Research Article

Received: 31 May 2012 Revised: 14 November 2012 Accepted article published: 3 January 2013 Published online in Wiley Online Library: 7 March 2013

(wileyonlinelibrary.com) DOI 10.1002/ps.3480

In vitro antifungal activity of synthetic dsRNA

molecules against two pathogens of banana,
Fusarium oxysporum f. sp. cubense and
Mycosphaerella fijiensis
Francis M Mumbanza,a,b∗ Andrew Kiggundu,c Geoffrey Tusiime,b
Wilberforce K Tushemereirwe,a Chuck Niblettd and Anna Baileyd

Abstract
BACKGROUND: A key challenge for designing RNAi-based crop protection strategies is the identification of effective target
genes in the pathogenic organism. In this study, in vitro antifungal activities of a set of synthetic double-stranded RNA molecules
on spore germination of two major pathogenic fungi of banana, Fusarium oxysporum Schlecht f. sp. cubense WC Snyder & HN
Hans (Foc) and Mycosphaerella fijiensis Morelet (Mf) were evaluated.

RESULTS: All the tested synthetic dsRNAs successfully triggered the silencing of target genes and displayed varying degrees
of potential to inhibit spore germination of both tested banana pathogens. When Foc dsRNAs were applied to Foc spores,
inhibition ranged from 79.8 to 93.0%, and from 19.9 to 57.8% when Foc dsRNAs were applied to Mf spores. However, when
Mf dsRNAs were applied on Mf spores, inhibition ranged from 34.4 to 72.3%, and from 89.7 to 95.9% when Mf dsRNAs were
applied to Foc spores.

CONCLUSION: The dsRNAs for adenylate cyclase, DNA polymerase alpha subunit and DNA polymerase delta subunit showed
high levels of spore germination inhibition during both self- and cross-species tests, making them the most promising targets
for RNA-mediated resistance in banana against these fungal pathogens.

c 2013 Society of Chemical Industry

Keywords: double-stranded RNA; genes; RNA interference; spore germination inhibition

1 INTRODUCTION heterologous genes coding for antimicrobial peptide, defensin-

Two major fungal diseases, black Sigatoka caused by
Mycosphaerella fijiensis Morelet (Mf) and Panama disease or
Fusarium wilt caused by Fusarium oxysporum Schlecht f. sp.
cubense WC Snyder & HN Hans (Foc), threaten banana production
worldwide. They are reported to cause a yield loss of over 38%
and up to 50% respectively in some banana-producing regions.1,2
Host resistance has long been identified as the most feasible and
sustainable way of managing diseases in crops, including banana.
This is achievable using either conventional cross-breeding and/or
genetic modification (GM) approaches. However, owing to the
paucity of disease-resistant germplasms and the sterility of most
edible banana cultivars, genetic engineering is now regarded
as the best way to introduce resistance genes into this hard-
to-breed crop. Significant successes in the genetic engineering
of banana have been obtained as far as agrobacterium-
mediated transformation and microprojectile bombardment of
cell suspension are concerned.3 – 6 Transformation systems using
apical meristems7,8 as well as intercalary meristematic tissues9
have also been reported. These achievements have enabled
the experimentation of a number of technology platforms that
can confer an acceptable level of resistance to banana pests
related protein, degradative enzymes or other toxins.10 – 12 The
use of an ‘RNAi-based crop protection’ strategy is another exciting
and promising option. RNAi is a post-transcriptional regulation of
genes through interception and degradation of mRNA. Using this
strategy, it is possible to modulate or inhibit the expression of
one or more target genes in a phytopathogenic microorganism,
leading to cessation of infection, growth, development or
reproduction and eventual death of the pathogen. The RNAi
sequence is chosen so that it shares little or no homology with
∗
Correspondence to: Francis M Mumbanza, National Banana Research
Programme, National Agriculture Research Organisation, PO Box 7065,
Kampala, Uganda. E-mail: francismumbanza@yahoo.fr
a National Banana Research Programme, National Agriculture Research
Organisation, Kampala, Uganda
b Department of Crop Production, Makerere University, Kampala, Uganda
c National Agricultural Research Laboratories, National Agriculture Research
Organisation, Kampala, Uganda
1155

and pathogens. Strategies rely mainly on the expression of d Venganza, Inc., Raleigh, NC, USA

Pest Manag Sci 2013; 69: 1155–1162 www.soci.org

c 2013 Society of Chemical Industry
 www.soci.org
the host’s genes or those of other off-target organisms. Upon
parasitism, the RNAi sequence enters the parasite, and post-
transcriptional gene silencing (PTGS) mechanisms are activated.13
Development of plant-derived RNAi for resistance against plant
pathogens and pests was first used to engineer host resistance
against viruses14 – 17 and bacteria.18 It was later demonstrated
for plant-parasitic nematodes,19 – 21 insects,22 – 24 and parasitic
weeds.25 The body of evidence on the effectiveness of RNAi to be
active and to protect plants against fungi is also growing. It has
been demonstrated against various species of Phytophthora,26
obligate parasites, including Blumeria27 and Puccinia,28 and
Fusarium verticillioides.29
A key challenge and crucial step for RNAi-based crop protection
strategies is the identification of effective target genes. One
approach to validate a candidate gene is to introduce an RNAi
elicitor molecule into pest cells and assess its effect on the silencing
phenotype.30,31 These investigations were conducted to assess
the effects of synthetic dsRNA molecules homologous to selected
target genes on Foc and Mf. The assessment was performed using
in vitro assays to measure the effects of the dsRNAs on spore
germination and subsequent colony establishment. The ultimate
objective was to identify the most effective gene segments to
test in RNAi-inducing constructs to provide resistance to black
Sigatoka and Panama disease in transgenic bananas.
2 MATERIALS AND METHODS
2.1 Microorganisms and cultivation
Ugandan isolates of Foc (obtained from the National Agricultural
Research Laboratories) and Mf (kindly provided by Dr L Tripathi,
IITA) and US isolates (kindly provided by Dr R Ploetz) were used
in this study. Foc was routinely cultured on potato dextrose agar
(PDA) (P2182; Sigma, UK). It was prepared with 39 g powder L−1
water and supplemented with ampicillin (A01040.0010; Duchefa
Biochemie, Netherlands) at 200 µg mL−1 agar at 28 ◦ C. Mf was
maintained on vegetable juice agar prepared with 300 mL of V8
juice (70512B3BD; Camden, NJ), 3 g of CaCO3 (AnalaR, 9999510 F;
BDH Chemicals Ltd, UK), 20 g agar L−1 water, supplemented with
ampicillin at 200 µg mL−1 agar (pH = 6.0) at room temperature
under white light. Harvesting of spores was done by flooding plate
cultures with sterile water and rubbing with a sterile spatula.
Water suspensions of spores were fragmented by vortexing
and filtered through a washed and sterilised double layer
of cheesecloth. The concentration of spores was determined
using a haemocytometer (1/10 mm deep, bright line; Boeco,
Germany) under optic microscopy (Orthoplan, Germany) at 40×
magnification. The concentration of spores was adjusted to the
appropriate working inoculum dilution.
2.2 Target genes
The target genes (Table 1) were chosen following consultation with
Venganza, Inc., and their unpublished data on the effectiveness
of dsRNAs transcribed from segments of those essential genes in
inhibiting spore germination of several fungal plant pathogens.
To confirm the presence of the target genes into the genome
of Ugandan and US isolates of Foc and Mf, PCR analyses were
performed. Genomic DNA was extracted from mycelia of colonies
growing on media by using the ZR fungal/bacterial DNA extraction
kit (Zymo Research Corp., USA). Primers specific for the 14 Foc and
12 Mf target genes tested were designed. They contained the T7
1156
RNA polymerase promoter underlined on the sequences (Table 2).
wileyonlinelibrary.com/journal/ps

c 2013 Society of Chemical Industry
FM Mumbanza et al.
PCR involved a 10 min initial denaturation step at 90 ◦ C and
40 cycles consisting of 1 min denaturation at 90 ◦ C, 1 min primer
annealing at 55 ◦ C and a 1 min extension at 72 ◦ C, followed by a
final 10 min extension step at 72 ◦ C. The amplification products
were separated, and their size was estimated by electrophoresis in
a 1% agarose gel stained with ethidium bromide and documented.
In order to compare their nucleotide sequences, segments of these
same essential genes were also amplified by PCR from genomic
DNAs of both Ugandan and US isolates of Foc and Mf. Three clones
of each amplicon were sequenced by standard procedures.
2.3 Synthetic dsRNAs
The dsRNA homologous to the targeted gene segments of US
isolates of Foc and Mf were synthesised in vitro according to Bailey
and Niblett.30 Briefly, 1 µg of the amplified DNA for each selected
target gene was subjected to transcription using the Ambion
MEGAscript high-yield transcription kit (Ambion Inc., Austin,
TX) to produce dsRNA corresponding to the target nucleotide
sequences.
2.4 Self- and cross-species dsRNA inhibitory bioassays
The antifungal activities of the dsRNA molecules were tested by
reduction in colony number following administration by imbibition
into spores of the selected fungi, as described by Bailey and
Niblett.30 Preliminary experiments were conducted to optimise
the test parameters and determine the optimal test concentration
of dsRNAs to use in the spore germination inhibition bioassays.
Then, self- and cross-species dsRNA inhibitory bioassays were
carried out. In self-species inhibition tests, dsRNAs prepared from
a fungal species were used to inhibit spore germination of the
same fungal species, whereas in cross-species inhibition tests it was
dsRNAs prepared from a fungal species that were used to inhibit
spore germination of the other fungal species. Assays were set
up in sterile 1.5 mL microfuge tubes (Eppendorf, Germany). The
treatments comprised different synthetic dsRNAs homologous
to 14 target genes specific to Foc and 12 specific to Mf. The
spores suspended only in distilled water suspension (no dsRNA)
served as controls. To test the effect of these synthetic dsRNAs
on Foc spore germination, spore concentration was diluted to
approximately 5 × 105 spores mL−1 . Aliquots containing about
5 × 103 spores (10 µL) were added into different sterile 1.5 mL
microfuge tubes. Then, 15 µL of the dsRNA to be tested or 15 µL
of water (for the controls) was added so that the total volume in
each tube was 25 µL. The assay tubes were incubated for 24 h
at room temperature. Following incubation, 1.5 mL of distilled
sterile water was added to each tube. Then 100 µL aliquots were
plated using a colony spreader onto quarter-strength PDA petri
dishes (φ 90 mm; Fisher, UK) [10 g of the powder and 9 g agar L−1
water, supplemented with ampicillin and rifampicin (R0146.0005;
Duchefa Biochemie, Netherlands) at 200 and 100 µg mL−1 agar
respectively]. Petri plates were then incubated at 28 ◦ C for
24 h, after which individual colonies established on the media
were counted. The colony count was done by observing the
plate through window light and marking the colony positions
on the plate bottom. The experiments were conducted under
completely randomised design (CRD), with three replications
of each treatment, and all experiments were conducted twice.
The protocol used to test the effect of these synthetic dsRNAs
on Mf spore germination was as described above, except that
spore concentration was diluted to approximately 15 × 104 spores
mL−1 , the aliquots (10 µL) containing about 15 × 102 spores
Pest Manag Sci 2013; 69: 1155–1162
In vitro antifungal activity of synthetic dsRNA molecules against two pathogens of banana www.soci.org

Table 1. Target genes tested and their predicted biological functions

Target gene Predicted biological functiona Reference

1. Nuclear condensin Mitotic chromosome condensation; mitotic sister chromatid 32

segregation; tRNA clustering
2. Coatomer alpha Endoplasmic reticulum to golgi vesicle-mediated transport; retrograde 33
vesicle-mediated transport, golgi to endoplasmic reticulum
3. DNA-directed RNA Nuclear transcription 34
polymerase
4. ARP 2/3 Actin cortical patch assembly; mitochondrion inheritance 35
5. Coatomer zeta Retrograde vesicle-mediated transport, golgi to endoplasmic reticulum 36
6. Cap methyltransferase mRNA capping 37
7. GTPase-binding protein Protein import into nucleus; RNA import from nucleus; 38
ubiquitin-dependent protein process
8. Proteasome Pre4 Proteasomal ubiquitin-dependent/independent protein catabolic 39–41
process; Proteasome assembly
9. Ribosomal RNA Ribosome biogenesis; rRNA processing 42
10. DNA polymerase alpha Initiation of DNA replication during mitotic and premeiotic DNA 43
subunit synthesis
11. DNA polymerase delta Chromosomal DNA replication; intragenic recombination; repair of 44
subunit dsDNA breaks
12. Adenylase cyclase G-protein signalling, coupled to cAMP nucleotide second messenger; 45
Ras protein signal transduction
13. Protein kinase C Protein amino acid phosphorylation; cell wall organisation 46,47
14. FRQ-interacting RNA Regulation of circadian rhythm 48
helicase
a Inferred from studies on Saccharomyces cerevisiae and/or Neuropora crassa.

were pipetted into sterile 1.5 mL microfuge tubes spores and
individual colonies established on the media were counted after
7 days.
2.5 Statistical analysis
Statistical analyses were carried out using the software XLSTAT
2010 (Addinsoft, New York, NY). Data were subjected to ANOVA,
followed by Fisher’s multiple mean separation techniques. The
percentage inhibition was calculated using the following formula:
Treated (No.colonies)
Inhibition% = 100 − × 100
Control (No.colonies)
3 RESULTS
3.1 PCR screens for the target genes and sequencing
Both Ugandan and US isolates of Foc and Mf were used for DNA
extraction, and PCRs were performed using the specific primers
for the selected target genes. Amplicons from all the target genes
were obtained and separated on a 1% agararose gel, with most
amplicons from the target genes of both Foc and Mf ∼600–800 bp
(Figures 1 and 2). Sequencing of the cloned amplicons from both
Ugandan and US isolates of Foc and Mf revealed that the nucleotide
sequences of the same essential genes were practically identical. A
small number of the genes contained one or two silent mutations,
but no significant differences (data not shown).
3.2 dsRNA concentration optimisation test
After optimisation of the test parameters in preliminary
experiments, the most effective test concentration to use in
the spore germination inhibition bioassays was determined at
3.3 Self-species dsRNA inhibitory bioassays
3.3.1 Effect of dsRNAs prepared from F. oxysporum f. sp. cubense
on spore germination of the same fungus
With an initial inoculum size of 5 × 103 spores mL−1 , an average
of 565.3 Foc colonies were established on control plates, whereas
39.7–114.3 colonies were established following dsRNA treatments.
Among the treatments, the lowest number of colonies was
observed with dsRNAs targeting adenylate cyclase, followed
by DNA polymerase delta subunit and FRQ-interacting helicase,
whereas treatment with dsRNAs targeting nuclear condensin had
the highest colony count (Table 3). Imbibition by Foc of dsRNA
molecules targeting the 14 genes tested caused a highly significant
reduction in the number of colonies that were established on the
plates (F = 86.175, df = 14, P < 0.0001) and were able to inhibit
Foc spore germination by 79.8–93.0% (Table 3). Imbibition of
dsRNA targeting adenylate cyclase was found to be the most
effective (P = 0.05) in reducing the number of colonies significantly
over those targeting other genes, and the imbibition of nuclear
condensin dsRNAs was the least effective (Table 3).
3.3.2 Effect of dsRNAs prepared from M. fijiensis on spore
germination of the same fungus
When Mf spores were treated with different synthetic dsRNAs
prepared from genes of the same fungus, the number of colonies
established on plates was also reduced compared with the number
on the control plates. Control plates averaged 42.7 colonies with
an initial inoculum of 15 × 102 spores mL−1 , whereas the average
number of colonies from the dsRNA treatments ranged from 11.8
to 28.0, depending on the treatment (Table 3). The number of
Mf colonies recorded varied significantly among synthetic dsRNA
molecules targeting the 12 essential Mf genes (F = 12.4, df = 12,
P < 0.0001). Imbibition by Mf of dsRNA molecules targeting
1157

0.6 µg mL−1 of dsRNAs (data not shown). adenylate cyclase and DNA polymerase delta subunit were the

Pest Manag Sci 2013; 69: 1155–1162

c 2013 Society of Chemical Industry wileyonlinelibrary.com/journal/ps
 www.soci.org FM Mumbanza et al.

Table 2. Primers for PCR screens for selected target genes

Primers for PCR

Target genes Foc Mf

Nuclear condensin FocNuCFPT GCGTAATACGACTCACTATAGGGAGA MfNuCFPT7 GCGTAATACGACTCACTATAGGGAGA

GGATTCGAAGAATATGCCACCATTAG GCCAAGAAGCGTACCGACG
FocNuCRPT7 GCGTAATACGACTCACTATAGGGAGA MfNuCRPT7 GCGTAATACGACTCACTATAGGGAGA
GGACTTCTTCAAATCAAGAATAGTGG CGTCACACTCTTCGTCATATGATTG
Coatomer alpha FocCoAFPT7 GCGTAATACGACTCACTATAGGGAGA MfCoAFPT7 GCGTAATACGACTCACTATAGGGAGA
AAGGTCAAGGGCCGTAATGTCTAC ATGCTCACCAAATTCGAGTCC
FocCoARPT7 GCGTAATACGACTCACTATAGGGAGA MfCoARPT7 GCGTAATACGACTCACTATAGGGAGA
AACATTTGGATACGATCCTCAACC TATCCCAAACTCTTACTGACTGGTC
DNA-directed RNA polymerase FocDdRpFPT7 GCGTAATACGACTCACTATAGGGAGA MfDdRpFPT7 GCGTAATACGACTCACTATAGGGAGA
AATGTTGATGTTACTGAAGAGCAAGATAAGG ATCTGGAGATACGACGCATGTC
FocDdRpRPT7 GCGTAATACGACTCACTATAGGGAGA MfDdRpRPT7 GCGTAATACGACTCACTATAGGGAGA
GTCGTGATCTAACATTTGCGTGCAAGATGGTTGAG- TGTGAGTGACACCGTCTTTGTTC
GAGAC
ARP 2/3 FocARP23FPT7 GCGTAATACGACTCACTATAGGGAGA MfARP23FPT7 GCGTAATACGACTCACTATAGGGAGA
GGTGGGTGTCTAAGCACCTGAAGAAG ACTGGGGAGTGGAAGCC
FocARP23RPT7 GCGTAATACGACTCACTATAGGGAGA MfARP23RPT7 GCGTAATACGACTCACTATAGGGAGA
AAGTTGAGTGTCATCCTTAGCCTTGC CAAGCTCCCAACCAGAAGCAG
Coatomer zeta FocCoZFPT7 GCGTAATACGACTCACTATAGGGAGA MfCoZFPT7 GCGTAATACGACTCACTATAGGGAGA
ATGGCTCCTGGAATGTCCCTTTTCTCGG ATGGCTCCCAACATGTCAC
FocCoZRPT7 GCGTAATACGACTCACTATAGGGAGA MfCoZRPT7 GCGTAATACGACTCACTATAGGGAGA
TTACAGACCCTGTCGAAGCCAATCC CAGTCCTTGTCGTAATCTTTCTCC
Cap methyltransferase FocCMtrFPT GCGTAATACGACTCACTATAGGGAGA Not tested
GCGTATCTCAGAGGCCGAG
FocCMtrRPT7 GCGTAATACGACTCACTATAGGGAGA
GCCGATGAATCGTCCTCCCTTC
GTPase-binding protein FocGTPaFPT7 GCGTAATACGACTCACTATAGGGAGA MfGTPaFPT7 GCGTAATACGACTCACTATAGGGAGA
GCCAACTTCGCCGATATCTTCACC GCCAAGAAAGAGAAGAAGGAAG
FocGTPaRPT7 GCGTAATACGACTCACTATAGGGAGA MfGTPaRPT7 GCGTAATACGACTCACTATAGGGAGA
TAAATCCCAGTCTTCTCGAGCTTCTTTG CTTGAACAGCGCCTCGTTCTC
Proteasome Pre4 FocPre4FPT7 GCGTAATACGACTCACTATAGGGAGA Not tested
TCATACGGCTCTCTGGCTCGTTTCACCG
FocPre4RPT7 GCGTAATACGACTCACTATAGGGAGA
TAGACAGTTTGAGTGCCATATCCGCG
Ribosomal RNA FocrRNAFPT7 GCGTAATACGACTCACTATAGGGAGA GzrRNAT7FP GCGTAATACGACTCACTATAGGGAGA
TCCGTAGGTGAACCTGCGGAG TCCGTAGGTGAACCTGCGGAG
FocrRNARPT7 GCGTAATACGACTCACTATAGGGAGA GzrRNA7RP GCGTAATACGACTCACTATAGGGAGA
TTGAGCTGTTGCCGCTTCACTCGC TTGAGCTGTTGCCGCTTCACTCGC
DNA polymerase alpha subunit FocDPAFPT7 GCGTAATACGACTCACTATAGGGAGA MfDPAFPT7 GCGTAATACGACTCACTATAGGGAGA
TGGCGGGGAAACAGGC AAGGACACGACCGAAGAGATCG
FocDPARPT7 GCGTAATACGACTCACTATAGGGAGA MfDPARPT7 GCGTAATACGACTCACTATAGGGAGA
CTTTGCAAGCTGATCGAAGCC TGCGGCTGAGCAGGATTC
DNA polymerase delta subunit FocDPDFPT7 GCGTAATACGACTCACTATAGGGAGA MfDPDFPT7 GCGTAATACGACTCACTATAGGGAGA
ATGAAGAAGCGAGATGCAGGC GCGTACGTGATGGTCAAGG
FocDPDRPT7 GCGTAATACGACTCACTATAGGGAGA MfDPDRPT7 GCGTAATACGACTCACTATAGGGAGA
GCATCCTCAAGATCCTTCTTAGCTTT CAAAGCGTAGCATCCCG
Adenylase cyclase FocACFPT7 GCGTAATACGACTCACTATAGGGAGA MfACFPT7 GCGTAATACGACTCACTATAGGGAGA
TGCACGAAAATTTTGGTCACATATTCGC CTTCATCGAGGAGCTTGAGAAG
FocACRPT7 GCGTAATACGACTCACTATAGGGAGA MfACRPT7 GCGTAATACGACTCACTATAGGGAGA
CCATAATTTTGCCCGAGGCGC GTCGCTCCGAATGCG
Protein kinase C FocPKCFPT7 GCGTAATACGACTCACTATAGGGAGA MfPKCFPT7 GCGTAATACGACTCACTATAGGGAGA
GATTACGGTCTGTGCAAGGAGG GCCGATTACGGTCTCTGC
FocPKCRPT7 GCGTAATACGACTCACTATAGGGAGA MfPKCRPT7 GCGTAATACGACTCACTATAGGGAGA
CTCAAAGTCAGCCGTGTATGAGAAGCC AAAGTCCGCCGAATAAGAGAAG
FRQ-interacting RNA helicase FocRNAHFPT7 GCGTAATACGACTCACTATAGGGAGA MfRNAHFPT7 GCGTAATACGACTCACTATAGGGAGA
CTCGATCCTTTCCAGAGTCTTTCCGTGGC CCAACTCGATCCATTCCAG
FocRNAHRPT7 GCGTAATACGACTCACTATAGGGAGA MfRNAHRPT7 GCGTAATACGACTCACTATAGGGAGA
ATCCACTCGGCGAATTGGAAAGCGTTGGG TGATCCATTCTGCAAATTGC
1158

wileyonlinelibrary.com/journal/ps

c 2013 Society of Chemical Industry Pest Manag Sci 2013; 69: 1155–1162
In vitro antifungal activity of synthetic dsRNA molecules against two pathogens of banana www.soci.org

Figure 1. PCR amplification of target gene segments from a US isolate (A) and a Ugandan isolate (B) of F. oxysporum f. sp. cubense. Lane 1: nuclear
condensin; lane 2: coatomer alpha; lane 3: DNA-directed RNA polymerase; lane 4: ARP 2/3; lane 5: coatomer zeta; lane 6: cap methyltransferase; lane 7:
GTPase-binding protein; L: DNA molecular weight marker (200–5000 bp); lane 8: proteasome Pre4; lane 9: ribosomal RNA; lane 10: DNA polymerase alpha
subunit; lane 11: DNA polymerase delta subunit; lane 12: adenylase cyclase; lane 13: protein kinase C; lane 14: FRQ-interacting RNA helicase.

Figure 2. PCR amplification of target gene segments from a US isolate (A) and a Ugandan isolate (B) of M. fijiensis. Lane 1: nuclear condensin; lane 2:
coatomer alpha; lane 3: DNA-directed RNA polymerase; lane 4: ARP 2/3; lane 5: coatomer zeta; lane 7: GTPase-binding protein; L: DNA molecular weight
marker (200–5000 bp); lane 9: ribosomal RNA; lane 10: DNA polymerase alpha subunit; lane 11: DNA polymerase delta subunit; lane 12: adenylase cyclase;
lane 13: protein kinase C; lane 14: FRQ-interacting RNA helicase; CK: rRNA control.

most efficient in reducing colony number, although statistically
on a par with those targeting nuclear condensin and DNA
polymerase alpha subunit (P = 0.05) (Table 3). They caused 72.3 and
71.1% reduction in colony establishment, respectively, followed
by dsRNAs targeting nuclear condensin and DNA polymerase
alpha subunit, each with 65.2% reduction. On the other hand,
the dsRNA molecules homologous to GTPase-binding protein,
proteinase kinase C and ribosomal RNA exhibited moderate levels
of reduction (57.4, 53.9 and 52.0% respectively), while all the
other dsRNAs caused comparatively less reduction (34.4–49.6%)
(Table 3).
3.4 Cross-species dsRNA inhibitory bioassays
3.4.1 Effect of dsRNAs prepared from M. fijiensis on spore
germination of Fusarium oxysporum f. sp. cubense
The effect of synthetic dsRNA molecules prepared from Mf on
spore germination of Foc is presented in Table 4. The reduction
in colony establishment differed significantly among the dsRNAs
(F = 177.298, df= 12, p < 0.0001). An average of 565.3 colonies
were established on PDA control plates, whereas, depending
on the dsRNA treatment, 23.3–58.3 were established on plates
from an initial inoculum of 5 × 103 spores mL−1 . Synthetic dsRNA
molecules targeting ribosomal RNA caused the highest reduction
in number of colonies significantly over others, except for
adenylate cyclase (P = 0.05). The dsRNAs targeting the ribosomal
RNA gene caused inhibition of 95.9%, and those targeting
adenylate cyclase an inhibition of 94.5%. The dsRNAs targeting
all the other genes also exhibited a very high level of inhibition,
ranging from 89.7 to 93.5%.
3.4.2 Effect of dsRNAs prepared from F. oxysporum f. sp. cubense
on spore germination of M. fijiensis
The effects of synthetic dsRNAs prepared from Foc genes on spore
previous tests, there was a significant difference in the reduction
in established colony numbers among the treatments (F = 5.7,
df = 14, P < 0.0001). On average, 42.7 colonies were established
on control plates, while 18.0–34.2 colonies were established
for the dsRNA treatments from an initial inoculum of 15 × 102
spores mL−1 . Colony counts for dsRNAs targeting FRQ-interacting
helicase and coatomer alpha did not differ significantly from
the control (P = 0.05). In general, the dsRNAs tested exhibited
low to moderate levels of inhibition. The dsRNAs targeting ARP
2/3, proteasome Pre4, DNA polymerase alpha subunit, adenylate
cyclase and DNA polymerase delta subunit had the most adverse
effect on spore germination (50.8–57.8% inhibition), while the
dsRNAs targeting the other genes were less detrimental to spore
germination (19.9–48.4% inhibition).
4 DISCUSSION
The need to develop durable resistance in crop plants to
disease-causing pathogens is a continuing task. dsRNA molecules
have the potential to affect various developmental stages of
microorganisms by modulating or inhibiting the expression of
one or more essential genes. Data from self- and cross-species
inhibition presented here revealed that all the tested dsRNAs
displayed varying degrees of potential to inhibit spore germination
of both Foc and Mf, suggesting an effective RNAi response
in these fungi following dsRNA imbibition. It was previously
demonstrated in the nematode Caenorhabditiselegans that dsRNA-
mediated gene silencing could be induced by injection, feeding
or imbibition.49,50
Another pertinent finding of this study came from cross-
inhibitory tests. It was observed that dsRNAs prepared from
Foc and Mf reciprocally had an effect on spore germination
of the other fungus. However, dsRNAs from Mf were more
1159

germination of Mf are also shown in Table 4. As with the three effective in inhibiting Foc spore germination than vice versa.

Pest Manag Sci 2013; 69: 1155–1162

c 2013 Society of Chemical Industry wileyonlinelibrary.com/journal/ps
 www.soci.org FM Mumbanza et al.

Table 3. Means of number of fungal colonies recorded on PDA media and percentage spore germination inhibition during self-species dsRNA
inhibitory bioassaysa

dsRNA source
Mf Foc
Test fungus
Mf Foc
Gene ID Colonies (No.)b Inhibition (%)c Colonies (No.)b Inhibition (%)c

1. Nuclear condensin 14.8 (3.9 ± 0.3) ef 65.2 (69.0 ± 3.2) ab 114.3 (10.7 ± 0.3) b 79.8 (7.04 ± 0.06) f
2. Coatomer alpha 21.5 (4.7 ± 0.3) bcd 49.6 (58.6 ± 3.9) cd 85.2 (9.2 ± 0.5) cdef 84.9 (7.27 ± 0.06) cde
3. DNA-directed RNA polymerase 25.3 (5.1 ± 0.2) bc 40.6 (52.5 ± 3.3) de 69.0 (8.3 ± 0.1) fg 87.8 (7.39 ± 0.01) bc
4. ARP 2/3 22.0 (4.7 ± 0.2) bcd 48.4 (58.0 ± 3.0) cd 71.2 (8.5 ± 0.2) fg 87.4 (7.37 ± 0.02) bc
5. Coatomer zeta 28.0 (5.3 ± 0.2) b 34.4 (47.9 ± 3.2) e 95.0 (9.7 ± 0.4) bcd 83.2 (7.19 ± 0.06) de
6. Cap methyltransferase — — 73.3 (8.5 ± 0.6) efg 87.0 (7.36 ± 0.07) bc
7. GTPase-binding protein 18.2 (4.3 ± 0.3) de 57.4 (63.9 ± 3.4) abc 102.5 (10.1 ± 0.2) bc 81.9 (7.14 ± 0.03) ef
8. Protease Pre4 — — 94.0 (9.7 ± 0.5) bcde 83.4 (7.20 ± 0.07) de
9. Ribosomal RNA 20.5 (4.5 ± 0.4) cde 52.0 (59.7 ± 6.1) bcd 78.3 (8.9 ± 0.3) defg 86.1 (7.32 ± 0.03) bcd
10. DNA polymerase α subunit 14.8 (3.9 ± 0.1) ef 65.2 (69.0 ± 1.6) ab 95.0 (9.8 ± 0.3) bcd 83.2 (7.19 ± 0.04) de
11. DNA polymerase δ subunit 12.3 (3.6 ± 0.1) f 71.1 (72.7 ± 1.4) a 61.0 (7.8 ± 0.5) g 89.2 (7.45 ± 0.05) b
12. Adenylate cylase 11.8 (3.5 ± 0.2) f 72.3 (73.4 ± 2.3) a 39.7 (6.3 ± 0.2) h 93.0 (7.60 ± 0.02) a
13. Protein kinase C 19.7 (4.4 ± 0.3) cde 53.9 (61.4 ± 4.6) bcd 99.8 (10.0 ± 0.5) bcd 82.3 (7.16 ± 0.08) ef
14. FRQ-interacting helicase 27.8 (5.3 ± 0.2) b 34.8 (47.9 ± 4.5) e 62.5 (7.9 ± 0.4) g 88.9 (7.44 ± 0.04) b
15. Control 42.7 (6.6 ± 0.2) a 0.0 (5.6 ± 0.0) f 565.3 (23.7 ± 0.9) a 0.0 (0.56 ± 0.0) g
R 2 (%) 69.6 82.7 94.1 99.6
LSD 0.712 10.074 1.207 0.149
CV (%) 11.5 11.9 8.7 1.3
a Values within treatments in vertical columns followed by the same letter are not significantly different at P ≤ 0.05 according to Fisher’s multiple

range test.
b
Values in parentheses are square-root transformed.
c Values in parentheses are arcsine transformed.

This promotes speculation that DNA sequences of the target
genes in the two fungi are probably conserved, and alignments of
the sequences demonstrate so (data not shown). These fungi may
have undergone divergent evolution and thus share homologous
genes. As RNA silencing induces gene suppression in a sequence-
specific but not locus-specific manner, it is quite possible to obtain
silencing of homologous genes by targeting a conserved sequence
of a gene family.51 The observed difference in RNAi response
(spore germination inhibition), however, could be attributed
to the silencing efficiency and/or the level of complementarity
between the target gene and siRNAs. The delivery of dsRNAs
to Mf by imbibition could have mediated an RNAi response of
a lower magnitude compared with Foc. Another explanation
could be that siRNAs processed from dsRNAs of Mf resulted in
almost perfect complementarity with target genes in Foc, whereas
siRNAs processed from dsRNAs of Foc resulted in only partial
complementarity with target genes in Mf.
Based on inhibition of spore germination, this study showed
that the target genes from which the synthetic dsRNAs were
prepared may be effective transgenes with which to engineer
transgenic bananas with resistance to Foc and Mf. The dsRNAs of
the genes coding for adenylate cyclase, DNA polymerase alpha
subunit and DNA polymerase delta subunit caused great spore
germination inhibition during both self- and cross-spore inhibition
tests. Therefore, they seem to be the most promising target
genes for RNA-mediated resistance in banana against these fungal
1160
gene segments into the same plant transformation construct could
provide additive effects resulting in high levels of resistance and
also achieve multiple fungal resistance in banana. Coexpression
of the dsRNAs from several unrelated genes was shown to be
highly effective in Drosophila.52 Prior to designing such constructs,
issues regarding species specificity and off-target effects should
be addressed. Targeting the more variable sequences of the 3
untranslated region could help in designing dsRNAs that are
species specific, thus reducing on off-target effects. This technique
was successfully applied by Whyard et al.53 in insects. They found
that even highly conserved genes could be exploited to trigger
species-specific RNAi without affecting non target-species.
5 CONCLUSION
The authors have demonstrated varying degrees of inhibition
of spore germination by administering in vitro synthesised
dsRNA molecules targeting essential genes to Foc and Mf by
imbibition. This suggests that this approach is an effective method
for identifying candidate targets for RNA-mediated resistance
against fungal pathogens. It has also been shown that dsRNAs
prepared from Mf have higher inhibition activities on Foc than
dsRNAs prepared from Foc on Mf spore germination. This may
result from differences in silencing efficiency and/or in the
level of complementarity displayed by these two fungi during
cross-species inhibitory tests. Overall, adenylate cyclase, DNA

pathogens. A strategy of stacking several of the most effective polymerase alpha subunit and DNA polymerase delta subunit

wileyonlinelibrary.com/journal/ps

c 2013 Society of Chemical Industry Pest Manag Sci 2013; 69: 1155–1162
In vitro antifungal activity of synthetic dsRNA molecules against two pathogens of banana www.soci.org

Table 4. Means of number of fungal colonies recorded on PDA media and percentage spore germination inhibition during cross-species dsRNA
inhibitory bioassaysa

dsRNA source
Mf Foc
Test fungus
Foc Mf
Gene ID Colonies (No.)b Inhibition (%)c Colonies (No.)b Inhibition (%)c

1. Nuclear condensin 41.5 (6.4 ± 0.4) bcd 92.7 (7.59 ± 0.04) def 22.0 (4.7 ± 0.2) cde 48.4 (57.9 ± 3.6) abc
2. Coatomer alpha 43.8 (6.6 ± 0.2) cde 92.2 (7.57 ± 0.02) def 34.2 (5.9 ± 0.2) ab 19.9 (35.2 ± 4.4) d
3. DNA-directed RNA polymerase 48.3 (7.0 ± 0.2) cde 91.5 (7.54 ± 0.02) cde 28.5 (5.4 ± 0.3) bc 33.2 (46.4 ± 5.1) cd
4. ARP 2/3 40.5 (6.4 ± 0.2) bcd 92.8 (7.60 ± 0.02) efg 20.3 (4.6 ± 0.1) de 52.3 (60.7 ± 1.7) a
5. Coatomer zeta 50.3 (7.1 ± 0.2) de 91.1 (7.53 ± 0.02) bcd 22.3 (4.8 ± 0.2) cde 47.7 (57.5 ± 2.5) abc
6. Cap methyltransferase — — 23.5 (4.8 ± 0.4) cde 44.9 (54.7 ± 6.4) abc
7. GTPase-binding protein 56.0 (7.5 ± 0.1) e 90.1 (7.49 ± 0.02) bc 27.0 (5.2 ± 0.4) bcd 36.7 (48.0 ± 7.6) bc
8. Protease Pre4 — — 21.0 (4.6 ± 0.2) cde 50.8 (59.6 ± 2.5) ab
9. Ribosomal RNA 23.3 (4.9 ± 0.1) a 95.9 (7.72 ± 0.01) h 22.5 (4.7 ± 0.5) cde 47.3 (56.2 ± 7.1) abc
10. DNA polymerase α subunit 36.7 (6.1 ± 0.2) bc 93.5 (7.63 ± 0.02) fg 19.2 (4.4 ± 0.2) de 55.1 (62.5 ± 2.4) a
11. DNA polymerase δ subunit 44.0 (6.7 ± 0.2) cde 92.2 (7.57 ± 0.02) def 18.0 (4.2 ± 0.3) e 57.8 (64.1 ± 4.3) a
12. Adenylate cylase 31.3 (5.6 ± 0.3) ab 94.5 (7.66 ± 0.03) gh 18.8 (4.3 ± 0.3) e 55.9 (62.8 ± 4.2) a
13. Protein kinase C 40.3 (6.3 ± 0.5) bcd 92.9 (7.60 ± 0.04) efg 24.7 (5.0 ± 0.2) cde 42.2 (53.6 ± 3.2) abc
14. FRQ-interacting helicase 58.3 (7.6 ± 0.4) e 89.7 (7.47 ± 0.04) b 34.0 (5.7 ± 0.2) ab 20.3 (35.2 ± 5.1) d
15. Control 565.3 (23.7 ± 0.9) f 0.0 (0.56 ± 0.0) a 42.7 (6.6 ± 0.2) a 0.0 (5.6 ± 0.0) e
R 2 (%) 97.0 99.9 51.7 68.9
LSD 2.028 0.071 0.799 12.717
CV (%) 8.6 0.634 11.7 17.8
a Values within treatments in vertical columns followed by the same letter are not significantly different at P ≤ 0.05 according to Fisher’s multiple

range test.
b
Values in parentheses are square-root transformed.
c Values in parentheses are arcsine transformed.

appear to be the most promising targets for RNA-mediated
resistance in banana against Foc and Mf. However, a strategy of
combining sequences targeting two or more genes of both fungi
in the same construct would likely achieve pyramided, durable
resistance.
ACKNOWLEDGEMENTS
The authors thank Venganza, Inc., for technical assistance and
BeCaNet for financial support.
REFERENCES
1 Marin DH, Romero RA and Sutton TB, Black Sigatoka: an increasing
threat to banana cultivation. Plant Dis 87(3):208–222 (2003).
2 Kidane EG and Laing MD, Integrated control of Fusarium wilt of
banana (Musa spp.), in Proceedings of the International Conference
on Banana and Plantain in Africa: Harnessing International Partnership
to Increase Research Impact, Mombasa, Kenya, 5–9 October 2008, ed.
by Dubois T, Hauser S, Staver C and Coyne D. International Society
for Horticultural Science. Acta Horti 879:315–325 (2010).
3 Sagi L, Panis B, Remy S, Schoofs H, De Smet K, Swennen R, et al., Genetic
transformation of banana (Musa spp.) via particle bombardment.
Bio/Technol 13:481–485 (1995).
4 Becker DK, Dugdale B, Smith MK, Harding RM and Dale JL, Genetic
transformation of Cavendish banana (Musa spp. AAA group)
cv. Grand Nain via microprojectile bombardment. Plant Cell Rep
19:229–234 (2000).
5 Ganapathi TR, Higgs NS, Balint-Kurti PJ, Arntzen CJ, May GD and Van Eck
cell suspensions of the banana cultivars Rasthali (AAB). Plant Cell
Rep 20:157–162 (2001).
6 Khanna H, Becker D, Kleidon J and Dale J, Centrifugation assisted
Agrobacterium tumefaciens-mediated transformation (CAAT) of
embryogenic cell suspensions of banana (Musa spp. Cavendish
AAA and Lady Finger AAB). Mol Breed 14:239–252 (2004).
7 May GD, Rownak A, Mason H, Wiecko A, Novak FJ and Arntzen
CJ, Generation of transgenic banana (Musa acuminata) plants via
Agrobacterium-mediated transformation. Bio/Technol 13:486–492
(1995).
8 Tripathi L, Tripathi JN and Hughes JA, Agrobacterium-mediated
transformation of plantain cultivar Agbagba (Musa spp.). Afr J
Biotechnol 4:1378–1383 (2005).
9 Tripathi L, Tripathi JN and Tushemereirwe WK, Rapid and efficient
production of transgenic East African highland banana (Musa spp.)
using intercalary meristematic tissues. Afr J Biotechnol 7:1438–1445
(2008).
10 Atkinson H, Dale J, Harding R, Kiggundu A, Kunert K, Muchwezi JM, etal.,
Genetic Transformation Strategies to Address the Major Constraints
to Banana and Plantain Production in Africa. INIBAP, Montpellier,
France, 130 pp. (2003).
11 Tripathi L, Mwaka H, Tripathi JN and Tushemereirwe WK, Expression
of sweet pepper Hrap gene in banana enhances resistance
to Xanthomonas campestris pv. musacearum. Mol Plant Pathol
11(6):721–731 (2010).
12 Namukwaya B, Tripathi L, Tripathi JN, Arinaitwe G, Mukasa SB
and Tushemereirwe WK, Transgenic banana expressing Pflp
gene confers enhanced resistance to Xanthomonas wilt disease.
Transgenic Res 21(4):855–865 (2012).
13 Runo S, Alankonya A, Machuka J and Sinha N, RNA interference as
a resistance mechanism against crop parasites in Africa: a ‘Trojan
horse’ approach. Pest Manag Sci 67:129–136 (2011).
14 Smith HA, Swaney SL, Parks TD, Wernsman EA and Dougherty WG,
1161

JM, Agrobacterium-mediated transformation of the embryogenic Transgenic plant virus resistance mediated by untranslatable sense

Pest Manag Sci 2013; 69: 1155–1162

c 2013 Society of Chemical Industry wileyonlinelibrary.com/journal/ps
 www.soci.org
RNAs: expression, regulation and fate of nonessential RNAs. Plant
Cell 6:1441–1453 (1994).
15 Kasschau KD and Carrington JC, A counter defensive strategy of
plant viruses: suppression of post-transcriptional gene silencing.
Cell 95:461–470 (1998).
16 Waterhouse PM, Wang MB and Lough T, Gene silencing as an adaptive
defence against viruses. Nature 411:834–842 (2001).
17 Mikhail P, Shivaprasad PV, Veluthambi K and Hohn T, RNAi targeting
of DNA virus in plants. Nat Biotechnol 21:131–132 (2003).
18 Escobar MA, Civerolo EL, Summerfelt KR and Dandekar AM, RNAi-
mediated oncogene silencing confers resistance to crown gall
tumorigenesis. Proc Natl Acad Sci USA 98:13 437–13 442 (2001).
19 Huang G, Allen R, Davis EL, Baum TJ and Hussey RS, Engineering broad
root-knot resistance in transgenic plants by RNAi silencing of a
conserved and essential root-knot nematode parasitism gene. Proc
Natl Acad Sci USA 103:14 302–14 306 (2006).
20 Yadav BC, Veluthambi K and Subramaniam K, Host-generated double
stranded RNA induces RNAi in plant-parasitic nematodes and
protects the host from infection. MolBiochemParasitol 148:219–222
(2006).
21 Steeves RM, Todd TC, Essig JS and Trick HN, Transgenic soybeans
expressing siRNAs specific to a major sperm protein gene suppress
Heterodera glycines reproduction. Funct Plant Biol 33:991–999
(2006).
22 Baum JA, Bogaert T, Clinton W, Heck GR, Feldmann P, Ilagan O, et al.,
Control of coleopteran insect pests through RNA interference. Nat
Biotechnol 25:1322–1326 (2007).
23 Mao YB, Cai WJ, Wang JW, Hong GJ, Tao XY, Wang LJ, et al.,
Silencing a cotton bollworm P450 monooxygenase gene by plant-
mediated RNAi impairs larval tolerance of gossypol. Nat Biotechnol
25:1307–1313 (2007).
24 Pitino M, Coleman AD, Maffei ME, Ridout CJ and Hogenhout SA,
Silencing of aphid genes by dsRNA feeding from plants. PLoS ONE
6(10):e25709 (2011).
25 Tomilov AA, Tomilova NB, Wroblewski T, Michelmore R and Yoder
JI, Trans-specific gene silencing between host and parasitic plants.
Plant J 56:389–397 (2008).
26 Niblett CL, Methods and materials for conferring resistance to pests
and pathogens of plants. US and PCT Patent 2006/0095987 A1 and
WO 2006/047495 A2 (2006).
27 Nowara D, Gay A, Lacomme C, Shaw J, Ridout C, Douchkov D et al.,
HIGS: Host-Induced Gene Silencing in the obligate biotrophic fungal
pathogen Blumeria graminis. Plant Cell 22:3130–3141 (2010).
28 Yin C, Jurgenson JE and Hulbert S, Development of a host-induced
RNAi system in the wheat stripe rust fungus Puccinia striiformis f. sp.
tritici. Mol Plant–Microbe Interact 24:554–561(2011).
29 Tinoco MLP, BaDias B, Dall’Asta RC, Pamphile JA and Arago
FJL, In-vitro trans-specific gene silencing in fungal cells by in
planta expression of a double-stranded RNA. BMC Biol 8:27
(http://www.biomedcentral.com/1741-7007/8/27) (2010).
30 Bailey AM and Niblett CL, Bioassay for gene silencing. US Patent
2010/0257634A (2010).
31 Niu JH, Jian H, Xu JM, Guo YD and Liu Q, RNAi technology extends its
reach: engineering plant resistance against harmful eukaryotes. Afr
J Biotechnol 9(45):7573–7582 (2010).
32 Strunnikov AV, Hogan E and Koshland D, SMC2, a Saccharomyces
cerevisiae gene essential for chromosome segregation and
condensation, defines a subgroup within the SMC family. Genes
Dev 9(5):587–599 (1995).
33 Gerich B, Orci L, Tschochner H, Lottspeich F, Ravazzola M, Amherdt M,
et al., Non-clathrin-coat protein alpha is a conserved subunit of
coatomer and in Saccharomyces cerevisiae is essential for growth.
Proc Natl Acad Sci USA 92(8):3229–3233 (1995).
1162
wileyonlinelibrary.com/journal/ps

c 2013 Society of Chemical Industry
FM Mumbanza et al.
34 Chen B, Kubelik AR, Morh S and Breitenberger CA, Cloning and
characterization of the Neurospora crassa cyt-5 gene. A nuclear-
coded mitochondrial RNA polymerase with a polyglutamine repeat.
J Biol Chem 271:6537–6544 (1996).
35 Winter D, Podtelejnikov AV, Mann M and Li R, The complex containing
actin-related proteins Arp2 and Arp3 is required for the motility and
integrity of yeast actin patches. Curr Biol 7(7):519–529 (1997).
36 Cosson P, Démollière C, Hennecke S, Duden R and Letourneur
F, Delta- and zeta-COP, two coatomer subunits homologous to
clathrin-associated proteins, are involved in ER retrieval. EMBO J
15(8):1792–1798 (1996).
37 Takagi T, Cho EJ, Janoo RT, Polodny V, Takase Y, Keogh MC, et al.,
Divergent subunit interactions among fungal mRNA 5 -capping
machineries. Eukaryot Cell 1(3):448–457(2002).
38 Künzler M, Gerstberger T, Stutz F, Bischoff FR and Hurt E, Yeast
Ran-binding protein 1 (Yrb1) shuttles between the nucleus and
cytoplasm and is exported from the nucleus via a CRM1 (XPO1)-
dependent pathway. Mol Cell Biol 20(12):4295–4308 (2000).
39 Choudhary S, Lee HC, Maiti M, He Q, Cheng P, Liu Q, et al., A double-
stranded-RNA response program important for RNA interference
efficiency. Mol Cell Biol 27(11):3995–4005 (2007).
40 Cohen MM, Leboucher GP, Livnat-Levanon N, Glickman MH and
Weissman AM, Ubiquitin-proteasome-dependent degradation of a
mitofusin, a critical regulator of mitochondrial fusion. Mol Biol Cell
19(6):2457–2464 (2008).
41 Baugh JM, Viktorova EG and Pilipenko EV, Proteasomes can degrade
a significant proportion of cellular proteins independent of
ubiquitination. J Mol Biol 386(3):814–827 (2009).
42 Gromadka R, Kaniak A, Slonimski PP and Rytka J, A novel cross-
phylum family of proteins comprises a KRR1 (YCL059c) gene which
is essential for viability of Saccharomyces cerevisiae cells. Gene
171(1):27–32 (1996).
43 Gutierrez PJ and Wang TS, Genomic instability induced by mutations
in Saccharomyces cerevisiae POL1. Genetics 165(1):65–81 (2003).
44 Chanet R and Heude M, Characterization of mutations that are
synthetic lethal with pol3-13, a mutated allele of DNA polymerase
delta in Saccharomyces cerevisiae. Curr Genet 43(5):337–350 (2003).
45 Broach JR, RAS genes in Saccharomyces cerevisiae: signal transduction
in search of a pathway. Trends Genet 7(1):28–33 (1991).
46 Levin DE, Fields FO, Kunisawa R, Bishop JM and Thorner J, A candidate
protein kinase C gene, PKC1, is required for the Saccharomyces
cerevisiae cell cycle. Cell 62(2):213–224 (1990).
47 Franchi L, Fulci V and Macino G, Protein kinase C modulates light
responses in Neurospora by regulating the blue light photoreceptor
WC-1. Mol Microbiol 56(2):334–345 (2005).
48 Cheng P, He Q, He Q, Wang L and Liu Y, Regulation of the Neurospora
circadian clock by an RNA helicase. Genes Dev 19(2):234–241 (2005).
49 Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE and Mello CC,
Potent and specific genetic interference by double-stranded RNA
in Caenorhabditis elegans. Nature 391:806–811 (1998).
50 Timmons L, Court DL and Fire A, Ingestion of bacteria expressed
dsRNAs can produce specific and potent genetic interference in
Caenorhabditis elegans. Gene 263:103–112 (2001).
51 Nakayashiki H, RNA silencing in fungi: mechanisms and applications.
Fed Eur Biochem Soc Lett 579:5950–5970 (2005).
52 Schmid A, Schindelholz B and Zinn K, Combinatorial RNAi: a method
for evaluating the functions of gene families in Drosophila. Trends
Neurosci 25:71–74 (2002).
53 Whyard S, Singh AD and Wong S, Ingested double-stranded RNAs
can act as species-specific insecticides. Insect Biochem Mol Biol
39:824–832 (2009).
Pest Manag Sci 2013; 69: 1155–1162