Evolution of RH Genes in Hominoids:

Characterization of a Gorilla RHCE-like Gene

A. Blancher and P.-A. Apoil

The human RH locus is responsible for the expression of the Rh blood group an-
tigens. It consists of two closely linked genes, RHD and RHCE, that exhibit 92%
similarity between coding regions. These observations suggest that they are de-
rived from a relatively recent duplication event. Previously a study of nonhuman
primate RH-like genes demonstrated that ancestral RH gene duplication occurred
in the common ancestor of man, chimpanzees and gorillas. By amplification of
intron 3 and intron 4 of gorilla RH-like genes, we have now shown that, like man,
gorillas possess two types of RH intron 3 (RHCE intron 3 being 289 bp longer than
the RHD intron 3) and two types of intron 4 (RHCE intron 4 being 654 bp longer
than the RHD intron 4). Here we report the characterization of a cDNA encoded by
a gorilla RH-like gene which possesses introns 3 and 4 of the RHCE type. A com-
parison of this gorilla RHCE-like coding sequence with previously characterized
human and ape cDNA sequences suggests that RH genes experienced complex
recombination events after duplication in the common ancestor of humans, chim-
panzees and gorillas.

From the Laboratoire d’Immunogénétique Moléculaire,
Université Paul Sabatier, Pavillon Charles Lefebyre,
Hôpital Purpan, Toulouse, France. This work was sup-
ported by funds from MESR (contrat Jeune équipe
1966) and from Agence Française du Sang (contract
65001731231). We wish to thank Dr. Francis Roubinet
for critically reviewing this manuscript and for helpful
discussions and advice. We are indebted to Stéphanie
Despiau for her very efficient laboratory assistance. All
experiments described in this article were performed
in accordance with French laws and regulations cur-
rently in force. We thank Alejandro Rooney and Masa-
toshi Nei for helpful discussion and critical review. The
gorilla RHCE-like coding sequence was submitted to
GenBank/EMBL. We are waiting for the accession num-
ber. Address correspondence to Antoine Blancher, La-
boratoire d’Immunologie, CHU (Centre Hospitalier et
Universitaire) de Toulouse, Hôpital Purpan, 31059 Tou-
louse CEDEX, France, or e-mail: blancher@mail.
easynet.fr. This paper was delivered at a symposium
entitled ‘‘Genetic Diversity and Evolution’’ sponsored
by the American Genetic Association at the Pennsyl-
vania State University, University Park, PA, USA, June
12–13, 1999.

2000 The American Genetic Association 91:205–210
The human Rh system encompasses five
main antigens—D, C, c, E, and e—that are
present on red blood cells ( Issitt and An-
stee 1998). The term ‘‘Rhesus antigen’’ was
introduced by Landsteiner and Wiener,
who found that rabbits (and later, guinea
pigs) immunized with red blood cells
(RBCs) from a rhesus monkey produced
antibodies which agglutinated 85% of Cau-
casian blood samples ( Landsteiner and
Wiener 1940, 1941). The antibodies were
called anti-Rhesus (anti-Rh), and the two
human groups were defined as Rh positive
and Rh negative. Before the discovery of
the rhesus factor it was suspected that
some cases of grave hemolytic anemia in
newborn babies resulted from an unspec-
ified immunologic incompatibility be-
tween the mother and the fetus ( Levine
and Stetson 1939). Several observations
made following the discovery of the Rh
factor firmly established that the Rh factor
was at the root of unexplained reactions
that occurred during transfusion of blood
that was of the same ABO, MNS and P
types as the recipient, and that it was the
cause of hemolytic disease in newborns
( Levine et al. 1941; Wiener and Peters
1940). Because the animal anti-Rh antibod-
ies required extensive absorption before
being able to produce faint Rh-specific ag-
glutination, the use of animal anti-Rh an-
tibodies was abandoned and the definition
of the Rh antigen was based on the use of
human anti-Rh antibodies. Another prob-
lem was that it was impossible to demon-
strate the presence of the Rh antigen on
macaque red cells by tests with human
anti-Rh reagents. Twenty years after Land-
steiner and Wiener’s experiments, Levine
et al. (1961) characterized in the serum of
a guinea pig immunized with human RBCs
a fraction of antibodies (called anti-LW in
honor of Landsteiner and Wiener), which
identified an antigen present on human
Rh-positive and Rh-negative and rhesus
monkey red cells ( Levine et al. 1961,
1963). The antigen LW was clearly distinct
from the Rh antigen, and later it was dem-
onstrated that the LW gene lies on human
chromosome 19 (Sistonen 1984), while the
RH gene is localized on the short arm of
human chromosome 1 (Chérif-Zahar et al.
1991; Marsh et al. 1974). Although the two
genes are distinct, the Rh and LW proteins
are part of a molecular complex called the
Rh complex at the surface of red cells
(Cartron et al. 1998). In conclusion, if the
term ‘‘Rh’’ was coined by Landsteiner and
Wiener because of the source of antigens
(the rhesus monkey) they used to obtain
anti-Rh in rabbits, it is highly probable
that, in fact, they produced anti-LW anti-
bodies. Despite that, the term Rh has con-

205
Table 1. Primer sequences
Name of primers Sequences References
Ex.1-dir GCCTGCACAGAGACGGACACAGG Apoil and Blancher 1999
Ex10.rev CAACAGCCAAATGAGGAAACTTCC Apoil and Blancher 1999
Ex.4-dir CGATACCCAGTTTGTCTGCCATGC Apoil and Blancher 2000
Ex.5-rev TTGGGGTGAGCCAAGGATGAC(C/A)C Apoil and Blancher 2000
Int.3-dir (A/G)GGATTACAAGCAAGCATCACC Apoil and Blancher 2000
Int.3-rev CACGCAC(C/T)TCACTGATTCCTACTTC Apoil and Blancher 2000
RB46-dir TGGCAAGAACCTGGACCTTGACTTT Matassi et al. 1997
intron4.RHCE-rev CCACCCTTGTTCCTTCACTCCTGG This study
Gor.CE-dir AAAGGGGGATAAAGGTCAGAG This study
tinued to be used for the most important ed that the four main alleles of the RHCE
human blood group system after ABO for gene were derived, by intergenic exchang-
clinical transfusion. es and interallele recombinations, from a
Cross-reactivity of human anti-Rh re- few ancestor alleles (Carritt et al. 1997).
agents with nonhuman primate RBCs in- Southern blot studies have shown that
dicated that apes, contrary to rhesus mon- chimpanzees and gorillas possess at least
key, possess counterparts of human Rh three and two RH-like genes per haploid
antigens (Masouredis et al. 1967; Moor- genome, respectively, whereas orangutan,
Jankowski et al. 1973). More recently, the gibbon, OWM, and NWM possess only one
use of monoclonal antibodies confirmed RH-like gene per haploid genome ( Blanch-
that some chimpanzees and gorillas ex- er et al. 1992a; Blancher and Socha 1997).
press antigens that share epitopes (the Thus it was inferred that the duplication
term epitope designate the portion of an event that produced the human RHCE and
antigen which reacts with the antibody RHD genes occurred in the common an-
site of a given antibody) with the human cestor of humans, chimpanzees, and goril-
D antigen ( Blancher et al. 1992a,b; Socha las.
and Ruffié 1990) and that chimpanzees, go- In man, intron 3 and intron 4 in the
rillas, and gibbons express monomorphic RHCE gene are longer by 289 bp and 654
c-like antigens (Socha and Ruffié 1983). bp, respectively, than those of the RHD
Chimpanzee and gorilla counterparts of gene (Arce et al. 1993; Matassi et al. 1997).
human antigen D are antigens Rc and Dgor, By PCR it was shown that chimpanzees
respectively ( Blancher et al. 1992a,b; and gorillas have two types of intron 3
Roubinet et al. 1993). The expression of (RHCE-like and RHD-like) homologous in
antigens Rc and Dgor was shown to depend length with those of human RHD and RHCE
on chimpanzee and gorilla RH-like genes genes, respectively, and two types of in-
(Apoil et al. 1999; Salvignol et al. 1993, tron 4 (RHCE-like and RHD-like) homolo-
1994). Although Rh-like antigen expression gous in length with those of human RHD
appears restricted to apes, Rh-like poly- and RHCE genes, respectively (Apoil et al.
peptides are present at the surface of 1999; Apoil and Blancher 2000; Westhoff
RBCs of rhesus monkey as well as several and Wylie 1996). Moreover, sequence
nonprimate mammalian taxa (e.g., cat, studies showed that chimpanzees and go-
cow, rat; Saboori et al. 1989). Moreover, rillas have two types of RHD intron 4,
Rh-like polypeptides were also found in which differ by the absence (type 1) or
proteins extracted from RBC membranes presence (type 2) of a 12-mer repeat
of both Old World monkeys (OWM), New (Apoil and Blancher 2000). Apparently
World monkeys ( NWM), lemur, mouse, only the RHD type 1 intron exists in hu-
rat, and dog by immunoblotting tech- mans, because the type 2 intron 4 cannot
niques (Apoil and Blancher 1999; Mouro et be detected by PCR experiments (Apoil
al. 1994; Salvignol et al. 1995). and Blancher 2000). Existence of the two
The human RH locus consists of two types of introns in chimpanzees and goril-
closely linked genes, RHD, responsible for las suggests that the gene with type 2 in-
the expression of the antigen D, and RHCE, tron was lost in the human lineage after
which encodes proteins carrying antigens the split from chimpanzees (Apoil and
C or c and E or e. RHD is present or absent Blancher 2000).
depending on the RH haplotype (Colin et The Rh-like cDNA sequences of three
al. 1991), and RHCE displays four common chimpanzees and one gorilla (Mabeke)
alleles (ce, Ce, cE, CE) responsible for the were shown to be closer to the human
expression of the two antithetical (allelic) RHD coding sequences than to the RHCE
series of antigens C or c and E or e (Mouro coding sequences (Salvignol et al. 1995).
et al. 1993). Moreover, it was demonstrat- However, RHCE-like genes, which possess
206 The Journal of Heredity 2000:91(3)
Figure 1. Length polymorphism of intron 3 and 4 re-
gions in gorilla RH-like genes. Black rectangles show
the DNA regions present in the introns of the RHCE
type and absent from introns of the RHD type. (A)
Length differences between gorilla RHCE and RHD
types introns 3 (289 bp) and between gorilla RHCE and
RHD types introns 4 (654 bp). (B) A fragment of 1.95
kb amplified from gorilla Kessala genomic DNA. It con-
tains introns 3 and intron 4 of the RHCE type. (C) Prim-
er Gor.CE-dir used for amplication of gorilla RHCE-like
cDNA from exon 4 to exon 10.
intron 3 and 4 of the RHCE type may exist
in chimpanzees and gorillas. Nevertheless,
the existence of functional RHCE-like
genes in chimpanzees and gorillas has to
be confirmed by detecting RHCE-like tran-
scripts. Here we report the results of char-
acterization of a cDNA encoded by a go-
rilla RH-like gene, which possess introns 3
and 4 of the RHCE type.
Materials and Methods
Data Collection
Fresh blood samples of gorillas were ob-
tained from CIRMF (Centre International
de Recherche Médicale de Franceville), Fr-
anceville, Gabon. Frozen blood samples
were from LEMSIP ( Laboratory for Exper-
imental Medicine and Surgery in Primates,
New York Medical Center, Tuxedo, NY).
The intron 4 and intron 3 regions of gorilla
RH-like genes were studied by PCR ampli-
fication using two pairs of oligonucleotide
primers described in Apoil et al. (1999)
and Apoil and Blancher (2000). The se-
quences of primers used here are given in
Table 1. From these preliminary studies,
we opted to select DNA samples from a
gorilla ( Kessala) that has introns 3 and 4
of the RHCE type. Long PCR amplification
from intron 3 (primer RB.46-dir) to intron
4 (primer intron 4.RHCE-rev) was carried
out with the genomic DNA from this gorilla
( Figure 1B). The length of the amplified
fragment was identical to that obtained
from the genomic DNA of a human control
possessing only the RHCE gene (i.e., an
RhD-negative Caucasian). The exon 4 re-
gion of the gorilla RHCE-like amplified frag-
ment was sequenced on both strands us-
ing automated protocols ( Figure 1B).
The mRNA extracted from the periph-
eral white blood cells of the previously
mentioned gorilla was submitted to re-
verse transcription PCR (RT-PCR). The re-
sultant cDNA product was first amplified
from exon 1 to 10 (primers Ex.1-dir and
Ex.10-rev) using cDNAs obtained from to-
tal RNA extracted from peripheral blood of
gorilla Kessala as templates. The resulting
amplified fragments were used for a sec-
ond seminested PCR amplification (from
exon 4 to 10) using primers Gor.CE-dir and
Ex.10-rev. The fragment obtained by the
seminested PCR was sequenced (see Fig-
ure 1C). In order to enhance the specificity
of the PCR reaction; a mismatch was intro-
duced into the sequence of primer Gor.CE-
dir at position 6 from the 5⬘ end. Amplified
fragments were separated by size with
agarose-gel electrophoresis and were puri-
fied on columns (Qiagen, Hilden, Germa-
ny). Following purification, PCR fragments
were sequenced on a 373A automated
DNA sequencer (PE Applied Biosystems,
Foster City, CA).
DNA Sequence Analysis
An alignment of nucleotide sequences was
conducted by taking into account the de-
duced amino acid sequence alignment of
the RH-like genes. The alignment was done
by using the computer program CLUS-
TALW version 1.7 ( Thompson et al. 1994),
with subsequent corrections made after
visual inspection. Phylogenetic analysis
was carried out using the computer pro-
gram MEGA version 1.03 ( Kumar et al.
1993). Pairwise distances between nucle-
otide sequences were calculated by using
Kimura’s (1980) two-parameter distances
or the uncorrected p distance. Distances
between amino acid sequences were cal-
culated using a gamma distance with a
shape parameter a ⫽ 2. Phylogenetic trees
were constructed by the neighbor-joining
method (Saitou and Nei 1987) with the
pairwise deletion option. Statistical reli-
ability was assessed using the bootstrap
method ( Felsenstein 1985) with 500 repli-
cates.
Results
Characterization of a Gorilla Gene
Which Possesses Intron 3 and 4 of the
RHCE Type
Figure 1A shows the length polymorphism
in gorilla introns 3 and 4 (Apoil et al.
1999). In the case of intron 4, all gorillas
tested so far (15 unrelated animals) had
an intron 4 sequence similar in length (0.5
kb) to the human RHD intron 4. The sec-
ond type of intron was similar in length to
the human RHCE intron 4 (1.25 kb), but
was detected by PCR amplification in only
5 of 15 gorillas. In the case of intron 3, 7
of 15 gorillas showed two different PCR
length fragments. One was similar to the
human RHD gene (290 bp) and the other
one was similar to the human RHCE gene
(580 bp). In the remaining eight gorilla
samples, only RHCE-like intron 3 was de-
tected.
To confirm the presence of an RHCE-like
gene in gorillas, we tried to amplify a long
genomic fragment which encompassed
both introns 3 and 4 of this putative gene.
From gorilla Kessala, which was known to
have introns 3 and 4 of the RHCE type, a
DNA fragment approximately 2 kb was am-
plified using an intron 3 primer (RB46-dir)
and a primer specific to the RHCE intron
4 ( Intron4.RHCE-rev) ( Figure 1B). The
length of this gorilla amplified fragment
was equivalent to those obtained by am-
plification of human DNA control samples
from individuals having only the RHCE
gene. By means of primers RB46-dir and
Intron4.RHCE-rev, this DNA fragment was
not obtained from a DNA sample of a dif-
ferent gorilla, which did not have intron 4
of the RHCE type. Direct sequencing of the
gorilla 2 kb amplified fragment confirmed
the presence of RHCE-specific elements in
intron 3 and intron 4 (data not shown).
The sequence of exon 4 of these fragments
( hereafter named Gor RHCE exon 4) was
closer to human RHCE exon 4 rather than
to human RHD exon 4 ( Figure 2 and Table
2). Moreover, the Gor RHCE exon 4 se-
quence differs significantly from all other
gorilla cDNA sequences previously char-
acterized (Salvignol et al. 1995).
Characterization of Gorilla RHCE-
like cDNA
From the gorilla Gor RHCE exon 4 se-
quence, we designed a primer (Gor.CE-dir)
for allele-specific PCR amplification (see
Material and Methods; Table 1 and Figure
1C). cDNA obtained from total RNA ex-
tracted from peripheral blood of gorilla
Kessala was first amplified from exon 1 to
10 (primers Ex.1-dir and Ex.10-rev). The
resulting amplified fragments were used
for a second seminested PCR (from exon
4 to 10) using primers Gor.CE-dir and
Ex.10-rev. The fragment obtained by the
seminested PCR was sequenced (see Fig-
ure 1C). The cDNA region which corre-
sponds to exon 4 (33 bp) was identical to
the genomic Gor RHCE exon 4. The cDNA
region that corresponds to the Gor RHCE
exon 5 sequence differed from the geno-
mic exon 5 sequence obtained in another
study by only one position (Apoil et al.
1999). We concluded from these compari-
sons that the amplified fragment corre-
sponded to the mRNA encoded by RHCE
gene detected in the genome of Kessala.
All our attempts to amplify the RHCE-like
cDNA of gorilla Kessala from exon 1 to
exon 4 failed.
A coding sequence was deduced from
the Kessala genomic exon 4 and from Kes-
sala’s RHCE-like cDNA. This gorilla RHCE-
like coding sequence (exon 4 to 10) was
aligned to human and primate Rh cDNA
sequences ( Figure 2). Gorilla RHCE-like
cDNA differs from human RHCE cDNA (cE
allele) by 34 nucleotides and from human
RHD cDNA by 35 nucleotides ( Table 2).
However, the phylogenetic tree shown in
Figure 2 suggests that the gorilla RHCE-like
coding sequence is closer to that of hu-
man RHCE (cE allele) than to that of hu-
man RHD ( Figure 3), although the boot-
strap value was very low (34%). The
phylogenetic trees constructed for exons
4 and 5 confirmed this result (data not
shown). For other coding regions, the go-
rilla RHCE-like cDNA sequence clustered
either with human counterparts [RHD and
RHCE (cE and Ce alleles)] and chimpanzee
Patr 211 sequences (exon 6), or with hu-
man RHD cDNA and the gorilla cDNA se-
quences Gor IC and Gor ID (exon 7), or
with the two gorilla cDNA sequences Gor
IC and Gor ID (exons 8, 9, and 10).
The gorilla RHCE-like coding region was
translated into an amino acid sequence
and compared with the sequences of oth-
er primates ( Figure 4). The number of ami-
no acid differences between the gorilla
RHCE-like polypeptide and the human RhD
and RhcE polypeptides were 29 and 25, re-
spectively ( Table 2). Differences between
gorilla RHCE-like polypeptide and two oth-
er gorilla Rh-like polypeptides were almost
identical (24 and 25, respectively) ( Table
2). The topology of the phylogenetic tree
obtained from the alignment shown in Fig-
ure 4 was identical to the tree reconstruct-
ed from nucleotide sequences given in Fig-
ure 3.
Discussion
We have shown here that a gorilla gene is
similar to the human RHCE gene with re-
spect to introns 3 and 4. A gorilla cDNA
amplified fragment that is encoded by this
gorilla RHCE-like gene was partially se-
quenced. Although it is not possible to de-
termine if RHCE-like encoded polypeptides
are expressed at the surface of red blood
cells on the basis of this study, one might
still speculate on the relationship between
gorilla RHCE-like encoded protein and the
Blancher and Apoil • Genes Evolution in Primates 207
 Table 2. Number of total and nonsynonymous
nucleotide substitutions observed when the
Gor.CE-like cDNA is compared to human and
gorilla RH sequences

Analyzed
region RhcE RhD Gor.IC Gor.ID Nb

Exon 4a 6 (6) 9 (9) 11 (9) 8 (8) 121

Exon 5 7 (6) 5 (5) 7 (6) 6 (6) 165
Exon 6 4 (2) 6 (4) 7 (3) 8 (5) 137
Exon 7 13 (8) 12 (8) 5 (3) 9 (5) 133
Exons 8–10 4 (3) 3 (3) 5 (4) 0 (0) 180
Exons 4–10 34 (25) 35 (29) 35 (25) 31 (2.4) 736

The numbers in parentheses correspond to nonsynon-

ymous substitutions. The lowest numbers of differenc-
es are underlined.
a
Only 121 positions were available in exon 4 for com-
parison.
b
Number of nucleotide positions analyzed.

branes of these transfected cells (Smythe,

JS personal communication). Moreover,
the mutation Asp350- → His in the human
DIVa variant is sufficient to abolish reactiv-
ity with LOR-15C9 (Apoil et al. 1997; Rouil-
lac et al. 1995). Of interest, the gorilla
RHCE-like polypeptide shows the motif
His350, Glu353, Ala354, which is equivalent to
human DIVa. These data suggest that the
gorilla RHCE-like polypeptide is not re-
sponsible for the expression of the Dgor an-
tigen in gorilla. In fact, Kessala was Dgor
negative (Apoil et al. 1997). By contrast,
an animal that does not have the RHCE-
like gene (Mabeke) is Dgor positive and ex-
presses one Rh polypeptide (Gor ID) that
shows the RhD characteristic motif Asp350-
Gly353-Ala354 ( Figure 4).
The RHCE-like cDNA exhibited a se-
quence suggestive of recombination be-
tween gorilla RHCE-like and RHD-like
genes. Indeed, the gorilla RHCE-like coding
sequence appears to be composite: RHCE-
like in exons 4 and 6, slightly closer to
Figure 2. Gorilla RHCE-like coding sequence in comparison with human and other primate sequences. Nucleotide
RHD-like in exon 5, and closer to other go-
positions are numbered according to the RHCE cDNA (⫹1 taken as the first nucleotide of the ATG initiator codon). rilla sequences than to human RH se-
The nucleotide sequence of human RHCE (cE allele) cDNA is used as a reference, with a point (.) for nucleotide quences from exon 8 to exon 10 (see Table
identity, a dash (-) for nucleotide deletion, and a question mark (?) when the position is unknown. Only variable
positions are shown. Exon boundaries are those of the human RHCE gene (Chérif-Zahar et al. 1994). The references 2). These observations suggest that the
of Rh and Rh-like cDNA sequences presented in this figure are human RhD (Homo sapiens): L08429 (Arce et al.
1993); human RhcE and RhCe (Chérif-Zahar et al. 1990, Mouro et al. 1993); Chimp. ⫽ chimpanzee (Pan troglodytes);
gorilla (Gorilla gorilla); cynomolgus (Macaca fascicularis) (Salvignol et al. 1995); baboon (Papio papio) (Apoil et al.,
2000); rhesus monkey (Macaca mulatta) (Mouro et al. 1994); capuchin monkey (Cebus apella) (this study, accession
number AF101479).

Rh-like antigens of gorilla. The single go-
rilla Rh-like antigen that can be studied is
called Dgor and is detected on red blood
cells by means of certain human anti-D
monoclonal antibodies (Roubinet et al.
1993). The reactivity of one of these hu-
man monoclonal anti-D antibodies, LOR-
15C9, was extensively studied with large
panels of human RhD antigenic variants
(Apoil et al. 1997). It was deduced from
the results that the reactivity of LOR-15C9
depended mainly on the sixth external
loop of the Rh polypeptide, and more pre-
cisely on a motif of three amino acids
(Asp350-Gly353-Ala354; Apoil et al. 1997). This
was confirmed by tests with erythroleu-
kemia cells transfected with human RHCE
cDNA mutagenized at codons 350, 353, Figure 3. Neighbor-joining tree of RH and RH-like
and 354 ( His350- → Asp, Trp353- → Gly, coding sequences. Evolutionary distances were calcu-
Asn354- → Ala) ( Liu et al. 1999). Rh poly- lated by Kimura’s two-parameter method on the basis
of the nucleotide alignment ( Figure 2). Bootstrap val-
peptides that are recognized by the LOR- ues are based on 500 replications. The percentages of
15C9 antibody are expressed on the mem- occurrence of each branching are reported on the tree.

208 The Journal of Heredity 2000:91(3)


Figure 4. Amino acids alignment of predicted Rh and Rh-like polypeptides. The human RhcE polypeptide is used
as reference, with a point (.) for amino acid identity and a dash (-) for a deletion. Only variable positions are
shown.
gorilla RHCE-like gene might be a product
of a series of complex recombination
events between two gorilla ancestor
genes: one resembling the human RHD
gene and another that was closer to hu-
man RHCE. If this is the case, it is possible
that the common ancestor of man and go-
rilla already had two different RH genes:
the RHD ancestor and the RHCE ancestor.
In this case, humans, chimpanzees, and
gorillas would have RH genes of two clear-
ly differentiated RHD and RHCE types.
This is demonstrated only in a region en-
compassing introns 3 and 4. The noncod-
ing regions of nonhuman RH-like genes
outside intron 3 and 4 have not yet been
characterized. Moreover, the analysis of
coding sequences does not allow us to de-
termine whether actual RH genes of hu-
mans, chimpanzees, and gorillas are clos-
er to the RHD ancestor or to the RHCE
ancestor genes (Apoil and Blancher 2000;
Salvignol et al. 1995). One might evoke an-
other hypothesis in which the differentia-
tion of the resulting genes occurred inde-
pendently in humans, chimpanzees, and
gorillas after the duplication of the ances-
tor gene, and some parts of the genes
were subsequently subject to homogeni-
zation by intergenic exchanges. This type
of evolution is compatible with the mosaic
aspect of the gorilla RHCE-like cDNA,
which is closer to human RHCE in some
exons and closer to human RHD or gorilla
sequences in other exons. However, in hu-
mans the RHD and RHCE genes remain dif-
ferentiated (along 417 codons, 41 nucleo-
tide substitutions in the coding parts 35
being nonsynonymous) despite intergenic
exchanges which are now well document-
ed ( Huang 1997). In gorilla the difference
between the RHCE-like and other gorilla
RH-like genes is similar to that observed
in man (along 245 codons, 33 or 35 nu-
cleotidic substitutions, 24 or 25 being non-
synonymous; see Table 2). This suggests
that the maintenance of such differences
between the two types of genes in humans
and in gorillas could have been favored by
positive selection.
References
Apoil P-A and Blancher A, 1999. Sequence and evolu-
tion of mammalian RH gene transcripts and proteins.
Immunogenetics 49:15–25.
Apoil P-A and Blancher A, 2000. Rh gene evolution in
primates: study of intron sequences. Mol Biol Evol. 17:
127–136
Apoil P-A, Reid ME, Halverson G, Mouro I, Colin Y,
Roubinet F, Cartron J-P, and Blancher A, 1997. A human
monoclonal anti-D antibody which detects a noncon-
formation-dependent epitope on the RhD protein by
immunoblotting. BJ Haematol 98:365–374.
Apoil P-A, Roubinet F, and Blancher A, 1999. Gorilla RH-
like genes and antigens. Immunogenetics 49:125–133.
Arce MA, Scott-Thompson E, Wagner S, Coyne KE, Ferd-
man BA, and Lublin DM, 1993. Molecular cloning of RhD
cDNA derived from a gene present in RhD positive but
not RhD-negative individuals. Blood 82:651–655.
Blancher A, Calvas P, and Ruffié J, 1992a. Etude des
équivalents des antigènes rhésus chez les primates non
hominiens. C R Soc Biol 186:682–695.
Blancher A and Socha WW, 1997. The Rhesus system.
In: Molecular biology and evolution of blood group and
MHC antigens in primates ( Blancher A, Klein J, Socha
WW, eds). Heidelberg: Springer Verlag; 93–164.
Blancher A, Socha WW, and Ruffié J, 1992b. Diversity
of human anti-D monoclonal antibodies revealed by re-
actions with chimpanzee red blood cells. Vox Sang 63:
112–118.
Carritt B, Kemp TJ, and Poulter M, 1997. Evolution of
the human RH (rhesus) blood group genes: a 50 year
old prediction (partially) fulfilled. Hum Mol Genet 6:
843–850.
Cartron JP, Bailly P, Le Van Kim C, Cherif-Zahar B, Ma-
tassi G, Bertrand O, and Colin Y, 1998. Insights into the
structure and function of membrane polypeptides car-
rying blood group antigens. Vox Sang 74(suppl 2):29–
64.
Chérif-Zahar B, Bloy C, Le Van Kim C, Blanchard D, Bail-
ly P, Hermand P, Salmon C, Cartron J-P, and Colin Y,
1990. Molecular cloning and protein structure of a hu-
man blood group Rh polypeptide. Proc Natl Acad Sci
USA 87:6243–6247.
Chérif-Zahar B, Le Van Kim C, Rouillac C, Raynal V, Car-
tron J-P, and Colin Y, 1994. Organization of the gene
(RHCE) encoding the human blood group RHCcEe an-
tigens and characterization of the promoter region.
Genomics 19:68–74.
Chérif-Zahar B, Mattéi MG, Le Van Kim C, Bailly P, Car-
tron JP, and Colin Y, 1991. Localisation of the human
Rh blood group gene structure to chromosome 1p34.3–
1p36.1 region by in situ hybridization. Hum Genet 86:
398–400.
Colin Y, Chérif-Zahar B, Le Van Kim C, Raynal V, Van
Huffel V, and Cartron J-P, 1991. Genetic basis of the
RhD-positive and RhD-negative blood group polymor-
phism as determined by Southern analysis. Blood 78:
2747–2752.
Felsenstein J. 1985. Confidence limits of phylogenies:
an approach using the bootstrap. Evolution 36:783–791.
Huang CH, 1997. Molecular insights into the Rh protein
family and associated antigens. Curr Opin Hematol 4:
94–103.
Issitt PD and Anstee DJ, 1998. The Rh blood group sys-
tem. In: Applied blood group serology, 4th ed ( Issitt PD
and Anstee DJ, eds). Durham, NC: Montgomery Scien-
tific; 315–423.
Kimura M, 1980. A simple method for estimating evo-
lutionary rates of base substitutions through compar-
ative studies of nucleotide sequences. J Mol Evol 16:
111–120.
Kumar S, Tamura K, and Nei M, 1993. MEGA: molecular
evolutionary genetics analysis, version 101. University
Park, PA: Pennsylvania State University.
Landsteiner K and Wiener AS, 1940. An agglutinable fac-
Blancher and Apoil • Genes Evolution in Primates 209
tor in human blood recognized by immune sera for
blood. Proc Soc Exp Biol Med 43:223.
Landsteiner K and Wiener AS, 1941. Studies of an ag-
glutinogen (Rh) in human blood reacting with anti-rhe-
sus antisera and human isoantibodies. J Exp Med 74:
309–320.
Levine P, Burnham L, Katzin EM, and Vogel P, 1941. The
role of isoimmunization in the pathogenesis of eryth-
roblastosis fetalis. Am J Obstet Gynecol 42:925–937.
Levine P, Celano MJ, Fenichel R, Pollack W, and Singher
HA, 1961. ‘‘D-like’’ antigen in rhesus monkey, human Rh
positive and human Rh negative red blood cells. J Im-
munol 87:747–752.
Levine P, Cellano MJ, Wallace J, and Sanger R, 1963. A
human ‘‘D-like’’ antibody. Nature 198:596–597.
Levine P and Stetson RE, 1939. An unusual case of in-
tragroup agglutination. JAMA 113:126–127.
Liu W, Smythe JS, Scott ML, Jones JW, Voak D, and Av-
ent ND, 1999. Site-directed mutagenesis of the human
D antigen: definition of D epitopes on the sixth external
domain of the D protein expressed on K562 cells.
Transfusion 39:17–25.
Marsh WL, Chaganti RS, Gardner FH, Mayer K, Nowell
PC, and German J, 1974. Mapping human autosomes:
evidence supporting assignment of rhesus to the short
arm of chromosome no. 1. Science 183:966–968.
Masouredis SP, Dupuy ME, and Elliot M, 1967. Distri-
bution of the Rh ( D) antigen in the red cells of non-
human primates. J Immunol 98:8–16.
Matassi GB, Chérif-Zahar I, Mouro I, and Cartron J-P,
1997. Characterization of the recombination hot spot
involved in the genomic rearrangement leading to the
210 The Journal of Heredity 2000:91(3)
hybrid D-CE-D gene in the DVI phenotype. Am J Hum
Genet 60:808–817.
Moor-Jankowski J, Wiener AS, Socha WW, Gordon EB,
and Kaczera Z, 1973. Blood group homologues in orang-
utans and gorillas of the human Rh-Hr and chimpanzee
C-E-F systems. Fol Primatol 19:360–367.
Mouro I, Colin Y, Chérif-Zahar B, Cartron J-P, and Le
Van Kim C, 1993. Molecular genetic basis of the human
rhesus blood group system. Nat Genet 5:62–65.
Mouro I, Le Van Kim C, Chérif-Zahar B, Salvignol I,
Blancher A, Cartron J-P, and Colin Y, 1994. Molecular
characterization of the Rh-like locus and gene tran-
scripts from the rhesus monkey (Macaca mulatta). J
Mol Evol 38:169–176.
Roubinet F, Blancher A, Socha WW, and Ruffié J, 1993.
Quantitative study of chimpanzee and gorilla counter-
parts of the human D antigen. J Med Primatol 22:29–
35.
Rouillac C, Colin Y, Hughes-Jones NC, Beolet M,
D’Ambrosio AM, Cartron J-P, and Le Van Kim C, 1995.
Transcript analysis of D category phenotypes predicts
hybrid RhD-CE-D proteins associated with alteration of
D epitopes. Blood 85:2937–2944.
Saboori AM, Denker BM, and Agre P, 1989. Isolation of
proteins related to the Rh polypeptides from nonhu-
man erythrocytes. J Clin Invest 83:187–191.
Saitou N and Nei M, 1987. The neighbor joining method:
a new method for reconstructing phylogenetic trees.
Mol Biol Evol 4:406–425.
Salvignol I, Blancher A, Calvas P, Clayton J, Socha WW,
Colin Y, and Ruffié J, 1994. Molecular genetics of chim-
panzee Rh-related genes: their relationship with R-C-E-
F blood group system the chimpanzee counterpart of
human RH system. Biochem Genet 32:201–221.
Salvignol I, Blancher A, Calvas P, Socha WW, Colin Y,
Cartron J-P, and Ruffié J, 1993. Relationship between
chimpanzee Rh-like genes and the R-C-E-F blood group
system. J Med Primatol 22:19–28.
Salvignol I, Calvas P, Socha WW, Colin Y, Le Van Kim C,
Bailly P, Ruffié J, Cartron J-P, and Blancher A, 1995.
Structural analysis of the RH-like blood group gene
products in nonhuman primates. Immunogenetics 41:
271–281.
Sistonen P, 1984. Linkage of the LW blood group locus
with the complement C3 and Lutheran blood group
loci. Ann Hum Genet 48:239–242.
Socha WW and Ruffié J, 1983. Blood groups of primates:
theory, practice, evolutionary meaning. New York: A.
Liss.
Socha WW and Ruffié J, 1990. Monoclonal antibodies
directed against human red cell antigens in tests with
the red cells of non human primates. Rev Fr Transfus
Hemobiol 33:39–48.
Thompson JD, Higgins DJ, and Gibson TJ, 1994. CLUS-
TALW: improving the sensitivity of progressive multiple
sequence alignment through sequence weighting posi-
tion-specific gap penalties and weight matrix choices.
Nucleic Acids Res 22:4673–4680.
Westhoff CM and Wylie DE, 1996. Investigation of the
Rh locus in gorillas and chimpanzees. J Mol Evol 42:
658–668.
Wiener AS and Peters HR, 1940. Hemolytic reactions
following transfusions of blood of the homologous
group with three cases in which the same agglutinogen
was responsible. Ann Intern Med 13:2306–2322.
Corresponding Editor: Masatoshi Nei