Journal of Integrative Plant Biology 2009, 51 (3): 287–298

Alternative Splicing and Differential Expression of Two

Transcripts of Nicotine Adenine Dinucleotide Phosphate
Oxidase B Gene from Zea mays
∗
Fan Lin, Yun Zhang and Ming-Yi Jiang
(College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China)

Abstract

With the exception of rice, little is known about the existence of respiratory burst oxidase homolog (rboh) gene in cereals. The present
study reports the cloning and analysis of a novel rboh gene, termed ZmrbohB, from maize (Zea mays L.). The full-length cDNA
of ZmrbohB encodes a 942 amino acid protein containing all of the respiratory burst oxidase homolog catalytically critical motifs.
Alternative splicing of ZmrbohB has generated two transcript isoforms, ZmrbohB-α and -β. Spliced transcript ZmrbohB-β retains an
unspliced intron 11 that carries a premature termination codon and probably leads to nonsense-mediated mRNA decay. Expression
analysis showed that two splice isoforms were differentially expressed in various tissues and at different developmental stages, and
the major product was ZmrbohB-α. The transcripts of ZmrbohB-α accumulated markedly when the maize seedlings were subjected
to various abiotic stimuli, such as wounding, cold (4 ◦ C), heat (40 ◦ C), UV and salinity stress. In addition, several abiotic stimuli also
affected the alternative splicing pattern of ZmrbohB except wounding. These results provide new insight into roles in the expression
regulation of plant rboh genes and suggest that ZmrbohB gene may play a role in response to environmental stresses.

Key words: abiotic stress; alternative splicing; respiratory burst oxidase homolog; Zea mays.

Lin F, Zhang Y, Jiang MY (2009). Alternative splicing and differential expression of two transcripts of nicotine adenine dinucleotide phosphate oxidase
B gene from Zea mays. J. Integr. Plant Biol. 51(3), 287–298.

Available online at www.jipb.net

Nicotine adenine dinucleotide phosphate oxidase (NOX) is an
enzyme that catalyzes the production of superoxide (O 2 •− ) by
transferring electrons from nicotine adenine dinucleotide phos-
phate (NADPH) to molecular oxygen, with secondary generation
of H 2 O 2 . Reactive oxygen species (ROS) generated by NOX
have been shown to play crucial roles in biotic interactions,
abiotic stress and development in higher plants (Torres and
Dangl 2005; Sagi and Fluhr 2006; Carter et al. 2007). Plant
NOXs, termed RBOH (respiratory burst oxidase homolog),
are predicted to contain cytosolic flavin adenine dinucleotide-
(FAD) and NADPH-binding domains and six conserved
Received 18 Jun. 2008 Accepted 9 Nov. 2008
Supported by the State Key Basic Research and Development Plan of China
(2003CB114302) and the National Natural Science Foundation of China
(30571122).
∗
Author for correspondence.
Tel: +86 25 8439 6372;
Fax: +86 25 8407 3464;
E-mail: <myjiang@njau.edu.cn>.

C 2009 Institute of Botany, the Chinese Academy of Sciences
doi: 10.1111/j.1744-7909.2008.00808.x
transmembrane helices that correspond to those identified in the
mammalian NOX catalytic subunit gp91phox (phox for phagocyte
oxidase) and to carry an N-terminal extension comprising two
Ca2+ -binding EF-hand motifs (Keller et al. 1998; Sagi and Fluhr
2006).
Plant rboh genes were first isolated from rice (Oryza sativa)
(Groom et al. 1996), and then identified in various plant
species, such as Arabidopsis thaliana (Keller et al. 1998; Torres
et al. 1998), tobacco (Nicotiana benthamiana) (Yoshioka et al.
2003), and potato (Solanum tuberosum) (Yoshioka et al. 2001;
Yamamizo et al. 2007). Recent studies have shown that ac-
tivation of particular RBOH isoforms is responsible for ROS
accumulation during biotic and abiotic stresses. In Arabidopsis,
10 rboh genes are known, and AtrbohD and AtrbohF play a role
in ROS production in response to avirulence pathogens (Torres
et al. 2002). A recent result demonstrates that the oxidative
burst generated by these enzymes suppresses the spread of
cell death by antagonizing salicylic acid-dependent pro-death
signals (Torres et al. 2005). Guard cell NOXs encoded by
AtrbohD and AtrbohF genes are implicated in the intercellular
ROS signaling and cell death that arises from ozone exposure
(Joo et al. 2005). These two rboh genes are also required for
the abscisic acid (ABA)-induced stomatal closure (Kwak et al.
288 Journal of Integrative Plant Biology Vol. 51 No. 3 2009
2003). In tobacco, NtrbohD from N. tabacum, and NbrbohA
and NbrbohB from N. benthamiana are shown to be required
for ROS accumulation following perception of pathogen signals
(Simon-Plas et al. 2002; Yoshioka et al. 2003). Likewise, tomato
(Lycopersicon esculentum) plants transformed with antisense
constructs of rboh show a reduced level of ROS in the leaf, and
are compromised in wound-induced gene expression (Sagi et al.
2004). Furthermore, NOX activity also plays a role in regulation
of plant development. NOX-mediated H 2 O 2 synthesis is impli-
cated in ABA-induced seed germination and root elongation in
Arabidopsis (Kwak et al. 2003). During root hair development,
a requirement for ROS is demonstrated in A. thaliana using a
knockout mutant in AtrbohC/RHD2 (ROOT HAIR DEFECTIVE
2) (Foreman et al. 2003). Analysis of the AtrbohC/RHD2 mutant
reveals that ROS produced by AtRbohC are responsible for lo-
calized cell expansion during the root hair growth (Foreman et al.
2003), and a positive feedback mechanism involving AtRbohC,
ROS, and Ca2+ can determine cell shape (Takeda et al. 2008).
Moreover, suppression of tomato rboh gene expression by the
antisense approach induces a wide range of developmental ab-
normalities, and results in ectopic expression of flower-specific
homeotic genes (Sagi et al. 2004). These reports show that
plant NOX isoforms have different functions and participate in
multiple distinct signaling pathways. Complexity in specific roles
and in regulation of these enzymes is supported by different
tissue distribution, variation in gene expression and amounts of
superoxide produced by NOX isoforms.
In order to obtain more information on the function and regula-
tory patterns of rbohs, it is necessary to isolate and characterize
more rboh genes from different species. The molecular and
biochemical characterization of rboh genes in plants has been
studied extensively, but, most studies are carried out in dicot
plants such as Arobidopsis, tobacco and potato. Maize (Zea
mays) is a model plant and economically important species.
The rbohs, however, have not been reported yet. In the present
study, an rboh gene named as ZmrbohB from maize was cloned
and characterized. Our data showed that there is alternative
splicing in the coding region of the rboh gene. The accumulation
of ZmrbohB mRNA after several abiotic stress treatments was
also investigated. Our results provide new insight into roles in
the expression regulation of plant rboh genes.
Results
Cloning and sequence analysis of ZmrbohB cDNA
Based on the conserved regions of plant rboh genes, degener-
ate primers Pzrb3 and Pzrb4 were designed and synthesized
for the amplification of the middle region of ZmrbohB. A 1360 bp
fragment with high sequence identity to the maize Unigene
CL562_1 was obtained. The Unigene CL562_1 shares high
nucleotide sequence similarity with plant rbohs and contains
a stop codon (TGA). Then it was identified by polymerase
chain reaction (PCR). Several reverse specific primers designed
according to the obtained region were used for the amplification
of the 5 upstream cDNA region of ZmrbohB by the 5 rapid
amplification of cDNA ends (RACE) method, and uncovered the
1154 bp sequence containing a translation start codon (ATG).
After analysis of the corresponding fragments, which overlapped
each other in, a 3423 bp ZmrbohB transcript was deduced and
had an open reading frame of 2829 nucleotides, encoding a
protein of 942 amino acids with a predicted molecular mass
(MW) of approximately 106.3 kDa and a pI of 9.24.
The deduced amino acid sequence of ZmRbohB contained
catalytically critical motifs, including two EF-hand motifs, FAD
and NADPH binding sites (Figure 1), which are conserved in
plant NOXs from many species (Sagi and Fluhr 2006). The
topology analysis showed that six transmembrane-spanning
domains (TMD1-6), usually identified in human gp91phox and
plants NOXs, were also conserved in the ZmRbohB sequence
(Figure 1). Likewise, TMD3 and TMD5 contained pairs of
histidine residues that are important for heme binding in human
gp91phox (Finegold et al. 1996) (Figure 1). Moreover, human
gp91phox amino acid residues Pro-415 and Asp-500, which are
indispensable for the catalytic activity (Segal et al. 1992), were
also conserved in ZmRbohB (Figure 1). In all Nox isoforms,
the first NADPH-ribose binding domain (GXGXXP) is followed
by a phenylalanine residue, which is typical of NADPH-rather
than NADH-specific enzymes (Cheng et al. 2001). In the
ZmRbohB sequence, this phenylalanine residue was also found
(Figure 1).
Comparison of the Rboh protein sequences
Figure 2 shows a phylogenetic tree for polypeptide ZmRbohB
and for 32 reported plant Rboh proteins. ZmRbohB was most
similar to OsRbohC from rice (85.8% identity), followed by rice
OsRbohA (74.1%). It also had high sequence identity to to-
bacco NbRbohA (71.6%), potato StRbohA (70.9%), Arabidopsis
AtRbohF (69.5%) and tomato LeRboh1 (51.9%).
From this tree, four main clusters could be distinguished. The
first contains AtRbohE, OsRbohF and OsRbohG. OsrbohF is
a defense-related gene (Yoshie et al. 2005), which deposits
in the database by Wong et al. (2007) and is identical to
the clone OsrbohE obtained by Yoshie et al. (2005). The
second major cluster includes NbRbohA and LeRboh1, which
are constitutively expressed in tobacco and tomato, respectively
(Amicucci et al. 1999; Yoshioka et al. 2003). But this cluster
also contains rice OsrbohA (Yoshie et al. 2005), Arabidopsis
AtrbohF (Kwak et al. 2003) and potato StrbohA (Kumar et al.
2007), which are inducible genes. Our ZmRbohB was classified
into this cluster, too. The third major cluster contains two sub-
groups. One sub-group contains StRbohB-D (Yoshioka et al.
2001; Yamamizo et al. 2007), NbRbohB (Yoshioka et al. 2003),
NtRbohD (Simon-Plas et al. 2002) and AtRbohD (Deskian et al.
 Rboh Gene from Maize 289

Figure 1. Alignment of the predicted amino acid sequences of ZmRbohB, OsRbohA, OsRbohC and AtRbohF.

Multiple alignments of the predicted ZmRbohB, OsRbohA, OsRbohC and AtRbohF proteins was made with the CLUSTALW program. A line above
the alignment is used to mark strongly conserved positions. Three characters (‘∗ ’, ‘:’ and ‘.’) are used. Dashes indicate gaps in the sequence to allow
for maximal alignment. Six potential transmembrane-spanning domains (TMD 1 to TMD 6) are indicated with overlines. Histidine residues involved
in heme binding are boxed in gray scale. Solid triangles under the sequences indicate amino acid residues that are required for the human nicotine
adenine dinucleotide phosphate (NADPH) oxidase function and conserved between gp91phox and the Rboh proteins (Segal et al. 1992; Torres et al.
1998). EF hand motifs in the N-terminal domain of Rbohs are overlined. Beneath these motifs is the sequence of a canonical helix E-loop-helix F
(Kretsinger 1996). n is usually a hydrophobic residue. Dashed indicate variable amino acid residues. X, Y, Z, and -X, contain oxygen within their side
chains. Carbonyl oxygen of # serves as a ligand. -Z is usually glutamic acid. The GenBank accession numbers of the rboh genes are DQ890023,
NM 001050700, NM 001062650, NM 105079, respectively.

1998; Kwak et al. 2003) proteins whose transcription has been
shown to be induced by biotic stress. The second sub-group
only includes three Arabidopsis Rboh proteins, AtRbohA, C and
G. The fourth major cluster consists of four proteins of unknown
function, AtRbohH, AtRbohJ, OsRbohD and OsRbohE (Sagi
and Fluhr 2006).
Alternative splicing of the ZmrbohB mRNA
To confirm our deduced cDNA sequence, reverse transcrip-
tion (RT)-PCR was carried out using the primers PBF1 and
PBR1 located at 5 and 3 UTR (untranslated region). After
sequencing, two transcripts, the shorter ZmrbohB-α and the
longer ZmrbohB-β, were identified (GenBank accession nos.:
ZmrbohB-α, DQ890023; ZmrbohB-β, EU807966). Compared
with ZmrbohB-α, which was identical to the deduced cDNA
sequence, ZmrbohB-β retained an excessive 112 bp fragment
(Figure 3).
This observation prompted us to study whether the ZmrbohB
gene presented alternative splicing by an intron retention event.
The ZmrbohB genomic sequence was isolated by nested long
distance PCR. Sequence comparison with genomic DNA se-
quence (GenBank accession no.: EU523147) revealed that two
transcripts were synthesized as the result of an alternative
splicing of a single precursor mRNA. The coding region of
ZmrbohB-α was composed of fourteen exons interrupted by
thirteen introns, and all of the sequences at exon-intron junc-
tions followed the GT-AG rule. This transcript was a potential
290 Journal of Integrative Plant Biology Vol. 51 No. 3 2009

Figure 2. Unrooted phylogenetic tree of various higher plant respiratory burst oxidase homologs.

Accession number of each sequence used for the alignment is indicated between brackets. Bootstrap values of 50% or higher are shown on significant
nodes. Species names are: At, Arabidopsis thaliana; Le, Lycopersicon esculentum; Nb, Nicotiana benthamiana; Nt, Nicotiana tabacum; Os, Oryza
sativa; St, Solanum tuberosum; Zm, Zea mays.

functional isoform. ZmrbohB-β retained an unspliced intron cleotides upstream of the exon11-12 junction, and followed
11 with a TGA termination codon, i.e., presumably contained the 50 bp-PTC rule in mammals (Nagy and Maquat 1998). So
one premature termination codon (PTC) in the reading frame this PTC-containing transcript would be the target of nonsense-
(Figure 3). The PTC in ZmrbohB-β was farther than 94 nu- mediated decay (NMD) pathway and regulate ZmrbohB mRNA
 Rboh Gene from Maize 291

Figure 3. Alternative splicing by intron retention of ZmrbohB transcripts and its effects on predicted translational products.

(A) Schematic of ZmrbohB gene organization, showing two splice variants by alternative splicing. Exons are shown as numbered boxes, while introns
are represented as thin lines.
(B) Comparison of splice variants of ZmrbohB gene and deduced amino acid sequences around locations of alternative splice. An unspliced intron in
ZmrbohB-β is boxed in gray scale. The terminated codons are indicated with overlines.

stability, if that pathway is to operate in plants as in humans
(Wang and Brendel 2006; Ali and Reddy 2008). Alternative
splicing in the coding region of the plant rboh gene is, to the
best of our knowledge, not reported. This finding indicated that
ZmRbohB activity may be regulated by mRNA splicing.
The expression of these alternative-spliced transcripts in
various maize tissues was investigated by RT-PCR using the
primers Prb1 and 2. The primer Prb1 bridged the exon 9-10
junction and the Prb2 located at exon 12. The results showed
that the ZmrbohB transcripts were detected throughout the
292 Journal of Integrative Plant Biology Vol. 51 No. 3 2009

Figure 4. Expression of ZmrbohB gene in various tissues.

Total RNA extracted from seedlings (roots, stems, and leaves) and adult plants (roots, stems, leaves, ears and male flowers). Total RNAs were
reverse-transcribed to cDNA and amplified by polymerase chain reaction (PCR) using primers (Pbr1 and Pbr2). The actin gene served as an internal
control.

plant (Figure 4). The transcripts of ZmrbohB-α accumulated

more abundantly than those of ZmrbohB-β in all of the tissues
examined (Figure 4). Furthermore, ZmrbohB was differentially
expressed in various tissues and at different developmen-
tal stages (Figure 4). In seedlings, the expression levels of
ZmrbohB-α and -β in leaves and stems were higher than those
in roots. In adult plants, the expression of both ZmrbohB-α
and -β was found to be higher in stems than in leaves, roots
and male flowers, and was faint in ears (Figure 4).

Changes in mRNA level of ZmrbohB in response to abiotic

stresses (salt stress, low temperature, heat, ultraviolet
Figure 5. Expression analysis of ZmrbohB-α under NaCl, cold, UV and
and wounding)
heat treatment using semi-quantitative reverse transcription-polymerase
Growing evidence indicates that plant NOXs are involved in chain reaction (RT-PCR).
several signal transduction pathways in plants (Torres and
(A) 200 mM NaCl treatment.
Dangl 2005). Thus, we first examined the effects of some abiotic
(B) Cold treatment at 4 ◦ C.
stresses on the expression of ZmrbohB-α in maize seedling
(C) UV treatment.
leaves. One set of E-E-jn (exon-exon junction) primers Prb1
(D) Heat treatment at 40 ◦ C.
and Prb3, which spanned intron 9 and intron 11 respectively,
(E) Controls (no treatment).
was designed, and contaminating ZmrbohB-β will not be am-
(F) The actin gene was used as the internal control for normalization of
plified by these primers. It was found that the response of
RNA loading.
ZmrbohB-α to 200 mM NaCl started 1 h after treatment and
kept a high level within 4 h, then declined (Figure 5A). The
accumulation of ZmrbohB-α transcript was markedly induced by
4 ◦ C treatment. The transcripts increased within 30 min, reached
the top level at 1 h, and returned to the control level at 4 h
(Figure 5B). A similar change in the expression of ZmrbohB-α
was observed in the leaves of maize seedlings exposed to UV
treatment, when compared with that of cold treatment, although
the response of ZmrbohB-α to UV was weaker (Figure 5C).
ZmrbohB-α expression was also upregulated by heat treatment,
Figure 6. Expression analysis of ZmrbohB-α under wounding treatment
which increased within 2 h after initiation of the stimuli and
using semi-quantitative reverse transcription-polymerase chain reaction
reduced after 4 h (Figure 5D). After wounding, transcript levels
(RT-PCR).
of ZmrbohB-α increased transiently and rapidly. The mRNA
accumulation increased markedly within 30 min, the peak ap- (A) Wounding treatment.
peared at 45 min, and then decreased to the base level after (B) Controls (no treatment).
1 h (Figure 6A). Moreover, we examined the effects of several (C) The actin gene was used as the internal control for normalization of
abiotic stresses on the alternative splicing pattern of ZmrbohB RNA loading.
 Rboh Gene from Maize 293

Figure 7. The alternative splicing pattern of ZmrbohB under various

stress conditions.

The maize seedlings treated by NaCl (200 mM, 2 h), cold (4 ◦ C, 2 h),
heat (40 ◦ C, 2 h), UV (2 h) and wounding (45 min) were used for reverse
transcription-polymerase chain reaction (RT-PCR) analysis.

Total RNAs were reverse-transcribed to cDNA and amplified by PCR

using primers (Pbr1 and Pbr2). The band density was quantified by
Quantity One software (Bio-Rad Laboratories, Hercules, CA, USA).
Numbers below each lane indicate band density of ZmrbohB-β relative
to ZmrbohB-α. Values represent the averages (av) and SD of three
independent replicates. The actin gene served as an internal control.
∗
Significantly different (P < 0.05, one way ANOVA) compared with values
Figure 8. Real-time polymerase chain reaction (PCR) analysis of the
for cont. (control, 0 h).
ZmrbohB transcripts under various stress conditions.

in maize seedling leaves. Compared with the control samples
(no stress treatment), the ratio of ZmrbohB-β/ZmrbohB-α was
reduced under salt stress conditions (Figure 7). Similar results
were observed under cold, heat and UV stress conditions (Fig-
ure 7). Nevertheless, the alternative splicing pattern of ZmrbohB
was not changed by wounding (Figure 7). In addition, the
transcription pattern of ZmrbohB was further analyzed by real-
time quantitative PCR. Results indicated that the transcription
levels of ZmrbohB were upregulated under different treatments
(Figure 8).
Discussion
The NOXs play pivotal roles in plant stress responses, growth
and development (Torres and Dangl 2005), and several rboh
genes have been identified in different plant genomes, including
10 members in genome of Arabidopsis (Foreman et al. 2003),
and nine members in rice (Wong et al. 2007). However, most
studies in plants are carried out in dicot plants such as Arabidop-
sis, tobacco and potato. Moreover, the phylogenetic analysis
revealed that AtRbohB, E and F, formed monophyletic sub-
groups with two rice proteins, respectively (Figure 2). But there
was one clade that only consisted of three Arabidopsis Rbohs,
AtRbohA, C and G, without rice isoforms (Figure 2) (Yamamizo
et al. 2007). These suggest that sequence-based phylogenetic
clustering of Rboh orthologs among different species could not
reliably predict their functions, and they must be established
experimentally on a case-by-case basis.
In maize seedlings, increasing pharmacological studies have
also showed that NOX-mediated ROS play an important role in
The maize seedlings treated by NaCl (200 mM, 2 h), cold (4 ◦ C, 2 h),
heat (40 ◦ C, 2 h), UV (2 h) and wounding (45 min) were used for real-
time PCR analysis. Columns represent the relative expression levels of
ZmrbohB transcripts. The mRNA amount in control seedlings (control,
0 h) served as a calibrator for the calculation of relative expression
levels in all cases (relative expression arbitrarily set to one). The data
are presented as means and SE from three independent replicates.
signaling and development (Jiang and Zhang 2003; Rodriguez
et al. 2007). For example, NOXs may implicate in the ABA
signal transduction pathway leading to the induction of antiox-
idant defense systems (Jiang and Zhang 2003; Zhang et al.
2006; Hu et al. 2007). However, maize DNA sequences that
encode NOXs have not been reported, the detailed molecular
mechanisms remain to be determined.
In this study, we isolated a novel rboh gene from maize,
namely ZmrbohB, and the amino acid sequence comparison
revealed that ZmRbohB was most similar to rice OsRbohC
(85.8% identity). It also had high sequence identity to rice
OsRbohA (74.1% identity), which was induced in response to
pathogen attack (Yoshie et al. 2005). Moreover, this comparison
showed that the maize sequence contained several features
common to NOX and contributing to the catalytic activity of
these enzymes, such as EF hand motifs, six transmenbrane-
spanning domains, and binding sites for the FAD, the NADPH-
ribose and the NADPH-adenine (Figure 1). Recently using the
maize expressed sequence tag (EST) and genomic sequence
databases, we have identified five full length and four partial
rboh sequences, bringing the total number for presently known
maize rboh genes to at least nine (Y Zhang, MY Jiang, unpubl.
294 Journal of Integrative Plant Biology Vol. 51 No. 3 2009
data, 2008). It will be interesting to see further studies on the
maize rboh gene family and molecular evolution of rboh genes
in plants.
In the present study, we found that the ZmrbohB gene
presented alternative splicing by intron retention events (Fig-
ures 3, 4, 7). Two ZmrbohB splice variants were differentially
expressed in various tissues and at different developmental
stages, and the major product was ZmrbohB-α (Figure 4).
Alternative splicing is an important posttranscriptional regulatory
mechanism that can increase protein diversity and affect mRNA
stability. Considerable attention has been paid to its function in
plants. In recent bioinformatics studies, alignment of cDNA/EST
with genomic sequences has revealed that the frequency of
alternatively spliced genes in plants is high and intron retention
is the predominant mode (Wang and Brendel 2006; Ner-Gaon
et al. 2007). For example, 20%–30% of expressed genes
are alternatively spliced in A. thaliana and O. sativa (Wang
and Brendel 2006). However, there are a few reports regard-
ing the experimental analysis of individual genes in maize.
Our results revealed that there were at least two ZmrbohB
splice variants, ZmrbohB-α and -β, in maize. Compared with
ZmrbohB-α, ZmrbohB-β retained an unspliced intron 11, i.e.,
intron retention (Figure 3). In human, NOX5, a homolog to
gp91phox , has been described with four splice variants, and they
contribute to ROS signaling in the vasculature (BelAiba et al.
2007). Even though the several biological roles of plant rboh
genes have been extensively studied, no information about the
alternative splicing of plant rboh genes is available. Here, it is
clear that the regulation of alternative splicing occurs at the
coding region of ZmrbohB (Figures 3, 4), but its biological roles
remain to be elucidated.
In the present study, we also analyzed the transcriptional
patterns of ZmrbohB against a variety of abiotic stresses. In
recent years, more and more studies have shown that tran-
scriptional activation of some plant rboh genes is common,
especially under pathogenic attack. For instance, the mRNA of
NtrbohD may accumulate when Nicotiana tabacum leaves and
cells are treated with the fungal elicitor cryptogein (Simon-Plas
et al. 2002), and NbrbohB is induced specifically by the protein
elicitor INF1 from the potato pathogen Phytophthora infestans
as well (Yoshioka et al. 2003; Asai et al. 2008). OsrbohA
and OsrbohC transcripts, which play a role in rice immune
response, are induced after inoculation with an incompatible
pathogen (Yoshie et al. 2005; Wong et al. 2007). In A. thaliana
suspension cultures, treatments with harpin elicitor or hydro-
gen peroxide induce the expression of the AtrbohD gene
(Deskian et al. 1998). Likewise, expression of both AtrbohD and
AtrbohF mRNAs are upregulated by ABA in Arabidopsis guard
cells (Kwak et al. 2003). Moreover, a series of studies also
demonstrate that Solanum tuberosum at least contains five
Strboh genes, StrbohA-D and F (Yoshioka et al. 2001; Kumar
et al. 2007; Yamamizo et al. 2007). Of the five NOXs in potato,
StrbohB-D genes are induced by pathogen signals, and the
mitogen-activated protein kinases (MAPKs) seem to play a
central role in the regulation of pathogen-responsive NOX at the
transcriptional level (Yoshioka et al. 2001; Yoshioka et al. 2003;
Yamamizo et al. 2007). Here, we provide evidence that the
full-length functional isoform, ZmrbohB-α, becomes activated
by transcriptional control under several abiotic stress stimuli
(Figures 5, 6). For example, the level of transcript encoding
ZmrbohB-α was enhanced transiently and rapidly after wound-
ing. Similar results are found with transcripts encoding StrbohA
in potato (Kumar et al. 2007). Under heat treatment, ZmrbohB-
α expression was upregulated. Arabidopsis rboh mutants were
also shown to be more sensitive to heat stress (Larkindale
et al. 2005). A continued increase was also observed for cold
treated samples until 2 h. That is similar to Lerboh1, whose
expression is induced by treatment at 2–4 ◦ C (Amicucci et al.
1999). Furthermore, the results of RT-PCR also indicated that
the expression of the ZmrbohB-α gene was induced by salt
stress. On the other hand, ZmrbohB also underwent alternative
splicing in response to a variety of abiotic stresses. Our results
revealed that the changes of alternative splicing pattern were
similar in maize seedlings treated with salt, cold, heat and UV.
The relative ratio of transcripts that retained alternative introns
was reduced by these external stimuli. These results indicate
that some stresses regulate the splicing of ZmrbohB through a
common mechanism. The relative ratio of these two transcripts
was, however, not changed by wounding, suggesting that the
constitutive presence of the two isoforms may be needed for
wound response. That is similar to the tomato prosystemin,
whose alternative splicing pattern is not changed by wounding
(Li and Howe 2001). Taken together these results indicate that
there is not one single signaling pathway that relays stress con-
ditions to ZmrbohB splicing machinery and alternative splicing
leads to a net increase in the functional isoform under various
abiotic stresses. In plants, serine/arginine-rich (SR) proteins are
widely believed be the major regulators of alternative splicing
and a majority of SR genes display alternative splicing specific
to a given stress (Ali and Reddy 2008). Thus, different stresses
may regulate ZmrbohB sometimes through different signaling
components, likely through different SR proteins or their iso-
forms. Since expression of ZmrbohB was changed by wounding,
cold, heat, UV and salt-stress, it is a reasonable hypothesis
that a putative ZmRbohB-mediated ROS is a common signaling
event that is shared by various signaling pathways leading to
activation of abiotic-stress responses in maize, just like the
hypothesis that NOXs act as a major source of ROS production
in many different signals (Torres and Dangl 2005). However,
whether induction of ZmrbohB gene expression is required for
its activity regulation will be needed to be studied further. The
identification of the cis-acting elements presented in this rboh
gene promoter and the cognate trans-acting factors may be the
important step, and transgenic analysis may also be helpful in
addressing whether the ZmRbohB is a regulator of abiotic-stress
tolerance.

Materials and Methods
Plant materials and treatments
Seeds of maize (Zea mays L. cv Nongda 108; from Nanjing
Agricultural University, China) were sown in trays of sand in a
light chamber at a temperature of 25–28 ◦ C, with a photosyn-
thetic active radiation (PAR) of 200 μmol/m2 per s with a 14:10 h
light : dark (LD) cycle, and watered daily.
For the tissue-specific experiments, seedlings and adult
plants were grown for 10 or 60 d after germination, respectively,
and various tissues of seedlings (roots, stems and leaves) and
adult plants (roots, stems, leaves, ears and male flowers) were
harvested, frozen immediately in liquid nitrogen, and stored at
−80 ◦ C until use.
To detect responses of the gene to some abiotic stresses,
the plants were excised at the base of the stem and collected
when the second leaves were fully expanded. Detached plants
were then placed in the distilled water with a continuous light
intensity of 200 μmol/m2 per s for 1 h to eliminate wound
stress. For salt (NaCl) treatment, plants were transferred into
solutions containing 200 mM NaCl and cultivated at 28 ◦ C.
Heat stress treatment was imposed incubating at 40 ◦ C. In
the low temperature experiment, plants were exposed to 4 ◦ C.
For ultraviolet (UV) treatment, plants were exposed to UV light
(254 nm, 16 W) at a 50 cm distance from the lamp (CAMAG,
Muttenz, Switzerland). At 0, 0.5, 1, 2, 4 and 8 h after every
treatment, the second leaves were sampled and immediately
frozen in liquid nitrogen for further analysis. For wounding
treatment, plants were wounded by crushing their second leaves
four times with forceps. At time 0, 15, 30, 45, 60 and 120 min
after wounding treatment, the second leaves were sampled
and immediately frozen in liquid nitrogen. Detached plants were
treated with distilled water for the whole period and served as
controls.
Primers
The primers used in this study are presented in Table 1.
RNA preparation, cDNA synthesis and DNA extraction
Total RNA was isolated from leaves using Plant RNA Purifica-
tion Reagent (Tiangen Biotech Co., Ltd. Beijing) according to
the manufacturer’s instructions. DNase treatment was included
in the isolation step using the RNase-free DNase (TaKaRa,
Dalian, China). Approximately 2 μg of total RNA were reverse
transcribed using oligo d(T) 16 primer and M-MLV reverse tran-
scriptase (Promega, Madison, WI, USA) at 42 ◦ C for 60 min.
Genomic DNA was isolated from seedling leaves using a hex-
adecyltrimethylammonium bromide (CTAB) method (Arechaga-
Ocampo et al. 2001). The quality and concentration of RNA
Rboh Gene from Maize 295
and DNA samples were examined by ethidium bromide-stained
agarose gel electrophoresis and spectrophotometer analysis.
Cloning of the cDNA encoding ZmrbohB
To get the internal conservative fragment, degenerate oligonu-
cleotides Pzrb3 and Pzrb4 (Table 1) were designed and syn-
thesized based on the conserved amino acid and nucleotide
sequences of plant rboh genes. RT-PCR was programmed as
below: pre-denatured at 94 ◦ C for 3 min, followed by 35 cycles
of amplification (94 ◦ C for 40 s, 52 ◦ C for 40 s, 72 ◦ C for 2 min),
and then followed by extension for 5 min at 72 ◦ C. The resulting
major fragment was cloned into pMD18-T vector (TaKaRa) and
three clones were sequenced in both directions. This sequence
(1 360 bp) was compared with sequences deposited in the Gen-
Bank database using the BLAST program at the National Center
for Biotechnology Information (www.ncbi.nlm.nih.gov), and a
matching sequence (maize Unigene CL562_1, AY109999.1)
was found. Gene-specific primers Pzrb11 and Pzrb12 (Table 1)
from this Unigene were designed for PCR to identify.
A 5 RACE approach (Invitrogen, Carlsbad, CA, USA) was
used to isolate the unknown 5 region of the ZmrbohB according
to the manufacturer’s recommendations. In detail, first-strand
synthesis for the ZmrbohB cDNA was carried out with the
gene-specific primer (ZmGSP1-1, Table 1). The cDNA was
amplified with a gene-specific primer (ZmGSP2-1, Table 1)
and the kit 5 primer (AAP, Table 1) followed by nested PCR
with a gene-specific primer (ZmGSP3-1, Table 1) and the kit
nested 5 primer (AUAP, Table 1). The 428 bp PCR product was
ligated into pMD18-T vector, cloned and sequenced. Based on
informative sequence data, new gene-specific primers (Table 1)
were designed and applied in additional 5 RACE experiments
as one walks toward the 5 -end.
By aligning the sequences of 5 RACE and the partial region
products, the full-length cDNA sequence of ZmrbohB was
deduced and then amplified using gene-specific primers PBF1
and PBR1 (Table 1). After being sequenced, the full-length
cDNA of ZmrbohB was subsequently analyzed for molecular
characterization.
Full-length genomic sequence amplification of ZmrbohB
The genomic sequence was amplified with gene-specific
primers PBF1 and PBR1 followed by nested PCR with gene-
specific primer PBF2 and PBR2 (Table 1). The major PCR
product was cloned and sequenced.
Phylogenetic analysis
Protein data matrices were aligned using ClustalX multiple
sequence alignment program (version 1.83) with default gap
penalties and further manual adjustments to minimize gap
296 Journal of Integrative Plant Biology Vol. 51 No. 3 2009

Table 1. The primers used in the analysis of the novel rboh gene, ZmrbohB, from maize
Abbreviation Sequence (5 -3 ) Description
Pzrb3 GCWGARACWMTIAARYTCAACAT Degenerate primer, Forward
Pzrb4 CCAATTWGGYYTAGCRAARTG Degenerate primer, Reverse
Pzrb11 AGCTGTCCAGGCTTAAGGAG Gene specific primer, Forward
Pzrb12 GTCCAGAACTCCAGATGAACATACC Gene specific primer, Reverse
AAP GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG Abridged anchor primer
AUAP GGCCACGCGTCGACTAGTAC Abridged universal amplification primer
ZmGSP1-1 AGTCCAGCCATTATTC Reverse primer for 5 RACE
ZmGSP2-1 GGTCTCCAACTGCCACAACTCAATG Reverse primer for 5 RACE
ZmGSP3-1 CCATAATCAGGGCGGCATACTC Reverse primer for 5 RACE
ZmGSP5-1 CGTTCTTATCCACCAT Reverse primer for 5 RACE
ZmGSP6-3 GCACCTGACGGCGGCGGCTC Reverse primer for 5 RACE
ZmGSP7-2 GAAGTCGGAGCGGGAGAGGAAAC Reverse primer for 5 RACE
ZmGSP9-2 GACTCGATGCCTGAC Reverse primer for 5 RACE
ZmGSP10-1 GGTGAGGTCCTGCGAGAAC Reverse primer for 5 RACE
ZmGSP11-3 GCCTGATCGACGGCGACAAGG Reverse primer for 5 RACE
PBF1 GCCCACCGTACTCGCCTTCTCATCCTCAT Gene specific primer, Forward
PBR1 GCTACCGACAATCCCAACTACTCTTTATCTTCAT Gene specific primer, Reverse
PBF2 ATTGCTGTCTCGTTGCGCTTCCTCTTTC Nested gene specific primer, Forward
PBR2 CGTCCAGAACTCCAGATGAACATACCAAG Nested gene specific primer, Reverse
Prb1 CAAGAAAGCCTTACCAAAAC ZmrbohB gene specific primer for RT-PCR analysis, Forward
Prb2 TCCTTCCTCATAAACACTCG ZmrbohB gene specific primer for RT-PCR analysis, Reverse
Prb3 CAATAATATTCCTTTGGTCCAG ZmrbohB-α gene specific primer for RT-PCR analysis, Reverse
Actin1 GCGAACAACTGGTATTGTG Actin gene specific primer for RT-PCR analysis, Forward
Actin2 CATCTGCTGCTGAAAAGTG Actin gene specific primer for RT-PCR analysis, Reverse
Prb5 ACCCTTTGAATGGCATCCG ZmrbohB gene specific primer for real-time RT-PCR analysis, Forward
Prb6 AAGGAGTTGCACCAATCCCTAAT ZmrbohB gene specific primer for real-time RT-PCR analysis, Reverse
Actin3 GATTCCTGGGATTGCCGAT Actin gene specific primer for real-time RT-PCR analysis, Forward
Actin4 TCTGCTGCTGAAAAGTGCTGAG Actin gene specific primer for real-time RT-PCR analysis, Reverse
RACE, rapid amplification of cDNA ends; RT-PCR, reverse transcription-polymerase chain reaction.

insertions. Phylogenetic tree was inferred by the neighbor-
joining (NJ) algorithm as implemented in the program PAUP
4.0b10 (Sinauer Associates, Sunderland, MA, USA) and 1 000
bootstrap replicates were carried out. Graphical output was
produced by Treeview, and figures were prepared in Illustrator
10.0 (Adobe Systems Incorporated, San Jose, CA, USA).
RT-PCR analysis of ZmrbohB mRNA accumulation
Total RNA was isolated from a given tissue and cDNA
was reverse transcribed as described above. To identify the
alternative-splicing patterns by semi-quantitative RT-PCR, two
primers Prb1 and Prb2 were used (Table 1). The primer Prb1
bridged the exon 9-exon 10 junction and the Prb2 corresponded
to exon 12. Another reverse E-E-jn primer Prb3 was designed to
span the intron 11 (Table 1) to differentiate between ZmrbohB-α
and -β. cDNA was amplified by PCR using Prb1 and Prb3
to detect responses of the ZmrbohB-α to abiotic stresses. To
standardize the results, the maize actin (GenBank accession
no. J01238) was used as an internal control for RT-PCR
with primers Actin1 and Actin2 (Table 1). The cycle number
of the PCR reactions was adjusted for each gene to obtain
barely visible bands in agarose gels. Aliquots of the PCR
reactions were loaded on agarose gels and stained with ethid-
ium bromide.
To confirm some of the semi-quantitative RT-PCR results,
real-time RT-PCR was carried out in a DNA Engine Opticon
2 Real-Time PCR Detection System (Bio-Rad Laboratories,
Hercules, CA, USA) using the SYBR Premix Ex Taq (TaKaRa)
according to the manufacturer’s instructions. Each PCR reaction
(20 μL) contained 10 μL 2× real-time PCR Mix (containing
SYBR Green I), 0.2 μM of each primer (Table 1) and appropriate
diluted cDNA. The thermal cycling conditions were 95 ◦ C for 10 s
followed by 40 cycles of 94 ◦ C for 5 s, 62 ◦ C for 10 s and 72 ◦ C
for 15 s. The expression of ZmrbohB was normalized to actin.
The relative changes in ZmrbohB transcripts were calculated
as χ-fold changes relative to the control samples (0 h). Each
treatment was repeated three times independently.

References
Ali GS, Reddy AS (2008). Regulation of alternative splicing of pre-
mRNAs by stresses. Curr. Top. Microbiol. Immunol. 326, 257–275.
Amicucci E, Gaschler K, Ward JM (1999). NADPH oxidase genes
from tomato (Lycopersicon esculentum) and curly-leaf pondweed
(Potamogeton crispus). Plant Biol. 1, 524–528.
Arechaga-Ocampo E, Saenz-Rivera J, Sarath G, Klucas RV,
Arredondo-Peter R (2001). Cloning and expression analysis of
hemoglobin genes from maize (Zea mays ssp. mays) and teosinte
(Zea mays ssp. parviglumis). Biochim. Biophys. Acta 1522, 1–8.
Asai S, Ohta K, Yoshioka H (2008). MAPK signaling regulates nitric
oxide and NADPH oxidase-dependent oxidative bursts in Nicotiana
benthamiana. Plant Cell 20, 1390–1406.
BelAiba RS, Djordjevic T, Petry A, Diemer K, Bonello S, Banfi B
et al. (2007). NOX5 variants are functionally active in endothelial
cells. Free Radic. Biol. Med. 42, 446–459.
Carter C, Healy R, O’Tool NM, Naqvi SM, Ren G, Park S et al. (2007).
Tobacco nectaries express a novel NADPH oxidase implicated in the
defense of floral reproductive tissues against microorganisms. Plant
Physiol. 143, 389–399.
Cheng G, Cao Z, Xu X, van Meir EG, Lambeth JD (2001). Homologs of
gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5.
Gene 269, 131–140.
Deskian R, Burnett E, Hancock J, Neill S (1998). Harpin and hydrogen
peroxide induce the expression of a homologue of gp91-phox in
Arabidopsis thaliana suspension cultures. J. Exp. Bot. 49, 1767–
1771.
Finegold AA, Shatwell KP, Segal AW, Klausner RD, Dancis A (1996).
Intramembrane bis-heme motif for transmembrane electron transport
conserved in a yeast iron reductase and the human NADPH oxidase.
J. Biol. Chem. 271, 31021–31024.
Foreman J, Demidchik V, Bothwell JH, Mylona P, Miedema H, Torres
MA et al. (2003). Reactive oxygen species produced by NADPH
oxidase regulate plant cell growth. Nature 422, 442–446.
Groom QJ, Torres MA, Fordham-Skelton AP, Hammond-Kosack KE,
Robinson NJ, Jones JD (1996). rbohA, a rice homologue of the
mammalian gp91phox respiratory burst oxidase gene. Plant J. 10,
515–522.
Hu X, Jiang M, Zhang J, Zhang A, Lin F, Tan M (2007). Calcium-
calmodulin is required for abscisic acid-induced antioxidant defense
and functions both upstream and downstream of H 2 O 2 production in
leaves of maize (Zea mays) plants. New Phytol. 173, 27–38.
Jiang M, Zhang J (2003). Cross-talk between calcium and reactive
oxygen species originated from NADPH oxidase in abscisic acid-
induced antioxidant defence in leaves of maize seedlings. Plant Cell
Environ. 26, 929–939.
Joo JH, Wang S, Chen JG, Jones AM, Fedoroff NV (2005). Different
signaling and cell death roles of heterotrimeric G protein alpha and
beta subunits in the Arabidopsis oxidative stress response to ozone.
Plant Cell 17, 957–970.
Keller T, Damude HG, Werner D, Doerner P, Dixon RA, Lamb C
(1998). A plant homolog of the neutrophil NADPH oxidase gp91phox
Rboh Gene from Maize 297
subunit gene encodes a plasma membrane protein with Ca2+ binding
motifs. Plant Cell 10, 255–266.
Kretsinger RH (1996). EF-hands reach out. Nat. Struct. Biol. 3, 12–15.
Kumar GN, Iyer S, Knowles NR (2007). Strboh A homologue of NADPH
oxidase regulates wound-induced oxidative burst and facilitates
wound-healing in potato tubers. Planta 227, 25–36.
Kwak JM, Mori IC, Pei ZM, Leonhardt N, Torres MA, Dangl JL et al.
(2003). NADPH oxidase AtrbohD and AtrbohF genes function in
ROS-dependent ABA signaling in Arabidopsis. EMBO J. 22, 2623–
2633.
Larkindale J, Hall JD, Knight MR, Vierling E (2005). Heat stress
phenotypes of Arabidopsis mutants implicate multiple signaling
pathways in the acquisition of thermotolerance. Plant Physiol. 138,
882–897.
Li L, Howe GA (2001). Alternative splicing of prosystemin pre-mRNA
produces two isoforms that are active as signals in the wound
response pathway. Plant Mol. Biol. 46, 409–419.
Mazel A, Leshem Y, Tiwari BS, Levine A (2004). Induction of salt and
osmotic stress tolerance by overexpression of an intracellular vesicle
trafficking protein AtRab7 (AtRabG3e). Plant Physiol. 134, 118–
128.
Nagy E, Maquat LE (1998). A rule for termination-codon position within
intron-containing genes: when nonsense affects RNA abundance.
Trends Biochem. Sci. 23, 198–199.
Ner-Gaon H, Leviatan N, Rubin E, Fluhr R (2007). Comparative cross-
species alternative splicing in plants. Plant Physiol. 144, 1632–
1641.
Rodriguez AA, Ramiro Lascano H, Bustos D, Taleisnik E (2007).
Salinity-induced decrease in NADPH oxidase activity in the maize
leaf blade elongation zone. J. Plant Physiol. 164, 223–230.
Sagi M, Davydov O, Orazova S, Yesbergenova Z, Ophir R, Stratmann
JW et al. (2004). Plant respiratory burst oxidase homologs impinge
on wound responsiveness and development in Lycopersicon escu-
lentum. Plant Cell 16, 616–628.
Sagi M, Fluhr R (2006). Production of reactive oxygen species by plant
NADPH oxidases. Plant Physiol. 141, 336–340.
Segal AW, West I, Wientjes F, Nugent JH, Chavan AJ, Haley B et al.
(1992). Cytochrome b-245 is a flavocytochrome containing FAD and
the NADPH-binding site of the microbicidal oxidase of phagocytes.
Biochem. J. 284(Pt 3), 781–788.
Simon-Plas F, Elmayan T, Blein JP (2002). The plasma membrane ox-
idase NtrbohD is responsible for AOS production in elicited tobacco
cells. Plant J. 31, 137–147.
Takeda S, Gapper C, Kaya H, Bell E, Kuchitsu K, Dolan L (2008).
Local positive feedback regulation determines cell shape in root hair
cells. Science 319, 1241–1244.
Torres MA, Dangl JL (2005). Functions of the respiratory burst oxidase
in biotic interactions, abiotic stress and development. Curr. Opin.
Plant Biol. 8, 397–403.
Torres MA, Dangl JL, Jones JD (2002). Arabidopsis gp91phox ho-
mologues AtrbohD and AtrbohF are required for accumulation of
reactive oxygen intermediates in the plant defense response. Proc.
Natl. Acad. Sci. USA 99, 517–522.
298 Journal of Integrative Plant Biology Vol. 51 No. 3 2009
Torres MA, Jones JD, Dangl JL (2005). Pathogen-induced, NADPH
oxidase-derived reactive oxygen intermediates suppress spread of
cell death in Arabidopsis thaliana. Nat. Genet. 37, 1130–1134.
Torres MA, Onouchi H, Hamada S, Machida C, Hammond-Kosack
KE, Jones JD (1998). Six Arabidopsis thaliana homologues of the
human respiratory burst oxidase (gp91phox). Plant J. 14, 365–370.
Wang BB, Brendel V (2006). Genomewide comparative analysis of
alternative splicing in plants. Proc. Natl. Acad. Sci. USA 103, 7175–
7180.
Wong HL, Pinontoan R, Hayashi K, Tabata R, Yaeno T, Hasegawa
K et al. (2007). Regulation of rice NADPH oxidase by binding of Rac
GTPase to its N-terminal extension. Plant Cell 19, 4022–4034.
Yamamizo C, Doke N, Yoshioka H, Kawakita K (2007). Involvement
of mitogen-activated protein kinase in the induction of StrbohC and
StrbohD genes in response to pathogen signals in potato. J. Gen.
Plant Pathol. 73, 304–313.
Yoshie Y, Goto K, Takai R, Iwano M, Takayama S, Isogai A et al.
(2005). Function of the rice gp91phox homologs OsrbohA and
OsrbohE genes in ROS-dependent plant immune responses. Plant
Biotechnol. 22, 127–135.
Yoshioka H, Numata N, Nakajima K, Katou S, Kawakita K, Rowland
O et al. (2003). Nicotiana benthamiana gp91phox homologs Nbr-
bohA and NbrbohB participate in H 2 O 2 accumulation and resistance
to Phytophthora infestans. Plant Cell 15, 706–718.
Yoshioka H, Sugie K, Park HJ, Maeda H, Tsuda N, Kawakita K et al.
(2001). Induction of plant gp91 phox homolog by fungal cell wall,
arachidonic acid, and salicylic acid in potato. Mol. Plant Microbe In.
14, 725–736.
Zhang A, Jiang M, Zhang J, Tan M, Hu X (2006). Mitogen-activated
protein kinase is involved in abscisic acid-induced antioxidant de-
fense and acts downstream of reactive oxygen species production
in leaves of maize plants. Plant Physiol. 141, 475–487.
(Handling editor: Jianhua Zhang)