (Rubenstein, 2011).
1.1. Study organism
We report observations from a 6-year study of a naturally occurring popula-
tion of degus (Octodon degus), a plurally breeding rodent endemic to Chile.
In this population, degu females rarely breed more than once per breeding
season despite high mortality (>95% of females do not survive to a second
breeding season) (Ebensperger et al., 2013). This life history makes degus
unique from most other plural breeders that have been the subject of investi-
gation. Most adult females (>95%) become pregnant and produce viable off-
spring (Ebensperger et al., 2014), distinguishing degus from plural breeders
in which groups consist of a mixture of breeders and non-breeding helpers
(Rubenstein, 2016). Frequently (63%, N = 203 social units, Ebensperger,
L.A. & Hayes, L.D., unpublished data), offspring are reared in multi-female
groups of varying size (2–8 adults; Hayes et al., 2009) and kin composition
(Quirici et al., 2011a; Davis et al., 2016). Females indiscriminately care for
and nurse offspring from communal litters (Ebensperger et al., 2002, 2007).
Competition among adult males and females, including infanticide, is un-
common (Ebensperger, 2001b; Ebensperger & Hurtado, 2005). Across all
social units, the per capita number of offspring weaned is sensitive to the size,
composition, and stability of groups (Ebensperger et al., 2016a; Ebensperger
et al., data not shown). We do not know how the number of adults per group
influences within-group variation in direct fitness or if variation in communal
litter size influences per capita and within-group variation in direct fitness.
Degu groups occupy multiple underground burrow systems. The abun-
dance of food, number of burrow openings, and soil hardness differs between
burrow systems used by different groups and can be spatially variable among
the burrow systems used by members of the same group (Ebensperger et al.,
2014, 2016a). Low abundance of food at burrow systems reduces survival,
fertility, and reproductive success of degu females (Hayes et al., 2009). Pre-
vious observations that the per capita number of offspring weaned (based

on overlap of adults and offspring at common burrow systems) increases

with increasing number of adult females under conditions of low mean food
(Ebensperger et al., 2014) suggest that plural breeding with communal care
improves (or compensates) reproductive success under conditions that are
challenging for reproduction (Hayes & Solomon, 2004).
1.2. Hypotheses
We tested five hypotheses for how social conditions influence the the di-
rect fitness of females in multi-female groups (Table 1). (1) Communal care
of offspring could result in equitable benefits to plurally breeding females
(Packer et al., 2001; Rubenstein et al., 2016). If so, we predict per capita
number of offspring weaned to increase and standardized variance in direct
fitness to decrease with increasing number of adult females per group (Pre-
dictions 1 and 2, Table 1; Nutt, 2007). (2) Cooperation among close relatives
is expected due to the potential direct and indirect benefits of improving
the reproductive success of close relatives (Hamilton, 1964; Clutton-Brock,
2002; Taborsky et al., 2016). If high kinship among breeding females facil-
itates kin-directed benefits of cooperation, then we predict that per capita
number of offspring weaned increases and standardized variance in direct
fitness of females decreases with increasing relatedness of adult females in a
group (Predictions 3 and 4, Table 1). (3) Multiple mating with adult or sub-
ordinate males enhances direct fitness in degus (based on all of social units;
Ebensperger et al., submitted) and alpine marmots (Marmota marmota; Co-
has et al., 2007). If there are benefits of multiple mating in plurally breeding
groups, then we predict that per capita number of offspring weaned increases
with increasing number of adult males per group (Prediction 5, Table 1).
(4) Males may be costly to females if they are aggressive towards females
(Nguyen et al., 2009), physical harm non-descendent offspring (Packer &
Pusey, 1983; Ebensperger, 1998) or disrupt social interactions between fe-
males, reducing group membership stability and direct fitness of females
(Ebensperger et al., 2016a). Males may also transfer harmful parasites to fe-
males and to their litters (Longdon & Jiggins, 2010). Under the costly males
hypothesis, we predict per capita number of offspring weaned decreases
and standardized variance in direct fitness of females increases within in-
creasing number of adult males per group (Predictions 6 and 7, Table 1).
(5) Competition among offspring over maternal care is expected to inten-
sify in large communal litters (Hodge et al., 2009) with offspring of different

Table 1.
Hypotheses for plural breeding, predictions and outcomes.
Hypothesis and predictions Model set Support
Equitable benefits
1. PCOW increases with increasing number of adult females 1 No
per group
2. STANDVAR decreases with increasing number of breeding 2 No
females per group
Kin directed benefits
3. PCOW increases with increasing relatedness of females 1 No
4. STANDVAR decreases with increasing relatedness of 2 No
females
Benefits of multiple mating
5. PCOW increases with increasing number of adult males per 1 No
group
Costly males
6. PCOW decreases with increasing number of adult males per 1 Yes
group
7. STANDVAR increases with increasing number of adult 2 Yes
males per group
Competition among offspring
8. STANDVAR increases with increasing communal litter size Correlation No
Equitable benefits under low food conditions
9. PCOW increases within increasing number of females per 1 No
group and when mean food abundance is low
10. STANDVAR decreases within increasing number of females 2 No
per group and when mean food abundance is low
Anti-predator benefits
11. PCOW increases and STANDVAR decreases with increasing 1, 2 No
mean number of burrow openings across burrow systems
used by group
12. PCOW decreases and STANDVAR increases with increasing 1, 2 No
CV in the number of burrow openings across burrow systems
used by group
Decreased costs of burrow construction and maintenance
13. PCOW increases with increasing number of adult females 1 No
and adult males per group and when soil hardness is the
greatest and most variable
14. STANDVAR decreases with increasing number of adult 2 No
females and adult males per group and when soil hardness is
greatest or most variable
Key: PCOW = Per capita number of offspring weaned, STANDVAR = standardized

variance in direct fitness, CV = coefficient of variation.

ages (Mennella et al., 1990), an effect recorded in laboratory reared degus

(Ebensperger et al. 2007). Under these conditions, younger or weaker off-
spring would have less access to maternal care or be trampled over by larger
offspring (Mennella et al., 1990), resulting in increased within-group varia-
tion in offspring survival to weaning. Under this hypothesis, we predict that
standardized variance in direct fitness increases with increasing communal
litter size (Prediction 8, Table 1).
We tested three hypotheses for how ecological conditions at burrow sys-
tems influence the direct fitness of plurally breeding females. (6) Based
on previous observations of benefits under low mean food conditions
(Ebensperger et al., 2014), plural breeding should provide equitable benefits
females under low food conditions. If so, we predict that per capita number
of offspring weaned increases and standardized variance in direct fitness de-
creases with increasing number of adult females per group, but only when
mean food abundance at burrow systems is low (Predictions 9 and 10, Ta-
ble 1). (7) Degu offspring are vulnerable to terrestrial and aerial predators at
the time they emerge from burrow systems. The potential anti-predator ben-
efits of plural breeding (Ebensperger, 2001a; Ebensperger & Wallem, 2002)
to offspring may depend on the total number of burrow entrances (places
to escape predators; Kinlaw, 1999) at burrow systems and distance of for-
aging patches to burrow entrances (Lagos et al., 2009). We predict that per
capita number of offspring weaned increases and standardized variance in
direct fitness decreases with increasing mean number of burrow openings
across burrow systems used by groups (Prediction 11, Table 1). We also
predict per capita number of offspring weaned decreases and standardized
variance increases with increasing coefficient of variation (an indicator of
predictability) in the number of burrow openings across the burrow systems
used by groups (Prediction 12, Table 1). (8) The energetic costs of digging
new burrows or maintaining existing underground burrows may influence
reproductive success. Digging costs depend on a number of factors includ-
ing soil hardness, and the depth, slope, and complexity of burrows (Kinlaw,
1999; Taraborelli, 2009). In degus, soft soils require less energy to move than
hard soils (Ebensperger & Bozinovic, 2000a). Degus that coordinate digging
with other group members remove more soil per capita than solitary degus
(Ebensperger & Bozinovic, 2000b). If plural breeding results in decreased
costs of burrow construction and maintenance, we predict greater per capita

number of offspring weaned and lower standardized variance in direct fit-

ness with increasing number of adult females and adults males per group
and when soil hardness is the greatest or most variable (Predictions 13 and
14, Table 1).
2. Methods
2.1. Study site
The study was conducted during the austral winter-spring transition (August–
October) in an approx. 2 ha area at the Estación Experimental Rinconada de
Maipú (33°23 S, 70°31 W), a field station of Universidad de Chile. Rin-
conada is characterized by a Mediterranean climate with cold, wet winters
and warm, dry summers and high inter-annual variation in within-year rain-
fall (Ebensperger et al., 2014). The site consisted of open areas with scattered
shrubs (Proustia pungens, Acacia caven and Baccharis spp.) that on average
covered 14.5% of ground (Ebensperger & Hurtado, 2005).
2.2. Social group determination
To determine social group membership, we used a combination of night-time
telemetry and early morning burrow trapping following Hayes et al. (2009)
and Ebensperger et al. (2016). A burrow system was defined as a group of
burrow openings surrounding a central location where individuals were re-
peatedly found during nighttime telemetry. Associations were determined
using the “simple ratio” association index, i.e., the number of times that two
individuals are captured or tracked via telemetry at the same burrow system
on the same day divided by the total number of times each is captured/tracked
on the same day regardless of burrow system. Social groups were determined
using a hierarchical cluster analysis in SOCPROG 2.0 software (Whitehead,
2009). Only associations with a value greater than 0.1 (i.e., 10% overlap of
trapping/telemetry locations) were initially considered to be part of the same
social group (Hayes et al., 2009). Details of our trapping and telemetry meth-
ods are reported in Ebensperger et al. (2014). We observed 45 multi-female
groups (2009: N = 9; 2011: N = 6; 2012: N = 3; 2013: N = 12; 2014:
N = 6; 2015: N = 9) during the austral-winter spring transition, the period
when degu females are pregnant and lactating. No multi-female groups were
observed in 2010. Degus in this population have been individually marked
since 2005.

All procedures for handling live animals were approved by the Univer-
sity of Tennessee at Chattanooga Animal Care and Use Committee and
by the Faculty of Biological Sciences at Ponificia Universidad Católica de
Chile (DFCB-021-2008 and CBB-229/2012), under Chilean permits issued
by the Servicio Agrícola y Ganadero (1-109/2008 (3542), 1-31/2009 (1956),
2826/2013 and 1-49/2010 (2332).
2.3. Ecological sampling
For all adults, we quantified the mean ecological conditions at burrow sys-
tems at which individuals were captured (food availability, soil hardness and
number of burrow openings at burrow systems; Ebensperger et al., 2014).
These ecological values were weighted by the number of times individu-
als were captured at burrow systems (Ebensperger et al., 2014), reducing
the effect of potential outliers on these estimates. From this information, we
calculated the mean and coefficient of variation (CV) food abundance, soil
hardness, and number of burrow openings for burrow systems for all groups.
Details of sampling procedures are reported in Ebensperger et al. (2014).
2.4. Genetic analyses
A small tissue sample was taken from each individual’s ear the first time it
was captured and stored in 99% ethanol at 5–6°C until analysis. We used
DNA microsatellite loci to quantify the number of offspring weaned by fe-
male group members (Tables A1 and A2 in the Appendix). Degus typically
breed annually, and only occasionally twice within a same year (Ebensperger
et al., 2013). DNA was extracted from a small piece (1 × 5 mm) of one
ear cartilage tissue per individual, using the Reliaprep DNA animal tissue
miniprep system kit (Promega) and the tail mouse protocol. DNA was eluted
in 200 μl of free nuclease water and stored al −20°C. Individuals were
genotyped using 9 degu microsatellite loci (OCDE1, 2, OCDE5, 7, 9–12,
14; Quan et al., 2009) and one primer from Spalacopus cyanus (SCY3;
Schroeder et al., 2000). These loci were amplified via polymerase chain
reaction (PCR) containing only one marker labeled with a fluorescent dye
(FAM, VIC, NED or PET). Details of our PCR procedures are reported in
Ebensperger et al. (2016).
The number of alleles per locus of the microsatellite loci used ranged from
7 to 19 (mean = 11.6, Ebensperger, L.A. & Correa, L., own data). Genotypes
for all individulas across years were complete with no missing data. We

tested the Hardy–Weinberg observed and expected heterozygosities for each

study year with the use of CERVUS 3.0 software (Kalinowski et al. 2007).
Deviations from Hardy–Weinberg (HW) expectations were detected in 5 out
of 6 years (Table A3 in the Appendix). This finding was not surprising for
us because our population is finite, open, non-panmitic and with moderated
level of genetic relatedness. This situation contrasted with the assumptions
of the theoretical and ideal population of HW. All markers were checked for
null alleles with Microchecker software (van Oosterhout et al., 2004). Thus,
observed HW deviations, were not the consequence of null allele presence.
Prior to conducting maternity analyses, we used the GERUD 2.0 software
(Jones, 2005) to quantify the probability of excluding potential mothers for
each locus, and for all loci combined. The ten loci selected had a combined
exclusion probability of 99.96% for all study years when neither parent was
previously known.
The pairwise coefficient of relatedness (R) among females within groups
was calculated using the ML-Relate software (Kalinowski et al., 2006). Es-
timations of pairwise relatedness were adjusted to account for potential null
alleles using the ML-Relate software (Quirici et al., 2011a). From this infor-
mation, the mean relatedness of adult females (R fem ) was determined for all
social groups (Davis et al., 2016).
We used CERVUS 3.0 (Kalinowski et al., 2007) to conduct maternity
analyses in which all offspring were checked against all potential mothers
in the population. This is an appropriate approach for degus because off-
spring are precocial and tend to move among burrow systems shortly after
weaning and breeding females communally rear their offspring (Ebensperger
et al., 2004). Confidence calculation on CERVUS 3.0 was made using the
LOD score option. The settings of the simulation file were based on allele
frequency data from the entire population, 10 000 cycles, and a genotyping
error rate of 1%. The proportion of the population that was sampled was set
to 0.9. Maternity assignment analyses were made using strict (95%) level of
statistical confidence (Kalinowski et al., 2007). We set the program to de-
termine the most likely mother. We accepted the most likely mother as real
mother only when the following conditions were met: (1) the LOD score for
the pair mother-offspring tested was positive, (2) the mother-offspring pair
confidence was significant and (3) there were no mismatches. We had sev-
eral cases in which criteria 1 and 2 were met, but the offspring-mother pair
exhibited 1 mismatch. We reviewed these genotype pairs to determine which

loci were involved. Whenever these cases of single mismatches affected two
repeat motif loci and involved contiguous alleles (i.e., separated by two base
pairs) we accepted these offspring-mother pair as correct. Fragment analy-
sis in Genemapper takes into account two pair bases errors (Duchesne et al.,
2005). Instead, single mismatches between offspring-mother found in a four
repeat motif loci or that involved noncontiguous alleles in two repeat motif
loci were discarded. Based on the fact that our degu population exhibits a
relatively high level of genetic relatedness (Ebensperger et al., 2004; Quirici
et al., 2011a), all maternity and paternity assignments with two or more mis-
matches were discarded (Li et al., 2009; Jones et al., 2010).
2.5. Direct fitness metrics
Communal litter size, the total number of offspring produced by adult fe-
males in a group, was determined by maternity analyses. Per capita number
of offspring weaned by females was determined by dividing communal lit-
ter size by the total number of adult females per group. The standardized
variance in direct fitness (variance in direct fitness of adult females in a
group/mean in direct fitness of adult female group members2 ; Rubenstein,
2011) was used as an index of variation in direct fitness among females
within the same multi-female groups. Standardized variance has been used to
quantify direct fitness variation within groups of other communally breeding
vertebrates (Packer et al., 1991; Rubenstein, 2011).
2.6. Statistical analyses
Per capita offspring weaned (model 1) and standardized variance in direct
fitness (model 2) were analyzed to evaluate the influence of social environ-
ment and ecological conditions at burrow systems. Thus, models 1 and 2
were used to test predictions of the equitable benefits of plural breeding,
kin directed benefits, benefits of multiple mating, costly males, benefits of
plural breeding under low food conditions, predation risk, and costs of bur-
row construction and maintenance hypotheses (Table 1). Predictors of both
models included effects of the number of adult females per group, number
of adult males per group, mean relatedness of females in the same group
(R fem ), mean and coefficient of variation (CV) of food availability at burrow
systems, mean and CV of soil hardness at burrow systems, and mean and
CV of number of burrow openings at burrow systems. Based on previous
observations that the relationship between per capita offspring weaned and

number of adult females per group covaries (Ebensperger et al., 2014), we

also included the interaction between the number of adult females per group
and mean food abundance in both models. Communal litter size is highly
correlated with the number of adult females and number of adult males per
group and thus, was not included as a predictor variable. We used Pearson’s
correlation to test the competition among offspring hypothesis (Table 1).
Estimation and hypothesis testing of the parameters of both models were
done using a model selection procedure based on the second-order biased-
corrected Akaike information criterion (AICc). We first checked whether a
random intercept and slope component was required to account for potential
changes in the functional relationship between each predictor and the re-
sponse variable across years. Nine models were thus specified and compared
using AIC values. Following Zuur et al. (2009) we performed the random
component selection first, starting with a full specification of predictors on
the fixed part of the model, and then moved on to do selection on this latter
component.
Selection of the fixed component was done using the best subset model
selection approach (Miller, 2002). This routine builds a set of alternative
models using combinations of predictors, fits them all, and rank them ac-
cording to AICc. We used a AICc > 2 to discard models of low quality
(Burnham & Anderson, 2002; Burnham et al., 2011). Following a parsimony
criterion, if two or more models showed a AICc < 2, we selected the sim-
plest one as the best model assisted by Akaike’s weight (ω) and evidence
ratios (ωi /ωi+1 ). Akaike’s weights revealed the likelihood that a model was
the best among the set of candidate models within a model set. In best-fit
models, statistical significance was inferred when p < 0.05.
Per capita number of offspring weaned met the conditions of normality
and linearity assumptions, therefore, best subset selection was applied on
a linear model with gaussian response. Neither the standardized variance
in direct fitness nor communal litter size met the normality and linearity
assumptions of ordinal linear regression models. Thus, generalized linear
regression models (GLMs) with a log link function was used in models 2
and 3.
Outliers were checked by both graphical ways (dot chart plot and com-
parison of residuals before) and after removing extreme data points. Multi-
collinearity was investigated using both pairwise Pearson’s correlation ma-
trix and Variance of Inflation (VIF).

Table 2.
Best subset model selection for the fixed part of model 1 (per capita offspring weaned).
No. females No. males Mean Mean no. logLik AICc Delta ω
per group per group food burrow
abundance openings
−0.49 −0.60 – – −71.95 152.96 0.00 0.33

– −0.44 – – −73.72 154.05 1.09 0.19
−0.51 −0.59 0.00 – −71.22 154.05 1.09 0.19
– – – – −75.00 154.29 1.33 0.17
−0.45 −0.62 – −2.49 −71.58 154.78 1.82 0.13
Analyses were conducted using the statistical software R 3.3.0 (R Devel-

opment Core Team, 2016) and library MuMIn (Barton, 2009). The best-fit
models are summarized in Tables 2 and 3 and all the candidate models are
given in Tables A4 and A5 (Appendix).
3. Results
3.1. Descriptive data
Multi-female groups (N = 45) included a mean of 2.6 ± 0.1 (range 2–5)
adult females and a mean of 0.88 ± 0.12 (range 0–3) adult males. The mean
relatedness of females within groups (R fem ) was 0.28 ± 0.03 (range 0.00–
0.65). Across groups, communal litters consisted of 11.9 ± 0.7 offspring
(range 3–27) and females weaned 4.7 ± 0.2 (range 1.5–9.0) offspring per
capita. Only one lactating female in 2009 failed to wean offspring. Across
groups, mean standardized variance in direct fitness of females was 0.24 ±
Table 3.
Beta coefficients for best selected model explaining per
capita offspring weaned (No. of observations = 43).
RV
B SE p
Intercept 6.43 0.83 <0.001

FGS −0.49 0.26 0.072
MGS −0.60 0.28 0.041
R 2 /adj. R 2 0.132/0.089

0.05 (range 0.00–1.44). Across years, mean food abundance was 125.6 ±
10.3 g/m2 (range 22.2–385.8), mean soil hardness was 2888 ± 29 kPa (range
2289–3119 kPa), and mean number of burrow openings was 0.16 ± 0.01
burrows/m2 (range 0.05–0.39) at burrow systems used by groups.
3.2. Model set 1: ecological and social factors influencing per capita
offspring weaned
The model without the random effect of year (ω = 0.82) was more parsimi-
nous than the model with the random effect of year (ω = 0.18) (Table A6
in the Appendix). Thus, the subsequent analysis did not include this random
effect to account for potential non-independence of the response variable
due to a grouping effect of year. The model with the greatest probability of
explaining variation in per capita offspring weaned included the number of
adult females and number of adult males per group (model 1: ω = 0.33; Ta-
ble 2). The evidence ratio of the best and second best models (ω1 /ω2 ) was
1.74, meaning that this model was 1.74 times likely to explain the data than
the next best candidate model in the model set. The number of adult females
and number of adult males were included in 3/5 and 4/5 of the top best-fit
models, suggesting that the model was robust. There was a negative, but not
statistically significant, relationship between per capita offspring weaned and
the number of adult females per group (β = −0.49, p = 0.07; Figure 1a, Ta-
ble 3). There was a statistically significant negative relationship between per
capita offspring weaned and number of adult males per group (β = −0.60,
p = 0.04; Figure 1b, Table 3). The best fit model was overall significant
(Analysis of Deviance: F2,40 = 10.88, p = 0.047).
3.3. Model set 2: ecological and social factors influencing standardized
variance of direct fitness
The model without the random effect of year (ω = 0.87) was more parsimi-
nous than the model without the random effect of year (ω = 0.13; Table A7
in the Appendix). Thus, the subsequent analysis did not included this random
effect, discarding any potential non-independence of the response variable
due to a grouping effect of year. The model with the greatest probability
of explaining standardized variance in direct fitness included the number of
adult males per group and mean burrow openings at burrow systems used
by groups (model 1: ω = 0.27; Table 4). The number of adult males per
group was included in all five of the top five models (Table 4). The standard-
ized variance in direct fitness increased significantly with increasing number

Figure 1. (a) Negative, but not statistically significant trend between per capita offspring
weaned (PCOW) and number of adult females per group. (b) Statistically significant nega-
tive association between the number of adult males per group. Dark circles represent social
groups.
of males per group (β = 0.13, p = 0.049; Figure 2a, Table 5) but did not
significantly associate with the mean number of burrow openings at burrow
systems used by groups (β = −1.12, p = 0.11, Table 5). The best fit model
was overall significant (Analysis of Deviance: F2,36 = 0.18, p = 0.03).
Post hoc, we compared standardized variance in direct fitness between
groups with and without males. The mean standardized variance in direct
fitness was approximately 3 times greater in groups with one or more males
than in groups without males (Figure 2b), though not in a stastistically sig-
nificant manner (Mann–Whitney U : H = 166, p = 0.34). Across groups,
variability in the standardized variance in direct fitness was greater in groups

Table 4.
Best subset model selection for the fixed part of model 2 (standardized variance in direct
fitness).
No. males Mean no. burrow Mean soil R fem logLik AICc Delta ω
per group openings hardness
0.13 −1.12 – – −8.99 27.04 0.00 0.27

0.14 – – – −10.41 27.44 0.40 0.22
0.14 – 0.00 – −9.54 28.14 1.09 0.15
0.12 −1.07 – −0.27 −8.44 28.49 1.45 0.13
0.14 – – −0.30 −9.76 28.58 1.54 0.12
Figure 2. (a) Statistically significant positive association between the standardized variance
in direct fitness of females and the number of adult males per group. Dark circles represent
values for multi-female groups. (b) Mean (SEM) standardized variance in direct fitness of
females in groups with and without males.

Table 5.
Beta coefficients for best selected model explaining standard-
ized variance in direct fitness (No. of observations = 43).
SD
B SE p
Intercept 0.32 0.14 0.026

MGS 0.13 0.06 0.049
Mean.openings_burrow −1.12 0.68 0.106
R 2 /adj. R 2 0.163/0.121
with one or more males than in groups without males (Figure 2b; F -test:
F42.33 < 0.001).
3.4. How communal litter sizes influence direct fitness
Per capita offspring weaned increased with increasing communal litter size
(Pearson’s r = 0.63, p < 0.0001). We determined how variable standardized
variances in direct fitness were across groups. The standardized variance
in direct fitness of females decreased with increasing communal litter size
(Pearson’s r = −0.34; p = 0.02; Figure 3).
4. Discussion
The per capita number of offspring weaned decreased and the standardized
variance in direct fitness of females increased with increasing number of
Figure 3. Statistically significant negative association between standardized variance in direct

fitness and communal litter size. Dark circles represent values for multi-female groups.

males per group. Contrary to expectations, standardized variance in direct

fitness decreased with increasing communal litter size. Neither per capita
offspring weaned nor standardized variance associated with any of our eco-
logical variables. Altogether, these results lend the greatest support to the
‘costly males’ hypothesis (Table 1). Our study did not support the ‘equi-
table benefits’, ‘benefits of multiple mating’, ‘kin directed benefits’, ‘com-
petition among offspring’, ‘equitable benefits under low food conditions’,
‘anti-predator benefits’, and ‘decreased costs of burrow construction and
maintenance’ hypotheses (Table 1).
4.1. Costly males
Inter-sexual conflict over reproduction could result in in sex-specific pref-
erences of social organization (Pradhan & van Schaik, 2008) and group
membership (Ebensperger et al., 2016a). Sex-specific group size and direct
fitness optima have been observed in social mammals (Lardy et al., 2015),
including degus (Ebensperger et al., 2016a). From the female degu perspec-
tive, socially stable conditions may favor maximum direct reproduction, the
key to success in a species with a short lifetime and only a few opportunities
to breed (Ebensperger et al., 2013). In degus, female-female conflict is low
(Soto-Gamboa et al., 2005) and per capita offspring weaned (based on spatial
overlap) is negatively associated with increasing potential for conflict among
females (Wey et al., 2013). Females benefit the most from living in groups
with increasing number of adult females (or potential communal care-givers;
Ebensperger et al., 2014) with high female and male membership stability
(Ebensperger et al., 2016a). In contrast, male degus benefit from groups with
increasing number of females but under low female and male membership
stability (Ebensperger et al., 2016a). An interesting implication of these pat-
terns is that social interests of females and males differ over immigration or
emigration of group members during breeding time.
Infanticide by males is commonly observed in numerous group-living an-
imals (Packer & Pusey, 1983; Ebensperger, 1998; Palombit, 2015; Jindal et
al., 2017). Males may commit infanticide to induce ovulation by females
after taking over a harem (Packer & Pusey, 1983) or to gain access to addi-
tional resources (Palombit, 2015). Several lines of evidence suggest that this
explanation is unlikely in degus. Male degus do not commit infanticide in
the laboratory (Ebensperger et al., 2001); rather, they provide some parental
care to communal litters (Ebensperger et al., 2010). Moreover, high levels

of multiple mating and mixed paternity of litters observed in our population

(Ebensperger et al., submitted) likely cause confusion over paternity, greatly
reducing the benefits and increasing the costs of infanticide to males.
Males could harass females with whom they have mated (Kaseda et al.,
1995; Linklater et al., 1999), disrupting female social organization and en-
hancing breeding opportunities (Ebensperger et al., 2016a). Although the
costs and benefits of social group membership stability differ for males and
females (Ebensperger et al., 2016a), this explanation is unlikely in degus
because males typically are not aggressive towards females during the non-
breeding and breeding seasons (Soto-Gamboa et al., 2005). Alternatively,
aggression between competing males in multi-male groups could disrupt the
social environment and lower the reproductive success of females (Nguyen
et al., 2009). Two factors suggest this hypothesis has potential to explain
our observations. Males are aggressive to other males during the breeding
season (Ebensperger & Hurtado, 2005; Soto-Gamboa et al., 2005), and so
male-male aggression could drive some females away from groups, reduc-
ing both female group membership stability and per capita offspring weaned
of remaining females (Ebensperger et al., 2016a). Moreover, new groups
form when adults migrate from other groups (Ebensperger et al., 2009), re-
sulting in conditions that could favor conflict over access to reproductively
active females. A test of this hypothesis requires that we quantify male-male
aggression within multi-female/multi-male groups, determine the impact of
this aggression on female residency within groups, and determine the com-
position of groups into which dispersing females move.
Multiple mating in multi-female/multi-male groups increases the risk of
disease or parasite transfer from males to females (or their offspring), which
in turn may decrease female reproductive success (Hurst et al., 1995; Kokko
et al., 2002; but see Seeley & Tarpy, 2007). The extent to which mates in-
fect each other and offspring depends on factors such as group size and the
mode of disease or parasite transmission (Côté & Poulin, 1995) as well as
the frequency of contact between mates (Altizier et al., 2003). Other factors,
such as dominance status of individuals and habitat use (Altizier et al., 2003)
determine the likelihood of parasite transfer between mates. Support for the
hypothesis that male degus reduce the fitness of females because they infect
them or their offspring is equivocable. Adult degus carry a diversity of ec-
toparasites and endoparasites (Cattan et al., 1976; Burger et al., 2012), some
of which alter behavior (Jimenez et al., 2015; Donoso et al., 2016) and have

negative impacts on the reproductive success of females (Burger et al., 2012).

Males move around more and engage in more social interactions with con-
specifics than females (Ebensperger & Hurtado, 2005), increasing the risk of
ectoparasite transfer to females and their young. However, in a 2-year study,
we found that males and females do not differ in the intensity of ectopara-
sitic flea infection intensity during the breeding season (Burger et al., 2012).
Males and females may differ in prevalence and intensity of endoparasite or
bacterial infections or how ectoparasite intensity varies across years. To test
the hypothesis, we need (1) to determine if heavily parasitized females asso-
ciate more with males with high parasite loads and (2) compare the parasite
levels and fitness females in groups in which males have naturally occurring
and experimentally reduced ectoparasite loads.
4.2. Unsupported hypotheses
Lack of support for the ‘kin directed benefits’ hypothesis was not entirely un-
expected. Although degus can live groups with kin, the average within-group
relatedness of group members in two populations (including the study site
used in this study) is not different from the relatedness of randomly paired
individuals (Davis et al., 2016). Moreover, there is evidence that females
engage in indiscriminate care of offspring, even when communal litters are
produced by unrelated females (Ebensperger et al., 2002, 2007). Lack of
support for the ‘predation risk’ hypothesis suggests that the availability of
burrow openings at communal nests has only a limited impact on offspring
survival. Degus often forage in groups with conspecifics from other social
groups (Ebensperger & Wallem, 2002), benefiting from improved vigiliance
(Ebensperger et al., 2006) and ability to detect predators (Ebensperger &
Wallem, 2002). Social foraging may, therefore, play a more important role
in the survivorship of degu offspring. Finally, soil hardness likely has a lim-
ited effect on degus because degus reuse existing burrows, implying that our
‘decreased costs of burrow construction and maintenance’ hypothesis has
little explanatory power.
Unexpectedly, our study did not support the ‘equitable benefits’, ‘equi-
table benefits under low food conditions’, and ‘benefits of multiple mating’
hypotheses. A previous study revealed that the per capita benefits (based
on trapping overlap of adults and offspring) of plural breeding were great-
est when food abundance is low (Ebensperger et al., 2014), suggesting that
benefits are greatest under harsh conditions. Previously, we also reported ev-
idence that the direct fitness of females increased with increasing number of

males per group (Ebensperger et al., submitted), evidence for the ‘benefits
of multiple breeding’ hypothesis. Descrepancies among these studies likely
occurred because of differences in aims, resulting in differences in predic-
tor variables, social units analyzed, and fitness metrics (Ebensperger et al.,
2012). For example, estimates of direct fitness in Ebensperger et al. (2014)
were based on trapping overlap of offspring and adults, while estimates in
this study were based on genetic analyses. Moreover, ecological predictors
were included in multivariate analyses in the current study but not in a con-
current analysis (Ebensperger et al., submitted). The current study focused
on multi-female groups whereas previous studies included all types of so-
cial units, including solitary females, single-female groups, and female–male
pairs. Moreover, there is evidence that the increasing frequency and duration
of El Niño Southern Oscillation (ENSO) events have had profound effects
on degu survival and reproductive success (Previtali et al. 2010). Thus, we
may require more years of data collection to fully capture how ecological
conditions influence the direct fitness consequences of plural breeding in de-
gus. Taken together, our long-term study of degus generates two important
questions: (1) Does increasing socality enhance direct fitness the most dur-
ing periodic, extremely harsh years (e.g., dry, La Niña) and (2) Are the costs
incurred by males associated with sex-specific consequences of social insta-
bility (Ebensperger et al., 2016a) that may co-vary with variation in social
organization? We hypothesize that competition between males increases in
the presence of multiple breeding females, potentially influencing the condi-
tion and fitness-influencing behaviors of females.
Competition among offspring in communal litters is a driving force for
direct fitness variation in other social mammals (e.g., Mennella et al., 1990;
Hodge et al., 2009). Several lines of evidence suggest that such competition
would be costly to female degus. Laboratory studies showed that degu off-
spring born in the presence of a second litter gained less mass than offspring
born in nests without other offspring and offspring in second-born litters
were less likely to survive than offspring in first-born litters (Ebensperger et
al., 2007). In the field, fecal metabolites of cortisol of degu offspring (an indi-
cator of physiological stress) increase with increasing number of offspring in
communal litters, though not in a statistically significant way (Quirici et al.,
2011b). The probability that offspring disperse from natal nests increases sig-
nificantly as the ratio of offspring to burrow systems used per group increases
(Quirici et al., 2011b), suggesting that costs are highest when available places

to hide from predators and harsh weather conditions are limited. Our obser-
vation that standardized variance in direct fitness of females decreased with
increasing communal litter size suggested greater equity among females as
communal litter sizes increased, and did not support these expectations. Why
is this? One possibility is that the costs of nursing additional offspring are
low, favoring communal nursing of offspring (MacLeod & Lukas, 2014).
Degu females nurse offspring indiscriminately (Ebensperger et al. 2002),
suggesting the possibility of low conflict among plurally breeding females.
Alternatively, the competitive ability and age of offspring within communal
litters are more important factors than communal litter sizes in determining
how social interactions among offspring influence reproductive success. Fe-
males might reduce the probability of competition within communal litters
and infanticide by synchronizing the birth of litters within communal groups
(Mennella et al., 1990). Litter synchrony is difficult to estimate in naturally
occurring populations of degus. Thus, we do not know if within-group vari-
ation in direct fitness associates with birth synchrony. However, as we build
our long-term dataset, we will eventually have sufficiently large sample size
to determine if litter synchrony influences per capita and within-group vari-
ation in direct fitness in degu groups of varying size and composition and
communal litter of varying size.
4.3. Why do degus breed plurally?
On the surface, the neutral-negative consequences of plural breeding ob-
served in this study and previous field studies (Hayes et al., 2009; Ebens-
perger et al., 2016b) suggest that plural breeding is not adaptive. Plural breed-
ing does not seem to increase access to resources (Ebensperger et al., 2016b),
improve immunity (Ebensperger et al., 2015), or provide kin directed bene-
fits (Quirici et al., 2011a; Davis et al., 2016; this study). Our current results
did not agree with previous observations that increasing group size benefits
plurally breeding females when food abundance is lowest (Ebensperger et
al., 2014). Moreover, the best-fit models for the per capita number of off-
spring weaned and standardized variance in direct fitness had relatively low
r 2 values (Tables 3, 5), implying that other components of the social system
or ecological conditions not included in our models need to be explored. We
need to consider how different components of the social system influence
the costs and benefits of plural breeding (Kappeler & van Schaik, 2002). In
terms of social interactions, communal rearing enhances the stress responses

of degu offspring born to females with experimentally elevated cortisol lev-

els (Bauer et al., 2015), which in turn, could increase offspring survival and
reproductive success in stressful environments. Plurally breeding females
may gain anti-predator benefits not analyzed in this study, including collec-
tive vigilance and reduced probability of predation (Ebensperger & Wallem,
2002; Ebensperger et al., 2006). Both communal rearing and group foraging
could increase the probability that offspring and adults survive to reproduc-
tive age. Given the fast life history of degus, these benefits could explain
the evolution of group-living in this species. Stability (but not strength) of
associations among females positively associate with female reproductive
success (Wey et al., 2013; Ebensperger et al., 2016a). Understanding the
adaptive significance of degu plural breeding requires that we examine re-
lationships between social group membership stability, foraging groups, and
reproductive success.
4.4. How do degus compare to other plural breeders?
Equitable breeding among females in the same groups has been observed in
some plurally breeding birds and mammals, leading some to refer to plu-
ral breeding as ‘egalitarian’ strategy of reproduction (de Luca & Ginsberg,
2001; Packer et al., 2001; Nutt, 2007). Our study and observations from other
plural breeders suggest that species vary widely, with some appearing to be
egalitarian (low aggression, low variability in direct fitness among group
members) and others with groups consisting of breeders and non-breeders
(high variability in direct fitness among group members). For example, in
banded mongooses (Mungos mungo) most females (80%) breed (Gilchrist et
al., 2004) and dominance rank among males does not predict the number of
matings that males achieve (de Luca & Ginsberg, 2001), suggesting egali-
tarianism. In gundis (Ctenodactylus gundi), the proportion of own out of all
offspring produced by females decreases with increasing number of females
per group, presumably due to the inability of females to prevent subordinates
from reproducing (Nutt, 2007). This trend seems to be common in mammals,
in which the percentage of females in the same group that breed is generally
unaffected by the number of breeding females in a group (Rubenstein et al.,
2016). However, there are numerous examples, including this study, in which
same-sex individuals of breeding age do not experience similar reproductive
success (Rubenstein et al., 2016). This effect may reflect the costs of breed-
ing alone in harsh environments (Rubenstein, 2011, 2016), conditions that

might favor reproductive delay, and cooperation by some group members

(Rubenstein, 2011). In African lion (Panthera leo) prides, the most success-
ful females produce 70% more offspring per year than the least successful
females (Packer et al., 2001). Our study suggests that the consequences of
plural breeding to degus parallel those of lions (i.e., most females breed),
albeit for different reasons. What distinguishes degus from lions is a short
lifespan, low reproductive output (Ebensperger et al., 2013), and low genetic
structure within groups (Quirici et al., 2011a; Davis et al., 2016). It is un-
likely that degu females with relatively low direct fitness compared to other
females in a group — up to 7 offspring difference between the most and least
successful females per group — can make up losses with future reproduc-
tion or through enhanced indirect fitness. Given these extraordinary social
and life history attributes, we now need to determine how elements of the
social environment, such as foraging group size, lead to other benefits (e.g.,
increased survival to reproductive age) that might offset these direct fitness
costs to some females. Additional avenues of future research include deter-
mining if plural breeding confers greater reproductive benefits than solitary
breeding, reduces energetic costs to offspring in harsh years, and is associ-
ated with the degree of connectivity with individuals in a population.
Acknowledgements
We are indebted to the Universidad de Chile for providing the facilities dur-
ing field work at Rinconada. In particular, we thank Marcelo Orellana Reyes
(former Field Station Administrator), Rosa Peralta (current Field Station Ad-
ministrator), and colleagues Giorgio Castellaro and Carlos Muñoz. We thank
J.R. Burger, C. León, J. Ramírez-Estrada and V. Quirici for assistance in the
field. We thank J. Bhattacharjee for advice. LDH was funded by NSF grants
Nos 0553910, 0853719 and 1261026. LAE was funded by FONDECYT
grant Nos 1090302, 1130091 and 1170409. SA was funded by FONDECYT
grant 1170995. LAC was funded by FONDECYT grant Nos 3131567 and
11170222. Other funding sources were the Program 1 of Centro de Estudios
Avanzados en Ecología and Biodiversidad (FONDAP 1501-001). This study
was approved by the Institutional Animal Use and Care Committee at the
Facultad de Ciencias Biológicas (DFCB-021/2008 and CBB-229/2012), and
received the required authorization to live trap wild degus by the Servicio
Agrícola y Ganadero (1-31/2009 [1956] and 2826/2013).

References
Altizier, S., Nunn, C.L., Thrall, P.H., Gittleman, J.L., Antonovics, J., Cunningham, A.A.,
Dobson, A., Ezenwa, V., Jones, K.E., Pederson, A.B., Poss, M. & Pulliam, J.R.C. (2003).
Social organization and parasite risk in mammals: integrating theory and empirical stud-
ies. — Annu. Rev. Ecol. Evol. Syst. 34: 517-547.
Barton, K. (2009). MuMIn: multi-model inference. — R package, version 0.12.2. Available
online at http://r-forge.r-project.org/pro-jects/mumin/.
Bauer, C.M., Hayes, L.D., Ebensperger, L.A., Ramírez-Estrada, J., León, C., Davis, G.T.
& Romero, L.M. (2015). Maternal stress and plural breeding with communal care affect
development of the endocrine stress response in a wild rodent. — Horm. Behav. 75: 18-24.
Brown, J.L. (1978). Avian communal breeding systems. — Annu. Rev. Ecol. Evol. Syst. 9:
123-155.
Burger, J.R., Chesh, A.S., Muñoz, P., Fredes, F., Ebensperger, L.A. & Hayes, L.D. (2012).
Sociality, exotic ectoparasites, and fitness in the plural breeding rodent Octodon degus. —
Behav. Ecol. Sociobiol. 66: 57-66.
Burnham, K.P. & Anderson, D.R. (2002). Model selection and multimodel inference. A prac-
tical information-theoretical approach. — Springer, New York, NY.
Burnham, K.P., Anderson, D.R. & Huyvaert, K.P. (2011). AIC model selection and mul-
timodel inference in behavioral ecology: some background, observations, and compar-
isons. — Behav. Ecol. Sociobiol. 65: 23-35.
Cattan, P.E., George-Nascimento, M. & Rodríguez, J. (1976). First observations on the vari-
ations of parasitic helminth populations from the Chilean rodent Octodon degus. — Bole.
Chil. Parasitol. 31: 16-20.
Clutton-Brock, T. (2002). Breeding together: kin selection and mutualism in cooperative
vertebrates. — Science 296: 69-72.
Cohas, A., Yoccoz, N.G. & Allainé, D. (2007). Extra-pair paternity in alpine marmots, Mar-
mota marmota: genetic quality and genetic diversity effects. — Behav. Ecol. Sociobiol.
61: 1081-1092.
Côté, I.M. & Poulin, R. (1995). Parasitism and group size in social animals: a meta-
analysis. — Behav. Ecol. 6: 159-165.
Davis, G.T., Vásquez, R.A., Poulin, E., Oda, E., Bazán-León, E.A., Ebensperger, L.A. &
Hayes, L.D. (2016). Octodon degus kin and social structure. — J. Mammal. 96: 1-12.
de Luca, D.W. & Ginsberg, J.R. (2001). Dominance, reproduction and survival in banded
mongooses: towards an egalitarian social system? — Anim. Behav. 61: 17-30.
Donoso, M.I., Fonturbel, F.E., Cares, R.A., Oda, E., Ramirez, P.A. & Botto-Mahan, C. (2016).
Temporal fluctuation in shrub species preferences of two native rodents: the effect of
infection status on habitat use. — Aust. Ecol. 41: 512-518.
Duchesne, P., Castric, T. & Bernatchez, L. (2005). PASOS (parental allocation of singles in
open systems): a computer program for individual allocation with missing parents. —
Mol. Ecol. Notes 5: 701-704.
Ebensperger, L.A. (1998). Strategies and counterstrategies to infanticide in mammals. —
Biol. Rev. 73: 321-346.

Ebensperger, L.A. (2001a). A review of the evolutionary causes of rodent group-living. —

Acta Ethol. 46: 115-144.
Ebensperger, L.A. (2001b). No infanticide in the hystricognath rodent, Octodon degus: does
ecology play a role? — Acta Ethol. 3: 89-93.
Ebensperger, L.A. & Bozinovic, F. (2000a). Energetics and burrowing behaviour in the semi-
fossorial degu (Octodon degus Rodentia: Octodontidae). — J. Zool. 252: 179-186.
Ebensperger, L.A. & Bozinovic, F. (2000b). Communal burrowing in the hystricognath ro-
dent, Octodon degus: a benefit of sociality? — Behav. Ecol. Sociobiol. 47: 365-369.
Ebensperger, L.A. & Hurtado, M.J. (2005). On the relationship between herbaceous cover
and vigilance activity of degus (Octodon degus). — Ethology 111: 593-608.
Ebensperger, L.A. & Wallem, P.K. (2002). Grouping increases the ability of the social rodent,
Octodon degus, to detect predators when using exposed microhabitats. — Oikos 98: 491-
497.
Ebensperger, L.A., Veloso, C. & Wallem, P.K. (2002). Do female degus communally nest and
nurse their pups? — J. Ethol. 20: 143-146.
Ebensperger, L.A., Hurtado, M.J., Soto-Gamboa, M., Lacey, E.A. & Chang, A.T. (2004).
Communal nesting and kinship in degus (Octodon degus). — Naturwissenschaften 91:
391-395.
Ebensperger, L.A., Hurtado, M.J. & Ramos-Jiliberto, R. (2006). Vigilance and collective
detection of predators in degus (Octodon degus). — Ethology 112: 879-887.
Ebensperger, L.A., Hurtado, M.J. & León, C. (2007). An experimental examination of the
consequences of communal versus solitary breeding on maternal condition and the early
postnatal growth and survival of degu, Octodon degus, pups. — Anim. Behav. 73: 185-
194.
Ebensperger, L.A., Chesh, A.S., Castro, R.A., Tolhuysen, L.O., Quirici, V., Burger, J.R.
& Hayes, L.D. (2009). Instability rules social groups in the communal breeder rodent
Octodon degus. — Ethology 115: 540-554.
Ebensperger, L.A., Ramírez-Otarola, N., León, C., Ortiz, M.E. & Croxatto, H.B. (2010).
Early fitness consequences and hormonal correlates of parental behaviour in the social
rodent, Octodon degus. — Phys. Behav. 101: 509-517.
Ebensperger, L.A., Rivera, D.S. & Hayes, L.D. (2012). Direct fitness of group living mam-
mals varies with breeding strategy, climate and fitness estimates. — J. Anim. Ecol. 81:
1013-1023.
Ebensperger, L.A., Tapia, D., Ramírez-Estrada, J., León, C., Soto-Gamboa, M. & Hayes, L.D.
(2013). Fecal cortisol levels predict breeding but not survival of females in the short-lived
rodent, Octodon degus. — Gen. Comp. Endocrinol. 186: 164-171.
Ebensperger, L.A., Villegas, Á., Abades, S. & Hayes, L.D. (2014). Mean ecological condi-
tions modulate the effects of group living and communal rearing on offspring production
and survival. — Behav. Ecol. 25: 862-870.
Ebensperger, L.A., León, C., Ramírez-Estrada, J., Abades, S.F., Hayes, L.D., Nova, E.,
Salazar, F., Bhattacharjee, J. & Becker, M.I. (2015). Immunocompetence of breeding fe-
males is sensitive to cortisol levels but not to communal rearing in the degu (Octodon
degus). — Phys. & Behav. 140: 61-70.

Ebensperger, L.A., Correa, L.A., León, C., Ramírez-Estrada, J., Abades, S., Villegas, Á. &
Hayes, L.D. (2016a). The modulating role of group stability on fitness effects of group
size is different in females and males of a communally rearing rodent. — J. Anim. Ecol.
DOI:10.1111/1365-2656.12566.
Ebensperger, L.A., Pérez de Arce, F., Abades, S. & Hayes, L.D. (2016b). Limited and fitness-
neutral effects of resource heterogeneity on sociality in a communally rearing rodent. —
J. Mammal. 97: 1125-1135.
Gilchrist, J.S., Otali, E. & Mwanguhya, F. (2004). Why breed communally? Factors affecting
fecundity in a communal breeding mammal: the banded mongoose (Mungos mungo). —
Behav. Ecol. Sociobiol. 57: 119-131.
Gonzalez, J.C.T., Sheldon, B.C. & Tobias, J.A. (2013). Environmental stability and the evo-
lution of cooperative breeding in hornbills. — Proc. Roy. Soc. B. 280: 20131297.
Hamilton, W.D. (1964). The genetical evolution of social behaviour. II. — J. Theor. Biol. 7:
17-52.
Hayes, L.D. & Solomon, N.G. (2004). Costs and benefits of communal rearing to female
prairie voles (Microtus ochrogaster). — Behav. Ecol. Sociobiol. 56: 585-593.
Hayes, L.D., Chesh, A.S., Castro, R.A., Tolhuysen, L.O., Burger, J.R., Bhattacharjee, J. &
Ebensperger, L.A. (2009). Fitness consequences of group living in the degu Octodon
degus, a plural breeder rodent with communal care. — Anim. Behav. 78: 131-139.
Hodge, S.J., Bell, M.B., Mwanguhya, F., Kyabulima, S., Waldick, R.C. & Russell, A.F.
(2009). Maternal weight, offspring competitive ability, and the evolution of communal
breeding. — Behav. Ecol. 20: 729-735.
Hurst, G.D., Sharpe, R.G., Broomfield, A.H., Walker, L.E., Majerus, T.M., Zakharov, I.A.
& Majerus, M.E. (1995). Sexually transmitted disease in a promiscuous insect, Adalia
bipunctata. — Ecol. Entomol. 20: 230-236.
Jiménez, C., Fontúrbel, F.E., Oda, E., Ramírez, P.A. & Botto-Mahan, C. (2015). Parasitic
infection alters rodent movement in a semiarid ecosystem. — Mammal. Biol. 80: 255-
259.
Jindal, S., Bose, A.P., O’Connor, C.M. & Balshine, S. (2017). A test of male infanticide as a
reproductive tactic in a cichlid fish. — Roy. Soc. Opin. Sci. 4: 160891.
Jones, A.G. (2005). GERUD 2.0: a computer program for the reconstruction of parental
genotypes from half-sib progeny arrays with known or unknown parents. — Mol. Ecol.
Notes 5: 708-711.
Jones, A.G., Small, C.M., Paczolt, K.A. & Ratterman, N.L. (2010). A practical guide to
methods in parentage analysis. — Mol. Ecol. Res. 10: 6-30.
Kalinowski, S.T., Wagner, A.P. & Taper, M.L. (2006). ML-RELATE: a computer program
for maximum likelihood estimation of relatedness and relationship. — Mol. Ecol. Notes
6: 576-579.
Kalinowski, S.T., Taper, M.L. & Marshall, T.C. (2007). Revising how the computer program
CERVUS accommodates genotyping error increases success in paternity assignment. —
Mol. Ecol. 16: 1099-1106.
Kappeler, P.M. & van Schaik, C.P. (2002). Evolution of primate social systems. — Int. J.
Primatol. 23: 707-740.

Kaseda, Y., Khalil, A.M. & Ogawa, H. (1995). Harem stability and reproductive success of
Misaki feral mares. — Equine Vet. J. 27: 368-372.
Kinlaw, A. (1999). A review of burrowing by semi-fossorial vertebrates in arid environ-
ments. — J. Arid Environ. 41: 127-145.
Koenig, W.D. & Walters, E.L. (2015). Temporal variability and cooperative breeding: testing
the bet-hedging hypothesis in the acorn woodpecker. — Proc. R. Soc. Lond. B Biol. 282:
20151742.
Kokko, H., Ranta, E., Ruxton, G. & Lundberg, P. (2002). Sexually transmitted disease and
the evolution of mating systems. — Evolution 56: 1091-1100.
Lagos, P.A., Meier, A., Tolhuysen, L.O., Castro, R.A., Bozinovic, F. & Ebensperger, L.A.
(2009). Flight initiation distance is differentially sensitive to the costs of staying and
leaving food patches in a small-mammal prey. — Can. J. Zool. 87: 1016-1023.
Lardy, S., Allainé, D., Bonenfant, C. & Cohas, A. (2015). Sex-specific determinants of fitness
in a social mammal. — Ecology 96: 2947-2959.
Li, M.-H., Välimäki, K., Piha, M., Pakkala, T. & Merilä, J. (2009). Extrapair paternity and ma-
ternity in the Three Toed Woodpecker, Picoides tridactylus: insights from microsatellite-
based parentage analyses. — PLoS One 4: e7895.
Linklater, W.L., Cameron, E.Z., Minot, E.O. & Stafford, K.J. (1999). Stallion harassment and
the mating system of horses. — Anim. Behav. 58: 295-306.
Longdon, B. & Jiggins, F.M. (2010). Paternally transmitted parasites. — Curr. Biol. 20: R695-
R696.
Lukas, D. & Clutton-Brock, T.H. (2011). Group structure, kinship, inbreeding risk and habit-
ual female dispersal in plural-breeding mammals. — J. Evol. Biol. 24: 2624-2630.
Lukas, D. & Clutton-Brock, T. (2012). Cooperative breeding and monogamy in mammalian
societies. — Proc. Roy. Soc. Lond. B: Biol. Sci. 279: rspb20112468.
Lukas, D. & Clutton-Brock, T. (2017). Climate and the distribution of cooperative breeding
in mammals. — Open Sci. 4: 160897.
Macedo, R.H. (2016). Guira cuckoos: cooperation, infanticide, and female reproductive in-
vestment in a joint-nesting species. — In: Cooperative breeding in vertebrates: studies
of ecology, evolution, and behavior (Koenig, W.D. & Dickinson, J.L., eds). Cambridge
University Press, Cambridge, p. 257-271.
MacLeod, K.J. & Lukas, D. (2014). Revisiting non-offspring nursing: allonursing evolves
when the costs are low. — Biol. Lett. 10: 20140378.
Mennella, J.A., Blumberg, M.S., McClintock, M.K. & Moltz, H. (1990). Inter-litter competi-
tion and communal nursing among Norway rats: advantages of birth synchrony. — Behav.
Ecol. Sociobiol. 27: 183-190.
Miller, A. (2002). Subset selection in regression, 2nd edn. — Chapman & Hall/CRC, New
York, NY.
Nguyen, N., Van Horn, R.C., Alberts, S.C. & Altmann, J. (2009). “Friendships” between
new mothers and adult males: adaptive benefits and determinants in wild baboons (Papio
cynocephalus). — Behav. Ecol. Sociobiol. 63: 1331-1344.
Nutt, K.J. (2007). Genetic reconstruction of breeding patterns in gundis (Rodentia: Cten-
odactylidae). — Behav. Ecol. Sociobiol. 61: 1651-1663.

Packer, C. & Pusey, A.E. (1983). Adaptations of female lions to infanticide by incoming
males. — Am. Nat. 121: 716-728.
Packer, C., Gilbert, D.A., Pusey, A.E. & O’Brien, S.J. (1991). Molecular genetic analysis of
kinship and cooperation in African lions. — Nature 351: 562-565.
Packer, C., Pusey, A.E. & Eberly, L.E. (2001). Egalitarianism in female African lions. —
Science 293: 690-693.
Palombit, R.A. (2015). Infanticide as sexual conflict: coevolution of male strategies and
female counterstrategies. — Cold Spring Harbor Persp. Biol. 7: a017640.
Pradhan, G.R. & van Schaik, C. (2008). Infanticide-driven intersexual conflict over matings
in primates and its effects on social organization. — Behaviour 145: 251-275.
Previtali, M.A., Meserve, P.L., Kelt, D.A., Milstead, W.B. & Gutierrez, J.R. (2010). Effets
of more frequent and prolonged El Niño events on life history parameters of the degu,
a long-lived and slow-reproducing rodent. — Cons. Biol. 24: 18-28.
Quan, Y.F., MacManes, M.D., Ebensperger, L.A., Lacey, E.A. & Hayes, L.D. (2009). Isola-
tion and characterization of polymorphic microsatellite loci from Octodon degus. — Mol.
Ecol. Res. 9: 999-1001.
Quirici, V., Faugeron, S., Hayes, L.D. & Ebensperger, L.A. (2011a). Absence of kin structure
in a population of the group-living rodent Octodon degus. — Behav. Ecol. 22: 248-254.
Quirici, V., Faugeron, S., Hayes, L.D. & Ebensperger, L.A. (2011b). The influence of group
size on natal dispersal in the communally rearing and semifossorial rodent, Octodon
degus. — Behav. Ecol. Sociobiol. 65: 787-798.
Riehl, C. (2013). Evolutionary routes to non-kin cooperative breeding in birds. — Proc. Roy.
Soc. Lond. B: Biol. Sci. 280: 20132245.
Rubenstein, D.R. (2011). Spatiotemporal environmental variation, risk aversion, and the evo-
lution of cooperative breeding as a bet-hedging strategy. — Proc. Natl. Acad. Sci. USA
108: 10816-10822.
Rubenstein, D.R. (2016). Superb starlings: cooperation and conflict in an unpredictable en-
vironment. — In: Cooperative breeding in vertebrates: studies of ecology, evolution, and
behavior (Koenig, W.D. & Dickinson, J.L., eds). Cambridge University Press, Cambridge,
p. 181-196.
Rubenstein, D.R., Botero, C.A. & Lacey, E.A. (2016). Discrete but variable structure of
animal societies leads to the false perception of a social continuum. — Roy. Soc. Opin.
Sci. 3: 160147.
Schroeder, J.W., Honeycutt, R.L., Rooney, A.P., Han, G., Begall, S. & Gallardo, M.H. (2000).
Microsatellites from the South American coruro, Spalacopus cyanus. — Mol. Ecol. 9:
1447-1449.
Seeley, T.D. & Tarpy, D.R. (2007). Queen promiscuity lowers disease within honeybee
colonies. — Proc. Roy. Soc. Lond. B: Biol. Sci. 274: 67-72.
Shen, S.F., Vehrencamp, S.L., Johnstone, R.A., Chen, H.-C., Chan, S.-F., Liao, W.-Y., Lin,
K.-Y. & Yuan, H.-S. (2012). Unfavourable environment limits social conflict in Yuhina
brunneiceps. — Nature Comm. 3: 885.
Shen, S.F., Yuan, H.W. & Liu, M. (2016). Taiwan yuhinas: unrelated joint-nesters cooperate in
unfavorable environments. — In: Cooperative breeding in vertebrates: studies of ecology,

evolution, and behavior (Koenig, W.D. & Dickinson, J.L., eds). Cambridge University
Press, Cambridge, p. 237-256.
Silk, J.B. (2007). The adaptive value of sociality in mammalian groups. — Phil. Trans. Roy.
Soc. 362: 539-559.
Silk, J.B. & Kappeler, P.M. (2017). Sociality in primates. — In: Comparative social evolution
(Rubenstein, D.R. & Abbot, P., eds). Cambridge University Press, Cambridge, p. 253-283.
Smith, J.E., Lacey, E.A. & Hayes, L.D. (2017). Sociality in non-primate mammals. — In:
Comparative social evolution (Rubenstein, D.R. & Abbot, P., eds). Cambridge University
Soto-Gamboa, M., Villalón, M. & Bozinovic, F. (2005). Social cues and hormone levels in
male Octodon degus (Rodentia): a field test of the challenge hypothesis. — Horm. Behav.
47: 311-318.
Taborsky, M., Frommen, J.G. & Riehl, C. (2016). The evolution of cooperation based on
direct fitness benefits. — Phil. Trans. Roy. Soc. 371: 20150472.
Taraborelli, P., Borruel, N., Sandobal, A.J. & Giannoni, S. (2009). Influence of biotic and
abiotic factors on the structure of burrows of the cavy Microcavia australis. — Mastozool.
Neotrop. 16: 411-421.
van Oosterhout, L., Hutchinson, W.F., Wills, D.P.M. & Shipley, P. (2004). Micro-checker:
software to identifying and correcting genotyping errors in microsatellite data. — Mol.
Ecol. Not. 4: 535-538.
Vehrencamp, S.L. & Quinn, J.S. (2004). Joint laying systems. — In: Ecology and evolution
of cooperative breeding in birds (Koenig, W. & Dickinson, J., eds). Cambridge University
Wey, T.W., Burger, J.R., Ebensperger, L.A. & Hayes, L.D. (2013). Reproductive correlates
of social network variation in plurally breeding degus (Octodon degus). — Anim. Behav.
85: 1407-1414.
Whitehead, H. (2009). SOCPROG programs: analysing animal social structures. — Behav.
Ecol. Sociobiol. 63: 765-778.
Zuur, A., Ieno, E.N., Walker, N., Saveliev, A.A. & Smith, G.M. (2009). Mixed effects models
and extensions in ecology with R. — Springer, New York, NY.

Appendix
Table A1.
Total number (N = 1826) of genotyped adults and offspring (2009–2015).
Year of Number Number Number Number Total

study of adult of adult of female of male
females males offspring offspring
2009 47 48 85 118 298

2010 10 24 18 30 82
2011 47 30 83 88 248
2012 31 23 62 64 180
2013 52 41 138 148 379
2014 25 34 101 88 248
2015 37 55 149 140 381
Total 249 255 636 676 1816

32
Table A2.
Sequence, annealing temperature (T a ), size and number of alleles of 10 microsatellite loci used to genotype degu adults and offspring.
Locus Repeat motif Primer sequence (5 → 3 ) T a (°C) PCR Number GenBank
product of Accession
size (bp) alleles No.
OCDE1 (CTTT)7CTCT (CTTT)10 F: VIC-CTAGGTGCCAGAGACCCTTG 60 152–184 9 FJ418930

R: CAAAGACCCTGGGTTCAATC
OCDE2 (CA)13 F: VIC-GTTCGAGCTGCCTAGTGAGG 64 200–214 7 FJ418931
R: ACTGGACATGGTGGTGTGTG
OCDE5 (GAAA)11GAGA (GAAA)7 F: FAM-CAAAGACCCTGGGTTCAATC 58 196–228 9 FJ418934
R: CATGATTGAGCTTGCCTCTG
OCDE7 (GAAA)13 (GA)4 * F: FAM-CAAGCTTGTCAAAGCACAGG 64 191–229 17 FJ418936
R: GGCAGAAAATTCTGGACAGG
OCDE9 (GA)23 F: FAM-CATGTAGTTTTCCAGGCACT 58 169–197 13 FJ418938
R: TTCCTCCACTTTCTGACAAT
OCDE10 (TG)13 F: NED-AAGGCAGCAGTTGGGAGAACAA 64 157–185 10 FJ418939
R: TGAGATTGTCCTTTGAGTCCACATGA
Costly males in a plural breeder
OCDE11 (CA)5TATA (CA)4 F: PET-TAGGAAGGAAAGGAGCTGGA 58 164–180 8 FJ418940

GAGACAAATA(CA)20 R: CAACAAGCTCGGGTGATTTA
OCDE12 (GT)15 F: PET-GCAGAGCTAAGGACTAAAGGTTCCA 62 174–224 19 FJ418941
R: CCAAGTTGCTAAGAGGTCCCTTG
OCDE14 (GT)20 (TG)2 F: FAM-GCTCTGGGGGCAATCAATATTCT 58 150–174 12 FJ418943
R: AAACCACTACTTCTGCACTGTTCCA
SCY3 (CA)20 F: NED-AAGTTGAGGCTAGTTGTTTG 52 125–151 12 AF250221
R: GATCACAGGCACCACATAC

Table A3.
Analysis of Hardy–Weinberg expectations for each locus within each study year (2009 to 2015).
Locus 2009 2010 2011

k H obs H exp p HW k H obs H exp p HW k H obs H exp p HW
OCDE1 9 0.893 0.844 0.153 NS 8 0.798 0.783 0.240 NS 9 0.869 0.839 0.694 NS
OCDE2 7 0.829 0.804 <0.001 *** 7 0.798 0.794 0.632 NS 7 0.730 0.787 0.210 NS
OCDE5 9 0.873 0.843 0.135 NS 8 0.702 0.789 0.118 NS 9 0.845 0.834 0.854 NS
OCDE7 13 0.843 0.875 <0.001 *** 13 0.833 0.840 0.406 NS 13 0.853 0.881 0.094 NS
OCDE9 13 0.853 0.865 0.025 NS 11 0.917 0.860 <0.001 *** 12 0.869 0.866 0.068 NS
OCDE10 10 0.796 0.788 0.319 NS 8 0.690 0.721 0.652 NS 9 0.766 0.735 0.336 NS
OCDE11 6 0.779 0.761 0.010 NS 7 0.857 0.791 0.021 NS 7 0.786 0.823 0.019 NS
OCDE12 14 0.823 0.853 0.010 NS 15 0.905 0.899 0.899 NS 16 0.861 0.862 0.010 NS
OCDE14 9 0.803 0.796 0.049 NS 9 0.774 0.805 <0.001 *** 9 0.750 0.753 0.391 NS
SCY3 9 0.823 0.799 0.882 NS 10 0.786 0.825 0.030 NS 11 0.841 0.826 0.087 NS
L.D. Hayes et al. / Behaviour 156 (2019) 1–36
33

34
Table A3.
(Continued.)
2012 2013 2014
k H obs H exp p HW k H obs H exp p HW k H obs H exp p HW
9 0.798 0.854 <0.001 *** 9 0.858 0.848 0.006 NS 9 0.837 0.855 0.089 NS
7 0.776 0.799 0.103 NS 7 0.744 0.789 0.001 * 6 0.761 0.794 0.253 NS
9 0.831 0.855 0.003 * 9 0.860 0.846 <0.001 ** 9 0.846 0.853 0.036 NS
14 0.814 0.855 0.048 NS 14 0.798 0.857 <0.001 *** 15 0.776 0.833 0.010 NS
11 0.869 0.855 0.011 NS 13 0.863 0.851 0.141 NS 13 0.861 0.850 0.031 NS
9 0.798 0.775 0.676 NS 9 0.744 0.750 0.003 * 10 0.782 0.772 0.129 NS
7 0.787 0.808 0.016 NS 7 0.793 0.790 <0.001 ** 8 0.770 0.792 <0.001 **
Costly males in a plural breeder
15 0.880 0.877 0.029 NS 16 0.907 0.893 <0.001 ** 15 0.903 0.895 0.684 NS

10 0.716 0.736 0.079 NS 12 0.767 0.768 0.155 NS 11 0.776 0.797 <0.001 **
11 0.923 0.881 <0.001 ** 11 0.894 0.871 <0.001 ** 11 0.864 0.878 <0.001 ***

Table A3.
(Continued.)
2015
k H obs H exp p HW
9 0.833 0.842 0.004 *

6 0.745 0.767 0.232 NS
9 0.842 0.841 0.004 *
15 0.835 0.851 0.035 NS
12 0.866 0.845 0.581 NS
10 0.802 0.808 0.005 NS
8 0.813 0.792 0.774 NS
17 0.921 0.903 0.025 NS
9 0.791 0.788 0.006 NS
12 0.884 0.881 0.047 NS
Data include the number of alleles (NA), observed heterozygosity (H obs ), expected het-
erozygosity (H exp ), Hardy–Weinberg p-value after Bonferroni Corrections (p-value), and
significant deviations from Hardy–Weinberg expectations highlights (HW). Key to statisti-
cal significance: NS = not significant; * significant at p < 0.05; ** significant at p < 0.01;
*** = significant at p < 0.001.
Table A4.
Random effect selection for model 1 (per capita offspring weaned).
Model ID Random effect logLik AICc delta weight
Model_1 1 | Year −69.81 174.03 0.00 0.84

Model_8 1 + CV_food_burrow | Year −68.51 180.02 5.99 0.04
Model_7 1 + CV_openings_burrow | Year −69.10 181.19 7.17 0.02
Model_6 1 + Mean.openings_burrow | Year −69.16 181.31 7.28 0.02
Model_5 1 + Mean.food_burrow | Year −69.17 181.34 7.31 0.02
Model_3 1 + MGS | Year −69.56 182.11 8.08 0.01
Model_2 1 + FGS | Year −69.57 182.15 8.12 0.01
Model_9 1 + Rfem | Year −69.81 182.63 8.60 0.01
Model_4 1 + Mean.soil_hardness | Year −69.83 182.65 8.62 0.01
All models included a full fixed effect part with terms FGS, MGS, Mean soil hardness,
Mean burrow food, Mean burrow openings, CV burrow openings + CV burrow food, Rfem
and the interaction between FGS and Mean burrow food. Random effect is testing for variable
intercept and slope. logLik: log likelihood, AICc: biased-corrected Akaike value.

Table A5.
Random effect selection for model 2 (standardized variance in direct fitness).
Model ID Random effect logLik AICc delta weight
Model_1 1 | Year −8.05 50.49 0.00 0.83

Model_7 1 + CV_openings_burrow | Year −6.63 56.26 5.77 0.05
Model_8 1 + CV_food_burrow | Year −6.79 56.59 6.10 0.04
Model_3 1 + MGS | Year −7.01 57.02 6.52 0.03
Model_2 1 + FGS | Year −8.04 59.08 8.59 0.01
Model_5 1 + Mean.food_burrow | Year −8.05 59.09 8.60 0.01
Model_6 1 + Mean.openings_burrow | Year −8.05 59.09 8.60 0.01
Model_9 1 + Rfem | Year −8.05 59.09 8.60 0.01
Model_4 1 + Mean.soil_hardness | Year −8.12 59.25 8.76 0.01
All models included a full fixed effect part with terms FGS, MGS, Mean soil hardness,
Mean burrow food, Mean burrow openings, CV burrow openings + CV burrow food, Rfem
and the interaction between FGS and Mean burrow food. Random effect is testing for variable
intercept and slope. logLik: log likelihood, AICc: biased-corrected Akaike value.
Table A6.
Model comparison between best model 1 (per capita off-
spring weaned) with and without the random effect.
logLik AICc delta weight
No random effect −80.70 191.92 0.00 0.82

Random effect −80.26 194.91 2.99 0.18
Table A7.
Model comparison between best model 2 (standardized vari-
ance in direct fitness) with and without the random effect.
logLik AICc delta weight
No random effect −33.17 96.85 0.00 0.87

Random effect −33.17 100.73 3.88 0.13


Hayes 2019

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Hayes 2019

Uploaded by

Copyright:

Available Formats

Behaviour 156 (2019) 1–36 brill.

Male group members are costly to plurally breeding

Loren D. Hayes a,∗ , Loreto A. Correa b,c , Sebastian Abades d ,

© Koninklijke Brill NV, Leiden, 2019 DOI 10.1163/1568539X-00003525

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

conditions, cooperation could enhance reproductive success of plural breed-

Downloaded from Brill.com11/12/2020 10:56:47AM

conditions underlying variation in direct fitness among breeding females in

Downloaded from Brill.com11/12/2020 10:56:47AM

on overlap of adults and offspring at common burrow systems) increases

Downloaded from Brill.com11/12/2020 10:56:47AM

Hypothesis and predictions Model set Support

Key: PCOW = Per capita number of offspring weaned, STANDVAR = standardized

Downloaded from Brill.com11/12/2020 10:56:47AM

ages (Mennella et al., 1990), an effect recorded in laboratory reared degus

Downloaded from Brill.com11/12/2020 10:56:47AM

number of offspring weaned and lower standardized variance in direct fit-

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

tested the Hardy–Weinberg observed and expected heterozygosities for each

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

number of adult females per group covaries (Ebensperger et al., 2014), we

Downloaded from Brill.com11/12/2020 10:56:47AM

−0.49 −0.60 – – −71.95 152.96 0.00 0.33

Analyses were conducted using the statistical software R 3.3.0 (R Devel-

Intercept 6.43 0.83 <0.001

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

0.13 −1.12 – – −8.99 27.04 0.00 0.27

Downloaded from Brill.com11/12/2020 10:56:47AM

Intercept 0.32 0.14 0.026

Figure 3. Statistically significant negative association between standardized variance in direct

Downloaded from Brill.com11/12/2020 10:56:47AM

males per group. Contrary to expectations, standardized variance in direct

Downloaded from Brill.com11/12/2020 10:56:47AM

of multiple mating and mixed paternity of litters observed in our population

Downloaded from Brill.com11/12/2020 10:56:47AM

negative impacts on the reproductive success of females (Burger et al., 2012).

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

of degu offspring born to females with experimentally elevated cortisol lev-

Downloaded from Brill.com11/12/2020 10:56:47AM

might favor reproductive delay, and cooperation by some group members

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

Ebensperger, L.A. (2001a). A review of the evolutionary causes of rodent group-living. —

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

Downloaded from Brill.com11/12/2020 10:56:47AM

Year of Number Number Number Number Total

2009 47 48 85 118 298

Downloaded from Brill.com11/12/2020 10:56:47AM

OCDE1 (CTTT)7CTCT (CTTT)10 F: VIC-CTAGGTGCCAGAGACCCTTG 60 152–184 9 FJ418930

OCDE11 (CA)5TATA (CA)4 F: PET-TAGGAAGGAAAGGAGCTGGA 58 164–180 8 FJ418940

via San Francisco State University

Locus 2009 2010 2011

via San Francisco State University