REPRODUCTION

RESEARCH

C-type natriuretic peptide enhances mouse preantral

follicle growth
Guangyin Xi1,*, Wenjing Wang1,*, Sarfaraz A Fazlani1,2,*, Fusheng Yao1, Mingyao Yang1,
Jing Hao1, Lei An1 and Jianhui Tian1
1
Ministry of Agriculture Key Laboratory of Animal Genetics, Breeding and Reproduction, National Engineering
Laboratory for Animal Breeding, College of Animal Sciences and Technology, China Agricultural University, Beijing,
China and 2Lasbela University of Agriculture, Water and Marine Science, Lasbela, Balochistan, Pakistan
Correspondence should be addressed to J Tian; Email: tianjh@cau.edu.cn
*(G Xi, W Wang and S A Fazlani contributed equally to this work)

Abstract
Compared to ovarian antral follicle development, the mechanism underlying preantral follicle growth has not been well documented.
Although C-type natriuretic peptide (CNP) involvement in preantral folliculogenesis has been explored, its detailed role has not been
fully defined. Here, we used mouse preantral follicles and granulosa cells (GCs) as a model for investigating the dynamic expression
of CNP and natriuretic peptide receptor 2 (NPR2) during preantral folliculogenesis, the regulatory role of oocyte-derived growth
factors (ODGFs) in natriuretic peptide type C (Nppc) and Npr2 expression, and the effect of CNP on preantral GC viability. Both
mRNA and protein levels of Nppc and Npr2 were gradually activated during preantral folliculogenesis. CNP supplementation in
culture medium significantly promoted the growth of in vitro-cultured preantral follicles and enhanced the viability of cultured GCs
in a follicle-stimulating hormone (FSH)-independent manner. Using adult and prepubertal mice as an in vivo model, CNP pre-
treatment via intraperitoneal injection before conventional superovulation also had a beneficial effect on promoting the ovulation
rate. Furthermore, ODGFs enhanced Nppc and Npr2 expression in the in vitro-cultured preantral follicles and GCs. Mechanistic
study demonstrated that the regulation of WNT signaling and estrogen synthesis may be implicated in the promoting role of CNP in
preantral folliculogenesis. This study not only proves that CNP is a critical regulator of preantral follicle growth, but also provides
new insight in understanding the crosstalk between oocytes and somatic cells during early folliculogenesis.
Reproduction (2019) 157 445–455

Introduction of intraovarian factors, which include R-Spondin 2,

Folliculogenesis is divided into three stages (Orisaka
et  al. 2013). The initial stage covers primordial to
primary follicle transition, which is believed to be
independent of gonadotropin influence (Mcnatty et  al.
2007). The second stage covers preantral to antral follicle
transition. Although it is a gonadotropin-responsive
phase, folliculogenesis during this stage is primarily
controlled by intraovarian regulators, not gonadotropins
(Cattanach et  al. 1977, Halpin et  al. 1986). In the last
stage, growing follicles may be recruited to continue
their development until they are ovulated (Craig et  al.
2007) in a gonadotropin-dependent manner (Hunter
et al. 2004). Compared with the well-documented role
of pituitary gonadotropins (e.g., follicle-stimulating
hormone (FSH) and luteinizing hormone (LH)) in
regulating antral follicle development, intraovarian
factors, which support autocrine and paracrine signals
from oocytes and granulosa cells (GCs), may be more
important for preantral follicle growth. Although a series
WNT, GDF9 (growth differentiation factor 9), BMP15
(bone morphogenetic protein 15) and KITL (KIT ligand),
are supportive factors of preantral follicle development
(Eppig et  al. 2001, 2002, Boyer et  al. 2010, Cheng
et  al. 2013), the molecular and cellular mechanisms
responsible for this process have not been fully defined.
A recent study (Sato et al. 2012) showed evidence that
C-type natriuretic peptide (CNP) may play an important
role as an upstream regulator in stimulating preantral
follicle growth. Using a cultured ovarian explant model,
they reported that CNP supplementation in culture
medium-facilitated primary and early secondary follicle
transition to the late secondary stage, which covers
preantral follicle development, in a dose-dependent
manner (0.25–3  μM). In addition, in vivo studies,
where juvenile and prepubertal mice were treated via
CNP intraperitoneal (i.p.) injection for 4  days, further
indicated the role of CNP in promoting follicle growth
(Sato et al. 2012).

© 2019 Society for Reproduction and Fertility https://doi.org/10.1530/REP-18-0470

ISSN 1470–1626 (paper) 1741–7899 (online) Online version via https://rep.bioscientifica.com
Downloaded from Bioscientifica.com at 11/05/2020 04:09:28PM
via free access
446 G Xi, W Wang, S A Fazlani and others
CNP belongs to the natriuretic peptide family, which
consists of three major types: atrial natriuretic peptide,
brain natriuretic peptide and CNP. These peptides
show high structural homology, characterized by a
highly conserved 17-member ring structure formed by
intramolecular disulfide linkage (Nishikimi et al. 2011).
Natriuretic peptides execute their biological function by
stimulating cyclic guanosine monophosphate (cGMP)
production via guanylyl cyclase–coupled receptors
(Chinkers et  al. 1989). CNP acts exclusively through
natriuretic peptide receptor 2 (NPR2 or NRRB) to
stimulate downstream cGMP signaling (Potter et  al.
2006). CNP–NPR2–cGMP signaling acts locally as a
positive regulator of endochondral ossification and is
essential for promoting physiological longitudinal bone
growth (Chusho et al. 2001). CNP is widely distributed
in the body, including in the brain, chondrocytes and
endothelial cells and is considered a paracrine/autocrine
regulator (Lumsden et al. 2010). More recently, genetic
evidence has elucidated that loss-of-function mutation
in Nppc and Npr2 results in female infertility due to
premature oocyte meiotic resumption (Zhang et  al.
2010, Geister et  al. 2013). In Graafian follicles, CNP
produced by mural GCs stimulates cGMP generation by
activating NPR2, which is expressed by cumulus cells
(CCs) surrounding and associating with oocytes and
diffuses into oocytes via gap junctions. In oocytes, cGMP
inhibits phosphodiesterase 3A, thereby preventing
cAMP hydrolysis and maintaining meiotic arrest with
high intra-oocyte cAMP levels (Zhang et al. 2010). The
results of Sato et al. (Sato et al. 2012) are in accordance
with an earlier study (Mcgee et  al. 1997), in which
cGMP analogs promoted the development of cultured
rat preantral follicles; the authors hypothesized that
cGMP pathway activators may be essential for preantral
follicle survival and development (Mcgee et  al. 1997).
These findings not only support the possible role of CNP
in initiating antrum formation, but also implicate CNP
regulation of preantral follicle response to gonadotropin,
which is essential for follicle development.
CNP–NPR2 signaling is the critical determinant for
oocyte meiotic arrest in antral follicles in different species
(Zhang et  al. 2010, Hiradate et  al. 2014, Zhong et  al.
2015, Xi et al. 2018), and its regulatory mechanisms via
gonadotropins or oocyte-derived growth factors (ODGFs)
are well documented (Kawamura et al. 2011, Lee et al.
2013). However, the upstream regulatory mechanism
of CNP–NPR2 signaling in preantral follicles and the
mechanism underlying the promoting effect on preantral
follicle growth remain to be elucidated. Accordingly, we
investigated (1) CNP and NPR2 expression dynamics
during preantral follicle development; (2) the effect of
ODGFs, as upstream regulators, on Nppc and Npr2
expression in mouse preantral follicles and (3) the
effect of CNP on the viability of GCs isolated from
mouse preantral follicles. We show that CNP and NPR2
expression is gradually activated during preantral follicle
Reproduction (2019) 157 445–455
development. CNP facilitated the in vitro preantral
follicle development and the viability of cultured GCs
in a dose-dependent and FSH-independent manner.
Furthermore, based on the role of CNP in facilitating
preantral follicle development, in vivo study also
confirmed the beneficial effect of CNP on early follicle
growth. This observation also provides a promising
reference for developing a novel strategy for inducing
ovulation by CNP-based pre-treatment in females. In
addition, the ODGFs regulated both Nppc and Npr2
expression in preantral follicles, providing new insight
into understanding the crosstalk between oocytes and
somatic cells during early folliculogenesis. Finally, we
demonstrate that CNP may regulate WNT signaling and
enhance estrogen synthesis by modulating the expression
of key ovarian genes (e.g., Wnt2b (wingless-type MMTV
integration site family, member 2B), Wnt5a, Cyp11a1
(chrome P450, family 11, subfamily a, polypeptide 1)
and Cdkn1a (cyclin-dependent kinase inhibitor 1A))
closely related to follicle development.
Materials and methods
Animal studies and ethical approval
All female ICR mice used in this study were from Beijing Vital
River Laboratory Animal Technology Co. Ltd. (Beijing, China).
The adult mice were maintained in a climate-controlled room
on a 12-h light/darkness cycle and allowed food and water ad
libitum. The China Agricultural University Institutional Animal
Care and Use Committee (XK662) approved this study and it
was performed in accordance with the committee guidelines.
All efforts were made to minimize animal suffering.
GCs collection and culture
The preantral GCs were collected as previously reported
(Latham et al. 2004). Briefly, ICR mice (10–13 days old) were
killed by cervical dislocation. The ovaries were dissected in
Dulbecco’s modified Eagle’s medium (DMEM)/F12 medium
(Gibco, Thermo Fisher Scientific) supplemented with 1%
fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific),
100 IU/mL penicillin (Invitrogen, Thermo Fisher Scientific) and
100 µg/mL streptomycin sulfate (Invitrogen, Thermo Fisher
Scientific) after three washes in physiological saline solution.
After mechanical dissection, the follicles (100–130 µm) were
digested in medium containing 1  mg/mL collagenase IV
(Sigma), 0.025% trypsin (Gibco, Thermo Fisher Scientific)
and 0.02 mg/mL DNase I (Sigma) for 10 min at 37°C. The
GC–oocyte complexes were aspirated repeatedly in and
out of a borosilicate glass pipette with an internal diameter
slightly smaller than that of an oocyte. After two washes, the
cells were seeded with DMEM/F12 culture medium (Gibco,
Thermo Fisher Scientific) supplemented with 10% FBS (Gibco,
Thermo Fisher Scientific), 100 IU/mL penicillin (Invitrogen,
Thermo Fisher Scientific) and 100  μg/mL streptomycin
sulfate (Invitrogen, Thermo Scientific) and cultured for 4 h
for adhesion. Subsequently, the cells were cultured in fresh
medium with or without CNP, 8-Br-cGMP (a cGMP analog),
https://rep.bioscientifica.com
Downloaded from Bioscientifica.com at 11/05/2020 04:09:28PM
via free access

BMP15, GDF9 or FGF8 (fibroblast growth factor 8) according
to the different experimental treatments.
Preantral follicle isolation and culture
The ovaries of prepubertal mice (13 days old) were aseptically
removed after the animals had been killed by cervical
dislocation and placed in 3 mL prewarmed isolation medium
consisting of L15 Leibovitz medium (Gibco, Thermo Fisher
Scientific) supplemented with 10% FBS (Gibco, Thermo
Fisher Scientific) and 1% antibiotics (100 units/mL penicillin
and 100  μg/mL streptomycin; Invitrogen, Thermo Fisher
Scientific) (Orisaka et  al. 2006). Then, the preantral follicles
were dissected microscopically using 26-gauge needles. To
minimize experimental variation during the isolation, only
follicles with two layers of GCs; a visible, centrally located
oocyte; 100–130-µm diameter, and which were enclosed by
an intact basal membrane and had at least some attached
thecal cells were collected (Cortvrindt et  al. 1996). Instead
of enzymatic digestion, the ovary and early preantral follicles
(EPFs) were mechanically dissected to conserve all cell types
and receptor systems of the ovarian follicle for culture.
After three washes in isolation medium and two washes
in culture medium, the preantral follicles were cultured
individually in 100 µL culture medium in 96-well tissue culture
plates for up to 4 days at 37°C in a humidified atmosphere of
5% CO2 in air (Cortvrindt et  al. 1998). The culture medium
consisted of α-minimal essential medium (with 10 mM HEPES;
Gibco, Thermo Fisher Scientific) enriched with 1% ITS (5 µg/
mL insulin, 5 µg/mL transferrin, 5 ng/mL selenium; Sigma),
0.1% bovine serum albumin (BSA; Sigma), 100 µg/mL sodium
pyruvate and 1% antibiotics in the absence (control) or
presence of CNP (N8768; Sigma-Aldrich) (Huang et al. 2011,
Zhong et  al. 2015, Zhang et  al. 2017). CNP was dissolved
in phosphate-buffered saline (PBS; Gibco, Thermo Fisher
Scientific) and stored at −20°C until used. For control cultures,
an equal volume of PBS was added to the culture medium in
place of CNP. All selected follicles were pooled and randomly
divided over the culture conditions under study. Half the
medium was replaced with fresh medium every other day.
The follicle morphological characteristics and diameters were
recorded every day as the average distance between the outer
edges of the basal membrane in two perpendicular planes
(Kobayashi et  al. 2009). To study ODGF regulation of Nppc
and Npr2 expression, the follicles were cultured in culture
medium with 100 ng/mL BMP15 (R&D Systems), 100 ng/mL
GDF9 (R&D Systems), 100 ng/mL FGF8 (R&D Systems) or
combinations thereof for 24 h (Su et  al. 2003, Zhang et  al.
2010, Miyoshi et al. 2012, Machado et al. 2015).
In vivo CNP treatment
Adult female mice (7  weeks old) were treated with CNP
(120 μg/kg body weight; N8768; Sigma-Aldrich) by i.p.
injection daily for 4  days. CNP was dissolved in PBS and
diluted by physiological saline solution before injection.
The mice were injected with 5 IU hCG (human chorionic
gonadotropin; Ningbo Second Hormone Factory, Zhejiang,
China) after 48-h administration of 5 IU PMSG (pregnant
https://rep.bioscientifica.com
CNP stimulates ovarian GC viability 447
mare serum gonadotropin; Ningbo Second Hormone Factory).
The ovulated oocytes in the oviducts were counted after
16 h to evaluate ovulation efficiency. Meanwhile, oocyte
morphology was evaluated under an inverted microscope
(Olympus). Nonviable oocytes had shape abnormalities, dark
cytoplasm, fragmented first polar body, ooplasm vacuolization
and fragments in the cytoplasm (Balaban & Urman 2006).
Prepubertal mice (13  days old) were processed as described
earlier, but were treated with 50 μg/kg body weight CNP. The
control group was injected with the same volume of normal
saline instead of CNP.
Cell viability assay
Cell viability was assessed by measuring the conversion
of tetrazolium salt (WST-8) to formazan according to the
manufacturer’s instructions of an Enhanced CCK-8 assay kit
(Beyotime Biotechnology, Jiangsu, China). The cells were
plated onto 96-well plates at a density of 3 × 103 cells per well
and cultured for 24 h, followed by 3-day treatment without
(control) or with CNP (Sigma) and 8-Br-cGMP (Sigma). CCK-8
assays were performed 24, 48 and 72 h after treatment. The
cells were washed with PBS (Gibco, Thermo Fisher Scientific),
and then 200 μL CCK-8 solution was added to each well
and incubated for 3 h at 37°C. The optical density of each
well at 450 nm was recorded on a Tecan microplate reader
(Infinite M200, Tecan Nordic AB, Stockholm, Sweden). The
results were calculated as the mean values of eight wells per
treatment group.
RNA extraction and quantitative real-time reverse
transcription (RT)-PCR (RT-qPCR)
Preantral follicle or cultured cell RNA isolation and qRT-PCR
were performed as previously described (Ren et al. 2015). In
summary, cultured cells in a six-well culture dish or about
100–150 follicles were treated as indicated, rinsed twice
with cold PBS and collected in 1.0 mL TRIzol (Invitrogen);
RNA was isolated as per the manufacturer’s instructions. The
extracted total RNA concentration and quality were assessed
by the absorbance at 260 nm (A260)/280 and A260/230
ratios as determined using a DS-11 spectrophotometer
(DeNovix, Wilmington, NC, USA). The RNA to be used
for the next experiment should have an A260/280 ratio of
1.8–2.0 and an A260/230 ratio of 2.0–2.2. Before RT, 1 μg
total RNA samples were digested with DNase I (Fermentas,
Hanover, MD, USA) to remove contaminating genomic DNA.
The primer of this cDNA synthesis kit was an oligo-dT and
random primer mix. Aliquot RNA RT was performed using
a commercially available first-strand cDNA synthesis kit
(iScript cDNA Synthesis Kit; Bio-Rad Laboratories). The real-
time PCR was performed in triplicate in a CFX96 Real-Time
PCR System (Bio-Rad Laboratories) using SsoFast EvaGreen
Supermix (Bio-Rad Laboratories). The thermal cycling
conditions were denaturation (95°C for 3 min), 40 cycles of
amplification (95°C for 10 s) and quantification (61°C for 30 s)
with a single fluorescence measurement and melting curve
analysis (65–95°C with 0.5°C/s increments and continuous
fluorescence measurements). Table 1 summarizes the related
Reproduction (2019) 157 445–455
Downloaded from Bioscientifica.com at 11/05/2020 04:09:28PM
via free access
448 G Xi, W Wang, S A Fazlani and others
Table 1  Primers for RT-PCR and qRT-PCR.
Gene Primer sequence (5′-3′)
Nppc Forward: GGTCTGGGATGTTAGTGCAGCTA
Reverse: TAAAAGCCACATTGCGTTGGA
Npr2 Forward: GCTGACCCGGCAAGTTCTGT
Reverse: ACAATACTCGGTGACAATGCAGAT
Wnt2b Forward: GACACGTCCTGGTGGTACATAGG
Reverse: TGGGTAGCGTTGACACAACTG
Wnt5a Forward: GCAGGCCGTAGGACAGTATACAA
Reverse: CGCCGCGCTATCATACTTCT
Cyp1a1 Forward: ATCCCCCACAGCACCACAA
Reverse: AGTTCCCGGTCATGGTTAACC
Cyp11a1 Forward: GACGCATCAAGCAGCAAAATTC
Reverse: TCCACGATCTCCTCCAGCAT
Cdkn1a Forward: CTGTCTTGCACTCTGGTGTCTG
Reverse: AGAAATCTGTCAGGCTGGTCTG
Gapdh Forward: CCTGGAGAAACCTGCCAAGTAT
Reverse: GGAAGAGTGGGAGTTGCTGTTG
primer information. The specificity of the qRT-PCR products
was confirmed with melting curve analysis. The amplification
efficiency of each primer pair was calculated based on the
slope of the standard curve. The amplification efficiency of
the primers used in our study was 95–105%. The relative
quantity of each gene was calculated by the comparative
threshold cycle (2−ΔΔCt) method as described previously (Livak
et  al. 2001). All experiments were repeated three or four
times using independent samples; the relative abundance of
specific genes was normalized to the relative abundance of
glyceraldehyde-3-phosphate dehydrogenase (Gapdh) levels
(Xu et al. 2013, Sadr et al. 2015, Yan et al. 2019).
Protein extraction and western blotting
The CNP and NPR2 levels in the mouse preantral follicles at
different stages were assayed by western blotting. About 250
preantral follicles were prepared by 20-min homogenization
in ice-cold radioimmunoprecipitation assay lysis buffer
(CWBio Co., Ltd., Beijing, China) containing 1% Halt Protease
and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific).
The supernatant was collected after 10-min centrifugation
at 15,000 g at 4°C, and proteins were quantified using an
Enhanced Bicinchoninic Acid Protein Assay Kit (Beyotime
Biotechnology). The samples were denatured in the same
volume of 2× Laemmli sample loading buffer (Bio-Rad
Laboratories) with 5% β-mercaptoethanol (Sigma) for 5 min
at 100°C and stored at −80°C for future use. Equal amounts
of protein (about 20 µg) were loaded in each well for 12%
SDS-PAGE, and then transferred onto microporous PVDF
membranes (Millipore). Membranes containing the transferred
proteins were blocked with Tris-buffered saline containing
0.1% Tween 20 (TBST; 20 mM Tris–HCl, 150 mM NaCl and
0.1% Tween 20, pH 7.6) and 5% skim milk for 1 h at room
temperature. After three washes with TBST, the membranes
were incubated overnight at 4°C with rabbit anti-CNP
polyclonal antibody (2  μg/mL; Santa Cruz Biotechnology
Inc.), rabbit anti-NPR2 antibody (2 μg/mL; Abcam) and rabbit
anti-GAPDH antibody (0.2 μg/mL; Sigma). After three washes
with TBST, the membranes were incubated for 1 h at room
temperature with horseradish peroxidase–linked secondary
Reproduction (2019) 157 445–455
Tm (°C) Amplification efficiency (%) Accession number
58 96.7 NM_010933.5
58 95.2 NM_173788.4
58 102.4 NM_009520.3
60 100.9 NM_009524.4
58 97.8 NM_001136059.2
58 99.1 NM_019779.4
60 95.0 NM_007669.5
60 104.3 NM_008084.3
antibodies (0.2 μg/mL; Golden Bridge, Beijing, China). After
three washes in TBST, the membranes were incubated with
enhanced chemiluminescence reagents (Millipore), exposed
digitally with Image Reader LAS-4000 (FujiFilm Life Science,
Tokyo, Japan).
Immunofluorescence staining
Mouse ovaries were fixed in 4% paraformaldehyde overnight
and stored at 4°C. The tissue was dehydrated and paraffin
embedded and sections (5 μm) were cut with a microtome. The
slides were deparaffinized in xylene, and then rehydrated in
a series of ethanol dilutions. After dewaxing and rehydration,
antigen retrieval was performed in 0.01% sodium citrate
buffer (pH 6.0), followed by cooling at room temperature
for at least 1 h. The sections were blocked in 0.5% BSA in
PBS for 1 h at room temperature. Then, the sections were
immunostained overnight at 4°C in a wet chamber with anti-
CNP primary antibody (10 μg/mL; Abnova, Taiwan, China)
and anti-NPR2 antibody (10 μg/mL; Abcam), followed by 1-h
incubation at room temperature with Alexa Fluor 594 Goat
Anti-Rabbit IgG (H+L) Secondary Antibody (1 μg/mL; Thermo
Fisher Scientific) and DAPI (4′,6-diamidino-2-phenylindole;
Thermo Fisher Scientific) counterstaining. The slides were
imaged with a fluorescence microscope (Olympus). For the
negative control, rabbit IgG (immunoglobulin G, 10 μg/mL;
Beyotime) was used in place of the primary antibody in
parallel reactions.
17β-Estradiol measurement
Media cultured with individual mouse follicles were pooled
on the fourth day and stored at −80°C until the measurement
of estradiol levels. Estradiol levels in the collected culture
media were determined by radioimmunoassay with the Iodine
[125I] Estradiol Radioimmunoassy Kit (Beijing North Institute
of Biological Technology, Beijing, China). The measurements
were taken in the General Hospital of the Nanjing Military
Command, China. The sensitivity of the assay was 1.4 pg/mL.
The intra-assay coefficient of variation (CV) was 6.2% and the
interassay CV was 8.9%.
https://rep.bioscientifica.com
Downloaded from Bioscientifica.com at 11/05/2020 04:09:28PM
via free access

Statistical analysis
Statistical differences in the data were evaluated using
SPSS (SPSS Inc.). Dunnett’s t-test was used for statistical
comparisons between two groups. Multiple groups were
compared statistically using one-way ANOVA, followed by
a least significant difference test. Significance was indicated
when P < 0.05.
Results
Nppc and Npr2 were gradually activated during
preantral follicle development
Follicle growth and development is largely dependent
on the activation of a series of paracrine, autocrine
and endocrine signals. Nppc and Npr2 transcription
were activated in the EPFs and late preantral follicles
(LPFs) of the prepubertal mice (Fig.  1A and B).
The immunofluorescence results confirmed these
observations (Fig.  1C). Interestingly, qRT-PCR showed
significantly increased Nppc and Npr2 transcripts
during early to late preantral follicle development
(Fig.  1D). Nppc is predominantly expressed in GCs,
whereas Npr2 is primarily expressed in CCs (Zhang
et  al. 2010). Here, we also detected antral GCs and
CCs as positive controls, which had higher Nppc and
Npr2 expression, respectively (Fig.  1D). These results
imply that, compared with antral follicles, in which high
CNP levels are needed for maintaining oocyte meiotic
arrest, relatively lower CNP levels may be sufficient for
promoting preantral follicle growth. Similarly, western
blotting showed an upward trend of CNP and NPR2 in
LPFs (Fig. 1E). Together, these results indicated a gradual
upregulation of CNP and NPR2 during mouse preantral
follicle growth.
CNP facilitated the growth of in vitro-cultured
preantral follicles
We isolated preantral follicles (100–130 µm diameter)
from prepubertal mouse ovaries and treated them with
0, 0.1, 1, 10, 100 or 500 nM CNP during in vitro culture.
Follicle growth dynamics monitoring showed that
>10 nM CNP increased follicle diameter significantly
(Fig. 2A and B), as revealed by the significantly increased
follicle sizes without flattened morphology (Fig.  2A).
Therefore, the role of CNP in promoting preantral follicle
growth was confirmed using the in vitro culture model
of mouse preantral follicles.
CNP and 8-Br-cGMP enhanced preantral GC viability
Based on the above observations, we speculated that
the promoting effect of CNP on preantral follicle growth
may largely be due to its effect on preantral GC viability.
Accordingly, we tested the effect of 0, 0.1, 10, 100 and
500 nM CNP on the viability of in vitro-cultured preantral
https://rep.bioscientifica.com
CNP stimulates ovarian GC viability 449
GCs. Unexpectedly, it appeared that CNP did not alter GC
viability at any concentration in culture conditions with
typical 10% FBS supplementation (Fig. 3A). Considering
CNP is ubiquitously present in serum (Yagci et al. 2008,
Kake et al. 2009), we reduced FBS supplementation to
5% and 1% to exclude its possible influence (Fig.  3B
and C). With 1% FBS supplementation, the control
group also showed sustained, but lower viability than
that with 10% FBS supplementation. Under the 1%
FBS supplementation culture condition, 10, 100 and
500 nM CNP significantly increased preantral GC
viability (Fig. 3C).
Next, as the biological function of CNP is dependent
on intracellular cGMP production via its exclusive
receptor NPR2, we detected the effect of the cGMP
analog (8-Br-cGMP) on preantral GC viability. At
>50 µM, 8-Br-cGMP exhibited a significant viability-
promoting effect (Fig. 3D). Taken together, these findings
suggest that both CNP and cGMP benefit preantral GC
viability in vitro.
CNP pre-treatment enhanced the ovulation rate of
superovulated mice
To detect the function of CNP for stimulating preantral
follicle development in vivo, adult (8-week-old)
and prepubertal mice (13-day-old) were treated
i.p. with CNP daily for 4  days, followed by a single
i.p. injection of 5 IU equine chorionic gonadotropin
for 48 h, and further treated with an ovulatory dose
of 5 IU hCG to examine superovulation efficiency.
We divided the total ovulated oocytes based on the
quality of the recovered oocytes: nonviable oocytes
always presented a non-uniform or even fragmented
cytoplasm (Fig.  4A). CNP pre-treatment (120 μg/kg
body weight) increased ovulation in the adult mice,
as revealed by the increased total and viable oocytes
(Fig.  4B). Similar results were obtained when the
prepubertal mice were pre-treated with CNP (50 μg/kg
body weight) (Fig. 4C). These findings suggest the ability
of CNP to promote preantral follicle development to
the early antral stage, thereby significantly enhancing
the outcome of superovulation in both adult and
prepubertal mice.
ODGFs stimulated Nppc and Npr2 expression
To understand the mechanism responsible for Nppc and
Npr2 expression regulation during early folliculogenesis,
we examined whether ODGFs modulate the two genes
in preantral follicles. Mouse preantral follicles and
preantral GCs were cultured in medium containing
BMP15, GDF9, FGF8 or combinations thereof, for
24 h. Real-time RT-PCR revealed that the ODGFs had
promoting effects on Nppc expression in the preantral
follicles (Fig.  5A). These effects were also observed in
the preantral GCs, except those cultured with FGF8,
Reproduction (2019) 157 445–455
Downloaded from Bioscientifica.com at 11/05/2020 04:09:28PM
via free access
450 G Xi, W Wang, S A Fazlani and others

A C DAPI NPR2 Merge

EPFs LPFs EPFs LPFs
OO OO OO
pAF

OO OO OO
CCs
AF CCs CCs

GCs GCs GCs

DAPI CNP Merge

B GCs
OO
GCs
OO
GCs
OO

pAF
Nppc 250 bp
100 bp
Npr2 250 bp
100 bp GCs GCs GCs

Gapdh 250 bp AF OO OO OO
100 bp CCs CCs CCs

DAPI IgG Merge

D
** ** OO
* * pAF OO
4 5
Relative Nppc mRNA expression

Relative Npr2 mRNA expression

** **
4
3
3 E EPFs LPFs GCs
2 CNP
2
GAPDH
1 1 NPR2
0 0 GAPDH
EPFs LPFs GCs

Figure 1 Nppc and Npr2 expression in follicles of different diameters. (A) Representative morphology of EPFs and LPFs. Scale bar = 100 μm. (B)
RT-PCR detection of Nppc and Npr2 expression in EPFs and LPFs. For the blank control reaction, water was used as the template. For the no
reverse transcriptase (NRT) control, 100 ng RNA was used as the template to confirm the absence of genomic DNA contamination. (C)
Representative immunofluorescence images of CNP and NPR2 expression. Scale bar = 100 μm. AF, antral follicle; pAF, preantral follicle. (D)
Comparisons of relative expression levels of Nppc and Npr2 in EPFs and LPFs. Antral GCs and CCs were used as positive controls for detecting
Nppc and Npr2, respectively. Values are the means ± s.e.m. of four independent replicates. Four samples prepared from individual animals were
used. P values for qRT-PCR were obtained using one-way ANOVA, followed by a least significant difference test. *P < 0.05, **P < 0.01. (E)
Western blotting detection of protein abundance of CNP and NPR2 in EPFs, LPFs and GCs. Antral GCs were used as the positive control for
detecting NPR2.

which only increased Nppc expression mildly, but not the preantral follicles and GCs (Fig.  5B and D). These
significantly (Fig. 5C). It is worth noting that BMP15 plus findings demonstrate that ODGFs, which are important
GDF9 had a dramatic additive effect on Nppc expression regulators of preantral follicle development, can also
in the preantral GCs (Fig. 5C). Only BMP15 significantly manipulate CNP–NPR2 signaling in mouse preantral
enhanced the expression levels of Npr2 mRNA in both GCs at transcriptional level.

Reproduction (2019) 157 445–455 https://rep.bioscientifica.com

Downloaded from Bioscientifica.com at 11/05/2020 04:09:28PM

via free access
 CNP stimulates ovarian GC viability 451

A B A 2
B 1.6
DMEM/F12+5%FBS
DMEM/F12+10%FBS
1.8
CNP Day 0 Day4

OD Value (450 nm)

190 ** 1.6

OD Value (450 nm)

1.2
1.4

0 nM
180 ** **
1.2 CNP CNP
1 0 nM 0.8 0 nM
0.8 500 nM 500 nM
170 **

Follicular Diameter/µm
0.6 100 nM 100 nM
** ** 10 nM 0.4 10 nM
0.4 1 nM
160 1 nM
0.1 nM 0.2 0.1 nM 0.1 nM
* 0 0
150 D0 D1 D2 D3 D0 D1 D2 D3
Time of Days Time of Days
140
1 nM C D
130 0.8 DMEM/F12+1%FBS ** 0.7
DMEM/F12+1%FBS
0.7 ** **
** 0.6

OD Value (450 nm)

120 * **

OD Value (450 nm)

0.6
0.5 **
D0 D1 D2 D3 D4 D5 ** **
10 nM 0.5 **
Time of Days CNP 0.4 cGMP
0.4 0 nM * 0 mM
0.3 **
0 nM 0.1 nM 1 nM 0.3 500 nM 1 mM
10 nM 100 nM 500 nM 100 nM 500 μM
0.2 0.2
10 nM 100 μM
100 nM 1 nM 0.1 50 μM
0.1
0.1 nM 10 μM
0 0
D0 D1 D2 D3 D0 D1 D2 D3
Time of Days Time of Days
500 nM

Figure 3 Effect of CNP and cGMP on GC viability in vitro. (A and B)

GC proliferation in CNP-treated high-serum culture medium (5 and
Figure 2 CNP promoted preantral follicle growth in vitro. (A) 10% FBS–DMEM/F12 medium) was not significantly different. (C) At
Representative images at day 0 and day 4 of cultured preantral 10, 100 and 500 nM, CNP significantly increased preantral GC
follicles with or without CNP treatment. Scale bar = 100 μm. (B) viability in low-serum (1% FBS) supplementation conditions. (D)
Diameters of preantral follicles with or without CNP treatment Preantral GCs cultured with 100 µM, 500 µM or 1 mM cGMP had
monitored daily from day 0 to day 4. Values are the means ± s.e.m. highly significant proliferation rates. Comparison was only performed
Four independent culture experiments were performed; there were at between the treatment groups and the control group. Five
least 100 follicles per group. Comparisons were performed between independent experiments were performed. Values are the
the treatment groups and the control group. Values are the means ± s.e.m. P values were obtained using Dunnett’s t-test.
means ± s.e.m. P values were obtained using Dunnett’s t-test. *P < 0.05, **P < 0.01.
*P < 0.05, **P < 0.01.
Discussion
The effect of CNP on the expression of key ovarian In female gametogenesis-related events, CNP is a well-
genes and steroidogenesis in mouse preantral follicles
established factor that plays a central role in regulating
To further elucidate the molecular mechanisms oocyte meiotic progress in growing follicles among
underlying the promoting effect of CNP on preantral different species (Zhang et al. 2010, Hiradate et al. 2014,
follicle development, we selected a set of key ovarian Zhong et al. 2015, Xi et al. 2018). In the present study, we
genes important for follicle growth and steroidogenesis focused on the function of CNP in promoting preantral
and detected the effect of CNP on their expression in follicle growth via enhanced GC viability. CNP–NPR2
cultured mouse preantral follicles. Preantral follicles were signaling was gradually activated upon early-to-late
treated with or without 200 nM CNP for 24 h before qRT- preantral follicle development (Fig.  1). The CNP and
PCR analyses of transcript levels. It should be noted that NPR2 expression dynamics during follicle development
the preantral growth promotion of 100 and 500 nM CNP provide a molecular basis for the promoting effect of
supplementation was not significantly different (Fig. 2). CNP, as an autocrine factor, on preantral follicle growth.
Therefore, an intermediate concentration (200 nM) was CNP treatment led to dose- and-time-dependent
used in the subsequent follicle culture. CNP increased increases in follicle size (Sato et al. 2012). Similarly, we
the expression of paracrine or autocrine factors that found that CNP stimulated preantral follicle growth in
contribute to follicle growth or GC viability (Wnt2b mice independent of FSH (Fig. 2). Correspondingly, LPFs
and Wnt5a) and a key steroidogenic enzyme (Cyp11a1) had significantly higher Nppc and Npr2 mRNA levels
(Fig.  6A). In contrast, CNP significantly repressed the than the EPFs (Fig.  1D). Considering GC viability is
expression of estrogen metabolic enzymes (Cyp1a1) essential for preantral follicle development (Zhang et al.
and cyclin-dependent kinase inhibitor (Cdkn1a/P21). 2011), we isolated preantral GCs and treated them with
Furthermore, the CNP-treated group had significantly CNP in vitro. CNP significantly promoted cell viability
increased 17β-estrogen concentrations in the medium (Fig. 3), and it is worth noting that this effect was also
at 4  days of culture compared with the control group independent of FSH or any other gonadotropins.
(Fig.  6B). These results demonstrate that CNP might CNP acts through guanylyl cyclase receptors, which
promote preantral follicle development by regulating activate intracellular cGMP production, one of the
WNT signaling and enhancing estrogen synthesis. most important second messengers. We show that, like

https://rep.bioscientifica.com Reproduction (2019) 157 445–455

Downloaded from Bioscientifica.com at 11/05/2020 04:09:28PM

via free access
 452 G Xi, W Wang, S A Fazlani and others

A Viable oocytes Nonviable oocytes A Nppc B Npr2

a a
6 2

Relative mRNA expression

Relative mRNA expression
ab
5

Preantral follicles
b b
4 b b b
b b
3 c c 1
c
2 d d
d
1
0 0
BMP15 BMP15
GDF9 GDF9
FGF8 FGF8

C Nppc D
Npr2
4 a
3
B C

Relative mRNA expression

Relative mRNA expression

Adult mice Prepubertal mice a

3 b

Granulosa cells
2
* * b
Mean total number of oocytes per mouse

b b
35
n=20
* PBS 35 n=21
2 b b
b
Mean number of ooc y tes per mous e

c c b b b
c 1 b
n=20 CNP
30 30 1
n=20
0 0
25 n=20 25 n=22
BMP15 BMP15
GDF9 GDF9
20 20 FGF8 FGF8

15 15 Figure 5 The effects of ODGFs on Nppc and Npr2 expression in

preantral follicles and GCs. (A) Nppc and (B) Npr2 mRNA expression
10 10
in ODGF-treated preantral follicles. (C) Nppc and (D) Npr2 mRNA
5 5 expression in cultured GCs treated with combination ODGFs. Four
independent experiments were performed. The P values for qRT-PCR
0 0 were obtained using one-way ANOVA followed by a least significant
Total Viable PBS CNP difference test. Values are the means ± s.e.m. Lowercase letters (a, b, c)
indicate significant differences (P < 0.05).
Figure 4 Effects of CNP pre-treatment on superovulation in mice.
(A) Representative images of viable (arrows) and nonviable et  al. 2012). Preantral follicles gradually establish the
(arrowheads) ovulated oocytes. Scale bar = 100 μm. (B) The number of full ability to respond to gonadotropins during follicular
total and viable oocytes from adult mice with or without CNP antrum formation, so we speculate that CNP can respond
pre-treatment were significantly different. (C) The number of total to gonadotropins by accelerating the development of
oocytes from prepubertal mice with or without CNP pre-treatment
was significantly different. The number of mice per group is
more preantral follicles. Accordingly, we tested the
indicated. Values are the means ± s.e.m. The two-tailed Student t-test effect of CNP on the ovulation rate in both adult and
was used to evaluate the statistical significance. *P < 0.05. prepubertal mice using the standard superovulation

CNP, cGMP remarkably increased GC viability in vitro A B

** Control 25
(Fig.  3D). 8-Br-cGMP suppressed rat preantral follicle 4
200nM CNP
*
apoptosis cultured in serum-free conditions (Mcgee
Relative mRNA expression

et  al. 1997). The authors hypothesized that a potential 20

3
Estrogen (pg/ml)

activator of the cGMP pathway may be essential for *

** 15
preantral follicle survival and development (Mcgee
2
et al. 1997). We speculate that CNP may be an upstream
10
factor that controls cGMP content in mouse preantral ** **
follicles. Nonetheless, how CNP increases GC viability 1
5
and whether it can inhibit GC apoptosis remains to
be studied. 0 0
In addition to the evidence from the in vitro Control 200nM
CNP
experiments, the in vivo studies using 13-day-old
juvenile mice also demonstrated that CNP may
promote preantral follicle development and enhance Figure 6 CNP regulates the transcription of ovarian developmental
preantral follicle response to subsequent exogenous key genes and increases estrogen levels. (A) Expression levels of
gonadotropins and lead to the satisfactory outcome of representative genes involved in follicle development (Wnt2b,
Wnt5a, Cdkn1a) and estrogen metabolism (Cyp1a1 and Cyp11a1) in
ovulation induction (Fig.  4). Similarly, CNP treatment
preantral follicles without (Control) or with 200 nM CNP treatment in
of 21-day-old prepubertal mice facilitated early antral vitro. (B) Estrogen concentration in control and CNP groups on day 4.
follicle development to the preovulatory stage, thereby Four independent experiments were performed. Values are the
allowing LH/hCG ovulation induction to generate means ± s.e.m. The two-tailed Student t-test was used to evaluate the
fertilizable oocytes and successful pregnancy (Sato statistical significance. *P < 0.05, **P < 0.01.

Reproduction (2019) 157 445–455 https://rep.bioscientifica.com

Downloaded from Bioscientifica.com at 11/05/2020 04:09:28PM

via free access

method. CNP pre-treatment significantly improved
the effect of superovulation in both groups of mice, as
indicated by the increase in total ovulated and viable
oocytes. Based on the profound inhibitory effect of CNP
on meiotic resumption, we have established a natural
factor synchronized in vitro oocyte maturation system
in our laboratory, which can significantly improve the
developmental competence of matured oocytes, thereby
resulting in higher in vitro bovine embryo production
efficiency (Xi et  al. 2018). In view of the role of CNP
in promoting follicle growth, it may be used to replace
gonadotropin for treating patients with infertility. As
CNP is a natural small-molecule polypeptide present in
the ovary, it may be possible to avoid adverse effects
stemming from the long half-life of gonadotropins,
such as ovarian hyperstimulation syndrome. Therefore,
our findings may provide a new strategy for improving
current superovulation technology in human infertility
treatment or farm animal reproductive management in
the future, if no adverse effects of CNP are found.
ODGFs are prominent paracrine regulators
of preantral follicle development, modulating
transcription in preantral follicles (Hayashi et al. 1999,
Celestino et al. 2011, Lima et al. 2012, Fenwick et al.
2013). We examined whether ODGFs can modulate
Nppc and Npr2 expression in preantral follicles and
GCs. Generally, GDF9, BMP15 and FGF8 alone or
combined enhanced Nppc and Npr2 expression in
preantral follicles and GCs (Fig. 5). Given the essential
role of CYP17A1 expression, GDF9 promotes rat
preantral follicle growth by upregulating follicular
androgen biosynthesis (Orisaka et al. 2009). Recently,
it has been found that BMP15 maintains in vitro culture
caprine preantral follicle integrity and promotes their
growth (Celestino et  al. 2011, Lima et  al. 2012). The
expression of FGF8 and its cognate receptors were
discovered in fetal bovine preantral follicles (Buratini
et  al. 2005). However, their regulation of Nppc
and Npr2 in mouse preantral follicle has not been
reported. Our results show that ODGFs are involved
in regulating Nppc and Npr2 expression in mouse
preantral follicle and imply that CNP may be a critical
mediator of the regulatory role of oocytes in preantral
follicle growth and survival, as oocytes secrete GDF9,
BMP15 and FGF8.
We investigated the effect of CNP on gene expression
in mouse preantral follicle and found that it affects
the expression of key ovarian genes involved in cell
growth and key steroidogenic enzymes (Fig.  6). CNP
enhanced Wnt2b, Wnt5a and Cyp11a1 expression
and reduced Cyp1a1 and Cdkn1a mRNA levels in
cultured preantral follicles (Fig.  6). Using conditional
gene targeting, Abedini et  al. found that GC-specific
inactivation of Wnt5a in mouse preantral follicle
results in female subfertility associated with increased
follicular atresia and decreased ovulation rates
https://rep.bioscientifica.com
CNP stimulates ovarian GC viability 453
(Abedini et  al. 2016). Therefore, Wnt5a expression is
critical for normal preantral follicle development in
mice. Cdkn1a encodes the potent cyclin-dependent
kinase inhibitor P21, which can directly bind to cyclin/
cyclin-dependent kinase 2 or 4 complexes and further
inhibit their activity, resulting in G1 arrest (Dutto
et  al. 2015). More recently, it was reported that p21
inhibits ovarian GC proliferation (Jiang et  al. 2015).
CNP treatment of preantral follicles may regulate
the GC cell cycle by affecting p21 expression. In the
future, it is necessary to focus on how CNP regulates
p21 expression and its effect on the cell cycle. We
observed that adding CNP to cultured preantral
follicles enhanced Cyp11a1 expression, which is
involved in estrogen synthesis. Consistent with our
observations, estrogen concentration was increased
after the 4-day CNP treatment (Fig.  6B). The elevated
estrogen levels were characteristic of preantral follicle
growth in vitro, and estrogen supplementation benefits
the reorganization of cultured follicles (Gore-Langton
et al. 1990, Adriaens et al. 2004).
Antrum initiation, the transition from preantral to
early antral follicle, is the determinant for normal
folliculogenesis. In humans, developmental disorder of
preantral follicles, including impaired antrum formation
and poor gonadotropin response, is a main cause of
female infertility. In short, our study not only highlights
the role of CNP in promoting preantral follicle growth by
enhancing follicular GC viability, but may also provide
a strategy for improving poor gonadotropin response in
human medicine.
Declaration of interest
The authors declare that there is no conflict of interest that
could be perceived as prejudicing the impartiality of the
research reported.
Funding
This work was supported by grants from the National Key R&D
Program (2017YFD0501901 and 2017YFD0501905), the
National Natural Science Foundation of China (No. 3167246
and 31472092) and the Earmarked Fund for the Innovative
Teams of Beijing Swine Industrialization Research Program.
Author contribution statement
G X, J T and L A were responsible for experimental design.
G X, L A, S A F and W W were responsible for writing the
paper and for data analysis. G X, W W and S A F were
responsible for RNA isolation, qRT-PCR and western blotting.
M Y was responsible for cell viability analysis. F Y and J H
were responsible for sample collection. J T and L A recruited
the subjects and supervised the experiments and revised
the manuscript.
Reproduction (2019) 157 445–455
Downloaded from Bioscientifica.com at 11/05/2020 04:09:28PM
via free access
454 G Xi, W Wang, S A Fazlani and others
References
Abedini  A, Zamberlam  G, Lapointe  E, Tourigny  C, Boyer  A, Paquet  M,
Hayashi K, Honda H, Kikuchi A, Price C et al. 2016 WNT5a is required
for normal ovarian follicle development and antagonizes gonadotropin
responsiveness in granulosa cells by suppressing canonical WNT
signaling. FASEB Journal 30 1534–1547. (https://doi.org/10.1096/fj.15-
280313)
Adriaens  I, Cortvrindt  R & Smitz  J 2004 Differential FSH exposure in
preantral follicle culture has marked effects on folliculogenesis and
oocyte developmental competence. Human Reproduction 19 398–408.
(https://doi.org/10.1093/humrep/deh074)
Balaban  B & Urman  B 2006 Effect of oocyte morphology on embryo
development and implantation. Reproductive Biomedicine Online 12
608–615. (https://doi.org/10.1016/S1472-6483(10)61187-X)
Boyer A, Goff AK & Boerboom D 2010 WNT signaling in ovarian follicle
biology and tumorigenesis. Trends in Endocrinology and Metabolism 21
25–32. (https://doi.org/10.1016/j.tem.2009.08.005)
Buratini JJ, Glapinski VF, Giometti IC, Teixeira AB, Costa IB, Avellar MC,
Barros  CM & Price  CA 2005 Expression of fibroblast growth factor-8
and its cognate receptors, fibroblast growth factor receptor (FGFR)-3c
and-4, in fetal bovine preantral follicles. Molecular Reproduction and
Development 70 255–261. (https://doi.org/10.1002/mrd.20205)
Cattanach  BM, Iddon  CA, Charlton  HM, Chiappa  SA & Fink  G
1977 Gonadotrophin-releasing hormone deficiency in a mutant
mouse with hypogonadism. Nature 269 338–340. (https://doi.
org/10.1038/269338a0)
Celestino JJ, Lima-Verde IB, Bruno JB, Matos MH, Chaves RN, Saraiva MV,
Silva  CM, Faustino  LR, Rossetto  R, Lopes  CA et  al. 2011 Steady-state
level of bone morphogenetic protein-15 in goat ovaries and its influence
on in vitro development and survival of preantral follicles. Molecular
and Cellular Endocrinology 338 1–9. (https://doi.org/10.1016/j.
mce.2011.02.007)
Cheng Y, Kawamura K, Takae S, Deguchi M, Yang Q, Kuo C & Hsueh AJ 2013
Oocyte-derived R-spondin2 promotes ovarian follicle development.
FASEB Journal 27 2175–2184. (https://doi.org/10.1096/fj.12-223412)
Chinkers M, Garbers DL, Chang MS, Lowe DG, Chin HM, Goeddel DV
& Schulz  S 1989 A membrane form of guanylate cyclase is an
atrial natriuretic peptide receptor. Nature 338 78–83. (https://doi.
org/10.1038/338078a0)
Chusho  H, Tamura  N, Ogawa  Y, Yasoda  A, Suda  M, Miyazawa  T,
Nakamura  K, Nakao  K, Kurihara  T, Komatsu  Y et  al. 2001 Dwarfism
and early death in mice lacking C-type natriuretic peptide. PNAS 98
4016–4021. (https://doi.org/10.1073/pnas.071389098)
Cortvrindt  R, Smitz  J & Van Steirteghem  AC 1996 In-vitro maturation,
fertilization and embryo development of immature oocytes from
early preantral follicles from prepuberal mice in a simplified culture
system. Human Reproduction 11 2656–2666. (https://doi.org/10.1093/
oxfordjournals.humrep.a019188)
Cortvrindt  R, Hu  Y & Smitz  J 1998 Recombinant luteinizing hormone
as a survival and differentiation factor increases oocyte maturation
in recombinant follicle stimulating hormone-supplemented mouse
preantral follicle culture. Human Reproduction 13 1292–1302. (https://
doi.org/10.1093/humrep/13.5.1292)
Craig J, Orisaka M, Wang H, Orisaka S, Thompson W, Zhu C, Kotsuji F &
Tsang BK 2007 Gonadotropin and intra-ovarian signals regulating follicle
development and atresia: the delicate balance between life and death.
Frontiers in Bioscience 12 3628–3639. (https://doi.org/10.2741/2339)
Dutto  I, Tillhon  M, Cazzalini  O, Stivala  LA & Prosperi  E 2015 Biology
of the cell cycle inhibitor p21(CDKN1A): molecular mechanisms and
relevance in chemical toxicology. Archives of Toxicology 89 155–178.
(https://doi.org/10.1007/s00204-014-1430-4)
Eppig  JJ 2001 Oocyte control of ovarian follicular development and
function in mammals. Reproduction 122 829–838. (https://doi.
org/10.1530/rep.0.1220829)
Eppig  JJ, Wigglesworth  K & Pendola  FL 2002 The mammalian oocyte
orchestrates the rate of ovarian follicular development. PNAS 99
2890–2894. (https://doi.org/10.1073/pnas.052658699)
Fenwick MA, Mora JM, Mansour YT, Baithun C, Franks S & Hardy K 2013
Investigations of TGF-beta signaling in preantral follicles of female
mice reveal differential roles for bone morphogenetic protein 15.
Endocrinology 154 3423–3436. (https://doi.org/10.1210/en.2012-2251)
Reproduction (2019) 157 445–455
Geister  KA, Brinkmeier  ML, Hsieh  M, Faust  SM, Karolyi  IJ, Perosky  JE,
Kozloff  KM, Conti  M & Camper  SA 2013 A novel loss-of-function
mutation in Npr2 clarifies primary role in female reproduction and
reveals a potential therapy for acromesomelic dysplasia, Maroteaux
type. Human Molecular Genetics 22 345–357. (https://doi.org/10.1093/
hmg/dds432)
Gore-Langton  RE & Daniel  SA 1990 Follicle-stimulating hormone and
estradiol regulate antrum-like reorganization of granulosa cells in rat
preantral follicle cultures. Biology of Reproduction 43 65–72. (https://
doi.org/10.1095/biolreprod43.1.65)
Halpin  DM, Charlton  HM & Faddy  MJ 1986 Effects of gonadotrophin
deficiency on follicular development in hypogonadal (hpg) mice. Journal
of Reproduction and Fertility 78 119–125. (https://doi.org/10.1530/
jrf.0.0780119)
Hayashi  M, Mcgee  EA, Min  G, Klein  C, Rose  UM, van Duin  M &
Hsueh  AJ 1999 Recombinant growth differentiation factor-9 (GDF-
9) enhances growth and differentiation of cultured early ovarian
follicles. Endocrinology 140 1236–1244. (https://doi.org/10.1210/
endo.140.3.6548)
Hiradate  Y, Hoshino  Y, Tanemura  K & Sato  E 2014 C-type natriuretic
peptide inhibits porcine oocyte meiotic resumption. Zygote 22
372–377. (https://doi.org/10.1017/S0967199412000615)
Huang  DH, Zhang  SW, Zhao  H & Zhang  L 2011 The role of C-type
natriuretic peptide in rat testes during spermatogenesis. Asian Journal of
Andrology 13 275–280. (https://doi.org/10.1038/aja.2010.147)
Hunter  MG, Robinson  RS, Mann  GE & Webb  R 2004 Endocrine and
paracrine control of follicular development and ovulation rate in farm
species. Animal Reproduction Science 82–83 461–477. (https://doi.
org/10.1016/j.anireprosci.2004.05.013)
Jiang L, Huang J, Li L, Chen Y, Chen X, Zhao X & Yang D 2015 MicroRNA-93
promotes ovarian granulosa cells proliferation through targeting CDKN1A
in polycystic ovarian syndrome. Journal of Clinical Endocrinology and
Metabolism 100 E729–E738. (https://doi.org/10.1210/jc.2014-3827)
Kake T, Kitamura H, Adachi Y, Yoshioka T, Watanabe T, Matsushita H, Fujii T,
Kondo E, Tachibe T, Kawase Y et al. 2009 Chronically elevated plasma
C-type natriuretic peptide level stimulates skeletal growth in transgenic
mice. American Journal of Physiology. Endocrinology and Metabolism
297 E1339–E1348. (https://doi.org/10.1152/ajpendo.00272.2009)
Kawamura  K, Cheng  Y, Kawamura  N, Takae  S, Okada  A, Kawagoe  Y,
Mulders  S, Terada  Y & Hsueh  AJ 2011 Pre-ovulatory LH/hCG surge
decreases C-type natriuretic peptide secretion by ovarian granulosa
cells to promote meiotic resumption of pre-ovulatory oocytes. Human
Reproduction 26 3094–3101. (https://doi.org/10.1093/humrep/der282)
Kobayashi  N, Orisaka  M, Cao  M, Kotsuji  F, Leader  A, Sakuragi  N &
Tsang  BK 2009 Growth differentiation factor-9 mediates follicle-
stimulating hormone-thyroid hormone interaction in the regulation of
rat preantral follicular development. Endocrinology 150 5566–5574.
(https://doi.org/10.1210/en.2009-0262)
Latham  KE, Wigglesworth  K, Mcmenamin  M & Eppig  JJ 2004 Stage-
dependent effects of oocytes and growth differentiation factor 9
on mouse granulosa cell development: advance programming and
subsequent control of the transition from preantral secondary follicles
to early antral tertiary follicles. Biology of Reproduction 70 1253–1262.
(https://doi.org/10.1095/biolreprod.103.023937)
Lee KB, Zhang M, Sugiura K, Wigglesworth K, Uliasz T, Jaffe LA & Eppig JJ
2013 Hormonal coordination of natriuretic peptide type C and natriuretic
peptide receptor 3 expression in mouse granulosa cells. Biology of
Reproduction 88 42. (https://doi.org/10.1095/biolreprod.112.104810)
Lima  IM, Brito  IR, Rossetto  R, Duarte  AB, Rodrigues  GQ, Saraiva  MV,
Costa  JJ, Donato  MA, Peixoto  CA, Silva  JR et  al. 2012 BMPRIB and
BMPRII mRNA expression levels in goat ovarian follicles and the in vitro
effects of BMP-15 on preantral follicle development. Cell and Tissue
Research 348 225–238. (https://doi.org/10.1007/s00441-012-1361-4)
Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods 25 402–408. (https://doi.org/10.1006/meth.2001.1262)
Lumsden  NG, Khambata  RS & Hobbs  AJ 2010 C-type natriuretic
peptide (CNP): cardiovascular roles and potential as a therapeutic
target. Current Pharmaceutical Design 16 4080–4088. (https://doi.
org/10.2174/138161210794519237)
Machado MF, Caixeta ES, Sudiman J, Gilchrist RB, Thompson JG, Lima PF,
Price  CA & Buratini  J 2015 Fibroblast growth factor 17 and bone
https://rep.bioscientifica.com
Downloaded from Bioscientifica.com at 11/05/2020 04:09:28PM
via free access

morphogenetic protein 15 enhance cumulus expansion and improve
quality of in vitro-produced embryos in cattle. Theriogenology 84
390–398. (https://doi.org/10.1016/j.theriogenology.2015.03.031)
Mcgee E, Spears N, Minami S, Hsu SY, Chun SY, Billig H & Hsueh AJ 1997
Preantral ovarian follicles in serum-free culture: suppression of apoptosis
after activation of the cyclic guanosine 3',5'-monophosphate pathway
and stimulation of growth and differentiation by follicle-stimulating
hormone. Endocrinology 138 2417–2424. (https://doi.org/10.1210/
endo.138.6.5164)
Mcnatty KP, Reader K, Smith P, Heath DA & Juengel JL 2007 Control of
ovarian follicular development to the gonadotrophin-dependent phase:
a 2006 perspective. Society of Reproduction and Fertility Supplement 64
55–68. (https://doi.org/10.5661/RDR-VI-55)
Miyoshi T, Otsuka F, Nakamura E, Inagaki K, Ogura-Ochi K, Tsukamoto N,
Takeda M & Makino H 2012 Regulatory role of kit ligand-c-kit interaction
and oocyte factors in steroidogenesis by rat granulosa cells. Molecular
and Cellular Endocrinology 358 18–26. (https://doi.org/10.1016/j.
mce.2012.02.011)
Nishikimi T, Kuwahara K & Nakao K 2011 Current biochemistry, molecular
biology, and clinical relevance of natriuretic peptides. Journal of
Cardiology 57 131–140. (https://doi.org/10.1016/j.jjcc.2011.01.002)
Orisaka  M, Orisaka  S, Jiang  JY, Craig  J, Wang  Y, Kotsuji  F & Tsang  BK
2006 Growth differentiation factor 9 is antiapoptotic during
follicular development from preantral to early antral stage. Molecular
Endocrinology 20 2456–2468. (https://doi.org/10.1210/me.2005-0357)
Orisaka  M, Jiang  JY, Orisaka  S, Kotsuji  F & Tsang  BK 2009 Growth
differentiation factor 9 promotes rat preantral follicle growth by
up-regulating follicular androgen biosynthesis. Endocrinology 150
2740–2748. (https://doi.org/10.1210/en.2008-1536)
Orisaka  M, Hattori  K, Fukuda  S, Mizutani  T, Miyamoto  K, Sato  T,
Tsang BK, Kotsuji F & Yoshida Y 2013 Dysregulation of ovarian follicular
development in female rat: LH decreases FSH sensitivity during
preantral-early antral transition. Endocrinology 154 2870–2880. (https://
doi.org/10.1210/en.2012-2173)
Potter LR, Abbey-Hosch S & Dickey DM 2006 Natriuretic peptides, their
receptors, and cyclic guanosine monophosphate-dependent signaling
functions. Endocrine Reviews 27 47–72. (https://doi.org/10.1210/
er.2005-0014)
Ren L, Wang Z, An L, Zhang Z, Tan K, Miao K, Tao L, Cheng L, Zhang Z,
Yang M et al. 2015 Dynamic comparisons of high-resolution expression
profiles highlighting mitochondria-related genes between in vivo
and in vitro fertilized early mouse embryos. Human Reproduction 30
2892–2911. (https://doi.org/10.1093/humrep/dev228)
Sadr  SZ, Ebrahimi  B, Shahhoseini  M, Fatehi  R & Favaedi  R 2015
Mouse preantral follicle development in two-dimensional and three-
dimensional culture systems after ovarian tissue vitrification. European
Journal of Obstetrics, Gynecology, and Reproductive Biology 194
206–211. (https://doi.org/10.1016/j.ejogrb.2015.09.028)
https://rep.bioscientifica.com
CNP stimulates ovarian GC viability 455
Sato  Y, Cheng  Y, Kawamura  K, Takae  S & Hsueh  AJ 2012 C-type
natriuretic peptide stimulates ovarian follicle development. Molecular
Endocrinology 26 1158–1166. (https://doi.org/10.1210/me.2012-1027)
Su YQ, Denegre JM, Wigglesworth K, Pendola FL, O’Brien MJ & Eppig JJ
2003 Oocyte-dependent activation of mitogen-activated protein kinase
(ERK1/2) in cumulus cells is required for the maturation of the mouse
oocyte-cumulus cell complex. Developmental Biology 263 126–138.
(https://doi.org/10.1016/S0012-1606(03)00437-8)
Xi  G, An  L, Jia  Z, Tan  K, Zhang  J, Wang  Z, Zhang  C, Miao  K, Wu  Z &
Tian J 2018 Natriuretic peptide receptor 2 (NPR2) localized in bovine
oocyte underlies a unique mechanism for C-type natriuretic peptide
(CNP)-induced meiotic arrest. Theriogenology 106 198–209. (https://
doi.org/10.1016/j.theriogenology.2017.09.003)
Xu B, Gao L, Cui Y, Gao L, Dai X, Li M, Zhang Y, Ma X, Diao F & Liu J
2013 SET protein up-regulated testosterone production in the cultured
preantral follicles. Reproductive Biology and Endocrinology 11 9.
(https://doi.org/10.1186/1477-7827-11-9)
Yagci R, Totan Y, Ozluk E, Ozyurt H, Akbay G & Eksioglu M 2008 Serum
levels of natriuretic peptides in patients with Behcet’s disease. Clinical
Rheumatology 27 1153–1158. (https://doi.org/10.1007/s10067-008-
0886-0)
Yan  W, Zhou  S, Shen  W, Cheng  J, Yuan  S, Ye  S, Jin  Y, Luo  A & Wang  S
2019 Suppression of SEMA6C promotes preantral follicles atresia with
decreased cell junctions in mice ovaries. Journal of Cellular Physiology
234 4934–4943. (https://doi.org/10.1002/jcp.27294)
Zhang M, Su YQ, Sugiura K, Xia G & Eppig JJ 2010 Granulosa cell ligand
NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes.
Science 330 366–369. (https://doi.org/10.1126/science.1193573)
Zhang CP, Yang JL, Zhang J, Li L, Huang L, Ji SY, Hu ZY, Gao F & Liu YX
2011 Notch signaling is involved in ovarian follicle development by
regulating granulosa cell proliferation. Endocrinology 152 2437–2447.
(https://doi.org/10.1210/en.2010-1182)
Zhang Y, Wang H, Liu W, Yang Y, Wang X, Zhang Z, Guo Q, Wang C & Xia G
2017 Natriuretic peptides improve the developmental competence of in
vitro cultured porcine oocytes. Reproductive Biology and Endocrinology
15 41. (https://doi.org/10.1186/s12958-017-0258-1)
Zhong Y, Lin J, Liu X, Hou J, Zhang Y & Zhao X 2015 C-Type natriuretic
peptide maintains domestic cat oocytes in meiotic arrest. Reproduction,
Fertility, and Development 28 1553–1559. (https://doi.org/10.1071/
RD14425)
Received 4 September 2018
First decision 10 October 2018
Revised manuscript received 11 February 2019
Accepted 25 February 2019
Reproduction (2019) 157 445–455
Downloaded from Bioscientifica.com at 11/05/2020 04:09:28PM
via free access