Compendium of Plant Genomes

Swarup Kumar Chakrabarti

Conghua Xie
Jagesh Kumar Tiwari Editors

The Potato
Genome
Compendium of Plant Genomes

Series editor
Chittaranjan Kole, Raja Ramanna Fellow, Department of Atomic Energy,
Government of India, Kalyani, India
Whole-genome sequencing is at the cutting edge of life sciences in the new
millennium. Since the first genome sequencing of the model plant
Arabidopsis thaliana in 2000, whole genomes of about 70 plant species
have been sequenced and genome sequences of several other plants are in the
pipeline. Research publications on these genome initiatives are scattered on
dedicated web sites and in journals with all too brief descriptions. The
individual volumes elucidate the background history of the national and
international genome initiatives; public and private partners involved;
strategies and genomic resources and tools utilized; enumeration on the
sequences and their assembly; repetitive sequences; gene annotation and
genome duplication. In addition, synteny with other sequences, comparison
of gene families and most importantly potential of the genome sequence
information for gene pool characterization and genetic improvement of crop
plants are described.

Interested in editing a volume on a crop or model plant? Please contact

Dr. Kole, Series Editor, at ckole2012@gmail.com

More information about this series at http://www.springer.com/series/11805

Swarup Kumar Chakrabarti
Conghua Xie Jagesh Kumar Tiwari
•

Editors

The Potato Genome

123
Editors
Swarup Kumar Chakrabarti Jagesh Kumar Tiwari
ICAR-Central Potato Research Institute ICAR-Central Potato Research Institute
Shimla, Himachal Pradesh Shimla, Himachal Pradesh
India India

Conghua Xie
Key Laboratory of Horticultural Plant
Biology
Huazhong Agricultural University
Wuhan
China

ISSN 2199-4781 ISSN 2199-479X (electronic)

Compendium of Plant Genomes
ISBN 978-3-319-66133-9 ISBN 978-3-319-66135-3 (eBook)
https://doi.org/10.1007/978-3-319-66135-3

Library of Congress Control Number: 2017951176

© Springer International Publishing AG 2017

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or
part of the material is concerned, specifically the rights of translation, reprinting, reuse of
illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way,
and transmission or information storage and retrieval, electronic adaptation, computer software,
or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this
publication does not imply, even in the absence of a specific statement, that such names are
exempt from the relevant protective laws and regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in
this book are believed to be true and accurate at the date of publication. Neither the publisher nor
the authors or the editors give a warranty, express or implied, with respect to the material
contained herein or for any errors or omissions that may have been made. The publisher remains
neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Printed on acid-free paper

This Springer imprint is published by Springer Nature

The registered company is Springer International Publishing AG
The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland
This book series is dedicated to
my wife Phullara, and our children Sourav,
and Devleena
Chittaranjan Kole
Preface to the Series

Genome sequencing has emerged as the leading discipline in the plant

sciences coinciding with the start of the new century. For much of the
twentieth century, plant geneticists were only successful in delineating
putative chromosomal location, function, and changes in genes indirectly
through the use of a number of “markers” physically linked to them. These
included visible or morphological, cytological, protein, and molecular or
DNA markers. Among them, the first DNA marker, the RFLPs, introduced a
revolutionary change in plant genetics and breeding in the mid-1980s, mainly
because of their infinite number and thus potential to cover maximum
chromosomal regions, phenotypic neutrality, absence of epistasis, and
codominant nature. An array of other hybridization-based markers
PCR-based markers, and markers based on both facilitated construction of
genetic linkage maps, mapping of genes controlling simply inherited traits
and even gene clusters (QTLs) controlling polygenic traits in a large number
of model and crop plants. During this period a number of new mapping
populations beyond F2 were utilized and a number of computer programs
were developed for map construction, mapping of genes, and for mapping of
polygenic clusters or QTLs. Molecular markers were also used in studies of
evolution and phylogenetic relationship, genetic diversity,
DNA-fingerprinting, and map-based cloning. Markers tightly linked to the
genes were used in crop improvement employing the so-called
marker-assisted selection. These strategies of molecular genetic mapping
and molecular breeding made a spectacular impact during the last one and a
half decades of the twentieth century. But still they remained “indirect”
approaches for elucidation and utilization of plant genomes since much of the
chromosomes remained unknown and the complete chemical depiction
of them was yet to be unraveled.
Physical mapping of genomes was the obvious consequence that
facilitated development of the “genomic resources” including BAC and
YAC libraries to develop physical maps in some plant genomes. Subse-
quently, integrated genetic-physical maps were also developed in many
plants. This led to the concept of structural genomics. Later on, emphasis was
laid on EST and transcriptome analysis to decipher the function of the active
gene sequences leading to another concept defined as functional genomics.
The advent of techniques of bacteriophage gene and DNA sequencing in the
1970s was extended to facilitate sequencing of these genomic resources in
the last decade of the twentieth century.

vii
viii Preface to the Series

As expected, sequencing of chromosomal regions would have led to too

much data to store, characterize, and utilize with the-then available computer
software could handle. But development of information technology made the
life of biologists easier by leading to a swift and sweet marriage of biology
and informatics and a new subject was born—bioinformatics.
Thus, evolution of the concepts, strategies, and tools of sequencing and
bioinformatics reinforced the subject of genomics—structural and functional.
Today, genome sequencing has traveled much beyond biology and involves
biophysics, biochemistry, and bioinformatics!
Thanks to the efforts of both public and private agencies, genome
sequencing strategies are evolving very fast, leading to cheaper, quicker and
automated techniques right from clone-by-clone and whole-genome shotgun
approaches to a succession of second-generation sequencing methods.
Development of software of different generations facilitated this genome
sequencing. At the same time, newer concepts and strategies were emerging
to handle sequencing of the complex genomes, particularly the polyploids.
It became a reality to chemically—and so directly—define plant genomes,
popularly called whole-genome sequencing or simply genome sequencing.
The history of plant genome sequencing will always cite the sequencing
of the genome of the model plant Arabidopsis thaliana in 2000 that was
followed by sequencing the genome of the crop and model plant rice in 2002.
Since then, the number of sequenced genomes of higher plants has been
increasing exponentially, mainly due to the development of cheaper and
quicker genomic techniques and, most importantly, development of collab-
orative platforms such as national and international consortia involving
partners from public and/or private agencies.
As I write this preface for the first volume of the new series “Compendium
of Plant Genomes”, a net search tells me that complete or nearly complete
whole-genome sequencing of 45 crop plants, eight crop and model plants,
eight model plants, 15 crop progenitors and relatives, and three basal plants
are accomplished, the majority of which are in the public domain. This means
that we nowadays know many of our model and crop plants chemically, i.e.,
directly, and we may depict them and utilize them precisely better than ever.
Genome sequencing has covered all groups of crop plants. Hence,
information on the precise depiction of plant genomes and the scope
of their utilization is growing rapidly every day. However, the information is
scattered in research articles and review papers in journals and dedicated web
pages of the consortia and databases. There is no compilation of plant
genomes and the opportunity of using the information in sequence-assisted
breeding or further genomic studies. This is the underlying rationale for
starting this book series, with each volume dedicated to a particular plant.
Plant genome science has emerged as an important subject in academia,
and the present compendium of plant genomes will be highly useful both to
students and teaching faculties. Most importantly, research scientists
involved in genomics research will have access to systematic deliberations
on the plant genomes of their interest. Elucidation of plant genomes is not
only of interest for the geneticists and breeders, but also for practitioners of
an array of plant science disciplines, such as taxonomy, evolution, cytology,
physiology, pathology, entomology, nematology, crop production,
Preface to the Series ix

biochemistry, and obviously bioinformatics. It must be mentioned that

information regarding each plant genome is ever-growing. The contents
of the volumes of this compendium are therefore focusing on the basic
aspects of the genomes and their utility. They include information on the
academic and/ or economic importance of the plants, description of their
genomes from a molecular genetic and cytogenetic point of view, and the
genomic resources developed. Detailed deliberations focus on the back-
ground history of the national and international genome initiatives, public
and private partners involved, strategies and genomic resources and tools
utilized, enumeration on the sequences and their assembly, repetitive
sequences, gene annotation, and genome duplication. In addition, synteny
with other sequences, comparison of gene families, and, most importantly,
potential of the genome sequence information for gene pool characterization
through genotyping by sequencing (GBS) and genetic improvement of crop
plants have been described. As expected, there is a lot of variation of these
topics in the volumes based on the information available on the crop, model,
or reference plants.
I must confess that as the series editor it has been a daunting task for me to
work on such a huge and broad knowledge base that spans so many diverse
plant species. However, pioneering scientists with life-time experience and
expertise on the particular crops did excellent jobs editing the respective
volumes. I myself have been a small science worker on plant genomes since
the mid-1980s and that provided me the opportunity to personally know
several stalwarts of plant genomics from all over the globe. Most, if not all,
of the volume editors are my longtime friends and colleagues. It has been
highly comfortable and enriching for me to work with them on this book
series. To be honest, while working on this series I have been and will remain
a student first, a science worker second, and a series editor last. And I must
express my gratitude to the volume editors and the chapter authors for
providing me the opportunity to work with them on this compendium.
I also wish to mention here my thanks and gratitude to the Springer staff,
Dr. Christina Eckey and Dr. Jutta Lindenborn in particular, for all their
constant and cordial support right from the inception of the idea.
I always had to set aside additional hours to edit books besides my
professional and personal commitments—hours I could and should have
given to my wife, Phullara, and our kids, Sourav, and Devleena. I must
mention that they not only allowed me the freedom to take away those hours
from them but also offered their support in the editing job itself. I am really
not sure whether my dedication of this compendium to them will suffice to do
justice to their sacrifices for the interest of science and the science
community.

Kalyani, India Chittaranjan Kole

Preface

Potato (Solanum tuberosum L.; 2n = 4x = 48) is the fourth most important

food crop of the world after rice, wheat and maize, with a worldwide
production of 381.68 million tons in the year 2014 (FAO). This highly
productive non-cereal food crop, domesticated in the highland tropics of the
Andes mountains in South America, has been declared the ‘Food for the
Future’ by the United Nation’s Food and Agriculture Organization, who
celebrated the year 2008 as the ‘International Year of the Potato’. By 2020, it
is estimated that more than two billion people worldwide will depend on the
potato for food, feed, or income. Potato is a member of the asterid clade of
eudicot that represents 25% of the flowering plant species and it belongs to
the Solanaceae, a family of about 90 genera and 2800 species. The family
Solanaceae contains several well-known cultivated crops such as tomato
(Lycopersicon esculentum), eggplant (Solanum melogena), tobacco
(Nicotiana tabacum), pepper (Capsicum annuum), petunia, and potato
(Solanum tuberosum). The International Code of Nomenclature of Cultivated
Plants (ICNCP 2009) recognized four species of cultivated potato, i.e.
Solanum tuberosum, with two cultivar groups, Andigenum containing
diploids, triploids and tetraploids, and the Chilotanum, from which our
modern tetraploid cultivars arise; Solanum ajanhuiri (diploid); Solanum
juzepczukii (triploid); and Solanum curtilobum (pentaploid).
Despite the importance of potato as a world food crop, the genetics and
inheritance of many important qualitative and quantitative agronomic traits of
this crop were poorly understood. The reasons for the scanty knowledge on
genetics of this crop are attributed to tetraploidy, the high degree of
heterozygosity and the absence of homozygous inbred lines or any collection
of genetically well-defined marker stocks. In addition, the long generation
time and the frequently observed distorted segregation ratios discouraged
geneticists from choosing the potato as a model species for genetic research.
However, for a critical investigation of complex biological processes like
tuberization, yield, disease resistance, etc. and to enable rapid, genome-based
breeding strategies, a comprehensive genetic analysis of the crop was a
prerequisite. To resolve this problem the international community of potato
researchers took on the task of deciphering the entire genetic code of potato
by sequencing. Thus, the Potato Genome Sequencing Consortium (PGSC)
was initiated in January 2006, consisting of 29 laboratories spread over 15
countries, i.e. Argentina, Brazil, China, Chile, Denmark, India, Ireland, Italy,

xi
xii Preface

The Netherlands, New Zealand, Peru, Poland, Russia, the United Kingdom
and the United States of America. The consortium deciphered 727 MB of
844 MB potato genome using a unique homozygous doubled-monoploid
potato clone (DM) and a hybrid sequencing approach consisting of Illumina
sequencing-by-synthesis, Roche/454 Pyrosequencing, and the classical
Sanger sequencing platforms. The PGSC sequenced the potato genome as a
public effort and made it freely available to all the researchers. Free access to
the potato genome data triggered extensive post-genomic work on gene
discovery, marker development, evolutionary and plant diversity studies,
improved breeding, and engineering of new phenotypes in potato, etc. Other
scientific communities also utilized the sequence data to understand basic
plant biology, biochemistry, and comparative genomics. This is evident from
>880 citations of the Nature article on the potato genome sequencing by May
2017.
The present compilation is an attempt to assess the post-genomic research
on structural and functional genomics, transcriptomics, repetitive sequences
and their application, resistance genes and their application, nutrient use
efficiency, and abiotic stress management in potato, etc. We hope the
information compiled in this book will be useful for students, researchers,
teachers, industry personnel and all other people interested in potato
improvement, production and protection. The primary users of this book will
be universities, public sector institutes as well as government and industrial
potato biologists/breeders who are involved in research to understand bio-
logical and agronomic processes in potato. It will be our privilege to receive
any suggestion for future improvement. We are grateful to Series Editor Prof.
Chittaranjan Kole for giving us opportunity to prepare this book. We are
highly thankful to Springer team for their valuable inputs.

Shimla, India Swarup Kumar Chakrabarti

Wuhan, China Conghua Xie
Shimla, India Jagesh Kumar Tiwari
Contents

1 The Historical, Social, and Economic Importance

of the Potato Crop . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Oscar Ortiz and Victor Mares
2 Potato Genetic Resources . . . . . . . . . . . . . . . . . . . . . . . . . . 11
Ryoko Machida-Hirano and Takao Niino
3 History of Potato Breeding: Improvement,
Diversification, and Diversity . . . . . . . . . . . . . . . . . . . . . . . 31
Salej Sood, Vinay Bhardwaj, S. K. Pandey and
Swarup Kumar Chakrabarti
4 Genetic Stocks Used for Potato Genome Sequencing . . . . . . 73
Richard E. Veilleux
5 Strategies and Tools for Sequencing and Assembly
of Plant Genomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
D. C. Mishra, S. B. Lal, Anu Sharma, Sanjeev Kumar,
Neeraj Budhlakoti and Anil Rai
6 High-Throughput Sequencing of the Potato Genome . . . . . . 95
Virupaksh U. Patil, Nitya N. Sharma and
Swarup Kumar Chakrabarti
7 The Wild Side of Potato: Insights into the Genome
Sequence of the Stress-Tolerant S. commersonii . . . . . . . . . . 109
Salvatore Esposito, Vincenzo D’Amelia, Clizia Villano,
Felice Contaldi, Domenico Carputo and Riccardo Aversano
8 Genomics in Management and Genetic Enhancement
of Potato Germplasm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 123
Jagesh Kumar Tiwari, Vinod Kumar, Sapna Devi,
S. K. Luthra, Swarup Kumar Chakrabarti, Shashi Rawat and
M. Nagesh
9 Repetitive Sequences in the Potato
and Related Genomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 143
Atul Grover and P. C. Sharma
10 New Strategies Towards Durable Late Blight Resistance
in Potato . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 161
Juan Du and Vivianne G. A. A. Vleeshouwers

xiii
xiv Contents

11 Genomics Approaches for Improving Nitrogen

Use Efficiency in Potato . . . . . . . . . . . . . . . . . . . . . . . . . . . 171
Jagesh Kumar Tiwari, Sapna Devi, Nilofer Ali,
Tanuja Buckseth, Vaishali Moudgil, Rajesh K. Singh,
Swarup Kumar Chakrabarti, V. K. Dua, Devendra Kumar and
Manoj Kumar
12 Genomics Resources for Abiotic Stress Tolerance
in Solanaceae Crops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195
Shambhavi Sharma, Saurabh Pandey,
Mehanathan Muthamilarasan, Vaishali Chaudhry,
Priya Dulani and Manoj Prasad
13 Somatic Cell Genetics and Its Application
in Potato Breeding . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 217
Ramona Thieme and Elena Rakosy-Tican
14 Structural Analysis of Resistance (R) Genes in Potato
(Solanum Species) Genome . . . . . . . . . . . . . . . . . . . . . . . . . 269
Soma S. Marla
15 Genotyping-by-Sequencing in Potato . . . . . . . . . . . . . . . . . . 283
Chiheb Boudhrioua, Maxime Bastien, Gaétan Légaré,
Sonia Pomerleau, Jérôme St-Cyr, Brian Boyle and
François Belzile
16 Genomics in True Potato Seed (TPS) Technology:
Engineering Cloning Through Seeds . . . . . . . . . . . . . . . . . . 297
Jagesh Kumar Tiwari, Satish K. Luthra, Vinod Kumar,
Vinay Bhardwaj, R. K. Singh, J. Sridhar, Rasna Zinta
and Shambhu Kumar
17 Genome Sequence-Based Marker Development
and Genotyping in Potato . . . . . . . . . . . . . . . . . . . . . . . . . . 307
Sanjeev Kumar Sharma and Glenn J. Bryan
 The Historical, Social, and Economic
Importance of the Potato Crop 1
Oscar Ortiz and Victor Mares

Abstract
The potato has a fascinating history, from its origin and domestication in
the Andean Region, where it was essential for feeding a growing
population, for example, the Inca Empire, to its introduction into farming
and food systems in Europe and elsewhere in the world. This crop has
been the key factor in terms of food security, nutrition, population growth
and urbanization in many regions. In recent decades, the potato has
become a dominant crop in countries such as China and India, and its
cropping area and production have increased more than those of any other
food crop in Africa. Besides the social and economic importance of
potato, extensively discussed in several published articles and briefly
mentioned in this chapter, we discuss two relevant issues that are
intimately related to potato genomics and breeding and which make potato
a crop that has a lot to offer for the future. Those issues are the potato’s
contribution to food and nutrition security, and the cultural and genetic
importance of biodiversity conservation in the Andes; these issues are
strongly related to gender, since women in traditional societies have
contributed—and still contribute—to an enormous wealth of knowledge in
relation to biodiversity conservation and utilization. The adaptability
shown by the potato crop over thousands of years indicates the potential
role of the potato as a climate-smart crop, particularly based on its short
vegetative period, water utilization efficiency, and productive capacity per
unit of input.

1.1 The Unique Saga of the Potato

The history of the potato is, arguably, the most

fascinating of all crops. The route it has followed
O. Ortiz (&)
V. Mares
International Potato Centre, Lima, Peru from its origin and domestication in the Andean
e-mail: o.ortiz@cgiar.org region, where its cultivation started about

© Springer International Publishing AG 2017 1

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_1
2 O. Ortiz and V. Mares
8000 years ago, and where it became an essential
crop for food security in pre-Columbian times
(Fiedel 1987; Moseley 1992; Hastorf 1993), to
becoming the third most important food crop in
the world has been extensively documented in
books, reviews and essays (Salaman 1949;
Brown 1993; McNeill 1999; Reader 2008).
These studies describe very well, both in scien-
tific and anecdotal terms, the amazing saga of the
potato on its way from South America to Europe
over several centuries and its adaptation to
farming and food systems in all the European
countries and elsewhere in the world. This
globalization process of the potato, which started
in the sixteenth century, is still going on today. In
addition to its history, the enormous and unpar-
alleled social and economic importance of the
potato in different societies in both the New
World and the Old World has been narrated and
described in great detail in several articles and
books (Salaman 1949; De Jong 2016). The
potato is credited with the distinction of being the
most crucial agricultural factor in the course of
human events in the last eight centuries, includ-
ing its effect on food security, its prowess in
nourishment of people on a great scale, aiding
explosive population growth in Europe, and
urbanization (Nunn and Qian 2011; De Jong
2016). Before that, in its land of origin and
domestication, pre-Hispanic societies reached
high levels of political organization and cultural
and technological development, based on the
potato as one of their main staple crops and
source of food security and nutrition. Its
domestication and continuous process of adap-
tation to highly diverse agroecosystems in the
Andes of South America generated a broad
genetic diversity, resulting in a crop that is very
well adapted to climatic variability, and able to
substantially increase and sustain food produc-
tion. This remarkable versatility of the crop
drove the development and consolidation of
highly organized societies, which reached their
pinnacle with the Inca Empire. The conquest of
this empire by the Spaniards in the sixteenth
century gave rise to the subsequent expansion of
the potato in the Old World, a process that
proved to be a major event in the history of
humanity. At the peak of the development of
Andean societies, just before the clash with the
Western world, it has been estimated that the
potato fed and nourished a population of around
ten million people in South America (Reader
1990), with no historical trace of a famine in
those societies. Potato domestication and culti-
vation are examples of the skills of Andean
societies who developed agricultural knowledge
and its associated technology, such as terrace
cropping, irrigation management, and
post-harvest processing. Also, since wild pota-
toes contain solanine and tomatine, toxic com-
pounds that protect the plants against herbivores
and pathogens and which are not eliminated by
cooking, ancient Andean farmers solved the
problem by breeding non-poisonous varieties
that started the potato revolution, as those new
plants were converted into a crop suitable for
human consumption (see http://www.
smithsonianmag.com/history/how-the-potato-
changed-the-world). We should add that one of
the first processed potato products known
worldwide, the freeze-dried potato, originated in
the Andes also thousands of years ago as a
storage technique and a way of making bitter
potatoes edible. Ortiz (2006) argued that the
information, knowledge, and technology associ-
ated with potato cultivation, breeding and
post-harvest management were disseminated
throughout the Andes with the potato itself,
transported by migrant populations to the new
territories progressively occupied by ancient
Andean settlers, and that this process that began
with the domestication of the crop still continues
to this day.
Although the importance of the potato in the
development of pre-Columbian Andean societies
is highly relevant, and its impact is greater than
that of any other contemporary crop (it could be
argued that maize was also extremely important),
it is the history of the impact of the potato on a
global scale, following its introduction into
Europe, that makes a most singular story. In this
section, we merely mention some highlights
since many excellent reviews have already
described this process. The first remarkable effect
of the introduction of the potato into Europe was
1 The Historical, Social and Economic Importance of the Potato Crop
its contribution to the significant increase in the
European population during the period from the
second half of the eighteenth century to the
middle of the nineteenth. This population growth
responded to the very significant increase in food
production brought about by the expansion of
potato cultivation in European countries. It has
been estimated that the introduction of the potato
resulted, over the years, in the doubling of the
food supply in Europe (Mann 2011). The potato
is said to have brought a solution to the historical
periodic food scarcity in Europe, where food
shortages were a recurrent problem (Vanden-
broeke 1971). It has also been argued that the
potato, by providing plentiful food to increasing
populations, was one of the factors that allowed
European countries to dominate the world during
the colonial centuries (McNeil 1999), facilitated
the Industrial Revolution to some extent, and
contributed to the recovery after the major
European wars in the twentieth century.
However, an infamous and tragic episode of
the arrival of the potato into European farming
and the dependence it created on a single crop is
provided by the history of the potato in Ireland.
Several publications describe how the potato
became so entrenched in Irish farming and
livelihoods that it became the main and almost
exclusive staple food for the Irish peasantry, and
this was conducive to a very large increase in the
population in the country, which soared from
three million to eight million in five generations
in the period ending in 1840. At that point in
time, the potato crop failed in several successive
years as a result of a massive outbreak of late
blight disease. The tragic consequence was the
Irish potato famine, which caused the deaths of
more than one million poor farmers from star-
vation and the emigration of a similar number of
people, mostly to the United States and other
English-speaking countries, such as Canada and
Australia (see Trueman 2016).
In recent decades, the potato has become a
dominant crop in emerging countries such as
China and India, which are now the largest
world producers and consumers of the tuber.
China’s official policy is to turn the potato into
3
its main source of food security in the near
future (Baroke 2015; Frederick and Lei 2015;
Qu and Xie 2008). Similar efforts are being
carried out in India (Singh and Rana 2013) and
elsewhere (Azimuddin et al. 2009; Devaux
2014; Devaux et al. 2014). In addition, the
arable potato area has increased more than that
of any other food crop in Sub-Saharan Africa in
the last three decades. For example, in East
Africa, potato production has nearly quadrupled
since the 1990s (Gildemacher 2012), and the
potential for growth is still significant because
consumption per capita is relatively low
(Havenkort et al. 2009). Worldwide, potato
production has increased at an annual rate of
4.5% over the past 10 years, exceeding the
growth in production of any other major food
commodity in developing countries, where there
is a pressing need to satisfy the growing
demand for food and nutrition.
Besides the social and economic importance
of the potato, briefly mentioned above, in the
following sections we discuss two relevant issues
intimately related to potato genomics and
breeding. These issues are the potato’s contri-
bution to food and nutrition security, and the
cultural and genetic importance of potato biodi-
versity in the Andes, which is intrinsically related
to gender aspects. Those attributes of the potato
are in addition to its potential role as a
climate-smart crop, a condition related to its short
vegetative period, its water utilization efficiency,
and adaptation to a diversity of agro-ecosystems:
all characteristics that make the potato a crop
with much to offer for the future.
1.2 Potato’s Contribution to Food
and Nutrition Security
The potato has traditionally been considered a
food security crop, usually implying the sheer
volume of a reliable foodstuff, which was critical
in the pre-Columbian eras in South America.
Even nowadays, the potato is regarded as a crop
that provides food for the poor, particularly in
developing regions (Lutaladio and Castaldi
4 O. Ortiz and V. Mares
2009). A clear example is provided by the
increasing reliance of North Korea on the potato
as a key crop to solve the chronic food shortages
that led to a famine some two decades ago.
Following that event, the potato cropping area in
the country and correlated per capita consump-
tion increased fourfold, from 11.5 to 49.0 kg per
year (FAOSTAT 2013). In rich countries, some
misconceptions about the potato’s nutritional
value are still prevalent, and it is erroneously
believed to be a fattening, high carbohydrate
foodstuff (Fitzgerald 2014). However, the truth is
that the potato is not only a key crop for pro-
viding food security to developing regions but
also is a highly nutritious food that provides
more calories, vitamins, and nutrients per area of
cropped land than any other staple crop. Contrary
to the above-mentioned erroneous beliefs, potato
is a rich source of vitamin C (U.S. Department of
Agriculture 2007; Love and Pavek 2008),
potassium, and dietary fiber (Nunn and Qian
2011). It is also an excellent source of vitamin
B6 and a provider of relatively high amounts of
other B complex vitamins, such as thiamin,
riboflavin, folate, and niacin, as well as minerals
such as magnesium, phosphorus, iron, and zinc,
all making the potato ideal for a healthy diet
when a few other food components such as dairy
and legumes are added to supplement it with
calcium, vitamin A and vitamin D (the few
nutrients of which the potato is not a good
source). Thus, the potato adds a new dimension
to food security, widening it to nutrition security
in a world in which malnutrition is still prevalent,
not only because of the lack of access to food,
but also due to the low quality of accessible food
from local crops. The potato crop, due to its short
duration, is able to produce food during the
hunger months (when other crops such as maize
are no longer available) in several countries in
Sub-Saharan Africa (Demo et al. 2015). The
nutritional quality of potato, the wide range of
agro-ecosystems where it is able to grow, and its
high dry matter and nutrient outputs per unit of
land area make this crop the best option for food
and nutrition security for large sectors of the
human population, both in the developing and
the developed regions of the world (DeFauw
et al. 2012; Devaux 2014; Devaux et al. 2014;
FAO 2008; De Jong 2016); this is particularly
applicable to highland agriculture, where not
many productive and nutrition options exist. Due
to the growing trends of consumption, particu-
larly in developing regions, and the increasing
importance of potato as a staple food worldwide,
its nutritive value has enormous potential as a
vehicle to improve people’s health in both the
developed and the developing countries (Love
and Pavek 2008). It has been shown that the
addition of zinc (Zn) through soil and foliar
fertilization of potato plants can increase tuber
Zn concentrations with some positive effects on
crop yield (Kromann et al. 2016; White et al.
2016). High rates of foliar and soil Zn application
produced a 2.51-fold and a 1.91-fold tuber Zn
increase, respectively. No difference between
cultivars was observed. The same experiments
showed that tuber iron (Fe) concentrations were
not increased with Fe fertilization. However, as
the genetic variation for Fe in potato is large, the
Fe content in the tuber content can be improved
through breeding (Haynes et al. 2012). Current
biofortification breeding work undertaken at the
International Potato Center (CIP) has increased
mineral concentrations by recurrent selection at
the diploid level, resulting in new generations of
biofortified potatoes with about 27% increased
concentrations up to 35 ppm of Fe and 32 ppm
of Zn concentrations on a dry weight basis
(Amoros et al. 2017). At present, a strategic
interploid crossing with top tetraploid parental
lines is being carried out, leading to
high-yielding, disease-resistant populations of
biofortified potatoes. Moreover, recent evidence
shows that the bio-availability of Fe from the
potato is higher than that found in other crops.
More than 50% of the potato Fe is released from
the matrix during the in vitro digestion and is
therefore available at the intestinal level. In vitro
bio-accessibility of Fe from potatoes was shown
to be 6.3 to 31.5% higher than that of pearl
millet, fava bean, and rice (Andre et al. 2015).
However, increased potato productivity and
production, fostered by new breeding and pro-
duction technologies, have an impact that goes
beyond food and nutrition security, positively
1 The Historical, Social and Economic Importance of the Potato Crop
affecting farming families’ livelihoods by
increasing income or creating employment (Sul-
livan 2010; Thiele et al. 2010). It is important to
realize that the potato is a crop with a wide range
of ecological adaptability, able to grow in dif-
ferent latitudinal and altitudinal conditions where
day length, temperatures, and rainfall are highly
diverse (Hijmans 2001). In this respect, the
ever-increasing pace of the development of
genomics is promoting more focused breeding
work oriented to producing new varieties that are
more efficient in using water and soil nutrients, as
well as more tolerant of biotic and abiotic stres-
ses, thereby making the potato an outstanding
climate-smart crop. This work is supported by
more effective yield analysis based on crop
growth modeling linked to proximal and remote
sensing of plant reflectance (Quiroz et al. 2017)
and also by new phenotyping techniques (Mon-
neveux et al. 2014).
Taking into consideration the need to nearly
double global food production by 2050, the
potato still has a significant contribution to make
to respond to this challenge, and it has already
started to do so, because since 2012 more pota-
toes are being produced in the developing world
than in developed countries.
1.3 The Cultural and Genetic
Importance of Potato
Biodiversity in the Andes
Being a clonal crop with a wide diversity of
cultivated species and landraces, in addition to a
clearly defined center of origin and domestica-
tion, the potato is unique in terms of the historic
and modern relevance of in situ conservation of
biodiversity. Although there is no full agreement
about potato classification, a recently published
comprehensive study of the systematics, diver-
sity, genetics, and evolution of wild and culti-
vated potatoes (Spooner et al. 2014) supports a
classification of the cultivated potatoes into four
species: (1) Solanum tuberosum, with two culti-
var groups (the Andigenum Group of upland
5
Andean genotypes containing diploids, triploids,
and tetraploids; and the Chilotanum Group of
lowland tetraploid Chilean landraces); (2) Sola-
num ajanhuiri (diploid); (3) Solanum juzepczukii
(triploid); and (4) Solanum curtilobum (penta-
ploid). In addition, the same article mentions that
there are some 3000 landraces (indigenous cul-
tivated crops) still grown by indigenous farmers
in South America, particularly in the high Andes,
who tend to grow many landraces of all ploidy
levels together in the same field. For instance, in
Central Peru, the planting of large cultivar mix-
tures in small areas with large agro-ecological
variability brought about by differences in alti-
tude accounts for the conservation of at least 406
unique cultivars (de Haan 2009). This cropping
system was a strategy developed by
pre-Columbian farmers to cope with climate
variability and extreme events prevalent in the
High Andes. It is still common to find small
potato plots in the Peruvian Andes where up to
20 landraces are grown together. Rather than
regarding this system as technologically back-
ward, apt to be replaced by a system based on
single, modern varieties, it should be conserved
based on two main attributes. First, it offers some
important lessons as a highly successful adaptive
system to cope with climate change and associ-
ated high climate variability (particularly extreme
events such as drought or frosts). Second, this
system is a very successful method of in situ
biodiversity conservation. CIP has the largest ex
situ (gene bank) potato collection in the world,
which included 4787 cultivated and traditional
Andean potatoes, up to February 2017. This is a
way of securing the conservation of valuable
genes for the future, particularly with threats of
climate change, the evolution of production
systems, and other agro-ecosystem changes.
However, in situ conservation has the advantage
of exposing the genetic material to the effect of
the environment, which is currently important
because native potatoes conserved for thousands
of years are subject to new challenges and
selection pressure that contribute to increased
fitness in the face of climate change. Therefore,
6 O. Ortiz and V. Mares
this system, in addition to the cultural importance
of potato as a food security and income-
generating crop for the Andean populations,
provides an invaluable wealth of genetic resour-
ces that need to be conserved for potential use in
breeding varieties tolerant of or resistant to biotic
and abiotic stresses. As FAO Success Stories on
Climate-Smart Agriculture (http://www.fao.org/
3/a-i3817e.pdf) point out, potato genetic resour-
ces will continue to represent key resources for
building the resilience of agro-ecosystems
around the world; and traditional Andean crop-
ping systems provide suitable varieties and
breeding stocks necessary to adapt production to
changing climatic conditions. Thus, their con-
servation and sustainable use are a prerequisite
for coping with climate change. The Global
Environmental Fund (GEF)-funded, FAO-led
Global Partnership Initiative on conservation
and adaptive management of “Globally Impor-
tant Agricultural Heritage Systems” (GIAHS), in
coordination with the Peruvian Ministry of
Environment, other local institutions and the
participation of local communities, is helping to
value these ingenious agricultural technologies to
guarantee their conservation, while providing
sustainable development conditions for present
and future generations of Andean people (http://
www.fao.org/giahs/giahsaroundtheworld/
designated-sites/latin-america-and-the-caribbean/
andean-agriculture/en/), and to date, 3500
smallholder farming families in 18 rural com-
munities are conserving 177 native potato lan-
draces. There is a very important relationship
between in situ biodiversity conservation in tra-
ditional farming systems and genomic work, as
evidenced by the Genomics and Biodiversity:
Providing New Opportunities for Smallholder
Potato Farmers project, funded by the German
Federal Ministry for Economic Cooperation and
Development (BMZ). The CIP in Peru and the
Max Planck Institute for Plant Breeding Research
(MPIZ) in Germany collaborated with several
other partners in this project, which built on
CIP’s attempts to use the biodiversity of potato
genetic resources to improve late blight
resistance, while providing income to farmers
and training national program scientists in using
molecular tools that permit further exploitation of
conserved germplasm (GILB 2003). The project
contributes to genetic conservation, and it docu-
ments and systematizes the traditional participa-
tory selection of new varieties in farmers’ fields.
Another important CIP effort is its contribution to
on-farm diversity by giving back, or repatriating,
native Peruvian landraces to those farmers whose
ancestors had conserved these varieties for mil-
lennia. As of 2016, CIP had repatriated over
7685 samples (>1250 unique accessions) to more
than 90 different communities, including those in
the “Potato Park,” which is a *10,000 ha
reservoir of potato genetic resources (see http://
cipotato.org/es/research/genebank/parque-de-la-
papa/). At present, the park holds more than 1200
varieties of Andean potato cultivated in the
highlands, and it is a unique center of biological
diversity of this crop, or of any other staple
crop. However, lack of funding for this vital
activity, which is sometimes erroneously regar-
ded as an anthropological living museum rather
than a modern scientific endeavor, is a stumbling
block.
The current existence of potato biodiversity
still being cultivated in the Andes has motivated
public and private organizations to support the
establishment of links between small farmers who
cultivate a number of potato landraces and the
market. CIP’s “Papa Andina” Project, imple-
mented between 2001 and 2012, and including a
wide range of public and private stakeholders,
developed different approaches in order to make
potato biodiversity available to the market and
position the native potato as a valuable good. As a
result, native potato varieties are now recognized
as an essential ingredient of Peru’s world-class
cuisine. You can now find native potatoes in the
market and in restaurants, which were not there a
decade ago. This integration of potato biodiver-
sity into value chains is contributing to revaluat-
ing the importance of conservation and use of
native potatoes, and it positions Peru and other
Andean countries as producers of potatoes that
1 The Historical, Social and Economic Importance of the Potato Crop
cannot be found anywhere else in the world (IICA
BID 2014; CIP 2014a, b).
In situ potato biodiversity conservation in the
Andes is inextricably linked to traditional local
culture and is heavily dependent on women’s
active decision-making and participation, which is
based on a highly sophisticated traditional
knowledge of plant diversity, breeding, and culi-
nary properties that has been developed since the
potato was first domesticated (Brush 2004; de
Haan 2009). Although the potato is generally
propagated by seed tubers, which produce clones
from the parent plant, women in remote Andean
communities were able to use true botanical seed
to breed new varieties with novel characteristics,
which were then propagated by seed tubers. This
implies not only the need to conserve biological
potato diversity (Pradel 2013) but also the
importance of preserving, understanding, and
disseminating women’s deep knowledge of the
value of this diversity and the techniques for
maintaining it. One common problem when
dealing with in situ biodiversity conservation and
the women’s role in it is that the approach is based
on a cultural anthropological focus, which gives
priority to the traditional way of life, particularly
the customs, beliefs, and mythology of an ancient
people, rather than the actual knowledge devel-
oped by that people (Sarapura et al. 2016). One
unintended consequence of this point of view,
which privileges the ceremonial and customary
attributes of traditional societies over the wealth of
poorly understood science and technology devel-
oped by those societies, is the fact that peasant
communities in the Andes, particularly women,
are excluded from national development programs
(Diez Hurtado 2010). An interesting and rather
different approach has been taken in the analysis
conducted by Sarapura et al. (2016), which is
based on a feminist standpoint that privileges the
peasant women’s knowledge and perspectives and
the gender implications of the traditional man-
agement of native potatoes. Based on the realiza-
tion of the highly relevant relationship between
gender, culture, and potato biodiversity conser-
vation, and the potential benefit for genomics
work, due consideration to appropriate funding for
potato work in the Andean Region is warranted.
7
1.4 The Future of the Potato
as a Crop
As important as the history of the potato and its
past and present economic and social importance
are, it is absolutely essential to consider the
future of the crop and the multiple aspects of its
further development as a crop able to contribute
to income generation of small farmers and to
satisfy the increasing future nutritional needs of
people all over the world. Consolidating the
future of the potato calls for research work on
several complementary research fronts, such as
closing the current yield gaps still existing in
several developing countries. This research
includes improved agronomic management and
the breeding of new varieties adapted and resis-
tant to abiotic and biotic stresses in different and
new agro-ecosystems, and dealing with the
challenges brought about by the conditions
imposed by climate change in current production
areas. It also involves the further improvement of
the nutritional content of the potato, particularly
as a source of micronutrients.
Yield gap (Yg) is the quantitative difference
between a baseline yield (usually the average
farmers’ yield) and either the attainable (usually,
experiment-based yield) or the potential yield
(Yp) over a specified spatial and temporal scale
(FAO 2015). In developing regions, the potato
yield gap is large, as shown for Sub-Saharan
Africa (SSA) by a recent participatory yield gap
analysis that included data from ten countries
from West Africa, Eastern and Central Africa, and
Southern Africa (Harahagazwe et al. submitted
for publication). This analysis has shown that
SSA (excluding South Africa) countries could
easily increase by 140% the current annual pro-
duction of 10.8 million metric tons if high quality
seed of improved varieties resistant to and tolerant
of abiotic and biotic stresses, along with improved
agronomic management practices, were deployed
in farmers’ fields. However, productivity increa-
ses need to go hand in hand with the development
of value chains that can bring opportunities to
farmers to reduce the income gap.
The furthering of the importance of potato as a
staple food for a high proportion of the human
8 O. Ortiz and V. Mares
population is largely determined by the significant
increase in production and productivity in highly
populated countries such as China and India. China
produces more than 95 million tons of potatoes per
year, which makes this country the world’s largest
potato producer (FAOSTAT 2015). However,
domestic consumption is still low and a challenge
to be surmounted by a policy to make potato a
staple food comparable to rice. Two significant
advantages of potato are that it requires 45% less
water than rice or wheat and produces more kcal per
unit of resources (Monneveux et al. 2013).
Climate change is one of the most important
factors affecting agriculture on a global scale and
its effects will increase as time, in decades, pro-
gresses. Climate change will affect current
potato-producing regions by bringing about an
increase in average temperature, the concomitant
increase in the reproduction rate of vectors of
pests and diseases, a variation in water avail-
ability caused by altered rainfall, and increased
carbon levels in the atmosphere. Taking advan-
tage of the large genetic diversity of potato spe-
cies and the capacity of the crop to grow in many
soil and climate conditions, scientists will be able
to adapt/breed and grow potato cultivars more
resilient to heat, water shortages, soil salinity,
and diseases. This work is currently being con-
ducted by CIP and its partners in different
regions. It is complemented by the development
of innovative water-saving irrigation techniques
such as Partial Root Zone Drying (PRD), as
reported by Yactayo et al. (2013).
In an interesting twist of history, it is highly
likely that the potato will add another milestone
to its saga by being the first crop to be grown on
another planet. NASA and CIP are working
together in a project conducted in Peru that is
exploring the possibility of growing potatoes
under Martian conditions (http://potatoes.space/
mars/). They are using soil from Las Pampas de
La Joya desert in Southern Peru, the world’s
driest and most nutrient-poor ecosystem, to test
the performance of 65 varieties from the CIP’s
germplasm bank, selected for their capacity to
grow under extreme conditions of variations in
day/night temperatures, water scarcity, and soil
salinity. These varieties are already being planted
in a closed environment that replicates the
atmospheric conditions of Mars. The potato is a
prime candidate to provide food security to
human explorers traveling to Mars in a few
decades due to the resilience of the crop and its
large number of species, varieties, and landraces
that provide a huge reservoir of genetic diversity,
adapted to the most extreme conditions on Earth,
such as high altitude, low oxygen pressure, water
scarcity, soil salinity, extreme temperatures, and
high UV radiation. In addition, the potato has a
high density and high content of proteins, car-
bohydrates, soluble and insoluble fiber and
micronutrients such as vitamin C, Zn and Fe
(http://cipotato.org/potato/potatonutrition/).
For CIP, however, this experience is helping to
assess the adaptation of the potato to extreme
environments that exist on Mars, but which in the
future may become more common on Earth, and
we need to be prepared for that scenario.
1.5 Conclusion
The potato has contributed to the development of
different civilizations for thousands of years and
still has a lot to offer to ensure that food and
nutrition security for a growing population is
achieved in the coming decades. Its genetic
diversity has not yet been fully exploited to
generate new varieties with sufficient adaptability
for changing and diverse conditions, particularly
the more frequent extreme conditions generated
by climate change, which implies that there is
still a wealth of potential enhancement of the
potato’s role in satisfying human need for secure,
nutritious, and delicious food sources. The
Andean region is still the repository of genes
conserved in landraces that are an integral part of
the culture of current farming communities, and
there is the challenge of supporting those farmers
to conserve the genetic diversity, and the
knowledge and culture that have helped the
world in the past, and will help it in the future.
1 The Historical, Social and Economic Importance of the Potato Crop
References
Amoros W, Salas E, Burgos G, Zum Felde T, Hualla V,
Sosa P, Bonierbale M (2017) Genetic gain for iron and
zinc concentrations in a diploid potato population after
three cycles of recurrent selection (in preparation)
Andre CM, Evers D, Ziebel J, Guignard C, Hausman JF,
Bonierbale M, Zum Felde T, Burgos G (2015) In vitro
bioaccessibility and bioavailability of iron from pota-
toes with varying vitamin c, carotenoid, and phenolic
concentrations. J Agric Food Chem 63:9012–9021
Azimuddin MD, Alam QM, Baset MA (2009) Potato for
food security in Bangladesh. Inter J Sustain Crop Prod
4(1):94–99
Baroke S (2015) China banks on potatoes for food
security. http://blog.euromonitor.com/2015/
04/china-banks-onpotatoes-for-food-security.html.
Accessed on 3 Sept 2015
Brown CR (1993) Origin and history of the potato. Am
Potato J 70:363–374
Brush SB (2004) Farmers’ bounty: Locating crop diver-
sity in the contemporary world. Yale University Press,
New Haven, CT
CIP (2014a) Peru´s native potato revolution. Papa Andina
Innovation Brief 2. Centro Internacional de la Papa
(CIP). Octubre 2014. Lima-Peru, 8 p
CIP (2014b) The PMCA and potato market chain
innovation in Peru. Papa Andina Innovation Brief 3.
Centro Internacional de la Papa (CIP). Octubre 2014.
Lima-Peru, 8 p
DeFauw SL, He Z, Larkin RP, Mansour SA (2012)
Sustainable potato production and global food secu-
rity. In: He Z, Larkin RP, Honeycutt W (eds) Sustain-
able potato production: global case studies. Springer,
Netherlands
de Haan S (2009) Potato diversity at height: Multiple
dimensions of farmer driven in-situ conservation in the
Andes. PhD thesis. Wageningen University, Wagenin-
gen, Netherlands
De Jong H (2016) Impact of the potato on society. Am J
Potato Res 93:415–429
Demo P, Lemaga B, Kakuhenzire R, Schulz S, Borus D,
Barker I, Woldegiorgis G, Parker ML,
Schulte-Geldermann E (2015) Strategies to improve
seed potato quality and supply in Sub-Saharan Africa:
experience from interventions in five countries. In:
Low et al. (eds) Potato and Sweet potato in Africa:
Transforming the value chains for food and nutrition
security. CAB International, London
Devaux A (2014) Potatoes for sustainable global food
security. Powerpoint presentation. Redepapa. http://
redepapa.org/2014/07/14/potatoes-for-sustainable-
globalfood-security/. Accessed on 4 Sept 2015
Devaux A, Kromann P, Ortiz O (2014) Potatoes for
sustainable global food security. Potato Res 57:185–
199
Diez Hurtado A (2010) Derechos formales y derechos
reales: Acceso de mujeres campesinas a tierras de
comunidades en el marco del proceso de
9
formalización de la propiedad en comunidades de
Huancavelica [informe de investigación]. Lima, Peru:
Centro de Investigaciones Sociológicas, Económicas,
Políticas y Antropológicas and International Land
Coalition
FAO (2008) Why potato. http://www.fao.org/potato-2008/
en/aboutiyp/index.html. Accessed on 15 July 2015
FAO (2015) Yield gap analysis of field crops. Methods
and case studies. FAO Water Reports 41
FAOSTAT (2013) http://faostat3.fao.org/download/FB/
CC/E
FAOSTAT (2015). Top 20 Commodities by Country
Fiedel SJ (1987) Prehistory of the Americas. Cambridge
University Press, Cambridge
Fitzgerald M (2014) Diet cults: the surprising fallacy at
the core of nutrition fads and a guide to healthy eating
for the rest of us. Pegasus, New York, pp 111–128
Frederick C, Lei Z (2015) China to boost potato
production and transform potato into its fourth major
grain. Global Agricultural Information Network.
GAIN Report Number CH15036. http://gain.fas.usda.
gov/Recent%20GAIN%20Publications/Potatoes%
20and%20Potato%20Products%20Annual_Beijing_
China%20-%20Peoples%20Republic%20of_9-25-
2015. Accessed on 11 October 2015
GILB (Global Initiative in Late Blight) (2003) Newsletter
December 2003, No. 21
Gildemacher P (2012) Innovations in seed potato systems
in eastern Africa. PhD Thesis. Royal Tropical Insti-
tute, International Potato Center, Wageningen Univer-
sity. KIT Publishers, Amsterdam
Hastorf CA (1993) Agriculture and the onset of political
inequality before the Inka. Cambridge University
Press, Cambridge, UK
Havenkort A, Struik PC, Visser RG, Jacobsen FE (2009)
Applied biotechnology to combat late blight in potato
caused by Phytophthora Infestans. Potato Res
52:249–264
Haynes KG, Yencho GC, Clough ME, Henninger MR,
Sterrett SB (2012) Genetic variation for potato tuber
micronutrient content and implications for biofortifi-
cation of potatoes to reduce micronutrient malnutri-
tion. Am J Pot Res 89:192–198
Hijmans RJ (2001) Global distribution of the potato
crop. Am J Potato Res 78:403–412
IICA BID (2014) Innovation to assess the biodiversity of
indigenous potatoes: The Case of the Andean
potato/INCOPA in Peru. In: Henríquez P, Li Pun
(eds) Impactful innovations: lessons from family
agriculture in Latin America and the Caribbean, ISBN
978-92-9248-514-6. San José Costa Rica, pp 49–51
Kromann P, Valverde F, Gabriel J, Caballero D, Devaux A
(2016) Can Andean potato be agronomically bioforti-
fied with iron and Zn fertilizers? In: Catalogue of
Abstracts, 4th International Zinc Symposium: Improv-
ing Crop Production and Human Health, Sao Paulo,
Brazil, 15–17 October 2015, pp 54–55
Love SL, Pavek JJ (2008) Positioning the potato as a
primary food source of vitamin C. Am J Pot Res
85:277–285
10
Lutaladio N, Castaldi L (2009) Potato: the hidden
treasure. J Food Compos Anal 22:491–493
Mann CC (2011) How the potato changed the world.
Smithsonian magazine. http://www.smithsonianmag.
com/history/how-the-potato-changed-the-world-
108470605/. Accessed on 30 Aug 2015
McNeill WH (1999) How the potato changed the world’s
history. Social Res 66:67–83
Monneveux P, Ramírez DA, Pino MT (2013) Drought
tolerance in potato (S. tuberosum L.). Can we learn
from drought tolerance research in cereals? Plant Sci
205–206:76–86
Monneveux P, Ramírez DA, Awais Khan M, Ray-
mundo RM, Loayza H, Quiroz R (2014) Drought
and heat tolerance evaluation in potato (Solanum
tuberosum L.). Potato Res 57:225–247
Moseley M (1992) The Incas and their ancestors: The
Archaeology of Peru. Thames and Hudson, London,
UK
Nunn N, Qian N (2011) The potato’s contribution to
population and urbanization: evidence from a histor-
ical experiment. Quart J Econ 126:593–650
Ortiz O (2006) Evolution of agricultural extension and
information dissemination in Peru: An historical
perspective focusing on potato-related pest control.
Agric Human Values 23:477–489
Pradel W (2013) Importance of in-situ conservation
initiatives in conservation of native potato varieties
in the Andes of Peru. LACEEP Working paper series
No. 55. Latin American and Caribbean Environmental
Economic Program
Qu D, Xie K (eds) (2008) How the Chinese eat potatoes.
World Scientific Publishing Co., Singapore
Quiroz R, Loayza H, Barreda C, Gavilán C, Posadas A,
Ramírez DA (2017). Linking process-based potato
models with light reflectance data: Does model
complexity enhance yield prediction accuracy? Eur J
Agron 82 (Part A):104–112
Reader J (1990) Man on Earth: A celebration of mankind:
portraits of human culture in a multitude of environ-
ments. Harpercollins, 255 pages. Chapter Nine: The
Potato Growers. pp 156–174
O. Ortiz and V. Mares
Reader J (2008) Propitious esculent. The potato in world
history. William Heinemann, London
Salaman R (1949) The history and the social influence of
the potato. Cambridge University Press, Cambridge.
Reprinted in 1970
Sarapura S, Hambly Odame H, Thiele G (2016) Gender
and innovation in Peru’s native potato market chains.
In: Njuki J, Parkings J, Kaler A (eds) Transforming
Gender and Food Security in the Global South.
Routledge, New York, pp 160–185
Singh BP, Rana RK (2013) Potato for food and nutritional
security in India. Indian Farm 63:37–43
Spooner DM, Ghislain M, Simon R, Jansky SH,
Gavrilenko T (2014) Systematics, diversity, genetics,
and evolution of wild and cultivated potatoes. Bot Rev
80:283–383
Sullivan E (2010) Nutritious potato a global source of
sustainable food and income. Earthzine. http://earthzine.
org/2010/06/10/nutritious-potato-a-global-source-of-su
stainable-food-andincome/. Accessed on 4 Sept 2015
Thiele G, Theisen K, Bonierbale M, Walker T (2010)
Targeting the poor and hungry with potato science.
Potato J 37:75–86
Trueman CN (2016). The great famine of 1845. The
history learning site. http://www.historylearningsite.
co.uk/ireland-1845-to-1922/the-great-famine-of-1845/
. 25 March 2015, 16 August 2016
U.S. Department of Agriculture (2007) USDA national
nutrient database for standard reference, Release 20.
U.S. Department of Agriculture, Agricultural Research
Service, Washington, DC
Vandenbroeke C (1971) Cultivation and consumption of
the potato in the 17th and 18th century. Acta Historiae
Neerlandica 1: 15–39. https://books.google.ca/books?
id = fM8UAAAAIAA J. Accessed on 15 Sept 2015
White PJ, Thompson JA, Wright G, Rasmussen SK
(2016) Biofortifying Scottish potatoes with zinc. Plant
Soil 411:151–165
Yactayo W, Ramírez D, Gutiérrez R, Mares V, Posadas A,
Quiroz R (2013) Effect of partial root-zone drying
irrigation timing on potato tuber yield and water use
efficiency. Agric Water Manag 123:65–70
 Potato Genetic Resources
2
Ryoko Machida-Hirano and Takao Niino

Abstract
A very narrow genetic base of cultivated potato has permitted the
collection and conservation of its landraces and wild relatives as sources
of resistant and agronomically desirable traits. Despite its importance for
identifying genetic materials and understanding diversity, potato taxon-
omy is complex and problematic due to the crossability, polyploidy, and
reproductive nature of the potato species. Currently, the collected
germplasm is preserved in gene banks around the world and distributed
to potato researchers with accompanying data. Many gene banks maintain
potato collections in vitro, and technological innovations have been
developed to assure the long-term preservation of potato genetic
resources. Release of the first draft sequence of the potato genome
reaffirms the importance of potato genetic resources. Collaboration
between potato researchers and gene bank curators promotes the effective
use of the genetic resources. Application of next generation sequencing
(NGS) technologies would accelerate germplasm management, the
evaluation of genetic diversity in situ and ex situ, and conservation
planning of potato genetic resources.

2.1 Introduction

The potato (Solanum tuberosum L.) is one of the

R. Machida-Hirano (&)
National Agriculture and Food Research
Organization, 3-1-1 Kannondai, Tsukuba
Ibaraki 305-8517, Japan
e-mail: machidar676@affrc.go.jp
T. Niino
Gene Research Center, University of Tsukuba,
1-1-1 Tennodai, Tsukuba, Ibaraki 305-3572, Japan
most important staple crops in the world. It is a
New World crop and was unknown to the rest of
the world until the sixteenth century. Within the
six following centuries, potato cultivation had
spread from its center of origin, in the high
Andes region in South America to the rest of the
world. Potato is currently the fourth most
important staple crop after rice, wheat, and maize

© Springer International Publishing AG 2017 11

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_2
12
(de Haan and Rodriguez 2016) and provides a
substantial part of the world’s food supply, but it
is susceptible to a wide range of pests and dis-
eases. The genetic diversity is harbored in lan-
draces and wild relatives considered to be
valuable sources of variation for genetic
enhancement and crop improvement, because the
genetic base of the modern cultivated potato is
very narrow (Hawkes 1979; Hanneman 1989;
Jansky et al. 2013, 2015). Numerous expeditions
have collected important potato genetic resources
and conserved them in gene banks. Their effec-
tive collection, characterization, conservation
and use will be an important key to future sus-
tainable crop production and adaptation under
climate change scenarios. At the same time, the
evolution of genetic diversity is on-going in situ
and in farmers’ field in its center of origin (de
Haan and Rodriguez 2016). In this chapter,
potato taxonomy, history, current conservation
status and future challenges in the genomic era
are described in relation to recent biotechnolog-
ical and genomic technologies.
2.2 Potato Taxonomy: Recent
Updates
Species names are an important key to identify-
ing genetic materials, understanding levels of
diversity, linking studies across different publi-
cations, and identifying germplasm to be used for
breeding programs. However, the taxonomy of
wild and cultivated potatoes seem to be prob-
lematic, because of their interspecific crossabil-
ity, auto- and allopolyploidy, mixture of sexual
and asexual reproduction, possible recent species
divergence, phenotypic plasticity, and the con-
sequent high morphological similarity among
species (Spooner and Berg 1992; Spooner 2009).
Many potato species maintain their sexual com-
patibility, making it difficult to distinguish the
boundary of a species.
Comprehensive taxonomic treatment by
Hawkes (1990) reported that there are 235 potato
species in total, 228 wild and 7 cultivated potato
species. Since then, taxonomical studies have been
carried out. Various studies, implementing
R. Machida-Hirano and T. Niino
advanced molecular tools with a large number of
samples covering a wide range of species, have
suggested that a reconsideration of the taxonomic
classification is needed (Jacobs et al. 2008, 2011;
Spooner 2009). Lately, combinations of molecular
and morphological studies have reduced the
number of species to 107 wild and 4 cultivated
(Spooner et al. 2014). A detailed historical over-
view and updates of the taxonomical descriptions
of wild and cultivated potatoes were reviewed by
Spooner et al. (2014).
2.3 Cultivated Potato Landraces
The distribution of cultivated potato landraces
ranges over the upland Andes from western
Venezuela to northern Argentina and in the low-
lands of south-central Chile (Contreras et al. 1993),
adapting to middle to high elevations (3000–4000
m above sea level, masl). Potato landraces are
highly diverse in skin and flesh colors, and tuber
shapes and it is assumed that perhaps 3000 lan-
draces of potato are still grown by indigenous
farmers in South America in semi-traditional and
market-oriented production systems (de Haan and
Rodriguez 2016; Spooner et al. 2014).
Cultivated potato species have a base chromo-
some number of n = 12 and include diploid
(2n = 2x = 24), triploid (2n = 3x = 36), tetra-
ploid (2n = 4x = 48), or pentaploid
(2n = 5x = 60) types. Spooner et al. (2007) clas-
sified the cultivated potatoes into four species:
(1) Solanum tuberosum, with two cultivar groups
(the Andigenum Group of upland Andean geno-
types containing diploids, triploids, and tetra-
ploids and the Chilotanum Group of lowland
tetraploid Chilean landraces); (2) Solanum ajan-
huiri (diploid); (3) Solanum juzepczukii (triploid);
and (4) Solanum curtilobum (pentaploid).
Solanum tuberosum is the original species
from which modern cultivars were selected
(Ames and Spooner 2008). The species com-
prises the Andigenum Group of upland Andean
genotypes (containing diploids, triploids, and
tetraploids) and the Chilotanum group of lowland
tetraploid Chilean landraces. Andean genotypes
are difficult to distinguish from each other due to
2 Potato Genetic Resources
extensive gene flow. Furthermore, differentiation
from the Chilean tetraploids is slight and
incomplete (Gavrilenko et al. 2010). Current
distribution of the Chilotanum group is restricted
to the Chiloe Island of south-central Chile
(Spooner et al. 2010). The Chilotanum group has
contributed to the establishment of the current
European and North American gene pool as well
as global crop improvement (van den Berg and
Groendijk-Wilders 2014).
A cultivated diploid species, S. ajanhuiri, was
formed by hybridization between diploid cultivars
of the S. tuberosum Andigenum Group (2x = S.
stenotomum) and the diploid wild species S. boli-
viense (= S. megistacrolobum) (Rodríguez et al.
2010). Two major morphotypes, Ajawiri (bitter
type) and Yari (non-bitter type), are present.
Solanum juzepczukii Bukasov is a triploid
(2n = 3x = 36) cultivar, formed by hybridization
between diploid cultivars of the S. tuberosum
Andigenum Group (2x = S. stenotomum) and the
tetraploid wild species S. acaule (Rodríguez et al.
2010). Its distribution range is from central Peru to
southern Bolivia, and can be grown at an altitude of
4000 masl (Spooner et al. 2010) and in the
frost-affected areas of the Altiplano (Hijmans 1999;
Condori et al. 2014). Since this species contains
high levels of glycoalkaloids, local people make
“chuño” by freeze-drying potatoes, to prepare a
detoxifying processed potato (Irikura 1989).
Pentaploid S. curtilobum (2n = 5x = 60) was
likely formed by hybridization between tetra-
ploid forms of S. tuberosum Andigenum Group
(4x = S. tuberosum subsp. andigenum) and S.
juzepczukii (Hawkes 1990; Rodríguez et al.
2010). It also possesses frost hardiness as strong
as that of S. juzepczukii. It is cultivated in the
Andean Altiplano at an altitude range of
approximately 4000 masl (Spooner et al. 2010).
This species contains high glycoalkaloid and is
used to prepare “chuño” as well (Irikura 1989).
2.4 Wild Potato
As aforementioned, potato species are highly
complex in taxonomic classification. Currently,
107 wild species are recognized, including
13
diploids, tetraploids, and hexaploids
(2n = 6x = 72), without including triploids and
pentaploids (Hijmans et al. 2007; Spooner 2009;
Spooner et al. 2014). Wild potatoes are distributed
in a broad latitudinal range from the
South-Western U.S. to Central Chile and Argen-
tina (Hijmans et al. 2002; Spooner et al. 2014).
Two centers for diversity in wild potatoes
have been recognized: one in North and Central
America, with its center in Mexico, and the other
in South America, with its center in the Andes,
extending from Venezuela to Chile. This broad
area of distribution, along with a broad range of
altitudinal distribution, from sea level up to 4500
masl, indicates a wide range of adaptation (Hij-
mans and Spooner 2001; Hijmans et al. 2002,
2007). Their natural habitats are quite diverse,
including cloud forests, cultivated fields, cliffs, as
epiphytes, deserts, forests, and on the Pacific
islands. This wide range of adaptation has also
been reflected in a diversity of morphological
traits (Hanneman 1989).
Adaptations to a wide range of habitats have
made the wild species tolerant of different envi-
ronmental stresses, and resistant to a broad range
of pests and diseases, and other agricultural
interests (Bamberg and Rio 2005; Barker 1996;
D’hoop et al. 2008; Hawkes 1990, 1994; Hij-
mans et al. 2003; Jansky 2010; Ochoa 1999;
Spooner and Bamberg 1994). These sources of
breeding interests have been screened, identified,
and listed by several authors. Genetic diversity,
the availability of the germplasm, and usefulness
have been the drive to incorporate wild genes
into cultivated ones (Bamberg and Rio 2005).
2.5 The Potato Gene Pool
and Crossability
The success of the use of wild relatives for
genetic improvement relies a lot on their cross-
ability with cultivated species. Although some
barriers to cross-species compatibility in potato
are known, such as differences in the endosperm
balance number (EBN) and ploidy level, potato
researchers have developed methods to overcome
these hybridization barriers.
14
The gene pool is the most commonly used
concept defining the degree of relatedness
between species in Harlan and de Wet’s (1971)
study. It is based on the degree of crossability
among species and it is classified as following;
(1) primary; cultivated taxa and wild or weedy
forms of the crop that cross easily with the crop
and possess total fertility; (2) secondary; less
closely related species from which gene transfer
to the crop is possible with conventional breed-
ing techniques; and (3) tertiary; species from
which gene transfer to the crop is impossible, or
if possible, requires sophisticated techniques.
Although Harlan and de Wet’s genepool concept
has been widely accepted, it has not been applied
to all crops, including the potato. The taxonomic
classifications of the crop genus can be used as a
proxy for relative crossability, as in the taxon
group concept (Maxted et al. 2006).
Attempts to apply the genepool concept to the
potato have been made (Bradeen and Haynes
2011; Veilleux and De Jong 2007). Spooner et al.
(2014) proposed a concept especially for the
potato, applying five crossability groups based
on EBN and self-compatible/self-incompatible
systems. The primary genepool of potato
includes S. tuberosum ssp. tuberosum with all
landraces and cultivars. All the cultivated pota-
toes are tetraploid (2n = 4x = 48) with 4EBN
(Johnston et al. 1980). Potato has an extremely
large secondary gene pool consisting of related
wild species which provides a rich, unique, and
diverse source of genetic variation.
The EBN is a model determining the success
of interspecific crosses. It was first proposed by
Johnston et al. (1980) to explain the success or
failure of intraspecific crosses. It relates to a
strong isolating mechanism present in the section
Petota that affects the endosperm development,
but the genetic basis is still under investigation
(Ehlenfeldt and Hanneman 1988; Camadro and
Masuelli 1995). The EBN classification reported
in potato are 2x (1EBN), 2x (2EBN),
4x (2EBN), 4x (4EBN), and 6x (4EBN) (Spoo-
ner and Hijmans 2001). Hybridization within
each group is expected to be successful rather
than hybridization across groups, and thus the
success of hybridization can be predicted.
R. Machida-Hirano and T. Niino
Whereas the genepool concept and the EBN
model offer guidance in the utilization of wild
genetic resources, they also provide insight into
phylogenetic relationship and taxonomy (Brad-
een and Haynes 2011). Nevertheless, attempts to
directly test species crossability are always
important to provide concrete evidence (Jackson
and Hanneman 1999).
Potato researchers have developed methods to
overcome the hybridization barrier to transfer
genes from wild species of the secondary and
even tertiary genepool (Jansky 2006). Manipula-
tion techniques to modify the ploidy level have
already been reported (Hermundstad and Pelo-
quin 1985; McHale and Lauer 1981; Camadro
and Espinillo 1990; Iwanaga et al. 1989). Even
genes from the tertiary genepool can be intro-
duced using bridge crosses (Hermsen and
Ramanna 1973; Jansky and Hamernik 2009),
mentor pollinations, and embryo rescue (Iwanaga
et al. 1991; Watanabe et al. 1995), and somatic
hybridization (Chen et al. 2013; Fock et al. 2001).
The transgenic approach has been used for dis-
ease resistance (Missiou et al. 2004; van der
Vossen et al. 2003; Wu et al. 1995; Zhu et al.
2012) and abiotic stresses in potato (reviewed by
Kikuchi et al. 2015). Once commercial hybrids
are obtained with valuable genes from wild spe-
cies, they can be maintained clonally as tubers.
2.6 Domestication
and Dissemination
of the Potato
The center of origin of the cultivated potato is
believed to be the Andes region of southern Peru
and northern Bolivia, where they still grow wild
relatives (Hawkes 1994). Archeological evidence
and other data suggest that the potato was
domesticated between 10,000 (Ovchinnikova
et al. 2011) and 7000 years ago, in the southern
Andes of Peru, north of Lake Titicaca (Hawkes
1990). Characters selected for domestication of
wild potato involved producing larger tubers,
with lower glycoalkaloid content, shorter stolons,
and attractive colors of tuber skin and tuber flesh
(Gavrilenko et al. 2013). Although the evolution
2 Potato Genetic Resources
of the cultivated potato has not reached a con-
clusive result, phylogenetic and biogeographic
patterns have been studied for each cultivated
species (de Haan and Rodriguez 2016).
The DNA sequence data of orthologous nuclear
genes have elucidated the allopolyploid origin of
S. tuberosum (Spooner et al. 2008, 2010;
Rodriguez and Spooner 2009; Rodriguez et al.
2009).
The tetraploid cultivar groups of S. tuberosum
Chilotanum, which contributed to most modern
cultivars cultivated in Europe and North Amer-
ica, are still controversial (Spooner et al. 2012).
The group appears to have hybridized with a
closely related species as well as the wild Chilean
species S. maglia (Ugent et al. 1987) or hybrids
of S. tarjiense (Hosaka 2003; Spooner et al.
2014). However, there still remains a possibility
of an Andean origin with the early introduction
into Chile (Hawkes 1990, 1999).
The domestication process of the S. tubero-
sum Andigenum Group is believed to have star-
ted from wild progenitors of the Solanum
brevicaule complex (S. bukasovii, S. canasense
and S. multissectum) in southern Peru (Spooner
et al. 2005a). These species would have an
ancestral relationship to the diploid S. tuberosum
Andigenum Group (= S. stenotomum), which is
believed to be the most primitive form of culti-
vated potato (Hawkes 1990). Multiple origins
(Grun 1990; Hawkes 1994; Huamán and Spoo-
ner 2002) and hybrid origins (Rodríguez et al.
2010) of cultivated potatoes have also been
suggested. The progenitor species have devel-
oped into the current cultivated potato through
repeated sexual polyploidization processes in
different cultivation zones.
Since its first appearance in Europe, the potato
has rapidly spread worldwide. A detailed history
of the potato introduction from its origin to the
rest of the world is described by de Haan and
Rodriguez (2016). Molecular studies have
revealed that the origin of the European potato
was dominated by the Andean potato in the
1700s, and later the Chilean potato was intro-
duced into Europe and became predominant long
before the late blight epidemics (Ames and
Spooner 2008; Ríos et al. 2007; Spooner et al.
15
2005a, 2005b). The successful introduction of
South American materials into higher latitudes
involved an adaptation to long-day circum-
stances (Hawkes 1994). Cultivated potatoes were
introduced to North America in 1691 from Ber-
muda, where they had been grown from an ear-
lier introduction from England since 1613. The
potato was taken to India and China in the sev-
enteenth century by British missionaries and at
about the same time, potatoes were introduced to
different parts of Africa, and New Zealand in
1769 (Hawkes 1994).
2.7 Potato Genetic Resources
Genetic resources are a strategic resource for
sustainable crop production. Their efficient con-
servation and use are critical to keep feeding
increasing world populations. Gene banks play a
key role in the conservation and distribution of
germplasm for crop improvement and research
for sustainable food production. An intensive and
systematic potato germplasm collection was ini-
tiated in Central and South America in the 1920s
by Russian scientists and formed the basis of the
potato germplasm collection of the N.I. Vavilov
Institute of Plant Industry in St. Petersburg
(Ovchinnikova et al. 2011). Since then, much
effort has been invested in collecting, maintain-
ing, exchanging, and evaluating these collec-
tions. As a result, currently potato genetic
resources are preserved in gene banks around the
world and are available for potato breeders and
researchers.
2.7.1 Germplasm Conserved in Gene
Banks
The Food and Agriculture Organization of the
United Nations (FAO) (2010) reported there
were approximately 98,000 accessions currently
conserved ex situ and 80% of them are main-
tained in 30 key collections. Within these, 25,727
potato accessions are registered in GENESYS
(https://www.genesys-pgr.org/ accessed March
17, 2017). A list of major genebank collections
16
of the Solanaceae species (nightshade, including
tomato, eggplant and potato) is available
(Machida-Hirano 2015).
Cultivated potatoes are conserved mainly as
clonal collections, such as tuber, in vitro and
cryopreservation; on the other hand, wild potato
species are primarily collected and conserved in
the form of botanical seeds (Salas et al. 2008).
Preservation by botanical seed reduces the
maintenance cost, increases the conservation
period (20 + years) and eliminates systemic
viruses such as the Potato Spindle Tuber Viroid
(Bamberg and Rio 2005), therefore, preservation
of botanical seeds should be considered an option
for potato conservation.
Potato germplasm, including wild and culti-
vated potatoes, is conserved in gene banks
throughout the world. The Global Crop Diversity
Trust (GCDT) (2006) reported that at least 23
gene banks have a total of nearly 59,000 acces-
sions of potato germplasm with a considerable
number of duplications. The report classified the
collection into four categories; (1) wild relatives;
(2) native cultivars; (3) modern cultivars of the
common potato (Solanum tuberosum
susp. tuberosum); and (4) other germplasm (e.g.
inter-specific hybrids, breeding clones, etc.).
Wild species are the largest group present in the
collections, followed by native cultivars collected
from centers of diversity in Latin America. The
most important collections are in Latin America,
Europe, and in North America and a few coun-
tries in Asia. Recently, ex situ conservation sta-
tus was assessed to identify potato crop wild
relatives (CWR) in need of conservation. A total
of 49,164 records for 73 species of CWR was
found, with 76% of them possessing geographi-
cal coordinates, which corresponds to 11,100
germplasm accessions.
Most of the gene banks have web-searchable
databases of their gene bank holdings. Passport
information, taxonomy, phenotypic and evalua-
tion data of agronomical traits are available to
help gene bank users search and identify acces-
sions to be ordered, for example:
• the Centre for Genetic Resources, the
Netherlands, http://cgngenis.wur.nl/;
R. Machida-Hirano and T. Niino
• the Leibniz Institute of Plant Genetics and
Crop Plant Research, https://gbis.ipk-
gatersleben.de/GBIS_I/detail.jsf;
• the U.S. National Plant Germplasm System,
https://npgsweb.ars-grin.gov/gringlobal/
search.aspx;
• the Genebank Project, National Agriculture
and Food Research Organization https://
www.gene.affrc.go.jp/databases_en.php?
section=plant).
The GENESYS database (https://www.
genesys-pgr.org/) is a comprehensive database
of plant genetic resources for food and agricul-
ture supported by the GCDT. This database can
cross-search accessions conserved in different
gene banks. An inter-gene bank network has also
been developed to coordinate activities on potato
genetic resources conserved in different gene
banks. The Association of Potato Intergenebank
Collaborators (APIC) has produced a global
inventory of wild potato genetic resources col-
laboration with gene banks in Europe, the United
States, Peru, and Argentina. The database was
first developed with about 12,000 entries and
contained more than 5300 accessions identified
with a collector number (Huamán et al. 2000a).
Now the database is hosted by the International
Potato Center (CIP) and can be found online
(http://germplasmdb.cip.cgiar.org/index.jsp),
containing passport, taxonomical, and evaluation
data. The Working Group on Potato of the
European Cooperative Programme for Crop
Genetic Resources Networks (ECP/GR) is
working to coordinate and extend the potato
genetic resources conservation in the European
Union. The network has developed a central
database of both cultivated and wild potatoes.
The databases can be found on http://ecpgr.cgn.
wur.nl/eupotato/ and the European Cultivated
Potato Database https://www.europotato.org/
menu.php.
As a precaution, duplication is recommended
to safeguard the collection from partial or total
loss caused by natural or human-made catastro-
phes (Engels and Visser 2003; FAO 2014). Some
sister gene banks have already made a back-up of
their holdings. Germplasms of Solanaceae seeds
2 Potato Genetic Resources
have been deposited in the Svalbard Global Seed
Vault (https://www.croptrust.org/our-work/
svalbard-global-seed-vault/). The vault was
donated by Norway to the international com-
munity and is being supported by the GCDT.
2.7.2 In Vitro Collections of Potatoes
Many gene banks around the world are main-
taining potato genetic resources including wild
types. The current accession number of potato in
these gene banks is as follows:
• International Potato Center (CIP), Peru, 6768;
• Leibniz Institute of Plant Genetics and Crop
Plant Research (IPK)/The Groß Lüsewitz
Potato Collection (GLKS), Germany, 6124;
• Northern Region 6 (NR6), USA, 5808 (Niino
and Arizaga 2015);
• Vavilov Institute of Plant Industry, Russia,
9000;
• Central Potato Research Institute (CPRI),
India, 3500;
• Potato Research Institute, Czechoslovakia,
2225 (Kaczmarczyk et al. 2011).
The preservation of potato genetic resources
(GRs) in gene banks is mostly in field collec-
tions, by vegetative propagation due their allog-
amous nature. Vegetatively maintained potato
GRs are vulnerable to loss from natural disasters
and damage caused by pests and diseases. Also,
this way of preserving potato GRs requires a
sufficient area of land, funding and continuous
maintenance.
2.7.2.1 Short-Term and Mid-Term
Storage
In vitro gene banks are a means to overcome the
disadvantage of field gene banks. In vitro cultures
can easily be propagated and regenerated in
plantlets with the latest progress achieved in
plant tissue culture techniques. The advantages
of tissue cultures are their maintenance in a
sterile and pathogen-free environment and
growth in a controlled environment. For the
establishment of in vitro gene banks, tissue
17
culture systems and subculture systems for spe-
cies are needed without contamination of mate-
rials. Some rare and endangered plants with no
previous information on tissue culture establish-
ment have required the development of new tis-
sue culture protocols (Niino et al. 2014). Several
slow growth (minimal growth) methods have
been established for short-term (3 months) to
mid-term (3 years) storage using low tempera-
ture, minimal nutrition, growth retardants, and so
on, alone or in combination (Oka and Niino
1997). The main disadvantage of an in vitro gene
bank is the induction of genetic variation or
somatic mutations during subculturing. Maki
et al. (2015) pointed out that DNA mutation
occurs due to the long period of subcultures of
the plants, while stored shoot tips in super-low
temperature retained their original genetic struc-
ture. For this reason, a minimal growth method is
desirable for preservation of in vitro materials in
order to reduce the subculture numbers. The
frequency of subculturing can be reduced by
incubating them at low temperature, under low
light intensity and varied photoperiods, and
growing the micro plants on the Murashige and
Skoog medium (MS medium, Murashige and
Skoog 1962) supplemented with growth retar-
dants or osmotic stress-inducing polyols (Gopal
and Chauhan 2010).
The CIP maintains 4062 accessions in vitro
under slow growth conditions. The MS medium
used contains 40 g/l sorbitol, 20 g/l sucrose.
Cultures are maintained at 6–8 °C under
22 lmol/m2s illumination and 16-h light. This
allows in vitro plantlets to be stored for approx-
imately two years without subculturing (Niino
and Arizaga 2015). The IPK maintains 2855
potato accessions in vitro at 4 °C as microtubers.
The cycle of slow growth maintenance consists
of a warm phase with long-day at 20 °C for 2–
3 months, a microtuber induction phase with
short-day at 9 °C for 2–4 months and a micro-
tuber storage at 4 °C for 12–15 months (Keller
et al. 2006; Niino and Arizaga 2015). At the
CPRI, more than 1500 parental lines and potato
varieties are maintained in vitro on an MS
medium supplemented with 40 g/l sucrose and
20 g/l mannitol at 6–8 °C and 16-h photoperiod
18
Fig. 2.1 In vitro gene banks of potatoes. Left: CIP, Peru; Middle: IPK, Germany; Right: CNRG, Mexico
(Gopal and Chauhan 2010). Besides these insti-
tutes, in vitro storage of potato GRs is conducted
at many other institutes around world, such as in
Mexico, Chile, Korea, Japan by their adjusted
techniques (Fig. 2.1).
2.7.2.2 Long-Term Storage
Cryopreservation techniques using in vitro shoot
tips are recognized as a long-term storage tool for
plant genetic resources (PGR). Cryopreservation
is based on the reduction and subsequent inter-
ruption of metabolic functions of biological
materials by freezing at a super-low temperature,
while maintaining viability. At liquid nitrogen
(LN) temperature (−196 °C), almost all the cel-
lular metabolic activities are quiescent and the
cells can be preserved in such a state for a long
time. Preservation of in vitro shoot tips at cryo-
genic temperatures is considered to be a suitable
alternative that can ensure the long-term security
of vegetatively propagated plants. Once stored in
LN, PGR can be kept for almost unlimited
periods as a base collection. Almost all cryop-
reservation protocols are combined with tissue
culture techniques, because the cryopreservation
procedure is usually preceded by tissue culture
(Niino and Arizaga 2015).
The current status of the main cryo-stored
PGR encompasses orthodox seeds, some
non-orthodox seeds, pollen, dormant buds of
some temperate woody plants and in vitro cul-
tures. Large-scale cryo-storage of in vitro shoot
tips has been accomplished at several institutes
by optimizing cryopreservation protocols. The
International Network for the Improvement of
Banana and Plantain (INIBAP) has been
R. Machida-Hirano and T. Niino
maintaining the Musa spp. cryo-bank collection
of over 700 accessions by the droplet vitrification
method (Panis et al. 2005; Panis 2008). Other
crops (except for potato which have been cry-
opreserved in cryo-banks), include but are not
limited to cassava (Escobar et al. 1997), garlic
(Kim et al. 2004a, 2004b; Keller 2005), mat rush
(Niino et al. 2013), mint (Senula et al. 2007),
pear (Reed 1990), and raspberry (Reed 1988)
among others.
The potato cryo-banks of in vitro-grown shoot
tips have been established at several institutes
around the world. IPK and CIP are two of the
largest potato gene banks, which have been
applying cryo-storage to potato and have achieved
large cryo-bank collections, with over 1456 and
869 accessions, respectively (Niino and Arizaga
2015; Fig. 2.1). The cryopreservation methods
used in both Institutes are DMSO droplet and
droplet vitrification methods. These methods
perform the ultra-rapid cooling and warming by
direct immersion in LN and in the rewarming
solution of shoot tips on aluminum foil strips.
Cooling and warming rates are about 4000–
5000 °C/min and about 3000–4000 °C/min,
respectively (Niino et al. 2013).
The DMSO droplet method was developed at
IPK (Schäfer-Menuhr et al. 1994). The explants
(2–3 mm) are incubated in the medium overnight
at 22 °C and treated with cryoprotectant solution
with 10% DMSO for 1–3 h at room temperature
(RT), followed by transfer into droplets of 2.5 ll
cryoprotectant solution one by one on aluminum
foil. Afterwards, the aluminum foil is immersed
directly into the cryotube filled with LN. The
explants are rewarmed quickly by putting
2 Potato Genetic Resources
aluminum foils in a liquid MS medium with
30 g/l sucrose at RT for regeneration (Kacz-
marczyk et al. 2009, 2011; Keller et al. 2008).
Currently 1436 potato accessions are stored at
IPK using this protocol with a mean regeneration
rate of 46% (Kaczmarczyk et al. 2011; Niino and
Arizaga 2015).
The droplet vitrification method was devel-
oped for banana cryopreservation at first (Panis
et al. 2005). This method was applied to in vitro
potato shoot tips, resulting in a regrowth of 46–
51% (Halmagyi et al. 2005), 8–47% (Panta et al.
2006) and 64–94% (Kim et al. 2006). The latest
procedure for droplet vitrification in CIP is as
follows. The shoot tips (1.3–2.5 mm) are dis-
sected from the shoots, preconditioned and
incubated at RT for about 1 h on a potato
meristem medium. Osmoprotection is performed
by loading a solution (LS, 2 M glycerol and
0.4 M sucrose; Matsumoto et al. 1994) for
15 min at RT. After that, the shoot tips are
dehydrated by a plant vitrification solution 2
(PVS2, Sakai et al. 1990) for 50 min. at 0 °C,
and 3 min. before the end of each PVS2 treat-
ment, the shoot tips are transferred to a PVS2
drop (10–15 µl) on an aluminum foil strip
(0.5  2 cm). Then, the strips holding the shoots
are rapidly immersed in an LN-filled cryotube.
For regeneration, the strips are rewarmed quickly
by dropping them into a liquid MS medium with
1.2 M sucrose at RT and then incubated for
20 min for regeneration. Post-cryo cultures are
kept in the dark on the medium with a progres-
sive decrease in sucrose levels and then incu-
bated at 22 °C under standard conditions (Panta
et al. 2014). This protocol was successfully
applied to four genotypes showing different
reactions to abiotic stress, which had high
regrowth levels ranging from 23 to 76% (Panta
et al. 2014; Niino and Arizaga 2015). The
modified droplet vitrification protocol was
applied to the Korean in vitro potato collection at
the National Agrobiodiversity Center for
cryo-storage of 130 accessions. The National
Center for Genetic Resources USA has also
adopted this protocol with slight modifications
for potato cryo-storage of 247 accessions (Niino
and Arizaga 2015). Kaczmarczyk et al. (2011)
19
emphasized that a critical aspect in potato cry-
opreservation is the diverse response between
different genotypes in terms of their regeneration
capacities after cryopreservation. To overcome
this issue, it is crucial not only to make uniform,
healthy and robust shoot tips tolerable to cryop-
reservation procedures but also to develop the
regeneration system. Also, it is important that the
cryopreservation method should be simple,
modifiable and a suitable protocol for different
genotypes.
Recently, two novel vitrification methods
using aluminum plates, called the V cryo-plate
and the D cryo-plate methods, have been devel-
oped in order to establish a simple, reproducible
and reliable protocol (Yamamoto et al. 2011;
Niino et al. 2013). The procedure of the V
cryo-plate and the D cryo-plate for potato
(Yamamoto et al. 2015) is as follows. The shoot
tips (about 1.5–2.0 mm) are excised from the
preconditioned shoots and precultured on an MS
medium containing 0.3 M sucrose at 25 °C
overnight. The shoot tips are placed on alu-
minum cryo-plates and embedded in calcium
alginate gel. Osmoprotection is performed by
immersing the cryo-plates for 30 min. at 25 °C
in an LS solution (2 M glycerol and 0.8 or 1.0 M
sucrose). In the V cryo-plate method, dehydra-
tion is performed for 30 min. at 25 °C in PVS2.
In the D cryo-plate method, dehydration is per-
formed by placing the cryo-plates for 2.0 h under
an air current in a laminar flow cabinet after
osmoprotection. Then, the cryo-plate is trans-
ferred into an uncapped 2 ml cryotube and
directly plunged into LN. For regeneration, the
cryo-plate is retrieved from the cryotube in LN
and immersed in a 2 ml cryotube containing 2 ml
MS basal medium with 1 M sucrose, in which it
is incubated for 15 min. at RT. Rewarmed shoot
tips are placed on the solid MS medium and
cultured under standard conditions. These pro-
tocols were successfully applied to 16 cultivars
and 4 wild potato accessions, resulting in high
regrowth rates of cryopreserved shoot tips in V
cryo-plate and D cryo-plate, 96.7% and 93.3%,
respectively. The Genetic Resource Center,
National Agriculture and Food Research Orga-
nization, Japan, has started cryo-storage of
20
Fig. 2.2 Cryobanks of plant genetic resources. Left: IPK, Germany; Middle: GRC NARO, Japan; Right: CIP, Peru
in vitro potato shoot tips using the V cryo-plate
method (Fig. 2.2). The National Genetic
Resources Center in Mexico has adopted the D
cryo-plate method with slight modifications for
potato cryo-storage of 13 accessions (Valle Ari-
zaga et al. 2016).
To date, many molecular, biochemical, and
morphological studies have been conducted in
order to evaluate the genetic stability of the
cryopreserved plants. No significant differences
have been observed in the regenerated material
(Maki et al. 2015; Matsumoto et al. 2013).
However, the possibility of some genetic changes
may occur in cryopreserved plants, therefore, it is
necessary to constantly monitor the genetic sta-
bility of regenerated plants. Cryo-storage of
potato germplasm is at the cutting edge of cry-
opreservation research. Many experiences
obtained from potato cryo-banking have facili-
tated the cryo-banking of other plant species. In
particular, such a huge diversity of potatoes
needs to have many choices of protocol for
cryopreservation. Cryopreservation should be
considered a back-up to field collections to insure
against loss of plant germplasm (Niino et al.
2007). To realize comprehensive cryo-storage of
PGR, future further refinement of cryopreserva-
tion techniques will be needed.
2.7.3 In Situ and on-Farm
Conservation
Supporting physical and biological processes
which drive the evolutional process of life, in situ
R. Machida-Hirano and T. Niino
conservation is valued as complementary to ex situ
conservation. This complementary approach is
essential to ensure the availability of genetic
resources for current and future uses. Recently, the
importance of crop wild relatives (CWR) has been
addressed for sustainable food production (Maxted
and Kell 2009). The importance of potato landraces
and their wild relatives has largely contributed to
improving the agronomically desirable traits of the
cultivated potato (Bradshaw et al. 2006), and will
continue to be critical to develop cultivars espe-
cially adapted to climate change (Jansky et al.
2013). However, their habitats are threatened by
human-mediated habitat destruction (Maxted et al.
2012) and climate change (Schafleitner et al. 2011).
The importance of population dynamism in
their natural habitat has been emphasized for
in situ conservation planning (Castañeda-Álvarez
et al. 2015; Jansky et al. 2013; Maxted and Kell
2009), but only a limited number of studies have
been carried out on the wild potato species
(Cadima Fuentes et al. 2015; Marfil et al. 2015).
In situ conservation of wild species largely
encompasses population genetics in their natural
habitat, whereas in situ conservation of crops
(landraces) involves research on cultural and
socio-economic aspects (Maxted et al. 1987).
Scientific evidence of loss of genetic diversity and
genetic erosion of landraces has emphasized the
need for conservation strategies on farms (Brush
et al. 1992; de Haan and Thiel 2004; de Haan
et al. 2013), therefore, research on farmer-driven
conservation has become a key to the conserva-
tion of potato landraces. In Peru, on-farm con-
servations of potato landraces have been studied
2 Potato Genetic Resources
using different approaches (Asociación ANDES
2016; de Haan 2009; Pradel 2013; Scott 2011;
Zimmer 1998). Together with knowledge
obtained from the perceptions of farmers on
genetic diversity management, including seed
exchange, incorporation of new varieties and
farmers’ selection (Meldrum et al. 2017), appli-
cations of the genomic tools could be useful for
understanding the status of the genetic diversity
of materials conserved in situ and on farm.
2.8 Next Generation Sequencing
(NGS) Technologies for Potato
Genetic Resources
A highly heterozygous and complex genome of
the potato has hampered the genomic under-
standing of potatoes. Various molecular tools
have been intensively applied to elucidate taxo-
nomic or phylogenetic relationships, and identify
genes for breeding interests (D’hoop et al. 2008;
Jacobs et al. 2008; Spooner et al. 2007; Watan-
abe 2015). Recent advances in high-throughput
sequencing technologies and next generation
sequencing (NGS) have greatly contributed to
aid analysis of the genomic information of vari-
ous species, including potato.
The original genome sequence was generated
from a homozygous doubled monoploid, which was
derived from a heterozygous clone of the Phureja
group of cultivated potato (The Potato Genome
Sequencing Consortium 2011). Publications of the
potato reference genome sequencing have led to the
development of a wide range of genomic and tran-
scriptomic resources (Massa et al. 2011; The Potato
Genome Sequencing Consortium 2011; Sharma
et al. 2013; Hardigan et al. 2016). Recent updates
and the data resources were reviewed by Gálvez et al
(2017) and Hirsch et al. (2014, 2016). These geno-
mic information studies and tools have facilitated
the discovery of genes contributing to breeding
interests, such as disease resistance (reviewed by
Ramakrishnan et al. 2015) and stress tolerance (re-
viewed by Kikuchi et al. 2015).
Recently, the genome sequence of potato wild
relatives, S. commersonii, has been reported
(Aversano et al. 2015). Further sequence release
21
and assembly with cultivated potato will shed
light on the phylogenetic relationship and tax-
onomy of potatoes. Comparative studies of the
genome sequence with related crop species (The
Tomato Genome Consortium 2012; Kim et al.
2014; Sierro et al. 2014; Bombarely et al. 2016)
will increase the ability to identify genes of
interests shared with the Solanaceae family.
2.9 Challenges for Conservation
and Utilization of Potato
Genetic Resources
2.9.1 The Conservation Gap
The world potato collection exhibits some gaps
and most institutes intend to organize future col-
lecting missions or acquisition from other gene
banks to fill the gaps (GCDT 2006). A gap analysis
compares the natural distribution range and doc-
umented inventories of germplasm conserved in
the gene bank. This analysis identifies underrep-
resented collections in gene banks and provides
direction for further germplasm collection (Max-
ted et al. 2008; Ramírez-Villegas et al. 2010).
The state of ex situ conservation of 73 species
of potato wild relatives revealed that 32 species
were not yet represented in ex situ collections
and identified as high priority species for further
collections. Four species (S. ayacuchense, S.
neovavilovii, S. olmosense and S. salasianum)
were identified as missing from internationally
available gene bank collections and their collec-
tion and conservation are urgently needed (Cas-
tañeda-Álvarez et al. 2015). Most of the high
priority species for collecting are concentrated in
the north-central Andes, particularly in Peru,
although a long history of collecting missions has
been conducted in the center of the species
diversity (Castañeda-Álvarez et al. 2015).
2.9.2 Taxonomy and Inter-Gene Bank
Cross-References
Updating taxonomic classification and the
re-evaluation of the materials stored in the gene
22
bank are urgently needed to assure the consis-
tency of their genetic materials. In the case of
potato, a practical concern exists for the correct
identification of germplasm conserved in differ-
ent gene banks, because potato gene banks
around the world use different taxonomic clas-
sifications (Machida-Hirano 2015). This situation
makes cross-referencing accession difficult. Van
den Berg and Groendijk-Wilders (2014) sug-
gested recording the name under which the
material was originally collected and adding later
taxonomic options in the additional fields in the
database to make possible the cross-reference
species names on the databases. Recently, the
germplasm collection of the Vavilov Institute of
Plant Industry, Russia, was assessed for their
collection based on modern taxonomy, including
morphological characters, chromosome number,
and SSR genotyping (Gavrilenko et al. 2010).
Taxonomic nomenclatural issues also affect
the distribution of germplasm. Annex list 1 of the
International Treaty on Plant Genetic Resources
for Food and Agriculture (ITPGRFA) provides a
list of crops covered by the multilateral system.
For potato, it is described as “Solanum section
tuberosa, excludes S. phureja” (FAO 2009). The
interpretation seems to depend on the gene bank.
For example, CGN uses the system of Hawkes
(1990) to distinguish some of the tomato-related
species which are not in Annex 1, and applied the
regulations of the Convention of Biological
Diversity (CGN website, accessed March 13,
2017). As described above, current taxonomical
treatment includes S. phureja in S. tuberosum
sbsp. Andigenum Group (Spooner et al. 2007). In
the CIP database, 37 accessions of S. phureja are
listed and all of them are included in the mate-
rials under ITPGRFA and can be distributed
using Standard Material Transfer Agreement (the
accessions data is available on the GENESYS
website) (accessed March 4, 2017, https://www.
genesys-pgr.org/). Breeders and researchers
should be aware of the issues regarding interna-
tional legislation on genetic resources.
R. Machida-Hirano and T. Niino
2.9.3 Maintaining Genetic Diversity
in Gene Banks
The level and representativeness of originally
introduced germplasm seem to be a key to suc-
cessful diversity conservation. Having a sam-
pling strategy is one of the most important
factors to avoid unrepresented sampling, espe-
cially for heterogeneous populations (Camadro
2012). Information on the in situ genetic struc-
ture of sampling populations will be useful when
planning a collection, however, such information
is usually not available. Studies of germplasm
conserved in situ and in gene banks revealed
genetic changes in some accessions due to
genetic drift and contamination. Accessions
conserved in gene banks might not represent the
genetic diversity that exists in the natural popu-
lations because of the sampling effects, mode and
types of reproduction, natural hybridization and
other reasons. Broadening the sampling area and
resampling from a single site would capture the
genetic diversity of in situ population and
increase the representativeness of ex situ collec-
tions (Bamberg and Rio 2005; Cadima Fuentes
et al. 2015; Camadro 2012).
Regeneration at the gene banks level involves
challenges to minimize selection, genetic drift,
gene flow and handling errors resulting in genetic
changes and/or loss of genetic diversity of
seedling progeny during the process (Börner
et al. 2000; Chebotar et al. 2003; Van Hintum
et al. 2007; Soengas et al. 2009; Cadima Fuentes
et al. 2015). Although the genetic diversity of the
potato germplasm has not demonstrated signifi-
cant changes in both auto- and outcrossing potato
species (del Rio et al. 1997a, 1997b), Cadima
Fuentes et al. (2015) demonstrated that the
regeneration process has affected genetic diver-
sity and the integrity of some wild potato
accessions conserved in gene banks. Regenera-
tion methods, particularly for wild potato, have
been described by Salas et al. (2008). However,
the genetic variation of outcrossing species is
2 Potato Genetic Resources
vulnerable to genetic changes during regenera-
tion (Bamberg and del Rio 2004; Chebotar et al.
2003) and maintaining genetic diversity and the
genetic integrity of the original collections is
always a challenging task due to the heteroge-
neous and outbreeding nature of potatoes.
2.9.4 Phenotypic Variation
and Plasticity
Recent discussions on the phenotypic variation
and plasticity of potato have led to a
re-consideration of how to manage potato germ-
plasm under gene bank conditions. Jansky et al.
(2015) reported considerable tuber phenotypic
variation in an F2 population, as much as all the
phenotype found in a large landrace collection,
derived from self-pollinated diploid F1 hybrid
potato derived from a single inbred-line. In con-
trast, insufficient morphological variation some-
times makes it difficult to correctly identify the
species (van den Berg and Groendijk-Wilders
2014). Phenotypic plasticity also is a problem in
potato morphological characterization (van den
Berg and Groendijk-Wilders 2014). Since most of
the wild species are maintained as true seed,
segregation during regeneration is a considerable
problem to certify the true-to-type materials and
identify the correct species. Considering the nat-
ural occurrence of introgression and natural
hybridization among distinct species, maintaining
the genetic component of the original materials
introduced into a gene bank collection is an
extremely challenging task. Consistent phenotyp-
ing strategies need to be developed because phe-
notypic characterization is the key to NGS data
exploitation.
2.10 Sustainable Conservation
and Utilization of Potato
Genetic Resources in the NGS
Era
The main functions of gene banks are the com-
prehensive collection, the long-term conserva-
tion, distribution, organization and dissemination
23
of germplasm information to all interested sci-
entists (Bamberg and del Rio 2007). Recent
progress in NGS technologies has led to a sig-
nificant decrease in the sequencing costs (van
Dijk et al. 2014; Goodwin et al. 2016) and it will
make genotyping with NGS technologies more
affordable and feasible. Massive genotyping of
the gene bank collections and sharing the infor-
mation would be a way to demonstrate the
potential use of germplasm collections in gene
banks. Some gene banks have already started
distribution of germplasm collections together
with the genotyping data by NGS datasets (Ellis
2014). The International Maize and Wheat
Improvement Center is distributing a set of maize
inbred line collections, consisting of 538 acces-
sions, and the agromorphological data and the
more than 360 k filtered Single Nucleotide
Polymorphisms datasets are publicly available on
their website (Wu et al. 2016).
Genomic information obtained by NGS can
be expected to have an impact on its
user-oriented services, such as the preparation of
the core collection (CC) (van Treuren and van
Hintum 2014). Core collection is a subset which
represents genetic variation in the collection and
serves as a reference for the characterization of
its biological diversity (Brown 1989). The CC
should be chosen for specific objectives, and
should be made publicly, quickly and cheaply
available, and the genomic and phenotypic
characterization should be accessible to a broad
range of the research community (Glaszmann
et al. 2010; Odong et al. 2013; van Treuren and
van Hintum 2014). The CC also needs to be
maintained and conserved for reference pur-
poses, comparative studies, future re-analysis and
integrative genomic analysis (Hawkins et al.
2010).
Currently, several CCs are available for both
tetraploid cultivated potato (based on morpho-
logical or geographical data, and disease and pest
resistance, Huamán et al. 2000b) and diploid
CRW (based on molecular markers, Bamberg
and del Rio 2014; Bamberg et al. 2016). The
main challenge of potato CC selection is mixed
ploidy within species (Ghislain et al. 2006),
which induces complications with the
24
interpretation of genotyping data. Another chal-
lenge is obtaining homogeneous/stabilized
genetic stocks which are taxonomically classi-
fied in the correct way (Kilian and Graner 2012).
Although heterogeneity may reflect the original
genetic state of potato wild relatives and lan-
draces, heterogeneity within an accession will be
a considerable problem in designing a CC
because it seriously can impair its molecular
characterization and its subsequent use for
research and breeding. The usefulness of
CC-produced data will be highly dependent on
the quality and generation of the corresponding
phenotyping data (Furbank and Tester 2011;
Cobb et al. 2013; Jansky et al. 2015). Strength-
ening the cooperation between gene banks and
the users will allow the efficient identification of
specific alleles of interest, and the collection of
evaluation data. Consequently, it will lead to a
more efficient use of the germplasm preserved in
its collection.
NGS technologies will also be useful for dif-
ferent fields of study such as conservation, evo-
lution, domestication, ecology, and taxonomy
(Egan et al. 2012; Jansky et al. 2015; van Treu-
ren and van Hintum 2014; Kilian and Graner
2012). NGS will also be beneficial for potato
taxonomy which relies greatly on the herbarium
specimen made from wild plants growing under
stressful conditions. Environmental effects on
phenotype have made direct comparison difficult
between gene bank collections and their wild
counterparts because their growing habitats may
be very different (Bamberg and Rio 2005), but
genomic information and NGS techniques will
make this comparison possible. Understanding
genetic diversity in situ is key to developing
strategies to identify genotypes that possess
desirable traits, and to understanding the pro-
cesses that create and maintain such useful
variations for functional traits. The data produced
by NGS can potentially be used to understand the
genetic diversity conserved both ex situ and in
situ/on farm.
R. Machida-Hirano and T. Niino
Acknowledgements The authors would like to thank
Moisés Cortez-Cruz for providing comments regarding
the improvement of the quality of the contents.
References
Ames M, Spooner DM (2008) DNA from herbarium
specimens settles a controversy about origins of the
European potato. Am J Bot 95:252–257
Asociación ANDES (2016) Resilient farming systems in
times of uncertainty: biocultural innovations in the
potato park, Peru. IIED, London
Aversano R, Contaldi F, Ercolano MR et al (2015) The
Solanum commersonii genome sequence provides
insights into adaptation to stress conditions and
genome evolution of wild potato relatives. Plant Cell
27:954–968
Bamberg JB, del Rio (2005) Conservation and potato
genetic resources. In: Razdan MK, Mattoo AK
(eds) Genetic improvement and Solanaceaous crops,
vol I. Potato, Science Publishers, Inc. Plymouth, p 476
Bamberg JB, del Rio A, Kinder D, Louderback L,
Pavlik B, Fernandez C (2016) Core collections of
potato (Solanum) species native to the USA. Am J
Potato Res 93:564–571
Bamberg JB, del Rio AH (2004) Genetic heterogeneity
estimated by RAPD polymorphism of four
tuber-bearing potato species differing by breeding
system. Am J Potato Res 81:377–383
Bamberg JB, del Rio AH (2007) The canon of potato
science: 1. Genet Divers Genebanks Potato Res
50:207–210
Bamberg JB, del Rio AH (2014) Selection and validation
of an aflp marker core collection for the wild potato
Solanum microdontum. Am J Potato Res 91:368–375
Barker H (1996) Inheritance of resistance to potato
viruses Y and A in progeny obtained from potato
cultivars containing gene Ry: evidence for a new gene
for extreme resistance to PVA. Theor Appl Genet
93:710–716
Bombarely A, Moser M, Amrad A et al (2016) Insight
into the evolution of the Solanaceae from the parental
genomes of Petunia hybrid. Nat Plants 2:16074
Börner A, Chebotar S, Korzun V (2000) Molecular
characterization of the genetic integrity of wheat
(Triticum aestivum L.) germplasm after long-term
maintenance. Theor Appl Genet 100:494–497
Bradeen JM, Haynes KG (2011) Introduction to potato.
In: Bradeen J, Kole C (eds) Genetics, genomics, and
breeding of potato. CRC Press, Boca Raton, Fl,
pp 1–19
Bradshaw JE, Bryan GJ, Ramsay G (2006) Genetic
resources (including wild and cultivated Solanum
2 Potato Genetic Resources
species) and progress in their utilisation in potato
breeding. Potato Res 49:49–65
Brown AHD (1989) Core collections: a practical approach
to genetic resources management. Genome
31:818–824
Brush SB, Taylor JE, Bellon MR (1992) Technology
adoption and biological diversity in Andean potato
agriculture. J Dev Econ 39:365–387
Cadima Fuentes X, van Treuren R, Hoekstra R, van den
Berg RG, Sosef SMS (2015) Genetic diversity of
Bolivian wild potato germplasm: changes during ex
situ conservation management and comparisons with
resamples in situ populations. Genet Resour Crop
Evol 64:331–344
Camadro E (2012) Relevance of the genetic structure of
natural populations, sampling and classification
approaches for conservation and use of wild crop
relatives: potatoes as an example. Botany 90:1065–
1072
Camadro EL, Espinillo JC (1990) Germplasm transfer
from the wild tetraploid species Solanum acaule bitt.
to the cultivated potato S. tuberosum L. using 2n eggs.
Am Potato J 67:737–749
Camadro EL, Masuelli RW (1995) A genetic model for
the endosperm balance number (EBN) in the wild
potato Solanum acaule bitt. and two related diploid
species. Sex Plant Reprod 8:283–288
Castañeda-Álvarez NP, de Haan S, Jurez H, Khoury CK,
Achicanoy HA, Sosa CC, Bernau V, Salas A, Hei-
der B, Simon R, Maxted N, Spooner DM (2015) Ex
situ conservation priorities for the wild relatives of
potato (Solanum L.Section Petota). PLoS One 10:
e0122599
Chebotar S, Röder MS, Korzun V, Saal B, Weber WE,
Börner A (2003) Molecular studies on genetic
integrity of openpollinating species rye (Secale
cereale L.) after long-term genebank maintenance.
Theor Appl Genet 107:1469–1476
Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B,
Liu J (2013) Nuclear and cytoplasmic genome com-
ponents of Solanum tuberosum + S. chacoense
somatic hybrids and three SSR alleles related to
bacterial wilt resistance. Theor Appl Genet 126:1861–
1872
Cobb JN, DeClerck G, Greenberg A, Clark R, McCouch S
(2013) Next-generation phenotyping: requirements and
strategies for enhancing our understanding of geno-
type–phenotype relationships and its relevance to crop
improvement. Theor Appl Genet 126:867–887
Condori B, Hijmans RJ, Ledent JF, Quiroz R (2014)
Managing potato biodiversity to cope with frost risk in
the high Andes: a modeling perspective. PLoS One 9:
e81510
Contreras MA, Ciampi L, Padulosi S, Spooner DM
(1993) Potato germplasm collecting expedition to the
25
Guaitecas and Chonos Archipelagos, Chile, 1990.
Potato Res 36:309–316
D’hoop BB, Paulo MJ, Mank RA, van Eck HJ, van
Eeuwijk FA (2008) Association mapping of quality
traits in potato (Solanum tuberosum L.). Euphytica
161:47–60
de Haan S (2009) Potato diversity at height: multiple
dimensions of farmer-driven in-situ conservation in
the Andes, PhD thesis Wageningen University, The
Netherlands
de Haan S, Rodriguez F (2016) Potato origin and
production. In: Singh J, Kaur L (eds) Advances in
potato chemistry and technology. Elsevier Inc., Lon-
don, GB, pp 1–32
de Haan S, Thiel G (2004) In situ conservation and potato
seed systems in the Andes. In: Jarvis DI,
Sevilla-Panizo R, Chavez-Servia JL, Hodgkin T
(eds). Seed systems and crop genetic diversity
on-farm: proceedings of a workshop, 16–20 Septem-
ber 2003, Pucallpa, Peru. International Plant Genetic
Resources Institute, Rome, Italy, pp 126–132
de Haan S, Núñez J, Bonierbale M, Ghislain M, van der
Maesen J (2013) A simple sequence repeat
(SSR) marker comparison of a large in- and ex-situ
potato landrace cultivar collection from Peru reaffirms
the complementary nature of both conservation strate-
gies. Diversity 5:505–521
del Rio AH, Bamberg JB, Huamán Z (1997a) Assessing
changes in the genetic diversity of potato gene banks. 1.
Effects of seed increase. Theor Appl Genet 95:191–198
del Rio AH, Bamberg JB, Huamán Z, Salas A, Vega SE
(1997b) Assessing changes in the genetic diversity of
potato gene banks. 2. In situ vs ex situ, Theor Appl
Genet 95:199–204
Egan AN, Schlueter J, Spooner DM (2012) Applications
of next-generation sequencing in plant biology. Am J
Bot 99:175–185
Ehlenfeldt MK, Hanneman RE Jr (1988) Genetic control
of Endosperm Balance Number (EBN): three additive
loci in a threshold-like system. Theor Appl Genet
75:825–832
Ellis D (2014) Could genebanks be a pot of gold at the
end of the rainbow? In: Tracy W, Sligh M (eds) pro-
ceedings of the summit on seeds and breeds for 21st
century agriculture, Washington, DC, USA. Rural
Advancement Foundation International, Pittsboro,
North Carolina, USA, pp 129–142
Engels JMM, Visser L (2003) A guide to effective
management of germplasm collections, IPGRI hand-
books for Genebank No.6, IPGRI, Rome, Italy, p 174
Escobar RH, Mafla G, Roca WM (1997) A methodology
for recovering cassava plants from shoot tips main-
tained in liquid nitrogen. Plant Cell Rep 16:474–478
FAO (2009) International treaty on plant genetic
resources for food and agriculture. Italy, Rome, p 68
26
FAO (2010) The second report on the state of the world’s
plant genetic resources for food and agriculture. Italy,
Rome, p 370
FAO (2014) Genebank standards for plant genetic
resources for food and agriculture, Rev edn. Italy,
Rome, p 166
Fock I, Collonnier C, Luisetti J, Purwito A, Souvan-
navong V, Vedel F, Servaes A, Ambroise A, Kodja H,
Ducreux G et al (2001) Use of Solanum stenotomum
for introduction of resistance to bacterial wilt in
somatic hybrids of potato. Plant Physiol Biochem
39:899–908
Furbank RT, Tester M (2011) Phenomics—technologies
to relieve the phenotyping bottleneck. Trends Plant Sci
16:635–644
Gálvez JH, Tai HH, Barkley NA, Gardner K, Ellis D,
Strömvik MV (2017) Understanding potato with the
help of genomics. AIMS Agric Food 2:16–39
Gavrilenko T, Antonova O, Ovchinnikova A,
Novikova L, Krylova E, Mironenko N, Pendinen G,
Islamshina A, Shvachko N, Kiru S et al (2010) A
microsatellite and morphological assessment of the
Russian National cultivated potato collection. Genet
Resour Crop Evol 57:1151–1164
Gavrilenko T, Antonova O, Shuvalova A, Krylova E,
Alpatyeva N, Spooner DM, Novikova L (2013)
Genetic diversity and origin of cultivated potatoes
based on plastid microsatellite polymorphism. Genet
Res Crop Evol 60:1997–2015
Ghislain M, Andrade D, Rodríguez F, Hijmans RJ,
Spooner DM (2006) Genetic analysis of the cultivated
potato Solanum tuberosum L. Phureja Group Using
RAPDs Nucl SSRs, Theor Appl Genet 113:1515–
1527
Glaszmann JC, Kilian B, Upadhyaya HD, Varshney RK
(2010) Accessing genetic diversity for crop improve-
ment. Curr Opin Plant Biol 13:167–173
Goodwin S, McPherson JD, McCombie WR (2016)
Coming of age: ten years of next-generation sequenc-
ing technologies. Nat Rev Genet 17:333–351
Gopal J, Chauhan NS (2010) Slow growth in vitro
conservation of potato germplasm at low temperature.
Potato Res 53:141–149
Grun P (1990) The evolution of the cultivated potato.
Econ Bot 44:39–55
Halmagyi A, Deliu C, Coste A (2005) Plant regrowth
from potato shoot tips cryopreserved by a combined
vitrification-droplet method. Cryo Lett 26:313–322
Hanneman RE (1989) The potato germplasm resource.
Am Potato J 66:655–667
Hardigan MA, Crisovan E, Hamilton JP et al (2016)
Genome reduction uncovers a large dispensable
genome and adaptive role for copy number variation
in asexually propagated Solanum tuberosum. Plant
Cell 28:388–405
Harlan JR, de Wet JMJ (1971) Toward a rational
classification of cultivated plants. Taxon 20:509–517
R. Machida-Hirano and T. Niino
Hawkes JG (1979) Genetic poverty of the potato in
Europe. In: Zeven AZ, van Harten AM (eds) Broad-
ening the genetic base of crops. Centre for agricultural
publishing and documentation, Wageningen,
pp 19–27
Hawkes JG (1990) The potato: evolution, biodiversity and
genetic resources. Belhaven Press, London, p 259
Hawkes JG (1994) Origins of cultivated potatoes and
species relationships. In: Bradshaw JE, Mackay GR
(eds) Potato genetics. CAB International, Wallingford,
pp 3–42
Hawkes JG (1999) The evidence for the extent of N.I.
Vavilov’s new world Andean centres of cultivated
plant origins. Genet Resour Crop Evol 46:163–168
Hawkins RD, Hon GC, Ren B (2010) Next-generation
genomics: an integrative approach. Nat Rev Genet
11:476–486
Hermsen JGTH, Ramanna MS (1973) Double-bridge
hybrids of Solanum bulbocastanum and cultivars of
Solanum tuberosum. Euphytica 22:457–466
Hermundstad SA, Peloquin SJ (1985) Germplasm
enhancement with potato hybrids. J Hered 76:463–467
Hijmans RJ (1999) Estimating frost risk in potato
production on the Altiplano using interpolated climate
data. International potato center, impact on a changing
world, program report 1997–1998. International
Potato Center, Lima, pp 373–380
Hijmans RJ, Spooner DM (2001) Geographic distribution
of wild potato species. Am J Bot 88:2101–2112
Hijmans JR, Jacobs M, Bamberg JB, Spooner DM (2003)
Frost tolerance in wild potato species: assessing the
predictivity of taxonomic, geographic and ecologic
factors. Euphytica 130:47–59
Hijmans RJ, Spooner DM, Salas AR, Guarino L, de la
Cruz J (2002) Atlas of wild potato. Systematic and
ecogeographic studies on crop genepools, Interna-
tional Plant Genetic Resources Institute, Rome, p 130
Hijmans RJ, Gavrilenko T, Stephenson S, Bamberg J,
Salas A, Spooner DM (2007) Geographical and
environmental range expansion through polyploidy
in wild potatoes (Solanum section Petota). Glob Ecol
Biogeogr 16:485–495
Hirsch CD, Buell C, Hirsch CN (2016) A toolbox of
potato genetic and genomic resources. Am J Potato
Res 93:21–32
Hirsch CD, Hamilton JP, Childs KL, Cepela J, Crisovan E,
Vaillancourt B, Hirsch CN, Habermann M, Neal B,
Buell CR (2014) Spud DB: a resource for mining
sequences, genotypes, and phenotypes to accelerate
potato breeding. Plant Genome, 7(1). doi: 10.3835/
plantgenome2013.12.0042
Hosaka K (2003) T-type chloroplast DNA in Solanum
tuberosum L. ssp. tuberosum was conferred from
some populations of S. tarijense Hawkes. Am J Potato
Res 80:21–32
Huamán Z, Hoekstra R, Bamberg JB (2000a) The
Inter-genebank potato database and the dimensions
2 Potato Genetic Resources
of available wild potato germplasm. Am J Potato Res
77:353–362
Huamán Z, Ortiz R, Gómez R (2000b) Selecting a
Solanum tuberosum subsp. andigena core collection
using morphological, geographical, disease and pest
descriptors. Am J Potato Res 77:183–190
Huamán Z, Spooner DM (2002) Reclassification of
landrace population of cultivated potatoes (Solanum
sect. Petota). Am J Bot 89:947–965
Irikura Y (1989) Bareisho. In: Matsuo T (ed) Collected
data of plant genetic resources 2. Kodansha Scientific,
Tokyo, pp 498–518
Iwanaga M, Freyre R, Watanabe K (1991) Breaking the
crossability barriers between disomic tetraploid Sola-
num acaule and tetrasomic tetraploid S. tuberosum.
Euphytica 52:183–191
Iwanaga M, Jatala P, Ortiz R, Guevara E (1989) Use of
FDR 2n pollen to transfer resistance to root-knot
nematodes into cultivated 4x potatoes. J Am Soc
Hortic Sci 114:1008–1013
Jackson SA, Hanneman RE Jr (1999) Crossability
between cultivated and wild tuber- and
non-tuber-bearing Solanums. Euphytica 109:51–67
Jacobs MM, Smulders MJ, van den Berg RG, Vosman B
(2011) What’s in a name; genetic structure in Solanum
section Petota studied using population-genetic tools.
BMC Evol Biol 11:42
Jacobs MM, van den Berg RG, Vleeshouwers VG,
Visser M, Mank R, Sengers M, Hoekstra R, Vosman B
(2008) AFLP analysis reveals a lack of phylogenetic
structure within Solanum section Petota. BMC Evol
Biol 14:145
Jansky S (2006) Overcoming hybridization barriers in
potato. Plant Breed 125:1–12
Jansky S (2010) Breeding for disease resistance in potato.
In: Janick J (ed) Plant breeding reviews, vol 19 John
Wiley & Sons, Inc., Oxford, p 69–155
Jansky SH, Dawson J, Spooner DM (2015) How do we
address the disconnect between genetic and morpho-
logical diversity in germplasm collections? Am J Bot
102:1213–1215
Jansky SH, Dempewolf H, Camadro EL, Simon R,
Zimnoch-Guzowska E, Bisognin DA, Bonierbale M
(2013) A case for crop wild relative preservation and
use in potato. Crop Sci 53:746–754
Jansky SH, Hamernik A (2009) The introgression of
2  1EBN Solanum species into the cultivated potato
using Solanum verrucosum as a bridge. Genet Res
Crop Evol 56:1107–1115
Johnston SA, den Nijs TP, Peloquin SJ, Hanneman RE Jr
(1980) The significance of genic balance to endosperm
development in interspecific crosses. Theor Appl
Genet 57:5–9
Kaczmarczyk A, Grübe M, Keller ERJ (2009) History and
development of the potato cryopreservation method
and the cryopreserved collection at the IPK Gater-
sleben, Meeting of the WG2, COST Action 871
‘Cryopreservation of Crop Species in Europe’. Gater-
sleben, Germany, p 37
27
Kaczmarczyk A, Rokka VM, Keller ERJ (2011) Potato
shoot tip cryopreservation: a review. Potato Res
54:45–79
Keller ERJ (2005) Improvement of cryopreservation
results in garlic using low temperature preculture and
high-quality in vitro plantlets. CryoLett 26:357–366
Keller ERJ, Sunura A, Kaczmarczyk A (2008) Cryop-
reservation of herbaceous dicots. In: Reed B (ed) Plant
cryopreservation. A practical Guide, Springer, New
York, pp 281–332
Keller ERJ, Sunura A, Leunufna S, Grűbe M (2006) Slow
growth storage and cryopreservation-tools to facilitate
germplasm maintenance of vegetatively propagated
crops in living plant collections. J Refrigeration
29:411–417
Kikuchi A, Huynh HD, Endo T, Watanabe K (2015)
Review of recent transgenic studies on abiotic stress
tolerance and future molecular breeding in potato.
Breed Sci 65:85–102
Kilian B, Graner A (2012) NGS technologies for
analyzing germplasm diversity in genebanks. Brief
Funct Genomics 11:38–50
Kim HH, Cho EG, Baek HJ, Kim CY, Keller ERJ,
Engelmann F (2004a) Cryopreservation of garlic shoot
tips by vitrification, effect of dehydration, rewarming,
unloading and regrowth conditions. CryoLett 25:59–
70
Kim HH, Kim JB, Baek HJ, Cho EG, Chae YA, Engelmann F
(2004b) Evolution of DMSO concentration in garlic
shoot tips during a vitrification procedure. CryoLett
25:91–100
Kim HH, Yoon JW, Park YE, Cho EG, Sohn JK, Kim TS,
Engelmann F (2006) Cryopreservation of potato
cultivated varieties and wild species, critical factors
in droplet vitrification. CryoLett 27:223–234
Kim S, Park M, Yeom SI et al (2014) Genome sequence
of the hot pepper provides insights into the evolution
of pungency in Capsicum species. Nat Genet 46:270–
278
Machida-Hirano R (2015) Diversity of potato genetic
resources. Breed Sci 65:26–40
Maki S, Hirai Y, Niino T, Matsumoto T (2015) Assess-
ment of molecular genetic stability between long-term
cryopreserved and tissue cultured wasabi (Wasabia
japonica) plants. CryoLett 36:318–324
Marfil CF, Hidalgo V, Masuellia RW (2015) In situ
conservation of wild potato germplasm in Argentina:
example and possibilities. Global Ecol Conserv
3:461–476
Massa AN, Childs KL, Lin H et al (2011) The transcrip-
tome of the reference potato genome Solanum
tuberosum group Phureja clone DM1-3 516R44.
PLoS One 6(10):e26801
Matsumoto T, Akihiro T, Maki T, Mochida K, Kita-
gawa M, Tanaka D, Yamamoto S, Niino T (2013)
Genetic stability assessment of Wasabi plants regen-
erated from long-term cryopreserved shoot tips using
morphological, biochemical and molecular analysis.
CryoLett 34:128–136
28
Matsumoto T, Sakai A, Yamada K (1994) Cryopreserva-
tion of in vitro-grown apical meristems of wasabi
(Wasabia japonica) by vitrification and subsequent
high plant regeneration. Plant Cell Rep 13:442–446
Maxted N, Dulloo E, Ford-Lloyd BV, Iriondo JM,
Jarvis A (2008) Gap analysis: a tool for complemen-
tary genetic conservation assessment. Divers Distrib
14:1018–1030
Maxted N, Ford-Lloyd BV, Hawkes JG (1987) Comple-
mentary conservation strategies. In: Maxted N,
Ford-Lloyd BV, Hawkes JG (eds) Plant genetic
conservation, Chapman & Hall, pp 15–39
Maxted N, Ford-Lloyd BV, Jury S, Kell S, Scholten M
(2006) Towards a definition of a crop wild relative.
Biodivers Conserv 15:2673
Maxted N, Kell S (2009) Establishment of a network for
the In Situ conservation of crop wild relatives: status
and needs commission on genetic resources for food
and agriculture. Food and Agriculture Organization of
the United Nations, Rome, Italy
Maxted N, Kell S, Ford-Lloyd BV, Dulloo E, Toledo Á
(2012) Toward the systematic conservation of global
crop wild relative diversity. Crop Sci 52:774–785
McHale NA, Lauer FI (1981) Inheritance of tuber traits
from Phureja in diploid Phureja-Tuberosum hybrids.
Am Potato J 58:93–102
Meldrum G, Mijatović D, Rojas W et al (2017) Climate
change and crop diversity: farmers’ perceptions and
adaptation on the Bolivian Altiplano. Environ Dev
Sustain. doi:10.1007/s10668-016-9906-4
Missiou A, Kalantidis K, Boutla A, Tzortzakaki S,
Tabler M, Tsagris M (2004) Generation of transgenic
potato plants highly resistant to potato virus Y
(PVY) through RNA silencing. Mol Breed 14:185–
197
Murashige T, Skoog F (1962) A revised medium for rapid
growth and bio assays with tobacco tissue cultures.
Physiol Plant 15:473–497
Niino T, Arizaga MV (2015) Cryopreservation for
preservation of potato genetic resources. Breed Sci
65:41–52
Niino T, Tanaka D, Tantely RR, Fukui K, Shirata K
(2007) Cryopreservation of basal stem buds of
in vitro-grown mat rush (Juncus spp.) by vitrification.
CryoLett 28:197–206
Niino T, Wunna Watanabe K, Nohara N, Rafique T,
Yamamoto S, Fukui K, Valle Arizaga M, Castillo
Martinez CR, Matsumoto T, Engelmann F (2014)
Cryopreservation of mat rush lateral buds by air
dehydration using aluminum cryo-plate. Plant
Biotechnol 31:281–287
Niino T, Yamamoto S, Fukui K, Castillo Martínez CR,
Valle Arizaga M, Matsumoto T, Engelmann F (2013)
Dehydration improves cryopreservation of mat rush
(Juncus decipiens Nakai) basal stem buds on
cryo-plates. CryoLett 34:549–560
Ochoa CM (1999) Las papas de sudamerica: Peru (Parte
I). International Potato Center, Lima, p 1036
Odong TL, Jansen J, van Eeuwijk FA, van Hintum TJL
(2013) Quality of core collections for effective
R. Machida-Hirano and T. Niino
utilisation of genetic resources review, discussion
and interpretation. Theor Appl Genet 126:289–305
Oka S, Niino T (1997) Long term storage of pear (Pyrus
spp.) shoot cultures in vitro by minimal growth
method. Japan Agric Res Quar 31:1–7
Ovchinnikova A, Krylova E, Gavrilenko T, Smekalova T,
Zhuk M, Knapp S, Spooner DM (2011) Taxonomy of
cultivated potatoes (Solanum section Petota: Solana-
ceae). Bot J Linn Soc 165:107–155
Panis B (2008) Cryopreservation of monocots. In: Reed B
(ed) Plant cryopreservation. A practical Guide,
Springer, New York, pp 241–280
Panis B, Piette B, Swennen R (2005) Droplet vitrification
of apical meristems: a cryopreservation protocol
applicable to all Musaceae. Plant Sci 168:45–55
Panta A, Panis B, Ynouye C, Criel B, Swennen R,
Roca W (2006) Improvement of potato cryopreserva-
tion for the long-term conservation of Andean
landraces at the International Potato Center (CIP).
Cryobiol 53:401
Panta A, Panis B, Ynouye C, Swennen R, Roca W (2014)
Development of a PVS2 droplet vitrification method
for potato cryopreservation. CryoLett 35:255–266
Pradel W (2013) Importance of in-situ conservation
initiatives in conservation of native potato varieties
in the Andes of Peru, No 201355, Working Papers,
Latin American and Caribbean Environmental Eco-
nomics Program
Ramakrishnan AP, Ritland CE, Blas Sevillano RH,
Riseman A (2015) Review of potato molecular
markers to enhance trait selection. Am J Potato Res
92:455–472
Ramírez-Villegas J, Khoury C, Jarvis A, Debouck DG,
Guarino L (2010) A gap analysis methodology for
collecting crop genepools: A case study with phase-
olus beans. PLoS ONE 5: e13497
Reed BM (1988) Cold acclimation as a method to
improve survival of cryopreserved Rubus meristems.
CryoLett 9:166–171
Reed BM (1990) Survival of in vitro-grown apical
meristems of Pyrus following cryopreservation.
HortSci 25:111–113
Ríos D, Ghislain M, Rodríguez F, Spooner DM (2007)
What is the origin of the European potato? Evidence
from Canary Island landraces. Crop Sci 47:1270–1280
Rodríguez F, Ghislain M, Claused AM, Jansky SH,
Spooner DM (2010) Hybrid origins of cultivated
potatoes. Theor Appl Genet 121:1187–1198
Rodriguez F, Spooner DM (2009) Nitrate reductase
phylogeny of potato (Solanum sect. Petota) genomes
with emphasis on the origins of the polyploid species.
System Bot 34:207–219
Rodriguez F, Wu F, Ané C, Tanksley S, Spooner DM
(2009) Do potatoes and tomatoes have a single
evolutionary history, and what proportion of the
genome supports this history? BMC Evol Biol 9:191
Sakai A, Kobayashi S, Oiyama I (1990) Cryopreservation
of nucellar cells of navel orange (Citrus sinensis Osb.
var. brasiliensis Tanaka) by vitrification. Plant Cell
Rep 9:30–33
2 Potato Genetic Resources
Salas A, Gaspar O, Rodríguez W, Vargas M, Centeno R,
Tay D (2008) Regeneration guidelines: wild potato.
In: Dulloo ME, Thormann I, Jorge MA, Hanson J
(eds) Crop specific regeneration guidelines. CGIAR
System-wide Genetic Resource Programme, Rome,
Italy, p 8
Schäfer-Menuhr A, Schumacher HM, Mix-Wagner G
(1994) Langzeitlagerung alter Kartoffelsorten durch
Kryokonservierung der Meristeme in flüssigem Stick-
stoff. Landbauforsch Völkenrode 44:301–313
Schafleitner R, Ramirez J, Jarvis A, Evers D, Gutierrez R,
Scurrah M (2011) Adaptation of the potato crop to
changing climates. In: Yadav SS, Redden RJ, Hat-
field JL, Lotze-Campen H, Hall AE (eds) Crop
adaptation to climate change. Wiley-Blackwell,
Oxford, UK
Scott G (2011) Plants, people, and the conservation of
biodiversity of potatoes in Peru. Natureza Con-
servação 9:21–38
Senula A, Keller ERJ, Sanduijav T, Yohannes T (2007)
Cryopreservation of cold-acclimated mint (Mentha
spp.) shoot tips using a simple vitrification protocol.
CryoLett 28:1–12
Sharma SK, Bolser D, de Boer J et al (2013) Construction
of reference chromosome-scale pseudomolecules for
potato: integrating the potato genome with genetic and
physical maps. G3:2031–2047
Sierro N, Battey JND, Ouadi S et al (2014) The tobacco
genome sequence and its comparison with those of
tomato and potato. Nat Commun 5:3833
Soengas P, Cartea E, Lema M, Velasco P (2009) Effect of
regeneration procedures on the genetic integrity of
Brassica oleracea accessions. Mol Breed 23:389–395
Spooner DM (2009) DNA barcoding will frequently fail
in complicated groups: an example in wild potatoes.
Am J Bot 96:1177–1189
Spooner DM, Bamberg JB (1994) Potato genetic
resources: sources of resistance and systematics. Am
Potato J 71:325–337
Spooner DM, Gavrilenko T, Jansky SH, Ovchinnikova A,
Krylova E, Knapp S, Simon R (2010) Ecogeography
of ploidy variation in cultivated potato (Solanum sect.
Petota). Am J Bot 97:2049–2060
Spooner DM, Ghislain M, Simon R, Jansky SH,
Gavrilenko T (2014) Systematics, diversity, genetics,
and evolution of wild and cultivated potatoes. Bot Rev
80:283–383
Spooner DM, Hijmans RJ (2001) Potato systematics and
germplasm collecting, 1989–2000. Am J Potato Res
78:237–268
Spooner DM, Jansky S, Clausen A, del Rosalio Herrera M,
Ghislain M (2012) The enigma of Solanum maglia in
the origin of the chilean cultivated potato, Solanum
tuberosum Chilotanum group. Econ Bot 66:12–21
Spooner DM, McLean K, Ramsay G, Waugh R, Bryan G
(2005a) A single domestication for potato based on
multilocus amplified fragment length polymorphism
genotyping. Proc Natl Acad Sci USA 102:14694–14699
Spooner DM, Nuñez J, Rodriguez F, Naik PS, Ghislain M
(2005b) Nuclear and chloroplast DNA reassessment of
29
the origin of Indian potato varieties and its implica-
tions for the origin of the early European potato. Theor
Appl Genet 110:1020–1026
Spooner DM, Núñez J, Trujillo G, Del Rosario Herrera M,
Guzmán F, Ghislain M (2007) Extensive simple
sequence repeat genotyping of potato landraces sup-
ports a major reevaluation of their gene pool structure
and classification. Proc Natl Acad Sci USA
104:19398–19403
Spooner DM, Rodríguez F, Polgár Z, Ballard HE Jr,
Jansky SH (2008) Genomic origins of potato poly-
ploids: GBSSI gene sequencing data. Plant Genome
Suppl Crop Sci 48(S1):S27–S36
Spooner DM, van den Berg (1992) An analysis of recent
taxonomic concepts in wild potatoes (Solanum sect.
Petota). Genet Resour Crop Evol 39:23–37
The Global Crop Diversity Trust (2006) Background on
the development of the ‘global strategy for the Ex situ
conservation of potato’. http://www.croptrust.org/
documents/cropstrategies/Potato.pdf. Accessed 08
Mar 2017
The Potato Genome Sequencing Consortium (2011)
Genome sequence and analysis of the tuber crop
potato. Nature 475:189–195
The Tomato Genome Consortium (2012) The tomato
genome sequence provides insights into fleshy fruit
evolution. Nature 485:635–641
Ugent D, Dillehay T, Ramirez C (1987) Potato remains
from a late Pleistocene settlement in Southcentral
Chile. Econ Bot 41:17–27
Valle Arizaga M, Villalobos Navarro OF, Castillo
Martinez CR, Cruz Gutiérrez EJ, López Delgado HA,
Yamamoto S, Watanabe K, Niino T (2016) Improve-
ment to the D cryo-plate protocol applied to practical
cryopreservation of in vitro grown potato shoot tips.
Hortic J. doi:10.2503/hortj.OKD-002
van den Berg R, Groendijk-Wilders N (2014) Taxonomy. In:
Navarre R, Pavek M (eds) The potato: Botany. Produc-
tion and Uses, CABI Publishing, Surrey, pp 12–28
van der Vossen E, Sikkema A, Bt Hekkert, Gros J, Stevens P,
Muskens M, Wouters D, Pereira A, Stiekema W, Allefs S
(2003) An ancient R gene from the wild potato species
Solanum bulbocastanum confers broad-spectrum resis-
tance to Phytophthora infestans in cultivated potato and
tomato. Plant J 36:867–882
van Dijk EL, Auger H, Jaszczyszyn Y, Thermes C (2014)
Ten years of next-generation sequencing technology.
Trend Genet 30:418–426
van Hintum TJL, van de Wiel CCM, Visser DL, van
Treuren R, Vosman B (2007) The distribution of
genetic diversity in a Brassica oleracea gene bank
collection related to the effects on diversity of
regeneration, as measured with AFLPs. Theor Appl
Genet 114:777–786
van Treuren R, van Hintum TJL (2014) Next-generation
genebanking: plant genetic resources management and
utilization in the sequencing era. Plant Genet Resour
12:298–307
Veilleux RE, De Jong H (2007) Potato. In: Singh RJ
(ed) Genetic resources, chromosome engineering, and
30
crop improvement, vol 3. CRC Press, Boca Raton,
pp 17–58
Watanabe K (2015) Potato genetics, genomics, and
applications. Breed Sci 65:53–68
Watanabe KN, Orrillo M, Vega S, HurtadoA Valko-
nen JPT, Pehu E, Tanksley SD (1995) Overcoming
crossing barriers between non-tuber bearing and
tuber-bearing Solanum species: towards potato germ-
plasm enhancement with a broad spectrum of solana-
ceous genetic resources. Genome 38:27–35
Wu G, Shortt BJ, Lawrence EB, Levine EB, Fitzsim-
mons KC, Shah DM (1995) Disease resistance
conferred by expression of a gene encoding
H202-generating glucose oxidase in transgenic potato
plants. Plant Cell 7:1357–1368
Wu Y, San Vicente F, Huang K, Dhliwayo H, Costich DE,
Semagn K, Sudha N, Olsen M, Prasanna BM,
Zhang X, Babu R (2016) Molecular characterization
R. Machida-Hirano and T. Niino
of CIMMYT maize inbred lines with
genotyping-by-sequencing SNPs. Theor Appl Genet
129:753–765
Yamamoto S, Rafique T, Priyantha WS, Fukui K, Mat-
sumoto T, Niino T (2011) Development of a cryop-
reservation procedure using aluminium cryo-plates.
CryoLett 32:256–265
Yamamoto S, Wunna Rafique T, Valle Arizaga M,
Fukui K, Cruz Gutierrez E, Castillo Martinez C,
Watanabe K, Niino T (2015) The aluminium
cryo-plate increases efficiency of cryopreservation
protocols for potato shoot tips. Am J Potato Res
92:250–257
Zhu S, Li Y, Vossen JH, Visser RGF, Jacobsen E (2012)
Functional stacking of three resistance genes against
Phytophthora infestans in potato. Trans Res 21:89–99
Zimmer C (1998) The Ecogeography of Andean potatoes.
Bioscience 48:445–454
 History of Potato Breeding:
Improvement, Diversification, 3
and Diversity

Salej Sood, Vinay Bhardwaj, S. K. Pandey

and Swarup Kumar Chakrabarti

Abstract
The potato is an important crop in the world economy and has received a
lot of attention with regard to genetic improvement for different crop uses.
Many varieties worldwide have been released for table purposes as well as
for processing needs. The crop reproductive biology, its tetrasomic
inheritance and asexual reproduction complicate the genetic enhancement
and improvement of the crop. Many pests and diseases and changing
market needs require more trait mining to search for donor lines to
develop desirable plant types in the potato. The large species diversity and
crop gene pool offer an advantage for the use of wild species in the crop
improvement. Along with higher productivity, the focus nowadays is on
improved nutritional quality characteristics. Potato varieties suited to
sub-tropical and tropical climates with greater heat and drought tolerance
are required. There is more and more demand for different type of potatoes
suited to various needs of the consumers and markets. The recent
genomics advances and availability of the potato genome sequence will
provide new avenues to unravel and decipher the complex traits for
enhanced productivity and improved quality.

3.1 Introduction

The cultivated potato, Solanum tuberosum L.

S. Sood
V. Bhardwaj (&)
S. K. Pandey (&)
S. K. Chakrabarti
ICAR-Central Potato Research Institute, Shimla,
Himachal Pradesh 171001, India
e-mail: vinaycpri@gmail.com
S. K. Pandey
e-mail: write2skpandey@gmail.com
(2n = 4x = 48) is an important part of the diet of
nearly 1.5 billion people around the world. It is
an ancient crop of South American origin, dis-
persed by humans over a considerable area to
other parts of the globe. Molecular and historical
evidence suggests that the potato originated in
the Andean highlands of Southern Peru from
where it spread to Europe and other parts of the

© Springer International Publishing AG 2017 31

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_3
32
world, beginning in the sixteenth century. This
New World crop was originally domesticated
about 8000 years ago by communities of hunters
and gatherers in the Andes mountain range of
South America, on the border between Bolivia
and Peru. In India, potatoes were introduced by
British missionaries in the late seventeenth cen-
tury. Now, potato has become a crop of world
importance, ranking fourth in production after
rice, wheat and maize (FAO 2006). Potato is one
of the most diverse and nutritious crops and
comes in an array of shapes, sizes and colours. It
is a member of the nightshade family, Solana-
ceae, and is a short-lived perennial species. The
economically important part of the plant, the
potato tuber, is a site containing carbohydrates.
The tubers are produced underground as swel-
lings along modified stems known as stolons.
Although true botanical seed can be produced in
the potato, the tubers are used as organs of pri-
mary propagule also.
The crop is particularly suited to Indian con-
ditions. It enjoys a wide range of seasonal
adaptability. In the Gangetic plains of Uttar
Pradesh, the sowing time of the crop can be
extended over a period of three months from
October to December. In Punjab and the western
districts of Uttar Pradesh, two crops can be raised
in succession on the same piece of land, the first
in September–October and the second in
December–January. In the high hills in the
Himalayas, the potato crop is grown in the
summer months. Potato can be grown on any
type of soil, except alkaline soil, though it is
fairly tolerant even of saline conditions. It thrives
well in sandy or sandy loam soils. In the plains,
tuberization of the potato starts about 45 days
after planting. Due to its flexibility in respect of
sowing and harvesting times, short duration and
adaptability to different types of soil, it fits in
well with various crop rotation systems. More-
over, potato is grown in ridges, and a number of
inter-crops can be sown before the potato is
harvested.
The pressure on food production is increasing
year after year due to the continued expansion of
the world population and limited land resources.
Potato is one such crop which yields substantially
S. Sood et al.
more calories per acre than any other major cereal
crops and no crop can match the potato for the
production of food, with the energy and food
value per unit of land incomparable. Therefore,
potato could be the most important crop for pro-
viding food security in the coming years. More-
over, potato is a wholesome food. The tuber is
primarily composed of carbohydrates but is also a
significant dietary source of potassium and other
minerals, fiber, vitamin C, B6 and essential amino
acids. The lysine content of potato complements
cereal-based diets that are deficient in this
essential amino acid. It contains all the dietary
constituents except for fat. The reports on the
chemical composition of the potato state it is large
and varied, which is not due only to inherent
differences between genotypes but also due to
environmental and growth conditions, stage of
tuber maturity and the method of analysis.
There are more than 4000 varieties of potato
worldwide and all modern cultivars share a sin-
gle origin limited to the southern region of Peru
and north-east sections of Bolivia. Potato is also
progressively acquiring higher market value, thus
contributing to poverty reduction (Scott et al.
2000). Not only is the potato an important food
for the fresh market, but also it is the raw
material for the French fry, chipping, and starch
processing industries. An increasing part of the
production is transformed by industry, particu-
larly in Asia (Jansky et al. 2009).
Given the significance of the potato, research
on the genetic improvement of this crop is
important. However, the potato breeders are
challenged by an autotetraploid genome, asexual
propagation, and breeding principles and prac-
tices that are quite different from those employed
for the majority of diploid (or allopolyploid)
seed-propagated crops and numerous
market-limiting traits. Tarn et al. (1992) have
identified 18 traits related to fresh and processing
uses, 17 pathogens and 6 pest resistance traits,
and numerous agronomic traits that need to be
considered in a potato breeding programme.
Moreover, the genetic base of the cultivated
potato is considered to be narrow. However, the
rich gene pool of potato has contributed to sig-
nificant breeding advances.
3 History of Potato Breeding: Improvement, Diversification …
3.2 Origin and Domestication
Cultivated potato is a New World crop species.
The remains of potato peels from ancient fire pits
in southern Chile reveal that potato species were
consumed in that part of the world at least
13000 years ago (Ugent et al. 1987). Similarly,
recovery of fossilized potato tubers in Peru sug-
gest that potato was used as a food source in Peru
for at least 10000 years (Engel 1970). Consistent
with archaeological evidence which suggests that
potato was first grown in South America,
Vavilov (1951) identified the New World region
of Mexico, Peru and adjoining countries as the
centre of origin for the potato. The exact place of
origin of the potato, however, has been the topic
of scientific study for decades. Juzepczuk and
Bukasov (1929) proposed that modern potatoes
originated from the tetraploid landraces from
Chile (the Chilotanum group), whereas Salaman
(1946, 1954), and Hawkes and Francisco-Ortega
(1992) suggested an initial origin from the tet-
raploid landraces from the Andes (the Andi-
genum group). Hosaka et al. (1988, 1998a, b)
showed that tetraploid Chilean landraces are
primarily distinguished from most populations of
tetraploid Andean landraces and other cultivated
and wild species by an approximately 400 bp
deletion in chloroplast DNA (cpDNA). Hosaka
(1995) further studied the origin of the cultivated
tetraploid potato species using cpDNA restriction
site data. He studied 132 accessions of the
diploid Stenotomum group and of 6 related
diploid wild species. He showed extensive
Table 3.1 Botanical Family
classification of the
cultivated potato Subfamily
Tribe
Genus
Subgenus
Section
Subsection
Superseries
Series
Species
Sub-species
33
cpDNA polymorphism in all taxa except S. bre-
vicaule and concluded that Andean diploid lan-
draces were domesticated many times from the
wild species, followed by sexual polyploidization
to form Andean land races. Several authors have
advocated the multiple domestication events for
potato, involving complex inter-specific
hybridization of various Solanum species (Grun
1990; van der Berg et al. 1998; Huamán and
Spooner 2002). However, Spooner et al. (2005)
refuted the multiple domestication hypotheses by
applying AFLP marker technology to a potato
collection comprising cultivated and wild species
where all the cultivated types clustered together.
Moreover, the cultivated types were more closely
related to Northern wild species, thereby indi-
cating that the potato was domesticated in
Southern Peru. Thus, Spooner et al. (2005) sup-
ported a single origin of potato from a wild
species progenitor in the S. brevicaule complex
in Southern Peru.
3.3 Species Diversity in the Potato
The genus Solanum is extremely large, contain-
ing approximately 1500–2000 species (PBI
Solanum Project 2014). Of these, approximately
200 tuber-bearing species are grouped in the
Petota section. This section is subdivided into
two subsections, Potatoe and Estolonifera
(Hawkes 1990, 1994). The botanical classifica-
tion of the cultivated potato is given in Table 3.1.
The taxonomic treatment of the cultivated potato
Solanaceae
Solanoideae
Solaneae
Solanum L.
Potatoe (G. Don) D’Arcy
Petota dumortier
Potatoe G. Don
Rotata hawkes
Tuberosa (Rydb.) hawkes
Solanum tuberosum L.
Tuberosum
34
is still under discussion. Hawkes (1990) stated
that there are 7 cultivated potato species, whereas
Ochoa (1999) identified only 9 species and 141
infraspecific taxa. The most recent suggestion
was made by Spooner et al. (2007). They geno-
typed 742 landraces of all cultivated species and
wild progenitors with SSR and chloroplast
markers, and suggested reclassification of culti-
vated potatoes into the following four species:
(1) S. tuberosum, with two cultivar groups (the
Andigenum group of upland Andean genotypes
containing diploids, triploids, and tetraploids and
the Chilotanum group of lowland tetraploid
Chilean landraces); (2) S. ajanhuiri (diploid);
(3) S. juzepczukii (triploid); and (4) S. curtilobum
(pentaploid) (Spooner et al. 2007). However, all
major web-searchable databases of the world
potato germplasm collections continue to use the
classifications and descriptions of Hawkes
(1990).
Potato has an extremely large secondary gene
pool consisting of related wild species. There-
fore, its taxonomy has been the subject of study
for many years. Consistency of names assigned
to species and higher ranks, identification of
identical materials, and the classification of
materials reflecting genetic similarities are major
objectives in potato systematics (Spooner and
Bamberg 1994). Given the importance of taxo-
nomic consistency, different taxonomic classifi-
cations of wild and cultivated potatoes have been
presented by several authors (Huamán and
Spooner 2002; Ovchinnikova et al. 2011;
Spooner and Hijmans 2001). This complication
of potato taxonomy at the species level may have
arisen by introgression, interspecific hybridiza-
tion, auto- or allopolyploidy, sexual compatibil-
ity among many species, a mixture of sexual and
asexual reproduction, recent species divergence,
phenotypic plasticity and consequently high
morphological similarity among species
(Spooner 2009; Spooner and Bamberg 1994).
After Hawkes (1990), the current independent
taxonomic decisions regarding the number of
species and the interrelationships among species
in the section Petota was given by Spooner et al.
(2014). They clubbed together the different
names of one species under one heading and
S. Sood et al.
identified 107 wild species along with 5 culti-
vated species. This new classification of species
diversity along with useful traits in potato is
shown in Table 3.2.
3.4 Potato Germplasm Collections
and Their Utilization
The great use of wild species and potato lan-
draces has led to a series of expeditions for col-
lection in the centres of origin. The collections
are currently available for breeders and
researchers through gene banks (Spooner and
Bamberg 1994). Approximately 98,000 acces-
sions are conserved ex situ (Table 3.3) and 80%
of them are maintained in 30 key collections
(FAO 2010). The major potato collections are in
Latin America, Europe, North America, and a
few countries in Asia. Landraces and wild rela-
tives are found mostly in Latin American col-
lections, whereas modern cultivars and breeding
materials are found mostly in collections in
Europe and North America (FAO 2010). Glob-
ally, 20% of accessions are in medium-term
storage, 11% in short-term storage for immediate
use, and 69% in unknown storage conditions
(Machida-Hirano 2015).
The value of germplasm is determined by its
genetic diversity, availability and utility. In this
regard, potato stands out among all other crops
(Bamberg and del Rio 2005). The two hundred
wild species of potato are potentially a rich
source of useful genes for the improvement of
the cultivated potato. Clearly, these germplasm
collections contain a lot of biodiversity, but it is
pertinent to ask to what extent they have been
used in the past and what are the prospects for
their further use in the future. In order to effi-
ciently use large potato germplasm, the potato
germplasm has been divided into three different
categories. These three categories are gene pool
concept, the Endosperm Balance Number
(EBN) model, and phylogenetic classification.
The gene pool concept, as in other crops, is based
on the crossability of germplasm to a cultivated
species. The primary gene pool consist of culti-
vated potato (S. tuberosum L.) as well as all
 3

Table 3.2 Solanum species with ploidy status, EBN number and reported useful traits
Name of the species Synonyms Ploidy EBN Fungus resistance Bacterial resistance Virus resistance
Status number
Late Wart Common Bacterial Soft Potato Potato Potato Spindle
blight scab wilt rot: virus virus leaf roll tuber
black X Y virus viroid
leg

Wild species

Solanum acaule Bitter S. acaule f. incuyo Ochoa; S. acaule var. punae 4x, 6x 2EBN (4x) b a b a b a
(Juz.) Hawkes

Solanum acroglossum Juz 2x 2EBN

Solanum acroscopicum S. lopez-camarenae Ochoa 2x

Ochoa

Solanum aemulans Bitter S. acaule subsp. aemulans (Bitter & Wittm.) Hawkes 3x, 4x 2EBN (4x)
& Wittm & Hjert.; S. indunii K.A. Okada & A.M. Clausen

Solanum agrimonifolium 4x 2EBN

Rydb

Solanum albicans (Ochoa) S. acaule subsp. palmirense Kardolus 6x 4EBN

Ochoa

Solanum albornozii 2x 2EBN

Correll

Solanum amayanum 2x 2EBN

Ochoa
History of Potato Breeding: Improvement, Diversification …

Solanum anamatophilum S. peloquinianum Ochoa 2x 2EBN

Ochoa

Solanum andreanum S. burtonii Ochoa; S. correllii Ochoa; S. 2x, 4x 2EBN,

Baker cyanophyllum Correll; S. paucijugum Bitter; S. 4EBN
regularifolium Correll; S. serratoris Ochoa; S. solisii
Hawkes; S. suffrutescens Correll; S. tuquerrense
Hawkes

Solanum augustii Ochoa 2x 1EBN

Solanum ayacuchense 2x 2EBN

Ochoa

Solanum berthaultii S. flavoviridens Ochoa; S. tarijense Hawkes; S. 2x, 3x 2EBN (2x) a a a a

Hawkes litusinum Ochoa; S. trigalense Cárdenas; S.
zudaniense Cárdenas

Solanumblanco-galdosii 2x 2EBN
Ochoa

(continued)
35
Table 3.2 (continued)
36

Name of the species Synonyms Ploidy EBN Fungus resistance Bacterial resistance Virus resistance
Status number
Late Wart Common Bacterial Soft Potato Potato Potato Spindle
blight scab wilt rot: virus virus leaf roll tuber
black X Y virus viroid
leg

Solanum boliviense Dunal S. astleyi Hawkes & Hjert.; S. megistacrolobum 2x 2EBN

in DC Bitter; S. megistacrolobum f. purpureum Ochoa; S.
sanctae-rosae Hawkes; S. toralapanum Cárdenas &
Hawkes

Solanum bombycinum 4x
Ochoa

Solanum brevicaule Bitter S. alandiae Cárdenas; S. avilesii Hawkes & Hjert.; S. 2x, 4x, 2 EBN (2x), a a
gourlayi Hawkes; S. gourlayi subsp. pachytrichum 6x 4EBN (4x,
(Hawkes) Hawkes & Hjert.; S. gourlayi 6x)
subsp. saltense A.M. Clausen & K.A. Okada; S.
gourlayi subsp. vidaurrei (Cárdenas) Hawkes &
Hjert.; S. hondelmannii Hawkes & Hjert.; S.
hoopesii Hawkes & K.A. Okada; S. incamayoense
K.A. Okada & A.M. Clausen; S. leptophyes Bitter;
S. oplocense Hawkes; S. setulosistylum Bitter; S.
sparsipilum (Bitter) Juz. & Bukasov; S. spegazzinii
Bitter; S. sucrense Hawkes; S. ugentii Hawkes & K.
A. Okada; S. virgultorum (Bitter) Cárdenas &
Hawkes; S.subandigena Hawkes;

Solanum brucheri S.viirsoii K.A. Okada & A.M. Clausen 3x

Correll

Solanum buesii Vargas 2x 2EBN

Solanum bulbocastanum S. bulbocastanum subsp. dolichophyllum (Bitter) 2x, 3x 1EBN (2xx) b a a a

Dunal in Poir Hawkes; S. bulbocastanum subsp. partitum (Correll)
Hawkes

Solanum burkartii Ochoa S. irosinum Ochoa S. irosinum forma tarrosum 2x

Ochoa

Solanum cajamarquense 2x 1EBN

Ochoa

Solanum candolleanum S. abancayense Ochoa; S. achacachense Cárdenas; 2x, 3x 2EBN (2x) a a

Berthault S. ambosinum Ochoa; S. ancoripae Ochoa; S.
antacochense Ochoa; S. aymaraesense Ochoa; S.
bill-hookeri Ochoa; S. bukasovii Juz.; S. bukasovii
var. multidissectum (Hawkes) Ochoa; S. bukasovii
forma multidissectum (Hawkes) Ochoa; S.
canasense Hawkes; S. canasense var. xerophilum
(Vargas) Hawkes; S. chillonanum Ochoa; S.

(continued)
S. Sood et al.
 3
Table 3.2 (continued)
Name of the species Synonyms Ploidy EBN Fungus resistance Bacterial resistance Virus resistance
Status number
Late Wart Common Bacterial Soft Potato Potato Potato Spindle
blight scab wilt rot: virus virus leaf roll tuber
black X Y virus viroid
leg

coelestispetalum Vargas; S. hapalosum Ochoa; S.

huancavelicae Ochoa; S. longiusculus Ochoa; S.
marinasense Vargas; S. multidissectum Hawkes; S.
orophilum Correll; S. ortegae Ochoa; S. pampasense
Hawkes; S. puchupuchense Ochoa; S. sarasarae
Ochoa; S. sawyeri Ochoa; S. saxatile Ochoa; as
‘saxatilis’ S. sicuanum Hawkes; S. sparsipilum
subsp. calcense (Hawkes) Hawkes; S. tapojense
Ochoa; S. tarapatanum Ochoa; S.mollepujroense
Cárdenas & Hawkes

Solanum cantense Ochoa 2x 2EBN

Solanum cardiophyllum S. cardiophyllum subsp. lanceolatum (Berthault) 2x, 3x 1EBN (2x) b a a

Lindl Bitter

Solanum chacoense Bitter S. arnezii Cárdenas; S. calvescens Bitter; 2x, 3x 2EBN (2x) a a a a a a b
S. chacoense subsp. chacoense S. chacoense
subsp. muelleri (Bitter) Hawkes; S. tuberosum
subsp. yanacochense Ochoa; (=S. yanacochense
(Ochoa) Gorbatenko; S. yungasense Hawkes
History of Potato Breeding: Improvement, Diversification …

Solanum chilliasense 2x 2EBN

Ochoa

Solanum chiquidenum S. ariduphilum Ochoa; S. chiquidenum forma 2x 2EBN

Ochoa amazonense Ochoa; S. chiquidenum var. gracile
Ochoa; S. chiquidenum var. robustum Ochoa

Solanum chomatophilum S. chomatophilum forma sausianense Ochoa; 2x 2EBN

Bitter S. chomatophilum var. subnivale Ochoa;
S. huarochiriense Ochoa; S. jalcae Ochoa; S.
pascoense Ochoa; S. taulisense Ochoa

Solanum clarum Correll 2x a

Solanum colombianum S. cacetanum Ochoa; S. calacalinum Ochoa; S. 4x 2EBN a

Dunal jaenense Ochoa; S. moscopanum Hawkes; S.
nemorosum Ochoa; S. orocense Ochoa; S. otites
Dunal; S. pamplonense L.E. López; S.
subpanduratum Ochoa; S. paramoense Bitter; S.
sucubunense Ochoa

Solanum commersonii 2x, 3x 1EBN a a a a

Dunal

(continued)
37
Table 3.2 (continued)
38

Name of the species Synonyms Ploidy EBN Fungus resistance Bacterial resistance Virus resistance
Status number
Late Wart Common Bacterial Soft Potato Potato Potato Spindle
blight scab wilt rot: virus virus leaf roll tuber
black X Y virus viroid
leg

Solanum contumazaense 2x 2EBN

Ochoa

Solanum demissum Lindl S. semidemissum Juz. 6x 4EBN b a a a b a

Solanum doddsii Correll 2x 2EBN

Solanum S. chavinense Correll; S. huanuchense Ochoa 2x 1EBN

dolichocremastrum Bitter

Solanum edinense S.edinense subsp. salamanii (Hawkes) Hawkes 5x a

Berthault

Solanum ehrenbergii S. cardiophyllum subsp. ehrenbergii Bitter 2x 1EBN

(Bitter) Rydb

Solanum flahaultii Bitter S. neovalenzuelae L.E.López 4x

Solanum gandarillasii 2x 2EBN

Cárdenas

Solanum garcia-barrigae S. donachui (Ochoa) Ochoa 4x

Ochoa

Solanum gracilifrons 2x
Bitter

Solanum guerreroense 6x 4EBN a

Correll

Solanum hastiforme 2x 2EBN

Correll

Solanum hintonii Correll 2x

Solanum hjertingii S. hjertingii var. physaloides (Correll) Hawkes; 4x 2EBN a

Hawkes S. leptosepalum Correll; S. matehualae Hjert. & T.R.
Tarn

Solanum hougasii Correll 6x 4EBN

Solanum huancabambense 2x 2EBN

Ochoa

Solanum humectophilum 2x 1EBN

Ochoa

S. guzmanguense Whalen & Sagást. 2x 1EBN

(continued)
S. Sood et al.
 3
Table 3.2 (continued)
Name of the species Synonyms Ploidy EBN Fungus resistance Bacterial resistance Virus resistance
Status number
Late Wart Common Bacterial Soft Potato Potato Potato Spindle
blight scab wilt rot: virus virus leaf roll tuber
black X Y virus viroid
leg

Solanum hypacrarthrum
Bitter

Solanum immite Dunal S. yamobambense Ochoa 2x, 3x 1EBN (2x)

Solanum incasicum Ochoa 2x 2EBN

Solanum infundibuliforme 2x 2EBN a a

Phil

Solanum iopetalum (Bitter) S. brachycarpum (Correll) Correll 6x 4EBN a a

Hawkes

Solanum jamesii Torr 2x 1EBN a a

Solanum kurtzianum Bitter S. ruiz-lealii Brücher 2x 2EBN a a a

& Wittm

Solanum laxissimum Bitter S. neovargasii Ochoa; S. santolallae Vargas 2xx 2EBN

Solanum lesteri Hawkes & 2x

Hjert

Solanum lignicaule Vargas 2x 1EBN

History of Potato Breeding: Improvement, Diversification …

Solanum limbaniense 2x 2EBN

Ochoa

Solanum lobbianum Bitter 4x 2EBN

Solanum longiconicum 4x
Bitter

Solanum maglia Schltdl 2x, 3x

Solanum malmeanum 2x, 3x 1EBN (2x)

Bitter

Solanum medians Bitter S. arahuayum Ochoa; S. sandemanii Hawkes; S. 2x, 3x 2EBN (2x)
tacnaense Ochoa; S. weberbaueri Bitter

Solanum michoacanum 2x
(Bitter) Rydb

Solanum microdontum S. microdontum subsp. gigantophyllum (Bitter) 2x, 3x 2EBN (2x) a a a a a

Bitter Hawkes & Hjert.; S. microdontum var.
montepuncoense Ochoa

2x 1EBN

(continued)
39
Table 3.2 (continued)
40

Name of the species Synonyms Ploidy EBN Fungus resistance Bacterial resistance Virus resistance
Status number
Late Wart Common Bacterial Soft Potato Potato Potato Spindle
blight scab wilt rot: virus virus leaf roll tuber
black X Y virus viroid
leg

Solanum minutifoliolum
Correll

Solanum mochiquense S. chancayense Ochoa; S. incahuasinum Ochoa

Ochoa

Solanum morelliforme 2x a
Bitter & Muench

Solanum multiinterruptum S. chrysoflorum Ochoa; S. moniliforme Correll; S. 2x, 3x 2EBN (2x)

Bitter multiinterruptum forma albiflorum Ochoa; S.
multiinterruptum forma longipilosum
Correll; S. multiinterruptum var. machaytambinum
Ochoa

Solanum neocardenasii 2x
Hawkes & Hjert.

Solanum neorossii Hawkes 2x

& Hjert.

Solanum neovavilovii 2x 2EBN

Ochoa

Solanum 3x
neoweberbaueri Wittm.

Solanum nubicola Ochoa 4x 2EBN

Solanum okadae Hawkes 2x

& Hjert.

Solanum olmosense Ochoa 2x 2EBN

Solanum oxycarpum 4x 2EBN a

Schiede

Solanum paucissectum 2x 2EBN

Ochoa

Solanum pillahuatense 2x 2EBN

Vargas

Solanum pinnatisectum 2x 1EBN b a a a a

Dunal

Solanum piurae Bitter 2x 2EBN

(continued)
S. Sood et al.
 3
Table 3.2 (continued)
Name of the species Synonyms Ploidy EBN Fungus resistance Bacterial resistance Virus resistance
Status number
Late Wart Common Bacterial Soft Potato Potato Potato Spindle
blight scab wilt rot: virus virus leaf roll tuber
black X Y virus viroid
leg

Solanum polyadenium 2x a a a a
Greenm.

Solanum raphanifolium S. hawkesii Cárdenas 2x 2EBN a a

Cárdenas & Hawkes

Solanum raquialatum S. ingaefolium Ochoa 2x 1EBN

Ochoa

Solanum rechei Hawkes 2x, 3x

& Hjert.

Solanum 2x 2EBN
rhomboideilanceolatum
Ochoa

Solanum salasianum 2x
Ochoa

Solanum sambucinum 2x
Rydb.

Solanum scabrifolium 2x
Ochoa
History of Potato Breeding: Improvement, Diversification …

Solanum schenckii Bitter 6x 4EBN

Solanum simplicissimum 2x 1EBN

Ochoa

Solanum sogarandinum 2x, 3x 2EBN (2x)

Ochoa

Solanum stenophyllidium S. brachistotrichium (Bitter) Rydb.; S. nayaritense 2x 1EBN

Bitter (Bitter) Rydb.

Solanum stipuloideum S. circaeifolium Bitter; S. circaeifolium 2x 1EBN a a

Rusby subsp. quimense
Hawkes & Hjert.; S. capsicibaccatum Cárdenas; S.
soestii Hawkes & Hjert.

Solanum stoloniferum S. fendleri A. Gray; S. fendleri subsp. arizonicum 4x 2EBN b a a b a

Schltdl. Hawkes; S. papita Rydb.; S. polytrichon Rydb.; S.
stoloniferum subsp. moreliae Hawkes

(continued)
41
Table 3.2 (continued)
42

Name of the species Synonyms Ploidy EBN Fungus resistance Bacterial resistance Virus resistance
Status number
Late Wart Common Bacterial Soft Potato Potato Potato Spindle
blight scab wilt rot: virus virus leaf roll tuber
black X Y virus viroid
leg

Solanum tarnii Hawkes & 2x

Hjert.

Solanum trifidum Correll 2x 1EBN a a

Solanum trinitense Ochoa 2x 1EBN

Solanum vallis-mexici 3x
Juz.

Solanum venturii Hawkes 2x 2EBN

& Hjert.

Solanum vernei Bitter & S. vernei subsp. ballsii (Hawkes) 2x 2EBN a a

Wittm. Hawkes & Hjert.

Solanum verrucosum S. macropilosum Correll 2x, 3x, 2EBN (2x) a a

Schltdl. 4x

Solanum S. multiflorum Vargas; S. neovavilovii Ochoa; S. 2x 2EBN

violaceimarmoratum Bitter urubambae Juz.; S. villuspetalum Vargas

Solanum wittmackii Bitter 2x 1EBN

Solanum woodsonii 4x
Correll

Cultivated species

Solanum tuberosum L. S. tuberosum subsp. tuberosum 4x 4EBN

Chilotanum group

Solanum tuberosum S. chaucha Juz. & Bukasov; S. phureja Juz. & 2x, 3x, 2EBN (2x), a a a a a b a a
Andigenum group Bukasov; S. phureja subsp. estradae (L. López) 4x 4EBN (4x)
Hawkes; S. phureja subsp. hygrothermicum
(Ochoa) Hawkes; S. stenotomum Juz. & Bukasov; S.
stenotomum Juz. & Bukasov subsp.
goniocalyx (Juz. & Bukasov) Hawkes; S. tuberosum
subsp. andigenum Hawkes

Solanum ajanhuiri Juz. & 2x 2EBN

Bukasov

Solanum curtilobum Juz. 5x a

& Bukasov

Solanum juzepczukii Juz. 3x a

(continued)
S. Sood et al.
 3
Table 3.2 (continued)
Name of the species Synonyms Ploidy EBN Insect resistance Nematode resistance Physiological characters
Status number
Colorado Myzus Globodera Meloidgyne Frost Heat Drought No tuber
beetle persicae, rostochiensis, incognita blackening
Macrosiphum G. pallida (root knot
euphorbiae (potato cyst nematode)
(aphids) nematode)

Wild species

Solanum acaule Bitter S. acaule f. incuyo Ochoa; S. acaule var. punae 4x, 6x 2EBN a a a b a a
(Juz.) Hawkes (4x)

Solanum acroglossum Juz. 2x 2EBN

Solanum acroscopicum S. lopez-camarenae Ochoa 2x

Ochoa

Solanum aemulans Bitter S. acaule subsp. aemulans (Bitter & Wittm.) Hawkes 3x, 4x 2EBN
& Wittm. & Hjert.; S. indunii K.A. Okada & A.M. Clausen (4x)

Solanum agrimonifolium 4x 2EBN

Rydb.

Solanum albicans (Ochoa) S. acaule subsp. palmirense Kardolus 6x 4EBN

Ochoa

Solanum albornozii 2x 2EBN

Correll

Solanum amayanum 2x 2EBN

History of Potato Breeding: Improvement, Diversification …

Ochoa

Solanum anamatophilum S. peloquinianum Ochoa 2x 2EBN

Ochoa

Solanum andreanum S. burtonii Ochoa; S. correllii Ochoa; S. 2x, 4x 2EBN, a

Baker cyanophyllum Correll; S. paucijugum Bitter; S. 4EBN
regularifolium Correll; S. serratoris Ochoa; S. solisii
Hawkes; S. suffrutescens Correll; S. tuquerrense
Hawkes

Solanum augustii Ochoa 2x 1EBN

Solanum ayacuchense 2x 2EBN

Ochoa

Solanum berthaultii S. flavoviridens Ochoa; S. tarijense Hawkes; S. 2x, 3x 2EBN a a a a

Hawkes litusinum Ochoa; S. trigalense Cárdenas; S. (2x)
zudaniense Cárdenas

Solanumblanco-galdosii 2x 2EBN
Ochoa

Solanum boliviense Dunal S. astleyi Hawkes & Hjert.; S. megistacrolobum 2x 2EBN a a a

in DC Bitter; S. megistacrolobum f. purpureum Ochoa; S.
43

(continued)
Table 3.2 (continued)
44

Name of the species Synonyms Ploidy EBN Insect resistance Nematode resistance Physiological characters
Status number
Colorado Myzus Globodera Meloidgyne Frost Heat Drought No tuber
beetle persicae, rostochiensis, incognita blackening
Macrosiphum G. pallida (root knot
euphorbiae (potato cyst nematode)
(aphids) nematode)

sanctae-rosae Hawkes; S. toralapanum Cárdenas &

Hawkes

Solanum bombycinum 4x
Ochoa

Solanum brevicaule Bitter S. alandiae Cárdenas; S. avilesii Hawkes & Hjert.; S. 2x, 4x, 2 EBN a a a a
gourlayi Hawkes; S. gourlayi subsp. pachytrichum 6x (2x),
(Hawkes) Hawkes & Hjert.; S. gourlayi 4EBN
subsp. saltense A.M. Clausen & K.A. Okada; S. (4x, 6x)
gourlayi subsp. vidaurrei (Cárdenas) Hawkes &
Hjert.; S. hondelmannii Hawkes & Hjert.; S.
hoopesii Hawkes & K.A. Okada; S. incamayoense
K.A. Okada & A.M. Clausen; S. leptophyes Bitter;
S. oplocense Hawkes; S. setulosistylum Bitter; S.
sparsipilum (Bitter) Juz. & Bukasov; S. spegazzinii
Bitter; S. sucrense Hawkes; S. ugentii Hawkes & K.
A. Okada; S. virgultorum (Bitter) Cárdenas &
Hawkes; S.subandigena Hawkes;

Solanum brucheri S.viirsoii K.A. Okada & A.M. Clausen 3x

Correll

Solanum buesii Vargas 2x 2EBN

Solanum bulbocastanum S. bulbocastanum subsp. dolichophyllum (Bitter) 2x, 3x 1EBN b a a a a

Dunal in Poir Hawkes; S. bulbocastanum subsp. partitum (Correll) (2x)
Hawkes

Solanum burkartii Ochoa S. irosinum Ochoa S. irosinum forma tarrosum 2x

Ochoa

Solanum cajamarquense 2x 1EBN

Ochoa

Solanum candolleanum S. abancayense Ochoa; S. achacachense Cárdenas; 2x, 3x 2EBN a a a a a a

Berthault S. ambosinum Ochoa; S. ancoripae Ochoa; S. (2x)
antacochense Ochoa; S. aymaraesense Ochoa; S.
bill-hookeri Ochoa; S. bukasovii Juz.; S. bukasovii
var. multidissectum (Hawkes) Ochoa; S. bukasovii
forma multidissectum (Hawkes) Ochoa; S.
canasense Hawkes; S. canasense var. xerophilum
(Vargas) Hawkes; S. chillonanum Ochoa; S.

(continued)
S. Sood et al.
 3
Table 3.2 (continued)
Name of the species Synonyms Ploidy EBN Insect resistance Nematode resistance Physiological characters
Status number
Colorado Myzus Globodera Meloidgyne Frost Heat Drought No tuber
beetle persicae, rostochiensis, incognita blackening
Macrosiphum G. pallida (root knot
euphorbiae (potato cyst nematode)
(aphids) nematode)

coelestispetalum Vargas; S. hapalosum Ochoa; S.

huancavelicae Ochoa; S. longiusculus Ochoa; S.
marinasense Vargas; S. multidissectum Hawkes; S.
orophilum Correll; S. ortegae Ochoa; S. pampasense
Hawkes; S. puchupuchense Ochoa; S. sarasarae
Ochoa; S. sawyeri Ochoa; S. saxatile Ochoa; as
‘saxatilis’ S. sicuanum Hawkes; S. sparsipilum
subsp. calcense (Hawkes) Hawkes; S. tapojense
Ochoa; S. tarapatanum Ochoa; S.mollepujroense
Cárdenas & Hawkes

Solanum cantense Ochoa 2x 2EBN

Solanum cardiophyllum S. cardiophyllum subsp. lanceolatum (Berthault) 2x, 3x 1EBN a a a a

Lindl Bitter (2x)

Solanum chacoense Bitter S. arnezii Cárdenas; S. calvescens Bitter; 2x, 3x 2EBN a a a a a

S. chacoense subsp. chacoense S. chacoense (2x)
subsp. muelleri (Bitter) Hawkes; S. tuberosum
subsp. yanacochense Ochoa; (=S. yanacochense
(Ochoa) Gorbatenko; S. yungasense Hawkes
History of Potato Breeding: Improvement, Diversification …

Solanum chilliasense 2x 2EBN

Ochoa

Solanum chiquidenum S. ariduphilum Ochoa; S. chiquidenum forma 2x 2EBN

Ochoa amazonense Ochoa; S. chiquidenum var. gracile
Ochoa; S. chiquidenum var. robustum Ochoa

Solanum chomatophilum S. chomatophilum forma sausianense Ochoa; 2x 2EBN a a b

Bitter S. chomatophilum var. subnivale Ochoa;
S. huarochiriense Ochoa; S. jalcae Ochoa; S.
pascoense Ochoa; S. taulisense Ochoa

Solanum clarum Correll 2x a a a

Solanum colombianum S. cacetanum Ochoa; S. calacalinum Ochoa; S. 4x 2EBN

Dunal jaenense Ochoa; S. moscopanum Hawkes; S.
nemorosum Ochoa; S. orocense Ochoa; S. otites
Dunal; S. pamplonense L.E. López; S.
subpanduratum Ochoa; S. paramoense Bitter; S.
sucubunense Ochoa

(continued)
45
Table 3.2 (continued)
46

Name of the species Synonyms Ploidy EBN Insect resistance Nematode resistance Physiological characters
Status number
Colorado Myzus Globodera Meloidgyne Frost Heat Drought No tuber
beetle persicae, rostochiensis, incognita blackening
Macrosiphum G. pallida (root knot
euphorbiae (potato cyst nematode)
(aphids) nematode)

Solanum commersonii 2x, 3x 1EBN a a b

Dunal

Solanum contumazaense 2x 2EBN

Ochoa

Solanum demissum Lindl S. semidemissum Juz. 6x 4EBN a a a a

Solanum doddsii Correll 2x 2EBN

Solanum S. chavinense Correll; S. huanuchense Ochoa 2x 1EBN

dolichocremastrum Bitter

Solanum edinense S.edinense subsp. salamanii (Hawkes) Hawkes 5x a

Berthault

Solanum ehrenbergii S. cardiophyllum subsp. ehrenbergii Bitter 2x 1EBN

(Bitter) Rydb

Solanum flahaultii Bitter S. neovalenzuelae L.E.López 4x

Solanum gandarillasii 2x 2EBN

Cárdenas

Solanum garcia-barrigae S. donachui (Ochoa) Ochoa 4x

Ochoa

Solanum gracilifrons 2x
Bitter

Solanum guerreroense 6x 4EBN

Correll

Solanum hastiforme 2x 2EBN

Correll

Solanum hintonii Correll 2x

Solanum hjertingii S. hjertingii var. physaloides (Correll) Hawkes; 4x 2EBN a

Hawkes S. leptosepalum Correll; S. matehualae Hjert. & T.R.
Tarn

Solanum hougasii Correll 6x 4EBN

(continued)
S. Sood et al.
 3
Table 3.2 (continued)
Name of the species Synonyms Ploidy EBN Insect resistance Nematode resistance Physiological characters
Status number
Colorado Myzus Globodera Meloidgyne Frost Heat Drought No tuber
beetle persicae, rostochiensis, incognita blackening
Macrosiphum G. pallida (root knot
euphorbiae (potato cyst nematode)
(aphids) nematode)

Solanum huancabambense 2x 2EBN

Ochoa

Solanum humectophilum 2x 1EBN

Ochoa

Solanum hypacrarthrum S. guzmanguense Whalen & Sagást. 2x 1EBN

Bitter

Solanum immite Dunal S. yamobambense Ochoa 2x, 3x 1EBN

(2x)

Solanum incasicum Ochoa 2x 2EBN

Solanum infundibuliforme 2x 2EBN a a a

Phil

Solanum iopetalum (Bitter) S. brachycarpum (Correll) Correll 6x 4EBN a a a a

Hawkes

Solanum jamesii Torr 2x 1EBN a a

Solanum kurtzianum Bitter S. ruiz-lealii Brücher 2x 2EBN a a a a a a

History of Potato Breeding: Improvement, Diversification …

& Wittm

Solanum laxissimum Bitter S. neovargasii Ochoa; S. santolallae Vargas 2x 2EBN

Solanum lesteri Hawkes & 2x

Hjert

Solanum lignicaule Vargas 2x 1EBN a

Solanum limbaniense 2x 2EBN

Ochoa

Solanum lobbianum Bitter 4x 2EBN

Solanum longiconicum 4x
Bitter

Solanum maglia Schltdl 2x, 3x

Solanum malmeanum 2x, 3x 1EBN

Bitter (2x)

Solanum medians Bitter S. arahuayum Ochoa; S. sandemanii Hawkes; S. 2x, 3x 2EBN a

tacnaense Ochoa; S. weberbaueri Bitter (2x)

(continued)
47
Table 3.2 (continued)
48

Name of the species Synonyms Ploidy EBN Insect resistance Nematode resistance Physiological characters
Status number
Colorado Myzus Globodera Meloidgyne Frost Heat Drought No tuber
beetle persicae, rostochiensis, incognita blackening
Macrosiphum G. pallida (root knot
euphorbiae (potato cyst nematode)
(aphids) nematode)

Solanum michoacanum 2x
(Bitter) Rydb

Solanum microdontum S. microdontum subsp. gigantophyllum (Bitter) 2x, 3x 2EBN a a a a

Bitter Hawkes & Hjert.; S. microdontum var. (2x)
montepuncoense Ochoa

Solanum minutifoliolum 2x 1EBN

Correll

Solanum mochiquense S. chancayense Ochoa; S. incahuasinum Ochoa

Ochoa

Solanum morelliforme 2x a a
Bitter & Muench

Solanum multiinterruptum S. chrysoflorum Ochoa; S. moniliforme Correll; S. 2x, 3x 2EBN

Bitter multiinterruptum forma albiflorum Ochoa; S. (2x)
multiinterruptum forma longipilosum
Correll; S. multiinterruptum var. machaytambinum
Ochoa

Solanum neocardenasii 2x
Hawkes & Hjert.

Solanum neorossii Hawkes 2x

& Hjert.

Solanum neovavilovii 2x 2EBN

Ochoa

Solanum 3x
neoweberbaueri Wittm.

Solanum nubicola Ochoa 4x 2EBN

Solanum okadae Hawkes 2x

& Hjert.

Solanum olmosense Ochoa 2x 2EBN

Solanum oxycarpum 4x 2EBN a

Schiede

Solanum paucissectum 2x 2EBN

Ochoa

(continued)
S. Sood et al.
 3
Table 3.2 (continued)
Name of the species Synonyms Ploidy EBN Insect resistance Nematode resistance Physiological characters
Status number
Colorado Myzus Globodera Meloidgyne Frost Heat Drought No tuber
beetle persicae, rostochiensis, incognita blackening
Macrosiphum G. pallida (root knot
euphorbiae (potato cyst nematode)
(aphids) nematode)

Solanum pillahuatense 2x 2EBN

Vargas

Solanum pinnatisectum 2x 1EBN a a a a

Dunal

Solanum piurae Bitter 2x 2EBN

Solanum polyadenium 2x a a a a a a a
Greenm.

Solanum raphanifolium S. hawkesii Cárdenas 2x 2EBN a a a a

Cárdenas & Hawkes

Solanum raquialatum S. ingaefolium Ochoa 2x 1EBN

Ochoa

Solanum rechei Hawkes 2x, 3x

& Hjert.

Solanum 2x 2EBN
rhomboideilanceolatum
Ochoa
History of Potato Breeding: Improvement, Diversification …

Solanum salasianum 2x
Ochoa

Solanum sambucinum 2x
Rydb.

Solanum scabrifolium 2x
Ochoa

Solanum schenckii Bitter 6x 4EBN

Solanum simplicissimum 2x 1EBN

Ochoa

Solanum sogarandinum 2x, 3x 2EBN

Ochoa (2x)

Solanum stenophyllidium S. brachistotrichium (Bitter) Rydb.; S. nayaritense 2x 1EBN a

Bitter (Bitter) Rydb.

Solanum stipuloideum S. circaeifolium Bitter; S. circaeifolium 2x 1EBN a a a a

Rusby subsp. quimense

(continued)
49
Table 3.2 (continued)
50

Name of the species Synonyms Ploidy EBN Insect resistance Nematode resistance Physiological characters
Status number
Colorado Myzus Globodera Meloidgyne Frost Heat Drought No tuber
beetle persicae, rostochiensis, incognita blackening
Macrosiphum G. pallida (root knot
euphorbiae (potato cyst nematode)
(aphids) nematode)

Hawkes & Hjert.; S. capsicibaccatum Cárdenas; S.

soestii Hawkes & Hjert.

Solanum stoloniferum S. fendleri A. Gray; S. fendleri subsp. arizonicum 4x 2EBN a a a a a a

Schltdl. Hawkes; S. papita Rydb.; S. polytrichon Rydb.; S.
stoloniferum subsp. moreliae Hawkes

Solanum tarnii Hawkes & 2x

Hjert.

Solanum trifidum Correll 2x 1EBN a a a

Solanum trinitense Ochoa 2x 1EBN

Solanum vallis-mexici 3x
Juz.

Solanum venturii Hawkes 2x 2EBN

& Hjert.

Solanum vernei Bitter & S. vernei subsp. ballsii (Hawkes) 2x 2EBN a a a b a a

Wittm. Hawkes & Hjert.

Solanum verrucosum S. macropilosum Correll 2x, 3x, 2EBN a a a a

Schltdl. 4x (2x)

Solanum S. multiflorum Vargas; S. neovavilovii Ochoa; S. 2x 2EBN a

violaceimarmoratum Bitter urubambae Juz.; S. villuspetalum Vargas

Solanum wittmackii Bitter 2x 1EBN

Solanum woodsonii 4x
Correll

Cultivated species

Solanum tuberosum L. S. tuberosum subsp. tuberosum 4x 4EBN

Chilotanum group

Solanum tuberosum S. chaucha Juz. & Bukasov; S. phureja Juz. & 2x, 3x, 2EBN a a a a a
Andigenum group Bukasov; S. phureja subsp. estradae (L. López) 4x (2x),
Hawkes; S. phureja subsp. hygrothermicum 4EBN
(Ochoa) Hawkes; S. stenotomum Juz. & Bukasov; S. (4x)
stenotomum Juz. & Bukasov subsp.
goniocalyx (Juz. & Bukasov) Hawkes; S. tuberosum
subsp. andigenum Hawkes

(continued)
S. Sood et al.
 3
Table 3.2 (continued)
Name of the species Synonyms Ploidy EBN Insect resistance Nematode resistance Physiological characters
Status number
Colorado Myzus Globodera Meloidgyne Frost Heat Drought No tuber
beetle persicae, rostochiensis, incognita blackening
Macrosiphum G. pallida (root knot
euphorbiae (potato cyst nematode)
(aphids) nematode)

Solanum ajanhuiri Juz. & 2x 2EBN a a

Bukasov

Solanum curtilobum Juz. 5x a a a

& Bukasov

Solanum juzepczukii Juz. 3x a

Adapted from Spooner et al. (2014), Machida-Hirano (2015)

a
Species include individuals possessing resistance, tolerance, or good quality. The resistance/tolerance mentioned in this table is based on the information available for the particular species
b
Species includes individuals possessing immunity, high resistance, high tolerance, or high quality
History of Potato Breeding: Improvement, Diversification …
51
52 S. Sood et al.

Table 3.3 List of holders Name of institute Accessions Types of accession (%)
of ex situ collections of
potato germplasm No. Percent WS LR BL AC OT
(Solanum sp.) INRA-RENNES, 10,461 11 6 2 84 8 –
France
VIR, Russian 8889 9 46 3 26 25
Federation
CIP, Peru 7450 8 2 69 2 <1 27
IPK, Germany 5392 5 18 37 7 32 6
NR6, the USA 5277 5 65 21 9 5 <1
NIAS, Japan 3408 3 3 1 31 65
CORPOICA, Colombia 3043 3 100
CPRI, India 2710 3 15 85
BNGTRA-PROINPA, 2393 2 26 74
Bolivia
HBROD, Czech 2207 2 5 1 29 52 13
Republic
BAL, Argentina 1739 2 85 15
CNPH, Brazil 1735 2 100
SASA, the UK 1671 2 100
ROPTA, The 1610 2 3 1 1 95
Netherland
PNP-INIFAP, Mexico 1500 2 100
TARI, Taiwan 1282 1 100
SamAI, Uzbekistan 1223 1 100
IPRBON, Poland 1182 1 8 92
RIPV, Kazakhstan 1117 1 26 2 15 57
SVKLOMNICA, 1080 1 1 2 47 41 9
Slovakia
Others (154) 32,916 33 19 15 3 16 46
Total 98285 100 15 20 16 14 35
WS wild species, LR landraces/old cultivars, BL research materials/breeding lines, AC
advanced cultivars, OT (others), the types are unknown or a mixture of two or more
types. Adapted from Machida-Hirano (2015)

landraces and cultivars. There is no crossability
barrier within the primary genepool. The sec-
ondary gene pool consists of wild species that
can be sexually crossed with cultivated species
through manipulation of ploidy levels or modi-
fications of breeding techniques. The potato
secondary gene pool consists of around 200 wild
tuber-bearing species. Solanum demissum is one
example of a secondary gene pool which has
been widely used for late blight resistance. The
tertiary gene pool includes those wild species
that are distantly related to the cultivated
crop. Due to cross-incompatibilities, wild species
in the tertiary gene pool are sexually isolated
from the cultivated crop. Thus, the genes avail-
able in the tertiary gene pool are not normally
accessible to plant breeders. The tertiary gene
pool consists of 18–20 diploid species. One ter-
tiary gene pool species, S. bulbocastanum, has
long been recognized as a source of potentially
durable late blight-resistant genes (Graham et al.
1959).
Even though potato breeders have been
experimenting with the introduction of wild
3 History of Potato Breeding: Improvement, Diversification …
relatives into their programs for more than
150 years, the genetic diversity within and
among major cultivars remains low (Wang et al.
2011). While the introgression of a few specific
genes from wild species has had a significant
impact on cultivar development, only a handful
of species have been used extensively (Bradshaw
et al. 2006). These include S. acaule, S. cha-
coense, S. demissum, S. brevicaule, S. stoloni-
ferum, and S. vernei, mainly as sources of major
genes for resistance to late blight, viruses, and
potato cyst nematodes. Although not developed
as a processing cultivar, ‘Lenape’ containing
genes from S. chacoense, is in the pedigree of
many modern chip cultivars and is credited with
contributing to major advances in breeding for
chip quality in the late twentieth century (Love
et al. 1998). ‘Lenape’ was removed from the
market, however, due to excessive levels of
glycoalkaloids in its tubers, likely coming from
S. chacoense (Zitnak and Johnston 1970). This
example illustrates the need for germplasm
enhancement programmes to carry out compre-
hensive evaluations of their products to avoid the
inclusion of undesirable properties in eventual
varieties. To broaden the genetic base of the
common potato gene pool and to combine dif-
ferent resistance genes introgressed from wild
potato species, various methods have been used,
including ploidy manipulations and bridge
crosses, embryo rescue, hormone treatments,
reciprocal crosses and protoplast fusion (Jansky
2006). The range of sexual hybridization has
been broadened using biotechnological methods
that allowed the use of new species that have
never been used before in breeding programmes,
such as species outside of section Petota
(S. etuberosum, S. palustre, S. nigrum), and
species in section Petota but in a clade distantly
related to cultivated potatoes (S. tarnii, S. car-
diophyllum, S. bulbocastanum) (Gavrilenko
2007). Direct genetic transfer of genes from wild
potatoes into existing widely adopted varieties is
another tool available to breeders. The current
development of late blight-resistant varieties
using genes from S. bulbocastanum is an exam-
ple of the short cut breeders can use instead of
the 45 years it took from the original bridge
53
crosses between cultivated and wild species to
introduce useful traits (Haverkort et al. 2009).
However, public resistance to genetically modi-
fied organisms is still delaying the full exploita-
tion of such direct transfer. Breeding tetraploid
potatoes is a challenge due to the heterozygous
nature of the parents used in breeding. Selfing
produces severe inbreeding depression in pota-
toes and has impeded the elimination of unfa-
vourable alleles and the fixation of alleles
responsible for important traits. Wild potatoes
can be a genetic source of a self-compatible
breeding system that can revolutionize potato
breeding through the development of hybrid
potatoes from diploid inbred lines (Lindhout
et al. 2011).
3.5 Reproductive Biology
and Overcoming Hybridization
Barriers in the Potato
Potatoes have a basic chromosome number of 12
and the majority of species are diploid. Culti-
vated potatoes are mostly auto-tetraploid (2n =
4x = 48) and few diploids (2n = 2x = 24), while
several other ploidy levels from diploid
(2n = 2x = 24) to hexaploid (2n = 6x = 72) exist
in nature. Because of its ability to reproduce
asexually, stable triploid and pentaploid popula-
tions are possible in the potato. In order to use
the wealth of genetic resources in potato,
breeders and geneticists must first understand the
causes of interspecific hybridization failure. They
can then devise strategies to overcome these
problems (Jansky 2006).
3.5.1 Self-Incompatibility
While diploid potatoes are generally
self-incompatible, Solanum tuberosum and other
cultivated species are self-compatible due to a
phenomenon called “competition interaction”
because of certain interactions that either weaken
or suppress the incompatibility reaction in pollen
grains carrying different S alleles (Frankel and
Galun 1977). Almost all diploid species are
54
self-incompatible due to a gametophytically
controlled system (Swaminathan and Howard
1953). A highly polymorphic locus called the S
gene, expressed in pollen tubes as they grow
through the style, prevents the fertilization of an
egg cell by a sperm cell of the same genotype.
Genetic systems that overcome self-
incompatibility have been reported in two
germplasm sources of diploid potato. Hybrids
between cultivated diploid potatoes and
S. tuberosum haploid (US-W4) were reported to
be self-compatible due to the action of a domi-
nant self-incompatibility inhibitor in US-W4 (De
Jong and Rowe 1971). Similarly, a dominant
self-incompatibility inhibitor (Sli) has been
reported in the wild diploid species S. chacoense
(Hosaka and Hanneman 1998a). This gene has
been mapped to the distal end of chromosome 12
(Hosaka and Hanneman 1998b). The Sli gene is
independent of the S locus, which maps to
chromosome 1 (Tanksley and Loaiza-Figueroa
1985). The Sli gene has been transferred to sev-
eral diploid genotypes, allowing them to
self-pollinate (Phumichai et al. 2006). This could
revolutionize potato breeding at the diploid level.
3.5.2 Unilateral Incompatibility
Unilateral incompatibility is a phenomenon
where self-compatible species can be crossed as
female but not as a male, to self-incompatible
species. Dinu et al. (2005) found that S. verru-
cosum could be crossed as a female but not as a
male to self-incompatible species. It has been
reported that some exceptional plants do not
exhibit unilateral incompatibility, e.g. excep-
tional plants that accept S. verrucosum pollen
and produce fertile hybrids have been reported
(Eijlander et al. 2000).
3.5.3 Male Sterility
Male sterility due to deleterious nuclear genes is
common in cultivated potato. Since the mar-
ketable product is not seed, there is no selection
pressure for high fertility in breeding
S. Sood et al.
programmes. Potatoes also exhibit sterility due to
interaction between cytoplasmic genes and
nuclear genes. Levels of cytoplasmic genetic
male sterility are frequently variable, presumably
due to genetic and environmental influences.
This type of sterility can be overcome through
reciprocal crosses, or selecting parents that do
not contain sensitive cytoplasm or dominant
nuclear sterility genes (Iwanaga et al. 1991).
Besides, fertility restorer genes may be identified.
3.5.4 2n Gametes
Most polyploidy crop plants originated from the
union of numerically unreduced gametes (2n).
These gametes are produced in plants carrying
meiotic mutations. 2n gametes originate from
meiotic aberrations. Two main categories of
2n gamete formation are: first division restitution
(FDR), and second division restitution (SDR).
Besides these two main categories, several other
meiotic aberrations exist where the final chro-
mosome constitution in the microspores is
equivalent to the FDR or SDR pathways. 2n ga-
metes have been used to create new cultivars at
higher ploidy levels as well as creating a bridge
to transfer desirable genes from wild diploid
species into the cultivated polyploid gene pool
(Carputo et al. 2000). Although 2n gametes have
been documented in several genera, they have
been extensively investigated in potato (Peloquin
et al. 1999). Ploidy manipulations have been
used in potato (S. tuberosum) breeding for many
decades. Cultivated potatoes are tetraploid but
most wild species are diploid. Haploidization
techniques can create dihaploids from cultivated
potatoes. Via a series of hybridizations between
selected dihaploids and 2x species, desirable
agronomic traits from wild and closely related
species can be captured. These dihaploids (pro-
ducing 2n gametes) can then be introduced to
tetraploids via interploidy crosses between
2x and 4x plants. The most successful breeding
scheme for potatoes involves obtaining
4x progeny from 4x to 2x crosses, where the
2x parent forms 2n pollen via the meiotic mutant
ps (Peloquin et al. 1999). Several ploidy series
3 History of Potato Breeding: Improvement, Diversification …
have been developed in potato by using hap-
loidization and sexual polyploidization tech-
niques, ranging from the monoploid to the
hexaploid level (Carputo and Barone 2005).
Unilateral sexual polyploidization (USP) is
one of the most effective breeding techniques for
the capture of exotic genetic diversity, in which a
4x (4EBN) Tuberosum Group plant is crossed
with a 2x (2EBN) plant that produces 2n pollen or
2n eggs. The diploid plant is typically a Tubero-
sum Group haploid  wild species hybrid or a
Phureja or Stenotomum Group plant  Tubero-
sum Group haploid. One of the earliest examples
of USP was outlined by Hanneman and Peloquin
(1967) using 2x (2EBN) hybrids containing
Phureja Group, Stenotomum Group, Andigena
Group and Tuberosum Group, as well as the
2x (2EBN) species S. chacoense. Tetraploid
hybrids were produced following USP with
diploid 2n gamete-producing plants as male and
female parents. There are many examples of the
use of the USP scheme to transfer genetic diver-
sity and valuable traits from diploid hybrids to the
tetraploid level (Murphy et al. 1995; Capo et al.
2002; Buso et al. 2003; Sterrett et al. 2003;
Hanneman and Peloquin 1967). The USP scheme
can also be used to directly access 2x (2EBN)
species. For example, Raimondi and Camadro
(2003) were able to produce tetraploid offspring
from 4x (4EBN) Tuberosum Group  2x (2EBN)
S. kurtzianum crosses in both directions because
the S. kurtzianum parent produced both 2n eggs
and 2n pollen. Jackson and Hanneman (1999)
also created a number of tetraploid hybrids from
crosses between Tuberosum Group cultivars and
diploid wild species. Bilateral sexual poly-
ploidization (BSP) provides an alternative to
USP. In this scheme, both parents are diploid and
produce 2n gametes. Tetraploid progeny from
BSP are highly heterotic and typically outyield
their diploid full-sibs (Mendibuni and Peloquin
1977) and commercial cultivars (Werner and
Peloquin 1991). In contrast, tetraploids produced
by somatic doubling of diploids do not exhibit a
yield increase, because additional inter- and
intra-locus interactions have not been created (Tai
and De Jong 1997). Somatic doubling can
55
produce only one type of heterozygote (duplex)
and a maximum of two alleles per locus, while
sexual polyploidization can produce three types
of heterozygotes (simplex, duplex and triplex)
and up to four alleles per locus. In addition, a
wider array of complex epistatic (inter-locus)
interactions results following sexual poly-
ploidization (Jansky 2006).
3.5.5 Endosperm Balance Number
(EBN)
The hypothesis of the endosperm balance num-
ber (EBN) was first developed to explain the
basis of normal seed development after intra- and
inter-specific crosses first in potato and then in
several other crop species. Johnston et al. (1980)
described it to predict the crossability of potato
species. This model suggests that each potato
species has associated with it a characteristic
EBN ranging from 1 to 4. The EBN defines
crossability between species such that successful
cross-species hybridization requires a 2:1 ratio of
maternal: paternal genetic contribution to the
developing endosperm. This ratio is obtained
when the two parents/species have matched
EBNs. Manipulating ploidy levels also alters the
EBN, thus providing a mechanism for successful
crosses where the EBN does not match.
The EBN numbers of different species were
experimentally assigned after crosses with stan-
dard species with S. chacoense, whose EBN was
arbitrarily established and assuming the 2:1
genomic dosage ratio as a prerequisite for normal
endosperm development. The S. chacoense
(2n = 24) was assigned an EBN of 2 by Johnston
and Hanneman (1980). All species which resul-
ted in successful crosses with S. chacoense were
also assigned an EBN of 2. Thus, if the species
with same EBN are crossed, the maternal to
paternal EBN ratio in the developing endosperm
will always be 2:1 regardless of the parental
ploidy and direction of the cross. Although the
genetic basis of EBN system has not been fully
elucidated, this model has been widely used by
potato breeders and researchers.
56
3.5.6 Dihaploids
Dihaploids of tetraploid potato cultivars provide
a mechanism for direct gene transfer from wild
2x relatives and provide the opportunity to work
at the diploid level in potato. Selection progress
is more rapid in diploids than tetraploids. Hap-
loids can be produced from tetraploid cultivars
and breeding clones via parthenogenesis (Hougas
and Peloquin 1957). When a tetraploid is crossed
with any of several selected diploid clones, some
of the offspring are diploid. As a result of seg-
regation, haploids may express traits that were
not found in their tetraploid parents. Haploid
populations have been used to characterize the
genetic basis of the total tuber yield, the average
tuber weight, the tuber number, dry matter con-
tent, tuber dormancy, vine maturity, and the tuber
glucose levels (Kotch et al. 1992). Tetraploid
potatoes are typically more vigorous and higher
yielding than their haploid offspring (Peloquin
and Hougas 1960; DeMaine 1984; Kotch and
Peloquin 1987). The loss of vigour and yield in
haploids is due to ploidy reduction and inbreed-
ing depression. The magnitude of this loss at the
diploid level differs, depending on the tetraploid
clone from which the haploids were derived
(Kotch and Peloquin 1987). In order to overcome
reproductive barriers to bridge crosses, mentor
pollination, embryo rescue, hormone treatment,
reciprocal crosses, cross-compatible genotypes
and somatic fusion have also been used in potato.
These approaches have been discussed in detail
by Jansky (2006).
3.6 History of Breeding
and Cultivars Development
in Potato
The first report of directed breeding in potato
through hybridization between cultivars was
made in the early nineteenth century (Knight
1807). Many new cultivars were produced by
farmers, hobby breeders and seeds men later. At
least two Chilean Tuberosum introductions were
used in breeding in the nineteenth century. The
cultivar Daber was introduced into Germany in
S. Sood et al.
1830, most probably from Chile (Plaisted and
Hoopes 1989), and likewise the cultivar Rough
Purple Chili was introduced into the USA in
1851 (Goodrich 1863). North America’s most
popular potato cultivar, Russet Burbank, was
derived from it by three generations of open
pollination with selection and released in 1914
(Ortiz 2001). The descendents of Rough Purple
Chili were widely employed as female parents in
crosses with European Tuberosum at the end of
the nineteenth century, and Chilean Tuberosum
cytoplasm predominates in modern cultivars.
Modern potato breeding started later in the 1930s
in China and India, and now these countries are
two of the leading potato producers in the world
(Gaur and Pandey 2000; Jin et al. 2004). The
extent of progress since 1807 can be judged by
the latest World Catalogue of Potato Varieties
(Hils and Pieterse 2005), which lists over 4000
cultivars from more than 100 countries, a
remarkable achievement for a crop which outside
of Latin America was derived from a narrow
genetic base. Although these present-day culti-
vars are the foundation for future breeding,
breeders should also seek to make full use of the
diversity that exists in native Latin American
cultivars and their cross-compatible wild
relatives.
During the second half of the twentieth cen-
tury, recognition was given to the narrow genetic
base of European and North American breeding
programmes and CIP also recognized the need to
make broad-based germplasm from South
America available to National Programmes in
developing countries, particularly germplasm
with durable resistance to late blight. Attempts
were made to widen the genetic base of European
and North American potatoes through the creation
of broadly based populations of long-day-adapted
S. tuberosum subsp. andigena (Neotuberosum)
and long-day-adapted S. phureja/S. stenotomum.
Since the first experiment started by Simmonds in
1959 (Simmonds 1969), a number of programmes
worldwide have demonstrated that, through sim-
ple mass selection under northern latitudes, in
long-day summer conditions, subsp. andigena
will adapt and produce parents suitable for direct
incorporation into modern potato breeding
3 History of Potato Breeding: Improvement, Diversification …
programmes (Bradshaw and Mackay 1994).
Furthermore, under long days, Tuberosum
long-day Andigena/Neotuberosum hybrids have
shown yield advantages of 13–17% over
Tuberosum-Tuberosum hybrids (Tarn and Tai
1983; Maris 1989), but it appears that the extent
of heterotic advantage is dependent on day length
(Cubillos and Plaisted 1976). Likewise, during
the period 1962–1979, Carroll (1982) employed a
mass selection method to produce a population of
S. phureja/S. stenotomum adapted to long-day
Northern European conditions. Direct hybridiza-
tion of members of this improved diploid popu-
lation with tetraploid potato cultivars via
unreduced pollen grains (4x–2x crosses) resulted
in tetraploid hybrids, some of which were supe-
rior to standard tetraploid cultivars in both total
and marketable yield (Carroll and De Maine
1989). Similar work has been done in North
America (Plaisted and Hoopes 1989; Haynes and
Christ 1999; Haynes and Lu 2005). The tetraploid
offspring from Tuberosum (4x)-Tuberosum/
Phureja hybrids (2x) have shown yield advan-
tages of 27% over their 4x parents and controls
(Tai and De Jong 1980), but in a later study (Buso
et al. 1999), a 15% yield advantage occurred only
in the higher yielding of two environments.
Bonierbale et al. (1993) found that specific com-
binations of individual marker fragments were
more important than maximum heterozygosity for
tuber yield heterosis in Tuberosum, Neotubero-
sum and Phureja germplasm.
However, to date, relatively few clones of
Neotuberosum and long-day S. phureja/S. steno-
tomum have been used to any extent in the
breeding of modern cultivars. Part of the reason
for this is that while adaptation to tubering in
long days was quickly achieved, other problems
remained. Neotuberosum clones lacked the reg-
ularity of tuber shape of intensively selected
subsp. tuberosum clones, and long-day-adapted
S. phureja clones lacked tuber dormancy. Hence
these populations need, and are receiving,
selection for further improvements in order to
achieve the original goal of direct use as parents
in breeding finished cultivars (i.e., contributing
50% of their genes to their offspring, or 25% in
57
backcrosses), as suggested by Tai (1994) for
S. phureja-based 2x parents.
Probably the best-known, broad-based germ-
plasm from CIP’s breeders are the B populations
which they have developed from 1988 onwards.
The aim was to help the development of
improved cultivars for a wide range of environ-
ments that possess high and stable levels of
resistance to late blight in combination with
resistance to viruses and suitable culinary and
processing quality (Trognitz et al. 2001; Landeo
2002). Briefly, there were three groups of material
differing in their genetic base and degree of
enhancement. GroupB1 was native cultivated
forms of short-day-adapted S. tuberosum
subsp. andigena lacking the major R genes which
had failed to give durable resistance, GroupB2
comprised crosses of the subsp. andigena clones
with subsp. tuberosum clones that also lacked R
genes, and GroupB3 comprised subsp. tuberosum
germplasm with S. demissum derived resistance,
subsp. andigena, Neotuberosum and complex
hybrids of S. acaule and S. bulbocastanum with
S. phureja and S. tuberosum subsp. tuberosum.
The breeding involved recurrent selection for
quantitative resistance to late blight and other
desirable traits together with selection in those
geographical areas where the new cultivars were
to be grown, for example, in East Africa (Mulema
et al. 2004). Clones with good general combining
ability were also identified for use as parents in
the local breeding programmes of the National
Agricultural Research Systems (NARS) in
developing countries.
Conventionally, potato breeding has been
restricted to the members of the cultivated
tuberosum accessions. Choice of a parent is most
often based on its de facto phenotypic expression
of the characters of interest. Normally breeders
try to pick pairs of clones/varieties for
inter-mating based on complementary sets of
characters with desirable levels of expression.
The ideal strategy would be to identify the
superior parents based on their general combin-
ing ability and inter-mating them in all feasible
combinations to select a few top combinations
based on progeny test. This is followed by
58
selection over successive generations for yield
and other desirable traits (Bradshaw and Mackay
1994). S. tuberosum is known to have a narrow
genetic base and little improvement is observed
in tuber yield among the recombinants produced
by crossing among tuberosum parental clones.
To overcome these problems, attempts were
made in Europe and North America (where the
crop is grown under temperate long days) to use
andigena in potato breeding programmes. But the
short-day requirement for the tuberization of
andigena resulted in the poor performance of
tuberosum  andigena progenies. However, the
use of andigena pre-selected for long days, in
crosses with tuberosum led to progenies yielding
higher than tuberosum  tuberosum progenies.
Due to the plasticity of various causal organisms
responsible for a number of maladies in potato,
new pathotypes mainly through mutations keep
on emerging in nature. The situation is further
aggravated by the cultivation of resistant mono-
cultures on a large scale, rendering the available
resistant varieties infructuous. This phenomenon
makes the breeding of resistant varieties against
the biotic stresses a continuous process (She-
khawat et al. 2000). The breeding of new vari-
eties, therefore, always requires the search of
new/appropriate genes obtaining resistance from
wild/semi-cultivated species and their introgres-
sion into a suitable agronomically superior
background. In a number of instances, however,
resistant genes are not available and in that case,
biotechnological interventions in conjunction
with conventional breeding techniques can be
useful in transferring resistance across the spe-
cies, genera, families, etc.
3.7 Trait-Specific Breeding
in Potato
3.7.1 Breeding for Late Blight
Resistance
Late blight caused by Phytophthora infestans is
highly variable and is an important disease
attracting worldwide attention in potato
(Bhardwaj et al. 2005). Although the use of
S. Sood et al.
disease-free seeds and fungicide has controlled
damage in potato production worldwide (Fry
2007; Struik and Wiersema 1999), late blight
remains the primary disease. Dominant resistance
genes were initially identified in the Mexican
wild species S. demissum and introgressed by
crossing and backcrossing into cultivated potato.
Towards the end of twentieth century, the racial
complexity had reached its peak in most coun-
tries. The fungus had developed virulences
against almost all the known R-genes in potato.
S. stoloniferum has also been found to possess
similar, if not identical, resistance genes. How-
ever, the R-genes, wherever deployed, were
defeated in due course of time. In India, the
process of transfer of R-genes from the S. de-
missum background started in the mid-1950s and
the first set of late blight-resistant varieties was
released for commercial cultivation in 1968. Of
these, cv. Kufri Jyoti (possessing R-genes 3,4,7)
became the most popular, which is still grown in
several parts of the country. Since then a lot of
varieties carrying R-genes have been bred and
deployed across the country (Joseph et al. 2006,
2007, 2011). After the defeat of R-genes origi-
nated from S. demissum, the search for other
resistance sources became more urgent. So the
interest of researchers and potato breeders was
oriented to other potato wild species than S.
demissum. A multitude of Rpi-genes were dis-
covered and from a diversity of wild species: S.
bulbocastanum, S. stoloniferum, S. phureja, S.
verrucosum, S. schenckii, S. venturii, a total of
more than 20 R genes were isolated and cloned.
Strategies to prevent rapid evolution of com-
patible races have been proposed. R-gene pyra-
mids, combining multiple resistance genes
isolated from diverse sources, seem to be a
promising strategy for durable and broad spec-
trum resistance against LB (Haverkort et al.
2009; Kim et al. 2012; Tan et al. 2010). In recent
years, the development of durable and extreme
resistance to late blight disease, using resistance
genes from several wild potato species collected
from Central America and Andean South
America has been attempted.
Race non-specific resistance is a quantitative
and multifaceted trait, probably governed by
3 History of Potato Breeding: Improvement, Diversification …
many genes. Although, at the phenotypic level,
both types of resistance can easily be identified,
at the genotypic level, they are almost similar.
Genetic analysis of resistance to late blight using
DNA markers showed that major genes for
resistance (the R-genes) are closely linked to the
factors controlling quantitative resistance, sug-
gesting that there is no real difference between
qualitative and quantitative resistance to late
blight as far as the nature of the genes involved.
All late blight R-genes identified so far encoded
nucleotide-binding leucine-rich repeat region
(NB-LRR) proteins. These proteins are located
intracellularly and serve as specific receptors for
P. infestans effector proteins (also known as
avirulence (Avr) proteins) that are deposited in
the host cytoplasm. P. infestans has been shown
to be able to rapidly break resistance based on a
single R-gene. This is because mutations that
avoid the recognition of the P. infestans effector
can easily happen in the natural diversity or by
genetic systems of the pathogen. To impose
incremental hurdles for the pathogen, a stack
with several R-genes needed to be transferred.
Through virulence monitoring in the field, the
efficacy of the R-gene stack is followed to
ascertain long-term durability of the resistance
(Haverkort et al. 2016). Simple sequence repeats
(SSR) markers have been used for the develop-
ment of a molecular map of the diploid wild
species Solanum chacoense and identification of
major quantitative trait loci (QTLs) for late blight
resistance (Chakrabarti et al. 2014). Attempts are
in progress to isolate novel genes for late blight
within these QTLs and develop molecular mark-
ers. Furthermore, the type of resistance deployed
in the present and future cultivars can be better
planned using marker assisted selection (MAS).
Transgenes (genes transferred over distant
species) for late blight resistance have the capacity
to revolutionize the present scenario around the
world to develop resistant potato varieties. In
contrast, cisgenes which involve transfer of genes
within the same species or plant family may be
considered safer in genetically modified crops.
Developing cisgenic potato varieties may be a
significant way to breach the worldwide public
59
criticism on use of GM crops. ‘Fortuna’ is a GM
potato variety, having two resistance genes,
namely, Rpi-blb1 and Rpi-blb2 from Solanum
bulbocastanum (Vleeshouwers et al. 2011). Zhu
et al. (2012) succeeded in introducing three wide
spectrum R-genes into Desiree: Rpi-sto1 from S.
stoloniferum, Rpi-vnt1 from S. venturii, and Rpi-
blb3 from S. bulbocastanum. The resulting resis-
tance was the sum of the individual R-genes’
effects. The potato cultivar with the most durable
resistance against P. infestans, Sarpo Mira, carries
at least five R-genes (R3a, R3b, R4, Rpi- Smira1,
and Rpi-Smira2) that confer qualitative and
quantitative resistance. Another approach is RNA
interference (RNAi), which is an evolutionarily
conserved and universal gene regulation mecha-
nism in eukaryotes, whereby sequence-specific
ribonucleic acid (RNA) degradation takes place.
The RNA-based gene silencing in plants is
achieved by small RNAs of 20–30 nucleotides
processed through long dsRNA hairpin molecules
that guide the sequence-specific repression of
target gene or genes of interest.
3.7.2 Breeding for Resistance Against
Viruses
Viral diseases are an important constraint on
potato crops because of their systemic distribu-
tion in the host and are mainly responsible for the
degeneration of seed stocks (Khurana 2008;
Jeffries et al. 2006). At least 12 viral diseases are
known to infect potato crops in India and else-
where. Among them, PVX, PVY, PVS, PVA,
PVM, leaf roll (PLRV) and apical leaf curl
viruses (PALCV) are important. Introducing
resistant cultivars is one of the most efficient
ways of reducing the losses caused by viruses
(Bhardwaj et al. 2015). Resistance genes to dif-
ferent potato viruses have been identified in
many wild potato species. Some of these genes
have been incorporated into many of the recently
released potato cultivars.
PVY is the most important of all the viruses.
The Ryadg gene, conferring extreme resistance
to all known PVY strains, has been mapped and
60
cloned from S. andigena (Hamalainen et al.
1997). Kasai et al. (2000) developed
sequence-characterized amplified region (SCAR)
markers to detect PVY resistance of the gene
Ryadg. Other wild species are also known to
carry Ry-genes (Cockerham 1970), including
S. stoloniferum (Cockerham 1943), S. phureja
(Ross 1986), S. brevidens (Pehu et al. 1990), and
S. chacoense (Hosaka et al. 2001). Recently, a
hypersensitive response gene, Ny, conferring
resistance was also identified and mapped (Sza-
jko et al. 2014). Combining late blight and PVY
resistance in potato seems to be a promising
strategy for simultaneous control of two impor-
tant pathogens in potato (Bhardwaj et al. 2007).
A triplex potato line with extreme resistant to
PVY has been developed using marker-assisted
selection (Kaushik et al. 2013).
3.7.3 Breeding for Bacterial Wilt
Resistance
Bacterial wilt or brown rot caused by Ralstonia
solanacearum, first reported in India in 1892, is
the most destructive of all bacterial diseases.
Incidence of bacterial wilt is widespread in all
mid-hill regions of the country and pockets of
Assam, Meghalaya and Maharashtra. The disease
damages the crop in two different ways—pre-
mature wilting of the standing crop and the rot-
ting of the tubers in fields, in transit and in
storage. Resistance to bacterial wilt is a partially
dominant character and is more of a polygenic
type. Inheritance of resistance and its expression
are complex and both additive and non-additive
gene actions are involved, but the latter compo-
nent is more important. A gene-for-gene rela-
tionship is not applicable to bacterial wilt.
Certain genes other than those for resistance
alone have turned out to have the novel (pleio-
tropic) effects in conferring the resistance once
the potato plant has come into contact with the
pathogen under a certain set of environmental
conditions. Resistance to bacterial wilt has been
found in S. phureja (Fock et al. 2000), S. steno-
tomum (Fock et al. 2001), S. commersonii
(Kim-Lee et al. 2005; Laferriere et al. 1999), and
S. Sood et al.
S. chacoense (Chen et al. 2013). The resistance
genes have been transferred to cultivated potato
by protoplast fusion (Fock et al. 2000, 2001;
Kim-Lee et al. 2005; Laferriere et al. 1999) or
somatic hybrids (Chen et al. 2013). But the
Indian isolates of the bacterium have proved to
be highly virulent, making these sources
ineffective.
3.7.4 Breeding for Resistance to Wart
Wart disease of potato, caused by a phy-
comycetous fungus, Synchytrium endobioticum
(Schilb), was first reported from India in 1953 in
the North Bengal Hills. To avoid its further
spread to other parts of the country, this area was
brought under domestic quarantine in 1959. The
resistance genes are available in a number of
varieties of S. tuberosum. Besides, a number of
wild species such as S. boliviense, S acaule, S
microdontum, S. demissum, S. sparsipilum,
S. polytrichon, S. simplicifolium, S. chacoence f.
sp. boergerii, S. vernei and S. spegazzinii are
known to have resistance to the disease. Mono-
genic dominant mode of inheritance for at least
the control of necrotic response has been proved.
However, modifying genes are also present
which condition the nature and extent of the
response. A systematic breeding programme for
wart immunity started in 1964. Since the patho-
gen survives in the soil over long period, the only
plausible defence mechanism is to develop
immune varieties and spread the same to saturate
the areas. The crosses between wart-immune
tuberosum parents result in the recovery of quite
a high percentage of resistant clones, more than
between resistant x susceptible parents.
3.7.5 Breeding for Resistance
to Nematodes
About 90 species of nematodes belonging to 38
genera have been reported to be associated with
potatoes. Among these, the root-knot nematodes
and potato cyst nematodes have been recognized
as major pests. At least nine species of root-knot
3 History of Potato Breeding: Improvement, Diversification …
nematode (Meloidogyne spp.) are known to
infect potatoes. Among these, M. incognita is the
most important throughout the world followed by
M. javanica. The dominant root-knot nematode
species affecting potato both in the hills and the
plains is Meloidogyne incognita while M. javan-
ica infestation is restricted to mid-hills and
plains. Potato cyst nematodes, Globodera
spp. also known as golden nematode or potato
root eelworms, are considered one of the major
pests throughout the world. Quarantine or regu-
latory actions are imposed against them in most
countries. S. hougasii showed high levels of
resistance to Columbia root-knot nematode
(Brown et al. 1991). Cyst nematode resistance
has been identified in the Argentinian wild spe-
cies S. vernei and S. acaule (Hawkes 1994) as
well as in genotypes of cultivated species (Sudha
et al. 2016).
Apart from these, Verticillium wilt (Verticil-
lium dahliae), common scab (Streptomyces sca-
bies), soft rot or black leg (Erwinia sp.) and ring
rot (Clavibacter michinganensis) are other
important diseases requiring the attention of
potato breeders.
3.7.6 Breeding for Resistance
to Abiotic Stresses
Many primitive forms of cultivars and wild rel-
atives of potato can tolerate environmental stress
conditions in their habitats (Watanabe et al.
2011). Frost tolerance may be one of the oldest
breeding objectives of potato breeding. S. demis-
sum, S. acaule, and S. juzepczukii were not
affected by frost of −6 °C, S. demissum and
S. ajanhuiri showed different reactions in differ-
ent plants, and S. andigenum perished entirely
under the same conditions, with the exception of
one variety “Pacus”, which proved to be resistant
(Bukasov 1933). Frost tolerance also occurred in
certain accessions of S. commersonii and its
hybrids. Cultivated potato, however, is suscepti-
ble to both drought (Monneveux et al. 2013) and
heat (Levy and Veilleux 2007). Drought sus-
ceptibility of potato has been mainly attributed to
its shallow root system and low capacity of
61
recuperation after a period of water stress (Iwama
and Yamaguchi 2006). Drought decreases plant
growth (Deblonde and Ledent 2001), shortens
the growth cycle (Kumar et al. 2007), and
reduces the number (Eiasu et al. 2007) and size
(Schafleitner et al. 2007) of tubers. The magni-
tude of drought effects on potato production
depends on the phenological timing, duration,
and severity of the stress (Jeffery 1995;
Schafleitner 2009). Emergence and tuberization
are two critical periods when water stress most
affects final tuber yield (Martínez and Moreno
1992). High temperature drastically affects potato
production (Gregory 1965; Slater 1968). Soil
temperatures higher than 18 °C tend to reduce
tuber yield, especially when combined with high
ambient air temperature (30 °C day/23 °C night).
When heat stress accompanies drought stress,
pronounced declines in tuber yield and tuber
quality are noted with notable differences among
cultivars (Ahn et al. 2004). Heat stress creates
imbalances in source-sink relations, delays in
tuber initiation and bulking, and malformation
and necrosis of tubers (Levy and Veilleux 2007).
Heat tolerance is an important trait for the further
development of potato in subtropical India (Gaur
and Pandey 2000; Bhardwaj et al. 2003), the
semi-arid Middle East (Levy et al. 2001), and the
tropics (Minhas et al. 2011). A high proportion of
accessions combining drought tolerance with
high irrigated yield were identified in Andean
landraces, particularly in the species S. cur-
tilobum (Juz. & Bukasov) in the S. tuberosum L.
cultivar groups Stenotomum, Andigenum, and
Chaucha. Watanabe et al. (2011) identified S.
chillonanum, S. jamesii, and S. okadae as
potential drought-tolerant species by screening
44 accessions of wild species selected, based on
their drought habitats derived from GIS infor-
mation. For a long time, potato was not consid-
ered a crop of major importance in drought and
heat-prone production systems (Hyman et al.
2008; Li et al. 2011) and breeders consequently
did not consider tolerance to these stresses as
priority objectives (Thiele et al. 2010; Monn-
eveux et al. 2013). Today, the advances in
genomics and bioinformatics offer real opportu-
nities for dissecting the genetic basis of drought
62
and heat tolerance into component traits and
selecting plants with favourable alleles at the
underlying genes (Tuberosa 2012). An important
number of genes involved in drought and heat
tolerance have been identified in the past few
decades in potato (Monneveux et al. 2014).
Availability of the genome sequence and high
throughput marker systems have enriched the
genomic resources that were used to develop
genetic and physical maps (Kumar et al. 2013).
Recently, studies also reported the identification
of QTLs for drought tolerance in a diploid
genetic background (Anithakumari et al. 2010).
Further progress in developing drought-tolerant
germplasm and increasing plant performance in
drought and heat-prone areas, however, depends
largely on our capacity to generate the
high-quality quantitative data that are needed for
genetic analysis and gene identification and
transfer (Tuberosa 2012).
3.7.7 Breeding for Quality Traits
Quality parameters change according to the
specific market utilization types, and are often
referred to two major categories. The first cate-
gory groups “external quality”, aspects com-
prising skin colour, tuber size and shape, eye
depth. These traits are deemed very important for
fresh consumption where external traits are most
likely to influence consumers’ choice. The sec-
ond category comprises “internal quality” aspects
including nutritional properties, culinary value,
and after-cooking properties or processing qual-
ity. Internal quality is given by traits such as dry
matter content, flavour, sugar and protein con-
tent, starch quality, type and amount of gly-
coalkaloids. The potato needs a continued
improvement of quality traits to meet the needs
of a changing and demanding world. There are
several factors affecting tuber quality. They
include the genetic make-up of the cultivar, crop
maturity, agronomic practices, environmental
conditions, storage temperatures, the presence of
pests and diseases. The genetic make-up is the
S. Sood et al.
most important factor that influences quality
attributes. Traits that are genetically controlled
can be grouped as follows: (1) biological traits
(proteins, carbohydrates, vitamins, minerals,
reduced amounts of toxic glycoalkaloids;
(2) sensorial traits (flavour, texture, colour); and
(3) industrial traits (tuber shape and size, dry
matter content, cold sweetening, oil absorption,
starch quality).
3.7.8 Resistance to Cold Sweetening
Most potato tubers are stored for a period of time
before they are processed. When they are stored
at low temperatures (<10 °C) to prevent losses
due to shrinkage and disease and to prevent
sprouting, they undergo a phenomenon called
low-temperature sweetening. This results pri-
marily from the accumulation of reducing sugars
(glucose and fructose) as the starch breaks down.
Using wild Solanum relatives, however, breeders
have been able to improve levels of resistance to
cold sweetening in breeding clones and cultivars
(Thill and Peloquin 1994; Hayes and Thill
2002a, b; Domanski et al. 2004; Hamernik et al.
2009; Meena et al. 2009; Bhardwaj et al. 2011).
Major genes appear to control resistance to cold
sweetening in potato. A three-gene model has
been proposed for good potato chip quality when
tubers are used directly out of cold storage (Thill
and Peloquin 1994). Another three-gene model
explains chip quality when tubers are recondi-
tioned prior to processing. There may be some
overlap in these genes. Acid invertase and
UDP-glucose phosphorylase appear to be espe-
cially important components of the carbohydrate
metabolism pathway as it is related to the accu-
mulation of reducing sugars. Alleles associated
with both enzymes have been found to be asso-
ciated with resistance to cold sweetening
(Sowokinos et al. 1997; Sowokinos 2001; Li
et al. 2005; McKenzie et al. 2005). Specific
alleles for genes that control the carbohydrate
pathway have been found to be associated with
resistance to cold sweetening (Sowokinos et al.
3 History of Potato Breeding: Improvement, Diversification …
1997; Sowokinos 2001; Li et al. 2005). A marker
associated with the gene for sucrose synthase has
been found to be effective in selecting for clones
with light chip colour (Kawchuk et al. 2008).
Vacuolar invertases (VInv) localized in the
vacuole, play an important role in the production
of reducing sugars in cold-stored tubers (Kumar
et al. 2004; Matsuura-Endo et al. 2006;
Sowokinos 2001). Transgenic RNA interference
(RNAi) approaches have confirmed that knock-
ing down VInv expression lowers reducing sug-
ars and dark-pigmented non-enzymatic browning
in cold-stored potatoes (Bhaskar et al. 2010). No
accumulation of the reducing sugars, glucose and
fructose, was detected in the RNAi lines that
suppressed VInv gene expression by more than
97%, whereas partial suppression did not control
CIS effectively. This observation suggested that
the VInv gene has to be almost completely
silenced to confer the CIS-resistant trait. When
all four VInv alleles were mutated, reducing
sugars were undetectable (Clasen et al. 2016).
3.7.9 Starch Content and Quality
Dry matter content in potato tubers is determined
in large part by the starch content. The starch
content is especially important for the processing
industry, but it is also of interest in fresh market
potatoes because it influences the texture. Early
maturing cultivars typically do not produce as
much dry matter as late maturing clones, which
have more time to accumulate photosynthate.
Quantitative trait loci influencing starch content
have been identified on each of the 12 chromo-
somes of potato (Chen et al. 2001; Gebhardt
et al. 2005). There is currently interest in
breeding for increased levels of amylose in
potato starch because high amylose starch has
superior nutritional qualities. In a survey of wild
Solanum species, a large amount of variability
was found for dry matter content, starch content,
protein content, percentage of amylose in starch,
and the diameter of starch granules (Jansen et al.
2001). These wild species can be introgressed
63
into the cultivated potato, providing the means to
improve important tuber quality traits.
The production of starches with modified
amylose to amylopectin ratio represents a good
example of the possibilities offered by genetic
engineering in improving potato quality traits.
Lloyd et al. (1999) provided evidence that
transgenic potato lines, where the activity of
ADP-glucose pyrophosphorylase (AGPase) was
reduced through antisense technology, had a
significant reduction of amylose. They also
observed that in AGPase antisense plants, amy-
lopectin accumulated shorter chains and that the
size of starch granules was reduced. By contrast,
the simultaneous antisense inhibition of two
isoforms of starch branching enzymes (SBE A
and B) to below 1% of the wild type activity
gave transgenic lines with increased amounts of
amylose (Schwall et al. 2000). In particular,
amylose level in one line was 75% of total starch,
and in 19 lines it was higher than 40% (28% was
the amylose content of the wild type).
3.7.10 Breeding for Enhanced
Nutritional Quality
Breeding for enhanced iron and zinc content and
bioavailability is another major area of potato
breeding. Potatoes have high levels of ascorbic
acid, which promotes iron absorption. They also
have low levels of phytic acid, which inhibits
iron absorption. Efforts have been made at CIP to
identify germplasm accessions with high iron
and zinc content and their transfer into adapted
lines. Great attention has been given to improve
the essential amino acid composition of tubers
and especially their lysine, tyrosine, methionine
and cysteine content. Chakaborty et al. (2000)
transformed a potato genotype with the gene
AmA1 from Amaranthus hypocondriacus,
encoding a protein with a nutritionally balanced
amino acid composition. The amino acid profile
in tubers of both types of transgenic plants
showed a 1.5- to 8-fold increase for all essential
amino acids in the wild type.
64
3.8 Reinventing Potato
at the Diploid Level: Progress
and Possibilities
In order to achieve the continuous progress in
potato breeding, an alternative system should be
developed that is based on the structural removal
of unfavourable alleles. This can be efficiently
achieved at the diploid level as the chance that
unfavourable alleles are homozygous in diploids
is much higher than in tetraploids (Jansky et al.
2016). Such genes can be identified and elimi-
nated in a breeding programme. Severe
inbreeding depression and self-incompatibility in
diploid germplasm have hitherto blocked the
development of inbred lines in potato. The idea
of hybrid potato breeding goes back more than
50 years (Hawkes 1956) and saw a revival some
30 years ago with the onset of cell biology
techniques in potato. Several studies reported the
successful generation of haploid and dihaploid
potato plants (Uijtewaal et al. 1987; Chani et al.
2000). However, no progress has been reported
in the generation of homozygous potato clones
with acceptable agronomic performance. The
reasons for the same could be the large number
of unfavourable alleles, which gets expressed
during homozygosity and thus does not generate
vigorous homozygous potatoes. Diploids usually
have lower yields than tetraploids, although some
diploids may outyield tetraploid standards
(Hutten 1994). Diploids are usually self-
incompatible, prohibiting selfing that is needed
to generate and maintain homozygous lines.
Hosaka and Hanneman (1998a, b) reported on
the Sli gene originating from Solanum chacoense
that renders diploid potato self-compatible. They
used repeated selfings to generate homozygous
genotypes (Phumichai et al. 2005, 2006;
Phumichai and Hosaka 2006). These homozy-
gous clones showed poor agronomic perfor-
mance as tuber quality and yield were extremely
low. This could be considered as evidence for
severe inbreeding depression in potato, and that
inbreds will never have commercial value
(Uijtewaal et al. 1987; Almekinders et al. 2009).
However, the combination of a wide diploid
germplasm with much allelic variation and Sli
S. Sood et al.
gene are the crucial elements for a breeding
programme aimed at selecting for inbreeding
tolerance (Lindhout et al. 2011).
The implementation of the F1 hybrid potato
breeding technology will result in a completely
new potato breeding system with a new breeding
germplasm. From a breeding point of view, this
can be considered a completely new crop. For
instance, enrichment of existing parent lines can
be achieved by repeated backcrosses. This can be
done in few years, with the great advantage that
most of the traits, including processing traits, are
already known and will remain unaltered. More
importantly, traits can be stacked. This will take
one or two years more and offers great advan-
tages to develop suitable varieties for specific
markets with similar performance but with a
series of different additional traits (e.g., disease
resistances). There is still a large gap and lack of
fundamental knowledge on the performance of
diploids versus tetraploids. At this moment,
commercial tetraploids perform better than
diploids, but this may be due to the limited
breeding efforts in diploids versus tetraploids. If
the removal of unfavourable alleles in diploid
potato is successful, diploids may eventually
outperform tetraploids. The other top three world
staple crops, rice, wheat and corn, are all culti-
vated as diploids, while a crop like sugar beet has
been converted from tetra, via tri- to diploid
crop. As long as the underlying mechanisms of
the phenotype changes in polyploid crops are
unknown, plant performance at various ploidy
levels should be empirically tested and the results
applied in practice (Carputo and Barone 2005).
3.9 Genomic Resources
from the Potato Genome
Sequence Data
The cultivated potatoes are autotetraploid with a
basic chromosome number of 12 and an esti-
mated genome size of 840 million base pairs.
The availability of the first potato genome
sequence and several transcriptomes from a
diverse set of potato genotypes, organs and
developmental conditions, have produced
3 History of Potato Breeding: Improvement, Diversification …
genomic tools useful to study genetic diversity
and gene networks underlying important traits
(Spooner et al. 2014). The potato genome has an
extraordinary high polymorphism manifested by
high frequency of SNPs, Indels, duplications and
rearrangements. Sequencing of 78 genomic DNA
fragments corresponding to 14 loci with an
overall length of 31 kb from a panel of 11
diploid and 17 tetraploid potato genotypes iden-
tified, on average, one SNP every 21 base pairs
and one Indel every 243 base pairs (Rickert et al.
2003). Another study using 47 diverse potato
accessions and 66 fragments distributed across
all potato chromosomes confirmed these fre-
quencies, one single nucleotide polymorphism
(SNP) every 23 bp and one insertion deletion
(Indel) every 441 bp (Simko et al. 2006). The
comparison of DM (DM1-3 516R44-double
monoploid) and the two RH (diploid lines) gen-
ome sequences was possible for 99 Mb with the
DM genome where one SNP was found every
40 bp and one Indel every 394 bp. The two RH
genomes were aligned for 6.6 Mb with one SNP
every 29 bp and one Indel every 253 bp (The
Potato Genome Sequencing Consortium 2011).
A more recent study using 83 tetraploid potato
cultivars representing the global gene pool of
commercial potatoes, re-sequencing using
next-generation sequencing with an in-solution
hybridization enrichment for 807 targeted
nuclear genes distributed across the genome
resulted in detection of one SNP every 24 bp in
exons and 15 bp in introns (Uidewilligen et al.
2013).
Potato linkage disequilibrium (LD) first
reported at the R1 locus using 600 potato
accessions from the German potato gene bank
was relatively quickly lost after less than 1 cM
whereas the analysis of 66 DNA fragment in only
47 potato accession revealed a LD decay
of *10 cM for a disequilibrium coefficient
r2 < 0.10 which is close to linkage equilibrium
(Gebhardt et al. 2004; Simko et al. 2006). More
recently, a genome-wide estimate of LD was
around 5 cM for r2 < 0.10 (D’Hoop et al. 2010).
This is a relatively high value for LD compared
to another outbreeder, maize, for which LD falls
within 2 kb for r2 < 0.10 (Remington et al.
65
2001). Hence, at one SNP every 25 bp and LD
between *10 cM for r2 < 0.10, the precise
identification of the gene of interest by genetic or
association mapping remains a serious challenge
in potatoes. However, a more recent study has
shown LD decay after only 275 bp for r2 < 0.10
(Stich et al. 2013). Although done on a smaller
sample of 36 tetraploid varieties of similar origin
than prior other studies, the marked difference in
LD decay is attributed to a much more diverse
germplasm sample used and the SNP marker in
trait-coding loci. Hence, more genome-wide
studies need to be conducted to improve our
understanding of LD decay in potato.
Breeding for disease resistance, a permanent
global threat to potato production, has new tools
for rapid identification of alleles of interest.
Using nucleotide binding (NB) and leucine-rich
repeat (LRR) conserved domains, the search for
resistance genes identified 438 NB-LRR type
genes which were among the 39,000 predicted
genes from DM (Jupe et al. 2012). The physical
map position was identified for most of them and
was organized into 63 clusters, of which 50
consisted of R-genes derived from a recent
common ancestor. The potato genome sequence
also helped elucidate the genes for maturity and
the initiation of tuber development, with the
identification of the gene underlying a major
QTL for tuberization under long-day conditions
(Kloosterman et al. 2013). The tomato genome
sequence, published a year later than the potato
sequence, confirmed remarkable synteny with the
potato genome (8.7% sequence divergence
between homologous euchromatic regions) with
nine large and several smaller inversions (The
Tomato Genome Consortium 2012), providing
evolutionary data relating to these two sister
clades. The availability of a first potato genome
sequence and several transcriptomes have
already produced genomic tools useful to study
genetic diversity and gene networks underlying
important traits in potato and more is yet to
come.
Finally, the biggest question being raised
today is “Can potato be reinvented at the diploid
level?” It will allow the genetic diversity for
favourable alleles to be maintained and
66
unfavourable alleles will be greatly reduced
through self-pollination at the diploid level.
Moreover, all computational and genomics tools
can easily be applied at the diploid level to elu-
cidate the genetic and molecular basis of com-
plex traits. The ultimate advantage of
self-pollinating diploid breeding lines will be
propagation through TPS, like all major cereal
crops.
References
Ahn Y, Claussen K, Zimmerman JL (2004) Genotypic
differences in the heat-shock response and thermotol-
erance in four potato cultivars. Plant Sci 166:901–911
Almekinders CJM, Chujoy E, Thiele G (2009) The use of
true potato seed as pro-poor technology: the efforts of
an international agricultural research institute to
innovating potato production. Potato Res 52:275–293
Anithakumari AM, Tang J, Van Eck HJ, Visser RGF,
Leunissen JA, Vosman B, Van der Linden CG (2010)
A pipeline for high throughput detection and mapping
of SNPs from EST databases. Mol Breed 26:65–75
Bamberg JB, del Rio A (2005) Conservation of potato
genetic resources. In: Razdan MK, Mattoo AK
(eds) Genetic improvement of solanaceous crops,
volume I: Potato (p 476). Science Publishers, Inc.
Plymouth
Bhardwaj V, Kumar V, Kaushik SK, Minhas JS (2003)
Genetic parameters for tuberization efficiency in
potato under heat stress. J Indian Potato Assoc 30:5–6
Bhardwaj V, Kaushik SK, Singh PH, Singh BP (2005)
Tuber and foliage resistance to late blight in advanced
potato hybrids. Potato J 32:131–132
Bhardwaj V, Kaushik SK, Chakrabarti SK, Pandey SK,
Singh PH, Manivel P, Singh BP (2007) Combining
resistance to late blight and PVY in potato. Potato J 34
(1–2):41–42
Bhardwaj V, Manivel P, Gopal J (2011) Screening potato
species for reducing sugars. Indian J Agric Sci 81
(1):20–24
Bhardwaj V, Sharma R, Dalamu, Srivastava AK,
Baswaraj R, Singh R, Singh BP (2015) Molecular
characterization of potato virus Y resistance in potato
(Solanum tuberosum L.). Indian J Genet 75(3):389–
392
Bhaskar PB, Wu L, Busse JS, Whitty BR, Hamernik AJ,
Jansky SH, Buell CR, Bethke PC, Jiang J (2010)
Suppression of the vacuolar invertase gene prevents
cold-induced sweetening in potato. Plant Physiol
154:939–948
Bonierbale MW, Plaisted RL, Tanksley SD (1993) A test
of the maximum heterozygosity hypothesis using
molecular markers in tetraploid potatoes. Theor Appl
Genet 86:481–491
S. Sood et al.
Bradshaw JE, MacKay GR (1994) Breeding strategies for
clonally propagated crops. In: Bradshaw JE,
MacKay GR (eds) Potato genetics (pp 467–497).
CAB International, Wallington, Oxon, UK
Bradshaw JE, Hackett CA, Lowe R, McLean K, Ste-
wart HE, Tierney I, Vilaro MDR, Bryan GJ (2006)
Detection of a quantitative trait locus for both foliage
and tuber resistance to late blight [Phytophthora
infestans (Mont.) de Bary] on chromosome 4 of a
dihaploid potato clone (Solanum tuberosum subsp.
tuberosum). Theor Appl Genet 113:943–951
Brown CR, Mojtahedi H, Santo GS (1991) Resistance to
Columbia root-knot nematode in Solanum ssp. and in
hybrids of S. hougasii with tetraploid cultivated
potato. Am Potato J 68:445–452
Bukasov SM (1933) The potatoes of South America and
their breeding possibilities. (According to data gath-
ered by expeditions of the Institute of Plant Industry to
Central and South America). Bull Appl Bot Suppl. 58,
pp 1–192
Buso JA, Boiteux LS, Peloquin SJ (1999) Evaluation
under long-day conditions of 4x-2x progenies from
crosses between potato cultivars and haploid
Tuberosum-Solanum chacoense hybrids. Ann Rev
Appl Biol 135:35–40
Buso JA, Boiteux LS, Peloquin SJ (2003) Tuber yield and
quality of 4x-2x (FDR) potato progenies derived from
the wild diploid species Solanum berthaultii and
Solanum tarijense. Plant Breed 122:229–232
Capo A, Cammareri M, Rocca DF, Errico A, Zoina A,
Conicella C (2002) Evaluation for chipping and tuber
soft rot (Erwinia carotovora) resistance in potato
clones from unilateral sexual polyploidization (2x  4
x). Am J Potato Res 79:139
Carputo D, Barone A (2005) Ploidy level manipulations
in potato through sexual hybridisation. Ann Appl Biol
146:71
Carputo D, Barone A, Frusciante L (2000) 2n gametes in
the potato: essential ingredients for breeding and
germplasm transfer. Theor Appl Genet 101:805–813
Carroll CP (1982) A mass-selection method for the
acclimatisation and improvement of edible diploid
potatoes in the United Kingdom. J Agric Sci (Cam-
bridge) 99:631–640
Carroll CP, De Maine MH (1989) The agronomic value of
tetraploid F1 hybrids between potatoes of Group
Tuberosum and Group Phureja/Stenotomum. Potato
Res 32:447–456
Chakaborty S, Chakaborty N, Datta A (2000) Increased
nutritive value of transgenic potato by expressing a
nonallergenic seed albumin gene from Amaranthus
hypochondriacus. Proc Natl Acad Sci USA 97:3724–
3729
Chakrabarti SK, Singh BP, Thakur G, Tiwari JK,
Kaushik SK, Sharma S, Bhardwaj V (2014) QTL
mapping underlying resistance to late blight in a
diploid potato family of Solanum spegazzinii  S.
chacoense. Potato Res 57:1–11
Chani E, Veilleux RE, Boluarte-Medina T (2000)
Improved androgenesis of interspecific potato and
3 History of Potato Breeding: Improvement, Diversification …
efficiency of SSR markers to identify homozygous
regenerants. Plant Cell Tiss Organ Cult 60:101–112
Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B,
Liu J (2013) Nuclear and cytoplasmic genome com-
ponents of Solanum tuberosum + S. chacoense
somatic hybrids and three SSR alleles related to
bacterial wilt resistance. Theor Appl Genet 126:1861–
1872
Chen X, Salamini F, Gebhardt C (2001) A potato
molecular-function map for carbohydrate metabolism
and transport. Theor Appl Genet 102:284–295
Clasen BM, Stoddard TJ, Luo S, Demorest ZL, Li J,
Cedrone F, Tibebu R, Davison S, Ray EE, Daulhac A,
Coffman A, Yabandith A, Retterath A, Haun W,
Baltes NJ, Mathis L, Voytas DF, Zhang F (2016)
Improving cold storage and processing traits in potato
through targeted gene knockout. Plant Biotechnol J
14:169–176
Cockerham G (1943) Potato breeding for virus resistance.
Ann Appl Biol 30:105–108
Cockerham G (1970) Genetical studies on resistance to
potato viruses X and Y. Heredity 25:309–348
Cubillos AG, Plaisted RF (1976) Heterosis for yield in
hybrids between S. tuberosum ssp. tuberosum and
tuberosum ssp. andigena. Am Potato J 53:143
D’hoop BB, Paulo MJ, Kowitwanich K, Sengers M,
Visser RGF, van Eck HJ, van Eeuwijk FA (2010)
Population structure and linkage disequilibrium unrav-
eled in tetraploid potato. Theor Appl Genet 121:1151–
1170
De Jong H, Rowe PR (1971) Inbreeding in cultivated
diploid potatoes. Potato Res 14:74–83
Deblonde PMK, Ledent JF (2001) Effects of moderate
drought conditions on green leaf number, stem height,
leaf length and tuber yield of potato cultivars. Eur J
Agron 14:31–41
DeMaine MJ (1984) Patterns of variation in potato
dihaploid families. Potato Res 27:1–11
Dinu II, Hayes RJ, Kynast RG, Phillips RL, Thill CA
(2005) Novel inter-series hybrids in Solanum, section
Petota. Theor Appl Genet 110:403–415
Domanski L, Zirnnoch-Guzowska E, Domanska M,
Zgorska K, Paczowska M (2004) The germplasm
release of M-62774 and M-62805, two potato clones
with cold-sweetening resistance. Folia Hort 16:33–40
Eiasu BK, Soundy P, Hammes PS (2007) Response of
potato (Solanum tuberosum) tuber yield components
to gelpolymer soil amendments and irrigation regimes.
NZ J Crop Hort 35:25–31
Eijlander R, Ter Laak W, Hermsen JGT, Ramanna MS
(2000) Occurrence of self-compatibility,
self-incompatibility and unilateral incompatibility
after crossing diploid S. tuberosum (SI) with S.
verrucosum (SC): I. Expression and inheritance of
self-compatibility. Euphytica 115:127–139
Engel FA (1970) Explorations of the Chilca Canyon,
Peru. Curr Anthropol 11:55–58
FAO (2006) FAOSTAT database. http://faostat.fao.
org/faostat/
67
FAO (2010) The second report on the state of the world’s
plant genetic resources for food and agriculture,
Rome. http://www.fao.org/agriculture/crops/thematic-
sitemap/theme/seeds-pgr/sow/en. Accessed 02 May
2017
Fock I, Collonnier C, Purwito A, Luisetti J, Souvan-
navong V, Vedel F, Servaes A, Ambroise A, Kodja H,
Ducreux G et al (2000) Resistance to bacterial wilt in
somatic hybrids between Solanum tuberosum and
Solanum phureja. Plant Sci 160:165–176
Fock I, Collonnier C, Luisetti J, Purwito A, Souvan-
navong V, Vedel F, Servaes A, Ambroise A, Kodja H,
Ducreux G et al (2001) Use of Solanum stenotomum
for introduction of resistance to bacterial wilt in
somatic hybrids of potato. Plant Physiol Biochem
39:899–908
Frankel R, Galun E (1977) Pollination mechanisms,
reproduction and plant breeding. Springer, New York
Fry W (2007) The canon of potato science: late blight and
early blight. Potato Res 50:243–345
Gaur PC, Pandey SK (2000) Potato improvement in
sub-tropics. In: Paul Khurana SM, Shekhawat GS,
Singh BP, Pandey SK (eds) Potato, global research
and development, vol 1, pp 52–63. Indian Potato
Association, Shimla, India
Gavrilenko T (2007) Potato cytogenetics. In: Vruegden-
hil D (ed) Potato biology and biotechnology: advances
and perspectives. Elsevier, Amsterdam, pp 203–216
Gebhardt C, Ballvora A, Walkemeier B, Oberhagemann P,
Schüler K (2004) Assessing genetic potential in
germplasm collections of crop plants by marker-trait
association: a case study for potatoes with quantitative
variation of resistance to late blight and maturity type.
Mol Breed 13:93–102
Gebhardt C, Menendez C, Chen X, Schafer-Pregl R,
Salamini F (2005) Genomic approaches for the
improvement of tuber quality traits in potato. Acta
Hort 684:85
Goodrich CE (1863) The origination and test culture of
seedling potatoes. Trans New York State Agric Soc
23:89–134
Graham KM, Niederhauser JS, Romero S (1959) Obser-
vations on races of Phytophthora infestans in Mexico
during 1956–1957. Am J Potato Res 36:196–203
Gregory LE (1965) Physiology of tuberization in plants.
Encycl Plant Physiol 15:1328–1354
Grun P (1990) The evolution of cultivated potatoes. In:
Bretting PK (ed) New perspectives on the origin and
evolution of new world domesticated plants. Econ Bot
3 (Suppl.) 44:39–55
Hamalainen JH, Watanabe KN, Valkonen JPT, Arihara A,
Plaisted RL, Pehu E, Miller L, Slack SA (1997)
Mapping and marker assisted selection for a gene for
extreme resistance to potato virus Y. Theor Appl
Genet 94:192–197
Hamernik AJ, Hanneman REJ, Jansky S (2009) Intro-
gression of wild species germplasm with extreme
resistance to cold sweetening into the cultivated
potato. Crop Sci 49:529–542
68
Hanneman Jr. RE, Peloquin SJ (1967) Crossability of 24
chromosome potato hybrids with 48 chromosome
cultivars. Eur Potato J 10:62–73
Haverkort AJ, Boonekamp PM, Hutten R, Jacobsen E,
Lotz LAP, Kessel GJT, Vossen JH, Visser RGF
(2016) Durable late blight resistance in Potato through
dynamic varieties obtained by cisgenesis: scientific
and societal advances in the DuRPh project. Potato
Res 59:35–66
Haverkort AJ, Struik PC, Visser RG, Jacobsen E (2009)
Applied biotechnology to combat late blight in potato
caused by Phytophthora infestans. Potato Res 52:249–
264
Hawkes JG (1956) Taxonomic studies on the
tuber-bearing solanums. 1. Solanum tuberosum and
the tetraploid species complex. Proc Linn Soc London
166:97–144
Hawkes JG (1990) The potato: evolution, biodiversity and
genetic resources. Belhaven Press, London
Hawkes JG (1994) Origins of cultivated potatoes and
species relationships. In: Bradshaw JE, Mackay GR
(eds) Potato genetics. CAB International, Wallingford,
pp 3–42
Hawkes JG, Francisco-Ortega (1992) The potato in Spain
during the late 16th century. J Econ Bot 46:86
Hayes RJ, Thill CA (2002a) Introgression of cold (4C)
chipping from 2x (2 Endosperm Balance Number)
potato species into 4x (4EBN) cultivated potato using
sexual polyp loidization. Am J Potato Res 79:421–431
Hayes RJ, Thill CA (2002b) Selection for potato geno-
types from diverse progenies that combine 4C chip-
ping with acceptable yields, specific gravity, and tuber
appearance. Crop Sci 42:1343–1349
Haynes KG, Christ BJ (1999) Heritability of resistance to
foliar late blight in a diploid hybrid population of
Solanum phureja - Solanum stenotomum. Plant Breed
118:431–434
Haynes KG, Lu W (2005) Improvement at the diploid
species level. In: Razdan MK, Mattoo AK
(eds) Genetic improvement of Solanaceous crops, vol
I. Potato. Science Publishers Inc, Enfield, pp 101–114
Hils U, Pieterse L (2005) World catalogue of potato
varieties. Agrimedia GmbH, Bergen/Dumme, Germany
Hosaka K (1995) Successive domestication and evolution
of the Andean potatoes as revealed by chloroplast
DNA restriction site analysis. Theor Appl Genet
90:356–363
Hosaka K, Hanneman RE Jr (1998b) Genetics of
self-compatibility in a self-incompatible wild diploid
potato species Solanum chacoense. 2. Localization of
an S locus inhibitor (Sli) gene on the potato genome
using DNA markers. Euphytica 103:256–271
Hosaka K, Hannernan RE Jr (1998a) Genetics of
self-compatibility in a self-incompatible wild diploid
potato species Solanum chacoense. I. Detection of an
S locus inhibitor (Sli) gene. Euphvtica 99:191–197
Hosaka K, de Zoeten GA, Hanneman RE Jr (1988)
Cultivated potato chloroplast DNA differs from the
wild type by one deletion—evidence and implications.
Theor Appl Genet 75(5):741–745
S. Sood et al.
Hosaka K, Hosaka Y, Mori M, Maida T, Matsunaga H
(2001) Detection of a simplex RAPD marker linked to
resistance to potato virus Y in a tetraploid potato.
Am J Potato Res 78:191–196
Hougas RW, Peloquin SJ (1957) A haploid plant of the
potato variety Katahdin. Nature 180:1209–1210
Huamán Z, Spooner DM (2002) Reclassification of
landrace populations of cultivated potatoes (Solanum
sect. Petota). Am J Bot 89:947–965
Hutten R (1994) Basic aspects of potato breeding via the
diploid level. Ph.D. thesis, Wageningen University,
Wageningen
Hyman G, Fujisaka S, Jones P, Wood S, de Vicente MC,
Dixon J (2008) Strategic approaches to targeting
technology generation: assessing the coincidence of
poverty and drought-prone crop production. Agric
Syst 98:50–61
Iwama K, Yamaguchi Y (2006) Abiotic stresses. In:
Gopal J, Paul Khurana SM (eds) Handbook of potato
production improvement and post harvest manage-
ment. Food Product Press, New York, pp 231–278
Iwanaga M, Ortiz R, Cipar MS, Peloquin SJ (1991) A
restorer gene for genetic-cytoplasmic male sterility in
cultivated potatoes. Am Potato J 68:19–28
Jackson SA, Hanneman RE Jr (1999) Crossability
between cultivated and wild tuber-and
non-tuber-bearing Solanums. Euphytica 109(1):51–67
Jansen G, Flamine W, Schuler K, Vandrey M (2001)
Tuber and starch quality of wild and cultivated potato
species and cultivars. Potato Res 44:137–146
Jansky S (2006) Overcoming hybridization barriers in
potato. Plant Breed 125:1–12
Jansky SH, Simon R, Spooner DM (2009) A test of
taxonomic predictivity: resistance to the colorado
potato beetle in wild relatives of cultivated potato.
J Econ Entomol 102:422–431
Jansky SH, Charkowski AO, Douches DS, Gusmini G,
Richael C, Bethke PC, Spooner DM, Novy RG et al
(2016) Reinventing potato as a diploid inbred
line-based crop. Crop Sci 56:1–11
Jeffery RA (1995) Physiology of crop response to
drought. In: Haverkortand AJ, MacKerron DKL
(eds) Potato ecology and modeling of crops under
conditions limiting growth. Wageningen Academic
Publishers, The Netherlands, pp 61–74
Jeffries C, Barker H, Khurana SMP (2006) Viruses &
viroids. In: Gopal J, Khurana SMP (eds) Handbook of
potato production, improvement and post harvest
management. The Howarth Press Inc, USA, pp 387–
448
Jin LP, Qu DY, Xie KY, Bian CS, Duan SG (2004)
Potato germplasm, breeding studies in China. In:
Proceedings of the Fifth world potato congress,
Kunming, China, 26–31st March 2004, pp 175–177
Johnston SA, Hanneman RE (1980) Support of the
endosperm balance number hypothesis utilizing some
tuber-bearing Solanum species. Am Potato J 57:7–14
Johnston SA, den Nijs TPM, Peloquin SJ, Hanneman RE
(1980) The significance of genic balance to endosperm
3 History of Potato Breeding: Improvement, Diversification …
development in interspecific crosses. Theor Appl
Genet 57:5–9
Joseph TA, Kaushik SK, Singh BP, Bhardwaj V,
Singh PH, Pandey SK, Paul Khurana SM, Gopal J
(2006) Kufri Shailja: a late blight resistant potato
variety for Indian hills. Potato J 33:99–103
Joseph TA, Kaushik SK, Singh BP, Bhardwaj V,
Pandey SK, Singh SV, Singh PH, Gupta VK (2007)
Kufri Himalini: a high yielding, late blight resistant
potato variety suitable for cultivation in Indian hills.
Potato J 34:168–173
Joseph TA, Singh BP, Kaushik SK, Bhardwaj V,
Pandey SK, Singh PH, Singh SV, Gopal J,
Bhat MN, Gupta VK (2011) Kufri Girdhari: a medium
maturing, late blight resistant potato variety for
cultivation in Indian hills. Potato J 38:26–31
Jupe F, Pritchard L, Etherington GJ, MacKenzie K,
Cock PJA, Wright F, Sharma SK, Bolser D, Bryan GJ,
Jones JDG, Hein I (2012) Identification and localiza-
tion of the NB-LRR gene family within the potato
genome. BMC Genomics 13
Juzepczuk SW, Bukasov SM (1929) A contribution to the
question of the origin of the potato. Trudy Vsesoyuz-
nogo S”zeda po Genetike i Selektsii Semenovodstvu i
Plemennomu Zhivotnovodstvu. Leningrad 3:593–611
Kasai K, Morikawa Y, Sorri VA, Valkonen JPT, Geb-
hardt C, Watanabe KN (2000) Development of SCAR
markers to the PVY resistance gene Ryadg based on a
common feature of plant disease resistance genes.
Genome 43:1–8
Kaushik SK, Sharma R, Garg ID, Singh BP,
Chakrabarti SK, Bhardwaj V, Pandey SK (2013)
Development of triplex (YYYy) potato parental line
having extreme resistance to PVY using Marker
Assisted Selection (MAS). J Hort Sci Biotechnol 88
(5):580–584
Kawchuk LM, Lynch DR, Yada RY, Bizimungu B,
Lynn J (2008) Marker assisted selection of potato
clones that process with light chip color. Am J Potato
Res 85:227–231
Khurana SMP (2008) Potato viruses. In: Rao GP et al
(eds) Characterization, diagnosis and management of
plant viruses, vol I. Industrial crops. Studium
Press LLC, Texas, pp 1–45
Kim HJ, Lee HR, Jo KR, Mortazavian SM, Huigen DJ,
Evenhuis B, Kessel G, Visser RG, Jacobsen E,
Vossen JH (2012) Broad spectrum late blight resis-
tance in potato differential set plants MaR8 and MaR9
is conferred by multiple stacked R genes. Theor Appl
Genet 124:923–935
Kim-Lee H, Moon JS, Hong YJ, Kim MS, Cho HM
(2005) Bacterial wilt resistance in the progenies of the
fusion hybrids between haploid of potato and Solanum
commersonii. Am J Potato Res 82:129–137
Kloosterman B, Abelenda JA, Gomez MDMC,
Oortwijn M, de Boer JM, Kowitwanich K, Hor-
vath BM, van Eck HJ, Smaczniak C, Prat S, Vis-
ser RGF, Bachem CWB (2013) Naturally occurring
69
allele diversity allows potato cultivation in northern
latitudes. Nature 495:246–250
Knight TA (1807) On raising of new and early varieties of
the potato (Solanum tuberosum). Trans Hort Soc
London 1:57–59
Kotch GP, Peloquin SJ (1987) A new source of haploid
germplasm for genetic and breeding research. Am
Potato J 64:137–141
Kotch GP, Ortiz R, Peloquin SJ (1992) Genetic analysis
by use of potato haploid populations. Genome
35:103–108
Kumar D, Singh BP, Kumar P (2004) An overview of the
factors affecting sugar content of potatoes. Ann Appl
Biol 145:247–256
Kumar S, Asrey R, Mandal G (2007) Effect of differential
irrigation regimes on potato (Solanum tuberosum)
yield and post-harvest attributes. Indian J Agric Sci
77:366–368
Kumar S, Garrick DJ, Bink MCAM, Whitworth C,
Chagné D, Volz RK (2013) Novel genomic
approaches unravel genetic architecture of complex
traits in apple. BMC Genom 14:393
Laferriere LT, Helgeson JP, Allen C (1999) Fertile
Solanum tuberosum + S. commersonii somatic
hybrids as sources of resistance to bacterial wilt
caused by Ralstonia solanacearum. Theor Appl Genet
98:1272–1278
Landeo JA (2002) Durable resistance:
quantitative/qualitative resistance. In: C. Lizarraga
(ed) Proceedings of global initiative on late blight
conference 11–13th July 2002. Hamburg, Germany,
pp 29–36
Levy D, Veilleux RE (2007) Adaptation of potato to high
temperatures and salinity: a review. Am J Potato Res
84:487–506
Levy D, Itzhak Y, Fogelman E, Margalit E, Veilleux RE
(2001) Ori, Idit, Zohar and Zahov: tablestock and
chipstock cultivars bred for adaptation to Israel. Am J
Potato Res 78:167–173
Li L, Strahwald J, Hofferhert HR, Lubeck J, Tacke F,
Junghans H, Wunder J, Gebhardt C (2005) DNA
variation at the invertase focus invGE/GF is associated
with tuber quality traits in populations of potato
breeding clones. Genetics 170:813–821
Li X, Waddington SR, Dixon J, Joshi AK, de Vicente MC
(2011) The relative importance of drought and other
water-related constraints for major food crops in South
Asian farming systems. Food Secur 3:19–33
Lindhout P, Meijer D, Schotte T, Hutten RCB, Vis-
ser RGF, Eck HJ (2011) Towards F1 hybrid seed
potato breeding. Potato Res 54:301–312
Lloyd JR, Springer F, Buleon A, Müller-Röber B,
Willmitzer L, Kossmann J (1999) The influence of
alterations in ADP-glucose pyrophosphorylase activ-
ities on starch structure and composition in potato
tubers. Planta 209:230–238
Love SL, Pavek JJ, Thompson-Johns A, Bohl W (1998)
Breeding progress for potato chip quality in North
American cultivars. Ame J Potato Res 75:27–36
70
Machida-Hirano R (2015) Diversity of potato genetic
resources. Breed Sci 65:26–40
Maris B (1989) Analysis of an incomplete diallel cross
among three ssp. tuberosum varieties and seven
long-day adapted ssp. andigena clones of the potato
(Solanum tuberosum L.). Euphytica 41:163–182
Martínez CA, Moreno U (1992) Expresiones fisiológicas
de resistencia a sequía en dos variedades de papa
sometidas a estrés hídrico. Rev Bras Fisiol Veg 4:33–
38
Matsuura-Endo C, Ohara-Takada A, Chuda Y, Ono H,
Yada H, Yoshida M, Kobayashi A, Tsuda S, Taki-
gawa S, Noda T, Yamauchi H, Mori M (2006) Effects
of storage temperature on the contents of sugars and
free amino acids in tubers from different potato
cultivars and acrylamide in chips. Biosci Biotechnol
Biochem 70:1173–1180
McKenzie MJ, Sowokinos JR, Shea IM, Gupta SK,
Lindlauf RR, Anderson JAD (2005) Investigations on
the role of acid invertase and UDP-glucose phy-
rophosphorylase in potato clones with varying resis-
tance to cold-induced sweetening. Am J Potato Res
82:231–239
Meena RS, Manivel P, Bhardwaj V, Gopal J (2009)
Screening potato wild species for low accumulation of
reducing sugars during cold storage. Electr J Plant
Breed 1:89–92
Mendibuni AO, Peloquin SJ (1977) Bilateral sexual
polyploidization in potatoes. Euphvtica 26:573–583
Minhas JS, Rawat S, Govindakrishnan PM, Kumar D
(2011) Possibilities in enhancing potato production in
non-traditional areas. Potato J 38(1):14–17
Monneveux P, Ramírez DA, Pino MT (2013) Drought
tolerance in potato (S. tuberosum L.): can we learn
from drought tolerance research in cereals? Plant Sci
205–206:76–86
Monneveux P, Ramírez DA, Khan MA, Raymundo RM,
Loayza H, Quiroz R (2014) Drought and heat
tolerance evaluation in potato (Solanum tuberosum
L.). Potato Res 57(4):225–247
Mulema JMK, Olanya OM, Adipala E, Wagoire W
(2004) Stability of late blight resistance in population
B potato clones. Potato Res 47:11–24
Murphy AM, De Jong H, Tai GCC (1995) Transmission
of resistance to common scab from the diploid to the
tetraploid level via 4x-2x crosses in potatoes 82:227–
233
Ochoa CM (1999) Las papas de sudamerica: Peru (Parte
I). International Potato Center, Lima, p 1036
Ortiz R (2001) The state of the use of potato genetic
diversity. In: Cooper HD, Spillane C, Hodgkin T
(eds) Broadening the genetic base of crop production.
CABI Publishing, Wallingford, pp 181–200
Ovchinnikova A, Krylova E, Gavrilenko T, Smekalova T,
Zhuk M, Knapp S, Spooner DM (2011) Taxonomy of
cultivated potatoes (Solanum section Petota: Solana-
ceae). Bot J Linn Soc 165:107–155
PBI Solanum Project (2014) Solanaceae Source. http://
www.solanaceaesource.org. Accessed 1 May 2017
S. Sood et al.
Pehu E, Gibson RW, Jones MGK, Karp A (1990) Studies
on the genetic basis of resistance to potato leaf roll
virus, potato virus Y and potato virus X in Solanum
brevidens using somatic hybrids of Solanum brevidens
and Solanum tuberosum. Plant Sci 69:95–101
Peloquin SJ, Hougas RW (1960) Genetic variation among
haploids of the common potato. Am Potato J 37:289–
297
Peloquin SJ, Boiteux LS, Carputo D (1999) Meiotic
mutants in potato: valuable variants. Genetics
153:1493–1499
Phumichai C, Hosaka K (2006) Cryptic improvement for
fertility by continuous selfing of diploid potatoes using
Sli gene. Euphytica 149:251–258
Phumichai C, Mori M, Kobayashi A, Kamijima O,
Hosaka K (2005) Toward the development of highly
homozygous diploid potato lines using the
self-compatibility controlling Sb gene. Genome
48:977–984
Phumichai C, Ikeguchi-Samitsu Y, Fujmatsu M, Kitan-
ishi S, Kobayashi A, Mori M, Kosaka K (2006)
Expression of S-locus inhibitor gene (Sli) in various
diploid potatoes. Euphytica 148:227–234
Plaisted RL, Hoopes RW (1989) The past record and
future prospects for the use of exotic potato germ-
plasm. Am Potato J 66:603–627
Raimondi JP, Camadro EL (2003) Crossability relation-
ships between the common potato, Solanum tubero-
sum spp. tuberosum, and its wild diploid relatives S.
kurtzianum and S. ruiz-lealii. Genetic Resour Crop
Evol 50:307–314
Remington DL, Thornsberry JM, Matsuoka Y, Wil-
son LM, Whitt SR, Doebley J, Kresovich S, Good-
man MM, Buckler ES (2001) Structure of linkage
disequilibrium and phenotypic associations in the
maize genome. Procd Natl Acad Sci USA 98:11479–
11484
Rickert AM, Kim JH, Meyer S, Nagel A, Ballvora A,
Oefner PJ, Gebhardt C (2003) First generation
SNP/InDel markers tagging loci for pathogen resis-
tance in the potato genome. Plant Biotechnol J 1:399–
410
Ross H (1986) Potato breeding—problems and perspec-
tives. Verlag Paul Parey, Berlin, Hamberg
Salaman RN (1946) The early European potato; its
character and place of origin. J Linn Soc (Bot) 53:1–
27
Salaman R (1954) The origin of the early European
potato. J Linn Soc London Bot 55:185–190
Schafleitner R (2009) Growing more potatoes with less
water. Trop Plant Biol 2:111–121
Schafleitner R, Gutierrez R, Espino R, Gaudin A, Pérez J,
Martínez M, Domínguez A, Tincopa L, Alvarado C,
Numberto G, Bonierbale M (2007) Field screening for
variation of drought tolerance in Solanum tuberosum
L. by agronomical, physiological and genetic analysis.
Potato Res 50:71–85
Schwall GP, Safford R, Westcott RJ, Jeffcoat R, Tayal A,
Shi Y-C, Gidley MJ, Jobling SA (2000) Production of
3 History of Potato Breeding: Improvement, Diversification …
very-high-amylose potato starch by inhibition of
SBE A and B. Nat Biotechnol 18:551–554
Scott GJ, Rosegrant MW, Ringler C (2000) Global
projections for root and tuber crops to the year 2020.
Food Policy 25:561–597
Shekhawat GS, Khurana SMP, Singh BP (2000) Impor-
tant diseases of potato and their management. In:
Khurana SMP, Shekhawat GS, Singh BP, Pandey SK
(eds) Potato global research and development, vol 1.
Indian Potato Association, Shimla, pp 281–303
Simko I, Haynes KG, Jones RW (2006) Assessment of
linkage disequilibrium in potato genome with single
nucleotide polymorphism markers. Genetics
173:2237–2245
Simmonds NW (1969) Prospects of potato improvement.
Scott Plant Breed Stat Ann Rep 48:18–38
Slater JW (1968) The effect of night temperature on tuber
initiation of the potato. Eur Potato J 11:14–22
Sowokinos JR (2001) Allele and isozyme patterns of
UDP-glucose pyrophosphorylase as a marker for cold
sweetening resistance in potatoes. Am J Potato Res
78:57–64
Sowokinos JR, Thomas C, Burrell MM (1997) Pyrophos-
phorylases in Potato. V. Allelic polymorphism of
UDP-glucose pyrphosphorylase in potato cultivars and
its association with tuber resistance to sweetening in
the cold. Plant Physiol 113:511–517
Spooner DM (2009) DNA barcoding will frequently fail
in complicated groups: an example in wild potatoes.
Am J Bot 96:1177–1189
Spooner DM, Bamberg JB (1994) Potato genetic
resources: sources of resistance and systematics. Am
Potato J 71:325–337
Spooner DM, Hijmans RJ (2001) Potato systematics and
germplasm collecting, 1989-2000. Am J Potato Res
78:237–268
Spooner DM, McLean K, Ramsay G, Waugh R, Bryan G
(2005) A single domestication for potato based on
multilocus amplified fragment length polymorphism
genotyping. Procd Natl Acad Sci USA 102:14694–
14699
Spooner DM, Núñez J, Trujillo G, Del Rosario Herrera M,
Guzmán F, Ghislain M (2007) Extensive simple
sequence repeat genotyping of potato landraces sup-
ports a major reevaluation of their gene pool structure
and classification. Proc Natl Acad Sci USA
104:19398–19403
Spooner DM, Ghislain M, Simon R, Jansky SH,
Gavrilenko T (2014) Systematics, diversity, genetics,
and evolution of wild and cultivated potatoes. Bot Rev
80:283–383
Sterrett SB, Henninger MR, Yencho GC, Lu W, Vin-
yard BT, Haynes KG (2003) Stability of internal heat
necrosis and specific gravity in tetraploid  diploid
potatoes. Crop Sci 43:790–796
Stich B, Urbany C, Hoffmann P, Gebhardt C (2013)
Population structure and linkage disequilibrium in
diploid and tetraploid potato revealed by genome-wide
high-density genotyping using the SolCAP SNP array.
Plant Breed 132:718–724
71
Struik PC, Wiersema SG (1999) Seed potato technology.
Wageningen Press, Wageningen, p 383
Sudha R, Venkatasalam EP, Bairwa A, Bhardwaj V,
Dalamu Sharma R (2016) Identification of potato cyst
nematode resistant genotypes using molecular mark-
ers. Scientia Hort 198:21–26
Swaminathan MS, Howard HW (1953) The cytology and
genetics of the potato (Solanum tuberosum) and
related species. Bibliographia Genetica 16:1–192
Szajko K, Strzelczyk-Żyta D, Marczewski W (2014) Ny-1
and Ny-2 genes conferring hypersensitive response to
potato virus Y (PVY) in cultivated potatoes: mapping
and marker-assisted selection validation for PVY
resistance in potato breeding. Mol Breed 34:267–271
Tai GCC (1994) Use of 2n gametes. In: Bradshaw JE,
Mackay GR (eds) Potato genetics. CAB International,
Wallingford, pp 109–132
Tai GCC, De Jong H (1980) Multivariate analyses of
potato hybrids. 1. Discrimination between
tetraploid-diploid hybrid families and their relation-
ship to cultivars. Can J Genet Cytol 22:227–235
Tai UCC, De Jong H (1997) A comparison of perfor-
mance of tetraploid progenies produced by diploid and
their vegetatively doubled (tetraploid) couterpart par-
ents. Theor Appl Genet 94:303–308
Tan MYA, Hutten RCB, Visser RGF, van Eck HJ (2010)
The effect of pyramiding Phytophthora infestans
resistance genes Rpimcd1 and Rpi-ber in potato.
Theor Appl Genet 121:117–125
Tanksley SD, Loaiza-Figueroa F (1985) Gametophytic
self-incompatibility is controlled by a single major
locus on chromosome 1 in Lycopersicon peruvianum.
Procd Natl Acad Sci USA 82:5093–5096
Tarn TR, Tai GCC (1983) Tuberosum-tuberosum and
tuberosum-andigena potato hybrids: comparisons of
families and parents, and breeding strategies for
andigena potatoes in long-day temperate environ-
ments. Theor Appl Genet 66:87–91
Tarn TR, Tai GCC, De Jong H, Murphy AM,
Seabrook JEA (1992) Breeding potatoes for long
day temperate climates. Plant Breed Rev 9:217–332
The Potato Genome Sequencing Consortium (2011)
Genome sequence and analysis of the tuber crop
potato. Nature 475:189–197
The Tomato Genome Consortium (2012) The tomato
genome sequence provides insights into fleshy fruit
evolution. Nature 485:635–641
Thiele G, Theisen K, Bonierbale M, Walker T (2010)
Targeting the poor and hungry with potato science.
Potato J 37:75–86
Thill CA, Peloquin SJ (1994) Inheritance of potato chip
color at the 24-chromosome level. Am Potato J
71:629–646
Trognitz BR, Bonierbale M, Landeo JA, Forbes G,
Bradshaw JE, Mackay GR, Waugh R, Huarte MA,
Colon L (2001) Improving potato resistance to disease
under the global initiative on late blight. In:
Cooper HD, Spillane C, Hodgkin T (eds) Broadening
the genetic base of crop production. CABI Publishing,
Wallingford, pp 385–398
72
Tuberosa R (2012) Phenotyping for drought tolerance of
crops in the genomics era. Front Physiol 3(347):1–26
Ugent D, Dillehay T, Ramirez C (1987) Potato remains
from a late Pleistocene settlement in Southcentral
Chile. Econ Bot 41:17–27
Uidewilligen JG, Wolters AMA, Bjorn B, Borm TJ,
Visser RG, van Eck HJ (2013) A next generation
sequencing method for genotyping-by-sequencing of
highly heterozygous autotetraploid potato. PLoS One
8(5):e62355
Uijtewaal BA, Huigen DJ, Hermsen JGT (1987) Produc-
tion of potato monohaploids (2n = x = 12) through
prickle pollination. Theor Appl Genet 73:751–758
Van den Berg RG, Miller JT, Ugarte ML, Kardolus JP,
Villand J, Nienhuis J, Spooner DM (1998) Collapse of
morphological species in the wild potato Solanum
brevicaule complex (sect. Petota). Am J Bot 85:92–
109
Vavilov NI (1951) The origin, variation, immunity and
breeding of cultivated plants. Chron. Bot. 13:1–366.
S. Sood et al.
[Originally published in 1935; transl. from Russian by
K. S. Chester.]
Vleeshouwers VGAA, Raffaele S, Vossen JH, Cham-
pouret N, Oliva R, Segretin ME, Rietman H,
Cano LM, Lokossou A, Kessel G, Pel MA,
Kamoun S (2011) Ann Rev Phytopathol 49:507–531
Wang F, Li F, Wang J, Zhou Y, Sun H (2011) Genetic
diversity of the selected 64 potato germplasms
revealed by AFLP markers. Mol Plant Breed 2:22–29
Watanabe KN, Kikuchi A, Shimazaki T, Asahina M
(2011) Salt and drought stress tolerances in transgenic
potatoes and wild species. Potato Res 54:319–324
Werner JE, Peloquin SJ (1991) Occurrence and mecha-
nisms of 2n egg formation in 2x potato. Genome
4:975–982
Zhu S, Li Y, Vossen JH, Visser RG, Jacobsen E (2012)
Functional stacking of three resistance genes against
Phytophthorainfestans in potato. Transgenic Res
21:89–99
Zitnak A, Johnston G (1970) Glycoalkaloid content of
B5141-6 potatoes. Am Potato J 47:256–260
 Genetic Stocks Used for Potato
Genome Sequencing 4
Richard E. Veilleux

Abstract
Potato is a highly heterozygous and tetraploid crop and therefore it was a
major challenge to decipher the potato genome. This chapter highlights the
developmental stories of the potato genetic stock used for the whole
genome sequencing by the Potato Genome Sequencing Consortium
(PGSC).

Phureja Group, and Stenotomum Group) (Huá-

4.1 Introduction
man and Spooner 2002). Ploidy was thought to
distinguish the Groups: Ajanhuiri, Phureja and
As difficulties arose with sequencing attempts on
Stenotomum were diploid; Juzepczukii and
heterozygous potato germplasm, assembly of a
Chaucha were triploid; Tuberosum, Andigenum
draft sequence of the potato genome was con-
and Chilotanum were tetraploid; Curtilobum was
tingent upon the utilization of a completely
pentaploid. However, exceptions to the ploidy
homozygous cultigen in this highly heterozygous
classification were common. The similarity
tetraploid (2n = 4x = 48) crop that declines
between Groups Tuberosum and Andigenum
rapidly on inbreeding. Cultivated potatoes all fall
have been demonstrated graphically in two
within Solanum tuberosum L. but have been
independent studies where diverse populations of
divided taxonomically into indistinct Groups,
tetraploid Andigenum landraces have been bred
including Group Tuberosum (tetraploid com-
to resemble commercial potato cultivars through
mercial cultivars grown throughout Europe and
recurrent selection (Glendinning 1975; Huarte
North America), and eight landrace populations
and Plaisted 1984). Spooner et al. (2007) later
grown in South America (Ajanhuiri Group,
used simple sequence repeat (SSR) markers to try
Andigenum Group, Chaucha Group, Chilotanum
to distinguish a collection of 742 landraces and
Group, Curtilobum Group, Juzepczukii Group,
reclassified the previous eight landrace Groups
into four species, with two Groups [Andigenum
(now including Andigenum, Phureja, Stenoto-
R. E. Veilleux (&) mum and Chaucha) and Chlotanum] within S.
Department of Horticulture, Virginia Tech, tuberosum and Groups Ajanhuiri, Juzepczukii
Blacksburg, VA 24061, USA and Curtilobum elevated to species. The
e-mail: potato@vt.edu

© Springer International Publishing AG 2017 73

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_4
74
Andigenum Group then encompassed the genet-
ically indistinct diploids, triploids and tetraploids
whereas the other more genetically distinct
Groups and species retained the ploidy status of
their previous Groups. So, potato presents a
wealth of germplasm from primitive cultivars to
advanced tetraploid commercial clones with little
difference genetically among them, justifying the
use of a primitive cultivar to represent the potato
genome. For the sake of clarity, we will continue
to use the now extinct Group Phureja designation
in this review.
There are only a few reports of inbreeding in
tetraploid Group Tuberosum germplasm. Krantz
(1946) reported an extensive study of inbreeding
through self-pollination in five different families
where the average tuber yield of subsequent
generations declined from 83% of the original
plant material in the S1 generation to 19% in the
S6 generation. The data for the S6 generation
were limited to only one of the five starting
families due to a high proportion of weak plants
that failed to flower in other families. The rapid
decline of tetraploid potatoes after even a single
generation of inbreeding has been confirmed in a
wide range of germplasm, especially if starting
with the most productive cultivars (Golmirzaie
et al. 1998a, b; Hagberg and Tedin 1951). Many
studies have been conducted on potato dihap-
loids, i.e., derivatives of tetraploid selections
with the diploid chromosome number
(2n = 2x = 24) obtained by prickle pollination
(Uijtewaal et al. 1987a) or anther culture (Wenzel
et al. 1979). Most dihaploids exhibit reduced
vigor compared to the tetraploid progenitors,
averaging only 50% of the yield and most do not
shed functional pollen (Rokka 2009), limiting
their utility in breeding. In an extensive study of
5377 dihaploids extracted from 31 different tet-
raploid clones, Hutten et al. (1995) found that
39% of a subset of the most vigorous did not
tuberize and 32% did not flower. Although
dihaploids have reduced heterozygosity com-
pared to tetraploid cultivars, they still exhibit
considerable heterozygosity and are therefore
unsuitable nominees for sequencing as the dif-
ferences in intergenic DNA on homologous
chromosomes defied assembly using the
R. E. Veilleux
sequencing platforms available in 2011. Reduc-
tion of dihaploids to the monoploid level
(2n = 1x = 12) requires functional female
gametes using prickle pollination or functional
male gametes using anther culture, assuming that
the genetic load were sufficiently light to obtain a
viable monoploid genome. Uijtewaal et al.
(1987b) obtained true monoploids (synonymous
with monohaploids) from two different dihaploid
families by prickle pollination; after chromosome
doubling, these are the only reported truly
homozygous plants obtained primarily from
Solanum tuberosum Group Tuberosum germ-
plasm. Yet, even in this case, a close look at the
parental material reveals that Group Phureja
diploids comprised either 3/8 (M9 family) or ½
(H78.01 family) of their composition (De Vries
et al. 1987; Uijtewaal et al. 1987b). The mono-
ploids and doubled monoploids obtained were
extremely weak with little or no tuber set
(Uijtewaal et al. 1987b). Because of the heavy
genetic load of tetraploid Group Tuberosum
germplasm revealed in these studies of chromo-
some reduction, it was an unlikely source of a
suitable homozygous clone for sequencing. In
any case this source of plant material was no
longer available at the time when sequencing was
first seriously envisioned.
Due to the lack of availability of a homozy-
gous line derived from tetraploid Tuberosum
germplasm, an alternative source of homozygous
potato lines was necessary. Diploid accessions of
Group Andigenum germplasm would be expec-
ted to carry a less crippling genetic load than
tetraploids as they would have been subjected to
more purifying selection through sexual propa-
gation as well as reduced masking of deleterious
alleles at the diploid compared to the tetraploid
level. In order to demonstrate the possibility of
homozygous potato germplasm, we embarked on
a program starting in the 1980s to extract
monoploids from diploid Phureja germplasm
(Fig. 4.1). Our starting material was sexually
propagated derivatives of the Phureja population
bred for photoperiod adaptation to long days in
North Carolina (Haynes 1972). We screened
selected seedlings randomly from crosses among
diplandrous (2n pollen-producing) clones within
4 Genetic Stocks Used for Potato Genome Sequencing
Fig. 4.1 Tubers of a diverse
population of adapted Phureja
Fig. 4.2 Anther-derived
embryos of diploid potato
a diverse population (Veilleux and Lauer 1981)
for their ability to form embryos in anther culture
(Fig. 4.2) using the protocol described by Wen-
zel et al. (1979). The rationale of using diplan-
drous clones was to derive monoploid plants
from reduced pollen grains while retaining the
ability of the resulting monoploids or their sex-
ually derived hybrids to generate 2n pollen
through fused or parallel spindles at the second
division of microsporogenesis, thereby providing
building blocks for sexual polyploidization in
future applications. The corollary, however, was
75
that the embryos generated from heterozygous
2n microspores in anther culture would be more
vigorous and outcompete the relatively weak
sought-after monoploid embryos from 1n mi-
crospores. Another complication was that
diploids derived by anther culture would include
heterozygous 2n pollen-derived clones as well as
homozygous clones from spontaneously doubled
1n embryos or even 2n plants from somatic
anther tissue. All diploids were routinely dis-
carded as the effort of sorting homozygous from
heterozygous clones using whatever marker
76
Fig. 4.3 Monoploid and
isogenic doubled monoploid
potato
system was in vogue at the time was deemed too
great (Veilleux et al. 1995). Instead, verified
monoploids were subjected to a leaf disc regen-
eration protocol (Hulme et al. 1992) resulting in
diploidization (Fig. 4.3) either through regener-
ation from pre-existing endoreduplication in leaf
explants or spontaneous endoreduplication dur-
ing regeneration from callus (Paz and Veilleux
1999).
The first set of anther-derived embryos and
plants derived from the adapted Phureja popula-
tion was recovered from a single seedling that
responded positively to anther culture (Veilleux
et al. 1985). The homozygous plants, though
weak compared to their heterozygous diploid
anther donor, were sufficiently viable for green-
house trials, field trials (Lough et al. 2001) and,
once doubled (Fig. 4.3), crosses as stylar parents
to various heterozygous pollinator plants
(M’Ribu and Veilleux 1992). A modest effort was
made to enlarge the germplasm base by screening
for other anther culture-competent selections
within the adapted Phureja seedling population to
generate a more genetically diverse homozygous
Phureja germplasm base (Johnson et al. 2001).
Over the years, various efforts were made to
improve the vigor of Phureja monoploids through
somatic hybridization (Haynes 1972; Johnson
et al. 2001; Lightbourn and Veilleux 2007) and
outcrossing followed by re-extraction of
R. E. Veilleux
monoploids (M’Ribu and Veilleux 1992; Paz and
Veilleux 1997). The monoploids and doubled
monoploids were maintained in vitro for many
years at Virginia Tech and some were deposited
in the Potato Gene Bank (http://www.ars-grin.
gov/nr6/; most easily found by searching for
germplasm developed by Veilleux) or provided to
the International Potato Center (accession CIP
801092). One of the heterozygous anther donor
clones, BARD 1-3, is also maintained at the US
Potato Gene Bank as accession GS 224. As the
response to anther culture was found to be a
highly hereditable trait (Taylor and Veilleux
1992), seedling families obtained from crosses
between anther-derived doubled monoploids and
a range of heterozygous pollinators can be
expected to respond to anther culture. Such
seedling families have been generated at CIP,
Virginia Tech and elsewhere. Likewise, tetraploid
somatic hybrids derived by intermonoploid pro-
toplast fusions (Lightbourn and Veilleux 2007)
also respond positively to anther culture and
represent heterozygous potato germplasm where
all alleles would have passed through the mono-
ploid sieve (Wenzel et al. 1979). One of these
somatic hybrids is maintained by the US Potato
Gene Bank as accession GS 220 (https://
npgsweb.ars-grin.gov/gringlobal/accessiondetail.
aspx?id=1648798). Hence, a limited variety of
homozygous potato germplasm has been made
4 Genetic Stocks Used for Potato Genome Sequencing
Fig. 4.4 Tubers of
DM BARD 1-3 516 R44
available in recent years; most generated through
haploid extraction with the aim of facilitating
genetic studies rather than direct breeding
applications.
When the Potato Genome Sequencing Con-
sortium (PGSC) became frustrated with attempts
to assemble the sequence of the heterozygous
dihaploid potato clone, RH89-039-16, a search for
homozygous potato germplasm that might be
more amenable to sequencing using available
Sanger, Roche 454 Pyrosequencing and Illumina
Sequencing by Synthesis platforms was initiated.
DM BARD 1-3 516 R44 (DM) was available at
both Virginia Tech and CIP, facilitating its distri-
bution to partner institutions in the PGSC. It had
been extracted as one of many monoploids from
heterozygous adapted Phureja clone BARD 1-3,
then subjected to chromosome doubling by leaf
disc regeneration (Paz and Veilleux 1999). The
designation R44 is simply the 44th shoot regen-
erated that was later identified as a diploid. As with
most selections of Phureja, DM prefers a cool
season (22 °C days/16 °C nights); under these
conditions, it will grow slowly but, once estab-
lished, will flower (white flowers) and set fruit
when pollinated by a fertile diploid potato selec-
tion. Although it produces stainable pollen, there
are no reports of pollen fertility. It tuberizes after a
few weeks, sooner if grown under a short 12 h
photoperiod, later if grown under a long 16 h
photoperiod. The tubers (Fig. 4.4) are fingerling,
yellow fleshed, slightly and variably red-skinned
and have poor keeping quality as they often exhibit
tuber end rot even when still attached to the mother
plant. Because of its homozygosity in intergenic as
well as genic regions of the genome, the DM
genome sequence was assembled rapidly and
published in 2011 (The Potato Genome
77
Sequencing Consortium 2011) where 86% of the
844 Mb genome was assembled and some 39,000
genes predicted. The genome assembly was later
improved through marker analysis of a backcross
population of DD x (DM x DD) where DD was a
heterozygous clone of S. tuberosum Group Andi-
genum Goniocalyx cultivar group (Sharma et al.
2013).
4.2 Conclusion
As of March, 2017, the original publication of
the DM sequence has been cited more than 500
times, providing a framework for studies of gene
families (Charfeddine et al. 2015; Gao et al.
2016; Ma et al. 2016; Schreiber et al. 2014; Seo
et al. 2016; Tang et al. 2016; Van Harsselaar
et al. 2017), a scaffold for alignment of tran-
scriptomic data (Campbell et al. 2014; Gong
et al. 2015; Goyer et al. 2015; Liu et al. 2015;
Morris et al. 2014; Tang et al. 2014) or a refer-
ence genome against which to discover genomic
variation (Hardigan et al. 2016), to cite just a
few. As sequencing platforms improve, the DM
assembly will likely be supplanted by that of a
more robust commercial potato line. In the
meantime, it will have served its purpose to bring
this genetically clumsy, yet important, crop into
the genomic era.
References
Campbell R, Pont SDA, Morris JA, McKenzie G,
Sharma SK, Hedley PE, Ramsay G, Bryan GJ,
Taylor MA (2014) Genome-wide QTL and bulked
transcriptomic analysis reveals new candidate genes
for the control of tuber carotenoid content in potato
78
(Solanum tuberosum L.). Theor Appl Genet 127
(9):1917–1933
Charfeddine S, Saidi MN, Charfeddine M,
Gargouri-Bouzid R (2015) Genome-wide identifica-
tion and expression profiling of the late embryogenesis
abundant genes in potato with emphasis on dehydrins.
Mol Biol Rep 42:1163–1174
De Vries SE, Ferwerda MA, Loonen A, Pijnacker LP,
Feenstra WJ (1987) Chromosomes in somatic hybrids
between Nicotiana plumbaginifolia and a monoploid
potato. Theor Appl Genet 75(1):170–176
Gao JP, Cao XL, Shi SD, Ma YL, Wang K, Liu SJ,
Chen D, Chen Q, Ma HL (2016) Genome-wide survey
of Aux/IAA gene family members in potato (Solanum
tuberosum): Identification, expression analysis, and
evaluation of their roles in tuber development.
Biochem Biophys Res Commun 471(2):320–327
Glendinning DR (1975) Neo-tuberosum: new potato
breeding material. 2. A comparison of
neo-tuberosum with unselected Andigena and with
Tuberosum. Potato Res 18(3):343–350
Golmirzaie AM, Bretschneider K, Ortiz R (1998a)
Inbreeding and true seed in tetrasomic potato. II.
Selfing and sib-mating in heterogeneous hybrid pop-
ulations of Solanum tuberosum. Theor Appl Genet 97
(7):1129–1132
Golmirzaie AM, Ortiz R, Atlin GN, Iwanaga M (1998b)
Inbreeding and true seed in tetrasomic potato. I. Selfing
and open pollination in Andean landraces (Solanum
tuberosum Gp. Andigena). Theor Appl Genet 97
(7):1125–1128
Gong L, Zhang HX, Gan XY, Zhang L, Chen YC, Nie FJ,
Shi L, Li M, Guo ZQ, Zhang GH, Song YX (2015)
Transcriptome profiling of the potato (Solanum
tuberosum L.) plant under drought stress and
water-stimulus conditions. PLoS ONE 10(5):
e0128041
Goyer A, Hamlin L, Crosslin JM, Buchanan A, Chang JH
(2015) RNA-seq analysis of resistant and susceptible
potato varieties during the early stages of potato virus
Y infection. BMC Genom 16:472
Hagberg A, Tedin O (1951) Inter- and intraclonal crosses
and inbreeding in potatoes. Hereditas 37(1–2):280–
287
Hardigan MA, Crisovan E, Hamilton JP, Kim J, Laim-
beer P, Leisner CP, Manrique-Carpintero NC, New-
ton L, Pham GM, Vaillancourt B, Yang XM,
Zeng ZX, Douches DS, Jiang JM, Veilleux RE,
Buell CR (2016) Genome reduction uncovers a large
dispensable genome and adaptive role for copy
number variation in asexually propagated Solanum
tuberosum. Plant Cell 28(2):388–405
Haynes FL (1972) The use of cultivated diploid Solanum
species in potato breeding. In: French ER
(ed) Prospects for the potato in the developing world:
an international symposium on key problems and
potentials for greater use of the potato in the
developing world, Lima, Peru. International Potato
Center (CIP), pp 100–110
R. E. Veilleux
Huáman Z, Spooner DM (2002) Reclassification of
landrace populations of cultivated potatoes (Solanum
sect. Petota). Am J Bot 89(6):947–965
Huarte MA, Plaisted RL (1984) Selection for tuberosum
likeness in the vines and in the tubers in a population
of Neotuberosum. Am Potato J 61(8):461–473
Hulme JS, Higgins ES, Shields R (1992) An efficient
genotype-independent method for regeneration of
potato plants from leaf tissue. Plant Cell Tiss Org
Cult 31(2):161–167
Hutten RCB, Soppe WJJ, Hermsen JGT, Jacobsen E
(1995) Evaluation of dihaploid populations from potato
varieties and breeding lines. Potato Res 38(1):77–86
Johnson AAT, Piovano SM, Ravichandran V, Veilleux RE
(2001) Selection of monoploids for protoplast fusion
and generation of intermonoploid somatic hybrids of
potato. Am J Potato Res 78(1):19–29
Krantz EA (1946) Potato breeding methods. III. A sug-
gested procedure for potato breeding. Bulletin of
Minnesota Agricultural Experimental Station No. 173
Lightbourn GJ, Veilleux RE (2007) Production and
evaluation of somatic hybrids derived from monoploid
potato. Am J Potato Res 84(5):425–435
Liu BL, Zhang N, Wen YK, Jin X, Yang JW, Si HJ,
Wang D (2015) Transcriptomic changes during tuber
dormancy release process revealed by RNA sequenc-
ing in potato. J Biotechnol 198:17–30
Lough RC, Varrieur JM, Veilleux RE (2001) Selection
inherent in monoploid derivation mechanisms for
potato. Theor Appl Genet 103(1):178–184
M’Ribu HK, Veilleux R (1992) Fertility of doubled
monoploids of Solanum phureja. Am Potato J 69
(7):447–459
Ma HL, Cao XL, Shi SD, Li SL, Gao JP, Ma YL, Zhao Q,
Chen Q (2016) Genome-wide survey and expression
analysis of the amino acid transporter superfamily in
potato (Solanum tuberosum L.). Plant Physiol Bio-
chem 107:164–177
Morris WL, Hancock RD, Ducreux LJM, Morris JA,
Usman M, Verrall SR, Sharma SK, Bryan G,
McNicol JW, Hedley PE, Taylor MA (2014) Day length
dependent restructuring of the leaf transcriptome and
metabolome in potato genotypes with contrasting tuber-
ization phenotypes. Plant Cell Environ 37(6):1351–1363
Paz MM, Veilleux RE (1997) Genetic diversity based on
randomly amplified polymorphic DNA (RAPD) and
its relationship with the performance of diploid potato
hybrids. J Am Soc Hort Sci 122(6):740–747
Paz MM, Veilleux RE (1999) Influence of culture medium
and in vitro conditions on shoot regeneration in
Solanum phureja monoploids and fertility of regener-
ated doubled monoploids. Plant Breed 118(1):53–57
Rokka VM (2009) Potato Haploids and Breeding. In:
Touraev A, Forster BP, Jain SM (eds) Advances in
haploid production in higher plants. Springer, New
York, pp 199–208
Schreiber L, Nader-Nieto AC, Schonhals EM, Walke-
meier B, Gebhardt C (2014) SNPs in genes functional
in starch-sugar interconversion associate with natural
4 Genetic Stocks Used for Potato Genome Sequencing
variation of tuber starch and sugar content of potato
(Solanum tuberosum L.). G3: genes|genomes |. Genet-
ics 4(10):1797–1811
Seo E, Kim S, Yeom SI, Choi D (2016) Genome-wide
comparative analyses reveal the dynamic evolution of
nucleotide-binding leucine-rich repeat gene family
among Solanaceae plants. Front Plant Sci 7:1205
Sharma SK, Bolser D, de Boer J, Sønderkær M, Amoros W,
Carboni MF, D’Ambrosio JM, de la Cruz G, Di
Genova A et al (2013) Construction of reference
chromosome-scale pseudomolecules for potato: inte-
grating the potato genome with genetic and physical
maps. G3: Genes|Genomes|Genetics 3:2031–2047
Spooner DM, Núñez J, Trujillo G, Herrera MD, Guzmán
F, Ghislain M (2007) Extensive simple sequence
repeat genotyping of potato landraces supports a major
reevaluation of their gene pool structure and classifi-
cation. Proc Nat Acad Sci USA 104(49):19398–19403
Tang X, Datema E, Guzman MO, de Boer JM, van
Eck HJ, Bachem CWB, Visser RGF, de Jong H (2014)
Chromosomal organizations of major repeat families
on potato (Solanum tuberosum) and further exploring
in its sequenced genome. Mol Genet Genomics 289
(6):1307–1319
Tang RM, Zhu WJ, Song XY, Lin XZ, Cai JH, Wang M,
Yang Q (2016) Genome-wide identification and
function analyses of heat shock transcription factors
in potato. Front Plant Sci 7:490
Taylor TE, Veilleux RE (1992) Inheritance of compe-
tences for leaf disk regeneration, anther culture, and
protoplast culture In Solanum phureja and correlations
among them. Plant Cell Tiss Org Cult 31(2):95–103
79
The Potato Genome Sequencing Consortium (2011)
Genome sequence and analysis of the tuber crop
potato. Nature 475(7355):189–195
Uijtewaal BA, Huigen DJ, Hermsen JG (1987a) Produc-
tion of potato monohaploids (2n = x =12) through
prickle pollination. Theor Appl Genet 73(5):751–758
Uijtewaal BA, Jacobsen E, Hermsen JGT (1987b) Mor-
phology and vigor of monohaploid potato clones, their
corresponding homozygous diploids and tetraploids
and their heterozygous diploid parent. Euphytica 36
(3):745–753
Van Harsselaar JK, Lorenz J, Senning M, Sonnewald U,
Sonnewald S (2017) Genome-wide analysis of starch
metabolism genes in potato (Solanum tuberosum L.).
BMC Genomics 18
Veilleux RE, Booze-Daniels J, Pehu E (1985) Anther
culture of a 2n pollen producing clone of Solanum
phureja Juz. and Buk. Can J Genet Cytol 27(5):559–
564
Veilleux RE, Lauer FI (1981) Breeding behavior of yield
components and hollow heart in tetraploid-diploid vs
conventionally derived potato hybrids. Euphytica 30
(3):547–561
Veilleux RE, Shen LY, Paz MM (1995) Analysis of the
genetic composition of anther-derived potato by
randomly amplified polymorphic DNA and simple
sequence repeats. Genome 38(6):1153–1162
Wenzel G, Schieder O, Przewozny T, Sopory SK,
Melchers G (1979) Comparison of single cell-culture
derived Solanum tuberosum L. plants and a model for
their application in breeding programs. Theor Appl
Genet 55(2):49–55
 Strategies and Tools for Sequencing
and Assembly of Plant Genomes 5
D. C. Mishra, S. B. Lal, Anu Sharma, Sanjeev Kumar,
Neeraj Budhlakoti and Anil Rai

Abstract
This chapter highlights strategies and tools for sequencing and assembly
of plant genomes. It discusses in brief the methods of sequencing
technologies (the first, second and third generations), details the
approaches of genome assembly (the de novo and reference assembly)
and presents the challenges of plant genome assembly.

sequencing has greatly improved, but also sig-

5.1 Introduction
nificantly reduced the associated cost.
The efficiency of assembling the plant genome
In general, plant genomes have higher ploidy,
depends on sequencing technology and type of
higher rates of heterozygosity and repeats. Fur-
assembler used. Broadly, there are two types of
thermore, the gene content in plants can be very
approaches of assemblies being used by the sci-
complex, as shown by the presence of large gene
entific communities, i.e. de novo assembly and
families and abundant pseudogenes with nearly
reference-based assembly. De novo genome
identical sequences derived from recent whole
assemblers are used for the reconstruction of
genome duplication events and transposon
novel genomes from a collection of reads without
activity. In order to understand the complexity of
any reference genomes, whereas reference-based
the plant genomes, DNA sequencing and its
assembly is highly dependent on the availability
assembly are very important. Thus, genome
of the reference genomes of the same or closely
sequencing and its assembly have been major
related species. During the last decade, efforts
priorities in plant genetic research during the past
have been made to develop de novo assemblers
25 years. With rapid advancements in sequenc-
to work on short read sequences generated by
ing technologies, not only the efficiency of
Next Generation Sequencing (NGS) technolo-
gies. NGS technologies are highly efficient in
terms of cost and time as compared to the tra-
D. C. Mishra
S. B. Lal
A. Sharma
S. Kumar
N. Budhlakoti
A. Rai (&) ditional Sanger’s approach (Sanger et al. 1977).
Center for Agricultural Bioinformatics, ICAR-Indian The emergence of short read sequencing imposes
Agricultural Statistics Research Institute, New Delhi, new challenges in assembling plant genomes due
India to their size and complex nature. The de novo
e-mail: anilrai@iasri.res.in

© Springer International Publishing AG 2017 81

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_5
82
assembly of plant genomes from these short read
sequences leads to a large number of contigs and
low N50 values, mainly due to the complexity of
the genome and the presence of conserved
regions. These limitations of short read
sequencing technologies have been addressed by
third generation, long read sequencing tech-
nologies. The simplicity offered by long read
sequencing is often offset by low accuracy with
the error rates of 10–20% of the generated
sequences.
For all the above reasons, de novo assembly
of a plant genome poses great challenges in spite
of the availability of varied platforms of genome
sequencing. Assembling a plant genome requires
high coverage, long read length and high quality
with a low error rate. It may be noted that it is
necessary to integrate the sequences from dif-
ferent sequencing platforms in order to have a
quality plant genome assembly.
The existing assemblers are mostly
platform-dependent and are unable to handle the
integration of data coming from different plat-
forms. This further increases the computational
complexity of the genome assembly process.
Moreover, the available genome assemblers are
either based on serial processing or based on very
limited use of parallel processing technology.
A number of genome assembly algorithms have
been developed incorporating the benefits of
short and long read sequences for de novo hybrid
assembly (Jason et al. 2010).
5.2 Sequencing Technologies
DNA sequencing determines the exact order of
nucleotides in a given DNA molecule, i.e. this
process determines the order of the four bases:
(1) adenine; (2) guanine; (3) cytosine; and
(4) thymine. With the advances in DNA
sequencing methods, the pace of biological
research and discovery has been accelerated.
Sequencing of DNA molecules started in the
early 1970s with the development of the
Maxam-Gilbert method, followed by the Sanger
method, based on chain termination approach
D. C. Mishra et al.
during the same period. Subsequently, due to the
development of fluorescence-based sequencing
methods along with automated analysis, this
DNA sequencing process has become easier and
faster. Gradually, DNA sequencing moved from
traditional cloning DNA molecules to PCR based
amplification analysis. Currently, the DNA
sequencing is based on Single Molecule Real
Time Sequencing (SMRT) methods.
5.2.1 First-Generation Sequencing
Methods
The Maxam-Gilbert method was the first method
of sequencing a DNA molecule. This method is
based on radioactive labelling of DNA molecule
at the 5′ end. In this, chemical cleavages at
variable positions specific to four nucleotide
reactions (G, A+G, C, C+T) are labelled (Maxam
and Gilbert 1977). Therefore, a series of labelled
fragments are generated by different chemical
reactions. Fragments of four different reactions
are electrophoresed using acrylamide gels for
size separation.
Sanger’s method was developed after the
Maxam-Gilbert technique. This method uses a
special chemical compound, dideoxynucleoside
triphosphates (ddNTPs), which lacks the hydro-
xyl group in the 3′ position. In this process,
sequencing starts with synthetic 5′-end-labelled
fragment, having oligodeoxynucleotide as a pri-
mer, polymerase and template DNA molecule.
Every polymerization reaction requires the nor-
mal deoxynucleotide triphosphates (dNTPs) at a
high concentration and one of the four ddNTPs at
a low concentration. With the addition of DNA
polymerase, the sequencing of DNA molecule is
extended until a ddNTP is encountered. With an
optimum dNTP: ddNTP ratio, the DNA chain
will terminate at a variable length [30]. The ter-
minated chain will always be identified with the
help of a specific ddNTP. Hence, the resulting
sequence can be obtained by reading the
respective gel lane. Therefore, the original
sequence of DNA can be obtained by reading the
sequencing gel from bottom to top (Fig. 5.1).
5 Strategies and Tools for Sequencing and Assembly …
Fig. 5.1 Gel lane of
Sanger’s sequencing method
(Sanger et al. 1977)
5.2.2 Second-Generation Sequencing
The first-generation sequencing technologies are
resource-inefficient in terms of cost and time. For
example, the draft assembly of the rice (Oryza
Sativa) genome of size 390 MB took approxi-
mately around 5 years using Sanger’s approach,
while the wheat (Triticum aestivum) genome is
40 times larger and more complex than the rice
genome, if Sanger’s method had been used, the
assembly of wheat genome would have taken
more than a century. Therefore, there was an
urgent need to develop a faster sequencing
technology to sequence plant genomes. Keeping
in mind the above need, a number of second
generation sequencing technologies such as
Pyrosequencing, Roche/454, Illumina, SOLiD
and IonTorrent have been developed.
Pyrosequencing is a second-generation
sequencing technology based on the sequencing
by synthesis principle. In this sequencing
method, primer is hybridized to a single-stranded
DNA molecule and determination of sequence is
based on the detection of pyrophosphate
Fig. 5.2 Sequential steps of pyrosequencing
83
(PPi) released during this process. It simply
requires the DNA templates to be sequenced,
DNA polymerase, sequencing primer, APS
(adenosine-5`-phosphosulphate), luciferin and
other enzymes. Different dNTPs are sequentially
added to this mixture and based on the chemical
reaction and release of pyrophosphate target, a
template is sequenced. The process of pyrose-
quencing could easily be understood through
following reactions (Fig. 5.2).
This sequencing technology of Roche/454 is
based on the concept of Emulsion PCR. In this
sequencing process, first, the ssDNA library is
prepared using suitable adapters, which was
followed by its annealing with an excess of DNA
beads. Also, these beads are washed to filter
untethered strands, which are then subjected to a
hybridization-based enrichment. Further, four
DNA nucleotides were added subsequently and
the DNA polymerase reaction extends the
nucleotide chain by adding complementary
nucleotides. Addition of these nucleotides gen-
erates a specific signal which is captured by a
Charge Coupled Device (CCD) camera.
84
The most popular technology of
second-generation sequencing is Illumina. It is
based on the concept of Bridge PCR. In this, a
DNA library is prepared using ligation of a suit-
able adapter which is further enriched by using
Bridge PCR, i.e. solid phase amplification. The
sequencing process starts by adding labelled
modified nucleotide (reversible terminators),
DNA polymerase and sequencing primer. Tem-
plates are sequenced in parallel by adding a single
base at a time. These bases compete with each
other to bind with templates and added nucleotide
is identified using a laser. This natural competition
among nucleotides improves the accuracy. This
sequencing technology has overcome the draw-
back of Roche/454 by controlling the homopoly-
mer error.
In the case of SOLiD, the sequencing process
has two choices of sample preparation, i.e.
(1) single DNA fragment library generation; and
(2) mate pair library generation. Then, this DNA
library is amplified on beads using emulsion
PCR. These enriched beads are ligated to
sequencing primer and fluorescently labelled by
di-base probe where each fluorescent dye repre-
sent four of sixteen di-nucleotide sequences.
Sequencing reaction starts with hybridization of
complementary probes and ligated. Dye is
cleaved off after measurement of fluorescence.
Subsequently new primer is hybridized with one
length greater than earlier and this process is
repeated. This sequencing platform provides the
dual measurement of each base, hence accuracy
is improved.
Ion-Torrent is a faster sequencing technology
which is based on the release of hydrogen atoms
during elongation of the DNA chain. This tech-
nology relies on a semi-conductor-based detec-
tion system. This sequencing process starts with
library preparation, enrichment of reads and
release of the hydrogen ion after incorporation of
the nucleotides to ssDNA (Quail et al. 2012).
This release of the hydrogen ion alters the pH of
the chemical mixture, resulting in a change of
voltage. This fluctuation in voltage indicates the
incorporated nucleotide. This process occurs
simultaneously in millions of wells.
D. C. Mishra et al.
5.2.3 Third-Generation Sequencing
The second-generation sequencing technologies
are based on short read sequencing. However,
around 200 plant genomes were sequenced by
now. due to the low cost of sequencing and the
faster rate of data generation. But the chromo-
some levels of de novo assembled sequences are
available only for a few plant genomes. Most of
these plant genome assemblies based on short
read sequencing have a large number of contigs
and scaffolds. This is due to the fact that the plant
genomes are highly repetitive in nature, due to the
transposable elements and are also large in
genome size. For example, the genome size of the
pine tree is more than 20 GB. Therefore, a
number of third-generation sequencing technolo-
gies were developed to overcome the problem of
short read sequencing. The four major techno-
logical developments in this area are: (1) Helis-
cope Sequencing; (2) Pacific Biosciences;
(3) Oxford Nanopore Technologies Limited; and
(4) Illumina—Synthetic Long Read (SLR).
Heliscope sequencing was developed by
Helicos Biosciences. It is based on the principle
of Single Molecule Real Time (SMRT)
sequencing. In this, a DNA sequence is sheared
into small pieces of around hundred base pair,
then Poly A nucleotides with labelled fluores-
cence are added to 3′-end of each DNA fragment.
These modified DNA sequence are then hybri-
dized to Helicos flow cells, having millions of
oligo T’s immobilized in the flow cell surface.
Furthermore, this hybridized molecule is loaded
into the Helicos instrument. The flow cell is
incorporated with the addition of fluorescently
labelled nucleotide and DNA polymerase. An
image is taken by CCD camera and the nucleo-
tide is identified based on fluorescence specific to
nucleotides.
The technology developed by Pacific Bio-
sciences is most widely used for long read
sequencing technology based on SMRT
sequencing (Quail et al. 2012). The sequencing
process starts with the addition of polymerase,
nucleotide (phosphor linked with different
fluorescence). Here phosphor-linked nucleotide
5 Strategies and Tools for Sequencing and Assembly …
carries the fluorescence to the phosphate rather
than to the base. The activity of individual
molecules is observed in Zero-Mode Waveg-
uides (ZMW).
Nanopore sequencing technology has been
developed by Oxford. In this process, the DNA
molecule is passed through a nanopore mem-
brane and voltage is applied across this mem-
brane (Mikheyev and Tin 2014). Flow of ion
through the pores creates a current and the passed
nucleotide is identified through a specific pattern
of current (Laver et al. 2015).
Synthetic Long Read (SLR) sequencing
technology was developed by Illumina. This
technology is based on the generation of long
reads through short read sequences of Illumina.
In this, a long fragment of DNA has been dis-
tributed into multiple tiny fragments and these
tiny fragments are sequenced after bar-coding
using the Illumina short read sequencing. These
bar-coded tiny fragments are assembled into a
synthetic long read. Different sequencing tech-
nology platforms are compared in Table 5.1
(Glenn 2011; Liu et al. 2012; Mikheyev and Tin
2014; Niedringhaus et al. 2011; Shendure and Ji
2008; Quail et al. 2012).
5.3 Approaches of Genome
Assembly
In order to assemble the genome from the data
generated through different sequencing tech-
nologies, several genome assemblers have been
developed in the past two decades. The algo-
rithms of different assemblers differ in many
ways depending on: (1) type of reads (i.e. long
reads to short reads); (2) type of graph con-
struction; (3) way of sequencing the error cor-
rection; and (4) the ability to deal with different
length of fragments. Mainly two types of
assembling algorithms have been developed
according to the type of reads, i.e. long and short.
Short read assembling algorithms can be further
classified based on two approaches: (1) contig
extension; and (2) a de Bruijn graph. The de
Bruijn graph is a graph data structure that is
particularly suitable to represent the overlap
85
relationship of short read sequences. Several
short read assemblers based on de Bruijn graphs
have been developed. The most widely used
assemblers in this category include ALLPATHS
(Butle et al. 2008), Velvet (Zerbino and Birney
2008), ABySS (Simpson et al. 2009) and
SOAPdenovo (Li et al. 2010). In the case of
contig extension algorithms, a greedy algorithm
is used in which overlapped areas among
sequences are identified and merged, this process
continues till no overlapping sequence is found.
Some contig extension-based assemblers are
SSAKE (Warren et al. 2007), PE-Assembler
(Ariyaratne and Sung 2011) and SHARCGS
(Dohm et al. 2007). However, this approach is
not efficient in the case of plant genome assem-
bly due to high repetitive regions. It may be
noted that short read sequencing is useful for
genome assembly of some species but is not able
to resolve major repeat families of the plant
genome.
Overlap Layout Consensus (OLC) is generally
used for assembling long read sequences. Over-
lap graphs work well if there is a small number of
reads with significant overlap. However, this
method is computationally expensive for large
plant genomes. The complexity of pairwise
sequence alignment is quadratic in terms of
number of reads. Recent advances in sequencing
technologies such as SMRT have the capability
to resolve repetitive structures in the assembly
graph. A number of assembly algorithms have
been developed to resolve the repetitive struc-
tures of the plant genome sequences. In this
regard, MIRA is one of the OLC-based assem-
blers, which uses both high as well as low quality
regions of the genome along with repetitive
region tags. Some of the OLC-based assemblers
use the MinHash Alignment algorithm. This is a
probabilistic algorithm and able to detect over-
laps efficiently between reads. Furthermore, it
uses a dimensionality reduction technique called
MinHash to create more compact representation
of sequence reads and reduce space complexity.
Other approaches for OLC-based assemblers use
supervised learning to detect overlaps to improve
the quality of contigs and classify homogeneous
sequences in the data. In contrast to short read
 86

Table 5.1 Comparison of different DNA sequencing methods

Method Sanger Ion Torrent 454 (Roche) Illumina HiSeq 2500 SOLiD PacBio Oxford Nanopore
(Rapid Run) (MinION)
Read 600–1000 200 700 2  250 2  60 1.0–1.5  104 on 2–5  103 on average
length average
(bp)
Error rate 0.001 1 1 0.1 5 15–20 15–20
(%)
Reads per 96 8.2  107 1  106 1.2  109 (paired) 8  108 3.5–7.5  104 1.1–4.7  104
run
Time per 0.5–3 h 2–4 h 23 h 1–6 days 6 days 0.5–4 h 50 h
run
Strength High quality, Faster run Long read size High sequence yield, Low cost Longest read length Minimal sample
long read length time, Low cost and Fast low error rate per base preparation, long read
length
Weakness High cost low Small read Low yield, Small read length Small Low sequence yield, High error rate
throughput length Homopolymer read high error rate
error length
D. C. Mishra et al.
5 Strategies and Tools for Sequencing and Assembly …
assemblers, long read assemblers are good at
resolving the repeat regions but suffer from low
accuracy.
Plant genome assembly is a very complex
procedure which depends on many factors such
as the size of the genome, the repeat regions,
heterogeneity, polyploidy and other factors.
Depending upon the availability of the reference
genome of closely related species and the size of
the reads, genome assembly is broadly classified
into three categories: (1) reference or compara-
tive assembly; (2) de novo assembly; and
(3) hybrid assembly.
5.3.1 Reference Assembly
Reference assembly is used only when the
assembled genome of the same species or closely
related species is available. In this approach,
reads are mapped to the reference genome which
forms the layout of the overlapping reads and
finally a consensus sequence is produced. Ref-
erence assembly consists of three major steps:
1. Read alignment.
2. Layout refinement.
3. Consensus sequence generation.
5.3.1.1 Step 1: Read Alignment
In this step, each read is aligned with the avail-
able reference genome. In order to obtain the
chains of mutually consistent matches, the
Longest Increasing Subsequences (LIS) algo-
rithm is used. The objective of this algorithm is
to find the length of the longest subsequence of a
given sequence such that the length of all the
subsequences are arranged in ascending order. In
this way the LIS algorithm produces the layout of
the overlapping reads.
5.3.1.2 Step 2: Layout Refinement
The layout generated by the read alignment to the
reference genome has many constraints, such as
the presence of indels, the rearrangement
between the target and the reference genome, etc.
Due to these constraints, accurate mapping of the
87
reads to the reference genome is difficult. Con-
sequently, only a partial number of reads are
mapped to the reference genome. Therefore, it is
essential to go for the refinement of the layout
formed by the read alignment step. Layout
refinement is the most difficult step in
reference-based assembly. In this step, recon-
struction of indels information is done by fol-
lowing de novo assembly of these reads in the
mismatched part of the target genome.
5.3.1.3 Step 3: Consensus Sequence
Generation
In this step, a Multiple Sequence Alignment
(MSA) algorithm is used for the generation of a
consensus sequence. For each of the refined
layouts, MSA is applied to find the overlapped
reads for the generation of the consensus
sequence. Here, the MSA algorithm follows an
iterative approach to find the final consensus
sequence. In each iteration, a pairwise alignment
between each read and current consensus
sequence is carried out to find the next consensus
sequence. This process is repeated until the new
consensus sequence is same as the previous one.
This consensus sequence is called a contig.
5.3.1.4 Step 4: Scaffold Generation
The contigs obtained lack the information
regarding their order and orientation. Scaffolds
are generated by combining contigs together in
the proper order and orientation. Scaffold gen-
eration requires the information of mate pair,
physical/genetic map or some additional infor-
mation, such as BAC library, optical mapping,
long-range HI-C interaction, etc.
5.3.2 De Novo Assembly
The de novo assembly needs to be done in the
absence of the availability of a reference.
Therefore, the assembly of the plant genome is
done right from scratch (Chaisson et al. 2004,
2009). There are two broad approaches: (1) OLC;
and (2) a de Bruijn graph (DBG) approach based
on the read length for the de novo assembly.
88
5.3.2.1 Approach 1: Overlap Layout
Consensus (OLC)
It is desirable to use OLC for assembling plant
genomes using long read sequences due to the
fact of obtaining desirable overlap regions
among the sequences. The performance of the
OLC approach is poor in the case of short read
sequencing as in the case of assembling short
read sequences both time and space complexities
are very high. Also, this approach is highly
computational-intensive and not suitable for
large numbers of reads (i.e. short reads of large
genomes). Assembly based on OLC is performed
using following steps:
Step 1: Identification of Candidate Overlap
Sequence overlaps are identified by constructing
an overlap graph by pair-wise comparison of
each read to other reads. Nodes in the overlap
graph represent reads while sequence overlaps
are shown by edges.
Step 2: Fragment Layout Formation
Fragment layout formation is done through
bundling stretches of overlaps, which satisfies the
prefixed criterion of (1) minimum length of
overlaps; (2) maximum length of overhangs;
(3) minimum similarity in the overlapping
region; and (4) maximum number of local errors.
Step 3: Consensus Sequence Generation
An overlap graph is traversed to find the simple
path for a consensus sequence generation. This
path is obtained by traversing through all the
nodes and edges and keeping the node in the path
at most once.
5.3.2.2 Approach 2: De-Bruijn Graph
(DBG)
The DBG-based approach is also known as the
k-mer graph approach, and requires the genera-
tion of k-mers of reads for graph construction
(Chaisson et al. 2004). A de Bruijn graph is a
form of directed graph of the same in and out
degrees where each node represents k-mer and
edges represent the overlaps between the reads.
In this way, contigs are generated by traversing
the Eulerian path in the graph. This approach is
D. C. Mishra et al.
comparatively faster than OLC. However, in the
case of long reads, its performance is not satis-
factory due to the increase in computational
complexity. The following problems may occur
during the formation of contigs from a k-mer
graph:
1. In the case of a low coverage sequencing, a
tip, i.e. a short, dead-end divergence from the
main path is formed (Fig. 5.3a).
2. Plant genomes are often very heterozygous or
polymorphic. In such cases, bubbles may be
formed in k-mer graph (Fig. 5.3b).
3. Plant genomes are highly repetitive in nature,
due to which a frayed rope-like structure, i.e.
convergent and divergent paths may be
formed (Fig. 5.3c).
The contig formation is followed by scaffold
generation as discussed in step 4 of the OLC
approach.
5.3.2.3 Approach 3: Hybrid Assembly
Various sequencing platforms have some inher-
ent advantages and disadvantages. As already
discussed, some of these platforms produce large
reads with a high error rate (Pacific Biosciences)
while others generate short reads with high
accuracy (Illumina). Therefore, it is desirable to
use the sequencing data from both types of
(a)
(b)
(c)
Fig. 5.3 a Tip formation in k-mer graph, b Bubble
formation in k-mer graph, c Frayed rope formation in
k-mer graph
5 Strategies and Tools for Sequencing and Assembly …
platforms to improve the quality of plant genome
assembly. This approach is known as hybrid
assembly. There are various methods of hybrid
assembly where the data from different platforms
are combined either at the level of reads or at the
level of contigs. A method has been developed
for hybrid error correction and de novo assembly
of single-molecule sequencing reads (Koren et al.
2012). A hybrid assembly pipeline has been
developed using primary and secondary assem-
bly steps (Wang et al. 2012). Similarly, a method
of hybrid assembly of Illumina and Roche/454
data has been developed (Utturkar et al. 2014).
Also, there exists a hybrid error correction
method known as LoRDEC, that builds a suc-
cinct DBG representing the short reads, and
seeks a corrective sequence for each erroneous
region in the long reads by traversing chosen
paths in the graph by Salmela and Rivals (2014).
Further, a novel hybrid error correction algorithm
for long PacBio sequencing reads that uses
pre-assembled Illumina sequences for the error
correction has been developed (Lee et al. 2014).
A popular hybrid assembler named Jabba has
been developed, in which the hybrid method is
used to correct long third-generation reads by
mapping them onto a corrected DBG that was
constructed from second-generation data
(Miclotte et al. 2016). Recently one efficient
approach called DBG2OLC (Ye et al. 2016) has
been developed and used extensively. This
pipeline is executed through following steps:
• Generate contigs using de Bruijn graph
(DBG) from highly accurate NGS short reads.
The generated contigs are mapped to the long
reads and long reads are further compressed
into a list of contig identifiers.
• Multiple sequence alignment is used to clean
the errors present in the long reads.
• Following the OLC approach, a best overlap
graph of the cleaned compressed reads is
generated.
• A final consensus sequence is obtained by
decompressing the compressed long reads
and obtaining the simple path from the gen-
erated best overlap graph.
89
A description of some widely used plant
genome assembly tools is given in Table 5.2.
5.4 Issues and Challenges of Plant
Genome Assembly
Three major issues associated with the genome
assembly are: (1) computational complexity;
(2) biological complexity; and (3) the quality
genome finishing. The issues and challenges in
these areas are discussed below:
5.4.1 Computational Complexity
The plant genome assembly needs high-end
computational resources to assemble the
sequence fragment of DNA. Also, the assembly
programs should be able to handle large data sets
efficiently. Two major algorithms employed by
existing assemblers are based on OLC and the
DBG approach (Li et al. 2011). Each of these has
associated memory and space requirements. The
OLC-based approach was implemented in many
assemblers, namely, Celera, CABOG (Miller
2008) and MaSuRCA (Zimin et al. 2013). This
approach is computationally constrained by the
complicacy in the identification of overlaps
between reads. This step requires O(n2) pairwise
alignments, where, n is the number of reads, and
each pairwise alignment is O(nm) where n and m
are the lengths of the reads. Many variants of
OLC algorithm have been proposed by scholars
and researchers to reduce the time complexity in
the original algorithm, such as the use of dynamic
programming and indexing (Li et al. 2011).
Eulerian path-based DBG graphs using
k-mers are a much faster approach compared to
OLC, given the same computational memory (Li
et al. 2011). A major issue is the space com-
plexity which requires optimization. Some of the
widely used assemblers based on DBG are Vel-
vet for very short reads (Zerbino and Birney
2008), SOAPdenovo2 (Short Oligonucleotide
Analysis Package) (Luo et al. 2012), Minia
(Chikhi and Rizk 2012), Ray for parallel genome
90 D. C. Mishra et al.

Table 5.2 List of plant genome assembly tools

Assembler Input Acceptable technologies Year Assembler type
ABySS Genomic reads Solexa, SOLiD 2008 De novo
ALLPATHS-LG Genomic reads Solexa, SOLiD 2011 De novo
Celera WGA Genomic reads Sanger, 454, Solexa 2004 De novo and
Assembler reference
assembly
CLC Genomics Genomic reads Sanger, 454, Solexa, SOLiD 2008 De novo and
Workbench reference
assembly
DNASTAR Genomic reads, exomes, Illumina, ABI SOLiD, Roche 454, 2007 De novo
transcriptomes, metagenomes, Ion Torrent, Solexa, Sanger
ESTs
Newbler Genomic reads, ESTs 454, Sanger 2004 De novo
PASHA Genomic reads Illumina 2011 De novo
Phrap Genomic reads Sanger, 454, Solexa 1994 Reference
assembly
TIGR Assembler Genomic reads Sanger 1995 Reference
assembly
Trinity Transcriptomes short reads (paired, oriented, mixed) 2011 De novo
Illumina, 454, Solid, …
SOAPdenovo Genomic reads Solexa 2009 De novo
SPAdes Genomic reads Illumina, Solexa, Sanger, 454, Ion 2012 De novo
Torrent, PacBio, Oxford Nanopore
Velvet Genomic reads Sanger, 454, Solexa, SOLiD 2007 De novo
LoRDEC Genomic reads Illumina, PacBio 2014 Hybrid
assembler
DBG2OLC Genomic reads Illumina, PacBio, Oxford Nanopore 2016 Hybrid
assembler
Jabba Genomic reads Illumina, PacBio 2016 Hybrid
assembler

assemblies for parallel DNA sequencing (Bois- 5.4.2 Biological Complexity

vert et al. 2010), etc. The most
computational-intensive and space-intensive task
is the construction of the DBG graph. Algorithms
like Minia and SparseAssembler (Ye et al. 2012)
tackle the space complexity problem of DBG
algorithms, however, a sacrifice on accuracy and
runtime is made.
Assemblers based on a greedy algorithm
make use of a graph structure and the construc-
tion of a graph, which is a computationally
complex task. Even the greedy assembly algo-
rithms like SSAKE (Warren et al. 2007),
VCAKE (Jeck et al. 2007) and others are not
computationally efficient at graph construction.
Sequencing of large genomes scales up both the
biological and computational complexity during
the assembly process. Increasing the genome size
results in the increase in the number and type of
sub-clones, the number of sequence reads, the
computational resources requirement and the
demand for better assembly algorithms. Further,
this complexity increases with an increase in the
depth of coverage.
The presence of large repetitive/duplicated
regions enhances the generation of redundant
sequences in plant genomes, which may lead to
poor assembly of the genome. One of the
5 Strategies and Tools for Sequencing and Assembly …
primary difficulties in computational genome
assembly is to develop an algorithmic approach
capable of detecting stretches of repetitive DNA
without compromising the quality of the assem-
bly. Repetitive sequences complicate the assem-
bly as different pieces of sequence can share the
same repeat sequence but originating from dif-
ferent genomic locations. Since the pieces are put
together by searching for matching overlapping
nucleotides, these repeats can be put together
erroneously. Typically, for shotgun data, repeti-
tive sequences are revealed by clusters contain-
ing more overlapping reads than expected by
chance.
Another biological complexity of the plant
genomes arises due to polymorphism in plants.
A high degree of heterozygosity in plants can
complicate the assembly, depending on the
sequencing strategy and the assembly algorithm.
Some assemblers, such as Platanus (Kajitani
et al. 2014) or Spades (Bankevich et al. 2012),
perform comparatively better than others. Apart
from this, the assembly process of plant genomes
is further complicated by the chromosomal
structure. During the sequencing process, the
stem-loop structure of the centromere region of
the chromosome is generally ignored. Also, parts
of the telomere region are not properly
sequenced. These biological complexities create
problems during the assembly process of the
genome.
5.4.3 Genome Finishing
Genome assemblies produced by different
assemblers must be re-examined and reconsid-
ered with respect to low coverage of reads, poor
quality of data and inadequate handling of repeat
regions. This re-examination is performed man-
ually as well as with the help of automated tools
to elucidate the specific ambiguities. This pro-
cedure is known as genome finishing and it
consists of three main sub-processes, namely,
gap closure, assembly validation and genome
refinement.
The main approaches used for gap closure are:
(1) directed-PCR; (2) mate-pair libraries; and
91
(3) primer-walking. Mate-pair libraries are used
to infer the adjacency of contigs and filling the
gaps in the assembly. PCR experiments are used
in those situations where mate-pair libraries
cannot be used, such as regions with stem-loop
structure on the chromosome. Other relevant
information, such as BAC libraries, EST,
mRNA, physical map, etc. is used for the gap
closure. The recent techniques, such as optical
mapping, long-range-HI-C technique, are now
becoming popular for gap closure.
Analysis of the assembled contigs can be
performed using a number of tools. One of these
is Consed (Gordon et al. 1998), which allows the
navigation of the assembled contigs and reads.
Using this tool, problematic regions of the gen-
ome can be searched and tagged, based on dif-
ferent criteria for further inspection. Other tools
for a similar task are Autofinish (Gordon et al.
2001), BAC cardi (Bartels et al. 2005) and GAP4
(Bonfield et al. 1995).
Genome assembly validation and refinement
can be done using physical/genetic maps which
provide a context or scaffold for the sequence
assembly contigs. Genetic maps typically pro-
vide context in terms of simple sequence repeats
that generally occur near genic regions. The
availability of the genome sequence for a closely
related organism can also provide some support
for assembly validation. The assembly can also
be validated using molecular markers like SNPs,
SSRs, AFLP, RAPD, RFLP, etc. ESTs are also
useful for checking quality genome assembly as
well as genome refinement.
5.5 Conclusion
Plant genomes are relatively very complex in
nature and sequencing plant genome as well as
its assembly are still challenging tasks. However,
NGS technology has accelerated the process of
plant genome sequencing, but most of the
assembled plant genomes are highly fragmented
due to lack of a proper algorithm dealing with
biological and computational complexity. The
majority of existing algorithms are not able to
perfectly preserve the repetitive regions, the
92
regions of heterozygosity, structural variants, etc.
Thus, there is a need to develop better compu-
tational approaches to preserve the additional
information along with an efficient algorithm for
searching the shortest common superstring/
sequence and finding Eulerian walks in a DBG.
With the advances in the computing industry, the
cost of memory and cores has dropped remark-
ably and biologists are using cluster and
GPU-based systems for genome assembly. This
has considerably reduced the problem of com-
putational complexity. The process of plant
genome assembly can be further accelerated by
developing efficient algorithms using a paral-
lelized computing framework on GPU clusters.
Further, the big data analytic approach is another
promising area that may be applied for faster
genome assembly. The major challenge faced by
researchers is the modification of the existing
algorithm to recreate the biological truth.
References
Ariyaratne PN, Sung WK (2011) PE-Assembler: de novo
assembler using short paired-end reads. Bioinformat-
ics 27(2):167–174
Bankevich A, Nurk S, Antipov D, Gurevich AA,
Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI,
Pham S, Prjibelski AD, Pyshkin AV, Sirotkin AV,
Vyahhi N, Tesler G, Alekseyev MA, Pevzner PA
(2012) SPAdes: a new genome assembly algorithm
and its applications to single-cell sequencing. J Com-
put Biol 19:455–477
Bartels D, Kespohl S, Albaum S, Druke T, Goesmann A,
Herold J, Kaiser O, Puhler A, Pfeiffer F, Raddatz G,
Stoye J, Meyer F, Schuster SC (2005) BACCardI—a
tool for the validation of genomic assemblies, assisting
genome finishing and inter genome comparison.
Bioinformatics 21(7):853–859
Boisvert S, Laviolette F, Corbeil J (2010) Ray: simulta-
neous assembly of reads from a mix of
high-throughput sequencing technologies. J Comput
Biol 17:1519–1533
Bonfield J, Smith K, Staden R (1995) A new DNA
sequence assembly program. Nucleic Acids Res 23
(24):4992–4999
Butle J, MacCallum I, Kleber M, Shlyakhter IA, Bel-
monte MK, Lander ES, Nusbaum C, Jaffe DB (2008)
ALLPATHS: de novo assembly of whole-genome
shotgun microreads. Genome Res 18(5):810–820
Chaisson M, Pevzner P, Tang H (2004) Fragment assembly
with short reads. Bioinformatics 20:2067–2074
D. C. Mishra et al.
Chaisson MJ, Brinza D, Pevzner PA (2009) De novo
fragment assembly with short mate-paired reads: does
the read length matter? Genome Res 19:336–346
Chikhi R, Rizk G (2012) Space-efficient and exact de
Bruijn graph representation based on a Bloom filter.
Algorithms Mol Biol 8:22
Dohm JC, Lottaz C, Borodina T, Himmelbauer H (2007)
SHARCGS, a fast and highly accurate short-read
assembly algorithm for de novo genomic sequencing.
Genome Res 17(11):1697–1706
Glenn TC (2011) Field guide to next-generation DNA
sequencers. Mol Ecol Resour 11:759–769
Gordon D, Abajian C, Green P (1998) Consed: a
graphical tool for sequence finishing. Genome Res 8
(3):195–202
Gordon D, Desmarais C, Green P (2001) Automated
finishing with auto finish. Genome Res 11(4):614–625
Jason R, Miller SK, Sutton G (2010) Assembly algo-
rithms for next-generation sequencing data. Genomics
95:315–327
Jeck WR, Reinhardt JA, Baltrus DA (2007) Extending
assembly of short DNA sequences to handle error.
Bioinformatics 23:2942–2944
Kajitani R, Toshimoto K, Noguchi H, Toyoda A,
Ogura Y, Okuno M (2014) Efficient de novo assembly
of highly heterozygous genomes from whole-genome
shotgun short reads. Genome Res 24:1384–1395
Koren S, Schatz MC, Walenz BP, Martin J, Howard JT,
Ganapathy G, Wang Z, Rasko DA, McCombie WR,
Jarvis ED (2012) Hybrid error correction and de novo
assembly of single-molecule sequencing reads. Nature
Biotech 30:693–700
Laver T, Harrison J, O’Neill PA, Moore K, Farbos A,
Paszkiewicz K (2015) Assessing the performance of
the Oxford Nanopore Technologies MinION. Biomol
Detect Quantif 3:1–8
Lee H, Gurtowski J, Yoo S, Marcus S, McCombie WR,
Schatz M (2014) Error correction and assembly
complexity of single molecule sequencing reads.
bioRxiv doi:10.1101/006395
Li R, Zhu H, Ruan J, Qian W, Fang X, Shi Z, Li Y, Li S,
Shan G, Kristiansen K, Li S, Yang H, Wang JI,
Wang JU (2010) De novo assembly of human
genomes with massively parallel short read sequenc-
ing. Genome Res 20(2):265–272
Li Z, Chen Y, Mu D, Yuan J, Shi Y, Zhang H, Gan J,
Li N, Hu X, Liu B, Yang B, Fan W (2011)
Comparison of the two major classes of assembly
algorithms: overlap layout consensus and de-bruijn
graph. Brief Funct Genomics 11(1):25–37
Liu L, Li Y, Li S, Hu N, He Y, Pong R (2012)
Comparison of next-generation sequencing systems.
J Bio Med Res Int 2012:e251364
Luo R, Liu B, Xie Y, Li Z, Huang W, Yuan J, He G, Chen Y,
Pan Q, Liu Y, Tang J, Wu G et al (2012) SOAPdenovo2:
an empirically improved memory-efficient short read de
novo assembly. GigaScience 1:18
Maxum A, Gilbert W (1977) A new method for
sequencing DNA. Procd Natl Acad Sci 74:560–564
5 Strategies and Tools for Sequencing and Assembly …
Miclotte G, Heydari M, Demeester P, Rombauts S, Van
de Peer Y, Audenaert P, Fostier J (2016) Jabba: hybrid
error correction for long sequencing reads. Algorithms
Mol Biol 11:10
Mikheyev AS, Tin MMY (2014) A first look at the
Oxford Nanopore MinION sequencer. Mol Ecol
Resour 14:1097–1102
Miller JR (2008) Aggressive assembly of pyrosequencing
reads with mates. Bioinformatics 24(24):2818–2824
Niedringhaus TP, Milanova D, Kerby MB, Snyder MP
(2011) Barron Landscape of next-generation sequenc-
ing technologies. Anal Chem 83:4327–4341
Quail MA, Smith M, Coupland P, Otto TD, Harris SR,
Connor TR, Bertoni A, Swerdlow HP, Gu Y (2012) A
tale of three next generation sequencing platforms:
comparison of Ion Torrent, Pacific Biosciences and
Illumina MiSeq sequencers. BMC Genom 13:341
Salmela L, Rivals E (2014) LoRDEC: accurate and
efficient long read error correction. Bioinformatics
30:3506–3514
Sanger F, Nicklen S, Coulson AR (1977) DNA sequenc-
ing with chain-terminating inhibitors. Procd Natl Acad
Sci 74:5463–5467
Shendure J, Ji H (2008) Next-generation DNA sequenc-
ing. Nat Biotechnol 26:1135–1145
Simpson JT, Wong K, Jackman SD, Schein JE, Jones SJ,
Birol I (2009) ABySS: A parallel assembler for short
read sequence data. Genome Res 19:1117–1123
93
Utturkar SM, Klingeman DM, Land ML, Schadt CW,
Doktycz MJ, Pelletier DA, Brown SD (2014) Evalu-
ation and validation of de novo and hybrid assembly
techniques to derive high-quality genome sequences.
Bioinformatics 30:2709–2716
Wang Y, Yu Y, Pan B, Hao P, Li Y, Shao Z, Xu X, Li X
(2012) Optimizing hybrid assembly of next-generation
sequence data from Enterococcus faecium: a microbe
with highly divergent genome. BMC Systems Biol 6
(Suppl 3):S21
Warren RL, Sutton GG, Jones SJ, Holt RA (2007)
Assembling millions of short DNA sequences using
SSAKE. Bioinformatics 23:500–501
Ye C, Cannon CH, Ma ZS, Yu DW, Pop M (2012)
Sparseassembler2: Sparse k-mer graph for memory
efficient genome assembly. ArXiv:1108.3556
Ye C, Hill CM, Wu S, Ruan J, Ma Z (2016) DBG2OLC:
Efficient assembly of large genomes using long
erroneous reads of the third generation sequencing
technologies. Scientific Rep 6:31900–31906
Zerbino DR, Birney E (2008) Velvet: Algorithms for de
novo short read assembly using de Bruijn graphs.
Genome Res 18:821–829
Zimin AV, Marcais G, Puiu D, Roberts M, Salzberg SL,
Yorke JA (2013) The MaSuRCA genome assembler.
Bioinformatics 29(21):2669–2677
 High-Throughput Sequencing
of the Potato Genome 6
Virupaksh U. Patil, Nitya N. Sharma
and Swarup Kumar Chakrabarti

Abstract
Potato is globally the most important food crop, with the potential to be an
alternate staple food. It is being cultivated in over 125 countries on all five
continents. It is clonally propagated, highly heterozygous, auto-tetraploid,
and suffers acute inbreeding depression. Potato is the first crop to be
sequenced under the asteroid clade of eudicot plants that represent *25%
of flowering plant species. A total of 96.6 Gb raw data was generated
using the next generation sequencing (NGS) technologies, Pyrosequenc-
ing and Illumina GAII along with the conventional Sanger sequencing, to
complete the genome sequencing. The genome sequencing and its
successful alignment of the 827 Mb potato genome into un-gapped
super-scaffolds covering 93.9% of the total genome size of 840 Mb were
completed by the Potato Genome Sequencing Consortium (PGSC),
consisting of 26 institutes belonging to 13 countries. Ninety-nine per cent
of the aligned sequence fell into 443 super-scaffolds. It took nearly four
years for complete sequencing and assembling of the sequence. A brief
discussion of the entire potato genome sequencing using the next
generation sequencing technologies is covered in this chapter.

6.1 Introduction

Potato (Solanum tuberosum L.) is the world’s

V. U. Patil
N. N. Sharma
S. K. Chakrabarti (&)
Central Potato Research Institute, Shimla,
Himachal Pradesh, India
e-mail: Chakrabarti.SK@icar.gov.in
V. U. Patil
e-mail: veerubt@gmail.com
most important non-grain food crop and is cen-
tral to global food security. After wheat and rice,
potato is the third most important in terms of
consumption as food, with a world-wide pro-
duction of 364.8 million tons in 2012 (FAO-
STAT 2013). By 2020, it is estimated that more
than two billion people worldwide will depend
on potato for food, feed, or income. It is clonally

© Springer International Publishing AG 2017 95

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_6
96
propagated, highly heterozygous, auto-tetraploid,
and suffers acute inbreeding depression. Opti-
mization of production levels and resistance to
biotic and abiotic stresses are key objectives of
global potato breeding programmes. The need to
develop a high quality, well-annotated genome
sequence of potato, combined with established
mapping techniques to radically enhance our
ability to identify the desirable allelic variants of
genes underlying important quantitative traits in
potato, led to the foundation of The Potato
Genome Sequencing Consortium (PGSC)—a
collaboration of 13 countries Argentina, Brazil,
China, Chile, India, Ireland, The Netherlands,
New Zealand, Peru, Poland, Russia, the United
Kingdom and the United States. Potato genetics
is complicated by its polyploid genome and
many important qualitative and quantitative
agronomic traits are poorly understood. An
understanding of its genetic composition is a
basic requirement to develop more efficient
breeding methods. The potato genome sequence
will provide a major boost to gaining a better
understanding of potato trait biology, underpin-
ning future breeding efforts.
Potato belongs to the asterid clade of eudicot
plants that represents *25% of flowering plant
species and the complete genome sequence
information of any species in this group was not
available. Solanaceae, the family of potato,
includes several other economically important
species, such as tomato, eggplant, petunia,
tobacco and pepper. Worldwide, an economic
loss on the potato crop of about €3 billion per
year is estimated from diseases such as late
blight. These diseases are still largely controlled
by frequent application of fungicides. It is
expected that one of the first benefits of a potato
sequence will be a major breakthrough in our
ability to characterize and select genes involved
in disease resistance.
6.2 Sequencing Technologies
The development of DNA sequencing strategies
has been a high priority in genomics research
since the unearthing of the structure of DNA and
V. U. Patil et al.
the basic molecular mechanisms of heredity.
However, it was not until the works by Maxam
and Gilbert (1997) and Sanger et al. (1977), that
the first practical sequencing methods were
developed and implemented on a large scale.
These two landmark researches were responsible
for the introduction of first automated DNA
sequencers led by Caltech (Smith et al. 1986) and
subsequently commercialized by Applied
Biosystems (ABI), European Molecular Biology
Laboratory (EMBL), Pharmacia-Amersham and
General Electric (GE) healthcare. These are now
categorized as first-generation sequencing tech-
nologies. Despite their popularity as a ‘gold
standard’ among the research community, these
suffer certain limitations such as limited length of
DNA sequenced, biological biasness, higher
amount of sample required, lower number of
samples that can be analysed and most important
is the higher cost of sequencing. With the
advances made in the field of micro-fluidics,
imaging power, detection power and computa-
tional tools, unconventional sequencing tech-
nologies with increased throughput and lower
sequencing cost are continuously emerging. The
completion of the first human genome drafts
(Yamey 2000) was just the start of the modern
DNA sequencing era, which resulted in further
invention, improved development towards new
advanced strategies of high-throughput DNA
sequencing, which were collectively called the
‘High-Throughput Next Generation Sequencing’
(HT-NGS) (Varshney et al. 2009). The first of
these NGS technologies was pyrosequencing,
which was followed by Illumina and SOLiD
(Sequencing by Oligo Ligation and Detection).
These HT-NGS technologies have the capacity to
produce 100 times more data as compared to the
first-generation sequencers and a comparison of
features of these three technologies is given in
Table 6.1. The horizons and expectations have
broadened due to the technological advances in
the field of genomics, especially the HT-NGS
and its wide range of applications such as:
chromatin immune-precipitation coupled to
DNA microarray (ChIP-chip) or sequencing
(ChIP-seq), RNA sequencing (RNA-seq), whole
genome genotyping, de novo assembling and
6 High-Throughput Sequencing of the Potato Genome
Table 6.1 Special features of NGS technologies
NGS Approach Read length Bp per run
technologies (bp)
Roche 454 Pyrosequencing 400–800 800–1000 Mb
Titanium
Illumina Sequencing by 100 600 Gb
GAII synthesis with
reversible
terminators
SOLiD Massively 50 1–4 Gb
parallel
sequencing by
ligation
re-assembling of genome, genome-wide struc-
tural variation, mutation detection and carrier
screening, DNA library preparation, paired ends
and genomic captures, and the sequencing of the
mitochondrial and chloroplast genome. Besides
the advances in sequencing techniques, the past
decade will be remembered as the decade of the
genome research. Since the publications of the
first composite genomes of humans (Venter et al.
2001), many draft genomes from many plants
and animal species have been published (www.
ensembl.org/info/about/species.html), including
the potato genome. For the genome sequencing
of potato, three main sequencing technologies
were used, namely, Illumina, Pyrosequencing
and the Sanger sequencing, which are discussed
in detail by Xu et al. (2011).
6.2.1 Roche/454 FLX Pyrosequencer
The 454 sequencing technology (http://www.
454.com) was the first of the NGS, derived from
a technical combination of pyrosequencing and
emulsion PCR. The basis of this technology was
sequencing by synthesis (Melamede 1985), a
different approach to DNA sequencing by
pyrophosphate detection was also reported
(Hyman 1988). A team led by Nyren in 1993
came out with a sequencing approach based on
chemi-luminescent detection of pyrophosphate
97
Quality Cost per Sources of error
Mb ($)
10−4–105 45.00 Amplification, mixed
beads, intensity
thresholding,
homoplymers,
neighbour interference
10−2–10−3 5.97 Amplification, mixed
clusters/neighbour,
interference, phasing,
base labelling
10−2–10−3 5.81 Amplification, mixed
beads, signal decline,
neighbour interference
released during deoxynucleotide triphosphate
(dNTP) incorporation (Nyren et al. 1993). Later,
upgrading of a technique by Ronaghi and his
co-workers laid the foundation for the commer-
cial development of pyrosequencing at the Royal
Institute of Technology, Stockholm in 1996
(Ronaghi et al. 1996). 454 Life Sciences, foun-
ded by Jonathan Rothberg in 2000, launched the
first commercially available NGS platform called
GS 20 in 2005. In the same year, Margulies and
colleagues for 454 Life Sciences sequenced the
whole genome of Mycoplasma genitalia at 96%
coverage and 99.96% accuracy in a single run
using GS 20 (Margulies et al. 2005). The tech-
nology has continuously been upgraded several
times into a routine functioning method. The first
major technological improvement was the
replacement of dATP with that of dATPaS
(Ronaghi et al. 1996), followed by the intro-
duction of light phase pyrosequencing and the
addition of ssDNA-binding proteins to pyrose-
quencing (Ronaghi et al. 2000). In 2007, Roche
introduced a newer version as GS FLX with the
same sequencing chemistry as GS 20 with a
unique flowcell referred to as a ‘picotiter plate’
(PTP). An advanced version of the instrument
with a PTP plate is GS FLX comprising
3.4  106 separate sequencing reaction wells,
allowing hundreds of thousands of sequencing
reactions to be carried out in parallel and in a
massive high-throughput way.
98
Pyrosequencing is basically a two-stage
approach. First, single-stranded DNA is frac-
tionated into smaller fragments (300–1000 bp),
polished (made to have a blunt end), and short
oligo adapters having a 5′ biotin tag are ligated to
the fragments. These adapters provide the prim-
ing sequence for the attachment; amplification as
well as sequencing the fragment. DNA fragments
to be sequenced are then individually immobi-
lized onto streptividin decorated beads which are
amplified by the PCR in the water-oil emulsion
droplets. These droplets act as individual ampli-
fication reactors producing manifold replicas
(*107) of the same DNA sequence on each
bead. Template single-stranded DNA is hybri-
dized to a sequencing primer and loaded on to
the PTP plate along with DNA polymerase, ATP
sulfurylase (a recombinant version from Sac-
charomyces cerevisiae), luciferase (from the
American firefly Photinus pyralis) (Ronaghi
et al. 1998), the nucleotide-degrading enzyme
Apyrase (from potato), along with the substrates
adenosine 5′ phosphosulfate (APS) and luciferin.
One of the four dNTPs is added and, if com-
plementary, DNA polymerase incorporates onto
the template accompanied by the release of
pyrophosphate (PPi) equal to the molarity of the
incorporated nucleotide. This PPi released is
quantitatively converted into adenosine tri phos-
phate (ATP) in the presence of APS. The ATP
acts as a fuel to the luciferase-mediated conver-
sion of luciferin to oxyluciferin that generates
light in a comparative amount to the ATP pro-
duced. Unincorporated nucleotides and ATPs are
continuously washed away by the apyrase and
the next reaction starts with another nucleotide
addition cycle. One picomole of DNA in a
pyrosequencing reaction yields 6  109 photons
at a wavelength of 560 nm, which is easily
detected by a 16 mega pixel CCD camera
maintained at −24 °C for its higher resolution
and performance. The sequence of DNA is
yielded in the form of a ‘pyrogram’, which cor-
responds to the order of nucleotides that has been
incorporated. The current 454 instrument, the GS
FLX + produces an average read length of
approximately 1000 bp and throughput of
V. U. Patil et al.
approximately 800 Mb to 1 Gb of high quality
sequence data per 7–8 h run (www.454.com).
6.2.2 The Illumina Genome Analyzer
In 1997, British chemists Shankar Balasubra-
manian and David Klenerman conceptualized an
approach for sequencing single DNA molecules
attached to microspheres. They funded Solexa in
1998; however, their goal of sequencing single
DNA molecules was not fulfilled. The idea was
then shifted towards sequencing clonally ampli-
fied templates. The year 2006 marks the com-
mercial launch of the first ‘short read’ sequencing
platform Solexa Genome Analyzer. The idea was
based on sequencing by synthesis, one of the high
throughput DNA sequencing in NGS. The tem-
plet DNA sample is fractionated to the average
size *800 bp. The fragmented DNA ends are
repaired; 5′ end phosphorylated while a 3′ poly A
tail is added. Repair of DNA is carried out using
T4 DNA Polymerase (digests 3′ protruding ends),
Klenow DNA polymerase (extension of 3′
recessive ends) and T4 PNK (phosphorylates 5′
ends and dephosphorylates 3′ ends). Like
454/Roche, Illumina sequencing also requires the
template sequence to be converted to a special
sequencing library which ensures the immobi-
lization and amplification for sequencing
(Fedurco et al. 2006). Therefore, two unique
folked adaptors (adaptor oligonucleotides are
complementary to flow cell anchors) are added at
the 5′ and 3′ ends of the DNA fragment. The
prepared samples are immobilized on an
8-channelled flowcell surface, allowing bridge
amplification. Hybridization of the library frag-
ments and the adapter with that of flow cell
occurs by active heating and cooling stages.
Subsequently, reactants and an isothermal poly-
merase are incubated to amplify the fragment in a
discrete area ‘cluster’ on a flow cell surface (for
animation: http://www.illumina.com/) to form
small clusters of single-stranded fragments called
‘bridge amplification’. Clusters are formed
spontaneously due to the fact that the newly
produced copies of the fragment get attached in
6 High-Throughput Sequencing of the Potato Genome
close proximity to the original fragment. After
the bridge amplification is complete, densely
packed clusters of fragments have formed, and
each cluster consists of many copies of the same
fragment, which begins the sequencing by syn-
thesis step. For single-strand sequencing of for-
ward strands, clusters are denatured, chemically
cleaved and washed. Sequencing of a forward
strand starts with the hybridization of sequencing
primer complementary to the adapter sequence
followed by the addition of DNA polymerase and
a mixture of four differently coloured fluorescent
dye terminator nucleotides. All four nucleotides
are modified with a distinct fluorochrome, and
the reversible terminator group attached at its 3′
hydroxyl group is chemically blocked, so that
when one nucleotide is incorporated, replication
stops. This ensures the uniqueness of each event.
DNA polymerase incorporates the appropriate
nucleotide and unused nucleotides are washed
away. After every incorporation cycle, the
imaging step occurs to determine each incorpo-
rated nucleotide followed by the chemical
cleavage step which removes the fluorescent
nucleotide and unblocks the 3′ end with the help
of reducing agent tris (2-carboxymethyl phos-
phine) for the next sequencing cycle. The process
of adding nucleotides, imaging and removing the
terminator is called a cycle. The sequencing run
requires 2–8 days with 50  106 clusters per
flow cell to generate read lengths of 35–75 bases.
The system generates overall sequencing output
of 2–15 Gb per run. The latest technology
‘Hi-seq 2500’ produces around 600 Gb
throughput per 11-day run with dual flow cell
and another higher version of the same MiSeq®
system with much higher throughput and quality
is almost ready to be released (http://www.
illumina.com/).
Recently single molecule-based sequencing
technologies have hit the market, which are
collectively called the Next-Next Generation
Sequencing (NNGS) or Third Generation
Sequencing (TGS) technologies. Pacific Bio-
sciences Inc. was the first to introduce the NNGS
in the global market. The NNGS technologies are
said to be more efficient compared to NGS in
terms of throughput, cost of sequencing and time
99
consumption, but their utility and performance
are yet to be proved as a real advance of tech-
nologies over NGS. These never-ending advan-
ces in sequencing technologies provide
opportunities to target not only the model plant
species with small genome sizes, but many cul-
tivated and other economically important plant
species like potato for sequencing, identifying
millions of novel markers, agronomically
important genes, knowledge of which can be
directly translated into crop improvement.
6.3 Sequencing the Potato Genome
The potato has one of the richest genetic
resources of any cultivated plant (Spooner and
Hijmans 2001). The tuber-bearing Solanum spe-
cies are very widely distributed in the Americas,
from the South Western USA to Southern Chile
and Argentina and from sea level to the high-
lands of the Andes. Many wild species can be
crossed directly with the common potato and,
moreover, possess a wide range of resistances to
pests and diseases, tolerance to frost and drought
and many other valuable traits, making them a
useful resource for breeding new cultivars. Out-
side of its natural range in South America, the
cultivated potato is considered to have a narrow
genetic base, resulting originally from limited
germplasm introductions to Europe. Most potato
cultivars are auto-tetraploid (2n = 4x = 48),
highly heterozygous, suffer acute inbreeding
depression, and are susceptible to many devas-
tating pests and pathogens, as exemplified by the
Irish potato famine in the mid-nineteenth cen-
tury. Together, these attributes present a signifi-
cant barrier to potato improvement using
classical breeding approaches. The knowledge of
the genome sequence in potato facilitates
advanced breeding targeting many important
agronomic traits.
To overcome the key issue of heterozygosity
to generate a high-quality draft potato genome
sequence, a unique homozygous form of potato
called a doubled monoploid is derived using
classical tissue culture techniques (Paz and
Veilleux 1999). The draft genome sequence from
100
this genotype, S. tuberosum group Phureja
DM1-3 516 R44 (hereafter referred to as DM),
was used to integrate sequence data from a
heterozygous diploid breeding line, S. tuberosum
group Tuberosum RH89-039-16 (hereafter
referred to as RH). These two genotypes repre-
sent a sample of potato genomic diversity; DM
with its fingerling (elongated) tubers was derived
from a primitive South American cultivar
whereas RH more closely resembles commer-
cially cultivated tetraploid potato. The combined
data resources, allied to deep transcriptome
sequence from genotypes, explored the potato
genome structure and organization, as well as
key aspects of the biology and evolution of this
important crop.
The potato genome consists of 12 chromo-
somes and has a (haploid) length of approxi-
mately 840 million base pairs, making it a
medium-sized plant genome. The PGSC origi-
nally started out with sequencing RH. This part
of the project builds on a diploid potato genomic
bacterial artificial chromosome (BAC) clone
library of 78,000 clones, which has been finger-
printed and aligned into *7000 physical map
contigs. In addition, the BAC-ends have been
sequenced and are publicly available. Approxi-
mately 30,000 BACs are anchored to the Ultra
High Density genetic map of potato, composed
of 10,000 unique AFLP markers. From this
integrated genetic-physical map, between 50 and
150 seed BACs have currently been identified for
every chromosome. Fluorescent in situ
hybridization experiments on selected BAC
clones confirm these anchor points. The seed
clones provide the starting point for a
BAC-by-BAC sequencing strategy. This strategy
is being complemented by whole genome shot-
gun sequencing approaches using both 454
GS FLX and Illumina GA2 instruments.
Assembly and annotation of the sequence data
have been carried out by the researchers using
publicly available and tailor-made tools. The
availability of the annotated data will help to
characterize germplasm collections based on
allelic variance and to assist potato breeders to
more fully exploit the genetic potential of potato.
Sequencing of DM was also started because the
V. U. Patil et al.
overall progress in RH was slow. The heterozy-
gosity of RH has limited the progress of physical
mapping and will complicate the assembly of the
genome sequence. Whole-genome shotgun
sequencing of DM1-3 516R44 (CIP801092), a
doubled monoploid potato clone, is expected to
eliminate the complexity in assembly. In 2011,
the findings of genome and transcriptome
sequencing of DM and RH was published in
Nature in ‘Genome sequence and analysis of the
tuber crop potato’ (Xu et al. 2011). In the later
sections we will discuss the strategies and major
conclusions of this project.
6.3.1 DM Whole-Genome Shotgun
Sequencing
and Assembly
The nuclear and organellar genomes of DM were
sequenced using a whole-genome shotgun
sequencing (WGS) approach. In total, 96.6 Gb of
raw sequence data was generated from two
next-generation sequencing (NGS) platforms,
Illumina Genome Analyser and Roche Pyrose-
quencing, as well as the conventional Sanger
sequencing technologies. The genome was
assembled using SOAPdenovo, resulting in a
final assembly of 727 Mb, of which 93.9% is
non-gapped sequence. Ninety per cent of the
assembly falls into 443 superscaffolds larger than
349 kb. The 17-nucleotide depth distribution
suggested a genome size of 844 Mb, consistent
with estimates from flow cytometry. Analysis of
the DM scaffolds indicated 62.2% repetitive
content in the assembled section of the DM
genome, less than the 74.8% estimated from
bacterial artificial chromosome (BAC) and fos-
mid end sequences, indicating that much of the
unassembled genome is composed of repetitive
sequences.
Libraries from DM genomic DNA were con-
structed for Illumina Genome Analyser II (paired
end 200 and 500 bp; mate pair 2, 5 and 10 kb
insert size) and Roche 454 platforms (8 and
20 kb) for sequencing using standard protocols.
A BAC library and three fosmid libraries were
end-sequenced using the Sanger platform. For
6 High-Throughput Sequencing of the Potato Genome
the Illumina GAII platform, 70.6 Gb of 37–
73 bp paired-end reads from 16 libraries with
insert lengths of 200–811 bp was generated. The
mate-pair libraries (2, 5 and 10 kb insert size)
were used to generate 18.7 Gb. In total, 7.2 Gb
of 454 single-end data were generated and
applied to gap filling to improve the assembly, of
which 4.7 Gb (12,594,513 reads) were incorpo-
rated into the final assembly. For the 8 and 20 kb
454 paired-end reads, representing 0.7 and
1.0 Gb of raw data respectively, 90.7 Mb
(511,254 reads) and 211 Mb (1,525,992 reads),
respectively, were incorporated into the final
assembly.
A high-quality potato genome was con-
structed using the short read assembly software
SOAPdenovo (Version 1.014). The 69.4 Gb data
of GAII paired-end short reads were first
assembled into contigs, which were sequence
assemblies without gaps composed of overlap-
ping reads. To increase the assembly accuracy,
only 78.3% of the reads with high quality were
considered. Then contigs were further linked into
scaffolds by paired-end relationships (*300 to
*550 bp insert size), mate-pair reads (2 to
approx. 10 kb), fosmid ends (*40 kb, 90,407
pairs of end sequences) and BAC ends
(*100 kb, 71,375 pairs of end sequences). Then
filled gaps with the entire short-read data were
generated using Illumina GAII reads. The pri-
mary contig N50 size (the contig length such that
using equal or longer contigs produces half of the
bases of the assembled genome) was 697 bp and
increased to 1318 kb after gap-filling. When only
the paired-end relationships were used in the
assembly process, the N50 scaffold size was
22.4 kb. Adding mate-pair reads with 2, 5 and
10 kb insert sizes, the N50 scaffold size increased
to 67, 173 and 389 kb, respectively. When inte-
grated with additional libraries of larger insert
size, such as fosmid and BAC end sequences, the
N50 reached 1318 kb. The final assembly size
was 727 Mb, 93.87% of which is non-gapped
sequence. The gap filling was further carried out
using 6.74 fold coverage of 454 data, which
increased the N50 contig size to 31,429 bp with
15.4% of the gaps filled.
101
The single-base accuracy of the assembly was
estimated by the depth and proportion of dis-
cordant reads. For the DM v3.0 assembly,
95.45% of 880 million usable reads could be
mapped back to the assembled genome by SOAP
2.20 using optimal parameters. The read depth
was calculated for each genomic location and the
peak depths for the whole genome and the CDS
regions are 100 and 105, respectively. Approxi-
mately 96% of the assembled sequences had
more than 20-fold coverage. The overall GC
content of the potato genome is about 34.8%
with a positive correlation between GC content
and sequencing depth. The DM potato should
have few heterozygous sites and 93.04% of the
sites can be supported by at least 90% reads,
suggesting high base quality and accuracy.
6.3.2 RH Genome Sequencing
and Assembly
Whole-genome sequencing of genotype RH was
performed on the Illumina GAII platform using a
variety of fragment sizes and reads lengths,
resulting in a total of 144 Gb of raw data. These
data were filtered using a custom C program and
assembled using SOAPdenovo 1.03 (Li et al.
2009). Additionally, four 20-kb mate-pair
libraries were sequenced on a Roche/454 Tita-
nium sequencer, amounting to 581 Mb of raw
data (Tables 6.1 and 6.2). The resulting sequen-
ces were filtered for duplicates using custom
Python scripts.
The RH BACs were sequenced using a com-
bination of Sanger and 454 sequencing at various
levels of coverage. Consensus base calling errors
in the BAC sequences were corrected using
custom Python and C scripts, using a similar
approach to that described previously (Chaisson
et al. 2004). Sequence overlaps between BACs
within the same physical tiling path were iden-
tified using megablast from BLAST 2.2.21
(Altschul et al. 1997) and merged with mega-
merger from the EMBOSS 6.1.0 package (Rice
et al. 2000). Using the same pipeline, several
kilobase-sized gaps were closed through
102 V. U. Patil et al.

Table 6.2 RH Library type Insert size Read length Total reads Total bp
whole-genome data from
Illumina and 454 as per A. Illumina
insert size Single-end 500 bp 75 107,492,068 8,061,905,100
Paired-end 200 bp 75 174,979,788 13,123,484,100
Paired-end 200 bp 125 326,814,010 40,851,751,250
Paired-end 300 bp 100 82,324,780 8,232,478,000
Paired-end 500 bp 75 528,763,314 39,657,248,550
Paired-end 500 bp 125 200,147,478 25,018,434,750
Matepair 2 kb 35 72,401,032 2,534,036,120
Matepair 5 kb 35 167,488,622 5,862,101,770
Matepair 10 kb 35 41,822,754 1,463,796,390
Total 1,702,233,846 144,805,236,030
B. 454
Matepair 20 kb 259 686,844 178,053,005
Matepair 20 kb 255 653,410 166,359,937
Matepair 20 kb 310 765,621 237,055,547
Matepair 20 kb 293 643,577 188,612,498
Total 2,105,875 581,468,489

alignment of a preliminary RH whole-genome directly from assembled sequence scaffolds,

assembly. The resulting non-redundant contigs
were scaffolded by mapping the RH
whole-genome Illumina and 454 mated sequen-
ces against these contigs using SOAPalign 2.20
(Li et al. 2009) and subsequently processing
these mapping results with a custom Python
script. The scaffolds were then ordered into
superscaffolds based on the BAC order in the
tiling paths of the FPC map. This procedure
removed 25 Mb of redundant sequence, reduced
the number of sequence fragments from 17,228
to 3768, and increased the N50 sequence length
from 24 to 144 kb.
6.3.3 Construction of the DM Genetic
Map and Anchoring
of the Genome
To anchor and fully orientate physical contigs
along the chromosome, a genetic map was devel-
oped de novo using sequence-tagged-site
(STS) markers comprising simple sequence
repeats (SSR), SNPs, and diversity array technol-
ogy (DArT). SSR and SNP markers were designed
whereas polymorphic DArT marker sequences
were searched against the scaffolds for
high-quality unique matches. A total of 4836 STS
markers including 2174 DArTs, 2304 SNPs and
358 SSRs were analysed on 180 progeny clones
from a backcross population ((DM  DI)  DI)
developed at CIP between DM and DI (CIP no.
703825), a heterozygous diploid S. tuberosum
group Stenotomum (formerly S. stenotomum
ssp. goniocalyx) landrace clone. The data from
2603 polymorphic STS markers comprising 1881
DArTs, 393 SNPs and 329 SSR alleles were
analysed using JoinMap 4 and yielded the expec-
ted 12 potato linkage groups. Anchoring the DM
genome was accomplished using direct and indi-
rect approaches. The direct approach employed the
((DM  DI)  DI) linkage map whereby 2037 of
the 2603 STS markers comprised of 1402 DArTs,
376 SNPs and 259 SSRs could be uniquely
anchored on the DM superscaffolds. This approach
anchored *52% (394 Mb) of the assembly
arranged into 334 superscaffolds.
RH is the male parent of the mapping popu-
lation of the ultra-high-density (UHD) linkage
map used for construction and genetic anchoring
6 High-Throughput Sequencing of the Potato Genome
of the physical map using the RHPOTKEY BAC
library. The indirect mapping approach exploited
in silico anchoring using the RH genetic and
physical map (Van Os et al. 2006; Visser et al.
2009), as well as the tomato genetic map data
from SGN (http://solgenomics.net/). Amplified
fragment length polymorphism markers from the
RH genetic map were linked to DM sequence
scaffolds via BLAST alignment (Altschul et al.
1997) of whole-genome-profiling sequence tags
(Van der Vossen et al. 2010) obtained from
anchored seed BACs in the RH physical map, or
by direct alignment of fully sequenced RH seed
BACs to the DM sequence. The combined mar-
ker alignments were processed into robust anchor
points. The tomato sequence markers from the
genetic maps were aligned to the DM assembly
using SSAHA2. Positions of ambiguously
anchored superscaffolds were manually checked
and corrected. This approach anchored an addi-
tional *32% of the assembly (229 Mb). In 294
cases, the two independent approaches provided
direct support for each other, anchoring the same
scaffold to the same position on the two
maps. Overall, the two strategies anchored 649
superscaffolds to approximate positions on the
genetic map of potato covering a length of
623 Mb. The 623 Mb (*86%) anchored gen-
ome includes *90% of the 39,031 predicted
genes. Of the unanchored superscaffolds, 84
were found in the N90 (622 scaffolds greater than
0.25 Mb), constituting 17 Mb of the overall
assembly or 2% of the assembled genome. The
longest anchored superscaffold is 7 Mb (from
chromosome 1) and the longest unanchored
superscaffold is 2.5 Mb.
6.3.4 Identification of Repetitive
Sequences
Transposable elements (TEs) in the potato gen-
ome assembly were identified at the DNA and
protein level. RepeatMasker (Chen 2004) was
applied using Repbase (Jurka et al. 2005) for TE
identification at the DNA level. At the protein
level, RepeatProteinMask (Chen 2004; Jiang
et al. 2008) was used in a WuBlastX 9 (Altschul
103
et al. 1997) search against the TE protein data-
base to further identify TEs. Overlapping TEs
belonging to the same repeat class were collated,
and sequences were removed if they over-
lapped >80% and belonged to different repeat
classes. Repetitive sequences account for at least
62.2% of the assembled genome (452.5 Mb)
with long terminal repeat retrotransposons com-
prising the majority of the transposable element
classes, representing 29.4% of the genome. In
addition, subtelomeric repeats were identified at
or near chromosomal ends. Using a newly con-
structed genetic map based on 2603 polymorphic
markers in conjunction with other available
genetic and physical maps, we genetically
anchored 623 Mb (86%) of the assembled gen-
ome, and constructed pseudomolecules for each
of the 12 chromosomes, which harbour 90.3% of
the predicted genes.
6.3.5 Gene Prediction
To predict genes, ab initio predictions on the
repeat-masked genome was carried out and then
results were integrated with the spliced align-
ments of proteins and transcripts to genome
sequences using GLEAN (Elsik et al. 2007). The
potato genome was masked by identified repeat
sequences longer than 500 bp, except for
miniature inverted repeat transposable elements
which are usually found near genes or inside
introns (Kuang et al. 2009). The software
Augustus (Stanke et al. 2004) and Genscan
(Burge and Karlin 1997) was used for ab initio
predictions with parameters trained for A. thali-
ana. For similarity-based gene prediction, the
protein sequences of four sequenced plants (A.
thaliana, Carica papaya, V. vinifera and Oryza
sativa) were aligned onto the potato genome
using TBLASTN with an E-value cut-off of
1  10−5, and then similar genome sequences
were aligned against the matching proteins using
Genewise (Birney et al. 2004) for accurately
spliced alignments. In EST-based predictions,
EST sequences of 11 Solanum species were
aligned against the potato genome using BLAT
(identity  0.95, coverage  0.90) to generate
104
spliced alignments. All these resources and pre-
diction approaches were combined by GLEAN
(Elsik et al. 2007) to build the consensus gene
set. To finalize the gene set, the RNA-Seq from
32 libraries, of which eight were sequenced with
both single- and paired-end reads, were aligned
to the genome using Tophat (Trapnell et al.
2009) and the alignments were then used as input
for Cufflinks (Trapnell et al. 2010) using the
default parameters. Gene, transcript and peptide
sets were filtered to remove small genes, genes
modelled across sequencing gaps, TE-encoding
genes, and other incorrect annotations. The final
gene set contains 39,031 genes with 56,218
protein-coding transcripts, of which 52,925
non-identical proteins were retained for analysis.
6.3.6 Transcriptome Sequencing
RNA was isolated from many tissues of DM and
RH that represent developmental, abiotic stress
and biotic stress conditions (Xu et al. 2011).
cDNA libraries were constructed (Illumina) and
sequenced on an Illumina GA2 in the single-
and/or paired-end mode. To represent the
expression of each gene, we selected a repre-
sentative transcript from each gene model by
selecting the longest CDS from each gene. The
aligned read data were generated by Tophat
(Trapnell et al. 2009) and the selected transcripts
used as input into Cufflinks (Trapnell et al.
2010), a short-read transcript assembler that
calculates the fragments per kb per million
mapped reads (FPKM) as expression values for
each transcript. Cufflinks was run with default
settings, with a maximum intron length of
15,000.
In developing DM and RH tubers, 15,235
genes were expressed in the transition from
stolons to tubers, with 1217 transcripts
exhibiting >5-fold expression in stolons versus
five RH tuber tissues (young tuber, mature tuber,
tuber peel, cortex and pith). Of these, 333 tran-
scripts were upregulated during the transition
from stolon to tuber, with the most highly
upregulated transcripts encoding storage pro-
teins. Foremost among these were the genes
V. U. Patil et al.
encoding proteinase inhibitors and patatin (15
genes), in which the phospholipase A function
has been largely replaced by a protein storage
function in the tuber. In particular, a large family
of 28 Kunitz protease inhibitor genes (KTIs) was
identified with twice the number of genes in
potato compared to tomato in the tuber (Gore
et al. 2009).
The stolon to tuber transition also coincides
with strong up-regulation of genes associated
with starch biosynthesis. It was observed that
several starch biosynthetic genes were 3–8-fold
more highly expressed in tuber tissues of RH
compared to DM. Together this suggests a
stronger shift from the relatively low sink
strength of the ATP-generating general carbon
metabolism reactions towards the plastidic starch
synthesis pathway in tubers of RH, thereby
causing a flux of carbon into the amyloplast.
6.3.7 Identification
of Disease-Resistant
Genes
Predicted open reading frames (ORFs) from the
annotation of S. tuberosum group Phureja
assembly V3 were screened using HMMER V3
(http://hmmer.janelia.org/software) against the
raw hidden Markov model (HMM) correspond-
ing to the Pfam NBS (NB-ARC) family
(PF00931). The HMM was downloaded from the
Pfam home page (http://pfam.sanger.ac.uk/). The
analysis using the raw HMM of the NBS domain
resulted in 351 candidates. From these, a high
quality protein set (<1  10−60) was aligned and
used to construct a potato-specific NBS HMM
using the module ‘hmmbuild’. Using this new
potato-specific model, we identified 500
NBS-candidate proteins that were individually
analysed. To detect TIR and LRR domains,
Pfam HMM searches were used. The raw
TIR HMM (PF01582) and LRR 1 HMM
(PF00560) were downloaded and compared
against the two sets of NBS-encoding amino acid
sequences using HMMER V3. Both TIR and
LRR domains were validated using NCBI con-
served domains and multiple expectation
6 High-Throughput Sequencing of the Potato Genome
maximization for motif elicitation (MEME)
(Bailey and Elkan 1995). In the case of LRRs,
MEME was also useful to detect the number of
repeats of this particular domain in the protein.
As previously reported (Mun et al. 2009), Pfam
analysis could not identify the CC motif in the
N-terminal region. CC domains were thus anal-
ysed using the MARCOIL (Delorenzi and Speed
2002) program with a threshold probability of 90
(Mun et al. 2009) and double-checked using
paircoil with a P-score cut-off of 0.025 (Porter
et al. 2009). Selected genes (±1.5 kb) were
searched using BLASTX against a reference R-
gene set (Sanseverino et al. 2010) to find a
well-characterized homologue. The reference set
was used to select and annotate as pseudogenes
those peptides that had large deletions, inser-
tions, frameshift mutations, or premature stop
codons. DNA and protein comparisons were
used.
6.3.8 Haplotype Diversity Analysis
RH reads generated by the Illumina GA2 were
mapped on to the DM genome assembly using
SOAP2.20 (Li et al. 2009) allowing at most four
mismatches, and SNPs were called using
SOAPsnp. Q20 was used to filter the SNPs
owing to sequencing errors. To exclude SNP
calling errors caused by incorrect alignments, we
excluded adjacent SNPs separated
by <5 bp. SOAPindel was used to detect the
indels between DM and RH. Only indels sup-
ported by more than three uniquely mapped reads
were retained. Owing to the heterozygosity of
RH, the SNPs and indels were classified into
heterozygous and homozygous SNPs or indels.
On the basis of the annotated genes in the DM
genome assembly, we extracted the SNPs located
at coding regions and stop codons. If a
homozygous SNP in RH within a coding region
induced a premature stop codon, we defined the
gene harbouring this SNP as a homozygous
premature stop gene in RH. If the SNP inducing
a premature stop codon was heterozygous, the
gene harbouring this SNP was considered a
heterozygous premature stop codon gene in RH.
105
In addition, both categories can be further divi-
ded into premature stop codons shared with DM
or not shared with DM. As a result, the numbers
of premature stop codons are 606 homozygous
PS genes in RH, 1760 heterozygous PS genes in
RH but not shared with DM, 288 PS in DM only,
and 652 heterozygous premature stop codons in
RH and shared by DM. To identify genes with
frame-shift mutations in RH, we identified all the
genes containing indels of which the length could
not be divided by 3. We found 80 genes with
frame-shift mutations, of which 31 were
heterozygous and 49 were homozygous.
To identify DM-specific genes, all the RH
Illumina GA2 reads were mapped to the DM
genome assembly. If the gene was not mapped to
any RH read, it was considered a DM-specific
gene and in total 35 DM-specific genes, 11 of
which are supported by similarity to entries in the
KEGG database, were identified (Kanehisa et al.
2004). To identify RH-specific genes, the RH
Illumina GA2 reads not mapping to the DM
genome were assembled into RH-specific scaf-
folds. Then, these scaffolds were annotated using
the same strategy as for DM. To exclude con-
tamination, the CDS sequences against the pro-
tein set of bacteria with the E-value cut-off of
1  10−5 using Blastx were aligned. CDS
sequences with >90% identity and >90% cover-
age were considered contaminants and were
excluded. In addition, all DM RNA-seq reads
were mapped onto the CDS sequences, and CDS
sequences with homologous reads were excluded
because these genes may be due to incorrect
assembly. In total, we predicted 246 RH specific
genes, 34 of which are supported by Gene
Ontology annotation (Shannon et al. 1996).
6.4 Conclusion
The sequencing of a unique doubled-monoploid
potato clone to overcome the problems associ-
ated with genome assembly due to high levels
of heterozygosity can help to generate a
high-quality draft potato genome sequence that
provides new insights into eudicot genome evo-
lution. A combination of data from the vigorous,
106
heterozygous diploid RH and relatively weak,
doubled-monoploid DM, was used to directly
address the form and extent of heterozygosity in
potato and provide the first view into the com-
plexities that underlie inbreeding depression.
Combined with other recent studies, the potato
genome sequence may elucidate the evolution of
tuberization. This evolutionary innovation
evolved exclusively in the Solanum section
Petota that encompasses *200 species dis-
tributed from the south–western United States to
central Argentina and Chile. Neighbouring
Solanum species, including the Lycopersicon
section, which comprises wild and cultivated
tomatoes, did not acquire this trait. Both gene
family expansion and recruitment of existing
genes for new pathways have contributed to the
evolution of tuber development in potato.
Given the pivotal role of potato in world food
production and security, the potato genome pro-
vides a new resource for use in breeding. Many
traits of interest to plant breeders are quantitative
in nature and the genome sequence will simplify
both their characterization and deployment in
cultivars. Whereas much genetic research is
conducted at the diploid level in potato, almost
all potato cultivars are tetraploid and most
breeding is conducted in tetraploid material.
Hence, the development of experimental and
computational methods for routine and informa-
tive high-resolution genetic characterization of
polyploids remains an important goal for the
realization of many of the potential benefits of
the potato genome sequence.
References
Altschul SF et al (1997) Gapped BLAST and
PSI-BLAST: a new generation of protein database
search programs. Nucleic Acids Res 25:3389–3402
Bailey TL, Elkan C (1995) The value of prior knowledge
in discovering motifs with MEME. Proc Int Conf
Intell Syst Mol Biol 3:21–29
Birney E, Clamp M, Durbin R (2004) Genewise and
Genomewise. Genome Res 14:988–995
Burge C, Karlin S (1997) Prediction of complete gene
structures in human genomic DNA. J Mol Biol
268:78–94
V. U. Patil et al.
Chaisson M, Pevzner P, Tang H (2004) Fragment assembly
with short reads. Bioinformatics 20:2067–2074
Chen N (2004) Using RepeatMasker to identify repetitive
elements in genomic sequences. Curr Protoc Bioin-
form 25:4.10.1–4.10.14
Delorenzi M, Speed T (2002) An HMM model for
coiled-coil domains and a comparison with
PSSM-based predictions. Bioinformatics 18:617–625
Elsik CG et al (2007) Creating a honey bee consensus
gene set. Genome Biol 8:R13
FAOSTAT (2013) www.faostat.fao.org
Fedurco M, Romieu A, Williams S et al (2006) BTA, a
novel reagent for DNA attachment on glass and
efficient generation of solid-phase amplified DNA
colonies. Nucleic Acids Res 34:e22
Gore MA et al (2009) A first-generation haplotype map of
maize. Science 326:1115–1117
Hyman ED (1988) A new method of sequencing DNA.
Anal Biochem 174:423–436
Jiang Z, Hubley R, Smit A, Eichler EE (2008)
DupMasker: a tool for annotating primate segmental
duplications. Genome Res 18:1362–1368
Jurka J et al (2005) Repbase Update, a database of
eukaryotic repetitive elements. Cytogenet Genome
Res 110:462–467
Kanehisa M, Goto S, Kawashima S, Okuno Y, Hattori M
(2004) The KEGG resource for deciphering the
genome. Nucleic Acids Res 32:D277–D280
Kuang H et al (2009) Identification of miniature
inverted-repeat transposable elements (MITEs) and
biogenesis of their siRNAs in the Solanaceae: new
functional implications for MITEs. Genome Res
19:42–56
Li R et al (2009) SOAP2: an improved ultrafast tool for
short read alignment. Bioinformatics 25:1966–1967
Margulies M, Egholm M, Altman WE, Attiya S,
Bader JS, Bemben LA et al (2005) Genome sequenc-
ing in micro-fabricated high-density picolitre reactors.
Nature 437:376–380
Maxam AM, Gilbert W (1997) A new method for
sequencing DNA. Proc Natl Acad Sci USA 74:560–
564
Melamede RJ (1985) Automatable process for sequencing
nucleotide. US Patent no. US4863849
Mun JH, Yu HJ, Park S, Park BS (2009) Genome-wide
identification of NBS-encoding resistance genes in
Brassica rapa. Mol Genet Genomics 282:617–631
Nyren P, Pettersson B, Uhlen M (1993) Solid phase DNA
minisequencing by an enzymatic luminometric inor-
ganic pyrophosphate detection assay. Anal Biochem
208:171–175
Paz MM, Veilleux RE (1999) Influence of culture medium
and in vitro conditions on shoot regeneration in
Solanum phureja monoploids and fertility of regener-
ated doubled monoploids. Plant Breed 118:53–57
Porter BW et al (2009) Genome-wide analysis of Carica
papaya reveals a small NBS resistance gene family.
Mol Genet Genomics 281:609–626
6 High-Throughput Sequencing of the Potato Genome
Rice P, Longden I, Bleasby A (2000) EMBOSS: the
European molecular biology open software suite.
Trends Genet 16:276–277
Ronaghi M, Karamohamed S, Pettersson B, Uhlen M,
Nyren P (1996) Real-time DNA sequencing using
detection of pyrophosphate release. Anal Biochem
242:84–89
Ronaghi M, Pourmand N, Jain M, Willis T, Davis R
(2000) Pyrosequencing for genome resequencing. In:
12th International genome sequencing and analysis
conference, Miami, FL
Sanger F, Nicklen S, Coulson AR (1977) DNA sequenc-
ing with chain-terminating inhibitors. Proc Natl Acad
Sci USA 74:5463–5467
Sanseverino W et al (2010) PRGdb: a bioinformatics
platform for plant resistance gene analysis. Nucleic
Acids Res 38:D814–D821
Shannon JC, Pien FM, Liu KC (1996) Nucleotides and
nucleotide sugars in developing maize endosperms:
synthesis of ADP-glucose in brittle-1. Plant Physiol
110:835–843
Smith LM et al (1986) Fluorescence detection in
automated DNA sequence analysis. Nature 321:674–
679
Spooner DM, Hijmans RJ (2001) Potato systematics and
germplasm collecting, 1989–2000. Am J Potato Res
78:237–268
Stanke M, Steinkamp R, Waack S, Morgenstern B (2004)
AUGUSTUS: a web server for gene finding in
eukaryotes. Nucleic Acids Res 32:W309–W312
107
Trapnell C, Pachter L, Salzberg SL (2009) TopHat:
discovering splice junctions with RNA-Seq. Bioinfor-
matics 25:1105–1111
Trapnell C et al (2010) Transcript assembly and quantifi-
cation by RNA-Seq reveals unannotated transcripts
and isoform switching during cell differentiation.
Nature Biotechnol 28:511–515
Van Os H et al (2006) Construction of a 10,000-marker
ultradense genetic recombination map of potato: pro-
viding a framework for accelerated gene isolation and a
genomewide physical map. Genetics 173:1075–1087
Van der Vossen E et al (2010) Whole Genome Profiling
of the Diploid Potato CloneRH89-039-16 (Plant &
Animal Genomes XVIII Conference, 2010)
Varshney RK, Nayak SN, May GD, Jackson SA (2009)
Next-generation sequencing technologies and their
implications for crop genetics and breeding. Trends
Biotechnol 27:522–530
Venter JC, Adams MD, Myers EW, Li PW, Mural RJ
(2001) The sequence of the human genome. Science
291:1304–1351
Visser RGF et al (2009) Sequencing the potato genome:
outline and first results to come from the elucidation of
the sequence of the world’s third most important
crop. Am J Potato Res 86:417–429
Xu X, Pan S, Cheng S, Zhang B, Mu D et al (2011)
Genome sequence and analysis of the tuber crop
potato. Nature 475:189–195
Yamey G (2000) Scientists unveil first draft of human
genome. BMJ 321:7
 The Wild Side of Potato: Insights
into the Genome Sequence 7
of the Stress-Tolerant S. commersonii

Salvatore Esposito, Vincenzo D’Amelia, Clizia Villano,

Felice Contaldi, Domenico Carputo
and Riccardo Aversano

Abstract
Solanum commersonii is a potato species native to Central and South
America. Despite being genetically isolated from cultivated potato, in the
past few years it has garnered significant research interest because it
exhibits high tolerance to both biotic and abiotic stresses. Among the
abiotic stresses, particularly interesting are its freezing tolerance and
capacity to cold acclimatize. Little is understood of the genetic determi-
nants and mechanisms beyond its resistance traits. This is partially due to
the lack of genomic resources for potato germplasm. The group at the
University of Naples has recently decoded, for the first time, the genome
of S. commersonii, ushering in a new era of whole-genome sequencing of
wild potato relatives. After illustrating the genome structure and
organization of this species and its intrigffuing evolutionary roots, this
chapter describes findings relative to the identification of the candidate
genes for cold stress tolerance. The genome sequence of S. commersonii
will pave the way to an understanding of the molecular dynamics that
have given this species so many adaptive characteristics.

species represent an extraordinary source of genes

7.1 Introduction
Potato breeding requires a continuous flow of
new genetic material to produce superior vari-
eties. To achieve this goal, wild tuber-bearing
S. Esposito
V. D’Amelia
C. Villano
F. Contaldi

D. Carputo (&)
R. Aversano
Department of Agricultural Sciences, University of
Naples Federico II, Via Università 100, Portici, Italy
e-mail: carputo@unina.it
and allelic diversity that are lacking in cultivated
S. tuberosum. Among the attractive traits pos-
sessed by potato relatives, it is worth mentioning
the high dry matter content of tubers, the resis-
tance to biotic (i.e. fungi, insects, nematodes,
bacteria and viruses) and abiotic (especially cold
and drought) stresses, and traits related to the
tuber nutritional processing quality and plant fit-
ness. From this point of view, a very attractive
species is S. commersonii Dun. (2n = 2x = 24),
native to Central and South America. It possesses

© Springer International Publishing AG 2017 109

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_7
110
resistance to root knot nematode, soft rot and
blackleg, bacterial and verticillium wilt, potato
virus X, tobacco etch virus, common scab, and
late blight (Hawkes 1990; Micheletto et al. 2000;
Machida-Hirano 2015). Particularly interesting is
its freezing tolerance and capacity to cold accli-
matize (i.e. ability to increase cold tolerance after
exposure to low, non-freezing temperatures)
(Palta and Simon 1993). It was named by the
french taxonomist Michel-Felix Dunal in honour
of Philibert Commerçon (1727–1773), a natural-
ist who collected the type specimen (No. 47) in
1767 in Montevideo in Uruguay. This was
probably the first wild potato to be collected on a
scientific expedition (Hawkes 1990). Analyses of
plastidial genome restriction sites and nitrate
reductase (NIA) gene sequence confirmed that S.
commersonii is phylogenetically distinct from the
cultivated potato (Rodríguez and Spooner 2009).
Consistently, S. commersonii and S. tuberosum
are sexually incompatible (Jackson and Hanne-
man 1999) due to differences in their Endosperm
Balance Number (EBN). The former is
2x (1EBN), whereas the latter is 4x (4EBN).
Therefore, interspecific crosses fail due to the
EBN imbalance between parents (Johnston et al.
1980). To overcome sexual barriers between
these species, the manipulation of their ploidy
levels (genome engineering) is possible. Fig-
ure 7.1 shows a breeding scheme used to intro-
gress S. commersonii into the cultivated gene
pool (Carputo et al. 1997). The bridge F1 triploids
Fig. 7.1 Potato breeding
strategy to sexually exploit S.
commersonii
S. Esposito et al.
can be produced by crosses between S. commer-
sonii and S. tuberosum haploids (2x, 2EBN), as
long as S. commersonii produces 2n gametes or it
is subjected to somatic chromosome doubling. If
triploids, in turn, produce 2n gametes, pentaploid
progenies can be produced by backcrossing them
with tetraploid varieties. With the pentaploid
hybrids, it is relatively easy to proceed with
backcrosses, as they are easily cross-referenced
with S. tuberosum. The scheme described in
Fig. 7.1 points out that the exploitation of S.
commersonii through conventional breeding is
hampered by several factors, including the tetra-
ploid level of the cultivated potato, sexual barriers
to interspecific crosses, and self-incompatibility
at the diploid levels. Current and emerging tech-
nologies to analyze thousands of genetic markers
simultaneously, or resequence entire genomes,
have the potential to make the introgression of
wild species genes much more efficient and thus
to enhance our ability to effectively identify and
incorporate traits related to the desired phenotype.
Considering this, an important result has appeared
the genome sequence of S. commersonii, the first
wild potato whose genome has been deciphered
(Aversano et al. 2015a). In this chapter, we report
in detail the data obtained from this genome
sequencing effort in terms of gene duplication,
metabolite diversification and expression atlas.
We also provide insights into deciphering the
capacity of S. commersonii to withstand low
temperatures, an important breeding target.
7 The Wild Side of Potato: Insights into The Genome …
7.2 Comparative Genomics
The potato genome sequence was published in
2011 (Potato Genome Sequencing Consortium
2011), using an homozygous doubled monoploid
(DM1-3 516R44) of S. tuberosum Group Phureja
(2n = 2x = 24). Later, S. commersonii genome
was released by Aversano et al. (2015a), and
showed a lower number of predicted genes
(37,662) compared with potato (*39,000). More
than 50% of them were assigned to Gene
Ontology (GO) terms in S. commersonii (20,501)
and S. tuberosum (20,961). A Simple Sequence
Repeat (SSR) recognition and analysis were used
to identify genomic structural polymorphisms
between the two species. Indeed, using MISA
(MIcroSAtellite) software and perl scripts, a total
of 242,923 and 168,375 SSR loci were identified
in S. commersonii and S. tuberosum, respec-
tively. A large proportion of mono-, di-, tri-,
tetra-, penta- and hexa-nucleotides repeat motifs
were identified in both species (Fig. 7.2).
The mononucleotide repeats exhibited a
strong bias towards A/T motif (62%) compared
with C/G (5%). The AT/AT was the most
common motif in both species, whereas the
CG/CG was present at a very low level, showing
a consistent trend with those of many other
plants species, such as apple (Guang et al. 2012)
and grape (Cai et al. 2009). The comparison of
SSR distribution and patterns in S. commersonii
and S. tuberosum genomes showed that the
former is significantly enriched in terms of SSR
Fig. 7.2 SSR loci identified in S. commersonii and S. tuberosum genomes. mono- mononucleotides; di- dinucleotides;
tri- trinucleotides; tetra- tetranucleotides; penta- pentanucleotides; hexa- esanucleotides
111
loci compared to the latter. Comparative tran-
script profiling also suggested that in S.
tuberosum post-transcriptional modifications
(i.e. alternative splicing) were potentially more
abundant. Indeed, more predicted proteins per
gene were found in potato (23,000) than in the
wild species (4,900). The number of genes,
proteins and the specific annotation of S. com-
mersonii and S. tuberosum are represented in
Fig. 7.3. To understand also the type and num-
ber of RNA molecules in S. commersonii, tran-
scriptomic analysis was carried out on five
different tissues, namely flowers, leaves, roots,
stolons and tubers. A large number of transcripts
(20,994) with no apparent coding capacity
(ncRNAs) were predicted. Among them, 22
transfer RNAs (tRNA), 40 ribosomal RNAs
(rRNA), 18,882 long non-coding RNAs
(lncRNA), and 1,703 putative microRNAs
(miRNA) precursors were identified. As far as
miRNAs are concerned, 350 of them were able
to fold in a secondary structure, leading to the
typical miRNA/miRNA* double-stranded RNA
duplexes (Aversano et al. 2015a). In S. com-
mersonii we also constructed small RNA
libraries to identify and annotate specific miR-
NAs. Roughly, 350 miRNAs, conserved and
novel, and thousands of trans-acting small
interfering RNAs (tasiRNAs) and siRNA were
found. Most of the siRNAs (56%) and tasiRNAs
(76%) overlapped with TEs regions, confirming
their role in preventing transposable element
movement. Consistent with S. commersonii
112
Fig. 7.3 Number of predicted genes in S. commersonii
and S. tuberosum. Genes with GO and KEGG pathways
are also shown
results, Lakhotia et al. (2014) were able to
identify a total of 349 miRNAs (89 conserved
and 260 potato-specific) in a comprehensive
study at genome-wide level using different
vegetative tissues. Studies on S. tuberosum
tasiRNAs and siRNAs are still lacking. The data
reported below are mainly focussed on the
genome size, the number of duplicated genes
and the type of genes involved in metabolic
synthesis.
7.2.1 Genome Sequence Annotation
of S. commersonii and
S. tuberosum
Once obtained, the genome size of a species can
easily be compared to those of other plant spe-
cies. The S. commersonii genome estimated size
placed it exactly between the two other most
significant Solanums sequenced: potato and
tomato (Fig. 7.4). Its genome size was evaluated
at *830 Mb by flow cytometry, in agreement
with that (838 Mb) obtained by the 23-nucleotide
depth distribution. Generally speaking, the dif-
ferences between genome sizes might be affected
by several structural variations, such as duplica-
tions, deletions, and transpositions. However, it
has been reported that transposable elements
(TEs) are the main components of complex
genomes and that transpositions can be regarded
as the predominant force driving their structural
changes, besides polyploidy (Bennetzen 2000).
In this regard, a class of TEs, the long terminal
repeats (LTR)-retrotransposons, is considered a
S. Esposito et al.
2500 TE
Genome size (Mb)
Non-TEs
2000
1500
1000
500
0
Rice Tomato Wild Potato Corn
potato
Fig. 7.4 Genome size of five sequenced species. Further
information about the content of transposable elements
(TEs) and non transposable elements (non-TEs) are
reported
key factor in genomic inflation because of the
property to increase their copy number during
transposition (Boulesteix et al. 2006). The best
example occurred in a wild relative of rice
(Oryza australiensis), with a genome nearly
two-fold larger than rice due to recent bursts of
the LTR-retrotransposons (Piegu et al. 2006). In
a comprehensive review of the first 50 sequenced
plant genomes, Michael and Jackson (2013)
reported that genome repetitive content ranged
from 3% (Utricularia gibba) to 85% (Zea mays).
Plant genomes are very often composed in a
large part by TEs, which contain protein-coding
sequences that are often annotated as genes. An
example is reported by Bennetzen et al. (2004) in
rice, where only 40,000 of the more than 55,000
annotated genes are effectively genes and
roughly 10,000 are usually TEs-low copy. Cur-
rently, the main approach to identify TEs in fully
sequenced genomes is based only on sequence
similarity to previously identified TEs. With this
system, circa 383 Mb of repetitive sequences
were identified, accounting for 44.5% of the
current assembly of the S. commersonii genome.
Compared to potato, S. commersonii has a lower
amount of repetitive DNA (45% vs. 55%), which
might explain its smaller genome size and predict
different genome dynamics in these two species
since their separation from a common ancestor.
To further investigate the nature of repetitive
DNA in S. commersonii, RepBase library (Jurka
2000) and RepeatMasker (RepeatMasker
Open-3.0) were used. However, homology
searching using RepeatMasker is limited in
7 The Wild Side of Potato: Insights into The Genome …
finding previously TEs unknown or that are in
low copy. For this reason, a de novo approach
based on LTR-RTs structure was performed to
improve the current annotations of S. commer-
sonii and S. tuberosum. The former has thou-
sands of predicted full-length LTR-RTs. As in
other Solanaceae species, in S. commersonii
many more Ty3-gypsy type than Ty1-copia type
LTR-RTs were identified, suggesting that the
former elements have been more successful in
colonizing and persisting in Solanaceae genomes
(Table 7.1). The TEs differences identified
between the wild and cultivated species suggest
that S. commersonii holds a lower level of
heterozygosity (Hirsch et al. 2013), since most of
single nucleotide polymorphism were located in
intergenic regions. The presence of these varia-
tions may affect the transcriptional regulation in
the two species differently. Indeed, TEs strongly
affect expression levels and transcript splicing
and consequently may impact plant phenotypes.
In S. commersonii high levels of homozygosity
were detected, probably due to: (1) naturally
occurring inbreeding within small populations or
during gene bank maintenance; (2) small sample
sizes during collection; or (3) ineffectiveness of
the self-incompatibility system, which may not
be as effective or as widespread as we have
believed. Sixteen percent of SNPs were placed in
genes related to specific biological processes,
such as macromolecule metabolic processes,
response to stimuli, carbohydrate derivative
binding, localization, and ion binding. These
may have a direct impact on phenotypes.
7.2.2 Gene and Genome Duplication
The estimate of the time of divergence between
tomato and potato, and between the latter and S.
commersonii is *7.3 and *2.3 Mya, respec-
tively. Approximately 45% of orthologs are
Table 7.1 Number of Elements
full-lenght LTR-RTs in
S. tuberosum and LTR/Copia
S. commersonii LTR/Gypsy
Unknown
113
shared by these three species. This scenario likely
results from the past genome duplications shared
by the three Solanum species, followed by dif-
ferential loss of paralogous genes. It has been
strongly suggested that these major duplications
predate the divergence of Solanum species
(Tomato Genome Consortium 2012). Most of the
paralogous pairs considered as potato-specific or
S. commersonii-specific result from differential
retention of duplicated pairs in each of the
investigated lineages. It has been further assessed
that the genomic organization of these duplicates
is in tandem. Several examples of retention and
loss of paralogous genes between the wild and the
cultivated species exist. For instance, among the
loci linked to anthocyanin production, the D (de-
veloper) gene showed a tandem replication of two
of them (StAN2 and StAN1) belonging to the
transcription factor MYB family (D’Amelia et al.
2017). Interestingly, besides these genes, S.
commersonii retained a further duplication named
ScAN1-like, which was truncated in the S.
tuberosum Group Phureja genome. A second case
of a duplication event that appeared in the potato
genome is concerned with Dicer-like (DCL), a
key component of small RNA-mediated gene
silencing. Basically, the DCL family in plants is
characterized by four members (DCL1, DCL2,
DCL3 and DCL4) with different roles in devel-
opmental stages and abiotic and biotic stress
response. The members of this family were
expanded through duplication events during
evolution in both wild and cultivated potatoes. As
for DCL2, four paralogs showing a strong simi-
larity were found to be duplicated in tandem on
chromosome 11 of S. tuberosum. Sequence sim-
ilarities between the two species suggest that the
duplication of this gene family probably appeared
before the divergence between S. commersonii
and S. tuberosum. An additional example of
retention and loss of paralogous sequences
between S. commersonii and S. tuberosum comes
S. tuberosum S. commersonii
2204 1702
4056 3517
4502 4417
114
from the CBF/DREB1 (C-repeat binding
factor/dehydration responsive element binding
(1) genes, which are transcriptional activators that
play a key role in the cold acclimatization process
in plants (Yamaguchi-Shinozaki and Shinozaki
2006). They belong to the AP2/ERF family of
DNA-binding proteins and interact with a 5-bp
core element (CCGAC), the C-RepeaT/
dehydration-responsive element (CRT/DRE)
motif present in the promoter region of their target
genes. These genes constitute the CBF regulon
and promote higher tolerance to cold (Gilmour
et al. 2004). The structural organization and
transcriptional activity of the ScCBFs revealed
some intriguing features. The cross-species
comparisons indicated that the CBFs underwent
rapid expansion via the duplication processes. In
S. commersonii two pseudogenes were found,
with roles in response to freezing and cold
acclimatization, respectively. In particular, the
paucity of sequence change indicated that, after
the divergence of the two species lineages, there
were likely strong constraints on CBF3 that
conserved the protein sequence. A different situ-
ation was found for the ScCBF2 pseudogene,
which shares only 80% of identity with the
functional ScCBF2 gene. This suggests that gene
duplication occurred prior to divergence of the S.
tuberosum and S. commersonii lineages from
their most recent common ancestor, with the
duplicated copy subsequently undergoing rear-
rangements, as observed also in other duplicated
genes (Lynch and Force 2000). It has been
hypothesized that a duplication event occurred
after the S. tuberosum-S. commersonii divergence
and may have led to a different functionalization
of the ScCBF3 pseudogene, resulting in enhanced
cold response capability in S. commersonii.
7.2.3 Gene and Metabolite
Diversification
Potato can be considered an important staple
crop for both developed and developing coun-
tries. Consequently, the biofortification of tubers
is an important breeding goal (Bradshaw et al.
2006). Further, the presence of certain
S. Esposito et al.
metabolites can help the plant to face several
environmental stressors and attacks by some
pathogens. Considering this, as the first wild
potato species sequenced, S. commersonii can be
considered an important resource. Recently, we
carried out comparative genome analyses to
verify whether differences in the metabolite
levels were caused by variations in the abun-
dance of genes involved in the metabolism of
ascorbic acid, aromatic amino acids, phenyl-
propanoids and glycoalkaloids (Aversano et al.
2017). It has been found that, for some important
metabolites, the number of gene families related
to their pathways is correlated with the abun-
dance of metabolites studied. Our data showed
that the gene families analyzed are dynamic and
greatly expanded in S. commersonii and differ-
ences in the copy numbers of some specific genes
may have been caused by gene loss or expansion
within a species and contribute to genetic varia-
tion. The variable expansion of the gene families
may reflect such an adaptive function. For
instance, S. commersonii showed more annotated
phenylpropanoid genes than S. tuberosum. Con-
sequently, the total amount of phenylpropanoids,
which are metabolites involved in several plant
responses, was higher in S. commersonii than in
the cultivated count part. Conversely, other
metabolites with a predominant nutritional
importance, such as ascorbic acid and trypto-
phan, were higher in potato than in the wild
species. For these metabolites, the number of
isomers of protein-coding genes involved in their
regulation (e.g. phosphomannomutase and N-5
phosphoribosylanthranilate isomerase, respec-
tively) prevailed more in potato than in S. com-
mersonii. The only exception was observed for
the glycoalkaloid gene family. In fact, although
S. commersonii showed a higher amount of
glycoalkaloids, it was S. tuberosum that had a
higher number of genes linked to them. It seems
possible that the different ploidy level between
the two species affected the glycoalkaloid con-
tent. Indeed, previous evidence showed a nega-
tive association between these compounds and
genome doubling in S. commersonii (Caruso
et al. 2011). This combination of findings pro-
vides some new conceptual premises on how
7 The Wild Side of Potato: Insights into The Genome …
metabolites and their genes may evolve during
potato domestication.
7.3 Expression Atlas
of S. Commersonii
In plants, transcriptome profiles were docu-
mented in several species including A. thaliana
(Schmid et al. 2005), maize (Sekhon et al. 2011,
2013), rice (Jiao et al. 2009), soybean (Libault
et al. 2010), barley (Druka et al. 2006), alfalfa
(Benedito et al. 2008), lotus (Verdier et al. 2013),
and sorghum (Shakoor et al. 2014). In 2011, a
reference for the potato transcriptome using 32
tissues and growth conditions from the doubled
monoploid S. tuberosum Group Phureja clone
DM1-3 516R44 was reported (Massa et al.
2011). This resource provided a powerful tool for
potato research as well as for studies on other
members of the Solanaceae family. The avail-
ability of the S. commersonii genome and the
Fig. 7.5 Venn diagram of
genes expressed in different S.
commersonii tissues
115
RNA-seq data has facilitated our investigation of
gene expression profiles associated with impor-
tant traits. To provide insight into the transcrip-
tional programmes controlling the development
of some organ systems, we generated a global
gene expression atlas for S. commersonii. We
profiled the transcriptome of S. commersonii
flowers, leaves, roots and stolons through
RNA-seq. Only those genes with an FPKM
value >1 in at least one tissue were designated as
expressed. Based on this criterion, 26,408 (71%)
of the annotated genes were expressed in at least
one tissue, indicating substantially higher repre-
sentation of the transcriptome. Only a small
quantity of genes was not expressed in the ana-
lyzed tissues. The diversity of transcriptional
activity was highly variable across tissues, with
the flower tissue expressing the largest number of
genes (24,000 of all genes), and the tuber tissue
expressing the smallest number of genes (less
than 20,000) (Fig. 7.5). This diversity is
enhanced also from the number of genes that
116
were tissue-specific. Indeed, a total of 1,090
genes were unique in flowers while 736, 726 and
90 were expressed only in leaves, roots and
stolons, respectively. As we did not deliberately
include sample tissues exposed to any abiotic or
biotic stresses, this observation suggests that
expansion of the atlas to include stressed tissues
may provide a broader representation of the full
S. commersonii transcriptomes. This will help to
identify the dynamic transcriptional profiles
representing different cell types and develop-
mental processes, provide new regulatory targets
and allow the manipulation of specific pathways
involved in the control of traits important for
breeding.
7.4 Genomic and Abiotic Stressors
7.4.1 S. commersonii Genome:
An Attractive Tool
to Study Polyplodiation
Genome polyploidization events occurred fre-
quently during flowering plant speciation and
diversification, with several major crops being
polyploid or having experienced genome dupli-
cation events during their evolution (Sattler et al.
2016). Regarding the cultivated potato, the
whole-genome sequence (WGS) assembly pro-
vided evidence that its genome has undergone
extensive genome duplications since its origin
and that the expansion of particular gene families
has contributed to the evolution of this crop
(Potato Genome Sequencing Consortium 2011).
Therefore, the study of the effects of genome
doubling in Solanaceae is particularly interesting
in order to understand how potato has evolved
and diversified. Furthermore, since polyploid
formation causes a series of structural and func-
tional genetic changes, as well as epigenetic
remodelling, polyploids offer the possibility of
exploiting several advantages from a practical
standpoint. Among them there is the option to
overcome sexual barriers as already described in
Fig. 7.1. The availability of the S. commersonii
genome sequence and the ease with which syn-
thetic polyploids can be produced in this species
S. Esposito et al.
make it an attractive biological system to study
the consequences of autopolyploidization. The
analysis of newly-synthetized S. commersonii
polyploids (the same type of polyploids used in
breeding) offered significant results. As sug-
gested by the analyses of both Inter-SSR and
SSR loci, chromosome doubling did not affect
the genome structure of S. commersonii (Aver-
sano et al. 2013, 2015a, b) but stochastic epige-
netic and morphological modifications occurred
after genome doubling (Aversano et al. 2013).
Interestingly, autopolyploidization remodelled
also the transcriptome and the metabolome, with
the latter being characterized by an increase in
chlorogenic acid accumulation and by a tuber
glycoalkaloids decrease (Caruso et al. 2011;
Fasano et al. 2016). This condition resembles the
common metabolic status of domesticated pota-
toes. A model explaining the polyploidy syn-
drome and the phenotypic effect that it can
produce has been proposed (Fasano et al. 2016).
According to this model, autopolyploidization
results in a nucleotide pool imbalance, which in
turn triggers a genomic shock responsible for the
stochastic events observed. The more extensive
genomic stress and the higher number of
stochastic events observed in S. commersonii
with respect to other species could be the result
of the greater nucleoside depletion observed in
this species. Given that, an intriguing question
regarding the divergent evolution between S.
commersonii and S. tuberosum may arise: did a
more suitable metabolic status of an ancestor
allow the development of a tetraploid potato?
The exploitation of the S. commersonii genome
sequence will help to answer this question and
promises to reveal important connections
between genotype and phenotype, thus allowing
plant breeders to manipulate polyploid genomes
more accurately when improving target traits.
7.4.2 The S. Commersonii Genome:
An Attractive Tool
to Study Cold Tolerance
Frost is the abiotic constraint that causes severe
yield losses in potato. If such exposure is
7 The Wild Side of Potato: Insights into The Genome …
extended in time, low temperature stress causes
major alterations in the plant metabolism that
ultimately lead to cell death. Although S. com-
mersonii does not have a commercial value, over
the past two decades this species has been mainly
studied for its resistance to cold. When S. com-
mersonii and S. tuberosum are grown at warm
temperature, their freeze-killing temperatures are
about −5.8 and −3 °C, respectively. After two
weeks of acclimatization at 4 °C, the killing
temperature of S. commersonii peaks to about
−8.3 °C while that of S. tuberosum remains at
about −2 °C (Fig. 7.6).
The ability of a genotype to tolerate low
temperatures has not been extensively under-
stood. However, several reports have been pub-
lished so far, documenting that low-temperature
tolerance is a complex process, involving chan-
ges in the expression of numerous
cold-responsive (COR) genes (Zhao et al. 2015).
Regulatory factors influencing the expression of
COR genes and/or freezing tolerance have been
identified over the last decade (van Buskirk and
Thomashow 2006; Chinnusamy et al. 2006). The
A. thaliana CBF cold response pathway is most
likely the best-understood regulatory pathway
involved in cold resistance. In A. thaliana,
Fig. 7.6 Phenotype of cold-treated (−2 °C for one hour) S. tuberosum and S. commersonii after recovery (24 h at 24 °C)
117
Gilmour et al. (1998) indicated that the CBF
genes are physically linked. Four CBF genes
were found in S. commersonii (CBF1–CBF4)
and five in S. tuberosum (CBF1–CBF5) (Aver-
sano et al. 2015a). S. commersonii CBF4 was
physically linked to CBF5 in S. tuberosum and
was identified as responsive to low temperature
(Pennycooke et al. 2008). Interestingly, an extra
copy of CBF3 that lacks the PPKKPAGR
domain, but retains the DASWR ones, both
located near the AP2 DNA-binding domain
(upstream and downstream, respectively) was
found in S. commersonii (Aversano et al. 2015a).
These latter domains play an important func-
tional role, as the ability of CBF1 to bind to the
CRT/DRE element requires amino acids that
extend beyond the AP2 DNA-binding domain.
To shed further light on wild potato freezing
tolerance, several studies on CBFs genes were
carried out. Pino et al. (2008) demonstrated that
the over-expression of AtCBF1 in transgenic
lines of S. tuberosum and S. commersonii did not
result in a further increase in freezing tolerance
of the cultivated potato, indicating that probably
no additional cold-regulated genes beyond those
regulated by CBF could increase freezing toler-
ance. Later, Carvallo et al. (2011) reported that
118
both species have CBF regulons (genes regulated
by CBFs) composed of hundreds of genes and
both plants altered their gene expression in
response to low temperature with similar kinet-
ics. However, there were considerable differences
in the sets of genes that comprised the low
temperature transcriptomes and CBF regulons.
The results reported by Carvallo et al. (2011)
indicated that the overexpression of AtCBF3
upregulated 160 cold-induced genes in S. com-
mersonii, and only 54 in S. tuberosum. Thus,
differences in cold regulatory programmes may
contribute to the differences in freezing tolerance
of these two species. However, due to the
array-based technology used, it is possible that
some of the differentially cold-regulated genes in
the two species resulted from a nucleotide mis-
match between S. commersonii transcripts and S.
tuberosum probe ESTs (Carvallo et al. 2011).
Nowadays, with the availability of the assembled
genome of S. commersonii, new studies can be
directed at detailing the qualitative and quanti-
tative differences between the transcriptomes of
resistant S. commersonii and susceptible S.
tuberosum. More than 5,800 predicted protein
sequences similar to Arabidopsis proteins anno-
tated as responsive elements to cold were iden-
tified in S. commersonii. 1,451 proteins were
homologous to Arabidopsis sequences annotated
with the GO terms related to cold, namely: cold
acclimation (CA), cellular response to cold
(CRC) and response to cold (RC). Roughly 2,860
genes were enriched in S. commersonii (707, 85
3500
Number of genes
3000
2500
2000
1500
1000
500
0
CA-like CRTC-like RTC-like
Fig. 7.7 Cold responsive genes annotation analysis.
Left: Number of genes with unique GO term in S.
commersonii and S. tuberosum. Right: Number of unique
S. Esposito et al.
and 2072 for CA-like, CRC-like and RC-like
terms, respectively). By contrast, only 532, 181
and 1,539 genes were enriched in S. tuberosum.
GO annotation also revealed that 34 CA-like,
CRC-like, and RC-like categories encompassed a
large number (1,546) of cold-responsive genes
harbouring a SNP (12.4% of total). In addition,
out of 126 unique annotated S. commersonii
genes involved in response to cold, 32 belonged
to CA-like, 4 to CRTC-like, and 90 to RTC-like
GO terms (Fig. 7.7).
Using the new genome sequence, a tran-
scriptional profiling of S. commersonii under low
temperature stress was performed. The cold
acclimatization pathway starts when plants sense
low temperatures through membrane rigidifica-
tion at the apoplastic level; it is followed by a
surge of Ca2+ into the cytosol able to induce the
activation of transcription factors and, conse-
quently, cold responsive genes in the nucleus
(Fig. 7.8). According to this scheme, a
whole-genome expression data analysis high-
lighted an extensive reorganization of the tran-
scriptome triggered by low temperatures. These
changes included up- and down-regulation of
hundreds of genes. The CDPK7 (Ca2+-dependent
protein kinases), as well as CIPK-3, and -23
(CBL interacting protein kinase) were all acti-
vated. Furthermore, the levels of expression of
CBF1 and CBF3 remained high even after long
exposure to cold. This situation has not been
observed in A. thaliana where the levels of
expression of CBF1 and CBF3 drastically
S. tuberosum
S. commersonii
PL
QR O
Total
genes involved in tolerance to cold in S. commersonii. CA
cold acclimation; CRTC cellular response to cold; RTC
response to cold
7 The Wild Side of Potato: Insights into The Genome … 119

Fig. 7.8 Cold-sensing and signalling pathway. Expression levels are indicated by shades of blue (down-regulation)
and red (up-regulation), where white indicates no differences between control and cold stressed plants

Fig. 7.9 Structural organization of the StCBF and ScCBF regions

decrease a few hours after exposure to cold and
expression levels of CBF2 increase from two
hours after cold exposure (Novillo et al. 2004). In
S. commersonii we also found an extra CBF3
copy lacking in the potato genome (Fig. 7.9) and
its contribution in increasing the cold resistance
of this wild species has been hypothesized.
Indeed, such extra copy encodes a protein still
retaining the functional domains and, therefore,
potentially able to bind the CRT/DRE motif of
the COR gene promoters. On the other hand, the
fact that they have only one functional copy of
the gene CBF2 (duplicated in S. tuberosum),
known for its negative regulation of CBF1 and
CBF3 (Novillo et al. 2004), may explain the high
levels of expression found for CBF1 and CBF3
even after many hours of exposure to cold.
120
7.5 Conclusion
With the release of the S. commersonii genome
sequence scientists have ushered in the new era
of WGS of wild potato relatives paving a path to
understanding the molecular dynamics confer-
ring this species with so many adaptive charac-
teristics. From the analysis of its *830 million
base pairs, the genome features of S. commer-
sonii have been enlightened. Candidate genes for
cold stress tolerance have been identified and the
evidence that the genomes of S. commersonii and
that of cultivated potato are similar in size but
exhibit sequence variation mainly in intergenic
regions have been provided. Furthermore, SSR
distribution and patterns in the S. commersonii
genome were found to be significantly enriched
compared to S. tuberosum, laying the foundation
for future investigations of their evolutionary
significance. On the horizon, we see the potential
to access much more efficiently and in greater
volume than before the tremendous amount of
genetic diversity this promising wild species
holds and the possibility of selecting specific
gene or haplotype combinations that are associ-
ated with the desired phenotypes. Collectively,
this will increase opportunities for a more
strategic use of such a genomic resource to
improve the cultivated potato.
References
Aversano R, Caruso I, Aronne G, De Micco V, Scog-
namiglio N, Carputo D (2013) Stochastic changes
affect Solanum wild species following autopoly-
ploidization. J Exp Bot 64(2):625–635
Aversano R, Contaldi F, Ercolano MR, Grosso V,
Iorizzo M, Tatino F et al (2015a) The Solanum
commersonii genome sequence provides insights into
adaptation to stress conditions and genome evolution
of wild potato relatives. Plant Cell 27(4):954–968
Aversano R, Scarano MT, Aronne G, Caruso I, D’Amelia
V, De Micco V, Fasano C, Termolino P, Carputo D
(2015b) Genotype-specific changes associated to early
synthesis of autotetraploids in wild potato species.
Euphytica 202(2):307–316
Aversano R, Contaldi F, Adelfi MG, D’Amelia V,
Diretto G, De Tommasi N, Vaccaro C, Vassallo A,
Carputo D (2017) Comparative metabolite and
genome analysis of tuber-bearing potato species.
S. Esposito et al.
Phytochemistry. doi:10.1016/j.phytochem.2017.02.
011
Benedito VA, Torres-Jerez I, Murray JD, Andriankaja A,
Allen S, Kakar K, Wandrey M, Verdier J, Zuber H,
Ott T, Moreau S, Niebel A, Frickey T, Weiller G,
He J, Dai X, Zhao PX, Tang Y, Udvardi MK (2008) A
gene expression atlas of the model legume Medicago
truncatula. Plant J 55(3):504–513
Bennetzen JL (2000) Transposable element contributions
to plant gene and genome evolution. Plant Mol Biol
42(1):251–269
Bennetzen JL, Coleman C, Liu JMR, Ramakrishna W
(2004) Consistent over-estimation of gene number in
complex plant genomes. Curr Opin Plant Biol 7:732–
736
Boulesteix M, Weiss M, Biémont C (2006) Differences in
genome size between closely related species: the
Drosophila melanogaster species subgroup. Mol Biol
Evol 23(1):162–167
Bradshaw JE, Bryan GJ, Ramsay G (2006) Genetic
resources (including wild and cultivated Solanum
species) and progress in their utilisation in potato
breeding. Potato Res 49:49–65
Cai B, Li CH, Yao QH, Zhou J, Tao JM, Zhang Z (2009)
Analysis of SSR in grape genome and development of
SSR database. J Nanjing Agric Univ 32(4):501–510
Carputo D, Barone A, Cardi T, Sebastiano A, Frus-
ciante L, Peloquin SJ (1997) Endosperm balance
number manipulation for direct in vivo germplasm
introgression to potato from a sexually isolated
relative (Solanum commersonii Dun.). Proc Natl Acad
Sci USA 94:12013–12017
Caruso I, Lepore L, De Tommasi N, Dal Piaz F,
Frusciante L, Aversano R, Garramone R, Carputo D
(2011) Secondary metabolite profile in induced
tetraploids of wild Solanum commersonii Dun. Chem
Biodivers 8(12):2226–2237
Carvallo MA, Pino MT, Jeknic Z, Zou C, Doherty CJ,
Shiu S-H, Chen THH, Thomashow MF (2011) A
comparison of the low temperature transcriptomes and
CBF regulons of three plant species that differ in
freezing tolerance: Solanum commersonii, Solanum
tuberosum, and Arabidopsis thaliana. J Exp Bot
62:3807–3819
Chinnusamy V, Zhu J, Zhu JK (2006) Gene regulation
during cold acclimation in plants. Physiol Plant
26:52–61
D’Amelia V, Aversano R, Ruggiero A, Batelli G, Appel-
hagen I, Dinacci C, Hill L, Martin C, Carputo D
(2017) Subfunctionalization of duplicate MYB genes
in Solanum commersonii generated the cold-induced
ScAN2 and the anthocyanin regulator ScAN1. Plant
Cell Environ (Accepted with minor revision)
Druka A, Muehlbauer G, Druka I, Caldo R, Baumann U,
Rostoks N (2006) An atlas of gene expression from
seed to seed through barley development. Funct Integr
Genomics 6:202–211
Fasano C, Diretto G, Aversano R, D’Agostino N, Di
Matteo A, Frusciante L, Giuliano G, Carputo D (2016)
Transcriptome and metabolome of synthetic Solanum
7 The Wild Side of Potato: Insights into The Genome …
autotetraploids reveal key genomic stress events
following polyploidization. New Phytol 210
(4):1382–1394
Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP,
Houghton JM, Thomashow MF (1998) Low temperature
regulation of the Arabidopsis CBF family of AP2
transcriptional activators as an early step in cold-induced
COR gene expression. Plant J 16(4):433–442
Gilmour SJ, Fowler SG, Thomashow MF (2004) Ara-
bidopsis transcriptional activators CBF1, CBF2, and
CBF3 have matching functional activities. Plant Mol
Biol 54:767–781
Guang L, Zhang Z, Wang XW, Xue HB, Liu YH,
Wang SH, Qiao Y-S (2012) Evaluation and applica-
tion of the SSR loci in apple genome. Sci Agric Sinica
44(21):4415–4428
Hawkes JG (1990) The potato: evolution, biodiversity and
genetic resources. Belhaven Press, Washington, USA
Hirsch CN, Hirsch CD, Felcher K, Coombs J, Zarka D,
Van Deynze A, De Jong W, Veilleux RE, Jansky SH,
BethkeP, Douches DS, Buell CR (2013) Retrospective
view of North American potato (Solanum tuberosum
L.) breeding in the 20th and 21st centuries. G3
(Bethesda) 3(6):1003–1013
Jackson SA, Hanneman RE (1999) Crossability between
cultivated and wild tuber-and non-tuber-bearing
Solanum. Euphytica 109:51–67
Jiao Y, Tausta SL, Gandotra N, Sun N, Liu N, Clay NK
(2009) A transcriptome atlas of rice cell types
uncovers cellular, functional and developmental hier-
archies. Nat Genet 41:258–263
Johnston SA, den Nijs TPM, Peloquin SJ, Hanneman RE
Jr (1980) The significance of genic balance to
endosperm development in interspecific crosses.
Theor Appl Genet 57:5–9
Jurka J (2000) Repbase update: a database and an
electronic journal of repetitive elements. Trends Genet
16(9):418–420
Lakhotia N, Joshi G, Bhardwaj AR, Katiyar-Agarwal S,
Agarwal M, Jagannath A, Goel S, Kumar A (2014)
Identification and characterization of miRNAome in
root, stem, leaf and tuber developmental stages of
potato (Solanum tuberosum L.) by high-throughput
sequencing. BMC Plant Biol 14:6
Libault M, Farmer A, Joshi T, Takahashi K, Langley RJ,
Franklin LD, He J, Xu D, May G, Stacey G (2010) An
integrated transcriptome atlas of the crop model
Glycine max, and its use in comparative analyses in
plants. Plant J 63(1):86–99
Lynch M, Force A (2000) The probability of duplicate
gene preservation by subfunctionalization. Genetics
154:459–473
Machida-Hirano R (2015) Diversity of potato genetic
resources. Breed Sci 65(1):26–40
Massa AN, Childs KL, Lin H, Bryan GJ, Giuliano G,
Buell CR (2011) The transcriptome of the reference
potato genome Solanum tuberosum Group Phureja
clone DM1-3 516R44. PLoS ONE. 6(10):e26801
Michael TP, Jackson S (2013) The First 50 Plant
Genomes. Plant Genome 6:7
121
Micheletto S, Boland R, Huarte M (2000) Argentinian
wild diploid Solanum species as sources of quantita-
tive late blight resistance. Theor Appl Genet 101
(5):902–909
Novillo F, Alonso JM, Ecker JR, Salinas J (2004)
CBF2/DREB1C is a negative regulator of
CBF1/DREB1B and CBF3/DREB1A expression and
plays a central role in stress tolerance in Arabidopsis.
Proc Natl Acad Sci USA 101:3985–3990
Palta JP, Simon G (1993) Breeding potential for improve-
ment of freezing stress resistance: genetic separation of
freezing tolerance, freezing avoidance, and capacity to
cold acclimate. In: Li PH (ed) Advances in plant cold
hardiness. CRC Press, Boca Raton, Florida, USA,
pp 299–310
Pennycooke JC, Cheng H, Roberts SM, Yang Q,
Rhee SY, Stockinger EJ (2008) The low
temperature-responsive, Solanum CBF1 genes main-
tain high identity in their upstream regions in a
genomic environment undergoing gene duplications,
deletions, and rearrangements. Plant Mol Biol 67:483–
497
Piegu B, Guyot R, Picault N, Roulin A, Sanyal A, Kim H,
Collura K, Brar DS, Jackson SA, Wing RA, Panaud O
(2006) Doubling genome size without polyploidiza-
tion: dynamics of retrotransposition- driven genomic
expansions in Oryza australiensis, a wild relative of
rice. Genet Res 16:1262–1269
Pino MT, Skinner JS, Jeknić Z, Hayes PM, Soeldner AH,
Thomashow MF, Chen TH (2008) Ectopic AtCBF1
over-expression enhances freezing tolerance and
induces cold acclimation-associated physiological
modifications in potato. Plant, Cell Environ 31
(4):393–406
Potato Genome Sequencing Consortium (2011) Genome
sequence and analysis of the tuber crop. Nature
475:189–195
Rodríguez F, Spooner DM (2009) Nitrate reductase
phylogeny of potato (Solatium sect. Petota) genomes
with emphasis on the origins of the polyploid species.
Syst botany 34:207–219
Sattler MC, Carvalho CR, Clarindo WR (2016) The
polyploidy and its key role in plant breeding. Planta
243(2):281–296
Schmid M, Davison TS, Henz SR, Pape UJ, Demar M,
Vingron M (2005) A gene expression map of
Arabidopsis thaliana development. Nat Genet
37:501–506
Sekhon RS, Lin H, Childs LK, Hansey CN, Buell CR, de
Leon N, Kaeppler SM (2011) Genome-wide atlas of
transcription during maize development. Plant J 66
(4):553–563
Sekhon RS, Briskine R, Hirsch CN, Myers CL,
Springer NM, Buell CR, de Leon N, Kaeppler SM
(2013) Maize gene atlas developed by RNA sequenc-
ing and comparative evaluation of transcriptomes
based on RNA sequencing and microarrays.
PLoS ONE 8(4):e61005
Shakoor N, Nair R, Crasta O, Morris G, Feltus A,
Kresovich S (2014) A Sorghum bicolor expression
122
atlas reveals dynamic genotype-specific expression
profiles for vegetative tissues of grain, sweet and
bioenergy sorghums. BMC Plant Biol 14(1):35
Tomato Genome Consortium (2012) The tomato genome
sequence provides insights into fleshy fruit evolution.
Nature 485:635–641
Van Buskirk HA, Thomashow MF (2006) Arabidopsis
transcription factors regulating cold acclimation.
Physiol Plant 126:72–80
Verdier J, Torres-Jerez I, Wang M, Andriankaja A,
Allen SN, He J, Tang Y, Murray JD, Udvardi MK
S. Esposito et al.
(2013) Establishment of the Lotus japonicus Gene
Expression Atlas (LjGEA) and its use to explore
legume seed maturation. Plant J 74(2):351–362
Yamaguchi-Shinozaki K, Shinozaki K (2006) Transcrip-
tional regulatory networks in cellular responses and
tolerance to dehydration and cold stresses. Annu Rev
Plant Biol 57(1):781–803
Zhao C, Lang Z, Zhu JK (2015) Cold responsive gene
transcription becomes more complex. Trends Plant Sci
20(8):466–468
 Genomics in Management
and Genetic Enhancement of Potato 8
Germplasm

Jagesh Kumar Tiwari, Vinod Kumar, Sapna Devi,

S. K. Luthra, Swarup Kumar Chakrabarti, Shashi Rawat
and M. Nagesh

Abstract
The systematic characterization and utilization of naturally occurring
genetic variation in the plant genetic resources have become an important
approach in plant genome research and breeding. The development of
molecular techniques now allows a more accurate analysis of a large
collections of potato germplasm. The rapid progress in high-throughput
technology such as next-generation sequencing (NGS) offers an exciting
tool for novel gene discovery involved in phenotypic traits expression. In
the years to come, genomics, transcriptomics and other ‘omics’ technolo-
gies will play a key role in potato improvement. The discovery and
high-throughput screening of single nucleotide polymorphism (SNP), the
presence/absence of allelic variations in diverse germplasm collections
will give a detailed insight into the origin, domestication and available
trait-relevant variations in the polyploid crops such as potato. In the
process, novel approaches and possibilities for marker/genomics-assisted
potato breeding are facilitated. This chapter highlights the use of potato
genome sequence in management and the genetic enhancement of the
potato through its characterization and identification of novel
gene/QTL/allele followed by their applications in potato improvement
with agricultural relevance.

J. K. Tiwari (&)
S. Devi
S. K. Chakrabarti

S. Rawat
M. Nagesh
ICAR-Central Potato Research Institute, Shimla,
Himachal Pradesh 171 001, India
e-mail: jageshtiwari@gmail.com
V. Kumar
ICAR-Central Potato Research Station,
Kufri-Shimla, Himachal Pradesh 171 012, India
S. K. Luthra
ICAR-Central Potato Research Institute Campus,
Modipuram, Meerut, Uttar Pradesh 250 110, India
8.1 Introduction
Potato is the fourth most important food crop of
the world, after rice, wheat and maize with
record global annual production of 381.68 mil-
lion tonnes (MT) from a 19.09 million hectare
area in 2014. China is the largest potato pro-
ducer, followed by India (95.51 and 46.39 MT,
respectively). However, potato yield has been

© Springer International Publishing AG 2017 123

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_8
124 J. K. Tiwari et al.

erratic across the world during 2000–2014,
ranging between 16.3 and 19.98 t/ha, though
showing an overall slight increase (FAOSTAT
2014). A summary of worldwide statistics of
area, production and productivity of potato is
outlined in Table 8.1. Given the pivotal role of
the potato, the United Nations declared the year
2008 as ‘International Year of the Potato’ (IYP).
Besides, it is also known as the ‘Hidden Trea-
sure of the Andes’ and identified as the ‘Food
for the Future’ by the Food and Agriculture
Organization. There is an imperative need to
use the available vast genetic diversity of potato
gene pools for the genetic enhancement of the
crop to ensure food and nutritional security in
the years to come.
The main cultivated potato Solanum tubero-
sum L. is a tetraploid (2n = 4x = 48), is highly
heterozygous, suffers acute inbreeding depres-
sion, and is susceptible to many pests and dis-
eases. Together, these traits raise problems for
potato improvement in classical breeding meth-
ods. Therefore, a challenge to the scientific
community was to decipher the whole genome
sequence of potato that would ultimately aug-
ment genomics-assisted potato breeding. To
overcome this issue, researchers across the world
successfully sequenced the potato genome
sequence at an international platform by the
Potato Genome Sequence Consortium (PGSC).
The PGSC discovered the potato genome
(844 Mb) and predicted 39,031 protein-coding
genes regulating various growth and develop-
ment in the potato crop (Xu et al. 2011; http://
www.potatogenome.net). The first potato gen-
ome sequence data provides a basic platform for
the genetic improvement of potato.
Potato belongs to the genus Solanum which
contains *2000 species, of which *235 are
tuber-bearing, that varies from 2x (73%) to
6x (6%) (Hawkes 1990). Potato gene pools
include four types of germplasm: (1) cultivated
potato (Solanum tuberosum subsp. tuberosum);
(2) native potatoes occurring in the centre of
diversity (7–12 species); (3) wild species (180–
200 species); and (4) other germplasm or
research material, genetic stocks, etc. (FAO
2010). Moreover, cultivated potato (Solanum
tuberosum L.) has two subspecies; (1) Solanum
tuberosum subsp. andigena is adapted to short
days and widely distributed in the Andean
regions of Venezuela and northern Argentina;
and (2) Solanum tuberosum subsp. tuberosum is
adapted to long days and occurs in southern
Chile. In South America, the native primitive
cultivated potato species are S. juzepczukii (3x),

Table 8.1 Statistics of SN Country Production Area Yield

area, production and (million tonnes) (million ha) (tonne/ha)
productivity of potato in
the world 1. China 95.51 5.64 16.92
2. India 46.39 2.02 22.92
3. Russian Federation 31.50 2.10 14.99
4. USA 20.05 0.42 47.15
5. Germany 11.60 0.24 47.41
6. Ukraine 23.69 1.34 17.64
7. Poland 7.68 0.27 27.76
8. France 8.08 0.16 47.97
9. Netherlands 7.10 0.15 45.66
10. Bangladesh 8.95 0.46 19.38
11. United Kingdom 5.91 0.14 41.92
12. Iran 4.71 0.15 29.67
13. Australia 1.17 0.03 39.70
World total 381.68 19.09 19.98
Source FAOSTAT (2014)
8 Genomics in Management and Genetic Enhancement …
S. chaucha (3x), S. stenotonum (2x), S. ajanhuiri
(2x), S. goniocalyx (2x), S. curtilobum (5x), S.
phureja (2x) and S. tuberosum subsp. andigena
(4x) (Hawkes 1990).
Conservation and utilization of crop genetic
diversity are essential to improve the productiv-
ity, sustainability, and nutritional quality in the
changing climates, pests, pathogens, and con-
sumer demands. Global potato gene banks exist
to conserve the diversity of the cultivated and the
wild Solanum species. Farmers in the crop’s
centre of origin and diversity still maintain hun-
dreds of native potatoes and thereby actively
contribute to the ongoing in situ conservation and
evolution of the cultivated potato. Globally,
about 98,000 accessions can be found ex situ
(in vitro conservation), 80% of which are main-
tained in 30 key gene bank collections. Acces-
sions are conserved as botanical seeds or
vegetatively as tubers and in vitro plantlets. Latin
American collections contain many native culti-
vars and wild relatives and the collections in
Europe and North America contain modern cul-
tivars and breeding materials, as well as wild
relatives (FAO 2010). The largest collection of
the potato germplasm is maintained by the
International Potato Centre (CIP), in Lima in
Peru, followed by other gene banks such as the
Dutch-German Potato Collection, the Centre for
Genetic Resources (CGN), The Netherlands; the
Commonwealth Potato Collection, Dundee,
Scotland, United Kingdom; the NRSP-6, United
States Potato Genebank, USA, and many others.
Solanum germplasm represents a huge diverse
gene pool source, however, only a very small
amount of the available biodiversity has been
exploited in the potato breeding. Attempts to
document and characterize in situ collections of
Solanum species diversity are needed as a base-
line for future research. However, breeders prefer
to use well-adapted germplasm or research
materials of cultivated potato with interesting
traits. Therefore, tapping the rich genetic diver-
sity in a Solanum species and their wild relatives
is a prerequisite for potato improvement in the
future. Hence, modern biotechnological tools
must be developed and exploited to accelerate
125
breeding by accessing available genetic diversity
stored in the gene banks around the world.
Recent developments in the potato genome
sequencing and high-throughput molecular mar-
ker technologies have great potential for genetic
enhancement of potato germplasm. Plant geno-
mics researchers have readily embraced bioin-
formatics and molecular approaches to generate
genome, transcriptome and epigenome datasets
for crop species, though ploidy and heterozy-
gosity together have been a challenge. The ability
to generate de novo transcriptome assemblies
provides an alternative approach to bypass these
complex genomes and to access the target genes
(Hamilton and Buell 2012). Moreover, at present,
omics approaches such as transcriptomics and
metabolomics are used the world over not only
for basic research to understand the relationships
between important traits and metabolism but also
to develop the next generation of breeding
strategies of crop plants. In this chapter, we
highlight the impact of the potato genome
sequence data on management and genetic
enhancement of potato using next-generation
sequencing technologies and other
genomics-based novel approaches.
8.2 Use of Genomics in Gene Bank
Management and Genetic
Diversity Analysis of Solanum
Germplasm
Only a small fraction of the naturally occurring
genetic diversity available in the worldwide gene
banks has been explored to date, but now it is
expected to rapidly increase with the advent of
high-throughput genotyping and sequencing
technologies. It is imperative that the systematic
genotyping of gene bank accessions will be more
effective to study potato crop biodiversity.
Large-scale genotyping and targeted
re-sequencing have the potential to significantly
advance the conservation, characterization, and
utilization of the potato genetic resources. This
approach of germplasm exploration will discover
the genetic potential of underutilized resources,
126
examine genome-wide natural variation and make
predictions about novel genes/alleles linked with
phenotypes. Genomics information would also
enable germplasm curators to monitor how their
germplasm is being used in research and breeding.
The size of germplasm collections continues
to increase, often through the uncontrolled
duplication of materials in different gene banks.
As their size increases, there is increasing pres-
sure to reduce the size of collections by elimi-
nating ‘duplicate samples’ to reduce redundancy.
One objective of a gene bank is to support the
broadening of the diversity in commercial crop
varieties through providing ready access to novel
and useful genetic variation. Until recently,
amplified fragment length polymorphism (AFLP)
or simple sequence repeat (SSR) were the
molecular markers of choice for genotyping of
crop genomes. High-throughput genotyping and
sequencing can be used to quantify levels of
genetic variation among individuals within an
accession as well as between accessions
(McCouch et al. 2012). Moreover, due to the
amenability of systematic development and quick
detection, single nucleotide polymorphism
(SNP) molecular markers are abundant and dis-
tributed enough in a whole genome to distinguish
individuals in a population. SNP markers are
increasingly being applied to study genetic
diversity in germplasm collections of thousands
of accessions. Researchers at the International
Rice Research Institute (IRRI) have used
384-SNP assays based on the rice genome for the
classification of rice genotypes (Thomson et al.
2012). The development of an Infinium 8.3 K
SNP Potato Array of the Solanaceae Coordinated
Agricultural Project (SolCAP) (http://solcap.msu.
edu) has shown its relevance in the characteri-
zation of a core collection. The potato core col-
lection of 48 genotypes, representing a collection
of 350 tetraploid potatoes, was defined in order
to maximize the allelic diversity by SolCAP SNP
array (Esnault et al. 2012). The recent discovery
of 20 K SNP array allows population structure
analysis, breeding uses and many other biotech-
nological applications in potato improvement
(Vos et al. 2015). SNP markers are useful in the
detection of the genetic integrity of crop plants
J. K. Tiwari et al.
conserved in gene banks. The germplasm of 20
maize landrace accessions was investigated for
genetic integrity using 1150 SNPs and 235 SNP
haplotypes (Wen et al. 2011). Many of the
germplasm accessions have been established as
association panels for linkage disequilibrium
(LD) mapping to provide linkage between phe-
notypic and genotypic data. As potato is a
clonally propagated crop, the maintenance of
great numbers of germplasm accessions make
comprehensive and impractical to maintain
accurate descriptions of in vitro plants. So in the
clonal regeneration, one of the most crucial
concerns of curators is to retain genetic stability
of in vitro propagating material using molecular
markers (Tiwari et al. 2013a, 2013d). Second, to
retain most of the genetic diversity of the original
collection, a core collection of the Andigena
potato has been constructed based on
morpho-agronomic traits and genotyped by 24
SSR markers for their efficient exploitation of
genetic resources (Tiwari et al. 2013e). Robust
molecular markers linked to disease resistance
have been developed and validated for distinct-
ness, uniformity and stability (DUS) testing in
tomato (Arens et al. 2010). A set of SNP markers
has been designed and applied for cultivar
identification in Capsicum (Jung et al. 2010).
Thus, different marker type of choice and number
based on genome sequence data could be used on
a collection of Solanum germplasm for the
molecular characterization of interspecific
somatic hybrids (Chandel et al. 2015; Sarkar
et al. 2011; Tiwari et al. 2010), cytoplasm
type/organelle genome analysis (Tiwari et al.
2014, 2016), genetic diversity (Tiwari et al.
2013b, 2013c, 2013e), to evaluate the breeding
potential of somatic hybrids (Luthra et al. 2016),
for population structure and many more studies.
An overview of late blight-resistant wild potato
species is shown in Fig. 8.1. A dendrogram
showing the SSR markers-based molecular
diversity among the wild potato species, based
on the Jaccard similarity coefficient by the
UPGMA method is depicted in Fig. 8.2. Further,
genetic enhancement of potato germplasm
through somatic hybridization has been achieved
(discussed in Chap. 13 in this volume) and
8 Genomics in Management and Genetic Enhancement … 127

S. berthaultii S. cardiophyllum S. iopetalum S. jamesii S. lesteri

S. microdontum S. polyadenium S. pinnatisectum S. trifidum S. verrucosum

S. stoloniferum S. huancabambense S. commersonii S. vernei

Fig. 8.1 An overview of late blight-resistant potato wild species except S. commersonii and S. vernei

net-house views of a few somatic hybrids are
shown in Figs. 8.3 and 8.4.
Large-scale genomics experiments now are
getting underway to characterize wild and lan-
drace resources. Intensive genetic and pheno-
typic characterization of genetic resources by
high-throughput sequencing techniques will
increasingly become important. Potato gene
banks have to prepare for enriching the genomic
era by developing new strategies and novel
information tools to assess the genetic diversity
of their collections. This effort involves identi-
fying combinations of alleles and regions of the
genome responsible for variation in elite genetic
backgrounds of interest. The integration of
genomic data into gene bank documentation
systems and its combination with taxonomic,
phenotypic and ecological data will usher in a
new era in the potato genetic resources. From the
determination of phenotypic traits to the appli-
cation of NGS to whole genomes, this process
will have great impact on both conservation of
Solanum germplasm and its utilization in potato
breeding (Kalian and Graner 2012).
8.3 Genome-Wide Characterization,
Mapping, Gene and SNP
Discovery in Solanum
Germplasm Using NGS
Technology
The most promising potential to increase the use
of potato germplasm genes is the advances in the
field of genomics. While introgression was not
easily detectable with the genetic tools earlier,
128 J. K. Tiwari et al.

Fig. 8.2 Dendrogram showing SSR markers-based molecular diversity among the wild potato species, constructed
based on the Jaccard similarity coefficient by the UPGMA method

Fig. 8.3 Net-house view of potato somatic hybrids C-13 (+) S. pinnatisectum grown under the sub-tropical plains of
Modipuram, Uttar Pradesh, India (a, b, c); S. pinnatisecturm (d), dihaploid C-13 (e), and somatic hybrid P-8 (f)

the recent discovery of molecular markers and difficult to detect based on phenotypes. NGS
next-generation sequencing (NGS) technologies technologies have enormous power and potential
has helped in isolating beneficial genes which are to access the complex polyploid genomes of
8 Genomics in Management and Genetic Enhancement …
Fig. 8.4 Net-house view of potato somatic hybrids, C-13 (+) S. etuberosum grown under the sub-tropical Modipuram
conditions. Net-house view (a, b, c); S. etuberosum (d), C-13 (e) and somatic hybrid Etb6-2 (f)
many crops that offer high density markers.
Tracking of genetic variation has become so
efficient and precise that thousands of genes can
be identified within large gene bank collections.
Using NGS technologies, it is possible to
re-sequence candidate genes, entire transcrip-
tomes or entire plant genomes more efficiently
and economically than ever before. Advances in
sequencing technologies will allow for
whole-genome re-sequencing of hundreds of
individuals. Discovery and screening of
genome-wide SNPs are no longer a bottleneck
even in polyploidy genomes, opening the way for
the application of high-resolution association
genetics and genomic selection approaches to
crop improvement (Edwards et al. 2013). In this
way, information on thousands of genes can be
harnessed to analyse genetic diversity, perform
linkage mapping, identify individual genes and
determine their functional diversity. A gene
underlying a major effect quantitative trait locus
for plant maturity and initiation of tuber devel-
opment has been discovered recently by explor-
ing naturally occurring allele diversity that
allows potato cultivation in northern latitudes
(Kloosterman et al. 2013).
129
8.3.1 Allele Mining
Allele mining is a research field aimed at iden-
tifying such allelic variation for a known gene
within germplasm collections for breeder uses
that have been left behind during the domesti-
cation of the process. These resources stored in
gene banks remain unexplored due to lack of
efficient strategies to detect target alleles. Germ-
plasm collections may be screened for allelic
variation to identify genes of known function and
their DNA sequence. The most effective strate-
gies to detect allelic richness at a given locus are
determined through the DNA sequence. Allele
mining facilitates the discovery of novel resis-
tance genes that can be used in breeding pro-
grammes. In allele mining studies, allelic
variation is analysed for the identified genes
whose function and basic DNA sequence are
known and whose map position in the genome
will generally have been determined. Sequencing
of candidate genes has been applied to study
phylogenetic and evolutionary process of crop
species. Allele mining in Solanum species iden-
tified conserved homologous types of Rpi-blb1 in
Solanum stoloniferum (Wang et al. 2008) and
130 J. K. Tiwari et al.

many other wild Solanum species (Tiwari et al.
2015a). The primary targets of allele mining
efforts are the loci of agronomic importance. The
germplasm utilized for allele mining should
contain maximum allelic variation at the loci of
interest, in the smallest possible number of
samples (Reeves et al. 2012). Using an allele
mining approach in potato, Pankin et al. (2011)
analysed wild Solanum species for homologues
of RB/Rpi-blb1 gene conferring durable late
blight resistance. A cluster analysis based on the
Neighbor-Joining coefficient using the UPGMA
method between DNA sequences of the 17 new
resistance gene analogues (RGAs) isolated from
the wild potato species and the reference
sequences of late blight resistance genes is
shown in Fig. 8.5. In our study, selected late
blight-resistant wild species S. berthaultii, S.
cardiophyllum, S. iopetalum, S. jamesii, S. les-
teri, S. microdontum, S. pinnatisectum, S.
polyadenium, S. polytrichon, S. trifidum and S.
verrucosum were PCR amplified using
gene-specific primers, gel eluted, cloned and
sequenced analyzed for homology of potato R
genes in the wild species. The potato R genes
(Rpi-pta1, Rpi-edn1.1, EDNR2GH7, Rpi-hjt1.1,
SNKR2GH5, Rpi-snk1.1, Rpi-blb1/RB, Rpi-
vnt1.1, Rpi-bt1, Rpi-sto1, Rpi-blb2, RGA1,
RGA3 and RGA4) were used for allele mining in
these wild species. The successfully isolated and

90 AY426260.1
72 AY426263.1
49
AY303171.1
96 KJ472309
KJ472319
77 87 KJ472317
KJ472315
KJ472320
47 87
50 KJ472306
78 KJ472311
34
KJ472307
75 KJ472314
KJ472318
60
81 KJ472308

98 KJ472313
KJ472316
55 1709840
37 KJ472305
GU295217.1

100 AY303170.1
37
XM_006352879.1
58 AY426266.1
100 AY426265.1

100 KJ472312
AY426259.1

100 KJ472310
HM131813.1
100
HM131814.1
75
84 JN688067.1
37
AY336128.1
99 EU884422.1
40 EU884421.1

Fig. 8.5 A cluster analysis based on the analogues (RGAs) isolated from the wild potato species
Neighbor-Joining coefficient by UPGMA method and the reference sequences of late blight resistance genes
between DNA sequences of the 17 new resistance gene
8 Genomics in Management and Genetic Enhancement … 131

Table 8.2 Summary of R gene homologues isolated from the wild potato species
SN Isolated R gene homologues Wild species Potato R gene (NCBI Acc. No.)
1. PTA1_CPH62 S. cardiophyllum Rpi-pta1 (EU884422.1)
2. PTA1_MCD24 S. microdontum Rpi-pta1 (EU884422.1)
3. EDN1.1_BER57 S. berthaultii Rpi-edn1.1 (GU563963.1)
4. EDNR2_TRF22 S. trifidum EDNR 2GH7 (GU563968.1)
5. EDNR2-VER55 S. verrucosum EDNR 2GH7 (GU563968.1)
6. SNK1.1_JAM07 S. jamesii Rpi-snk1.1 (GU563975.1)
7. SNKR2_IOP59 S. iopetalum SNKR2GH5 (GU563977.1)
8. SNKR2_LES34 S. lesteri SNKR2GH5 (GU563977.1)

sequenced genes were: (1) Rpi-pta1 (in S. car-
diophyllum and S. microdontum); (2) Rpi-edn1.1
(in S. berthaultii); (3) EDNR2GH7 (in S. trifidum
and S. verrucosum); (4) SNKR2GH5 (in S.
iopetalum and S. lesteri); and (5) Rpi-snk1.1 (in
S. jamesii). The isolated homologous R genes
from different wild species are summarized in
Table 8.2 and wild species are shown in Fig. 8.1.
There are various novel approaches for SNP
discovery/allele mining in potato germplasm that
will accelerate genomics-assisted potato
improvement.
8.3.2 Development of High-Density
Potato SNP Arrays
and Genome-Wide
Characterization
The potato genome sequence data, and the
reducing costs of NGS technologies, open great
opportunities for using genomic tools to inves-
tigate allelic variation in wild relatives to accel-
erate the potato breeding. Gene bank collections
have been established worldwide in order to
conserve the genetic diversity of the germplasm,
including cultivated, semi-cultivated and wild
species. Recent advances in genomics and
molecular marker technologies particularly
next-generation sequencing technologies provide
novel tools to assess the genetic diversity of such
collections and permit genome-wide sets of SNP
markers to be generated. Currently, SNPs that
result from a change in a single nucleotide
position represent the most abundant type of
genetic polymorphism in plant genomes and are
the most preferred molecular marker today for
genome-wide characterization and
high-throughput automation. This will allow an
understanding of the genetic basis of traits so that
more rapid improvement can occur over the next
century of breeding.
SNP genotyping arrays have been useful in
many applications that require a large number of
molecular markers, such as high-density genetic
mapping, genome-wide association studies
(GWAS), and genomic selection. The discovery
of the Infinium SolCAP 8.3 K SNP potato array
(http://solcap.msu.edu) which covers the whole
potato genome-wide sets of markers has revolu-
tionized the characterization of Solanaceous
species. In order to characterize the genetic
diversity, potato germplasm has been genotyped
using the SolCAP SNP array and genotypic dif-
ferentiation was observed within the germplasm,
including processing clones, wild species,
genetic stocks and cultivated potatoes. A high
degree of concordance between the linkage maps
and the pseudomolecules demonstrates the
quality of the potato genome sequence and the
functionality of the Infinium SolCAP SNP array.
The broad genome coverage of the SolCAP SNP
array compared to other marker sets will enable
numerous downstream applications (Felcher
et al. 2012). The discovery of a large number of
SNPs in elite north American potato germplasm
showed the importance of the quality of the
potato genome sequence (Hamilton et al. 2011).
132
The SNPs will enable high-throughput genotyp-
ing of germplasm and populations, which in turn
will enable more efficient marker-assisted
breeding efforts in potato. Due to a huge
genetic diversity among potato germplasm pop-
ulation, genomics of wild potatoes using
genome-wide SNP arrays aim to establish pat-
terns of nucleotide polymorphism and diver-
gence between several closely related,
morphologically distinct wild species. Based on a
large number of SNPs, population-genetic anal-
yses can assess the relative importance of
nucleotide diversity and interspecific divergence.
Genotyping of a panel of 350 diverse tetraploid
potato cultivars using the SolCAP SNP array
showed some insights into the different genetic
aspects of potato such as genetic diversity, pop-
ulation structure, or linkage disequilibrium (LD).
It revealed the potential of genome-wide associ-
ation mapping in tetraploid potato using
high-density genotyping to assess marker-trait
associations (Sharma et al. 2012). Like the pop-
ulation genomics of wild tomatoes, the use of the
potato genome sequence data is equally impor-
tant for studying potato genetic resources. Ganal
et al. (2011) have established a large maize SNP
array for its use in diversity analysis and high
density linkage mapping. Moreover, use of
potato genome sequence reflects genome-wide
analysis of plastome sequence variation and the
development of plastidial CAPS markers in
common potato and related Solanum species
(Gargano et al. 2012).
8.3.3 High-Throughput Genotyping
and Genome-Wide
Mapping for Elite QTLs
and Alleles
Sequencing of the potato genome has opened up
new vistas for potato genetics and breeding. Due
to the genetic complexities posed by the tetra-
somic inheritance, most potato genetic studies
are carried out at the diploid level. This causes
some difficulties in translating and applying the
derived results at the tetraploid level in cultivated
potato. For practical reasons, the molecular
J. K. Tiwari et al.
dissection of traits at the tetraploid level and
across a wider germplasm using a
high-throughput molecular marker platform is
highly desirable. Therefore, association mapping
is gaining importance in studying the genetics of
natural variation and greater allelic diversity in
polyploidy crop species. In association genetic
studies no prior information about the genes of
interest is available, but associations between
genetic markers and the considered traits are
simply derived from observational research.
Association genetics focus on the identification
of correlations between phenotypic traits and
genetic markers with the aim of identifying and
locating the underlying genes in the genome. In
addition, the huge volume of information gen-
erated through Genotyping-by-Sequencing
(GBS) has been exploited to understand domes-
tication, for the construction of maps,
high-resolution analyses of genetic diversity,
population structure and linkage disequilibrium,
high-throughput discovery of genes and alleles,
and whole genome selection for complex traits.
The breeding process, gene content variation,
and low diversity regions have also been
revealed by large-scale re-sequencing. The GBS
is a high-throughput and low-cost genotyping
platform originally developed for highly inbred
maize and sorghum populations. This type of
approach can reduce the problems associated
with ascertainment bias typically encountered
with other genotyping platforms (http://www.igd.
cornell.edu/index.cfm/page/projects/GBS.htm).
Whole genome association (WGA) mapping
of European potato varieties using the
SolCAP SNP array for bruising resistance iden-
tified SNPs linked to the trait, thereby discover-
ing new candidate genes (Stich et al. 2013).
Genome-wide association mapping in elite CIP
potato clones of advanced breeding population
B3 for late blight resistance showed some
quantitative trait loci (QTLs) linked to the trait.
A set of 103 clones were genotyped using the
SolCAP SNP array-identified QTL that explains
a significant amount of variation for late blight
resistance. The associated SNP marker could
prove useful in molecular breeding for late blight
resistance (Lindqvist-Kreuze et al. 2014).
8 Genomics in Management and Genetic Enhancement …
A phureja-tuberosum diploid potato
cross-segregating for several traits was geno-
typed with the SolCAP SNP array and identified
several QTLs linked with large effect QTLs.
Thus, the identified candidate genes in the potato
genome that are used to identify informative
markers are linked to commercially valuable
traits, in conjunction with an ongoing association
mapping analysis of 300 tetraploid cultivars.
Later a dense SNP-based linkage map of a
diploid potato population was generated and
major QTLs for tuber shape and eye depth on
chromosomes 2 and 10 were identified (Prashar
et al. 2014). Using genomics approaches, a panel
of 224 tetraploid potato cultivars was analysed
with 384 SNP array and identified five genotypic
classes and trait associations for flesh colour and
eye depth (Voorrips et al. 2010). Draffehn et al.
(2010) uncovered a very high natural allelic
variation in a set of five potato invertase genes
which are involved in cold-induced sweetening
of tubers by cDNA sequencing and SNP geno-
typing. The associations found between specific
invertase alleles and chip quality, tuber starch
content and starch yield will facilitate the selec-
tion of superior potato genotypes in breeding
programmes. Comparative next-generation map-
ping of the Phytophthora infestans resistance
gene Rpi-dlc2 in a European accession of Sola-
num dulcamara showed pyramiding of Rpi-dlc2
and Rpi-dlc1 significantly increased resistance,
compared with only one of the genes (Goals et al.
2013). High-throughput genotyping of tomato
and its wild relatives applying 5528 SNP array
revealed tomato breeding strategies in the geno-
mics era. Genotyping allows the evaluation at the
level of heterozygosity and introgressions among
commercial varieties using diagnostic markers
(Víquez-Zamora et al. 2013). Numerous
researchers have conducted high-throughput
genome-wide SNP genotyping and discovered
the SNP/allele/gene in many crops like sorghum
(Morris et al. 2013), or mungbean (Van et al.
2013) to name a few. Hackett et al. (2013)
studied linkage analysis and QTL mapping using
the SolCAP SNP array in a tetraploid potato
mapping population and overall 3839 of the 5378
polymorphic SNPs can be assigned to putative
133
genetic locations. QTL analysis of drought tol-
erance in a diploid mapping population with 499
SNP markers discovered SNPs in public EST
databases using QualitySNP software with the
Illumina GoldenGate assay (Anithakumari et al.
2012). A diploid population comprised of 138 F1
hybrids was mapped for after-cooking darkening
using simple sequence repeat and high-resolution
melting (HRM) markers (Koeyer et al. 2010).
8.3.4 Next-Generation
Re-Sequencing
and Comparative
Genomics in Wild
Genomes
To implement genomics into plant breeding
requires a comprehensive knowledge of the
genetic variation present in the crop germplasm.
The accessibility of the high quality reference
potato genome is an important tool for the anal-
ysis of wild and semi-cultivated potato species.
Efforts by the PGSC resulted in a genome
sequence of high quality that can be used as a
reference for re-sequencing of additional wild,
cultivated, semi-cultivated species, lines, and
cultivars for genetic diversity, allele mining and
gene discovery in potato germplasm. Recently,
Solanum commersonii is a wild potato species
native to Central and South America and exhibits
tolerance to both biotic and abiotic stresses. This
Solanum commersonii has been sequenced and
several genes have been identified particularly
for freezing tolerance (Aversano et al. 2015). We
at the Indian Council of Agricultural Research-
Central Potato Research Institute, Shimla,
Himachal Pradesh, in India have sequenced the
whole genome of a Solanum tuberosum dihap-
loid ‘C-13’ derived from tetraploid potato variety
Kufri Chipsona-2. It revealed 98.68% assembly
and annotated 42642 genes (98.68%) with the
potato reference genome (unpublished) and the
image of androgenic dihaploid potato clones is
shown in Fig. 8.6. Further, comparative geno-
mics focuses on the integration of genome
information derived from different species with
the aim of obtaining more insight into the genetic
134
Fig. 8.6 Androgenic
Solanum tuberosum
dihaplpoids ‘C-13’ and ‘D4’
were developed from the
potato variety Kufri
Chipsona-2 and TPS
population JTH/C107,
respectively
Dihaploid ‘C- 13’
(Reg. No. INGR 09068)
organization of traits through the identification of
conserved mechanisms. Together with the
availability of an increasing number of genome
sequences, including those of known genes, the
conservation of gene sequences and their func-
tions among species have been investigated and
are used to further develop the knowledge
obtained from previous genetic linkage maps for
different species. Comparative genomics of a
wild tomato species Solanum galapagense,
endemic to the Galapagos Islands, was analysed
to understand the genomic differences among the
wild and cultivated species particularly for high
salt tolerance, pathogen susceptibility, and mor-
phological variation (Strickler et al. 2015).
In order to characterize the distribution and
quality of SNPs in the tomato genome, eight
cultivated tomato inbred lines were re-sequenced
with the Illumina technology to a 25–40x gen-
ome coverage in order to fully investigate SNP
variation in cultivated tomato material on a
genome-wide scale. Based on the sequencing
data, *1 million SNPs were identified in single
copy sequences of the tomato genome (Ganal
et al. 2012). Many re-sequencing initiatives are
currently under way that will reap the potato
genome sequence information to help elucidate a
variety of processes, such as plant disease resis-
tance, development, and domestication. At the
SOL Genomics Network (SGN), sequencing a
tomato accession from a breeding programme
exhibiting unique resistance, and from a wild
relative of the tomato, S. galapagense has given
J. K. Tiwari et al.
Dihaploid ‘D- 4’
(Reg. No. INGR 09067)
insight into the whole genome diversity present
in Solanum. This set of sequenced accessions
contains an underexploited wealth of genetic
variation, and will therefore offer a useful gene
pool to cope with existing and new breeding
challenges (Mueller et al. 2012). Re-sequencing
of 120 tomato lines representing a broad allelic
diversity for the red fruit cluster, identified *6
million SNPs and other variations. Further, a
linkage disequilibrium study identified a set of
200 K SNPs that may be useful for genetic
mapping and association studies. The data pro-
vided a valuable resource to facilitate tomato
genetics and breeding (Huang et al. 2012).
Nonetheless, this approach will provide further
insight into the organization and dynamics of the
potato genome-based study. Developing efficient
methods to analyse and compare genomes, or
perform re-sequencing is essential to the many
routine applications on a large scale in the near
future, such as characterization of germplasm
used in breeding.
8.3.5 Sequence-Based
Transcriptomics
(RNA-Seq), Microarray
and Other ‘Omics’
Technologies
Utilization of the natural genetic variation in
traditional breeding programs remains a major
challenge in crop plants. Identification and access
8 Genomics in Management and Genetic Enhancement …
to allelic variation that affects the phenotype are
of the utmost importance for the use of genetic
resources, particularly in variety development.
Considering the huge number of germplasm
collections that are collected worldwide in the
potato gene banks, these are deemed a wealth of
huge allelic variants. So, the challenge is how to
reveal this variation. Recent advances in these
technologies have permitted the dissection of the
genetics of complex traits in crop species. The
development of high-throughput ‘omics’ tech-
nologies, such as genomics, transcriptomics,
metabolomics, proteomics and others has
brought the potential of population-wide data
collection. In the last few years, functional tran-
criptomics has been advanced by both microar-
ray technology as well as high-throughput
sequencing of cDNA (RNA-seq). Transcrip-
tomics represents a resource for targeting specific
genes underlying phenotypic traits and can serve,
in the absence of a full genome, as a reference for
RNAseq digital gene expression profiling. In the
past decades, microarrays (DNA chip technol-
ogy) have been used extensively to quantify the
transcripts/mRNA corresponding to the target
genes. Microarray is a high-throughput screening
technique based on the hybridization between
oligonucleotide probes (genomic DNA or
cDNA) and either DNA or mRNA. Certainly, the
microarray technology has achieved its technical
limits and is incresingly being complemented by
high-throughput next-generation sequencing
technologies. Hence, more recently RNA-seq has
emerged as an alternative powerful tool to study
transcriptomes. Unlike microarrays, RNA-seq
can evaluate absolute transcript levels of
sequenced and unsequenced organisms, detect
novel transcripts, reveal sequence variations and
many more. As the cost of sequencing decreases,
it is believed that the use of RNA-seq for dif-
ferential expression analysis will be increasingly
rapid (Mutz et al. 2013).
Wild species of Solanum were used to identify
resistance against late blight, the most devastating
disease of potato, which could be used to achieve
durable resistance in the popular potato varieties.
Microarray-based gene expression profiling in a
late blight-resistant Indian potato cultivar Kufri
135
Girdhari identified many up-regulated candidate
genes upon challenge inoculation by Phytoph-
thora infestans (Sundaresha et al. 2014). In other
microarrays-based studies, novel genes were
identified in leaf tissues of potato somatic hybrids
using cDNA microarrays designed on the potato
genome sequences for late blight resistance
(Singh et al. 2016) and for potato tuberization
(Tiwari et al. 2015b). To identify polymorphism
in loci that confer resistance to potato late blight,
transcriptome sequencing using Illumina GA2 of
S. berthaultii, S. venturii and S. nigrum identified
polymorphism and genes for late blight resis-
tance. These multiple R genes could be simulta-
neously introduced in popular varieties in order to
achieve durable resistance (Verweij et al. 2010).
Novel candidate genes were uncovered in potato
host plants for resistance to Phytophthora infes-
tans of compatible and incompatible interactions
by DeepSAGE (serial analysis of gene expres-
sion) transcriptome analysis (Gyetvai et al. 2012).
A comparative transcriptome analysis of potato
leaf tissue with a Verticillium wilt-resistant clone
showed increase expression of genes involved in
protein translation and photosynthesis (Tai et al.
2012b). Transcriptomes of tuber derived tissues
were analysed and transcripts were identified that
set apart the tuber from the rest of the plant tissues
to shed light on how this unique organ is func-
tioning at transcript level especially for carbohy-
drate metabolism (Sønderkær et al. 2010). Genes
driving potato tuber initiation and growth were
examined based on transcriptional changes using
the POCI (Potato Oligo Chip Initiative) array
(Kloosterman et al. 2008). De novo DNA
sequence-driven bulk segregant analysis for water
use efficiency identified polymorphisms on sev-
eral chromosomes and many candidate genes
(Kaminski et al. 2012). Drought tolerance can-
didate genes were identified in Peruvian native
potatoes by RNA-seq analysis. Filtered reads
were mapped to the potato genome, a large per-
centage of these read maps uniquely to the ref-
erence genome (Fernandez et al. 2012).
Drought-responsive compounds have been iden-
tified in potato through combined transcriptomic
and targeted metabolite approaches (Evers et al.
2010).
136
In other crops like tomato, a transcriptomic
approach was followed to identify regulatory
genes involved in the fruit set of wild and culti-
vated genotypes (Ruiu et al. 2012). Comparative
transcriptomics (RNAseq) revealed the effects of
artificial and natural selection patterns in culti-
vated tomato and five related wild species. Based
on sequence differences, 50 genes were detected
for positive selection and thousands of shifts in
gene-expression level were documented (Koenig
et al. 2013). A set of differentially expressed
genes was identified in wild tomato S. pennellii
in response to drought stress by microarray and
RNA-seq analysis (Ye et al. 2012). A genome-
wide deep-coverage short-read sequencing
approach was followed to analyse the transcrip-
tomes of one accession of domesticated tomato
and three wild relatives for changes in gene
expression, coding sequences, and gene regula-
tion (Sinha et al. 2012).
To investigate the effects of temperature and
day-length on potato tuber formation,
a 60 K-feature potato microarray was used to
compare global gene expression profiles in
leaves and tubers. Correlations between tran-
scriptomic and metabolomic analysis revealed
potential novel regulatory networks (Morris et al.
2012). In potato cv. Désirée, response to cold and
salt exposure was investigated at both transcrip-
tomic and proteomic levels in a growth chamber
experiment. Cold exposure in potato resulted in a
higher number of regulatory genes compared to
salt exposure (Legay et al. 2012). Analysis of
natural variation of the potato tuber proteome
revealed novel candidate genes for tuber bruis-
ing. The comparison of 20 potato varieties yiel-
ded insight into the high natural variation of
tuber protein patterns due to genetic background
(Urbany et al. 2012).
A range of volatile and non-volatile metabo-
lites associated with potato flavour and candidate
genes associated with the biosynthesis of these
molecules have been identified (Taylor 2010).
A diploid potato population was screened for
potato tuber quality for gene-expression and
secondary metabolite content using a microarray
and liquid chromatography–mass spectrometry
(LC–MS) approach, respectively, and identified
J. K. Tiwari et al.
several expression and metabolite quantitative
trait loci (eQTL and mQTL) (Kloosterman et al.
2010). Metabolomics and transcriptomics for
Colorado potato beetle resistance of S. oplocense
and S. tuberosum showed increased expression
of protease inhibitors associated with a defence
mechanism (Tai et al. 2012a). A combination of
metabolic and transcript profiling identified a
gene GAME4 that appears to play a key role in
biosynthesis of steroidal alkaloid (SA) pathway
for solanine in the sprouting potato tubers
(Aharoni 2012). To identify the genetic factors
underlying variation in primary metabolism in
potato, a diploid mapping population derived
from crosses between S. tuberosum and wild
relatives, was profiled using gas
chromatography-time of flight-mass spectrome-
try. In total, 139 polar metabolites were detected,
of which 72% detected compounds were
metabolite quantitative trait loci (Carreno-
Quintero et al. 2012). Variation within candi-
date genes for phytonutrient acquisition, specifi-
cally iron and zinc, acquired from the soil by
native Andean potato cultivars, was found over a
two-fold range in tubers. Using the potato gen-
ome browser, orthologous genes were identified
by sequence similarity to candidate genes for
phytonutrient acquisition in other crops (Medina
et al. 2012).
8.4 Markers/Genomics-Assisted
Breeding of Potato Germplasm
The potato breeding programme has distinct
pre-breeding and commercial cultivar develop-
ment phases. Pre-breeding research is focused on
developing the capacity to use elite parental
materials, by applying molecular tools such as
marker-assisted selection (MAS). In recent years
‘breeding by design’ as a concept described by
Pele man and van der Voort aims to bring
together superior alleles for all genes of agro-
nomic importance from genetic resources. This
might be achievable through high-resolution
allele detection based on precise mapping of
potential parental resources (Gai et al. 2012).
Diagnostic DNA-based markers are either
8 Genomics in Management and Genetic Enhancement …
derived directly from polymorphisms in genes
with a trait of interest or are in linkage disequi-
librium with those genes. They can be used to
identify superior genotypes among parents and
progeny in precision breeding programmes.
Diagnostic markers can be identified by a com-
bination of QTL, candidate gene and association
mapping using functional and positional candi-
date genes as markers. This approach was suc-
cessfully used to identify loci, which contribute
to the natural variation of pathogen resistance or
tuber traits in tetraploid breeding populations.
Candidate genes associated with field resistance
to late blight or tuber quality traits have been
developed and currently are being tested for their
diagnostic power in marker-assisted selection
experiments (Gebhardt et al. 2010).
The efficiency of breeding new resistant cul-
tivars may be improved by the development of
resistant parental lines derived from germplasm
resources. Parental lines are donors of traits of
interest, having the genetic background enriched
with genes originating from various Solanum
species. One of the bottlenecks in the develop-
ment of potato production is the availability of
cultivars with multiple resistance to major pests
and pathogens such as the most devastating dis-
ease, late blight, caused by P. infestans followed
by PVY and other viruses, bacterial diseases and
cyst nematodes. A genome-wide infection library
of P. infestans RXLR effectors that include
avirulence (AVR) proteins has been created to
accelerate cloning and specificity profiling tar-
geted by resistance proteins (R genes) from wild
Solanum species. This effectoromics strategy has
proven effective and complementary to classical
breeding approaches. Effector-based resistance
breeding will facilitate selection and combining
qualitative and quantitative resistance that may
lead to a more durable resistance to late blight in
potato (Vleeshouwers et al. 2012). Application of
MAS in pre-breeding of common potato clones
resistant to pathogens has been demonstrated for
the genes Ry-fsto (PVY resistance), Rm (PVM
resistance), Nsadg (PVS resistance), Rpi-phu1
(late blight resistance), H1 (resistance to Ro1-4 of
Globodera rostochiensis). The PCR markers
linked to respective resistance genes allowed a
137
combination of phenotypic and MAS
(Zimnoch-Guzowska and Flis 2012). In order to
develop diagnostic markers for MAS for quan-
titative resistance to late blight in tetraploid
potato, SNP close to the QRL were identified by
the use of the potato genome sequence (Marha-
dour et al. 2012). Three PCR-based diagnostic
markers (SC895, S1d11 and B11.6) were devel-
oped and validated for marker-assisted selection
of hypersensitive response (HR) genes for resis-
tance to PVY in the cultivated potato (Szajko
et al. 2012). Asano et al. (2012) demonstrated
marker-assisted evaluation of potato genotypes
for potential resistance to potato cyst nematode
pathotypes in Japan without phenotypic
evaluation.
Physical mapping and comparative genomics
were investigated for the potato cyst nematode
resistance locus H1 at three haplotypes in potato
and identified a large cluster consisting of the
CC-NB-LRR type of R genes (Finkers-Tomczak
et al. 2011). Examination of three wild
tuber-bearing species S. vernei, S. sparsipilum
and S. spegazzinii conferring a high resistance
level to G. pallida led to identification of QTLs.
Further, allele-specific molecular markers for the
S. spegazzinii GpaV resistance QTL has been
proven for marker- assisted breeding (Chauvin
et al. 2012). Marker-assisted potato breeding has
been advanced rapidly all over the world, for
example, in Australia for potato cyst nematode
(PCN), tomato spotted wilt virus (TSWV), and
potato virus Y (PVY) resistance (Slater et al.
2010); in Poland for viruses
(Zimnoch-Guzowska and Flis 2012); in India for
PVY and late blight (Tiwari et al. 2012, 2013b,
2013c, 2013f). Wild species S. microdontum and
S. kurtizianum, that represent the extremes for
tuber calcium traits, were analysed to understand
the genetics of tuber calcium uptake and the
potential role of tuber calcium in tuber quality
(Palta et al. 2010). Candidate gene markers at
loci encoding ADP-glucose pyrophosphorylase
and the invertase Pain-1 were identified and
validated for MAS of potato cultivars with
improved tuber quality, particularly chip colour,
tuber starch content and starch yield (Li et al.
2013).
138
8.5 Genetic Modification in Potato
Germplasm
The use of resistant cultivars in potato breeding
programmes is an important tool for disease
management. Recent advances in plant molecular
genetics have identified several genes for resis-
tance to potato pests and pathogens from within
the germplasm pool available to potato breeders.
Genetic transformation with resistance genes is
expected to enhance durable resistance against
pathogens, especially for potato late blight.
Functional gene stacking of multiple genes has
important implications in achieving more durable
resistance against potato late blight (Zhu et al.
2012, 2013). They demonstrated integration of
triple R genes (Rpi-sto1, Rpi-vnt1.1 and Rpi-
blb3) transformants and the inheritance of resis-
tance against potato late blight. On the contrary,
even loss of susceptibility factor/gene (S-gene) is
a novel breeding strategy for durable and
broad-spectrum resistance in non-host-like
resistance crop species. The absence of certain
host-factors encoded by plant S-genes enables
plants to escape the defence suppression and thus
to maintain their non-host status. With the aim of
achieving non-host-like durable resistance in
crops by disabling plant S-genes, researchers
have demonstrated that silencing putative tomato
orthologs of the S-genes identified in Arabidop-
sis resulted in resistance to tomato powdery
mildew, indicating that multiple S-genes are
conserved among unrelated plant species (Pavan
et al. 2010). Besides, T-DNA minicircles for
Agrobacterium-mediated delivery of potato
genes without vector backbone sequences offer a
method to reduce DNA molecules to a simple,
well-defined expression cassette for transforma-
tion. They offer an important tool for effective
delivery of cisgenes, intragenes and transgenes
through transformation without the vector back-
bone sequences, an important limitation of cur-
rent technology (Jacobs et al. 2010). Moreover,
in recent years, concepts like intragenesis and
cisgenesis as alternatives to transgenic crops
have emerged to meet the concerns of the general
public. So to exploit the diverse potato gene
J. K. Tiwari et al.
pool, both concepts implies use of the species
itself or from the closely related species capable
of sexual hybridization for crop improvement
(Holme et al. 2013).
8.6 Conclusion
The worldwide potato germplasm collection
provides excellent genetic resources for the use
of wild relatives in addressing global food
security in the era of climate change and the
emergence of new races of pest pathogens.
Germplasm has largely untapped genetic varia-
tion for abiotic and biotic stress tolerances, and
could greatly expand the available domesticated
gene pools in the predicted extremes of climate
change (Redden 2013). The international potato
gene banks collection is critical in order to col-
lect, conserve, characterize, and utilize the
germplasm in a systematic and integrated way to
meet future food needs. Current genomic strate-
gies can assist in the introgression of these
valuable traits into the domesticated crop gene
pools, where they can be better evaluated for
crop improvement. Knowledge and tools that can
be developed through the use of next-generation
sequencing technologies, SNP discovery, tran-
scriptomics, other ‘omics’ approaches and
genetic modification will pave the way forward
for the exploitation of an amazing germplasm
diversity for greater use of genomic research into
potato improvement (Van et al. 2011). Never-
theless, genomics-assisted breeding will play a
key role in potato, since it is not only
cost-effective and efficient but also amenable to
high-throughput automation. Indeed, to break
yield barriers in potato, multi-faceted potato
breeding efforts like the novel discovery of
SNPs/allele/genes from germplasm resources and
their deployment in broad marker-assisted
selection, the enrichment of the narrow genetic
base of modern potato varieties, the stability of
QTL analysis and genetic modifications that
regulate the phenotypic variation for
yield-associated traits will certainly help
genomics-assisted potato improvement.
8 Genomics in Management and Genetic Enhancement …
Acknowledgements The authors thank CABin, IASRI
for financial support to carry out the whole genome
sequencing of dihaploid potato clone ‘C-13’.
References
Aharoni A (2012) Gene discovery in the steroidal alkaloid
pathway. In: Abstract Book, SOL2012, 9th Solanaceous
Conference, August 26–30, 2012, Neuchâtel, p 53
Anithakumari AM, Nataraja KN, Visser RGF, van der
Linden CG (2012) Genetic dissection of drought
tolerance and recovery potential by quantitative trait
locus mapping of a diploid potato population. Mol
Breed 30:1413–1429
Arens P, Mansilla C, Deinum D, Cavellini L, Moretti A,
Rolland S, van der Schoot H, Calvache D, Ponz F,
Collonnier C, Mathis R, Smilde D, Caranta C, Vos-
man B (2010) Development and evaluation of robust
molecular markers linked to disease resistance in
tomato for distinctness, uniformity and stability test-
ing. Theor Appl Genet 120:655–664
Asano K, Kobayashi A, Tsuda S, Nishinaka M, Tamiya S
(2012) DNA marker-assisted evaluation of potato
genotypes for potential resistance to potato cyst
nematode pathotypes not yet invading into Japan.
Breed Sci 62:142–150
Aversano R, Contaldi F, Ercolano MR, Grosso V,
Iorizzo M, Tatino F et al (2015) The Solanum
commersonii genome sequence provides insights into
adaptation to stress conditions and genome evolution
of wild potato relatives. Plant Cell 27(4):954–968
Carreno-Quintero N, Acharjee A, Maliepaard C,
Bachem C, Mumm R, Bouwmeester H, Visser RG,
Keurentjes JJ (2012) Untargeted metabolic quantita-
tive trait loci analyses reveal a relationship between
primary metabolism and potato tuber quality. Plant
Physiol 158(3):1306–1308
Chandel P, Tiwari JK, Ali N, Devi S, Shashi Sharma,
Sanjeev Sharma, Luthra SK, Singh BP (2015) Inter-
specific potato somatic hybrids between Solanum
tuberosum and S. cardiophyllum, potential sources of
late blight resistance breeding. Plant Cell, Tissue
Organ Cult 123:579–589
Chauvin L, Lesage M-L, Fournet S, Caromel B, Queré J,
Dantec J-P, Kerlan M-C (2012) Molecular marker
development for introgression of nematode resistance
in potato breeding programs: exploitation of Solanum
spegazzinii resistance source. In: Abstract Book,
SOL2012, p 44
Draffehn AM, Meller S, Li L, Gebhardt C (2010) Natural
diversity of potato (Solanum tuberosum) invertases.
BMC Plant Biol 10:271
Edwards D, Batley J, Snowdon RJ (2013) Accessing
complex crop genomes with next-generation sequenc-
ing. Theor Appl Genet 126:1–11
Esnault F, Chauveau A, Bérard A, Boland A, Paslier
M-CL, Brunel D, Polley J-E (2012) Diversity analysis
139
of a potato (Solanum tuberosum L. subsp. tuberosum)
core collection using the SolCAP chip. In: Abstract
Book, SOL2012, p 126
Evers D, Lefevre I, Legay S, Lamoureux D, Hausman J-F,
Rosales ROG, Marca LRT, Hoffmann L, Bonier-
bale M, Schafleitner R (2010) Identification of
drought-responsive compounds in potato through a
combined transcriptomic and targeted metabolite
approach. J Exp Bot 61:2327–2343
FAO (2010) The second report on the state of the world’s
plant genetic resources for food and agriculture. FAO,
Rome, Italy
FAOSTAT (2014) Food and agriculture
production-FAOSTAT. http://faostat.fao.org
Felcher KJ, Coombs JJ, Massa AN, Hansey CN, Hamil-
ton JP, Veilleux RE, Buell CR, Douches DS (2012)
Integration of two diploid potato linkage maps with
the potato genome sequence. PLoS One 2012:e36347
Fernandez MGO, Mendez CGM, del Valle RLG,
Ascurra YCTT (2012) Drought tolerance genes
expression in peruvian native potatoes. In: Abstract
Book, SOL2012, p 187
Finkers-Tomczak A, Bakker E, de Boer J, van der
Vossen E, Achenbach U, Golas T, Suryaningrat S,
Smant G, Bakker J, Goverse A (2011) Comparative
sequence analysis of the potato cyst nematode resis-
tance locus H1 reveals a major lack of co-linearity
between three haplotypes in potato (Solanum tubero-
sum ssp.). Theor Appl Genet 122:595–608
Gai J, Chen L, Zhang Y, Zhao T, Xing G, Xing H (2012)
Genome-wide genetic dissection of germplasm
resources and implications for breeding by design in
soybean. Breed Sci 61:495–510
Ganal M, Plieske J, Durstewitz G, Luerssen H,
Wieseke R, Graner E-M, Polley A (2012) Large scale
SNP genotyping and haplotype characterization
through high-density mapping and genome resequenc-
ing in tomato. In: Abstract Book, SOL2012, p 56
Ganal MW, Durstewitz G, Polley A, Bérard A, Buck-
ler ES, Charcosset A, Clarke JD, Graner E-M,
Hansen M, Joets J, Paslier M-CL, McMullen MD,
Montalent P, Rose M, Schön C-C, Sun Q, Walter H,
Martin OC, Falque M (2011) A large maize (Zea mays
L.) SNP genotyping array: development and germ-
plasm genotyping, and genetic mapping to compare
with the B73 reference genome. PLoS One 6(12):
e28334
Gargano D, Scotti N, Vezzi A, Bilardi A, Valle G,
Grillo S, Cozzolino S, Cardi T (2012) Genome-wide
analysis of plastome sequence variation and develop-
ment of plastidial CAPS markers in common potato
and related Solanum species. Genet Resour Crop Evol
59:419–430
Gebhardt C, Ballvora A, Li L, Draffehn A, Paulo J,
Stich B, Lübeck J, Strahwald J, Tacke E, Hofferbert
H-R (2010) ‘Precision Breeding’ in tetraploid potato:
where are we and where do we want to go? In: Book
of abstracts, EAPR-EUCARPIA Congress, 27–30
June, 2010, Wageningen, the Netherlands, p 31
140
Golas TM, van de Geest H, Gros J, Sikkema A,
D’Agostino N, Nap JP, Mariani C, Allefs JJHM,
Rieu I (2013) Comparative next-generation mapping
of the Phytophthora infestans resistance gene Rpi-dlc2
in a European accession of Solanum dulcamara. Theor
Appl Genet 126:59–68
Gyetvai G, Sønderkær M, Göbel U, Basekow R, Bal-
lvora A, Imhoff M, Kersten B, Nielsen K-L, Geb-
hardt C (2012) The transcriptome of compatible and
incompatible interactions of potato (Solanum tubero-
sum) with Phytophthora infestans revealed by Deep-
SAGE analysis. PLoS One 7:e31526
Hackett CA, McLean K, Bryan GJ (2013) Linkage
analysis and QTL mapping using SNP dosage data
in a tetraploid potato mapping population. PLoS One
8:e63939
Hamilton JP, Buell CR (2012) Advances in plant genome
sequencing. Plant J 70:177–190
Hamilton JP, Hansey CN, Whitty BR, Stoffel K,
Massa AN, Deynze AV, De Jong WS, Douches DS,
Buell CR (2011) Single nucleotide polymorphism
discovery in elite north american potato germplasm.
BMC Genom 12:302
Hawkes JG (1990) The potato—evolution. Belhaven
Press, London, Biodiversity and Genetic Resources
Holme IB, Wendt T, Holm PB (2013) Intragenesis and
cisgenesis as alternatives to transgenic crop develop-
ment. Plant Biotech J 11:395–407
Huang S, Zhang J, Zhang Z, Xu X, Li J, Ye Z, Du Y
(2012) A map of genome variation in the red tomato
cluster. In: Abstract Book, SOL2012, p 76
Jacobs JME, Pringle JM, Lokerse AS, Barrell PJ,
Meiyalaghan S, Conner AJ (2010) T-DNA minicircles
for Agrobacterium-mediated delivery of potato genes
without vector backbone sequences. In: Book of
abstracts, EAPR-EUCARPIA Congress, p 35
Jung J-K, Park S-W, Liu WY, Kang B-C (2010)
Discovery of single nucleotide polymorphism in
Capsicum and SNP markers for cultivar identification.
Euphytica 175:91–107
Kalian B, Graner A (2012) NGS technologies for
analyzing germplasm diversity in genebanks. Brief
Funct Genomics 2:38–50
Kaminski KP, Sønderkær M, Sørensen KK, Ander-
sen MN, Nielsen KL (2012) De novo DNA sequence
driven bulk segregant analysis of water use efficiency
(WUE) in potato without prior knowledge of molec-
ular markers. In: Abstract Book, SOL2012, p 67
Kloosterman B, Koeyer DD, Griffiths R, Flinn B,
Steuernagel B, Scholz U, Sonnewald S, Sonnewald U,
Bryan GJ, Prat S, Bánfalvi Z, Hammond JP, Geigen-
berger P, Nielsen KL, Visser RGF, Bachem CWB
(2008) Genes driving potato tuber initiation and
growth: identification based on transcriptional changes
using the POCI array. Funct Integr Genom 8:329–340
Kloosterman B, Abelenda JA, Gomez MMC, Oortwijn M,
de Boer JM, Kowitwanich K, Horvath BM, van
Eck HJ, Smaczniak C, Prat S, Visser RGF,
Bachem CWB (2013) Naturally occurring allele
J. K. Tiwari et al.
diversity allows potato cultivation in northern lati-
tudes. Nature 495:246–250
Kloosterman B, Acharjee A, Maliepaard C, de Vos R,
Bachem C, Visser RGF (2010) An integrative -omics
approach for studying potato tuber quality traits. In:
Book of abstracts, EAPR-EUCARPIA Congress, p 53
Koenig D, Jiménez-Gómez JM, Kimura S, Fulop D,
Chitwood DH, Headland LR, Kumar R, Coving-
ton MF, Devisetty UK, Tat AV, Tohge T, Bolger A,
Schneeberger K, Ossowski S, Lanzb C, Xiongi G,
Taylor-Teeples M, Brady SM, Pauly M, Weigel D,
Usadel B, Fernie AR, Peng J, Sinha NR, Maloof JN
(2013) Comparative transcriptomics reveals patterns
of selection in domesticated and wild tomato. PNAS
2013:E2655–E2662
Koeyer DD, Douglass K, Murphy A, Wu Y, Wang-Pruski
G (2010) Mapping and validation of QTL for
after-cooking darkening. In: Book of abstracts,
EAPR-EUCARPIA Congress, p 48
Legay S, Hausman J-F, Renaut J, Evers D (2012) Parallel
investigations at both transcriptomic and proteomic
level of the response of the Solanum tuberosum
cultivar Désirée under cold and high salinity exposure.
In: Abstract Book, SOL2012, p 68
Li L, Tacke E, Hofferbert H-R, Lübeck J, Strahwald J,
Draffehn AM, Walkemeier B, Gebhardt C (2013)
Validation of candidate gene markers for
marker-assisted selection of potato cultivars with
improved tuber quality. Theor Appl Genet
126:1039–1052
Lindqvist-Kreuze H, Gastelo M, Perez W, Forbes GA, de
Koeyer D, Bonierbale M (2014) Phenotypic stability
and genome-wide association study of late blight
resistance in potato genotypes adapted to the tropical
highlands. Phytopathology 104(6):624–633
Luthra SK, Tiwari JK, Lal M, Chandel P, Kumar V
(2016) Breeding potential of potato somatic hybrids:
evaluations for adaptability, tuber traits, late blight
resistance, keeping quality and backcross (BC1)
progenies. Potato Res 59:375–391
Marhadour S, Méar A, Pellé R, Abiven J-M,
Aurousseau F, Dubreuil H, Hingrat YL, J-E Chauvin
(2012) Markers assisted selection for late blight
resistance in tetraploid potato, experience about the
use of the potato genome sequence. In: Abstract Book,
SOL2012, p 90
McCouch SR, McNally KL, Wang W, Hamilton RS
(2012) Genomics of gene banks: a case study in rice.
Am J Bot 99:407–423
Medina TB, Bonierbale M and Veilleux R (2012)
Variation within candidate genes for phytonutrient
acquisition in potato. In: Abstract Book, SOL2012,
p 42
Morris GP, Ramu P, Deshpande SP, Hash CT, Shah T,
Upadhyaya HD, Riera-Lizarazu O, Brown PJ,
Acharya CB, Mitchell SE, Harriman J, Glaubitz JC,
Buckler ES, Kresovich S (2013) Population genomic
and genome-wide association studies of agroclimatic
traits in sorghum. PNAS 110:453–458
8 Genomics in Management and Genetic Enhancement …
Morris W, Ducreux L, Hancock R, Hedley P, Morris J,
Zhang R, Bryan G, Taylor M (2012) Investigating the
effects of temperature and day-length on potato tuber
formation. In: Abstract Book, SOL2012, p 89
Mueller L, Menda N, Strickler S, Edwards J, Bombarely A
(2012) From genome to genomes. In: Abstract Book,
SOL2012, p. 35
Mutz K-O, Heilkenbrinker A, Lönne M, Walter J-G,
Stahl F (2013) Transcriptome analysis using
next-generation sequencing. Curr Opin Biotech
24:22–30
Palta JP, Zorrilla C, Vega SE, Navarro FM, Bamberg JB
(2010) Breeding for improved tuber internal quality
and processing quality traits. In: Book of abstracts,
EAPR-EUCARPIA Congress, p 51
Pankin A, Sokolova E, Rogozina E, Kuznetsova M,
Deahl K, Jones R, Khavkin E (2011) Allele mining in
the gene pool of wild Solanum species fr homologues
of late blight resistance gene RB/Rpi-blb1. Plant Genet
Res: Char Utiliz 9:305–308
Pavan S, Jacobsen E, Visser RGF, Bai Y (2010) Loss of
susceptibility as a novel breeding strategy for durable
and broad-spectrum resistance. Mol Breed 25:1–12
Prashar A, Hornyik C, Young V, McLean K, Sharma SK,
Dale MFB (2014) Bryan GJ (2014) Construction of a
dense SNP map of a highly heterozygous diploid
potato population and QTL analysis of tuber shape
and eye depth. Theor Appl Genet 127:2159–2171
Redden R (2013) New approaches for crop genetic
adaptation to the abiotic stresses predicted with
climate change. Agronomy 3:419–432
Reeves PA, Panella LW, Richards CM (2012) Retention
of agronomically important variation in germplasm
core collections: implications for allele mining. Theor
Appl Genet 124:1155–1171
Ruiu F, Picarella ME, Imanishi S, Mazzucato A (2012) A
transcriptomic approach to identify regulatory genes
involved in fruit set of wild type and parthenocarpic
tomato genotypes. In: Abstract Book, SOL2012, p 166
Sarkar D, Tiwari JK, Sharma S, Poonam Sharma Sanjeev,
Gopal J, Singh BP, Luthra SK, Pandey SK, Pat-
tanayak D (2011) Production and characterization of
somatic hybrids between Solanum tuberosum L. and
S. pinnatisectum Dun. Plant Cell Tiss Org Cult
107:427–440
Sharma SK, McLean K, Dale F and Bryan G (2012)
Characterization of the genetic diversity of tetraploid
potato using genome-wide high-density SNP geno-
typing. In: Abstract book, SOL2012, p 206
Singh R, Tiwari JK, Rawat S, Sharma V, Singh BP (2016)
Monitoring gene expression pattern in somatic hybrid
of Solanum tuberosum and S. pinnatisectum for late
blight resistance using microarray analysis.
Plant OMICS 9(1):99–105
Sinha N, Maloof J, Kumar R, Ranjan A, Koenig D,
Chitwood D, Headland L (2012) Genome assisted
developmental analyses in wild and domesticated
tomato. In: Abstract book, SOL2012, p 47
141
Slater AT, Schultz L, Cogan NOI, Forster JW, Rodoni B,
Milinkovic M (2010) Developing molecular genetic
marker technology capability to enhance Australian
potato breeding. In: Book of abstracts,
EAPR-EUCARPIA Congress, p 43
Sønderkær M, Kloosterman B, Whitty B, Bachem C,
Buell CR, Nielsen KL (2010) Gene expression
analysis to identify those genes important for making
the potato out of the potato. In: Book of abstracts,
EAPR-EUCARPIA Congress, p 32
Stich B, Urbany C, Hoffmann P, Gebhardt C (2013)
Population structure and linkage disequilibrium in
diploid and tetraploid potato revealed by genome-wide
high-density genotyping using the SolCAP SNP array.
Plant Breed 132:718–724
Strickler SR, Bombarely A, Munkvold JD, York T,
Menda N, Martin GB, Muelle LA (2015) Comparative
genomics and phylogenetic discordance of cultivated
tomato and close wild relatives. Peer J 3:e793
Sundaresha S, Tiwari JK, Sindhu R, Sharma S, Bhard-
waj V, Chakrabarti SK, Singh BP (2014) Phytoph-
thora infestans associated global gene expression
profile in a late blight resistant Indian potato cv. Kufri
Girdhari. Aus J Crop Sci 8:215–222
Szajko K, Strzelczyk-Żyta D, Marczewski W (2012) The
development of diagnostic markers for selection of
hypersensitive response (HR) genes for resistance to
PVY in the cultivated potato. In: Abstract Book,
SOL2012, p 156
Tai H, Worrall K, Koeyer DD, Pelletier Y, Calhoun L
(2012a) Metabolomics and transcriptomics of Color-
ado potato beetle resistance in wild Solanum species.
In: Abstract Book, SOL2012, p 207
Tai H, Worrall K, Koeyer DD, Pelletier Y, Calhoun L
(2012b) Comparative gene expression profiling of
diploid potato parents with variation in susceptibility
to verticillium wilt and eQTL mapping of the progeny.
In: Abstract book, SOL2012, p 91
Taylor MA (2010) Identification of genes that impact on
potato tuber colour, flavour and texture using tran-
scriptomic and transgenic approaches. In: Book of
abstracts, EAPR-EUCARPIA Congress, p 48
Thomson MJ, Zhao K, Wright M, Mcnally KL, Rey J,
Tung CW, Reynolds A et al (2012) High-throughput
SNP genotyping for breeding applications in rice
using the BeadXpress platform. Mol Breed 29:875–
886
Tiwari JK, Chandel P, Gupta S, Gopal J, Singh BP,
Bhardwaj V (2013a) Analysis of genetic stability of
in vitro propagated potato microtubers using DNA
markers. Physiol Mol Biol Plant 19:587–595
Tiwari JK, Chandel P, Singh BP, Bhardwaj V (2014)
Analysis of plastome and chondriome genome types in
potato somatic hybrids of Solanum tuberosum  S.
etuberosum. Genome 57:1–7
Tiwari JK, Devi S, Chandel P, Ali N, Bhardwaj V,
Singh BP (2016) Organelle genome analysis in
somatic hybrids between Solanum tuberosum and S.
142
pinnatisectum revealed diverse cytoplasm type in
potato. Agri Res 5:22–28
Tiwari JK, Devi S, Sundaresha S, Chandel P, Ali N,
Singh B, Bhardwaj V, Singh BP (2015a) Microarray
analysis of gene expression patterns in the leaf during
potato tuberization in the potato somatic hybrid
Solanum tuberosum and Solanum etuberosum. Gen-
ome 58:305–313
Tiwari JK, Gopal J, Singh BP (2012) Marker-assisted
selection for virus resistance in potato: options and
challenges. Potato J 39:101–117
Tiwari JK, Pandey SK, Poonam SK Chakrabarti, Gopal J,
Kumar V (2013b) Molecular markers of Ryadg gene
and serological assay reveal potato virus Y (PVY) re-
sistance in the tetraploid Indian potato (Solanum
tuberosum) germplasm. Indian J Agric Sci 83:397–
401
Tiwari JK, Poonam Chakrabarti SK, Kumar V, Gopal J,
Singh BP, Pandey SK, Pattanayak D (2013c) Identi-
fication of host gene conferring resistance to Potato
virus Y using Ry gene-based molecular markers.
Indian J Hort 70:373–377
Tiwari JK, Poonam Sarkar D, Pandey SK, Gopal J,
Kumar SR (2010) Molecular and morphological
characterization of somatic hybrids between Solanum
tuberosum L. and S. etuberosum Lindl. Plant Cell Tiss
Org Cult 103:175–187
Tiwari JK, Devi S, Sharma S, Chandel P, Rawat S,
Singh BP (2015b) Allele mining in Solanum germ-
plasm: cloning and characterization of
RB-homologous gene fragments from late blight
resistant wild potato species. Plant Mol Bio Rep
33:1584–1598
Tiwari JK, Saurabh S, Chandel P, Singh BP and
Bhardwaj V (2013d) Analysis of genetic and epige-
netic variation in potato somatic hybrid by AFLP and
MASP markers. Electr J Biotech
(DOI:10.2225/vol16-issue6-fulltext-9)
Tiwari JK, Singh BP, Gopal J, Poonam, Patil VU (2013e)
Molecular characterization of the Indian Andigena
potato core collection using microsatellite markers.
Afr J Biotech 12:1025–1033
Tiwari JK, Sundaresha S, Singh BP, Kaushik SK,
Chakrabarti SK, Bhardwaj V, Chandel P (2013e)
Molecular markers for late blight resistance breeding
of potato: an update. Plant Breed 132:237–245
Urbany C, Colby T, Stich B, Schmidt L, Schmidt J,
Gebhardt C (2012) Analysis of natural variation of the
potato tuber proteome reveals novel candidate genes
for tuber bruising. J Proteome Res 11:703–716
Van K, Kang YJ, Han K-S, Lee Y-H, Gwag J-G, Moon
J-K, Lee S-H (2013) Genome-wide SNP discovery in
mungbean by Illumina HiSeq. Theor Appl Genet
126:2017–2027
Van K, Kim DH, Shin JH, Lee S-H (2011) Genomics of
plant genetic resources: past, present and future. Plant
Genet Res: Char Utiliz 9:155–158
J. K. Tiwari et al.
Verweij W, Foster S, Jones J (2010) Identifying late
blight resistance genes in Solanum accessions. In:
Book of abstracts, EAPR-EUCARPIA Congress, p 41
Víquez-Zamora M, Vosman B, van de Geest H, Bovy A,
Visser RGF, Finkers R, van Heusden AW (2013)
Tomato breeding in the genomics era: insights from a
SNP array. BMC Genom 14:354
Vleeshouwers VGAA, Rietman H, Champouret N,
Bijsterbosch G, Vossen J, Jacobsen E, Birch P,
Kamoun S, Visser R (2012) Effector-driven disease
resistance breeding in potato. In: Abstract book,
SOL2012, p 73
Voorrips RE, D’hoop BB, Gort G, Vosman B (2010)
Analysis of tetraploid cultivars with GoldenGate
markers: Identification of 5 genotypic classes and trait
associations. In: Book of abstracts,
EAPR-EUCARPIA Congress, p. 42
Vos PG, Uitdewilligen JGAML, Voorrips RE, Vis-
ser RGF, van Eck HJ (2015) Development and
analysis of a 20 K SNP array for potato (Solanum
tuberosum): an insight into the breeding history. Theor
Appl Genet 128:2387–2401
Wang M, Allefs S, van den Berg RG, Vleeshouw-
ers VGAA, van der Vossen EAG, Vosman B (2008)
Allele mining in Solanum: conserved homologues of
Rpi-blb1 are identified in Solanum stoloniferum.
Theor Appl Genet 116:933–943
Wen W, Taba S, Shah T, Tovar VHC, Yan J (2011)
Detection of genetic integrity of conserved maize (Zea
mays L.) germplasm in genebanks using SNP markers.
Genet Resour Crop Evol 58:189–207
Xu X, Pan S, Cheng S, Zhang B, Mu D, Ni P, Zhang G,
Yang S, Li R, Wang J, Orjeda G, Guzman F, Torres M,
Lozano R, Ponce O, Martinez D, Cruz G,
Chakrabarti SK et al (2011) Genome sequence and
analysis of the tuber crop potato. Nature 475:189–195
Ye Z, Li J, Ouyang B, Zhang J, Li H (2012) Functional
characterization of drought-tolerant genes screened
from comparative transcriptomes between
drought-tolerant and drought sensitive tomato intro-
gression lines in response to drought stress. In:
Abstract book, SOL2012, p 65
Zhu S, Duwal A, Su Q, Vossen JH, Visser RGF,
Jacobsen E (2013) Vector integration in triple R gene
transformants and the clustered inheritance of resis-
tance against potato late blight. Transgenic Res
22:315–325
Zhu S, Li Y, Vossen JH, Visser RGF, Jacobsen E (2012)
Functional stacking of three resistance genes against
Phytophthora infestans in potato. Transgenic Res
21:89–99
Zimnoch-Guzowska E, Flis B (2012) Application of MAS
in pre-breeding of 4x potato clones resistant to
pathogens useful for organic farming. In: Abstract
book, SOL2012, p 181
 Repetitive Sequences in the Potato
and Related Genomes 9
Atul Grover and P. C. Sharma

Abstract
Repetitive sequence elements refer to sequences which are repeated a number
of times in the genome and are generally composed of either the interspersed
elements or tandem repeats, which may be coding or non-coding. Solanum
genomes, like that of potato and tomato, are exceptionally rich in repetitive
elements and have evolved by the multidirectional activities of the repetitive
elements. Interspersed elements, in particular, have contributed to the
evolution of Solanum genomes, not only by their amplification in the genome,
but also by their association with different genes. The genomic proximity of
interspersed elements to genes may influence the expression patterns,
development of alternative functions, emergence of new genes or elimination
of existing genes. Long terminal repeat (LTR) retrotransposons represent the
most abundant class of repetitive elements among all the repeats and they are
also considered the progenitors of some genes and other types of repeats such
as microsatellites. Centromeric, telomeric, minisatellites and microsatellites
constitute tandem repeats, which are abundant in the Solanum genomes. The
patterns of occurrence and abundance of repeats vary among different species
of Solanum, although a careful analysis reveals a number of perceptible
evolutionary trends. Tandem repeats, particularly microsatellites, have
frequently been exploited for the development of molecular markers for
diverse applications in potato. The present chapter deals with the occurrence
and distribution of different categories of repetitive elements in potato and the
related Solanum genomes.

A. Grover
Defence Institute of Bio Energy Research,
Defence Research and Development Organization, 9.1 Introduction
Ministry of Defence, Government of India,
Goraparao, Haldwani, India
Repetitive sequences are important constituents
P. C. Sharma (&) of genomes and contribute towards genome size
University School of Biotechnology, Guru Gobind
Singh Indraprastha University, New Delhi, India variations seen across present-day species (Aru-
e-mail: prof.pcsharma@gmail.com muganthan and Earle 1991; Nystedt et al. 2013).

© Springer International Publishing AG 2017 143

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_9
144
Unique sequences
Interspersed repeats
Paralogous tDNA Transposable Pseudogenes
genes genes elements
DNA Transposons Retrotransposons
LTR repeats
Fig. 9.1 An overview of a variety of repetitive sequences in plant genomes
Plant genomes are known to harbour a variety of
repetitive sequences (Fig. 9.1), broadly classified
as (1) interspersed repeats, which include trans-
posons, retrotransposons, etc.; and (2) tandem
repeats, which are often sub-grouped as satellite,
minisatellites and microsatellites. Repeats at
centromeric and telomeric regions of the chro-
mosomes also fall into this category (Jiang et al.
2003). Ribosomal DNA (rDNA) genic repeats
and inter-genic spacers too are sometimes
included in this category, or may be considered a
separate third category of repeats. There are
many categories, sub-categories, and constituent
families and sub-families of repeat elements.
Macas et al. (2002) have identified 154 families
of satellite repeats in plants, and, of course, the
list is only partial.
Though, there is a general belief that repetitive
sequences play little role in the execution of
routine genomic activities, still their sequence,
structure, organization and genomic position are
important characteristics that may play crucial
roles in the expression and evolution of the
A. Grover and P. C. Sharma
Genome
RepeƟƟve sequences
Tandem repeats
Paralogous rDNA Satellite
genes genes DNA
Satellite Ministatellite Microsatellite
repeats repeats repeats
Non-LTR repeats
genomes (Mehra et al. 2015). These repeats are
closely associated with the heterochromatin
component of the genome and help in the regu-
lation of its formation and maintenance (Volpe
et al. 2002; Zhong et al. 2002). For example,
centromeric satellite repeats are involved in the
cell division by becoming sites of centromere
recognition during spindle formation (Zhong
et al. 2002; Nagaki et al. 2003, 2011). Evolution
of certain genome groups like that of Brassica
spp. and sunflower is largely attributed to active
transposition of the interspersed elements (Staton
et al. 2012; Sampath et al. 2014).
In the present era of genomics, wherein Next
Generation Sequencing (NGS) technology has
facilitated high-through-put, fast and deep
sequencing of short pieces of DNA with revolu-
tionary applications, these repeats cause peculiar
problems both in sequencing as well as assembly
of short reads (Treangen and Salzberg 2012).
Such problems are also faced while annotating
and using genomic data, as one may end up
downloading single sequence multiple times, or
9 Repetitive Sequences in the Potato and Related Genomes
on the other hand, many different sequences
might be recognized as one. Though, repetitive
sequences hinder genomic studies, some of these,
particularly microsatellite sequences, have been
exploited widely as molecular markers in diverse
plant and animal species.
Potato (Solanum tuberosum L.; Family Solana-
ceae) stands fourth in securing global food security,
after rice, wheat and maize. It is an autotetraploid,
highly heterozygous and vegetatively propagated
crop. Inbreeding depression is well known in
potato. Due to its importance as a world crop, its
genome has received well-deserved attention, and
is now completely sequenced (The Potato Genome
Sequencing Consortium 2011). Tek et al. (2005)
considered potato to be an ideal species for under-
standing the evolution of repeat sequences as it is a
vegetatively propagated species and thus meiotic
mechanisms responsible for the emergence of new
repeats can be ruled out.
Zhu et al. (2008) presented convincing evi-
dence to decipher the role that repetitive sequences
have played in genome evolution within the genus
Solanum. Potato and tomato genomes diverged
fairly recently, about 12 million years ago (Moniz
de Sa and Drouin 1996). Although there is some
difference in their haploid genome sizes, that is
865 and 950 Mb respectively for potato and
tomato, there is a substantial difference in genome
coverage by repetitive elements. While, one-third
of the potato genome is comprised of repetitive
sequences, almost half of the tomato genome is
repetitive in nature (Zhu et al. 2008; The Potato
Genome Sequencing Consortium 2011; The
Tomato Genome Consortium 2012; Mehra et al.
2015). These two genomes have been annotated
for various genomic elements including repetitive
elements, revealing a total of 404,861 repetitive
elements for S. tuberosum and 719,453 repetitive
elements for S. lycopersicum (The Potato Genome
Sequencing Consortium 2011; The Tomato Gen-
ome Consortium 2012). Moreover, a high degree
of gene synteny has been observed between two
species (Zhu et al. 2008) suggesting that repetitive
DNA has been directing the evolution of the two
genomes independently since their divergence.
Chromosome 12 in both tomato and potato is the
richest in harbouring various repeats (Mehra et al.
145
2015). Repetitive DNA sequences have been iso-
lated from various species of the family Solana-
ceae, and have been exploited for various purposes
such as phylogenetic studies, establishing the
parental origin of chromosomes in somatic
hybrids, constructing karyotypes, and for studying
chromosomal structural alterations.
This chapter is an attempt to characterize
different kinds of repetitive elements present in
the potato genome. We also endeavour to explain
their influence on the genome evolution, their
exploitation as molecular markers, and the way
modern-day molecular biologists and the genome
sequencing community address questions per-
taining to these sequences.
9.2 Repetitive Elements in Potato
and Related Genomes:
Historical Perspective
In one of the pioneer studies, Osborne et al. (1991)
studied the transposition behaviour of Ac elements
in tomato. Later, Stadler et al. (1995) demonstrated
the utility of repetitive elements in somatic
hybridization and also identified novel repetitive
elements in the Solanum genomes, establishing a
foundation for the use of repetitive elements for
molecular breeding. Oosumi et al. (1995) scanned
the GenBank sequences of Solanaceae for inverted
repeats, facilitating the use of the in silico
approach for the first time in the identification of
repetitive elements in Solanaceae. Several genes
are now known to harbour repetitive elements in
their non-coding regions. Ganal et al. (1998)
identified four different repeat families in tomato,
which together constituted 0.15% of the total
genome. Subsequently, many novel tandem
repetitive elements including centromeric and
telomeric repeats were discovered in potato and
related genomes (Tek and Jiang 2004; Torres et al.
2011; Gong et al. 2012; Melters et al. 2013; Tang
et al. 2014; Zhang et al. 2014). A summary list of
known repetitive elements in potato genome is
presented in Table 9.1.
Potato is among the richest genomes, having a
fair number of molecular markers developed
using tandem repetitive DNA (satellite,
146 A. Grover and P. C. Sharma

Table 9.1 Distribution of repetitive sequence elements in the potato genome

Category Repeat/Repeat No. of Reference
family loci
DNA CMC-EnSpm 19999 Mehra et al. (2015)
transposons Harbinger 14341
hAt-Ac 10951
hAT-Tag1 3188
hAT-Tip100 9469
MULE-MuDR 8318
PIF-Harbinger 9489
TcMAr-Pogo 1967
TcMar-Stowaway 27720
Helitron 1957
Retrotransposons LINE/L1 23521 Mehra et al. (2015)
LINE/RTE-Bov8 27091
LTR/Caulimovirus 5888
SINE 3853 Wenke et al. (2011)
SINE/tRNA 10567 Mehra et al. (2015)
Tnt1 317 Manetti et al. (2007)
Ty3 Gypsy Not Zhu et al. (2008), Tang et al. (2014), Mehra et al. (2015)
known
Ty3 Copia Not Tang et al. (2014), Mehra et al. (2015)
known
snRNA 487 Mehra et al. (2015)
rRNA 1845 Schweizer et al. (1993), Dong et al. (2000), Mehra et al.
(5S, 18S, 5.8S, (2015)
25S)
Satellite 2444 Mehra et al. (2015)
Telomeric pAtT4 Not Visser et al. (2009)
known
Sub-telomeric pSB1 Not Pehu et al. (1990), Rokka et al. (1998)
known
pSB7 Not
known
pST3 Not
known
Sb4/2 Not Preiszner et al. (1994)
known
SPG 12 Gebhardt et al. (1995)
PGR1/REP3 14 Tang et al. (2014)
TGRI/Pleg15 20 Ganal et al. (1988)

CL14 13 Torres et al. (2011)

CL34 16
(continued)
9 Repetitive Sequences in the Potato and Related Genomes 147

Table 9.1 (continued)

Category Repeat/Repeat No. of Reference
family loci
Centromeric pSB1 Not Pehu et al. (1990), Rokka et al. (1998)
known
pSB7 Not
known
pSBTC1 Not Tek and Jiang (2004)
known
St18 Not Gong et al. (2012)
known
St24 Not
known
St49 Not
known
St57 Not
known
St3-58 Not
known
St3-238 Not
known
Pericentormeric 2D8 Not Stupar et al. (2002)
known
Sobo 01 Tek et al. (2005)
P5 Not Tang et al. (2014)
known

minisatellite, microsatellite) (Veilleux et al.
1995; Provan et al. 1996; Schneider and Douches
1997; Tang et al. 2008; Grover et al. 2009) and is
one of the first plant species for which high
density maps were constructed along with tomato
(Tanksley et al. 1992). The markers developed in
potato have been applied to potato genome
mapping, gene tagging and germplasm charac-
terization (Milbourne et al. 1998; McGregor et al.
2000a, b; Ashkenazi et al. 2001; van Os et al.
2006; Spooner et al. 2007; Grover et al. 2009).
Ghislain et al. (2009) have developed a genetic
identity kit for potato based on their study of
genetic characterization of around 1000 cultivars
using microsatellite markers.
Interspersed elements, particularly long termi-
nal repeat (LTR) retrotransposons, are more
abundant in the potato genome (Zhu et al. 2008).
The distribution, abundance, genomic localization
and functional influence of these repeats have been
studied more intensely in the tomato genome
(Jiang et al. 2009). Different workers in subse-
quent years have reported the abundance of
Miniature Inverted-repeat Transposable Ele-
ments (MITEs), Short Interspersed Nuclear
Elements (SINEs), MUtator-like Transposable
Elements (MULE) and LTR retrotransposon
(Mehra et al. 2015) mostly by using in silico tools.
Although in plant genomes most interspersed
repeat elements are not active, in potato, interest-
ingly, a good number of active interspersed ele-
ments have been reported (Momose et al. 2010).
9.3 Interspersed Repeats
Interspersed repeats are one of the major geno-
mic elements driving the evolution of genomes,
so much so that their genomic activities may
even lead to the origin of new species.
148
Nevertheless, only a small number of active
transposable elements generally exist as master
elements for their amplification in the genome,
and most copies are transpositionally inactive.
These elements are known to have been associ-
ated with plants even before the divergence of
monocot and dicot lineages (Rossi et al. 2004).
Initially, it was felt that transposon sequences
constitute only a minor portion (1.32%) of the
potato genome (Zhu et al. 2008), however, recent
findings indicate that these repeats constitute as
much as 49% of the genome and are preferen-
tially located in the genic regions of the genome
(Mehra et al. 2015). In particular, some repeats
occur in the regulatory regions of the genes,
while others have been reported from the introns
(Mehra et al. 2015). Those occurring in the
introns may get exonized and domesticated (van
de Lagemaat et al. 2003) after positional stabi-
lization and integration into the genes. Interest-
ingly, >99% genes in potato have positional
associations with repetitive elements. Further,
distribution of repetitive elements in regulatory
regions and introns of genes in the potato gen-
ome is fairly uniform (Mehra et al. 2015). When
a repetitive element is overlapping with the
genes, and also contains the splice sites, it would
stand a high chance of being exonized. The
impact of exonization on the transcriptome has
been studied several times in different species
including humans, animals and plants (Huang
et al. 2012), and both fruitful as well as adverse
effects have been recorded (Sorek 2007). It has
been observed that most exonization events
occur in the duplicated genes, a mechanism to
minimize any possible negative effects of
exonization on the genome (Mehra et al. 2015).
As LTR elements possess promoter sequences,
there may be a strong impact on regulation of the
expression of the genes downstream to these
elements. On the other hand, occurrence of
transposable elements within the introns may
lead to the creation of alternative splice sites, and
in certain cases may cause errors in transcription
and translation, resulting into several metabolic
errors (Bureau and Wessler 1992, 1994; Lockton
and Gout 2009). In totality, the occurrence of
transposable elements within the vicinity of
A. Grover and P. C. Sharma
genes may be responsible for variations at phe-
notypic level (Makalowski 2000; Muotri et al.
2007).
9.3.1 Retrotransposons
Retrotransposons are transposable elements
showing homology to retroviruses in terms of
their sequence and amplification strategies. They
are ubiquitous components of the eukaryotic
genomes. While, DNA transposons follow a
cut-and-paste mechanism for transposition, these
elements follow a copy-and-paste mechanism for
their transposition, and hence in the process keep
themselves amplifying in the genome. Retro-
transposons are first transcribed into RNA and
are then converted back into identical DNA
sequences by reverse transcription. Subse-
quently, they are inserted back into the genome
at target sites.
Retrotransposons are abundantly found in
eukaryotic genomes, constituting up to 50% of
the genome. They are more predominant in the
plant genomes (Bennetzen et al. 2005; Baucom
et al. 2009). They are often classified as LTR
retrotransposons, and non-LTR retrotransposons.
LTR retrotransposons, in particular, have widely
been reported from plant genomes, and are
thought to have the potential of driving the
genome evolution (San Miguel and Bennetzen
1998; Bennetzen and Wang 2014). Mehra et al.
(2015) have identified 30 pre-miRNA sequences
that possibly originated from LTR like repetitive
sequences in potato. Copies of LTR retrotrans-
posons may become sites for recombination
between different chromosomes leading to
reciprocal translocation or they may also be the
sites of reciprocal recombination between LTRs
and inverted LTRs, leading to gene loss and
gene inversions (Bennetzen 2000). Such events
have been widespread in the Solanum genomes
(Peters et al. 2012). Ty3-gypsy and Ty1-copia
are the representative kinds of LTR retrotrans-
posons in plant genomes (Wicker et al. 2007).
Importantly, LTRs are recognized to be the most
rapidly evolving component of the genomes
(Lisch 2013; Bennetzen and Wang 2014) and
9 Repetitive Sequences in the Potato and Related Genomes
are subdivided into three regions: U3, R and U5,
standing for Unique 3′ RNA, repeat RNA and
Unique 5′ RNA. LTRs generally host promoter,
terminator and poly A sites (Kumar and
Bennetzen 1999). LTR retrotransposons
amplify in genomes by their own replication
as well as by homologous recombination
between same or different elements (Manetti
et al. 2007).
A number of active LTR retretransposons
have been observed in the potato genome. The
comparison of orthologous regions of potato and
tomato genome has revealed that the two gen-
omes differ considerably with respect to the
composition of LTR retrotransposon, potato
being comparatively richer in LTR retrotrans-
posons (Peters et al. 2012). A well-studied
retrotransposon in potato is Tnt1, first character-
ized in tobacco (Grandbastein et al. 1989), and it
has subsequently been reported from other
Solanaceae genomes like potato, tomato, petunia,
etc. and their wild relatives (Grandbastein et al.
2005; Manetti et al. 2007; Kriedt et al. 2014; Paz
et al. 2015). Tnt1-like sequences from Solanum
sp. have been called RetroSol by Manetti et al.
(2007) and they share high sequence homology
with both Tnt1 of Nicotiana tabacum and Ret-
roLyc1 family of tomato (Costa et al. 1999;
Araujo et al. 2001; Manetti et al. 2007). Tnt1 and
RetorSol show hypervariability of the U3 region.
Manetti et al. (2007) suggested that amplification
and differentiation of RetorSol occurred prior to
species diversification within Solanum, but spe-
ciation in this genus is not a determinant of
RetroSol activity.
Non-LTR retrotransposons include Long
Interspersed Nuclear Elements (LINEs) and
Short Interspersed Nuclear Elements (SINEs).
LINE element 1 is among the most abundant
repeats in potato (Mehra et al. 2015). Retro-
transposition of SINEs depends on proteins
encoded by LINEs (Singer 1982; Weiner et al.
1986; Boeke 1997; Kajikawa and Okada 2002;
Dewannieux et al. 2003). Both LINEs and SINEs
are usually terminated by a poly(A) stretch, poly
(T) stretch, or simple sequence motifs at the 3’
end. Usually, they are also flanked by target site
duplications (TSDs) (Wenke et al. 2011). SINEs
149
are thought to have emerged from tRNA genes,
and at least in the Solanaceae family, most SINEs
have emerged prior to the diversion of the sola-
nae and nicotinae clades (Wenke et al. 2011)
around 23.7 mya (Wu and Tanksley 2010).
On analysis of 350 Mb of potato genome,
Wenke et al. (2011) identified 1560 full-length
novel SINEs falling into categories SolS-Ia,
SolS-Ib, SolS-II, SolS-IIIa, SolS-IIIb, SolS-IV,
SolS-V, SolS-VI, SolS-VII and AU. Members of
SolS-II were most abundant, while members of
SolS-IIIa were most repetitive. The latter is
thought to have amplified in tomato and potato
after their divergence from pepper and tobacco
(19.6 mya) (Wenke et al. 2011). Similarly,
SolS-IIIb and SolS-IV are thought to have
amplified in potato after its divergence from
tomato (7.3 mya) (Wenke et al. 2011). In addi-
tion to ful-length SINEs, 1039 SINEs with 5′-
truncated sequences were also identified. Mem-
bers of the TS family of SINEs, which share a
high sequence similarity to SolS-V at the 5′end
and a LINE SolRTE-I at the 3′′end, have been
reported in other members of Solanaceae
(Yoshioka et al. 1993; Pozueta-Romero et al.
1998; Yasui et al. 2001), other than potato.
Interestingly, 20% of SINEs in potato have been
reported to be transcriptionally active, which
might be due to co-transcription with some genes
or active transposition (Wenke et al. 2011).
9.4 Tandem Repeats
Tandem repeats include satellite, minisatellite
and microsatellite repeat sequences, which nec-
essarily differentiate from each other on the basis
of the length of the repeat unit. These sequences
are called satellite DNA (repeats), because they
were first isolated from the satellite bands (Tek
et al. 2005). These sequences generally expand
(tandem repeat amplification) from any small
repetitive sequence, for example,
‘proto-microsatellite’ (Grover and Sharma 2011)
by some genomic activities such as replication
slippage, unequal crossing over and rolling circle
amplification (Stupar et al. 2002), and diverge
rapidly. These tandem repeat amplification
150
events may work independently or in association
with each other (Walsh 1987). According to
another hypothesis, a library of repeats is present
in all the species. and in some of the species,
specific members of this library amplify in the
genome, while remain at a lower frequency in
other species (Salser et al. 1976). Such repeats
are often addressed as species-specific repeats
and tend to diverge rapidly (Lapitan 1992).
However, repeats may also originate from a
non-repeat sequence entirely by repeated unequal
crossing-over, precisely at the same site (Smith
1976). These repeats are generally distributed
throughout the genome (Stupar et al. 2002;
Grover et al. 2007; Sharma et al. 2007; Grover
and Sharma 2012). However, the tandem repeats
in centromeric, pericentromeric and telomeric
regions are often loosely designated by their
genomic positions. Importantly, repeats in
telomeric and centromeric regions are intrinsic
by their function (Gong et al. 2012; Korandova
et al. 2014). Like other repeats, these repeats too
may evolve from non-repeats or neo-repeats.
9.4.1 Repeats in Centromeres,
Pericentromeres
and Telomeres
Centromere-specific satellite repeats occur in six
of the potato centromeres, five of which have
evolved recently on the evolutionary scales
(Gong et al. 2012). The centromeric repeats in
the potato genome have been identified as St18,
St24, St49, St57, St3-58 and St3-238 with a
monomer size of 1180, 979, 2754, 1924, 2957
and 3814 bp, respectively. The total length up to
which these repeats span may exceed is
2000 Kb, for example, the entire CENH3 region
in the centromeres. These satellite repeats in
centromeres in potato seem to have been inserted
in centromeric regions by de novo amplification.
Five potato centromeres do not harbour satellite
repeats (Gong et al. 2012). Some satellite repeat
elements are widespread and well conserved
across the Solanum species. Solanum brevidens
repeats pSB1 and pSB7 are universally present in
the Etuberosa group of the genus Solanum
A. Grover and P. C. Sharma
(Malkamaki et al. 1996). Similarly, the pericen-
tromeric satellite repeat 2D8 of potato, derived
from the intergenic spacer of the 18S-25S ribo-
somal RNA genes is present in all Solanum
species (Stupar et al. 2002).
From an evolutionary point of view, the
sequence homology should be seen as the
sequence divergence from a parent sequence that
eventually leads to the origin of new sequence
elements, including repeats. DNA sequences at
different loci have different evolutionary time
frames and mutability. As a result, some
sequences may be conserved over long evolu-
tionary periods, even among the closely related
species, while other sequences get diverged
several times in the same species itself. Thus,
contrary to 2D8, Sobo, another satellite repeat in
pericentromeric region, with a monomer size of
4.7 Kb, was reported as unique to S. bulbocas-
tanum (Tek et al. 2005), and thus could be con-
sidered as a recently amplified satellite repeat.
Interestingly, unequal crossing is an unusual
event in pericentromeric regions in Solanaceae
(Sherman and Stack 1995), and thus there must
be other factors in play to explain the abundance
of satellite repeats in these regions. Tek et al.
(2005) opined that Sobo could have emerged
from the re-insertion of an amplified
extra-chromosomal circular DNA (Walsh 1987;
Charlesworth et al. 1994).
The potato genome is richer in telomeric
repeats (Zhu et al. 2008), located at telomeres,
and also in centromeric and pericentromeric
regions (Tek and Jiag 2004; Zhu et al. 2008; He
et al. 2013). The term ‘interstitial telomeric
repeats’ has been suggested for the telomeric
repeats, (TTTAGGG)n, located away from
telomeres. Such repeats are thought to have
evolved by telomere-telomere fusions of ancient
chromosomes (He et al. 2013). The characteristic
difference between a telomeric repeat and repeats
at the centromere or pericentromere is that a
telomeric repeat is essentially a hexanucleotide
microsatellite or a short motified (heptanuceotide)
minisatellite repeat, while the centromeric and
pericentromeric repeats are typically satellite
repeats. The interstitial telomeric repeats are
thought to be hotspots for breakage,
9 Repetitive Sequences in the Potato and Related Genomes
recombination, rearrangement, and amplification
sites in the genome (Lin and Yan 2008; Bolzan
2012).
In fact, sequence similarities suggest that the
satellite repeats in potato have evolved from
either telomeric repeats in centromeres or by
LTR retrotransposition (Gong et al. 2012). Cen-
tromeric DNA sequences partially homologous
to telomeric repeats have been reported in several
eukaryotic chromosomes like Drosophila mela-
nogaster Y chromosome (Abad et al. 2004;
Mendez-Lago et al. 2009), maize B chromosome
(Alfenito and Birchler 1993; Jin et al. 2005), and
tomato chromosomes (Presting et al. 1996). In
particular, St49 repeat located on the centromere
of chromosome 5, belonged to the family of
interstitial telomeric repeats (He et al. 2013) with
its A/T-rich sequence (Gong et al. 2012). This
repeat shares high sequence similarity to
telomere-similar centromeric repeats previously
reported in S. bulbocastanum by Tek and Jiang
(2004) and hybridizes to telomeric regions of
tomato chromosomes also (Gong et al. 2012).
Moreover, sequence similarities of centromeric
satellite repeats with LTR retrotransposons
alongwith their positional association with these
repeats (Pasero et al. 1993; Rossi et al. 1993;
Langdon et al. 2000; Temnykh et al. 2001;
Cheng and Murata 2003; Tek et al. 2005;
Roorkiwal et al. 2009) suggest that both
sequence and genomic positions of satellite
repeats have evolved from LTR containing
retrotransoposable elements. Thus, there is a high
chance that LTRs and LTR containing retro-
transposable elements may be the progenitors of
tandem repeats.
9.4.2 Minisatellite and Microsatellite
Repeats
Distribution, occurrence and abundance of tan-
dem repeats vary greatly across plant species
(Schmidt and Heslop-Harrison 1993; Frello et al.
2004). The patterns are generally species-specific
151
even among the closely related species. Nearly
0.5% of the transcriptome is constituted of tan-
dem repeats in the Solanaceae species. In EST
databases, however, 5.35% of potato ESTs con-
tain at least one microsatellite repeat (Grover and
Sharma 2012). Obviously, tandem repeats with
smaller repeat unit are more abundant than tan-
dem repeats with a larger repeat unit. Our expe-
rience of working with the genic sequences of
different species within the Solanaceae family
had led us to identify only around 100 repeats
conserved, out of the thousands of repeats iden-
tified in 15 species (Grover and Sharma 2012).
In the transcribed regions, while microsatel-
lites occur in all three regions i.e. UTRs, exons
and introns, minisatellite repeats were generally
reported within the exonic regions or overlapping
with the exonic regions (Grover and Sharma
2012). Being transcribed also, tandem repeats
with repeat units in multiples of three show
predominance over other repeats with different
lengths of repeat units. Grover and Sharma
(2012) reported an abundance of repeats with a
motif size of 2, 15, 18 and 21 bp. Repeats of unit
sizes 21 and 22 bp also represented the most
abundant tandem repeats in the genomic
sequences of potato and tomato. The repeats with
unit size ranging from 15–22 bp were markedly
abundant in genomic sequences also (Grover and
Sharma 2012). Among the Solanaceae members,
tandem repeat motif length did not exceed
228 bp and among all the repeats with a unit
length longer than 100 bp, repeats with unit
lengths in the multiple of 114 (114x) and par-
ticularly 228 bp are generally more abundant and
longer (Grover and Sharma 2012). Interestingly,
such repeats (belonging to the family of 114x)
were not found in the genomic sequences of
potato and tomato, indicating that they were split
over two or more exons. On the other hand,
repeats with motif sizes 180, 192 and 204 bp
were more abundant in genomic sequences,
which were annotated as transposable elements
(Grover and Sharma 2012). The potato genome
also showed a marked accumulation of tandem
152
repeats with the same-sized motif lengths and
with high levels of sequence similarity among
them (Grover and Sharma 2012).
Repeats of type (CG)n are very poorly repre-
sented, though (AG)n and (AT)n have been
reported to be most common as well as the longest
repeats in ESTs and unigenes of potato, respec-
tively (Grover et al. 2009). While the average
repeat number for (AG)n is 8.46, it was found to be
8.94 for (AT)n. Among trinucleotide repeats,
(AAG)n was found most commonly in ESTs and
(AAT)n in unigenes with average repeat numbers
being 5.91 and 5.85, respectively (Grover et al.
2009). A large number of microsatellites in potato
occur in 5′-UTRs (Grover et al. 2009). Nearly half
of 5′-UTR microsatellite repeats have been
reported to be (AAG)n, with a bias towards the
occurrence of (TTC)n, (TCT)n and (CTT)n
occurring on the transcribed strand. On the other
hand, 3′-UTR is relatively poorer in microsatellite
repeats, though among all the repeats occurring in
3′-UTR, (AAT)n occur most frequently. Among
the transcribed repeats, poly-G, that is (GGG)n,
was reported to be the most common.
9.5 Ribosomal DNA Repeats
rDNA sequences in potato are relatively less
abundant (Schweizer et al. 1993; Komarova et al.
2004; Zhu et al. 2008), and are mostly distributed
in the nucleolar organizing region (NOR) of
chromosomes 1 and 2 (Dong et al. 2000). The 45S
rDNA complex containing the 18S, 5.8S and 25S
units have been localized to the end of the short
arm of chromosome 2 in the NOR. The 5S rRNA
gene cluster was mapped to a single locus in the
short arm pericentromeric region of chromosome
1, close to the centromere (Dong et al. 2000).
9.6 Exploiting Repetitive
Sequences in Potato
as Molecular Markers
Owing to their hypervariability, repetitive
sequences can be employed for various genetic
studies such as gene tagging, molecular mapping,
A. Grover and P. C. Sharma
phylogenetics, DNA fingerprinting, etc. by con-
verting them into molecular markers. Most
attempts to use repetitive elements are generally
made by amplifying the repeat loci using flank-
ing sequence-specific primers in a PCR reaction.
However, Jacobs et al. (1995) isolated Ac ele-
ments and used them as RFLP probes for
molecular mapping in potato. Nevertheless, most
examples involving exploitation of repetitive
elements in potato have been based on PCR
amplifications to develop locus-specific
microsatellite markers, also termed sequence
tagged microsatellite markers (STMS).
The early reports of extraction and character-
ization of microsatellites in potato were based on
in silico searches in DNA sequences available in
the public databases. These three reports together
described about 30 microsatellite markers for the
potato genome (Veilleux et al. 1995; Provan
et al. 1996; Schnieder and Douches 1997). Later,
Milbourne et al. (1997, 1998) developed 112
microsatellite markers by screening cDNA
libraries and the EMBL database. Ashkenazi
et al. (2001) further contributed 30 microsatellite
markers by screening enriched libraries and
searching sequence databases. In subsequent
years, more microsatellites were exploited as
markers in potato (Grover et al. 2009). Until the
availability of the whole genome sequence of
potato, little more than 300 microsatellite mark-
ers had been developed and existed in the public
domain, as listed in Table 9.2.
Microsatellites have found immense utility in
a variety of genetic studies in potato. Analysis of
genetic relationships among cultivars has largely
benefitted from the use of microsatellite markers
(Provan et al. 1996; Schneider and Douches
1997; Ashkenazi et al. 2001; Grover et al. 2009).
Besides that, microsatellites have also been use-
ful in the characterization of novel gene pools
like that of anther-derived plants (Veilleux et al.
1995), inter-specific hybrids (Ashkenazi et al.
2001), diploid wild germplasm (Lara-Carbrera
and Spooner 2000), and many more (Table 9.3).
In fact, there are a number of ways in which
repetitive sequences can be used as molecular
markers, as listed in Tables 9.2, 9.3 and 9.4,
though their actual implementation as markers
9 Repetitive Sequences in the Potato and Related Genomes 153

Table 9.2 Microsatellite markers available in the public domain prior to the availability of potato whole genome
sequence
Source No. of Application Reference
markers
Gene sequences 05 Genetic characterization of anther-derived plants Veilleux et al. (1995)
Gene sequences 20 Genetic diversity estimation Provan et al. (1996)
Sequence 40 Genetic diversity estimation Schneider and Douches
databases (1997)
Sequence 75 Genetic diversity estimation Milbourne et al. (1997)
databases
Genomic 18 Genetic diversity estimation and cross-species Ashkenazi et al. (2001)
library transferability
Sequence 12 Genetic diversity estimation and cross-species Ashkenazi et al. (2001)
databases transferability
Tomato repeats 12 Genetic diversity estimation and cross-species Ashkenazi et al. (2001)
transferability
ESTs 13 Molecular mapping Ghislain et al. (2004)
ESTs 57 Molecular mapping Feingold et al.(2005)
Genomic 16 Genetic diversity estimation Grover et al. (2009)
library
ESTs 14 Genetic diversity estimation Grover et al. (2009)

Table 9.3 Summary of molecular marker systems based on repetitive sequences

SN Marker technology Methodology/characteristic Reference
1. Amplification of Insertion Variant of AFLP with one of the Frey et al. (1988),
mutagenized sites (AIMS) and primers specific to Mutator element Edwards et al. (2002)
MuAFLP
2. Direct amplification of Amplification of minisatellite DNA Zhou et al. (1997)
minisatellite DNA (DAMD) using minisatellite-specific single
primer under high stringency
3. Inter-Simple Sequence Repeat Random amplifications using Meyer et al. (1993)
(ISSR) anchored microsatellite primers
4. Microsatellites PCR PCR amplification is carried out Litt and Luty (1989), Weber
using specific primers targeting and May (1989)
microsatellite region
5. MITE AFLP In AFLP, MITEs are targeted during Park et al. (2003)
PCR amplification
6. PCR isolation of microsatellite RAPD products are cloned in a T/A Lunt et al. (1999)
arrays (PIMA) vector, and microsatellite positive
clones are screened by colony PCR,
with one microsatellite sequence
primer, and another a vector-specific
primer
(continued)
154
Table 9.3 (continued)
SN Marker technology
7. Random amplified hybridization
microsatellites
(RAHM) (Synonym: random
amplified microsatellite
polymorphism (RAMPO), and
randomly amplified microsatellites
(RAMS)
8. Random amplified microsatellite
polymorphism
(RAMP) and its variants-
denatured RAMP (dRAMP),
Long RAMP, Double
Stringency PCR (DS-PCR) and
Reverse RAMP (rRAMP)
9. Random Scans at Microsatellite
Regions (RaSMiR)
10. Rep-PCR (syn.: Tn PCR),
Inter-retrotransposon amplified
polymorphism (IRAP),
Retroposon-microsatellite
amplification polymorphism
(REMAP), Inter-MITE
polymorphism (IMP)
11. Selective amplification of
microsatellite polymorphic loci
(SAMPL) and
Microsatellite AFLP (M-AFLP)
12. Selectively amplified
microsatellite analysis (SAM)
13. Sequence-specific amplified
polymorphism (S-SAP)
14. Transposon display and Hbr
display
has been under-exploited. When we develop
markers, the ability to discriminate two (or more
alleles) is important, in addition to the availability
of an economic and reproducible assay. In recent
years, high-throughput direct DNA sequencing
A. Grover and P. C. Sharma
Methodology/characteristic Reference
PCR amplification using a single Cifarelli et al. (1995),
arbitrary decamer or a microsatellite Richardson et al. (1995),
oligomer Ender et al. (1996)
PCR amplification using 5’- Wu et al. (1994), Becker and
anchored random microsatellite Heun (1995), Matioli and de
repeat and another random decamer. Brito (1995), Min et al.
Amplicons are visualized on a (2008)
denaturing PAGE
PCR amplifications using one Grover et al. (2012)
specific and another microsatellite
primer
DNA primers corresponding to Versalovic et al. (1994),
interspersed repetitive elements in a Kalendar et al. (1999),
PCR reaction. Chang et al. (2001)
Variant of AFLP, with second Morgante and Vogel (1999)
amplification step having one of the
primers being a compound
microsatellite. In M-AFLP the
microsatellite primer is 5’-anchored.
Involved sequencing of AFLP bands Hayden and Sharp (2001)
for designing primers, which are
used in combination with 5’-
anchored microsatellite primers
Variant of AFLP with one of the Waugh et al. (1997)
primers specific to transposon or
retrotransposon
Transposons targeted PCR van den Broeck et al.
amplification in an AFLP analysis. (1998), Casa et al. (2000)
In Hbr display, Hbr family is
targeted
has offered these advantages in addition to speed
and automation. As the whole genome sequence
of potato is now available, different marker vari-
ants based on repetitive sequences in potato are
not likely to be developed any further.
9 Repetitive Sequences in the Potato and Related Genomes 155

Table 9.4 Application of molecular markers in potato

Marker technology
Inter-Simple Sequence Repeat (ISSR)
Microsatellites
Rep-PCR (syn.: Tn PCR),
Inter-retrotransposon amplified
polymorphism (IRAP),
Retroposon-microsatellite
amplification polymorphism
(REMAP), Inter-MITE polymorphism
(IMP)
Application in potato
DNA fingerprinting and
genetic diversity
estimation of different
accessions
Estimation of genetic
diversity among different
taxa
Inter-species
amplifications
Taxonomy and
phylogenetic studies
Evolutionary studies
Molecular mapping
Segregation analysis
Assessment of genetic
diversity in Indian potato
collections
Reference
Prevost and Wilkinson (1999), McGregor
et al. (2000b), Bornet et al. (2002), Gorji
et al. (2011)
Provan et al. (1996), Schneider and
Douches (1997), Milbourne et al. (1998),
Ashkenazi et al. (2001), Feinglod et al.
(2005), Grover et al. (2009), Sharma and
Nandineni (2014)
Ashkenazi et al. (2001), Grover et al.
(2009)
Lara-Carbrera and Spooner (2000), Raker
and Spooner (2002)
Spooner et al. (2005)
Kawchuk et al. (1996), Provan et al.
(1996), Milbourne et al. (1998),
Chani et al. (2002), Grover et al. (2009)
Sharma and Nandineni (2014)

different expression patterns, new functions,

9.7 Conclusion
Repetitive elements are essential components of
the modern eukaryotic genomes. With the
advances in genome studies, their specific roles,
strategic genomic locations and participation in
genome evolution and divergence are being
documented more precisely. Within the Solanum
gene pool, a number of repeat elements occur as
conserved elements indicating their emergence
and participation in genome expression and
evolution. On the other hand, unique repetitive
elements indicate their recent emergence. Inter-
estingly, repetitive elements are distributed like a
maze over entire genomes, and their distribution
patterns can be well utilized to build the evolu-
tionary history of genomes rich in repetitive
elements like that of potato and tomato. Many
repeats associate with genes, thereby giving them
eliminating existing genes, and even giving birth
to new genes. However, an analysis of all func-
tions and genomic locations of repeats require
substantial efforts, which to some extent may be
facilitated in future with the advent of
genome-wide sequencing projects.
References
Abad JP, de Pablos B, Agudo M, Molina I, Giovinazzo G,
Martin Gallardo A, Villasante A (2004) Genomic and
cytological analysis of the Y chromosome of Droso-
phila melanogaster: telomere-derived sequences at
internal regions. Chromosoma 113:295–304
Alfenito MR, Birchler JA (1993) Molecular characteriza-
tion of a maize B chromosome centric sequence.
Genetics 135:589–597
Araujo PG, Casacuberts JM, Costa APP, Hashimoto RY,
Grandbastien MA, Van Sluys MA (2001) Retrolyc1
subfamilies defined by different U3 LTR regulatory
156
regions in the Lycopersicon genus. Mol Genet
Genomics 266:35–41
Arumuganathan K, Earle ED (1991) Nuclear DNA con-
tent of some important plant species. Plant Mol Biol
Rep 9:208–218
Ashkenazi V, Chani E, Lavi U, Levy D, Hillel J,
Veilleux RE (2001) Development of microsatellite
markers in potato and their use in phylogenetic and
fingerprinting analyses. Genome 44:50–62
Baucom RS, Estill JC, Chaparro C, Upshaw N, Jogi A,
Deragon JM, Westerman RP, Sanmiguel PJ, Bennet-
zen JL (2009) Exceptional diversity, non-random
distribution, and rapid evolution of retroelements in
the B73 maize genome. PLoS Genet 5:e1000732
Becker J, Heun M (1995) Mapping of digested and
undigested random amplified microsatellite polymor-
phisms in barley. Genome 38:991–998
Bennetzen JL (2000) Transposable element contributions
to plant gene and genome evolution. Plant Mol Biol
42:251–269
Bennetzen JL, Ma J, Devos KM (2005) Mechanisms of
recent genome size variation in flowering plants. Ann
Bot (Lond.) 95:127–132
Bennetzen JL, Wang H (2014) The contributions of trans-
posable elements to the structure, function and evolution
of plant genomes. Ann Rev Plant Biol 65:505–530
Boeke JD (1997) LINEs and Alus—The poly A connec-
tion. Nat Genet 16:6–7
Bolzan AD (2012) Chromosomal aberrations involving
telomeres and interstitial telomeric sequences. Muta-
genesis 27:1–15
Bornet B, Goraguer F, Joly G, Branchard M (2002)
Genetic diversity in European and Argentinian culti-
vated potatoes (Solanum tuberosum subsp. tuberso-
sum) detected by inter-simple sequence repeats
(ISSRs). Genome 45:481–484
Bureau TE, Wessler SR (1992) Tourist: a large family of
small inverted repeat elements frequently associated
with maize genes. Plant Cell 4:1283–1294
Bureau TE, Wessler SR (1994) Stowaway: A new family
of inverted repeat elements associated with the genes
of both monocotyledonous and dicotyledonous plants.
Plant Cell 6:907–916
Casa AM, Brouwer C, Nagel A, Wang L, Zhang Q,
Kresovich S, Wessler SR (2000) The MITE family
Heartbreaker (Hbr): molecular markers in maize. Proc
Natl Acad Sci 97:10083–10089
Chang RY, O’Donoughue LS, Bureau TE (2001)
Inter-MITE polymorphisms (IMP): a high throughput
transposon-based genome mapping and fingerprinting
approach. Theor Appl Genet 102:773–781
Chani E, Ashkenazi V, Hillel J, Veilleux RE (2002)
Microsatellite marker analysis of an anther-derived
potato family: skewed segregation and gene cen-
tromere mapping. Genome 45:236–242
Charlesworth B, Sniegowski P, Stephan W (1994) The
evolutionary dynamics of repetitive DNA in eukary-
otes. Nature 371:215–220
A. Grover and P. C. Sharma
Cheng ZJ, Murata M (2003) A centromeric tandem repeat
family originating from a part of Ty3/gypsy-retroele-
ment in wheat and its realtives. Genetics 164:665–672
Cifarelli RA, Gallitelli M, Cellini F (1995) Random
amplified hybridization microsatellites (RAHM): iso-
lation of a new class of microsatellite-containing DNA
clones. Nucleic Acids Res 23:3802–3803
Costa APP, Scortecci K, Hashimoto RY, Araujo PG,
Grandbastien MA, van Sluys MA (1999) Retrolyc-1, a
member of the Tnt1 retrotransposon super-family in the
Lycopersicon peruvianum genome. Genetica 197:65–72
Dewannieux M, Esnault C, Heidmann T (2003)
LINE-mediated retrotransposition of marked Alu
sequences. Nat Genet 35:41–48
Dong F, Song J, Naess SK, Helgeson JP, Gebhardt C,
Jiang J (2000) Development and applications of a set
of chromosome-specific cytogenetic DNA markers in
potato. Theor Appl Genet 101:1001–1007
Edwards D, Coghill J, Batley J, Holdsworth M,
Edwards KJ (2002) Amplification and detection of
transposon insertion flanking sequences using fluores-
cent MuAFLP. Biotechniques 32:1090–1097
Ender A, Schwenk K, Stadler T, Streit B, Schierwater B
(1996) RAPD identification of microsatellites in
Daphnia. Mol Ecol 5:437–441
Feingold S, Lloyd J, Norero N, Bonierbale M, Lorenzen J
(2005) Mapping and characterization of new
EST-derived microsatellites for potato (Solanum
tuberosum L.). Theor Appl Genet 111:456–466
Frello S, Orgaard M, Jacobsen N, Heslop-Harrison JS (2004)
The genomic organization adn evolutionary distribution
of a tandemly repeated DNA sequence family in the
genus Crocus (Iridiaceae). Hereditas 141:81–88
Frey M, Stettner C, Gierl A (1998) A general method for
gene isolation in tagging approaches: amplification of
insertion mutagenised sites (AIMS). Plant J 13:717–721
Ganal MW, Lapitan NLV, Tanksley SD (1988) A
molecular and cytogenetic survey of major repeated
DNA sequences in tomato (Lycopersicon esculentum).
Mol Gen Genet 213:262–268
Gebhardt C, Eberle B, Leonards-Schippers C, Walke-
meier B, Salamini F (1995) Isolation, characterization
and RFLP linkage mapping of a DNA repeat family of
Solanum spegazzinii by which chromosome ends can
be localized on the genetic map of potato. Genet Res
65:1–10
Ghislain M, Spooner DM, Rodriguez F, Villamon F,
Nunez J, Vasquez C, Waugh R, Bonierbale M (2004)
Selection of highly informative and user-friendly
microsatellites (SSRs) for genotyping of cultivated
potato. Theor Appl Genet 108:881–890
Ghislain M, Nunez J, del Rosarion Herrera M, Pignataro J,
Guzman F, Bonierbale M, Spooner DM (2009) Robust
and highly informative microsatellite-based genetic
identity kit for potato. Mol Breed 23:377–388
Gong Z, Wu Y, Koblízková A, Torres GA, Wang K,
Iovene M, Neumann P, Zhang W, Novak P, Buell CR,
Macas J, Jiang J (2012) Repeatless and repeat-based
9 Repetitive Sequences in the Potato and Related Genomes
centromeres in potato: implications for centromere
evolution. Plant Cell 24:3559–3574
Gorji AM, Poczai P, Polgar Z, Taller J (2011) Efficiency
of Arbitrarily Amplified Dominant Markers (SCOT,
ISSR and RAPD) for Diagnostic Fingerprinting in
Tetraploid Potato. Am J Potato Res 88:226–237
Grandbastien MA, Spielmann A, Caboche M (1989) Tnt1,
a mobile retroviral-like transposable element of tobacco
isolated by plant cell genetics. Nature 337:376–380
Grandbastien MA, Audeon C, Bonnivard E, Casacu-
berta JM, Chalhoub B, Costa APP, Le QH,
Melayah D, Petit M, Poncet C, Tam SM, van
Sluys MA, Mhiri C (2005) Stress activation and
genomic impact of Tnt1 retrotransposons in Solana-
ceae. Cytogenet Genome Res 110:229–241
Grover A, Sharma PC (2011) Is spatial occurrence of
microsatellites in the genome a determinant of their
function and dynamics contributing to genome evolu-
tion? Curr Sci 100:859–869
Grover A, Sharma PC (2012) Tandem repetitions in
transcriptomes of some Solanaceae species. Am J Mol
Biol 2:140–152
Grover A, Aishwarya V, Sharma PC (2007) Biased
distribution of microsatellite motifs in the rice
genome. Mol Genet Genomics 277:469–480
Grover A, Ramesh B, Sharma PC (2009) Development of
microsatellite markers in potato and their transferabil-
ity in some members of Solanaceae. Physiol Mol Biol
Plants 15:343–358
Grover A, Gupta SM, Pandey P, Singh S, Ahmed Z (2012)
Random genomic scans at microsatellite loci for genetic
diversity estimation in cold adapted Lepidium lati-
folium. Plant Genet Resour-Characterization Utilization
10:224–231
Hayden MJ, Sharp PJ (2001) Sequence-tagged microsatel-
lite profiling (STMP): a rapid technique for developing
SSR markers. Nucleic Acids Res 29:e43
He L, Liu J, Torres GA, Zhang H, Jiang J, Xie C (2013)
Interstitial telomeric repeats are enriched in the
centromeres of chromosomes in Solanum species.
Chromosome Res 21:5–13
Huang KC, Yang HC, Li KT, Liu LY, Charng YC (2012)
Ds transposon is biased towards providing splice
donor sites for exonization in transgenic tobacco. Plant
Mol Biol 79:509–519
Jacobs JME, van Eck HJ, Arens P, Verkerk-Bakker B, te
Lintel Hekkert B, Bastiaanssen HJM, El-Kharbotly A,
Pereira A, Jacobsen E, Stiekema WJ (1995) A genetic
map of potato (Solanum tuberosum) integrating
molecular markers, including transposons, and classi-
cal markers. Theor Appl Genet 91:289–300
Jin WW, Lamb JC, Vega JM, Dawe RK, Birchler JA,
Jiang JM (2005) Molecular and functional dissection
of the maize B centromere. Plant Cell 17:1412–1423
Jiang J, Birchler JB, Parrott WA, Dawe RK (2003) A
molecular view of plant centromeres. Trends Plant Sci
8:570–575
Jiang N, Gao D, Xiao H, van der Knaap E (2009) Genome
organization of the tomato sun locus and characterization
of the unusual retrotransposon Rider. Plant J 60:181–193
157
Kajikawa M, Okada N (2002) LINEs mobilize SINEs in the
eel through a shared 39 sequence. Cell 111:433–444
Kalendar R, Grob T, Regina M, Suoniemi A, Schulman A
(1999) IRAP and REMAP: two new retrotransposon-
based DNA fingerprinting techniques. Theor Appl
Genet 98:704–711
Kawchuk LM, Lynch DM, Thomas J, Penner B, Sillito D,
Kulcsar F (1996) Characterization of Solanum tubero-
sum simple sequence repeats and application to potato
cultiwar identification. Am Potato J 73:325–335
Kriedt RA, Cruz GMQ, Bonatto SL, Freitas LB (2014)
Novel transposable elements in solanaceae: evolution-
ary relationships among Tnt1-related sequences in
wild petunia species. Plant Mol Biol 32:142
Komarova NY, Grabe T, Huigen DJ, Hemleben V,
Volkov RA (2004) Organization, differential expres-
sion and methylation of rDNA in artificial Solanum
allopolyploids. Plant Mol Biol 56:439–463
Korandova M, Krucek T, Vrbova K, Frydrychova RC
(2014) Distribution of TTAGG-specific telomerase
activity in insects. Chromosome Res 22:495–503
Kumar A, Bennetzen JL (1999) Plant Retrotransposons.
Annu Rev Genet 33:479–532
Langdon T, Seago C, Jones RN, Ougham H, Thomas H,
Foster JW, Jenkins G (2000) De novo evolution of
satellite DNA on the rye B chromosome. Genetics
154:869–884
Lapitan NLV (1992) Organization and evolution of higher
plant nuclear genomes. Genome 35:171–181
Lara-Carbrera SI, Spooner DM (2000) Taxonomy of
Mexican diploid potato (Solanum sect Petota) species:
Morphological and microsatellite data. United States
Department of Agriculture, Agriculture Research
Service
Lin KW, Yan J (2008) Endings in the middle: current
knowledge of interstitial telomeric sequences. Mutat
Res 658:95–110
Lisch D (2013) How important are transposons for plant
evolution? Nat Rev Genet 14:49–61
Litt M, Luty JA (1989) A hypervariable microsatellite
revealed by in vitro amplification of a dinucleotide
repeat within the cardiac muscle actin gene. Am J
Hum Genet 44:397–401
Lockton S, Gaut BS (2009) The contribution of transpos-
able elements to expressed coding sequence in Ara-
bidopsis thaliana. J Mol Evol 68:80–89
Lunt DH, Hutchinson WF, Carvalho GR (1999) An
efficient method for PCR-based isolation of
microsatellite arrays (PIMA). Mol Ecol 8:891–893
Macas J, Meszaros T, Nouzova M (2002) PlantSat: A
specialized database for plant satellite repeats. Bioin-
formatics 18:28–35
Makalowski W (2000) Genomic scrap yard: how
genomes utilize all that junk. Gene 259:61–67
Malkamaki U, Clark MS, Rita H, Valkonen JPT, Pehu E
(1996) Analyses of solanaceous species using repet-
itive genomic DNA sequences isolated from Solanum
brevidens. Plant Sci 117:121–129
Manetti ME, Rossi M, Costa APP, Clausen AM,
Sluys MAV (2007) Radiation of the TntI
158
retrotransposons superfamily in three Solanaceae
genera. BMC Evol Biol 7:34
Matioli SR, de Brito RA (1995) Obtaining genetic
markers by using double stringency PCR with
microsatellites and arbitrary primers. Biotechniques
19:752–756
McGregor CE, Greyling M, Warnich L (2000a) The use
of simple sequence repeats (SSRs) to identify com-
mercially important potato (Solanum tuberosum L.)
cultivars in South Africa. S Afr J Plant Biol 17:177–
180
McGregor CE, Lambert CA, Greyling M, Louw JH,
Warnich L (2000b) A comparative assessment of
DNA fingerprinting techniques (RAPD, ISSR, AFLP
and SSR) in potato (Solanum tuberosum L.) germ-
plasm. Euphytica 113:135–144
Mehra M, Gangwar I, Shankar R (2015) A deluge of
complex repeats: The Solanum Genome. PLoS ONE
10(8):e0133962
Melters DP, Bradnam KR, Young HA, Telis N, May MR,
Ruby JG, Sebra R, Peluso P, Eid J, Rank D, Garcia JF,
DeRisi JL, Smith T, Tobias C, Ross-Ibarra J, Korf I,
Chan SWL (2013) Comparative analysis of tandem
repeats from hundreds of species reveals unique
insights into centromere evolution. Genome Biol 14:
R10
Mendez-Lago M, Wild J, Whitehead SL, Tracey A, de
Pablos B, Rogers J, Szybalski W, Villasante A (2009)
Novel sequencing strategy for repetitive DNA in a
Drosophila BAC clone reveals that the centromeric
region of the Y chromosome evolved from a telomere.
Nucleic Acids Res 37:2264–2273
Meyer W, Mitchell TG, Freedman EZ, Vilgalys R (1993)
Hybridization probes for conventional DNA finger-
printing used as single primers in the polymerase
chain reaction to distinguish strains of Cryptococcus
neoformans. J Clin Microbiol 31:2274–2280
Milbourne D, Meyer R, Bradshaw JE, Baird E, Bonar N,
Provan J, Powell W, Waugh R (1997) Comparison of
PCR based marker systems for the analysis of genetic
relationships in cultivated potato. Mol Breed 3:127–
136
Milbourne D, Meyer RC, Collins AJ, Ramsay LD,
Gebhardt C, Waugh R (1998) Isolation, characteriza-
tion and mapping of simple sequence repeat loci in
potato. Mol Gen Genet 259:233–245
Min WK, Han JH, Kang WH, Lee HR, Kim BD (2008)
Reverse random amplified microsatellite polymor-
phism reveals enhanced polymorphisms in the 3′ end
of simple sequence repeats in the pepper genome. Mol
Cells 26:250–257
Momose M, Abe Y, Ozeki Y (2010) Miniature
inverted-repeat transposable elements of stowaway
are active in potato. Genetics 186:59–66
Moniz de Sa M, Drouin G (1996) Phylogeny and
substitution rates of angiosperm actin genes. Mol Biol
Evol 13:1198–1212
Morgante M, Vogel JM (1999) Compound microsatellite
primers for the detection of genetic polymorphisms.
U.S. Patent No. 5:955, 276
A. Grover and P. C. Sharma
Muotri AR, Marchetto MC, Coufal NG, Gage FH (2007)
The necessary junk: new functions for transposable
elements. Hum Mol Genet 2:R159–R167
Nagaki K, Talbert PB, Zhong CX, Dawe RK, Henikoff S,
Jiang J (2003) Chromatin immunoprecipitation reveals
that the 180-bp satellite repeat is the key functional
DNA element of Arabidopsis thaliana centromeres.
Genetics 163(3):1221–1225
Nagaki K, Shibata F, Suzuki G, Kanatani A, Ozaki S,
Hironaka A, Kashihara K, Murata M (2011) Coexis-
tence of NtCENH3 and two retrotransposons in
tobacco centromeres. Chromosome Res 19(5):591–605
Nystedt B, Street NR, Wetterbom A, Zuccolo A, Lin YC,
Scofield DG, Vezzi F, Delhomme N, Giacomello S
et al (2013) The Norway spruce genome sequence and
conifer genome evolution. Nature 497:579–584
Oosumi T, Garlick B, Belknap WR (1995) Identification
and characterization of putative transposable DNA
elements in solanaceous plants and Caenorhabditis
elegans. Proc Natl Acad Sci USA 92:8886–8890
Osborne BI, Corr CA, Prince JP, Hehl R, Tanksley SD,
McCormick S, Baker B (1991) Ac transposition from
a TDNA can generate linked and unlinked clusters of
insertions in the tomato genome. Genetics 129:833–
844
Park KC, Kim NH, Cho YS, Kang KH, Lee JK, Kim NS
(2003) Genetic variations of AA genome Oryza
species measured by MITE-AFLP. Theor Appl Genet
197:203–209
Pasero P, Sjakste N, Blettry C, Got C, Marilley M (1993)
Long-range organization and sequence directed cur-
vature of Xenopus laevis satellite 1 DNA. Nucleic
Acids Res 21:4703–4710
Paz RC, Rendina Gonzalez AP, Ferrer MS, Masuelli RW
(2015) Short-term hybridization activates Tnt1 and
Tto1 copia retrotransposons in wild tuber bearing
Solanum species. Plant Biol (Stuttg) 17:860–869
Pehu E, Thomas M, Poutala T, Karp A, Jones MGK
(1990) Species-specific sequences in the genus
Solanum: identification, characterization, and applica-
tion to study somatic hybrids of S. brevidens and S.
tuberosum. Theor Appl Genet 80:693–698
Peters SA, Bargesten JW, Szinay D, van de Belt J,
Visser RGF, Bai Y, de Jong H (2012) Structural
homology in the Solanaceae: analysis of genomic
regions in support of synteny studies in tomato, potato
and pepper. Plant J 71:602–614
Pozueta-Romero J, Houlne G, Schantz R (1998) Identi-
fication of a short interspersed repetitive element in
partially spliced transcripts of the bell pepper (Cap-
sicum annuum) PAP gene: New evolutionary and
regulatory aspects on plant tRNA-related SINEs. Gene
214:51–58
Preiszner J, Takacs I, Bilgin M, Gyorgyey J, Dudits D,
Feher A (1994) Organization of a Solatium brevidens
repetitive sequence related to the TGRI subtelomeric
repeats of Lycopersicon esculentum. Theor Appl
Genet 89:1–8
Presting GG, Frary A, Pillen K, Tanksley SD (1996)
Telomere homologous sequences occur near the
9 Repetitive Sequences in the Potato and Related Genomes
centromeres of many tomato chromosomes. Mol Gen
Genet 251:526–531
Prevost A, Wilkinson MJ (1999) A new system of
comparing PCR primers applied to ISSR fingerprint-
ing of potato cultivars. Theor Appl Genet 98:107–112
Provan J, Powell W, Waugh R (1996) Microsatellite
analysis of relationships within cultivated potato
(Solanum tuberosum). Theor Appl Genet 92:1078–1084
Raker CM, Spooner DM (2002) Chilean Tetraploid
Cultivated Potato, Solanum tuberosum, is Distinct
from the Andean Populations: Microsatellite Data.
Crop Sci 42:1451–1458
Richardson T, Cato S, Ramser J, Kahl G, Weising K
(1995) Hybridization of microsatellites to RAPD: a
new source of polymorphic markers. Nucleic Acids
Res 23:3798–3799
Rokka VM, Clark MS, Knudson DL, Pehu E, Lapitan NLV
(1998) Cytological and molecular characterization of
repetitive DNA sequences of Solanum brevidens and
Solanum tuberosum. Genome 41:487–494
Roorkiwal M, Grover A, Sharma PC (2009) Genome-wide
analysis of conservation and divergence of microsatel-
lites in rice. Mol Genet Genomics 282:205–215
Rossi M, Araujo PG, de Jesus EM, Varani AM, Van
Sluys MA (2004) Comparative analysis of
Mutator-like transposases in sugarcane. Mol Genet
Genomics 272:194–203
Rossi MS, Pesce CG, Reig OA, Kornblihtt AR, Zorzop-
ulos J (1993) Retroviral-like features in the monomer
of the major satellite DNA from the South American
rodents of the genus Ctenomys. DNA Seq 3:379–381
Salser W, Bowen S, Browne D, El Adli N, Fedoroff N,
Fry K, Heindell H, Paddock G, Poon R, Wallace B,
Whitcome P (1976) Investigation of the organization
of mammalian chromosomes at the DNA sequence
level. Fed Proc 35:23–35
Sampath P, Murukarthick J, Izzah NK, Lee J, Choi HI,
Shirasawa K, Choi BS, Liu S, Nou IS, Yang TJ (2014)
Genome-wide comparative analysis of 20 miniature
inverted-repeat transposable element families in Bras-
sica rapa and B. oleracea. PLoS ONE 9:e94499
San Miguel P, Bennetzen JL (1998) Evidence that a recent
increase in maize genome size was caused by the
massive amplification of intergene retrotransposons.
Annals Bot 82:37–44
Schmidt T, Heslop-Harrison JS (1993) Variability and
evolution of highly repeated DNA sequences in the
genus Beta. Genome 36:1074–1079
Schneider K, Douches DS (1997) Assessment of PCR
based simple sequence repeats to fingerprint North
American potato cultivars. Am Potato J 74:149–160
Schweizer G, Borisjuk N, Borisjuk L, Stafler M,
Stelzer T, Schilde L, Hemleben V (1993) Molecular
analysis of highly repeated genome fractions in
Solanum and their use as markers for the character-
ization of species and cultivars. Theor Appl Genet
85:801–808
Sharma PC, Grover A, Kahl G (2007) Mining microsatel-
lites in eukaryotic genomes. Trends Biotechnol
25:490–498
159
Sharma V, Nandineni MR (2014) Assessment of genetic
diversity among Indian potato (Solanum tuberosum
L.) collection using microsatellite and retrotransposon
based marker systems. Mol Phylogenet Evol 73:10–17
Sherman JD, Stack SM (1995) Two-dimensional spreads of
synaptonemal complexes from Solanaceous plants. VI.
High-resolution recombination nodule map for tomato
(Lycopersicon esculentum). Genetics 141:683–708
Singer MF (1982) Highly repeated sequences in mam-
malian genomes. Int Rev Cytol 76:67–112
Smith GP (1976) Evolution of repeated DNA sequences
by unequal crossover. Science 191:528–535
Sorek R (2007) The birth of new exons: Mechanisms and
evolutionary consequences. RNA 13:1603–1608
Spooner DM, Nunez J, Rodriguez F, Naik PS, Ghislain M
(2005) Nuclear and chloroplast DNA reassessment of
the origin of Indian potato varieties and its implica-
tions for the origin of the early European potato.
Theoret Appl Genet 110:1020–1026
Spooner DM, Nunez J, Trujillo G, Herrera MR, Guz-
man F, Ghislain M (2007) Extensive simple sequence
repeat genotyping of potato landraces supports a major
re-evaluation of their gene pool structure and classi-
fication. Proc Natl Acad Sci USA 104:19398–19403
Stadler M, Stelzer T, Borisjuk N, Zanke C,
Schilde-Rentschler L, Hemleben V (1995) Distribu-
tion of novel and known repeated elements of
Solanum and application for the identification of
somatic hybrids among Solanum species. Theor Appl
Genet 91:1271–1278
Staton SE, Bakken BH, Blackman BK, Chapman MA,
Kane NC, Tang S, Ungerer MC, Knapp SJ, Riese-
berg LH, Burke JM (2012) The sunflower (Helianthus
annuus L.) genome reflects a recent history of biased
accumulation of transposable elements. Plant J 72
(1):142–153
Stupar RM, Song J, Tek AL, Cheng Z, Dong F, Jiang J
(2002) Highly condensed potato pericentromeric
heterochromatin contains rDNA-related tandem
repeats. Genetics 162:1435–1444
Tang J, Baldwin SJ, Jacobs JME, van der Linden CG,
Voorrips RE, Leunissen JAM, van Eck H, Vosman B
(2008) Large-scale identification of polymorphic
microsatellites using an in silico approach. BMC
Bioinformatics 9:374
Tang X, Datema E, Guzman MO, de Boer JM, van
Eck HJ, Bachem CW, Visser RG, de Jong H (2014)
Chromosomal organizations of major repeat families
on potato (Solanum tuberosum) and further exploring
in its sequenced genome. Mol Genet Genomics
289:1307–1319
Tanksley SD, Ganal MW, Prince JP, de Vicente MC,
Bonierbale MW, Broun P, Fulton TM, Giovannoni JJ,
Grandillo S, Martin GB, Messeguer R, Miller JC,
Miller L, Paterson AH, Pineda O, Roder MS,
Wing RA, Wu W, Young ND (1992) High density
molecular linkage maps of the tomato and potato
genomes. Genetics 132:1141–1160
Tek AL, Jiang J (2004) The centromeric regions of potato
chromosomes contain megabase-sized tandem arrays
160
of telomere-similar sequence. Chromosoma
113:77–83
Tek AL, Song J, Macas J, Jiang J (2005) Sobo, a recently
amplified satellite repeat of potato, and its implications
for the origin of tandemly repeated sequences. Genet-
ics 170:1231–1238
Temnykh S, DeClerk G, Lukashova A, Lipovich L,
Cartinhour S, McCouch S (2001) Computational and
experimental analysis of microsatellites in rice (Oryza
sativa L.): frequency, length variation, transposon
associations and genetic marker potential. Genome
Res 11:1441–1452
The Potato Genome Sequencing Consortium (2011)
Genome sequence and analysis of the tuber crop
potato. Nature 475:189–197
The Tomato Genome Consortium (2012) The tomato
genome sequence provides insights into fleshy fruit
evolution. Nature 485:635–641
Torres GA, Gong Z, Iovene M, Hirsch CD, Buell CR,
Bryan GJ, Novak P, Macas J, Jiang J (2011)
Organization and evolution of subtelomeric satellite
repeats in the potato genome. G3 (Bethesda) 1:85–92
Treangen TJ, Salzberg SL (2012) Repetitive DNA and
next-generation sequencing: computational challenges
and solutions. Nat Rev Genet 13:36–46
van de Lagemaat LN, Landry JR, Mager DL, Medstrand P
(2003) Transposable elements in mammals promote
regulatory variation and diversification of genes with
specialized functions. Trends Genet 19:530–536
van den Broeck D, Maes T, Sauer M, Zethof J, De
Keukeleire P, D’hauw M, Van Monatgu M, Grates T
(1998) Transposon display identifies individual trans-
posable elements in high copy number lines. Plant J
13:121–129
Van Os H, Andrzejeweski S, Bakker E, Barrena I,
Bryan GJ, Caromel B, Ghareeb B et al (2006)
Construction of a 10,000-marker ultradense genetic
recombination map of potato: providing a framework
for accelerated gene isolation and a genomewide
physical map. Genetics 173:1075–1087
Veilleux RE, Shen LY, Paz MM (1995) Analysis of the
genetic composition of anther-derived potato by
randomly amplified polymorphic DNA and simple
sequence repeats. Genome 38:1153–1162
Versalovic J, Schneider M, de Bruijn FJ, Lupski JR
(1994) Genomic fingerprinting of bacteria using
repetitive sequence based PCR (rep-PCR). Methods
Mol Cell Biol 5:25–40
Visser RG, Bachem CW, de Boer JM, Bryan GJ,
Chakrabati SK, Feingold S, Gromadka R, van
Ham RC, Huang S, Jacobs JM, Kuznetsov B (2009)
Sequencing the potato genome: outline and first results
to come from the elucidation of the sequence of the
world’s third most important food crop. Am J Potato
Res 86:417
Volpe TA, Kidner C, Hall IM, Teng G, Grewal SIS,
Martienssen RA (2002) Regulation of heterochromatic
silencing and histone H3 lysine-9 methylation by
RNAi. Science 297:1833–1837
A. Grover and P. C. Sharma
Walsh JB (1987) Persistence of tandem arrays: implica-
tions for satellite and simple-sequence DNAs. Genet-
ics 115:553–567
Waugh R, McLean K, Flavell AJ, Pearce, SR, Kumar A,
Thomas BB, Powell W (1997) Genetic distribution of
Bare-1-like retrotransposable elements in the barley
genome revealed by sequence-specific amplification
polymorphisms (S-SAP). Mol Gen Genet 253:687–
694
Weber JL, May PE (1989) Abundant class of human DNA
polymorphisms which can be typed using the poly-
merase chain reaction. Am J Hum Genet 44:388–396
Weiner AM, Deininger PL, Efstratiadis A (1986) Nonvi-
ral retroposons: genes, pseudogenes, and transposable
elements generated by the reverse flow of genetic
information. Annu Rev Biochem 55:631–661
Wenke T, Dobel T, Sorensen TR, Junghans H, Weis-
shaar B, Schmidt T (2011) Targeted identification of
short interspersed nuclear element families shows their
widespread existence and estreme heterogeneity in
plant genomes. Plant Cell 23:3117–3128
Wicker T, Sabot F, Hua-Van A, Bennetzen JL, Capy P,
Chalhoub B, Flavell A, Leroy P, Morgante M,
Panaud O, Paux E, SanMiguel P, Schulman AH
(2007) A unified classification system for eukaryotic
transposable elements. Nat Rev Genet 8:973–982
Wu KS, Jones R, Danneberger L, Scolnik PA (1994)
Detection of microsatellite polymorphisms without
cloning. Nucleic Acids Res 22:3257–3258
Wu F, Tanksley SD (2010) Chromosomal evolution in the
plant family Solanaceae. BMC Genom 11:182
Yasui Y, Nasuda S, Matsuoka Y, Kawahara T (2001) The Au
family, a novel short interspersed element (SINE) from
Aegilops umbellulata. Theor Appl Genet 102:463–470
Yoshioka Y, Matsumoto S, Kojima S, Ohshima K,
Okada N, Machida Y (1993) Molecular characteriza-
tion of a short interspersed repetitive element from
tobacco that exhibits sequence homology to specific
tRNAs. Proc Natl Acad Sci USA 90:6562–6566
Zhang H, Koblížková A, Wang K, Gong Z, Oliveira L,
Torres GA, Wu Y, Zhang W, Novák P, Buell CR,
Macas J, Jiang J (2014) Boom-bust turnovers of
megabase-sized centromeric DNA in Solanum species:
Rapid evolution of DNA sequences associated with
centromeres. Plant Cell 26:1436–1447
Zhong CX, Marshall JB, Topp C, Mroczek R, Kato A,
Nagaki K, Birchler JA, Jiang J, Dawe RK (2002)
Centromeric retroelements and satellites interact with
maize kinetochore protein CENH3. Plant Cell
14:2825–2836
Zhou Z, Bebeli PJ, Somers DJ, Gustafson JP (1997)
Direct amplification of minisatellite-region DNA with
VNTR core sequences in the genus Oryza. Theor Appl
Genet 95:942–949
Zhu W, Ouyang S, Iovene M, O’Brien K, Vuong H,
Jiang J, Buell CR (2008) Analysis of 90 Mb of the
potato genome reveals conservation of gene structures
and order with tomato but divergence in repetitive
sequence composition. BMC Genom 9:286
 New Strategies Towards Durable
Late Blight Resistance in Potato 10
Juan Du and Vivianne G. A. A. Vleeshouwers

Abstract
Late blight caused by the oomycete pathogen Phytophthora infestans is
the most devastating disease of potato. So far, potato resistance breeding
has mainly relied on resistance (R) genes that encode an intracellular
nucleotide-binding site, Leucine-rich repeat (NLR) receptors. More than
20 NLR genes have been cloned to date, however, they have become
ineffective rather quickly. Recent studies have shown that resistance to late
blight in wild Solanum species is not only dependent on this type of
R gene. Additional types of plant genes, such as pattern recognition
immune receptors (PRR) and defense-responsive genes can also contribute
to resistance potentially in a more durable way. Thus, it is wise to source
those additional types of genes as well and not rely only on NLR genes.
The release of potato genome sequences and the development of
technologies, such as resistance gene enrichment sequencing (RenSeq)
and effectoromics, are speeding up the identification and cloning of such
potato genes. The potential for potato breeding with more durable
resistance to late blight, by employing multiple molecular strategies is
discussed.

J. Du (&)
Key Laboratory of Horticultural Plant Biology
(HZAU), Ministry of Education,
Wuhan 430070, China
e-mail: juandu@mail.hzau.edu.cn
J. Du
College of Life Science and Technology, Huazhong
Agricultural University, Wuhan 430070, China
V. G. A. A. Vleeshouwers
Wageningen UR Plant Breeding, Wageningen
University and Research Centre, Wageningen
6708 PB, The Netherlands
10.1 Introduction
Potato is the fourth most important food crop in
the world, after wheat, maize and rice, however,
it suffers from various diseases. Late blight,
caused by the oomycete pathogen Phytophthora
infestans, is the most devastating disease for
potato. To control this disease in an
environmental-friendly way, potato breeders
have been breeding resistant cultivars since the
1950s (Black et al. 1953; Mastenbroek 1953).

© Springer International Publishing AG 2017 161

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_10
162
The introgressed resistance genes all belong to
the class of the intracellular NLR receptors,
which are normally labelled as R genes. How-
ever, by now, most Leucine-rich repeat
(NLR) genes have been defeated due to the fast
evolution of the matching avirulence genes of
P. infestans. Practice proves that NLR genes
alone are not likely to provide durable resistance
to P. infestans and multiple strategies are
urgently required for exploitation.
10.2 Exploit Cytoplasmic NLR
Genes for Resistance Breeding
Intracellular immunity based on NLR genes has
been extensively explored in potato resistance
breeding. Till now, more than 20 NLR genes that
belong to 12 families have been cloned from
tuber-bearing Solanum section Petota
(Table 10.1). For example, R1, R2, R3a, R3b, R8
and R9a have been cloned from S. demissum
(Ballvora et al. 2002; Huang et al. 2005; Jo 2013;
Li et al. 2011; Lokossou et al. 2009; Vossen et al.
2016). In addition, nine R2 orthologs have been
cloned from other wild potatoes, including R2-
like, Rpi-blb3, Rpi-abpt, Rpi-snk1.1, Rpi-snk1.2,
Rpi-edn1.1, Rpi-hjt1.1, Rpi-hjt1.2 and Rpi-hjt1.3
(Champouret 2010; Lokossou et al. 2009).
Moreover, novel resistance to P. infestans (Rpi)
genes have also been cloned, including Rpi-am-
r3i from S. americanum (Witek et al. 2016); Rpi-
blb1/RB (Song et al. 2003; van der Vossen et al.
2003) and Rpi-blb2 (van der Vossen et al. 2005)
from S. bulbocastanum; Rpi-chc1 from S. cha-
coense (Vossen et al. 2012); Rpi-mcq1 from S.
mochiquense (Jones et al. 2014); Rpi-sto1, Rpi-
sto2 and Rpi-pta1 from S. stoloniferum
(Vleeshouwers et al. 2008); Rpi-vnt1.1/Rpi-phu1,
Rpi-vnt1.2 and Rpi-vnt1.3 from S. venturii (Fos-
ter et al. 2009; Pel et al. 2009). However, most
cloned NLR genes have been defeated by
fast-evolving P. infestans effectors (Vleeshouw-
ers et al. 2011a). Encouragingly, there are more
wild potato species with resistance to late blight,
and novel types of immune receptors have
remained unexploited (Jupe et al. 2012; Spooner
and Salas 2006; Vleeshouwers et al. 2011b).
J. Du and V. G. A. A. Vleeshouwers
10.3 Exploit Apoplastic PRRs
for Resistance Breeding
To defend against late blight disease, potato
actually involves two steps to sense pathogens,
namely, (1) pattern recognition immune receptors
(PRRs) that occur at the plant cell surface; and
(2) NLR proteins inside the plant cell. So far,
PRR-triggered immunity had not been identified
and not used for potato resistance breeding, most
likely because of its weaker resistance pheno-
type. Recently, it was recognized that apoplastic
immunity triggered by pathogen-associated
molecular patterns (PAMPs) could be more
durable, because PAMPs are essential for a
pathogen’s life cycle and/or pathogenicity by
definition (Jones and Dangl 2006; Segonzac and
Zipfel 2011). Pathogens are expected to less
easily avoid apoplastic immunity by losing
essential PAMPs, and an allelic variation of
PAMPs is expected to be limited by evolutionary
constraints on their structure (Bittel and Robat-
zek 2007; Boller and Felix 2009; McCann et al.
2012).
Among the most well-characterized oomycete
PAMPs are elicitins, which are small, structurally
conserved extracellular proteins in Phytophthora
and Pythium pathogen species (Pfam PF00964)
(Derevnina et al. 2016). We have successfully
cloned the first PRR called ELR (elicitin
response) from a wild potato genotype Solanum
microdontum (MCD) 360–1 that shows a certain
level of field resistance (Du et al. 2015a). We
have also proved that overexpression of ELR in
the potato cultivar can enhance its resistance to
P. infestans (Du et al. 2015a). Although the
resistance level is not as strong as most NLR
genes that have been isolated so far, it will set the
stage for future apoplastic immunity studies in
the potato-P. infestans pathosystem.
Considering the weaker responses in
apoplastic immunity compared to the typical
NLR genes, we hypothesize that the combination
of multiple PRRs may lead to more adequate
levels of resistance than by overexpressing single
surface receptors. Besides elicitins, other
apoplastic effectors with putative PAMP char-
acteristics are e.g. the extracellular protease
10 New Strategies Towards Durable Late Blight Resistance in Potato 163

Table 10.1 Isolated immune receptors against late blight from wild potato
Type R gene (family) Matching Avr /effector gene
Gene Solanum Chr. References Gene References
PRR ELR microdontum XII Du et al. (2015a) INF1 Kamoun et al.
(1997)
NLR R1 demissum V Ballvora et al. Avr1 Du et al.
(2002) (2015b)
R2, Rpi-blb3, Rpi-abpt, demissum, IV Lokossou et al. Avr2 Gilroy et al.
R2-like, Rpi-edn1.1, bulbocastanum, (2009), (2011)
Rpi-snk1.1,Rpi-snk1.2, edinense, Champouret
Rpi-hjt1.1, Rpi-hjt1.2, schenckii, (2010)
Rpi-hjt1.3 hjertingii
R3a, Rpi-sto2 demissum, XI Huang et al. Avr3a Armstrong
stoloniferum (2005), et al. (2005)
Champouret
(2010)
R3b demissum XI Li et al. (2011) Avr3b Li et al. (2011)
R8 demissum IX Vossen et al. Avr8/AvrSarpo2 Rietman et al.
(2016) (2012), Jo
(2013)
R9a demissum IX Jo (2013) Candidates* NA
Rpi-amr3i americanum IV Witek et al. NA NA
(2016)
Rpi-blb1/RB, Rpi-sto1, bulbocastanum, VIII Song et al. (2003), Avrblb1 Vleeshouwers
Rpi-pta1 stoloniferum van der Vossen et al. (2008),
et al. (2003), Oh et al.
Vleeshouwers (2009)
et al. (2008)
Rpi-blb2 bulbocastanum VI van der Vossen Avrblb2 Oh et al.
et al. (2005) (2009)
Rpi-chc1 chacoense X Vossen et al. Candidates* NA
(2012)
Rpi-mcq1 mochiquense IX Jones et al. (2014) Avr2 Gilroy et al.
(2011)
Rpi-vnt1.1/Rpi-phu1, venturii/phureja IX Foster et al. Avrvnt1 Pel (2010)
Rpi-vnt1.2, Rpi-vnt1.3 (2009), Pel et al.
(2009)
NA Not Available, *Specifically recognized effectors were found, but no evidence for avirulence activity

inhibitor (EPI) (Tian et al. 2004), small
cysteine-rich (SCR) proteins (Liu et al. 2005),
cellulose binding elicitor lectin (CBEL) (Gaulin
et al. 2006), Nep1-like protein (PiNPP) (Kan-
neganti et al. 2006), and the cystatin-like pro-
tease inhibitor EPIC of P. infestans (Tian et al.
2007). For example, EPIC2B binds and inhibits
Rcr3, the tomato apoplastic cysteine protease that
functions in fungal resistance (Rooney et al.
2005). Also SCR74, to which highly specific
responses were found in Solanum hougassi (Liu
et al. 2005; Rietman 2011, 2012), may be a good
target for apoplastic immunity. More recently,
the Arabidopsis RLP23 was identified to bind
164
in vivo to a conserved 20-amino-acid fragment
found in most NLPs (nlp20), and interfamily
transfer of RLP23 to potato enhanced resistance
to P. infestans (Albert et al. 2015). In addition,
the P. infestans genome sequence has provided
us with a wide resource of predicted apoplastic
effectors with PAMP characteristics.
10.4 Effectoromics Assists
in Resistance Breeding
The use of pathogen effectors in breeding and
deployment has recently proved a successful
strategy to understand and achieve resistance to
late blight in potato (Ellis et al. 2009; Hein et al.
2009; Vleeshouwers et al. 2008, 2011a). The
effectoromics strategy, i.e. high-throughput
functional screening with effectors on germ-
plasm, has contributed to accelerate and improve
the exploitation of NLR genes in contemporary
potato resistance breeding (Vleeshouwers et al.
2008). Briefly, effectoromics can contribute to
breeding in four aspects, i.e. accelerating R gene
identification, distinguishing functional redun-
dancy, detecting recognition specificity, and
assisting in R gene deployment (Du and
Vleeshouwers 2014; Vleeshouwers et al. 2011a).
Besides, the effectoromics approach also plays
an essential role in identification of PRRs
(Domazakis et al. 2017). Due to the clear
responses to INF elicitins in Solanum germplasm,
a map-based cloning of the ELR receptor was
feasible (Du et al. 2015a). This would never have
been achieved by phenotyping for resistant phe-
notypes to P. infestans isolates in segregating
populations (Vleeshouwers et al. 2006).
The effectoromics approach has already made
an important contribution to potato resistance
breeding and will continue to assist it in the
future. By implementing this approach, more
Rpi-genes and PRRs are expected to be identified
more efficiently than before from wild potato
resources. Then they can be applied in current
potato cultivars by traditional sexual crosses
making new varieties or by modern techniques
J. Du and V. G. A. A. Vleeshouwers
like cis- or transgenesis improving existing
varieties (Haverkort et al. 2016; Jo et al. 2016).
10.5 Exploit Key
Defense-Responsive Genes
for Resistance Breeding
Plant defense is a very complex procedure.
Immune receptors like NLR and PRR genes
mediate the recognition of pathogens. The
defense signals need to be transduced down-
stream to induce successful defense responses.
Defense-responsive genes are those induced
downstream of the recognition event and of
activation which contributes directly to potential
resistance mechanisms. Defense-responsive
genes respond to a pathogen attack by altering
expression or post-translationally by modifying
their encoding proteins (Benschop et al. 2007;
Eulgem 2005). In several pathosystems, the
overexpression of defense-responsive genes has
led to an enhanced resistance level in transgenic
dicots and monocots (Christensen et al. 2004;
Deng et al. 2012; Leckband and Lorz 1998; Ni
et al. 2010a, b; Shi et al. 2012; Wu et al. 2009).
In the downstream signaling pathways medi-
ated by NLR or PRR genes or even both, many
defense-responsive genes are involved (Kou and
Wang 2010; Win et al. 2012). Some genes may
have a redundant function while some other
genes are essential for plant resistance. Proper
manipulation of those key defense-responsive
genes has the potential to achieve durable and
broad-spectrum resistance.
A typical example of the key
defense-responsive genes is the LRR-RLK
Brassinosteroid insensitive1-associated kinase
1/Somatic-embryogenesis receptor-like kinase 3
(BAK1/SERK3) that belongs to a family of five
related SERK proteins (Hecht et al. 2001).
Actually, BAK1 was initially identified as an
interactor and positive regulator of the brassi-
nosteroid (BR) receptor BRI1 (Li et al. 2002;
Nam and Li 2002), unexpectedly, it was later
proved to also function as a master positive
10 New Strategies Towards Durable Late Blight Resistance in Potato
regulator of innate immunity. For instance,
BAK1 is required for responses triggered by the
bacterial PAMPs flg22, elf18, lipopolysaccha-
rides (LPSs), peptidoglycans (PGNs), HrpZ,
csp22 (derived from cold shock protein), the
DAMP AtPep1, and the oomycete PAMP INF1
(Chaparro-Garcia et al. 2011; Chinchilla et al.
2007; Heese et al. 2007; Postel et al. 2010; Shan
et al. 2008). We also show that the INF1 receptor
ELR associates with BAK1 (Du et al. 2015a).
Besides, BAK1 is also important for resistance to
obligate biotrophic fungi Verticillium, oomycete
Hyaloperonospora arabidopsidis (Hpa) and
hemibiotrophic bacterium Pseudomonas syr-
ingae (de Jonge et al. 2012; Fradin et al. 2009,
2011; Roux et al. 2011; Schwessinger et al.
2011). Moreover, BAK1 is recently found to
contribute to resistance against diverse RNA
viruses, namely, the tobamoviruses Tobacco
mosaic virus (TMV) strain U1 and ORMV, and
the tombusvirus Turnip crinkle virus
(TCV) (Korner et al. 2013).
Defense-responsive genes have been studied
in potato in different ways, e.g. suppression
subtractive hybridization (SSH) (Tian et al.
2003), microarray analysis (Wang et al. 2005),
cDNA-AFLP (Li et al. 2009). According to the
above analysis, many defense-responsive genes
to P. infestans have been identified and most of
them are related to metabolism, plant defense,
signaling and transcription regulation, involving
the whole process of plant defense response to
pathogens (Li et al. 2009; Tian et al. 2003;
Wang et al. 2005). Subsequently, 63 of those
identified defense-responsive genes were selec-
ted as candidate genes and screened by a tran-
sient assay for late blight resistance, resulting in
the identification of two genes, i.e. a lipoxyge-
nase and a suberization-associated anionic
peroxidase (Du et al. 2013). More
defense-responsive genes have been identified
as positive regulators for resistance to potato
late blight, e.g. U-box E3 ubiquitin ligase gene
StPUB17 (He et al. 2015), dihydrolipoyl acyl-
transferase gene BCE2 (Wang et al. 2014),
RING finger protein gene StRFP1 (Ni et al.
2010b) and NRC4 (NLR required for cell death
165
4), a helper for Rpi-blb2 function (Wu et al.
2016). Overexpression of the key
defense-responsive genes may raise the resis-
tance level of plants, and provide an additional
tool for breeders to control late blight disease.
10.6 The Elucidation
of the Reference Potato
Genome Accelerates
the Identification
of Resistance Genes
The genome sequence of potato (Xu et al. 2011)
was determined using a homozygous doubled
monoploid (DM1-3 518 R44 or ‘DM’; (Paz and
Veilleux 1999)), as well as a heterozygous
diploid line (RH89-039-16 or ‘RH’; (van Os
et al. 2006)). The elucidation of the reference
potato genome, including the annotation of
around 39,000 protein-coding genes, has opened
up opportunities to rapidly identify candidate
genes in regions associated with biotic resistance.
In total, 438 NLR genes were identified across all
12 potato chromosomes, providing a blueprint
for future efforts to identify and more rapidly
clone functional NLR genes from potato (Jupe
et al. 2012). These studies form the basis of a
novel NLR gene enrichment and sequencing
platform (RenSeq) that enables the improved
annotation of NLR genes and increased the
number from 438 to 755 (Jupe et al. 2013).
Derived from a RenSeq platform, diagnostic
RenSeq (dRenSeq) can be used to detect known
NLR genes (van Weymers et al. 2016). More-
over, single-molecule real-time (SMRT) RenSeq
can be applied to rapidly clone multiple NLR
genes to engineer pathogen-resistant crops
(Witek et al. 2016). Except for NLR genes,
RenSeq and derived techniques can also be
applied to other immune receptors that contain
conserved domains, such as eLRR in PRRs.
Targeted re-sequencing of wild potato species
that harbor resistance to major pests and patho-
gens combined with effectoromics assays should
enable identification of a wide array of valuable
resistances for breeders.
166
10.7 Conclusion
Recent developments in genomics have enabled
and accelerated the identification and characteri-
zation of new types of defenses against patho-
gens in potato. In addition to NLR that have
proved inadequate to achieve sustainable resis-
tance against P. infestans, a repertoire of immune
receptors is present in wild Solanum species.
Also other defense-related genes contribute to
resistance against P. infestans. More effective
strategies need to be explored to achieve more
durable and broad-spectrum resistance in potato
breeding. With continuing updating of potato
genome information and the related approaches
mentioned above, e.g. RenSeq and effectoromics,
novel resistance and related genes will be iden-
tified and can be applied more efficiently.
Acknowledgements The work was partially supported
by the National Science Foundation of China (31401436) and
Huazhong Agricultural University Scientific & Technological
Self-innovation Foundation (2662016QD042).
References
Albert I, Böhm H, Albert M, Feiler CE, Imkampe J,
Wallmeroth N, Brancato C, Raaymakers TM, Oome S,
Zhang H et al (2015) An RLP23-SOBIR1-BAK1
complex mediates NLP-triggered immunity. Nat
Plants 1:15140
Ballvora A, Ercolano MR, Weiß J, Meksem K, Bor-
mann CA, Oberhagemann P, Salamini F, Gebhardt C
(2002) The R1 gene for potato resistance to late blight
(Phytophthora infestans) belongs to the leucine
zipper/NBS/LRR class of plant resistance genes.
Plant J 30:361–371
Benschop JJ, Mohammed S, O’Flaherty M, Heck AJR,
Slijper M, Menke FLH (2007) Quantitative phospho-
proteomics of early elicitor signaling in Arabidopsis.
Mol Cell Proteom 6:1198–1214
Bittel P, Robatzek S (2007) Microbe-associated molecular
patterns (MAMPs) probe plant immunity. Curr Opin
Plant Biol 10:335–341
Black W, Mastenbroek C, Mills WR, Peterson LC (1953)
A proposal for an international nomenclature of races
of Phytophthora infestans and of genes controlling
immunity in Solanum demissum derivatives. Euphyt-
ica 2:173–179
Boller T, Felix G (2009) A renaissance of elicitors:
Perception of microbe-associated molecular patterns
and danger signals by pattern-recognition receptors.
Ann Rev Plant Biol 60:379–407
J. Du and V. G. A. A. Vleeshouwers
Champouret N (2010) Functional genomics of Phytoph-
thora infestans effectors and Solanum resistance
genes. Ph. D. dissertation. Wageningen University,
The Netherelands
Chaparro-Garcia A, Wilkinson RC, Gimenez-Ibanez S,
Findlay K, Coffey MD, Zipfel C, Rathjen JP,
Kamoun S, Schornack S (2011) The receptor-like
kinase SERK3/BAK1 is required for basal resistance
against the late blight pathogen Phytophthora infes-
tans in Nicotiana benthamiana. PLoS ONE 6:e16608
Chinchilla D, Zipfel C, Robatzek S, Kemmerling B,
Nürnberger T, Jones JDG, Felix G, Boller T (2007) A
flagellin-induced complex of the receptor FLS2 and
BAK1 initiates plant defence. Nature 448:497–500
Christensen AB, Thordal-Christensen H, Zimmermann G,
Gjetting T, Lyngkjaer MF, Dudler R, Schweizer P
(2004) The germinlike protein GLP4 exhibits super-
oxide dismutase activity and is an important compo-
nent of quantitative resistance in wheat and barley.
Mol Plant-Microbe Interact 17:109–117
de Jonge R, van Esse HP, Maruthachalam K, Bolton MD,
Santhanam P, Saber MK, Zhang Z, Usami T, Lievens B,
Subbarao KV, Thomma BPHJ (2012) Tomato immune
receptor Ve1 recognizes effector of multiple fungal
pathogens uncovered by genome and RNA sequencing.
Proc Natl Acad Sci USA 109:5110–5115
Deng H, Liu H, Li K, Xiao J, Wang S (2012) A
CCCH-type zinc finger nucleic acid-binding protein
quantitatively confers resistance against rice bacterial
blight disease. Plant Physiol 158:876–889
Derevnina L, Dagdas YF, De la Concepcion JC, Bialas A,
Kellner R, Petre B, Domazakis E, Du J, Wu C, Lin X
et al (2016) Nine things to know about elicitins. New
Phytol 212:888–895
Domazakis E, Lin X, Aguilera-Galvez C, Wouters D,
Bijsterbosch G, Wolters PJ, Vleeshouwers VG (2017)
Effectoromics-based identification of cell surface
receptors in potato. Methods Mol Biol 1578:337–353
Du J, Tian ZD, Liu J, Vleeshouwers VGAA, Shi XL,
Xie CH (2013) Functional analysis of potato genes
involved in quantitative resistance to Phytophthora
infestans. Mol Biol Rep 40:957–967
Du J, Verzaux E, Chaparro-Garcia A, Bijsterbosch G,
Keizer LCP, Zhou J, Liebrand TWH, Xie C, Govers F,
Robatzek S et al (2015a) Elicitin recognition confers
enhanced resistance to Phytophthora infestans in
potato. Nature Plants 1:15034
Du J, Vleeshouwers VGAA (2014) The do’s and don’ts of
effectoromics. In: Methods in Molecular Biology.
Volume 1127. 2014/03/20 edition, 257–268
Du Y, Berg J, Govers F, Bouwmeester K (2015b)
Immune activation mediated by the late blight resis-
tance protein R1 requires nuclear localization of R1
and the effector AVR1. New Phytol 207:735–747
Ellis JG, Rafiqi M, Gan P, Chakrabarti A, Dodds PN
(2009) Recent progress in discovery and functional
analysis of effector proteins of fungal and oomycete
plant pathogens. Curr Opin Plant Biol 12:399–405
Eulgem T (2005) Regulation of the Arabidopsis defense
transcriptome. Trends Plant Sci 10:71–78
10 New Strategies Towards Durable Late Blight Resistance in Potato
Foster SJ, Park TH, Pel M, Brigneti G, Sliwka J, Jagger L,
van der Vossen E, Jones JDG (2009) Rpi-vnt1.1, a
Tm-22 homolog from Solanum venturii, confers
resistance to potato late blight. Mol Plant-Microbe
Interact 22:589–600
Fradin EF, Abd-El-Haliem A, Masini L, van den
Berg GCM, Joosten MHAJ, Thomma BPHJ (2011)
Interfamily transfer of tomato Ve1 mediates Verticil-
lium resistance in Arabidopsis. Plant Physiol
156:2255–2265
Fradin EF, Zhang Z, Ayala JCJ, Castroverde CDM,
Nazar RN, Robb J, Liu CM, Thomma BPHJ (2009)
Genetic dissection of Verticillium wilt resistance
mediated by tomato Ve1. Plant Physiol 150:320–332
Gaulin E, Dramé N, Lafitte C, Torto-Alalibo T,
Martinez Y, Ameline-Torregrosa C, Khatib M, Mazar-
guil H, Villalba-Mateos F, Kamoun S et al (2006)
Cellulose binding domains of a Phytophthora cell wall
protein are novel pathogen-associated molecular pat-
terns. Plant Cell 18:1766–1777
Haverkort AJ, Boonekamp PM, Hutten R, Jacobsen E,
Lotz LAP, Kessel GJT, Vossen JH, Visser RGF
(2016) Durable late blight resistance in potato through
dynamic varieties obtained by cisgenesis: scientific
and societal advances in the DuRPh project. Potato
Res 59:35–66
He Q, McLellan H, Boevink PC, Sadanandom A, Xie CH,
Birch PRJ, Tian ZD (2015) U-box E3 ubiquitin ligase
PUB17 acts in the nucleus to promote specific
immune pathways triggered by Phytophthora infes-
tans. J Exp Bot 66:3189–3199
Hecht V, Vielle-Calzada JP, Hartog MV, Schmidt EDL,
Boutilier K, Grossniklaus U, De Vries SC (2001) The
Arabidopsis SOMATIC
EMBRYOGENESIS RECEPTOR KINASE 1 gene is
expressed in developing ovules and embryos and
enhances embryogenic competence in culture. Plant
Physiol 127:803–816
Heese A, Hann DR, Gimenez-Ibanez S, Jones AME,
He K, Li J, Schroeder JI, Peck SC, Rathjen JP (2007)
The receptor-like kinase SERK3/BAK1 is a central
regulator of innate immunity in plants. Proc Natl Acad
Sci USA 104:12217–12222
Hein I, Birch PRJ, Danan S, Lefebvre V, Odeny DA,
Gebhardt C, Trognitz F, Bryan GJ (2009) Progress in
mapping and cloning qualitative and quantitative
resistance against phytophthora infestans in potato
and its wild relatives. Potato Res 52:215–227
Huang S, van der Vossen EAG, Kuang H, Vleeshouw-
ers VGAA, Zhang N, Borm TJA, van Eck HJ,
Baker B, Jacobsen E, Visser RGF (2005) Comparative
genomics enabled the isolation of the R3a late blight
resistance gene in potato. Plant J 42:251–261
Jo KR (2013) Unveiling and deploying durability of
late blight resistance in potato. Wageningen
University
Jo KR, Zhu S, Bai Y, Hutten RC, Kessel GJ, Vleeshouw-
ers VG, Jacobsen E, Visser RGF, Vossen JH (2016)
Problematic crops: 1. Potatoes: Towards sustainable
167
potato late blight resistance by cisgenic R gene
pyramiding. In: Plant Pathogen Resistance Biotech-
nology (Ed. Collinge DB) 171
Jones JDG, Dangl JL (2006) The plant immune system.
Nature 444:323–329
Jones JDG, Witek K, Verweij W, Jupe F, Cooke D,
Dorling S, Tomlinson L, Smoker M, Perkins S,
Foster S (2014) Elevating crop disease resistance with
cloned genes. Philos Trans Royal Soc London B Biol
Sci 369:20130087
Jupe F, Pritchard L, Etherington GJ, MacKenzie K,
Cock PJA, Wright F, Sharma SK, Bolser D, Bryan GJ,
Jones JDG, Hein I (2012) Identification and localisa-
tion of the NB-LRR gene family within the potato
genome. BMC Genom 13:75
Jupe F, Witek K, Verweij W, Sliwka J, Pritchard L,
Etherington GJ, Maclean D, Cock PJ, Leggett RM,
Bryan GJ et al (2013) Resistance gene enrichment
sequencing (RenSeq) enables reannotation of the
NB-LRR gene family from sequenced plant genomes
and rapid mapping of resistance loci in segregating
populations. Plant J 76:530–544
Kanneganti TD, Huitema E, Cakir C, Kamoun S (2006)
Synergistic interactions of the plant cell death path-
ways induced by Phytophthora infestans Nep1-like
protein PiNPP1.1 and INF1 elicitin. Mol
Plant-Microbe Interact 19:854–863
Korner CJ, Klauser D, Niehl A, Dominguez-Ferreras A,
Chinchilla D, Boller T, Heinlein M, Hann D (2013)
The immunity regulator BAK1 contributes to resis-
tance against diverse RNA viruses. Mol Plant-Microbe
Interact 26:1271–1280
Kou Y, Wang S (2010) Broad-spectrum and durability:
Understanding of quantitative disease resistance. Curr
Opin Plant Biol 13:181–185
Leckband G, Lorz H (1998) Transformation and expres-
sion of a stilbene synthase gene of Vitis vinifera L. in
barley and wheat for increased fungal resistance.
Theor Appl Genet 96:1004–1012
Li G, Huang S, Guo X, Li Y, Yang Y, Guo Z, Kuang H,
Rietman H, Bergervoet M, Vleeshouwers VGGA et al
(2011) Cloning and characterization of R3b; Members
of the R3 superfamily of late blight resistance genes
show sequence and functional divergence. Mol
Plant-Microbe Interact 24:1132–1142
Li J, Wen JQ, Lease KA, Doke JT, Tax FE, Walker JC
(2002) BAK1, an Arabidopsis LRR receptor-like
protein kinase, interacts with BRI1 and modulates
brassinosteroid signaling. Cell 110:213–222
Li Y, Tian Z, Liu J, Xie C (2009) Comparative
cDNA-AFLP analysis reveals that DL-b-
amino-butyric acid induces resistance through early
activation of the host-defense genes in potato. Physiol
Plant 136:19–29
Liu Z, Bos JIB, Armstrong M, Whisson SC, Da Cunha L,
Torto-Alalibo T, Win J, Avrova AO, Wright F,
Birch PRJ, Kamoun S (2005) Patterns of diversifying
selection in the phytotoxin-like scr74 gene family of
Phytophthora infestans. Mol Biol Evol 22:659–672
168
Lokossou AA, Park TH, van Arkel G, Arens M,
Ruyter-Spira C, Morales J, Whisson SC, Birch PR,
Visser RG, Jacobsen E, van der Vossen EA (2009)
Exploiting knowledge of R/Avr genes to rapidly clone
a new LZ-NBS-LRR family of late blight resistance
genes from potato linkage group IV. Mol
Plant-Microbe Interact 22:630–641
Mastenbroek C (1953) Experiments on the inheritance of
blight immunity in potatoes derived from Solanum
demissum Lindl. Euphytica 2:197–206
McCann HC, Nahal H, Thakur S, Guttman DS (2012)
Identification of innate immunity elicitors using
molecular signatures of natural selection. Proc Natl
Acad Sci USA 109:4215–4220
Nam KH, Li JM (2002) BRI1/BAK1, a receptor kinase
pair mediating brassinosteroid signaling. Cell
110:203–212
Ni X, Tian Z, Liu J, Song B, Li J, Shi X, Xie C (2010a)
StPUB17, a novel potato UND/PUB/ARM repeat type
gene, is associated with late blight resistance and NaCl
stress. Plant Sci 178:158–169
Ni X, Tian Z, Liu J, Song B, Xie C (2010b) Cloning and
molecular characterization of the potato RING finger
protein gene StRFP1 and its function in potato
broad-spectrum resistance against Phytophthora infes-
tans. J Plant Physiol 167:488–496
Paz MM, Veilleux RE (1999) Influence of culture medium
and in vitro conditions on shoot regeneration in
Solanum phureja monoploids and fertility of regener-
ated doubled monoploids. Plant Breed 118:53–57
Pel MA, Foster SJ, Park TH, Rietman H, van Arkel G,
Jones JDG, van Eck HJ, Jacobsen E, Visser RGF, van
der Vossen EAG (2009) Mapping and cloning of late
blight resistance genes from Solanum venturii using an
interspecific candidate gene approach. Mol
Plant-Microbe Interact 22:601–615
Postel S, Küfner I, Beuter C, Mazzotta S, Schwedt A,
Borlotti A, Halter T, Kemmerling B, Nürnberger T
(2010) The multifunctional leucine-rich repeat recep-
tor kinase BAK1 is implicated in Arabidopsis devel-
opment and immunity. Eur J Cell Biol 89:169–174
Rietman H (2011) Putting the Phytophthora infestans
genome sequence at work; multiple novel avirulence
and potato resistance gene candidates revealed. Ph.D.
Wageningen University, The Netherlands
Rietman H, Bijsterbosch G, Cano LM, Lee HR,
Vossen JH, Jacobsen E, Visser RGF, Kamoun S,
Vleeshouwers V (2012) Qualitative and quantitative
late blight resistance in the potato cultivar Sarpo Mira
is determined by the perception of five distinct RXLR
effectors. Mol Plant-Microbe Interact 25:910–919
Rooney HCE, Van’t Klooster JW, Van Der Hoorn RAL,
Joosten MHAJ, Jones JDG, De Wit PJGM (2005)
Plant science: Cladosporium Avr2 inhibits tomato
Rcr3 protease required for Cf-2-dependent disease
resistance. Sci 308:1783–1786
J. Du and V. G. A. A. Vleeshouwers
Roux M, Schwessinger B, Albrecht C, Chinchilla D,
Jones A, Holton N, Malinovsky FG, Tör M, de
Vries S, Zipfel C (2011) The Arabidopsis leucine-rich
repeat receptor-like kinases BAK1/SERK3 and
BKK1/SERK4 are required for innate immunity to
hemibiotrophic and biotrophic pathogens. Plant Cell
23:2440–2455
Schwessinger B, Roux M, Kadota Y, Ntoukakis V,
Sklenar J, Jones A, Zipfel C (2011)
Phosphorylation-dependent differential regulation of
plant growth, cell death, and innate immunity by the
regulatory receptor-like kinase BAK1. PLoS Genet 7:
e1002046
Segonzac C, Zipfel C (2011) Activation of plant
pattern-recognition receptors by bacteria. Curr Opin
Microbiol 14:54–61
Shan L, He P, Li J, Heese A, Peck SC, Nürnberger T,
Martin GB, Sheen J (2008) Bacterial effectors target
the common signaling partner BAK1 to disrupt
multiple MAMP receptor-signaling complexes and
impede plant immunity. Cell Host Microbe 4:17–27
Shi X, Tian Z, Liu J, van der Vossen EAG, Xie C (2012)
A potato pathogenesis-related protein gene, StPRp27,
contributes to race-nonspecific resistance against
Phytophthora infestans. Mol Biol Rep 39:1909–1916
Song J, Bradeen JM, Naess SK, Raasch JA, Wielgus SM,
Haberlach GT, Liu J, Kuang H, Austin-Phillips S,
Buell CR et al (2003) Gene RB cloned from Solanum
bulbocastanum confers broad spectrum resistance to
potato late blight. Proc Natl Acad Sci USA 100:9128–
9133
Spooner DM, Salas A (2006) Structure, biosystematics
and genetic resources. In: Gopal J, Khurana SMP
(eds) Handbook of Potato, production, improvement
and postharvest. The Haworth Press, New York, pp 1–
39
Tian M, Huitema E, Da Cunha L, Torto-Alalibo T,
Kamoun S (2004) A Kazal-like extracellular serine
protease inhibitor from Phytophthora infestans targets
the tomato pathogenesis-related protease P69B. J Biol
Chem 279:26370–26377
Tian M, Win J, Song J, Van Der Hoorn R, Van Der
Knaap E, Kamoun S (2007) A Phytophthora infestans
cystatin-like protein targets a novel tomato papain-like
apoplastic protease. Plant Physiol 143:364–377
Tian ZD, Liu J, Xie CH (2003) Isolation of resistance
related-genes to Phytophthora infestans with suppres-
sion subtractive hybridization in the R-gene-free
potato. Acta Genet Sinica 30:597–605
van der Vossen E, Sikkema A, Hekkert BTL, Gros J,
Stevens P, Muskens M, Wouters D, Pereira A,
Stiekema W, Allefs S (2003) An ancient R gene from
the wild potato species Solanum bulbocastanum
confers broad-spectrum resistance to Phytophthora
infestans in cultivated potato and tomato. Plant J
36:867–882
10 New Strategies Towards Durable Late Blight Resistance in Potato
van der Vossen EAG, Gros J, Sikkema A, Muskens M,
Wouters D, Wolters P, Pereira A, Allefs S (2005) The
Rpi-blb2 gene from Solanum bulbocastanum is an
Mi-1 gene homolog conferring broad-spectrum late
blight resistance in potato. Plant J 44:208–222
van Os H, Andrzejewski S, Bakker E, Barrena I,
Bryan GJ, Caromel B, Ghareeb B, Isidore E, De
Jong W, van Koert P et al (2006) Construction of a
10,000-marker ultradense genetic recombination map
of potato: Providing a framework for accelerated gene
isolation and a genomewide physical map. Genet
173:1075–1087
van Weymers PSM, Baker K, Chen X, Harrower B,
Cooke DEL, Gilroy EM, Birch PRJ, Thilliez GJA,
Lees AK, Lynott JS et al (2016) Utilizing “Omic”
technologies to identify and prioritize novel sources of
resistance to the oomycete pathogen Phytophthora
infestans in potato germplasm collections. Front Plant
Sci 7:672
Vleeshouwers VGAA, Driesprong JD, Kamphuis LG,
Torto-Alalibo T, Van’t Slot KAE, Govers F, Vis-
ser RGF, Jacobsen E, Kamoun S (2006)
Agroinfection-based high-throughput screening
reveals specific recognition of INF elicitins in
Solanum. Mol Plant Pathol 7:499–510
Vleeshouwers VGAA, Raffaele S, Vossen JH, Cham-
pouret N, Oliva R, Segretin ME, Rietman H,
Cano LM, Lokossou A, Kessel G et al (2011a)
Understanding and exploiting late blight resistance in
the age of effectors. Ann Rev Phytopathol 49:507–531
Vleeshouwers VGAA, Finkers R, Budding D, Visser M,
Jacobs MMJ, van Berloo R, Pel M, Champouret N,
Bakker E, Krenek P et al (2011b) SolRgene: An online
database to explore disease resistance genes in
tuber-bearing Solanum species. BMC Plant Biol 11:116
Vleeshouwers VGAA, Rietman H, Krenek P, Cham-
pouret N, Young C, Oh SK, Wang M,
Bouwmeester K, Vosman B, Visser RGF et al (2008)
Effector genomics accelerates discovery and functional
profiling of potato disease resistance and Phytophthora
infestans avirulence genes. PLoS ONE 3:e2875
169
Vossen JH, Nijenhuis M, Arens-De Reuver MJB, van Der
Vossen EAG, Jacobsen E, Visser RGF (2012)
Cloning and exploitation of a functional R-gene from
Solanum chacoense. Patent publication
No. WO2011034433 A1
Vossen JH, van Arkel G, Bergervoet M, Jo KR, Jacob-
sen E, Visser RGF (2016) The Solanum demissum R8
late blight resistance gene is an Sw-5 homologue that
has been deployed worldwide in late blight resistant
varieties. Theor Appl Genet 129:1785–1796
Wang BL, Liu J, Tian ZD, Song BT, Xie CH (2005)
Monitoring the expression patterns of potato genes
associated with quantitative resistance to late blight
during Phytophthora infestans infection using cDNA
microarrays. Plant Sci 169:1155–1167
Wang H, Sun C, Jiang R, He Q, Yang Y, Tian Z, Xie C
(2014) The dihydrolipoyl acyltransferase gene BCE2
participates in basal resistance against Phytophthora
infestans in potato and Nicotiana benthamiana. J Plant
Physiol 171:907–914
Win J, Chaparro-Garcia A, Belhaj K, Saunders DG,
Yoshida K, Dong S, Schornack S, Zipfel C,
Robatzek S, Hogenhout SA, Kamoun S (2012)
Effector biology of plant-associated organisms: con-
cepts and perspectives. In Cold Spring Harb Symp
Quant Biol 77:235–247
Witek K, Jupe F, Witek AI, Baker D, Clark MD,
Jones JDG (2016) Accelerated cloning of a potato late
blight-resistance gene using RenSeq and SMRT
sequencing. Nat Biotechnol 34:656–660
Wu CH, Abd-El-Haliem A, Bozkurt TO, Belhaj K,
Terauchi R, Vossen JH, Kamoun S (2016) NLR
signaling network mediates immunity to diverse plant
pathogens. bioRxiv 090449
Wu T, Tian Z, Liu J, Xie C (2009) A novel leucine-rich
repeat receptor-like kinase gene in potato, StLRPK1, is
involved in response to diverse stresses. Mol Biol Rep
36:2365–2374
Xu X, Pan S, Cheng S, Zhang B, Mu D, Ni P, Zhang G,
Yang S, Li R, Wang J et al (2011) Genome sequence and
analysis of the tuber crop potato. Nat 475:189–195
 Genomics Approaches for Improving
Nitrogen Use Efficiency in Potato 11
Jagesh Kumar Tiwari, Sapna Devi, Nilofer Ali,
Tanuja Buckseth, Vaishali Moudgil, Rajesh K. Singh,
Swarup Kumar Chakrabarti, V. K. Dua, Devendra Kumar
and Manoj Kumar

Abstract
Increasing global food production to feed rapidly growing populations
where cultivable land area is limited is a serious challenge. Moreover,
increasing production costs, with high fertilizer input costs, particularly
using nitrogen (N), and degrading soil health are the major concerns when
enhancing the sustainable agricultural food production. Potato, being the
major non-cereal food crop globally, is a heavy N fertilizer feeder crop. In
the past several agricultural best management practices have been
discussed regarding N management in potato crop production through
the intervention of agronomy and soil science. However, unlike the
advances in other model plants and cereals, the application of molecular
genomics tools is lacking in potato, hence it is not possible to enhance
plant genetic potential with better nitrogen use efficiency (NUE). Better
N-use efficient plants can be grown with less fertilizer input and also on
poor soil. This chapter highlights the application of novel genomics tools
to improve NUE in potato through the discovery of novel genes and
markers for applications in molecular breeding methods and gene
manipulation (transgenic) techniques.

11.1 Introduction

The agricultural soils of the world are deficient in

J. K. Tiwari (&)
S. Devi
N. Ali
T. Buckseth

V. Moudgil
R. K. Singh
S. K. Chakrabarti

V. K. Dua
ICAR-Central Potato Research Institute, Shimla,
Himachal Pradesh 171001, India
e-mail: jageshtiwari@gmail.com
D. Kumar
M. Kumar
ICAR-Central Potato Research Institute Campus,
Modipuram, Meerut Uttar Pradesh, 250110, India
one or more essential nutrients needed for heal-
thy plant growth, of which nitrogen (N) is the
most important essential nutrient. In the
twenty-first century, N use efficient plants will
play a major role in increasing crop yields mainly
due to the limited land and water resources
available for crop production, the higher cost of
inorganic fertilizers, the declining trend of crop

© Springer International Publishing AG 2017 171

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_11
172
yields globally, and increasing global concerns
(Fageria et al. 2008). Plant growth and NUE are
known to be under genetic and physiological
control, and are implicated by genotype, envi-
ronment and their interactions. The dynamic
nature of N and its loss from soil-plant systems
create a challenging environment for efficient N
management. Crop responses to applied N and
use efficiency are important criteria for evaluat-
ing crop N requirements for the maximum eco-
nomic yield. Recovery of N in crop plants is
usually less than 50% worldwide. Low recovery
of N in annual crop is associated with its loss by
volatilization, leaching, surface runoff, denitrifi-
cation, and plant canopy. Low recovery of N is
not only responsible for the higher cost of crop
production, but also for environmental pollution.
Hence, improving N use efficiency (NUE) is
necessary to improve crop yields, reduce pro-
duction costs, and maintain environmental qual-
ity. There is a need for integrated
multidisciplinary approaches to focus on devel-
oping cultivars with high NUE. Identification of
traits, such as N uptake, transport,
utilization/assimilation, and mobilization in
plants, should greatly enhance NUE. The devel-
opment of new varieties with higher NUE, cou-
pled with best management practices will
contribute to sustainable agricultural systems that
protect and promote soil, water and air quality
(Baligar et al. 2001; Fageria and Baligar 2005).
Higher crop production costs, increased con-
sumption of food and fertilizer, and a growing
global population have led to calls for a “second
Green Revolution” using modern genetic manip-
ulation techniques to improve the production,
yield, and quality of crops. Considerable research
is being directed towards the study and engi-
neering of nitrogen use efficiency in crop plants.
The end goal is to reduce the amount of
nitrogen-based fertilizer used and thereby reduce
production costs and environmental damage while
increasing yields (Fischer et al. 2013). Moreover,
genetic approaches have been reviewed to
enhance NUE in cereals (Garnett et al. 2015).
Potato (Solanum tuberosum L.) is the fourth
most important food crop worldwide after wheat,
rice and maize, and potato is the number one
J. K. Tiwari et al.
non-cereal crop with global production of 381.68
million tonnes in 2014 (FAOSTAT 2014).
Because of the global importance of potato, the
United Nations declared the year 2008 as
“International Year of the Potato”. Moreover,
potato has been identified as “food for the future”
by Food and Agriculture Organization; and has
the potential to secure both food and nutritional
security globally.
11.2 Nitrogen Use Efficiency
in Potato
Potato crops require nitrogen mainly either in the
form of nitrate or nitrate mixed with ammonium
for healthy growth, like most crop plants. In a
study, Qsaki et al. (1995) investigated the effect
of ammonium and nitrate forms on plant growth
and tuberization of potato. Ammonium-N stim-
ulated tuber swelling and partitioned into tubers
and stems, while nitrate-N stimulated branching
of stolons, stems, shoot growth, and partitioned
into leaves. Further, ammonium-N appeared to
stimulate aspartic acid plus asparagines
(Asx) metabolism in tuber and Asx was stored in
tubers. On the other hand, nitrate-N was mainly
transported into leaves and promoted vegetative
growth. Gao et al. (2014) also investigated the
effect of two N forms (nitrate and ammonium) on
potato stolon and tuber growth. They observed
that plants supplied with nitrate produced more
and thicker stolons and more tubers than those
supplied with ammonium. However, no signifi-
cant yield difference was observed between two
N forms at the time of tuber harvest.
Potato is a heavy N fertilizer feeder crop,
requires 180–240 kg N/ha, of which nearly 40–
50% N is acquired by the crop and remaining N
is lost in the environment. Potato is a shallow
rooted crop, requires a high dose of N fertilizer,
and irrigated cultivation on sandy-loam soil leads
to nitrate leaching into soil. Therefore, improving
nitrogen use efficiency (NUE) of the potato plant
is a potential approach to sustainable crop pro-
duction and a precision agriculture system. In
potato, nitrogen use efficiency is broadly defined
as tuber yield per unit of N supply
11 Genomics Approaches for Improving Nitrogen …
(fertilizer + soil N). Precisely, NUE can be
divided into two parts: (1) N uptake efficiency or
NUpE (plant total N accumulation per unit of soil
N supply); and (2) N utilization efficiency or
NUtE (tuber dry matter production per unit of
plant N accumulation). Thus, NUE is the product
of NUpE and NUtE (Errebhi et al. 1998).
11.3 Phenotyping
for NUE-Associated Traits
11.3.1 Controlled Environment
Experiment
11.3.1.1 Hydroponic/Aeroponic Culture
Previously, a few studies had been conducted on
potato using hydroponic culture. Zebarth and
Rosen (2007) screened potato cultivars for nitro-
gen use efficiency with a recirculating hydroponic
system. Development of N-use efficient genotypes
could reduce N fertilizer and nitrate leaching,
however, screening in the field can be laborious,
costly and time-consuming. Hence, a hydroponic
culture experiment was conducted with two nitrate
concentrations (0.05 and 1 mM) and five different
potato cultivars for 30 days. The study concluded
plant total dry weight (TDW) and plant N accu-
mulation (PN) were highly correlated, therefore,
TDW can be considered an alternative criterion for
PN while screening for NUE. In another study,
Cao and Tibbitts (1998) studied the response of
potato to different forms (nitrate and ammonium)
of N concentrations in a hydroponic culture. With
nitrate, plants growth was greatest and similar at 2,
4 and 8 mM N whereas with ammonium, the plant
grew best only at 2 and 4 mM N. In addition,
recently, an aeroponic culture has been developed
for soil-less crop cultivation in air, supplying
nutrient solutions in the form of mist/fog required
for normal plant growth and aeroponics has been
used in many crops (Buckseth et al. 2016).
Small aeroponics boxes (made of plastic) have
been designed for potato growth under aeroponic
173
culture at the Indian Council of Agricultural
Research (ICAR), Central Potato Research Institute
(CPRI), Shimla, Himachal Pradesh, in India.
Virus-free healthy in vitro plant materials are
required for proper plant growth in aeroponics.
One-week hardened in vitro plantlets are planted in
the aeroponic boxes. Based on the experimental
design, nutrient solutions are prepared. For exam-
ple, N starvation (without nitrogen), N limitation
(e.g. 0.5 mM NO3−) and N sufficient (e.g. 5 mM
NO3−) can be used, while all other nutrients remain
the same except one or two. First, stock solutions of
all nutrients are prepared and then working solu-
tions are mixed in the growth tanks in which the
plant uptakes nutrients in the form of mist or fog
lifted via a pump. To illustrate, the following
nutrient solutions are required for potato plant
growth in aeroponics under N limitation
(0.5 mM N) and N sufficient (5 mM N) supplies.
Stock solutions are prepared using salts such as 1 M
MgSO4.7H2O, 0.5 M KH2PO4, 0.125 M H3BO3,
0.125 M MnSO4.H2O, 0.125 M ZnSO4.7H2O,
0.005 M CuSO4.5H2O, 0.005 M Na2MoO4.2H2O,
0.0125 M Fe-EDTA, 1 M Ca(NO3)2.4H2O, 1 M
KNO3, 0.5 M K2SO4 and 0.5 M CaSO4.2H2O.
Then, working solutions are prepared using the
stock solutions to make final working solutions
depending upon the volume of growth tank desired
for plant growth, having a nutrient concentration,
such as 0.5 mM N (NO3−), 0.5 mM P, 3 mM K,
1 mM Mg, 4.5 mM S, 0.0016 mM Mn,
0.00008 mM Zn, 0.004 mM B, 0.00004 mM Cu,
0.00004 mM Mo, 0.0062 mM Fe, and 2.5 mM
Ca, while in 5 mM N (NO3−) growth solution all
nutrients remain the same except 2.25 mM S. Like
other hydroponic culture systems, fresh nutrient
solutions are changed every week and pH is mon-
itored between 6.0 and 7.0. The temperature for
potato tuberization is very crucial and therefore a
controlled chamber with temperature (<20 °C) is
used to conduct a successful experiment. Over-
views of potato plants’ growth under aeroponic
culture at ICAR-CPRI, Shimla are depicted in
Figs. 11.1 and 11.2.
174 J. K. Tiwari et al.

Fig. 11.1 General overview of potato roots (early stage) growth under controlled aeroponic culture

0N 7.5 N 0N 7.5 N

0N 7.5 N

Fig. 11.2 Growth of potato plants cv. Kufri Jyoti supplied with different N solutions (N starvation: 0 N, and N
sufficient: 7.5 mM N) under the controlled aeroponic culture
11 Genomics Approaches for Improving Nitrogen …
11.3.1.2 High-Throughput Plant
Phenotyping
Remote sensing and spectral reflectance mea-
surements of plants have been used for long time
to assess plant growth and nutrient status in a
non-destructive manner. With improved imaging
and computer-aided technologies, these approa-
ches can now be used at high-throughput for
more extensive physiological and genetic studies.
Berger et al. (2013) presented an example of how
high-throughput imaging can be used to study
the growth of plants exposed to different nutrient
levels. In addition, the color of the leaves can be
used to estimate leaf chlorophyll and the nitrogen
status of the plant. In another study, Poiré et al.
(2014) applied digital imaging approaches to
phenotype the whole plant N response in
Brachypodium distachyon.
11.3.2 Field Experiment
Nitrogen best management practices (BMPs)
have been suggested for potato plant growth to
optimize tuber yield and quality, and also to
reduce environmental losses (Zebarth and Rosen
2007). Development of BMPs for N management
must consider the amount and timing of both the
N supply and the crop N demand, crop geno-
types, soil types, cropping systems, water man-
agement, and the climatic conditions. Potato
scientists have emphasized N response and N
management in potato through the development
of dose-responsive curves of fertilizer N inputs in
precision agriculture (Vos 2009). Moreover, N
fertilizer management can be improved through
the timing of fertilizer application, placement and
formulation on a field basis using site-specific
nutrient management (Zebarth et al. 2012).
Plant-based diagnostic tests such as the nitrogen
nutrition index (NNI), the petiole nitrate con-
centration, and the leaf chlorophyll meter reading
(SPAD) are successfully used to assess potato N
nutrition during the growing season, whereas
soil-based tests are used to provide soil N supply
and adjust N fertilizer dose at pre-planting time
(Ziadi et al. 2012).
175
Depending upon the objectives and the
experimental design, NUE experiments are con-
ducted to evaluate varieties/germplasm following
a proper statistical design under different N
treatments, such as N starvation (without N), N
limitation (e.g. 50 kg N/ha) and N sufficient (e.g.
200 kg N/ha) and/or multiple environments. In a
study, Cormier et al. (2013) studied a
multi-environmental effect on progress in NUE
of European winter wheat over the last 25 years
by comparing 195 varieties in eight trials under
high and low N conditions.
11.3.3 Estimate N Content and Its
Variable Parameters
Plant N content is an important parameter to esti-
mate the N requirement of crop. Application of
accurate dose of N fertilizer is critical for potato
tuber yield and quality (Vos 2009). Nitrogen use
efficiency (NUE) in potato plants involves several
physiological processes during different phases of
potato growth and development, such as stolon
initiation, tuberization, and tuber bulking. More-
over, to understand the N metabolism such as N
uptake/transport and N assimilation/utilization,
partitioning of N content into different plant parts
(root, shoot and tuber) is essential. There are several
methods existing today to estimate N content, such
as petiole nitrate concentration, N nutrition index
(NNI), leaf chlorophyll concentration, total plant N
content (root, shoot and tuber), plant biomass (fresh
weight and dry weight), dry matter, nitrate and
ammonium concentrations, NUE, N uptake effi-
ciency (NUpE), N utilization efficiency (NUtE),
harvest index (HI), or N harvest index
(NHI) (Zebarth et al. 2004). Goffart et al. (2008)
reviewed the methods used in the assessment of
potato crop nitrogen status to improve N fertiliza-
tion management based on methods such as petiole
sap nitrate concentration, leaf chlorophyll concen-
tration using a hand chlorophyll meter, or crop light
reflectance through a hand-held radiometer using
passive sensors. Besides, more recent methods
based on remote sensing are under investigation in
the near future.
176
There are also several physio-biochemical
traits associated with NUE that could be expec-
ted to investigate NUE in potato crop such as
enzymes, sugars, amino acids, protein and other
metabolites (Mäck and Schjoerring 2002).
Enzymes associated with N metabolism are
nitrite reductase (NIR), nitrate reductase (NR),
glutamine synthetase (GS), apparagine syn-
thetase (AS), glutamine oxoglutarate amino
transferase (GOGAT), or glutamate dehydroge-
nase (GDH), etc.
11.3.4 Root Phenotyping
The root is an important plant part through which
the plant uptakes nutrients from the soil. Potato is
a shallow-rooted crop (nearly up to 30 cm soil
depth) which uptakes nitrogen mainly in the form
of nitrate. Researchers have focussed on study
root morphology to meet the future demands for
food (Bishopp and Lynch 2015). Modern imag-
ing systems have been developed to measure the
root system architecture (RSA) precisely of
plants grown in the field and lab-based experi-
ments (Zhu et al. 2011). For example, an ideal
maize root system (steep, cheap and deep) has
been designed for efficient uptake of nutrients
and water (Lynch 2013). Also, root phenotypes,
root to shoot ratios, root vigour, root length
density and root N transport and metabolism are
measured when studying NUE (Garnett et al.
2009).
In potato, a study showed that the root bio-
mass is positively correlated with shoot biomass
and tuber yield (Iwama 2008). Moreover,
screening methods have been developed for field
and glasshouse conditions to study root mor-
phology in potato (Wishart et al. 2013; Sattel-
macher et al. 1990). Recently, the importance of
understanding the relationship between RSA and
yield pattern in the root and tuber crops was
reviewed (Villordon et al. 2014). Such pheno-
typing can easily be performed using aeroponics,
as depicted in Fig. 11.3.
J. K. Tiwari et al.
11.4 Genomics Approaches
to Improve NUE
11.4.1 Genetic Diversity
A large genetic variation is available in the cul-
tivated and wild relatives of crop species,
including potatoes (Solanum species). Therefore,
it is important to study the genetic variation
underlying Solanum species to investigate the
genes controlling the N metabolism processes.
Many studies have been conducted to analyze the
diversity in the potato germplasm (cultivated and
wild species) for various N-associated traits to
improve NUE (Zvomuya et al., 2002; Errebhi
et al. 1998, 1999). Sattelmacher et al. (1990)
screened 36 clones of tuber-bearing potatoes
belonging to different ploidy levels under field
conditions at low and high fertilizer rates. They
observed nine clones of high yielding potential
(advanced group) even under low soil fertility.
A broad genetic variation in root size at both
fertilizer levels was observed. Tuber dry matter
was significantly correlated with root dry matter
and the advanced clones had a higher tuber yield
per unit of dry matter produced.
Vos (1997) studied the response of potato to
different rates of nitrogen supply (0–40 g/m2 N)
in field experiments and observed that cultivars
differed only in the effect of N on the tuber dry
matter concentration. Errebhi et al. (1998)
screened exotic potato germplasm in the field
under two N treatments (0 and 225 kg N ha−1)
for nitrogen uptake and biomass production.
They observed that N rates and genotypes had a
significant effect on dry weight, N content and
tissue N concentration. Zebarth et al. (2004)
characterized potato cultivars for nitrogen use
efficiency with and without application of
100 kg N ha−1 as ammonium nitrate banded at
planting. They observed that NUE decreases
curvilinearly with increasing crop N supply, and
moreover, NUE was higher for mid-season and
late-maturing cultivars compared to lower
for early-maturing cultivars. A curvilinear
11 Genomics Approaches for Improving Nitrogen …
N starva on (-N)
Traits N starvation
Root length (m) 125.79 m
2
Surface area (cm ) 4905.44
Avg. Diameter (mm) 7.58
3
Root volume (cm ) 155.28
Fig. 11.3 Scanning of roots and preliminary values root parameters of cv. Kufri Jyoti grown under aeroponics
supplied with two N treatments (N starvation, 0 N; and N sufficient: 7.5 mM N) to study NUE in potato
relationship was also observed between plant dry
matter accumulation and plant N accumulation
for all cultivars. Later Zebarth et al. (2008)
evaluated the variation in NUE characteristics of
Andigena and diploid potato germplasm grown
at 0 and 100 kg N ha−1 in field. They observed a
significant variation in NUE characteristics
(NUpE, NUtE, HI and NHI) in adapted potato
germplasm and their consistent patterns across
the contrasting environments. Trehan (2009)
evaluated potato cultivars for nitrogen use effi-
ciency in field trials and observed Kufri Pukhraj
as the most efficient cultivar tested under N stress
conditions in the absence as well as the presence
of green manure. In a later study, Kufri Gaurav
(JX 576) was identified as the most N use effi-
cient potato cultivar to be grown under N stress
conditions (Trehan and Singh 2013). Govin-
dakrishnan et al. (1999) developed a technique
for selecting potato genotypes with low
177
N sufficient (+N)
N sufficient
246.15
9267.42
18.43
362.87
N requirement based on crop modeling. The
technique consists of fitting the quadratic model
to find a relationship between the yield of a
genotype and N rates, followed by determination
of the N dose to get the maximum yields of each
genotype including the standard cultivar.
Recently, Ospina et al. (2014) assessed phe-
notypic variation among 189 potato cultivars for
NUE and eco-physiological variables describing
canopy development (the percentage of soil
covered by green potato leaves) under contrast-
ing N inputs (high and low N). There was large
variation in NUE component traits among culti-
vars. Cultivars performing well under high N
also performed well under low N, and the total
area under the percentage soil cover was highly
correlated with the yield. Tiemens-Hulscher et al.
(2014) identified N efficient potato cultivars for
organic farming. Early canopy development is
responsive to N and shows genetic variation and
178
is significantly related to early tuber yield. They
suggested that N-efficient cultivars suitable for
organic production should have rapid early
canopy development with high agronomic NUE
and NUtE, but a low nitrogen concentration in
the tubers. Schum and Jansen (2014) developed
in vitro methods for the early evaluation of
NUE-associated traits in potato plants grown at
four N levels (60, 30, 15 and 7.5 mM) for three
weeks. Genotypes with a low biomass produc-
tion at full N (60 mM) responded to increased
root development at low N and increased their
NUtE in relation to the other cultivars. Da-Wei
et al. (2014) determined the nitrogen nutrition
index and its relationship with NUE, tuber yield,
radiation use efficiency and leaf parameters in
potatoes.
Potato roots are confined mainly in the plough
layer up to 30 cm in soil depth and potato culti-
vars were characterized for root traits (Iwama
2008). There are large differences in genotypes
across the different environments, soil types,
fertilizers, water, nutrients, etc. In general, root
mass is negatively correlated with early tuber
bulking. However, root mass generally shows
positive correlations with shoot mass and final
tuber yield. However, root traits have seldom
been considered as selection criteria to improve
the NUE of crops, due to the difficulty of mea-
suring root traits under field conditions. Pesse-
mier et al. (2013) studied natural variation of the
root morphological response to nitrate supply in
Arabidopsis. The identification of the root system
architecture ideotypes in the N response will
facilitate further analysis of quantitative traits for
root morphology. Following root biomass and
tuber yield as selection criteria, Konyu cultivars
were bred in Japan. In some studies on potato,
diversity for root phenotypes has been investi-
gated by a few research groups (Villordon et al.
2014; Wishart et al. 2013; Iwama 2008). Genetic
variations were observed for NUE-associated
traits in the Andigena and diploid potato germ-
plasm (Zebarth et al. 2008). Recently, phenotypic
variations were observed in potato cultivars (189
nos.) for NUE and a positive correlation between
eco-physiological variables (crop canopy cover)
and yield was observed under high and low
J. K. Tiwari et al.
nitrogen regimes (Ospina et al. 2014). In another
study, N-efficient potato cultivars suitable for
organic production had rapid early canopy
development but low N content in the tubers
(Tiemens-Hulscher et al. 2014). Wishart et al.
(2013) measured the variation in potato roots for
yield prediction and screening purposes in both
field and glasshouse conditions. In the field, final
yield was correlated negatively with basal root
length and weakly but positively with total root
weight. Phureja genotypes had more numerous
roots, particularly basal than stolon roots, com-
pared with Tuberosum genotypes. They observed
significant correlations between glasshouse and
field measurements.
In other crop species, Wei et al. (2012) map-
ped the quantitative trait locus (QTL) for NUE
and N-deficiency tolerance (NDT) traits in rice.
The identification of four QTL clusters, for both
NDT and NUE traits, provides a partial expla-
nation and genetic mechanism for the observed
correlations between NDT and NUE traits, and
these could be used as targets to improve NDT
and NUE traits in future breeding. Vijayalakshmi
et al. (2013) reviewed physiological approaches
to increase NUE in rice. The physiological, bio-
chemical, molecular aspects such as QTL, the
miRNA technology and transgenic approaches as
well as NUE can be targeted to improve rice
productivity. The yield is complex and multi-
genic trait linkages between carbon and nitrogen
pathways are essential. Gaju et al. (2011) ana-
lyzed genetic variability in NUE (grain dry
matter yield per unit N available from soil and
fertilizer) in winter wheat and identified traits to
improve NUE for application in breeding.
11.4.2 Mapping Studies
Genome-wide association studies and QTL
mapping have been performed in many crop
species to discover novel genes/markers. An
overview of approaches used in analyzing
quantitative traits relating to NUE has been dis-
cussed elsewhere (Chietera and Chardon 2014).
Although there are almost no reports of mapping
studies for NUE in the potato crop, researchers
11 Genomics Approaches for Improving Nitrogen …
can learn from the advances in NUE research in
crops such as cereals, model plants and others.
Some of the selected research reports in other
crops are described here. Several QTL have been
identified to improve NUE in many crop species
like rice (Wei et al. 2012), or barley (Kindu et al.
2014). In a genetic study of NUE in wheat, QTL
were established for 21 traits relating to growth,
yield and leaf N assimilation during the grain fill
stage using a mapping population from the cross
Chinese Spring  SQ1. Glutamine synthetase
(GS) isozymes and estimated locations of 126
genes were placed on the genetic map (Habash
et al. 2007). Tong et al. (2011) identified 33
digenic interactions and characterized QTL for
grain yield and its components under different
fertilization levels in rice. The identification of
genomic regions will be useful in MAS to
improve the NUE of rice.
In recent years, the genetic relationship
between NUE-associated traits and RSA has
been established and genomic regions for
marker-assisted selection in maize (Li et al.
2015) have been identified. Cui et al. (2014)
developed a novel genetic map using an F6:7
recombinant inbred line population comprising
188 lines and subsequently detected QTL for YD
and response to N stress. This novel map may
facilitate the use of novel markers in wheat
molecular breeding programs and genomics
research. Bouchet et al. (2014) identified a total
of 104 genomic regions (QTL), of which 28
controlled flowering time and 76 were related to
yield and yield component traits in winter oilseed
rape grown under nitrogen limitation.
11.4.3 Omics Technologies and Gene
Discovery
Unlike advances in NUE research in the model
plant Arabidopsis, cereals (rice, wheat and
maize) and other crops, there is an almost neg-
ligible report on the use of omics tools in potato
to improve NUE. Hence, in this chapter, appli-
cations of transcriptomics, proteomics and
metabolomics tools applied in other crops will be
discussed to improve the NUE of potato
179
crop. The DNA of an organism forms transcripts
(tanscriptomics) via transcription that translates
into proteins (proteomics) following various
physiological and metabolic processes (metabo-
lomics). Recent advances in next-generation
sequencing (NGS), namely, RNA-sequencing
technology, have the potential to identify novel
transcripts/genes involved in various plant
growth and developmental processes. Recent
applications of omics technologies using tran-
scripts and metabolites profiling regulating the N
metabolism in crop species have been reviewed
(Fukushima and Kusano 2014). Moreover, par-
ticular emphasis has been given to the develop-
ment of system biology in maize through
integrated datasets of transcriptomes, proteomes
and metabolomes (Simons et al. 2014). It is also
important to make potential use of these omics
technologies to understand whole plant N eco-
nomics in crop breeding and agronomy (Amiour
et al. 2012). In potato, candidate gene expression
profiling was investigated by the nCounter Dig-
ital Analyzer (Nanostring Technologies, Inc.) in
leaf tissues grown under abundant (7.5 mM N),
limited (0.75 mM N) and deficient (0 mM N)
nitrate supplies in nutrient solutions (Li et al.
2010). In other studies, it was concluded that the
expression of an ammonium transporter gene can
be used as a quantitative indicator of plant N
status in potato (Zebarth et al. 2011, 2012). We
observed real-time quantitative PCR-based can-
didate genes expression analysis in contrasting
potato cultivars (Tiwari et al. 2014). We also
performed transcriptome sequencing (RNA-seq)
for NUE using root and shoot samples of potato
variety Kufri Jyoti. Samples were collected at
different time intervals for two N treatments (N
starvation: 0 N and N sufficient: 7.5 mM N) to
study transcripts dynamics in potato for better
NUE. Samples were processed for library
preparation and followed by total RNA
sequencing on Ion Proton (ABI) as per the
manufacturer’s instructions, as, for example,
shown in Fig. 11.4.
In the vegetable crop of tomato, Ruzicka et al.
(2010) analyzed the transcriptome of the root in
response to a nitrogen-enriched soil patch. Root
transcriptome analysis identified 585 genes
180
Fig. 11.4 Image showing summary data generated by transcriptomes sequencing (RNA-Seq.) of potato leaf tissues of
aeroponically-grown plants with different N treatments to study genes associated with NUE in potato
differentially regulated 53 h after the treatments.
This response included an important role for the
mycorrhizal symbiosis in the utilization of an N
patch. In another study on cucumber, Zhao et al.
(2015) studied RNA-seq-based transcriptomes
profiling of early N deficiency response in
cucumber seedlings and identified more than
23,000 transcripts leaf tissue, of which 364 genes
were differentially expressed in response to N
deficiency. This study provides novel insights
into the responses of cucumber to nitrogen star-
vation at the global transcriptomes level, which
are expected to be highly useful for dissecting the
N response pathways in this major vegetable and
to improve N fertilization practices.
In a major cereal crop like rice, Nischal et al.
(2012) identified 32 microRNAs associated with
low-N tolerance in rice genotypes. Identification
of these regulatory elements associated with
J. K. Tiwari et al.
low-N tolerance is imperative to develop
low-N-tolerant crop plants, using gene manipu-
lation. Proteomes were analyzed for low and high
N-responsive proteins in the leaves of rice
genotypes grown at three N levels (Hakeem et al.
2012). Proteome analysis of the leaves revealed
that the proteins involved in the energy
production/regulation and metabolism in plant
leaf tissues are differentially expressed under N
treatments. This study could be useful in identi-
fying proteins responding to different levels of
nitrogen fertilization, which may open up new
avenues for a better understanding of NUE, and
to develop new strategies to enhance N efficiency
in cereal crops. Yang et al. (2015a) investigated
differentially expressed genes through
RNA-sequencing in rice under varied N supplies.
They observed that aldehyde dehydrogenase
seemed to have played an important role in rice
11 Genomics Approaches for Improving Nitrogen …
shoots under high ammonium conditions and
results implicated a coordinative regulation of
carbohydrate with amino acid metabolisms under
nitrogen deficiency, as well as the high ammo-
nium conditions in rice. In another study, they
identified 1650 genes that were differentially
expressed after 12 h of N-starvation. Responses
by those genes to a limited supply of N were
confirmed by RT-PCR and GUS assays. These
results provide valuable information about
N-starvation-responsive genes and will be useful
when investigating the signal transduction path-
way of N-utilization (Yang et al. 2015b). Zhang
et al. (2015) identified major QTLs on chromo-
some 12, the Tolerance Of Nitrogen Deficiency 1
(TOND1), that confers tolerance to N deficiency
in rice. Overexpression of TOND1 increased the
tolerance to N deficiency in the TOND1-deficient
rice cultivars. The identification of TOND1
provides a molecular basis for breeding rice
varieties with improved grain yield despite
decreased input of N fertilizers.
In the maize crop, numerous studies have
been conducted and it has more progress in NUE
research. In a few studies, Xu et al. (2011)
identified genome-wide microRNAs in response
to low nitrate availability in maize leaves and
roots. This study provides an insight into the
timing and tissue specificity of the transcriptional
regulation to low nitrate availability in maize,
and also how to develop strategies for maize
improvement. The discovery of a total of 99
absolutely new loci belonging to 47 miRNA
families by small RNA deep sequencing and
degradome sequencing in response to N defi-
ciency in maize is a unique achievement (Zhao
et al. 2012). Bioinformatic and subsequent small
RNA northern blot analysis identified eight
miRNA families differentially expressed under
the N-deficient condition. Liu et al. (2012)
studied mining of candidate genes for NUE in
maize genotypes by integrating gene expression
and QTL data under N sufficient and N limitation
conditions. It is suggested that a high NUE
genotype should have efficient C assimilation per
unit N and actively express CO2
assimilation-related genes under N-limited con-
ditions. Bi et al. (2014) investigated
181
high-throughput RNA sequencing of a hybrid
maize and its parent showed different mecha-
nisms responsive to N limitation. The data
showed that the three genotypes respond very
differently to N-limiting conditions, and the
hybrid clearly has a unique expression pattern
compared to its parents. Results expand our
current understanding of N responses and will
help to design effective strategies to improve
NUE and enhance crop production.
In wheat, Cormier et al. (2014) identified 333
chromosomal regions associated with 28 traits
determining NUE in European wheat, using
genome-wide association in a 214-varieties panel
experimented under eight environments. In other
crops, Deng et al. (2014) analyzed comparative
proteomes under N stress in ramie, a fibre crop,
using MALDI-TOF/TOF mass spectrometry and
provided important information for further study
on the high-efficiency N utilization mechanism of
ramie. Recently, transcriptome analysis of N
starvation and cultivar-specific leaf senescence in
winter oilseed rape has been investigated
(Koeslin-Findeklee et al. 2015). They identified
genes representing markers for the detection of
cultivar-specific differences in N
starvation-induced leaf senescence and these can
thus be employed as valuable tools in B. napus
breeding.
Taken together, linking plant phenotype to
gene and protein expression and also to
metabolite synthesis and accumulation is one of
the main challenges to improve crop production
worldwide. The impact of N deficiency was
examined to identify key steps involved in the
control of nitrogen metabolism at the transcrip-
tomic, proteomic and metabolomic levels in
maize. It was found that a number of key plant
biological functions were altered during N stress.
The genetic and metabolic alterations were dif-
ferent during the N assimilation and the
grain-filling period, indicating that plant devel-
opment is an important component in identifying
the key elements involved in the control of plant
NUE. It was also found that integration of the
three omics studies is not straightforward, since
different levels of regulation seem to occur in a
stepwise manner from gene expression to
182
M 1 2 3 4 5
bp
2000
1500
1000
500
Fig. 11.5 PCR amplification products of two contrasting potato varieties Kufri Jyoti (least N efficient) and Kufri
Gaurav (most N efficient) using gene-specific primers involved in the N metabolism pathways in the potato genome
metabolite accumulation (Amiour et al. 2012). In
another work, Fukushima and Kusano (2014)
studied a network perspective of nitrogen meta-
bolism from model to crop plants using integrated
omics approaches. Omics approaches, such as
metabolomics and transcriptomics have become a
promising way to inspect complex network
interactions in N metabolism and can be used for
monitoring the uptake and regulation, transloca-
tion, and remobilization of N. The importance of
improving NUE in crops as well as an overview
of the transcriptome, proteome and metabolome
datasets available, focusing on a comprehensive
understanding of nitrogen regulation has been
highlighted (Simons et al. 2014). Omics data are
hard to interpret in the absence of metabolic flux
information within genome-scale models. These
models, when integrated with omics data, can
serve as a basis for generating predictions that
focus and guide further experimental studies.
In addition, knowledge about how miRNAs are
involved in plant responses to N stresses promises
to provide novel strategies to develop crops with
improved NUE that could be grown in soils with
either high or low N availability. The role of micro
RNAs in plant responses to N metabolism and
controlling uptake and assimilation pathways has
been reviewed (Zeng et al. 2014). In another
review, an overview of recent advances in under-
standing the regulation of N metabolism by the
action of microRNAs with a view toward engi-
neering crops with increased nitrogen use effi-
ciency has been discussed (Fischer et al. 2013).
Thus, based on the studies in other crops, there is a
need to apply omics technologies in the potato
crop to advance NUE research and discover new
J. K. Tiwari et al.
6 7 8 9 10 11 12 M
genes/markers for potato improvement with better
NUE when applying breeding and/or gene
manipulation methods.
We analyzed sequence variations for
N-metabolism genes in potato. To unravel the
sequence variations among the genes involved in
nitrogen metabolism pathways, a total of 20
genes-specific primer pairs were used. Genes
were selected for the various pathways such as N
uptake/transporters, utilization and assimilation
from the potato and a few from the tomato gen-
omes. Leaf samples were PCR amplified using
genes-specific primers from the potato genome
database of genomic DNA from potato cultivars
Kufri Jyoti (N inefficient) and Kufri Pukhraj
(N-use efficient). Following this, PCR amplifi-
cation products were analyzed as shown in
Fig. 11.5 and later sequence variations and
diversity for the genes involved in nitrogen
metabolism pathways were also assessed, as
depicted in Fig. 11.6.
11.4.4 Transgenics
Transgenic technology has been used in many
crops for target traits using gene manipulation
techniques through overexpression and/or gene
knock-out mechanisms. There are several trans-
genic reports available in crop plants on the
application of these technologies. In a study, Lin
et al. (2013) concluded that overexpression of the
ZmDof1 gene in Populus does not improve
growth and nitrogen assimilation under low N
conditions. On the contrary, overexpression of
Arabidopsis Dof1, GS1 and GS2 enhanced N
11 Genomics Approaches for Improving Nitrogen … 183

100 KU965581 AMT KJ

100 KU965582 AMT KG

80 PGSC0003DMT400049775 AMT

PGSC0003DMT400031304 NRT

100 KU965591 NRT KJ

98
88 KU965592 NRT KG

KU965584 LeAMT KG

100 KU965583 LeAMT KJ

91 NM001247287.1 LeAMT1-3

95 KU965589 NR KJ
100 KU965590 NR KG

PGSC0003DMT400077648 NIR

100 KU965585 AS KJ
100 KU965586 AS KG

PGSC0003DMT400010685 AS
99 PGSC0003DMT400021310 NIR

100 KU965587 NIR KJ

100 KU965588 NIR KG

0.80 0.60 0.40 0.20 0.00

Fig. 11.6 A cluster analysis of the nucleotide sequences N-metabolism genes based on the NJ coefficient by the
UPGMA method

assimilation in transgenic tobacco grown under
low N conditions (Wang et al. 2013). Beatty
et al. (2013) developed alanine aminotransferase
overexpressing rice and measured various
parameters such as morphology, plant N levels,
enzymatic activity, metabolite levels, and tran-
scriptome response in the roots and shoots of
NUE under different N (low, medium and high)
regimes. Further cloning and characterization of
a high-affinity nitrate transporter gene
BraNRT2.1 in non-heading Chinese cabbage that
participates in nitrate uptake were demonstrated
(Liu et al. 2014). These findings provide a
foundation for future studies and plant breeding
to improve NUE and to reduce the accumulation
of nitrates in vegetables.
11.4.5 Molecular Breeding
11.4.5.1 Marker-Assisted Selection
(MAS)
Molecular markers closely associated with a
target trait can be used to increases the speed of
selection of genotype in less time. First, the
development of molecular markers linked to
QTL or the candidate gene is essential and then
comes their deployment in a breeding program.
In potato, most marker-assisted selections
(MAS) have been used for disease resistance
such as late blight (Tiwari et al. 2013) and
viruses (Tiwari et al. 2012). The recent advances
in sequencing technologies and the reducing
costs of high-throughput genotyping facilities
will lead to the development of new markers for
more complex traits like NUE in potato for MAS
(Ramakrishnan et al. 2015).
11.4.5.2 Genome-Wide Selection (GWS)
In the recent genomics technologies,
genome-wide selection (GWS) is one of the
emerging breeding methods by which several
germplasm types could be genotyped using
hundreds or thousands of SNPs to hasten the
improvement program. Many research groups
have explored the GWS technique in crop
improvement (Bernardo 2010). In potato,
genome-wide association mapping is possible
184
using the 8300 SolCAP SNPs panel. Another
more recent approach to develop SNPs is through
genotyping-by-sequencing (GBS) technology to
enhance crop breeding (Elshire et al. 2011). This
technique was used to characterize 83 tetraploid
potato cultivars with over 57,000 genes of vari-
ous traits (Uitdewilligen et al. 2013).
11.4.5.3 Genomic Selection (GS)
Genomic selection (GS) is a very novel breeding
method. Its success depends upon diverse and a
truly representative training population and their
precise phenotyping, as studied recently in wheat
for stem rust resistance (Rutkoski et al. 2010).
GS is a novel approach to develop elite lines with
overall excellent performance in a target envi-
ronment and it reduces the frequency of pheno-
typing and similarly also increases annual gains
from selection by reducing the cycle time (Rut-
koski et al. 2010). Thus, next generation breed-
ing methods based on the sequencing
technologies promise to revolutionize screening
and further breeding for the desirable traits of
crops.
11.4.5.4 Genome Editing, a New
Breeding Tool
With the advent of new techniques for manipu-
lating genes and genomes that are applicable now
to plants comes the use of gene editing tools such
as zinc finger nucleases, meganucleases, hybrid
DNA/RNA oligonucleotides, TAL effector
nucleases and the more recent one is
CRISPR/Cas9. These tools precisely target one
specific DNA sequence within a genome to
modify a double-stranded DNA. Creation and
use of such genome rearrangements, gene
knock-outs and gene replacements by the plant
science community are gaining significant
momentum. To explore the technology’s
longer-term potential, the future uses of designer
J. K. Tiwari et al.
nucleases have the potential to greatly expedite
research with model plant systems and to engi-
neer genes and genomes in major and minor crop
species for enhanced food production.
11.5 Conclusion
In the present century, increasing population
pressure, degrading soil health, limited cultivable
land, increasing environmental pollution and
increasing cost of N fertilizers are challenging
tasks at the global level. Hence, to meet the
global food demand under the sustainable agri-
culture system, it is imperative to develop potato
crop varieties that can be grown on poor soil with
less N fertilizer input. Moreover, with the
advances in sequencing technology and the
whole genome sequence of the potato genome,
the application of genomics and novel breeding
approaches are inevitable to improve the nitrogen
use efficiency of the potato crop. The whole
genome sequencing data will provide in-depth
information about the genes involved in various
nitrogen metabolism pathways. Some of the
selected genes involved in the N metabolism
pathways are listed in Table 11.1, as retrieved
from the Potato genome sequence database
(http://solanaceae.plantbiology.msu.edu/pgsc_
download.shtml). Identification of key traits
associated with N use efficiency, accurate esti-
mation of N content and its variable parameters
and precise plant phenotyping are the important
criteria for improving NUE. Later applications of
advance genetics and novel genomics as well as
breeding tools (transcriptomics, proteomics,
metabolomics, genome re-sequencing,
markers/genomics-assisted breeding, genomic
selection, genotyping-by-sequencing, genome
editing etc.) are important for potato improve-
ment with better NUE.
Table 11.1 List of some major genes associated with N metabolism in the potato genome
SN Gene
Nitrate transporter (NRT)
1 PGSC0003DMG400000713
2 PGSC0003DMG400000713
3 PGSC0003DMG400018235
4 PGSC0003DMG400006913
5 PGSC0003DMG402021183
6 PGSC0003DMG400025334
7 PGSC0003DMG400025334
8 PGSC0003DMG400025334
9 PGSC0003DMG400025334
10 PGSC0003DMG400025336
11 PGSC0003DMG400025336
12 PGSC0003DMG400025337
13 PGSC0003DMG400025339
14 PGSC0003DMG400027817
15 PGSC0003DMG403002548
16 PGSC0003DMG400002865
17 PGSC0003DMG400002865
18 PGSC0003DMG400002865
19 PGSC0003DMG400011691
20 PGSC0003DMG400011692
21 PGSC0003DMG400011692
22 PGSC0003DMG400011692
11
Transcript CDS Peptide Description Chr
PGSC0003DMT400001893 PGSC0003DMC400001392 PGSC0003DMP400001392 Nitrate and chloride 1
transporter
PGSC0003DMT400001894 PGSC0003DMC400001393 PGSC0003DMP400001393 Nitrate and chloride 1
transporter
PGSC0003DMT400046950 PGSC0003DMC400031768 PGSC0003DMP400031768 Nitrate transporter 1
PGSC0003DMT400017804 PGSC0003DMC400012236 PGSC0003DMP400012236 Nitrate transporter 2
PGSC0003DMT400054593 PGSC0003DMC400036729 PGSC0003DMP400036729 Nitrate transporter 2
PGSC0003DMT400065182 PGSC0003DMC400043949 PGSC0003DMP400043949 Nitrate transporter 3
PGSC0003DMT400065184 PGSC0003DMC400043950 PGSC0003DMP400043950 Nitrate transporter 3
PGSC0003DMT400065185 PGSC0003DMC400043951 PGSC0003DMP400043951 Nitrate transporter 3
PGSC0003DMT400065187 PGSC0003DMC400043952 PGSC0003DMP400043952 Nitrate transporter 3
Genomics Approaches for Improving Nitrogen …
PGSC0003DMT400065194 PGSC0003DMC400043957 PGSC0003DMP400043957 Nitrate transporter 3
NRT1-5
PGSC0003DMT400065196 PGSC0003DMC400043958 PGSC0003DMP400043958 Nitrate transporter 3
NRT1-5
PGSC0003DMT400065197 PGSC0003DMC400043959 PGSC0003DMP400043959 Nitrate transporter 3
PGSC0003DMT400065200 PGSC0003DMC400043961 PGSC0003DMP400043961 Nitrate transporter 3
PGSC0003DMT400071504 PGSC0003DMC400048381 PGSC0003DMP400048381 Nitrate transporter 3
PGSC0003DMT400006545 PGSC0003DMC400004535 PGSC0003DMP400004535 Nitrate transporter 3
PGSC0003DMT400007439 PGSC0003DMC400005174 PGSC0003DMP400005174 Nitrate transporter 4
PGSC0003DMT400007440 PGSC0003DMC400005175 PGSC0003DMP400005175 Nitrate transporter 4
PGSC0003DMT400007441 PGSC0003DMC400005176 PGSC0003DMP400005176 Nitrate transporter 4
PGSC0003DMT400030530 PGSC0003DMC400020728 PGSC0003DMP400020728 Nitrate transporter 4
PGSC0003DMT400030531 PGSC0003DMC400020729 PGSC0003DMP400020729 Nitrate transporter 4
PGSC0003DMT400030532 PGSC0003DMC400020730 PGSC0003DMP400020730 Nitrate transporter 4
PGSC0003DMT400030533 PGSC0003DMC400020731 PGSC0003DMP400020731 Nitrate transporter 4
(continued)
185
Table 11.1 (continued)
186

SN Gene Transcript CDS Peptide Description Chr

23 PGSC0003DMG400011693 PGSC0003DMT400030534 PGSC0003DMC400020732 PGSC0003DMP400020732 Nitrate transporter 4
24 PGSC0003DMG403011681 PGSC0003DMT400030502 PGSC0003DMC400020707 PGSC0003DMP400020707 Nitrate transporter 4
25 PGSC0003DMG400004134 PGSC0003DMT400010582 PGSC0003DMC400007390 PGSC0003DMP400007390 Nitrate transporter 5
26 PGSC0003DMG400015591 PGSC0003DMT400040275 PGSC0003DMC400027319 PGSC0003DMP400027319 Nitrate transporter 5
27 PGSC0003DMG400015591 PGSC0003DMT400040276 PGSC0003DMC400027320 PGSC0003DMP400027320 Nitrate transporter 5
28 PGSC0003DMG400015592 PGSC0003DMT400040277 PGSC0003DMC400027321 PGSC0003DMP400027321 Nitrate transporter 5
29 PGSC0003DMG400016996 PGSC0003DMT400043794 PGSC0003DMC400029708 PGSC0003DMP400029708 Nitrate transporter 5
30 PGSC0003DMG400017620 PGSC0003DMT400045412 PGSC0003DMC400030769 PGSC0003DMP400030769 Nitrate transporter 5
31 PGSC0003DMG400017620 PGSC0003DMT400045414 PGSC0003DMC400030770 PGSC0003DMP400030770 Nitrate transporter 5
32 PGSC0003DMG400017621 PGSC0003DMT400045415 PGSC0003DMC400030771 PGSC0003DMP400030771 Nitrate transporter 5
33 PGSC0003DMG400017621 PGSC0003DMT400045416 PGSC0003DMC400030772 PGSC0003DMP400030772 Nitrate transporter 5
34 PGSC0003DMG400017637 PGSC0003DMT400045466 PGSC0003DMC400030807 PGSC0003DMP400030807 Nitrate transporter 5
35 PGSC0003DMG400038206 PGSC0003DMT400088635 PGSC0003DMC400060310 PGSC0003DMP400060310 Nitrate transporter 5
36 PGSC0003DMG401015590 PGSC0003DMT400040272 PGSC0003DMC400027317 PGSC0003DMP400027317 Nitrate transporter 5
37 PGSC0003DMG402015590 PGSC0003DMT400040274 PGSC0003DMC400027318 PGSC0003DMP400027318 Nitrate transporter 5
38 PGSC0003DMG400007512 PGSC0003DMT400019427 PGSC0003DMC400013300 PGSC0003DMP400013300 Nitrate excretion 6
transporter 2
39 PGSC0003DMG400013815 PGSC0003DMT400035882 PGSC0003DMC400024385 PGSC0003DMP400024385 Nitrate transporter 6
40 PGSC0003DMG400025395 PGSC0003DMT400065325 PGSC0003DMC400044047 PGSC0003DMP400044047 Nitrate transporter 6
41 PGSC0003DMG400025395 PGSC0003DMT400065326 PGSC0003DMC400044048 PGSC0003DMP400044048 Nitrate transporter 6
42 PGSC0003DMG400025395 PGSC0003DMT400065327 PGSC0003DMC400044049 PGSC0003DMP400044049 Nitrate transporter 6
43 PGSC0003DMG400025395 PGSC0003DMT400065328 PGSC0003DMC400044050 PGSC0003DMP400044050 Nitrate transporter 6
44 PGSC0003DMG400025395 PGSC0003DMT400065329 PGSC0003DMC400044051 PGSC0003DMP400044051 Nitrate transporter 6
45 PGSC0003DMG400027083 PGSC0003DMT400069660 PGSC0003DMC400047041 PGSC0003DMP400047041 Nitrate transporter 6
46 PGSC0003DMG400030263 PGSC0003DMT400077799 PGSC0003DMC400052684 PGSC0003DMP400052684 Nitrate transporter 6
47 PGSC0003DMG400033068 PGSC0003DMT400083131 PGSC0003DMC400055838 PGSC0003DMP400055838 6
(continued)
J. K. Tiwari et al.
Table 11.1 (continued)
11

SN Gene Transcript CDS Peptide Description Chr

Nitrate transporter
NRT1-2
48 PGSC0003DMG400033068 PGSC0003DMT400083133 PGSC0003DMC400055839 PGSC0003DMP400055839 Nitrate transporter 6
NRT1-2
49 PGSC0003DMG400033097 PGSC0003DMT400083177 PGSC0003DMC400055873 PGSC0003DMP400055873 Nitrate transporter 6
50 PGSC0003DMG401011998 PGSC0003DMT400031304 PGSC0003DMC400021230 PGSC0003DMP400021230 High-affinity nitrate 6
transporter
51 PGSC0003DMG402000668 PGSC0003DMT400001782 PGSC0003DMC400001316 PGSC0003DMP400001316 Nitrate transporter 7
NRT1.1
52 PGSC0003DMG402000668 PGSC0003DMT400001783 PGSC0003DMC400001317 PGSC0003DMP400001317 Nitrate transporter 7
NRT1.1
53 PGSC0003DMG402000668 PGSC0003DMT400001784 PGSC0003DMC400001318 PGSC0003DMP400001318 Nitrate transporter 7
NRT1.1
Genomics Approaches for Improving Nitrogen …

54 PGSC0003DMG400004795 PGSC0003DMT400012225 PGSC0003DMC400008498 PGSC0003DMP400008498 Nitrate transporter 8

55 PGSC0003DMG400004795
56 PGSC0003DMG400012479
57 PGSC0003DMG400004329
58 PGSC0003DMG400004329
59 PGSC0003DMG400042160
60 PGSC0003DMG400000303
61 PGSC0003DMG400026455
62 PGSC0003DMG400026455
63 PGSC0003DMG400029396
64 PGSC0003DMG400029396
Nitrate reductase (NR)
65 PGSC0003DMG400030212
66 PGSC0003DMG400030212
PGSC0003DMT400012226 PGSC0003DMC400008499 PGSC0003DMP400008499 Nitrate transporter 8
PGSC0003DMT400032493 PGSC0003DMC400022078 PGSC0003DMP400022078 Nitrate transporter 8
PGSC0003DMT400011062 PGSC0003DMC400007697 PGSC0003DMP400007697 Nitrate transporter 10
PGSC0003DMT400011063 PGSC0003DMC400007698 PGSC0003DMP400007698 Nitrate transporter 10
PGSC0003DMT400092589 PGSC0003DMC400064264 PGSC0003DMP400064264 Nitrate transporter 10
PGSC0003DMT400000812 PGSC0003DMC400000603 PGSC0003DMP400000603 Nitrate transporter 12
PGSC0003DMT400068025 PGSC0003DMC400045945 PGSC0003DMP400045945 Nitrate transporter 12
PGSC0003DMT400068026 PGSC0003DMC400045946 PGSC0003DMP400045946 Nitrate transporter 12
PGSC0003DMT400075589 PGSC0003DMC400051197 PGSC0003DMP400051197 Nitrate transporter 12
PGSC0003DMT400075590 PGSC0003DMC400051198 PGSC0003DMP400051198 Nitrate transporter 12
PGSC0003DMT400077646 PGSC0003DMC400052591 PGSC0003DMP400052591 Nitrate reductase 11
PGSC0003DMT400077647 PGSC0003DMC400052592 PGSC0003DMP400052592 Nitrate reductase 11
(continued)
187
Table 11.1 (continued)
SN Gene
67 PGSC0003DMG400030212
Nitrite reductase (NiR)
68 PGSC0003DMG400025823
69 PGSC0003DMG400008262
Glutamine synthetase (GS)
70 PGSC0003DMG400004355
71 PGSC0003DMG400023620
72 PGSC0003DMG400014592
73 PGSC0003DMG400017703
74 PGSC0003DMG400017703
75 PGSC0003DMG400013235
76 PGSC0003DMG400014454
Asparagine synthetase (AS)
77 PGSC0003DMG400028314
78 PGSC0003DMG400028314
79 PGSC0003DMG400028314
80 PGSC0003DMG400004170
81 PGSC0003DMG400004170
Ammonium transporter (AMT)
82 PGSC0003DMG400046020
83 PGSC0003DMG400018761
84 PGSC0003DMG400018761
85 PGSC0003DMG400018761
188
Transcript CDS Peptide Description Chr
PGSC0003DMT400077648 PGSC0003DMC400052593 PGSC0003DMP400052593 Nitrate reductase 11
PGSC0003DMT400066399 PGSC0003DMC400044761 PGSC0003DMP400044761 Nitrite reductase 1
PGSC0003DMT400021310 PGSC0003DMC400014494 PGSC0003DMP400014494 Nitrite reductase 10
PGSC0003DMT400011133 PGSC0003DMC400007746 PGSC0003DMP400007746 Glutamine synthetase 1
PGSC0003DMT400060733 PGSC0003DMC400040866 PGSC0003DMP400040866 Glutamine synthetase 4
PGSC0003DMT400037822 PGSC0003DMC400025701 PGSC0003DMP400025701 Glutamine synthetase 5
PGSC0003DMT400045640 PGSC0003DMC400030933 PGSC0003DMP400030933 Glutamine synthetase 8
PGSC0003DMT400045641 PGSC0003DMC400030934 PGSC0003DMP400030934 Glutamine synthetase 8
PGSC0003DMT400034421 PGSC0003DMC400023400 PGSC0003DMP400023400 Glutamine synthetase 11
PGSC0003DMT400037457 PGSC0003DMC400025464 PGSC0003DMP400025464 Glutamine synthetase 12
PGSC0003DMT400072757 PGSC0003DMC400049219 PGSC0003DMP400049219 Asparagine synthetase 5
PGSC0003DMT400072758 PGSC0003DMC400049220 PGSC0003DMP400049220 Asparagine synthetase 5
PGSC0003DMT400072759 PGSC0003DMC400049221 PGSC0003DMP400049221 Asparagine synthetase 5
PGSC0003DMT400010684 PGSC0003DMC400007463 PGSC0003DMP400007463 Asparagine synthetase 6
[glutamine-hydrolyzing]
PGSC0003DMT400010685 PGSC0003DMC400007464 PGSC0003DMP400007464 Asparagine synthetase 6
[glutamine-hydrolyzing]
PGSC0003DMT400096449 PGSC0003DMC400068124 PGSC0003DMP400068124 Ammonium transporter 1
PGSC0003DMT400048283 PGSC0003DMC400032696 PGSC0003DMP400032696 Ammonium transporter 1 3
member 3
PGSC0003DMT400048284 PGSC0003DMC400032697 PGSC0003DMP400032697 Ammonium transporter 1 3
member 3
PGSC0003DMT400048285 PGSC0003DMC400032698 PGSC0003DMP400032698 3
(continued)
J. K. Tiwari et al.
Table 11.1 (continued)
11

SN Gene Transcript CDS Peptide Description Chr

Ammonium transporter 1
member 3
86 PGSC0003DMG400022523 PGSC0003DMT400058011 PGSC0003DMC400039042 PGSC0003DMP400039042 Ammonium transporter 3
87 PGSC0003DMG400028710 PGSC0003DMT400073887 PGSC0003DMC400050012 PGSC0003DMP400050012 Ammonium transporter 1 4
member 2
88 PGSC0003DMG400023149 PGSC0003DMT400059578 PGSC0003DMC400040097 PGSC0003DMP400040097 Ammonium transporter 8
89 PGSC0003DMG400001508 PGSC0003DMT400003805 PGSC0003DMC400002712 PGSC0003DMP400002712 Ammonium transporter 1 9
member 1
90 PGSC0003DMG400019338 PGSC0003DMT400049775 PGSC0003DMC400033595 PGSC0003DMP400033595 Ammonium transporter 9
Alanine aminotransferase (AlaAT)/Aspartate aminotransferase (AsaAT)
91 PGSC0003DMG400004899 PGSC0003DMT400012549 PGSC0003DMC400008716 PGSC0003DMP400008716 Alanine aminotransferase 6
92 PGSC0003DMG400027919 PGSC0003DMT400071775 PGSC0003DMC400048549 PGSC0003DMP400048549 Aspartate 4
aminotransferase
Genomics Approaches for Improving Nitrogen …

93 PGSC0003DMG400027919 PGSC0003DMT400071776 PGSC0003DMC400048550 PGSC0003DMP400048550 Aspartate 4

aminotransferase
94 PGSC0003DMG400041984 PGSC0003DMT400092413 PGSC0003DMC400064088 PGSC0003DMP400064088 Aspartate 5
aminotransferase
95 PGSC0003DMG400015637 PGSC0003DMT400040385 PGSC0003DMC400027394 PGSC0003DMP400027394 Aspartate 7
aminotransferase
96 PGSC0003DMG400020416 PGSC0003DMT400052597 PGSC0003DMC400035458 PGSC0003DMP400035458 Aspartate 7
aminotransferase
97 PGSC0003DMG400010840 PGSC0003DMT400028105 PGSC0003DMC400019157 PGSC0003DMP400019157 Aspartate 8
aminotransferase
98 PGSC0003DMG400010840 PGSC0003DMT400028106 PGSC0003DMC400019158 PGSC0003DMP400019158 Aspartate 8
aminotransferase
99 PGSC0003DMG400029897 PGSC0003DMT400076865 PGSC0003DMC400052080 PGSC0003DMP400052080 Aspartate 8
aminotransferase
100 PGSC0003DMG400029897 PGSC0003DMT400076866 PGSC0003DMC400052081 PGSC0003DMP400052081 Aspartate 8
aminotransferase
(continued)
189
Table 11.1 (continued)
190

SN Gene Transcript CDS Peptide Description Chr

101 PGSC0003DMG400006678
102 PGSC0003DMG400006678
103 PGSC0003DMG400006678
104 PGSC0003DMG400006678
105 PGSC0003DMG400022929
DOF transcription factor (TF)
106 PGSC0003DMG400013105
107 PGSC0003DMG400011680
108 PGSC0003DMG400004062
109 PGSC0003DMG400007506
110 PGSC0003DMG400007506
111 PGSC0003DMG400029191
112 PGSC0003DMG400027089
PGSC0003DMT400017110 PGSC0003DMC400011810 PGSC0003DMP400011810 Aspartate 10
aminotransferase
PGSC0003DMT400017111 PGSC0003DMC400011811 PGSC0003DMP400011811 Aspartate 10
aminotransferase
PGSC0003DMT400017112 PGSC0003DMC400011812 PGSC0003DMP400011812 Aspartate 10
aminotransferase
PGSC0003DMT400017113 PGSC0003DMC400011813 PGSC0003DMP400011813 Aspartate 10
aminotransferase
PGSC0003DMT400059031 PGSC0003DMC400039762 PGSC0003DMP400039762 Aspartate 11
aminotransferase
PGSC0003DMT400034111 PGSC0003DMC400023207 PGSC0003DMP400023207 DOF domain class TF 2
PGSC0003DMT400030496 PGSC0003DMC400020702 PGSC0003DMP400020702 DOF domain class TF 4
PGSC0003DMT400010397 PGSC0003DMC400007249 PGSC0003DMP400007249 DOF domain class TF 6
PGSC0003DMT400019415 PGSC0003DMC400013292 PGSC0003DMP400013292 DOF domain class TF 6
PGSC0003DMT400019416 PGSC0003DMC400013293 PGSC0003DMP400013293 DOF domain class TF 6
PGSC0003DMT400075051 PGSC0003DMC400050832 PGSC0003DMP400050832 DOF domain class TF 6
PGSC0003DMT400069680 PGSC0003DMC400047058 PGSC0003DMP400047058 DOF domain class TF 6
J. K. Tiwari et al.
11 Genomics Approaches for Improving Nitrogen …
References
Amiour N, Imbaud S, Clément G, Agier N, Zivy M,
Valot B, Balliau T, Armengaud P, Quilleré I, Cañas R,
Tercet-Laforgue T, Hirel B (2012) The use of
metabolomics integrated with transcriptomic and pro-
teomic studies for identifying key steps involved in the
control of nitrogen metabolism in crops such as maize.
J Exp Bot 63(14):5017–5033
Baligar VC, Fageria NK, He ZL (2001) Nutrient use
efficiency in plants. Comm Soil Sci Plant Anal 32
(7):921–950
Beatty PH, Carroll RT, Shrawat AK, Guevara D,
Good AG (2013) Physiological analysis of
nitrogen-efficient rice overexpressing alanine amino-
transferase under different N regimes. Botany 91:
866–883
Berger B, de Regt B, Tester M (2013) Applications of
high-throughput plant phenotyping to study nutrient
use efficiency. In: Frans JMM (ed) Plant mineral
nutrients: methods and protocols, methods in molec-
ular biology, Springer Science & Business Media,
LLC. 953:277–290
Bernardo R (2010) Genome wide selection with minimal
crossing in self-pollinated crops. Crop Sci 50:624–627
Bi Y-M, Meyer A, Downs GS, Shi X, El-kereamy A,
Lukens L, Rothstein SJ (2014) High throughput RNA
sequencing of a hybrid maize and its parents shows
different mechanisms responsive to nitrogen limita-
tion. BMC Genom 15:77
Bishopp A, Lynch JP (2015) The hidden half of crop
yields. Nat Plants 1:1–2
Bouchet A-S, Nesi N, Bissuel C, Bregeon M, Lariepe A,
Navier H, Ribie`re N, Orsel M, Grezes-Besset B,
Renard M, Laperche A (2014) Genetic control of yield
and yield components in winter oilseed rape (Brassica
napus L.) grown under nitrogen limitation. Euphytica
199:183–205
Buckseth T, Sharma AK, Pandey KK, Singh BP, Muthu-
raj R (2016) Methods of pre-basic seed potato
production with special reference to aeroponics—A
review. Scientia Hort 204:79–87
Cao W, Tibbitts TW (1998) Response of potatoes to
nitrogen concentrations differ with nitrogen forms.
J Plant Nut 21:615–623
Chietera G, Chardon F (2014) Natural variation as a tool
to investigate nutrient use efficiency in plants. In:
Hawkesford MJ et al. (eds) Nutrient use efficiency in
plants. Plant Ecophysiol 10. Doi:10.1007/978-3-319-
10635-9_2
Cormier F, Faure S, Dubreuil P, Heumez E, Beauchêne K,
Lafarge S, Praud S, Gouis JL (2013) A multi–
environmental study of recent breeding progress on
nitrogen use efficiency in wheat (Triticum aestivum
L.). Theor Appl Genet 126:3035–3048
Cormier F, Le Gouis J, Dubreuil P, Lafarge S, Praud S
(2014) A genome-wide identification of chromosomal
regions determining nitrogen use efficiency
191
components in wheat (Triticum aestivum L.). Theor
Appl Genet 127(12):2679–2693
Cui F, Fan X, Zhao C, Zhang W, Chen M, Ji J, Li J (2014)
A novel genetic map of wheat: utility for mapping
QTL for yield under different nitrogen treatments.
BMC Genet 15:57
Da-wei H, Zhou-ping S, Tian-lai L, Hong-zhi Y, Hua Z
(2014) Nitrogen nutrition index and its relationship
with N use efficiency, tuber yield, radiation use
efficiency, and leaf parameters in potatoes. J Integ
Agric 13(5):1008–1016
Deng G, Liu LJ, Zhong XY, Lao CY, Wang HY,
Wang B, Zhu C, Shah F, Peng DX (2014) Compar-
ative proteome analysis of the response of ramie under
N, P and K deficiency. Planta 239:1175–1186
Elshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K,
Buckler ES, Mitchell SE (2011) A robust, simple
genotyping-by-sequencing (GBS) approach for high
diversity species. PLoS ONE 6(5):e19379
Errebhi M, Rosen CJ, Lauer FI, Martin MW, Bamberg JB,
Birong DE (1998) Screening of exotic potato
germplasm for nitrogen uptake and biomass produc-
tion. Am J Potato Res 75:93–100
Errebhi M, Rosen CJ, Lauer FI, Martin MW, Bamberg JB
(1999) Evaluation of tuber-bearing Solanum species
for nitrogen use efficiency and biomass partitioning.
Am J Potato Res 76:143–151
Fageria NK, Baligar VC (2005) Enhancing nitrogen use
efficiency in crop plants. Adv Agron 88:97–185
Fageria NK, Baligar VC, Li YC (2008) The Role of
nutrient efficient plants in improving crop yields in the
twenty first century. J Plant Nutr 31:1121–1157
FAOSTAT (2014) www.fao.org/faostat/en/
Fischer JJ, Beatty PH, Good AG, Muencha DG (2013)
Manipulation of microRNA expression to improve
nitrogen use efficiency. Plant Sci 210:70–81
Fukushima A, Kusano M (2014) A network perspective
on nitrogen metabolism from model to crop plants
using integrated ‘omics’ approaches. J Exp Bot
65:5619–5630
Gaju O, Allard V, Martre P, Snape JW, Heumez E,
LeGouis J, Moreau D, Bogard M, Griffiths S,
Orford S, Hubbart S, Foulkes MJ (2011) Identification
of traits to improve the nitrogen-use efficiency of
wheat genotypes. Field Crops Res 123:139–152
Gao Y, Jia L, Hu B, Alva A, Fan M (2014) Potato stolon
and tuber growth influenced by nitrogen form. Plant
Prod Sci 17:138–143
Garnett T, Conn V, Kaiser BN (2009) Root based
approaches to improving nitrogen use efficiency in
plants. Plant Cell Env 32:1272–1283
Garnett T, Plett D, Heuer S, Okamoto M (2015) Genetic
approaches to enhancing nitrogen-use efficiency
(NUE) in cereals: challenges and future directions.
Func Plant Biol 42:921–941
Gebbers R, Adamchuk VI (2010) Precision agriculture
and food security. Science 327:828–831
Goffart JP, Olivier M, Frankinet M (2008) Potato crop
nitrogen status assessment to improve N fertilization
192
management and efficiency: past-present-future.
Potato Res 51:355–383
Govindakrishnan PM, Sharma RC, Khan IA, Sharma HC
(1999) A technique for selecting potato (Solanum
tuberosum) genotypes with low nitrogen requirement.
Indian J Agric Sci 69:350–354
Habash DZ, Bernard S, Schondelmaier J, Weyen J,
Quarrie SA (2007) The genetics of nitrogen use in
hexaploid wheat: N utilisation, development and yield.
Theor Appl Genet 114:403–419
Hakeem KR, Chandna R, Ahmad A, Qureshi MI, Iqbal M
(2012) Proteomic analysis for low and high
nitrogen-responsive proteins in the leaves of rice
genotypes grown at three nitrogen levels. Appl
Biochem Biotech 168(4):834–850
Iwama K (2008) Physiology of the potato: new insights
into root system and repercussions for crop manage-
ment. Potato Res 51:333–353
Kindu GA, Tang J, Yin X, Struik PC (2014) Quantitative
trait locus analysis of nitrogen use efficiency in barley
(Hordeum vulgare L.). Euphytica 199:207–221
Koeslin-Findeklee F, Rizi VS, Becker MA,
Parra-Londono S, Arif M, Balazadeh S,
Mueller-Roeber B, Kunze R, Horst WJ (2015) Tran-
scriptomic analysis of nitrogen starvation- and
cultivar-specific leaf senescence in winter oilseed rape
(Brassica napus L.). Plant Sci 233:174–185
Li P, Chen F, Cai H, Liu J, Pan Q, Liu Z, Gu R, Mi G,
Zhang F, Yuan L (2015) A genetic relationship
between nitrogen use efficiency and seedling root
traits in maize as revealed by QTL analysis. J Exp Bot
66(11):3175–3188
Li XQ, Sveshnikov D, Zebarth BJ, Tai H, De Koeyer D,
Millard P, Haroon M, Singh M (2010) Detection of
Nitrogen Sufficiency in Potato Plants Using Gene
Expression Markers. Am J Potato Res 87(1):50–59
Lin W, Hagen E, Fulcher A, Hren MT, Cheng Z-M
(2013) Overexpressing the ZmDof1 gene in Populus
does not improve growth and nitrogen assimilation
under low-nitrogen conditions. Plant Cell Tiss Organ
Cult 113:51–61
Liu KH, Huang CY, Tsay YF (1999) CHL1is a
dual-affinity nitrate transporter of Arabidopsis
involved in multiple phases of nitrate uptake. Plant
Cell 11:865–874
Liu R, Zhang H, Zhao P, Zhang Z, Liang W, Tian Z,
Zheng Y (2012) Mining of candidate maize genes for
nitrogen use efficiency by integrating gene expression
and QTL data. Plant Mol Biol Rep 30:297–308
Liu T, Dai W, Sun F, Yang X, Xiong A, Hou X (2014)
Cloning and characterization of the nitrate transporter
gene BraNRT2.1 in non-heading Chinese cabbage.
Acta Physiol Plant 36:815–823
Lynch JP (2013) Steep, cheap and deep: an ideotype to
optimize water and N acquisition by maize root
systems. Annals Bot 112(2):347–357
Mäck G, Schjoerring JK (2002) Effect of NO-3 supply on
N metabolism of potato plants (Solanum tuberosum
L.) with special focus on the tubers. Plant Cell Env
25:999–1009
J. K. Tiwari et al.
Nischal L, Mohsin M, Khan I, Kardam H, Wadhwa A,
Abrol YP, Iqbal M, Ahmad A (2012) Identification
and comparative analysis of microRNAs associated
with low-N tolerance in rice genotypes. PLoS ONE 7
(12):e50261
Ospina CA, van Bueren ETL, Allefs JJHM, Engel B, van
der Putten PEL, van der Linden CG, Struik PC (2014)
Diversity of crop development traits and nitrogen use
efficiency among potato cultivars grown under con-
trasting nitrogen regimes. Euphytica 199:13–29
Pessemier JD, Chardon F, Juraniec M, Delaplace P,
Hermans C (2013) Natural variation of the root
morphological response to nitrate supply in Arabidop-
sis thaliana. Mech Dev 130:45–53
Poiré R, Chochois V, Sirault XRR, Voge JP, Watt M,
Furbank RT (2014) Digital imaging approaches for
phenotyping whole plant nitrogen and phosphorus
response in Brachypodium distachyon. J Integr Plant
Biol 56:781–796
Qsaki M, Shirai J, Shinano T, Tadano T (1995) Effects of
ammonium and nitrate assimilation on the growth and
tuber swelling of potato plants. Soil Sci Plant Nutr 41
(4):709–719
Ramakrishnan AP, Ritland CE, Sevillano RHB, Rise-
man A (2015) Review of potato molecular markers to
enhance trait selection. Am J Potato Res 92:455–472
Rutkoski JE, Heffner EL, Sorrells ME (2010) Genomic
selection for durable stem rust resistance in wheat.
Euphytica 179:161–173
Ruzicka DR, Barrios-Masias FH, Hausmann NT, Jack-
son LE, Schachtman DP (2010) Tomato root tran-
scriptome response to a nitrogen-enriched soil patch.
BMC Plant Biol 10:75
Sattelmacher B, Kuene R, Malagamba P, Moreno U
(1990) Evaluation of tuber bearing Solanum species
belonging to different ploidy levels for its yielding
potential at low soil fertility. Plant Soil 129:227–233
Schum A, Jansen G (2014) In vitro method for early
evaluation of nitrogen use efficiency associated traits
in potato. J Appl Bot Food Qual 87:256–264
Simons M, Saha R, Guillard L, Clément G, Armengaud P,
Cañas R, Maranas CD, Lea PJ, Hirel B (2014)
Nitrogen-use efficiency in maize (Zea mays L.): from
‘omics’ studies to metabolic modelling. J Exp Bot 65
(19):5657–5671
Tiemens-Hulscher M, van Bueren ETL, Struik PC (2014)
Identifying nitrogen-efficient potato cultivars for
organic farming. Euphytica 199:137–154
Tiwari JK, Gopal J, Singh BP (2012) Marker-assisted
selection for virus resistance in potato: options and
challenges. Potato J 39:101–117
Tiwari JK, Sundaresha S, Singh BP, Kaushik SK,
Chakrabarti SK, Bhardwaj V, Chandel P (2013)
Molecular markers for late blight resistance breeding
of potato: an update. Plant Breed 132:237–245
Tiwari JK, Trehan SP, Sundaresha S, Poonam Singh BP,
Dua VK, Bhardwaj V (2014) Gene expression anal-
ysis: indicators of nitrogen use efficiency in potato
cultivars. Potato J 41:175–179
11 Genomics Approaches for Improving Nitrogen …
Tong H-h, Chen L, Li W-p, Mei H-w, Xing Y-z, Yu X-q,
Xu X-y, Zhang S-q, Luo L-j (2011) Identification and
characterization of quantitative trait loci for grain yield
and its components under different nitrogen fertiliza-
tion levels in rice (Oryza sativa L.). Mol Breed
28:495–509
Trehan SP (2009) Improving nutrient use efficiency by
exploiting genetic diversity of potato. Potato J
36:121–135
Trehan SP, Singh BP (2013) Nutrient efficiency of
different crop species and potato varieties-in retrospect
and prospect. Potato J 40:1–21
Uitdewilligen JGAML, Wolters A-MA, D’hoop BB,
Borm TJA, Visser RGF, van Eck Herman J (2013)
A next-generation sequencing method for
genotyping-by-sequencing of highly heterozygous
autotetraploid potato. PLoS ONE 8(5):e62355
Vijayalakshmi P, Kiran TV, Rao YV, Srikanth B, Rao IS,
Sailaja B, Surekha K, Rao PR, Subrahmanyam D,
Neeraja CN, Voleti SR (2013) Physiological
approaches for increasing nitrogen use efficiency in
rice. Ind J Plant Physiol 18(3):208–222
Villordon AQ, Ginzberg I, Firon N (2014) Root archi-
tecture and root and tuber crop productivity. Trends
Plant Sci 19(7):419–425
Vos J (1997) The nitrogen response of potato (Solanum
tuberosum L.) in the field: nitrogen uptake and yield,
harvest index and nitrogen concentration. Potato Res
40:237–248
Vos J (2009) Nitrogen responses and nitrogen manage-
ment in potato. Potato Res 52:305–317
Wang Y, Fu B, Pan L, Chen L, Fu X, Li K (2013)
Overexpression of Arabidopsis Dof1, GS1 and GS2
enhanced nitrogen assimilation in transgenic tobacco
grown under low-nitrogen conditions. Plant Mol Biol
Rep 31:886–900
Wei D, Cui K, Ye G, Pan J, Xiang J, Huang J, Nie L
(2012) QTL mapping for nitrogen-use efficiency and
nitrogen-deficiency tolerance traits in rice. Plant Soil
359:281–295
Wishart J, George TS, Brown LK, Ramsay G, Brad-
shaw JE, White PJ, Gregory PJ (2013) Measuring
variation in potato roots in both field and glasshouse:
the search for useful yield predictors and a simple
screen for root traits. Plant Soil 368:231–249
Xu Z, Zhong S, Li X, Li W, Rothstein SJ, Zhang S, Bi Y,
Xie C (2011) Genome-wide identification of micro-
RNAs in response to low nitrate availability in maize
leaves and roots. PLoS ONE 6(11):e28009
Yang S-y, Hao D-l, Song Z-z, Yang G-z, Wang L, Su Y-h
(2015a) RNA-Seq analysis of differentially expressed
193
genes in rice under varied nitrogen supplies. Gene
555:305–317
Yang W, Yoon J, Choi H, Fan Y, Chen R, An G (2015b)
Transcriptome analysis of nitrogen-starvation respon-
sive genes in rice. BMC Plant Biol 15:31
Zebarth BJ, Rosen CJ (2007) Research perspective on
nitrogen BMP development for potato. Am J Potato
Res 84:3–18
Zebarth BJ, Tai G, Tarn R, de Jong H, Milburn PH (2004)
Nitrogen use efficiency characteristics of commercial
potato cultivars. Can J Plant Sci 84:589–598
Zebarth BJ, Tarn TR, de Jong H, Murphy A (2008)
Nitrogen use efficiency characteristics of andigena and
diploid potato selections. Am J Potato Res 85:210–
218
Zebarth BJ, Tai H, Luo S, Millard P, De Koeyer D, Li
X-Q, Xiong X (2011) Differential gene expression as
an indicator of nitrogen sufficiency in field-grown
potato plants. Plant Soil 345:387–400
Zebarth BJ, Tai H, Luo S, Millard P, De Koeyer D, Li
X-Q, Xiong X (2012) Effect of nitrogen form on gene
expression in leaf tissue of greenhouse grown potatoes
during three stages of growth. Am J Potato Res
89:315–327
Zeng H, Wang G, Hu X, Wang H, Du L, Zhu Y (2014)
Role of microRNAs in plant responses to nutrient
stress. Plant Soil 374:1005–1021
Zhang Y, Tan L, Zhu Z, Yuan L, Xie D, Sun C (2015)
TOND1 confers tolerance to nitrogen deficiency in
rice. The Plant J 81:367–376
Zhao M, Tai H, Sun S, Zhang F, Xu Y, Li W-X (2012)
Cloning and characterization of maize miRNAs
involved in responses to nitrogen deficiency.
PLoS ONE 7(1):e29669
Zhao W, Yang X, Yu H, Jiang W, Sun N, Liu X, Liu X,
Zhang X, Wang Y, Gu X (2015) RNA-seq-based
transcriptome profiling of early nitrogen deficiency
response in cucumber seedlings provides new insight
into the putative nitrogen regulatory network. Plant
Cell Physiol 56(3):455–467
Zhu J, Ingram PA, Benfey PN, Elich T (2011) From lab to
field, new approaches to phenotyping root system
architecture. Current Opin Plant Biol 14:310–317
Ziadi N, Zebarth BJ, Bélanger G, Cambouris AN (2012)
Soil and plant tests to optimize fertilizer nitrogen
management of potatoes. In: He Z, Larkin R, Honey-
cutt W (eds) Sustainable potato production: global
case studies. Springer, Dordrecht, Heidelberg, New
York, London, pp 187–207
Zvomuya F, Rosen CJ, Miller JJC (2002) Response of
Russet Norkotah clonal selections to nitrogen fertil-
ization. Am J Potato Res 79:231–239
 Genomics Resources for Abiotic
Stress Tolerance in Solanaceae Crops 12
Shambhavi Sharma, Saurabh Pandey,
Mehanathan Muthamilarasan, Vaishali Chaudhry,
Priya Dulani and Manoj Prasad

Abstract
The study of abiotic stresses in plants is crucial for an understanding of the
mechanisms involved in responses to these stresses. The complex nature
of abiotic stress-related traits and the occurrence of more than one stress
simultaneously further complicate the study. The availability of genomic
tools and resources allows a leap in plant breeding by facilitating the study
of the genotype and its relationship with the phenotype. The development
of techniques such as Next-Generation Sequencing (NGS) allowed the
sequencing of genomes of cultivars and their wild relatives, enriching the
available genetic as well as genomic resources. Genome-wide discovery
of markers and quantitative trait loci are used for marker-assisted selection
and breeding. The availability of the genome sequence information has
expedited several downstream analyses, including genome-wide identifi-
cation and expression profiling of the genes associated with stress
response. This is coupled with the use of mutants and transgenics to
elucidate and verify the function of genes in a high-throughput fashion. In
this chapter, the progress made in the generation and enrichment of
genomic resources of Solanum tuberosum and S. lycopersicum are
discussed from the point of view of genetic improvement for abiotic stress
tolerance.

12.1 Introduction

In the era of climate change, development of

S. Sharma
S. Pandey
M. Muthamilarasan

V. Chaudhry
P. Dulani
M. Prasad (&)
National Institute of Plant Genome Research, Aruna
Asaf Ali Marg, New Delhi 110 067, India
e-mail: manoj_prasad@nipgr.ac.in
climate-smart crop varieties is of the utmost
importance. Climate change limits the crop pro-
ductivity through the induction of various biotic
and abiotic factors. Biotic factors include the
genotype of the plant, pathogens, pests and
insects attacking the plants; while abiotic factors

© Springer International Publishing AG 2017 195

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_12
196
comprise edaphic factors (type of soil, its texture,
its water retention capacity, etc.), climatic factors
(temperature, precipitation, the wind, atmo-
spheric humidity, solar radiation), nutrient
availability and anthropogenic activities. Of
these, the weather is a very influential factor for
crop production. In the past few years, scientists
have observed the considerable change in cli-
matic conditions including the shrinking of gla-
ciers, ice melting, increase in atmospheric
temperature, increase in atmospheric CO2 con-
centration and thedepletion of the stratospheric
ozone layer. The relative change in the average
global temperature is predicted to be 0.7 °C from
0.3 °C for the period 2016–2035 (Kirtman et al.
2013). An increase in temperature will cause
increased evapotranspiration, resulting in more
demand for water by crops and natural vegeta-
tion, eventually causing a rapid reduction of soil
moisture. Climatic changes, together with
increasing CO2 concentration, will widen the
geographic distribution of invasive weeds, pests
and pathogens. This change may also amplify
their competitiveness. Pests and diseases are
likely to appear in areas where they could not be
established previously and are biologically less
prepared for them. This may also allow their
early appearance in the season due to higher
temperatures. The potato leafhopper (Empoasca
fabae) now appears on average ten days earlier
than in the early 1950s in the United States of
America with more severity in the warmest
years. It is estimated that the losses each year
because of its prior arrival is millions of dollars
as about 200 plant species are proposed as its
potential hosts (Baker et al. 2015). Thus, climate
change adversely impacts agriculture and poses a
serious threat to food security making it a more
challenging task to combat hunger and malnu-
trition. Despite considerable progress in agricul-
tural sciences, almost 800 million people are still
chronically undernourished. FAO estimates that
at least a 60% increase in food production is
demanded to feed the growing population in the
next decades. As the area under agriculture is
further shrinking because of the increase in sea
level, there is an indispensable need to boost the
yield of the crops.
S. Sharma et al.
The genetic diversity of plants serves as a
promising raw material for their improvement.
Plant genetic resources comprise all the genetic
stocks, including the wild relatives, obsolete
cultivars, traditional varieties, modern domesti-
cated cultivars, breeding lines and landraces.
Various aspects of genetic resources include their
collection, preservation, sustainable utilization
and proper management. They serve as a crucial
reservoir which helps in the adaptation and
evolution of plant species with the continuously
changing environment. However, there is an
increasing risk of loss of genetic diversity due to
domestication and climatic change. Efficient
conservation and utilization of genetic resources
have been enabled by molecular techniques
(Roviglioni et al. 2000). Conservation of genetic
resources can be achieved by two approaches
namely, in situ and ex situ. With the availability
of genetic resources, development of genomic
resources for crop improvement could easily be
facilitated. In recent years, the area of genomics
has witnessed accelerated growth, making it
possible and more feasible to understand the
structural and functional aspects of plant gen-
omes. The availability of high-throughput, rapid
and cost-effective techniques such as FLX-454,
Illumina, SOLiD and Helicose and their advan-
ces in recent years have allowed the sequencing
of a significant number of crop plants, which can
also be considered a potential genomic resource.
Such techniques have helped dissect the genetic
mechanisms involved in novel complex traits and
thereby helped in assessing the genetic variability
of the selected genetic resources, thus enabling
the development of improved varieties by
breeding and transgenic approaches.
The family Solanaceae includes several
important vegetable plants invariably consumed
by the global population. The family constitutes
around 3000 species, which includes a tuber
crop, potato (Solanum tuberosum), fruit bearers
such as tomato (S. lycopersicum), brinjal (S.
melongena) and pepper (Capsicum annuum),
ornamental plants like petunia (Petunia hybrida)
and Nicotiana (Nicotiana sp), and edible leaf
crops (S. aethiopicum and S. macrocarpon)
(Knapp 2002). Other than being food sources,
12 Genomics Resources for Abiotic Stress Tolerance in Solanaceae Crops
Solanaceae family members are considered as
models for scientific research to study various
aspects such as fruit development (tomato and
pepper, Gray et al. 1992; Fray and Grierson
1993; Hamilton et al. 1995; Brummell and
Harpster 2001; Alexander and Grierson 2002;
Adams-Phillips et al. 2004; Giovannoni 2004;
Tanksley 2004), tuber development (potato, Prat
et al. 1990; Fernie and Willmitzer 2001), pig-
mental analysis (anthocyanin pigments of Petu-
nia), and stress biology (tobacco and tomato,
Bogdanove and Martin 2000; Gebhardt and
Valkonen 2001; Li et al. 2001; Pedley and
Martin 2003). Given this, the International
Solanaceae Initiative (SOL) was constituted with
the goal of instituting a network of resources and
information to address key questions in the
adaptation and diversification of Solanaceous
crops (Fernandez-Pozo et al. 2015). The avail-
ability of the genome sequence of several Sola-
naceae crops including tomato, potato, tobacco,
pepper and brinjal, has facilitated structural,
functional as well as comparative genomics
research among these crop species, and simulta-
neously, the studies have facilitated the devel-
opment of several genomic resources for
agronomic traits. Given the above, the present
chapter summarizes the available genomic
resources in two important Solanaceae crops,
namely, potato and tomato, in which a quantum
of research has been performed on abiotic stress
genomics aspect.
12.2 Abiotic Stresses in Potato
Potato is one of the most important non-cereal
food crop, which ranks fourth in terms of global
production (Pino et al. 2007). According to
FAO, the estimated production of potatoes
worldwide in 2014 was close to 382 million
tonnes (FAO 2014), where 50% of its produc-
tion is from developing countries with small
farming lands and limited access to improved
farming technologies. Potatoes are an important
source of dietary protein, vitamins and antioxi-
dants, apart from starch (Burlingame et al.
197
2009). Also, they are of interest in the food
industry as its products have high demand in the
markets. Apart from food and feed, they are also
being exploited as an important source of fuels.
Despite these advantages, potato productivity is
severely challenged by several biotic as well as
abiotic stresses. Among these, drought is an
important factor which directly affects the cul-
tivation due to its shallow root system and low
capacity to absorb water from the soil (Weisz
et al. 1994). Studies have shown that drought
impacts various physiological and morphologi-
cal traits of the plant including tuber number
(MacKerron and Jefferies 1986; Haverkort et al.
1991), yield (Deblonde and Ledent 2001), bio-
mass (Dalla Costa et al. 1997) and quality (Ta
et al. 2003). In addition to drought, heat is
another influential factor mainly in tropical and
subtropical regions (Simmonds 1971). Potatoes
are cultivated in a cool environment, and tem-
perature changes alter their quality and yield
(Levy and Veilleux 2007). Potato plants, when
grown at average day temperatures of 14–22 °C
exhibit good yield and quality of tubers (Van
Dam et al. 1996). Soil temperature exhibits
variable effects like lower tuber yield at a tem-
perature higher than 18 °C (Monneveux et al.
2014), less growth of tubers (above 25 °C) and
shoots (above 39 °C) (Donnelly et al. 2007).
The severity of deterioration of tuber yield and
quality is further enhanced when heat stress is
accompanied by drought stress (Ahn et al.
2004). The adverse effects of heat on tuber yield
and quality were shown to be more intense than
those of drought (Levy 1985). On the other
hand, low temperature is a major concern to
potatoes grown in cold and temperate regions
(Chen and Li 1980; Barrientzos et al. 1994;
Vega and Bamberg 1995). Further, the potato is
moderately sensitive to salt stress (Mass and
Hoffman 1977), and saline soil was observed to
delay seed germination, and to retard normal
growth and development (Heuer et al. 1995), and
decline tuber yield and quality (Katerji et al.
2003). The symptoms of salinity stress are stunt-
ing, leaf chlorosis, tip burn, browning and crack-
ing of the tuber surface (Levy and Veilleux 2007).
198
12.3 Genomic Resources Available
in Potato for Crop
Improvement
Common cultivated potato varieties are autote-
traploid ð2n ¼ 4x ¼ 48Þ with a basic chromo-
some number of 12; however, there are cultivated
species ranging from the diploid ð2n ¼ 2x ¼ 24Þ
to pentaploid ð2n ¼ 5x ¼ 60Þ genomes (Watan-
abe et al. 2015). The polyploid genome hinders the
improvement of potatoes by the conventional
breeding approach. Various factors such as high
degree of heterozygosity, lack of homozygous
lines, acute inbreeding depression, or susceptibil-
ity to both biotic and abiotic stresses make the
study of genetics and inheritance of qualitative and
quantitative traits more challenging. Thus, there is
an immediate need to develop genomic resources
and molecular techniques for crop improvement.
The NSF Potato Genome Project hosted by The
Institute of Genome Research (TIGR) conducts
research on potato and other Solanaceae members.
The outcomes of the project are genome sequence
information, gene expression data and profiles,
microarray data, expressed-sequence tags,
molecular markers and information on cDNA and
BAC clones. The project has also assembled the
disease resistance genes.
An interspecific cross between diploid potato
line (S. phureja Juz. et Buk. x (S. tuberosum
ð2n ¼ 2x ¼ 24Þ x S. chacoense Bitt)) along with
RFLP (Restriction fragment length polymor-
phism) markers were already mapped in tomato
to generate the first map of potato (Bernatzky and
Tanksley 1986; Bonierbale et al. 1988). Another
cross between two diploid S. tuberosum lines
resulted in a mapping population which was used
to develop the first intraspecific linkage map
using RFLP markers (Gebhardt et al. 1989,
1991). Subsequently, AFLP (Amplified fragment
length polymorphism) markers (van Eck et al.
1995; Jacobs et al. 1995) followed by
PCR (Polymerase chain reaction)-based simple
sequence repeat (SSR) markers (Milbourne et al.
1998; Feingold et al. 2005) were used for the
construction of several genetic linkage maps.
Further, the availability of whole genome
sequence information has expedited the genetic
S. Sharma et al.
as well as genomic studies in potato. The Potato
Genome Sequencing Consortium (PGSC) has
sequenced the genome of two potato varieties
RH89-039-16 (RH; a diploid, heterozygous
variety) and DM1-3 516R44 (DM; a doubled
monoploid) (Potato Genome Sequencing Con-
sortium 2011). Recently, an updated version of
the potato reference genome (version 4.04) was
released in 2016 (Hardigan et al. 2016).
12.3.1 Identification of Genomic
Regions Governing
Stress Tolerance
in Potato
Crop improvement primarily relies on examining
the available genetic resources to identify potential
candidate germplasms for further use in research.
Cultivars grown in extreme environments have
always served as sources of novel
genes/alleles/QTLs for improving tolerance traits in
cultivated varieties. Screening of several Solanum
species identified S. juzepczuckii and S. curtilobum
as salt-tolerant (Silva et al. 2001), and three species,
S. juzepczuckii, S. acaule and S. curtilobum are
frost-resistant (Mendoza et al. 1979; Martinez et al.
1996). The Andean potato landraces cultivated in
cold and dry climatic conditions served as ideal
candidates for identifying genes conferring toler-
ance to drought stress (Ritter et al. 2008), which
helped in developing drought-tolerant varieties
(Ritter et al. 2008; Vasquez-Robinet et al. 2008).
Similarly, wild potato germplasms have also been
useful in improving drought tolerance traits (Eka-
nayake and de Jong 1992; Spooner and Salas 2006;
Coleman 2008). The differential response of culti-
vated as well as wild varieties to salinity stress has
identified crucial genes and pathways responsible
for salt tolerance (Levy and Veilleux 2007; 2013).
Traditional breeding involves the introgres-
sion of genes of desirable traits from non-
commercial varieties to breeding stock by inter-
specific hybridization followed by a selection of
hybrids at each step. Owing to the labour-
intensive approach of the above, molecular
markers have been introduced which greatly
improved the breeding approach by directly
12 Genomics Resources for Abiotic Stress Tolerance in Solanaceae Crops
revealing the genetic variability (Staub et al.
1996). Numerous molecular markers have been
developed for plant genome analysis, making the
selection genotype-based in place of the
phenotype-based as in traditional breeding. This
laid down the concept of molecular
marker-assisted selection (MAS) (Paterson et al.
1991). Molecular marker-based maps of potato
have enabled the identification of genetic loci
and the quantitative trait locus (QTL) underlying
many simple and complex traits of agronomic
value. Most MAS markers have been used to
detect disease resistance genes such as Potato
virus Y, late blight causing Phytophthora infes-
tans and nematode resistance. Similarly, markers
linked to resistance to complex traits such as
cold, drought, salinity tolerance can be studied
by constructing genetic linkage maps with den-
sely located markers and comparing expressed
genes and markers (van Os et al. 2006).
Drought tolerance was surveyed by various
physiological parameters such as relative water
content, stomatal conductance and chlorophyll
fluorescence measurements (Tourneux et al.
2003; Schafleitner et al. 2007); however, these
traits show less level of heritability, are con-
trolled by several genes and their epistatic in
nature restricts the breeding in potato for drought
tolerance (Schafleitner et al. 2009). Anithakumari
et al. (2011) have identified 23 QTLs (13 QTLs
under well-watered conditions, 7 under drought
stress condition and 3 recovery QTLs) in a
diploid mapping population, and the genes
underlying these QTLs were related to root to
shoot ratio, plant height, shoot fresh weight,
shoot dry weight, fresh root weight, root dry
weight, root length, fresh biomass and dry bio-
mass. The ontology of these genes suggested
their involvement in the regulation of stress
response, hormone signalling pathways, trans-
port and carbon partitioning. Interestingly, the
study also found the co-localization of SNPs
(Single Nucleotide Polymorphism) with root to
shoot ratio QTL, thus proposing their applica-
bility in MAS for drought tolerance in potato.
QTLs associated with root length allow the
selection of plants with desirable root character-
istics in a non-invasive method as root traits are
199
of immense importance in tolerating drought. In
addition, QTLs associated with carbon radioiso-
tope discrimination, chlorophyll content and
chlorophyll fluorescence were also identified
(Anithakumari et al. 2012), which can serve as
good selection criteria since they are easy to
measure, fast, and allow little or no sample
destruction.
Recently, Sharma et al. (2013) have con-
structed a dense genetic and physical map for
diploid backcross progeny (DMDD) of potato
using 2469 markers, including simple sequence
repeats (SSRs), diversity array technology
(DArT), and SNPs, and using the same genotypic
data of these markers, Khan et al. (2015) con-
structed maternal and paternal maps to carry out
the first QTL study for drought tolerance. The
study identified 45 genomic regions associated
with nine traits in well-watered and terminal
drought treatments and 26 QTLs associated with
drought stress (Khan et al. 2015). These QTLs
will promisingly be used in the breeding of
potato for durable tolerance to drought, using
conventional as well as genomics-assisted
breeding approaches.
12.3.2 Resources Available
for Functional Genomics
Research in Potato
Advanves in next-generation sequencing tech-
nologies and the introduction of high-throughput
sequence analysis platforms have expedited the
genomics and transcriptomics research in several
crop plants. Several studies have dealt with the
transcriptomics of potato with respect to devel-
opment and response to biotic and abiotic factors
(Bachem et al. 2000; Flinn et al. 2005; Rensink
et al. 2005a; Kloosterman et al. 2005, 2008;
Evers et al. 2010; Massa et al. 2011, 2013). In
addition, Rensink et al. (2005b) have generated
20,756 expressed sequences of potato leaves and
roots subjected to heat, cold, drought and salt
stresses. A total of 1476 sequences unique to
abiotic stressed potato leaf and root tissue were
identified, most of which were found to be
involved in photosynthesis, transport, membrane
200
modification, signalling cascades, and transcrip-
tion regulation. Several genes with unknown
functions were also identified which were unique
to the abiotic stress library. Functional charac-
terization of these genes of unknown function
could unravel the novel stress-responsive
machinery present in the plant system.
In 2008, the development of the Potato Oligo
Consortium (POCI) array with 44,000 probes
representing 42,034 potato unigenes had further
upgraded the status of transcriptomic research of
potato (Kloosterman et al. 2008). This has led to
the identification of several drought-related genes
and their participating pathways, including
anti-oxidant biosynthesis, metallothioneins, fla-
vonoid biosynthesis, terpenoid biosynthesis,
cytochrome P450, chromatin remodelling and
specific transcription factors such asl Myb and
bZIP factors (Watkinson et al. 2006; Schafleitner
et al. 2007a; Evers et al. 2010). Further, the role
of compatible solutes such as proline, glycine
betaine, trehalose and glucosylglycerol in con-
ferring tolerance to drought and salt stress was
suggested by the enhanced expression of genes
involved in their biosynthetic pathways (Byun
et al. 2007; Kikuchi et al. 2015). Metabolomics
combined with transcriptomics has revealed the
higher accumulation of osmotically active solutes
like galactose, inositol, galactinol, proline, and
proline analogues upon drought stress in potato,
which subsequently confers tolerance to drought
stress. Therefore, the genes regulating the
biosynthesis and metabolism of these compounds
can be used to impart drought tolerance in potato.
Rensink et al. (2005a) have analysed the tran-
script profile of roots and leaves of potato seed-
lings subjected to cold (4 °C), heat (35 °C), or
salt (100 mM NaCl) stress. Using microarray,
they were able to identify 3314 differentially
expressed genes (DEGs) in at least one stress
condition, out of which cold stress showed the
maximum number of DEGs (2584) followed by
salt and heat stress (1149 and 998 DEGs,
respectively). A larger number of DEGs were
shared in salt and cold stress as a comparison to
those between heat and salt stress, and heat and
cold stress responses. These DEGs were anno-
tated as transcription factors, factors involved in
S. Sharma et al.
transport, hormone signalling, signal transduc-
tion, and heat-shock proteins, many of these
proteins were already reported to participate in
responses and mechanisms conferring abiotic
stress tolerance in Arabidopsis and rice. In
addition, 305 DEGs were found to be
stress-specific, suggesting these profiles can be
candidate signature profiles for each stress
(Rensink et al. 2005b).
Similarly, Kim and co-workers used DNA
microarrays to demonstrate the up-regulation of
six clones of ADP-ribosylation factor-like pro-
teins under salt stress in potato (Kim et al. 2003).
ADP-ribosylation factor-like proteins are repor-
ted to be involved in biotic and abiotic stress
response in several crop plants (Lee et al. 2003;
Muthamilarasan et al. 2016), and genetic
manipulation of these genes could confer better
tolerance to stress. Previously, Ryu et al. (1995)
provided salt treatment to S. commersonii plants
for 24 h and subsequently identified nine
stress-responsive proteins, among which few
were also found to be induced by cold stress or
ABA treatment. Differential transcript levels
were also studied for cold stress in potato (Tseng
and Li 1990). The stable transcripts were related
to small heat-shock proteins, and the
dehydrin/RAB group of proteins were also
induced by dehydration stress and upon abscisic
acid treatment. The latter also exhibited homol-
ogy to proteins from Arabidopsis and spinach
induced under cold stress (Van Berkel et al.
1994).
RNA-Seq, a method to sequence total tran-
scriptome using NGS technologies has gained
popularity among functional genomics research-
ers since it does not require prior knowledge of
the transcriptome of the organism under study
(Morin et al. 2008). PGSC has developed large
sets of RNA-Seq from two potato genotypes,
Phureja DM1-3 516 R44 and RH89-039-16 in
response to biotic and abiotic stresses, which
allows the functional identification of potential
stress-responsive genes (Massa et al. 2013). The
data highlights that many transcription factors are
involved in more than one stress, suggesting
common signalling and response mechanism in
different stresses. In another study, RNA-Seq
12 Genomics Resources for Abiotic Stress Tolerance in Solanaceae Crops
data was generated from stolon tips of S.
tuberosum variety Ningshu 4 under three differ-
ent experimental conditions (either exposed to
drought stress for three days, or rewatered and
grown for three days following the three days of
drought stress, or grown at maximum field
water-holding capacity at the flowering stage)
(Gong et al. 2015). In this study, the researchers
identified 3189 and 1797 differentially expressed
transcripts under only drought treatment and
treatment of drought followed by rewatering,
respectively, of which 263 genes showed reverse
differential expression patterns in plants grown
under first two conditions (Gong et al. 2015),
suggesting a strict transcriptional regulation of
these genes. A large number of transcription
factors genes such as the bHLH, ERF, MYB,
C2H2, NAC, WRKY, HD-ZIP, and bZIP fami-
lies were found to be differentially expressed
(Gong et al. 2015). Gangadhar et al. (2014) have
identified 95 potential candidate genes from
heat-stressed potato plants (analysed after 2 and
48 h at 35 °C). Out of 95 genes, 20 genes were
found to play a role in drought-, 14 in salt stress,
and 11 in heat/drought/salt stresses. These genes
showed differential expression profiling under
heat, drought, and salt stress conditions and
ontology annotation revealed their involvement
in various cellular metabolisms, signal transduc-
tion pathways, stress responses, and protein
folding mechanisms (Gangadhar et al. 2014).
Genetic transformation of plants is an impor-
tant step in engineering durable tolerance in
plants. In addition, transformation also enables
the functional characterization of key genes to
delineate their roles in cellular and molecular
processes. In potato, several overexpression lines
have been generated to demonstrate enhanced
tolerance to biotic as well as abiotic stresses
(Table 12.1). Overexpression of an R1-type
MYB-like transcription factor in potato resulted
in the up-regulation of drought-regulated genes
such as AtHB-7, RD28, ALDH22a1 and ERD1-
like in transgenic potato, which eventually
enhanced the tolerance to drought stress (Shin
et al. 2011). Kim et al. (2013) have overex-
pressed Arabidopsis YUCCA6 gene in potato for
enhanced drought tolerance based on reduced
201
water loss. Similarly, Arabidopsis DREB1A gene
was overexpressed in potato by Jia et al. (2016)
for improved drought tolerance. Previously,
Bouaziz et al. (2013) have overexpressed an
indigenous DREB1 from potato to develop
transgenic lines tolerant to salinity stress.
Recently, Szalonek et al. (2015) have shown that
overexpression of an endogenous annexin,
STANN1 gene in tomato conferred tolerance to
water deficit in the root zone, conserved more
water in green tissues and preserved chloroplast
functions. The study suggests that
annexin-mediated photoprotection could be
associated with defence against light-induced
oxidative stress in transgenic potatoes. Identifi-
cation of potential target genes for overexpres-
sion is an important step in transgenic research,
and therefore, genome-wide analysis of diverse
gene families has gained significance in func-
tional genomics research. Identification of the
members of a gene family using in silico
approaches and characterization of the members
using both bioinformatic as well as in vitro
experimentations suggest the putative candidates
involved in stress-response pathways. Some
examples of gene families studied for their
involvement in stress-responsive molecular
machinery are the AP2/ERF superfamily
(Charfeddine et al. 2015), the Snakin/GASA
gene family (Nahirñak et al. 2016) and heat
shock transcription factors (Tang et al. 2016).
Helicase members of the DEAD-box protein
family are shown to confer durable tolerance to
several stresses in different crops and given this,
an attempt has been made to identify and char-
acterize DEAD-box helicases in potato as well as
tomato (Chaudhry et al. Unpublished data).
Through in silico approaches, 115 and 131
DEAD helicases were identified in potato and
tomato, respectively, which were further cate-
gorized into three subfamilies, namely, DEAD,
DEAH and DExD/H types using sequence
alignment and phylogenetic analysis (Chaudhry
et al. Unpublished data). In silico expression
analysis of StDEAD-box members in different
tissues, stages of development and stress
response indicated their spatiotemporal differen-
tial expression profiles with higher expression of
202 S. Sharma et al.

Table 12.1 List of genes overexpressed in potato to enhance the stress tolerance
S. Gene Source Gene product Stress-associated Reference
No. phenotype
1. BADH Spinach Betaine aldehyde Drought and salinity Zhang et al.
dehydrogenase tolerant (2011)
2. codA Sweet potato choline oxidase Drought and salinity Kim et al.
tolerant (2003)
3. TPS1 Sachharomyces trehalose-6-phosphate Drought tolerant Stiller et al.
cerevisiae (2008)
4. ggpPS Azotobacter The GG-phosphate Drought and salinity Sievers
vinelandii phosphatase/synthase tolerant et al. (2013)
5. P5CS Arabidopsis pyrroline-5-carboxylate Salinity tolerant Kishor et al.
synthetase (1995)
6. mtlD Escherichia coli mannitol-1-phosphate Salinity tolerant Rahnama
dehydrogenase et al. (2011)
7. AtNHX1 Arabidopsis vacuolar Na+/ Salinity tolerant Wang et al.
H+ antiporter (2003)
8. GLOase Rat cells gulono-c-lactone oxidase Salinity and oxidative Upadhyaya
stress tolerant et al. (2010)
9. GalUR Strawberry d-galacturonic acid Salinity and oxidative Upadhyaya
reductase stress tolerant et al. (2009)
10. DREB1B Arabidopsis dehydration-responsive Drought and freezing Movahedi
element binding factor 1 tolerant et al. (2012)
11. DREB1A Arabidopsis Arabidopsis Freezing tolerant Behnam
et al. (2007)
12. CaPF1 Pepper Capsicum annuum Freezing, high Youm et al.
pathogen freezing temperature, drought, (2008)
tolerance protein 1 oxidative stress tolerant
13. AtNDPK2 Arabidopsis nucleoside diphosphate Heat, salinity, oxidative Tang et al.
kinase 2 tolerant (2008)
14. AtCBF1 Arabidopsis cold-responsive Freezing tolerant Pino et al.
AtCBF3 transcription factors (2007)

a few genes in at least one stress (Chaudhry et al.
Unpublished data). Further functional character-
ization of candidate genes in the suitable model
system is in progress, which may promisingly
provide insights into stress-responsive roles of
DEAD helicases in potato.
12.4 Cultivated and Wild Tomato
Species for Resource
Development
Compared to other vegetable crops, the tomato
has a large collection of germplasm resources
which includes several accessions belong to
domesticated, cultivated as well as wild types.
There are different collection centres located
worldwide where a huge repository of tomato
accessions is present. To list a few, The Tomato
Genetic Resources Center in California (TGRC,
www.tgrc.ucdavis.edu), the USDA2 collection
(www.ars.usda.gov), the World Vegetable Cen-
ter maintained in Taiwan (www.avrdc.org) are
large germplasm collection centres. In Europe,
most of the countries share a common platform
for the plant genetic resource conservation and
utilization, called the European Cooperative
Programme for Plant Genetic Resources (www.
ecpgr.cgiar.org) which has links to the National
Tomato Genetic Resource Centres from different
12 Genomics Resources for Abiotic Stress Tolerance in Solanaceae Crops
countries including INRA (France), IPK5 (Ger-
many), CGN4 (the Netherlands), the Vavilov
Institute (Russia), and COMAV3 (Spain).
Recently, the European Solanaceae Project
(EU-SOL, www.eu-sol.wur.nl) has recognized
and phenotyped an additional 6000 domesti-
cated tomato accessions (de Weerd et al. 2011).
Also, a global initiative called the Plant Biodi-
versity Inventories (www.nhm.ac.uk/
researchcuration/ projects/solanaceaesource/)
had been started with the purpose of generating
a comprehensive taxonomic monograph of the
genus Solanum and the species within it. In
addition, long-term collection of a plant species
project propelled by the Svalbard Global Seed
Vault initiative (Food 2008) has a tremendous
collection of germplasms belonging to several
Solanaceae species. Wild tomatoes are divided
into two groups, namely, red- or orange-fruited
species group and green-fruited species
group. The former includes S. cheesmaniae, S.
galapagense and S. pimpinellifolium, whereas
the latter comprises S. arcanum, S. chilense, S.
chmielewskii, S. corneliomulleri, S. huaylasense,
S. habrochaites, S. juglandifolium, S. lycoper-
sicoides, S. neorickii, S. peruvianum, S. pen-
nellii, S. ochranthum and S. sitiens. The primary
difference between these two groups is that the
red-fruited species group stores glucose and
fructose, whereas the green-fruited species stores
sucrose (Schauer et al. 2005).
12.5 Tomato Genome Sequencing
and the SOL-100 Species
Project for Resource
Development
Tomato genome sequencing was a multinational
effort involving 14 countries to sequence the
cultivar Heinz 1706. The project integrated the
platforms Sanger and 454/Roche GS FLX, and
SOLiD and Illumina GAIIx. This resulted in
760 Mb coverage of sequences assembled into
91 different scaffolds, of almost 900 Mb tomato
genomes, aligned to the 12 tomato chromosomes
containing 34,727 predicted protein-coding
genes (The Tomato Genome Consortium 2012).
203
Most of the gaps were constrained to repeat-rich
pericentromeric regions. Moreover, comparative
analysis of a draft sequence of the S. pimpinel-
lifolium (closest wild relative) to the Heinz
sequence was also performed, which showed the
high similarity between two genomes with only
0.6% nucleotide divergence. There are 60%
identical genes or the genes that have synony-
mous variations among domesticated and wild
tomato, whereas the residual 40% have
non-synonymous variations, comprising modifi-
cations of stop codons through possible conse-
quences for the gene function. In contrast to the
potato genome, the cultivated tomato and wild
tomato S. pimpinellifolium genomes illustrate
further 8% nucleotide divergence. Furthermore,
the genome sequence of tomato showed a high
syntenic relation with eggplant and pepper, the
other economically important family members of
Solanaceae. Also, two consecutive triplication
events were recognized in Solanum lineage by
comparative genome analysis. Excitingly, gen-
ome triplications events were identified as
responsible for the addition of a new gene family
of transcription factors as well as enzymes
essentially used for ethylene biosynthesis and
perception, which facilitate key fruit-specific
functions.
The “150 tomato genomes project” is an
across-the-board mission to sequence 83 different
ecotypes comprising 43 cultivated lines, 30 wild
accessions and 10 old varieties (http://www.
tomatogenome.net; Aoki et al. 2013). Addition-
ally, to ascertain the recombination breakpoints on
the genomic sequence of S. pimpinellifolium, 60
F8 plants of recombinant inbred lines (RILs)
population were also sequenced. Similarly, the
programme has sequenced the experimental cul-
tivars of tomato Micro-Tom, Rutgers, Ailsa Craig,
and M82 (http://solgenomics.net/organism/1/
view). The availability of these sequence data in
the public domain will expedite the structural as
well as the functional genomics studies in tomato
aimed at crop improvement.
Apart from this, the “SOL-100” project was
aimed at sequencing hundreds of Solanaceae spe-
cies via NGS technologies (https://solgenomics.
net/organism/sol100/view). This project will
204
integrate the genomes of several Solanaceae as well
as Asterid relatives to a common physical and
genetic map, and identify the genomic regions
responsible for agronomic traits. Further, the
updated genome sequence information of tomato is
present in the Sol Genomics Network (https://
solgenomics.net/organism/Solanum_
lycopersicum/genome). The version SL3.0 of the
tomato genome and version ITAG3.10 of the
annotation comprise 34,879 genes, of which 6660
are novel to tomato.
12.6 Genetics and Breeding
of Tomato for Abiotic Stress
Tolerance
12.6.1 QTLs for Drought Stress
Tolerance
QTLs governing tolerance to drought during seed
germination were first mapped by Foolad et al.
(2003a). Four QTLs were recognized in back-
cross progeny on chromosomes 1, 8, 9 and 12
derived from the S. lycopersicum  S.
pimpinellifolium (LA0722) cross. Following this,
F9 RILs were generated from the above cross and
assessed for germination rate in drought stress
using composite interval mapping. In this way,
several QTLs for drought tolerance on different
chromosomes were detected (Foolad et al.
2003b). Further, different sub-isogenic lines were
developed from IL5-4, and QWUE5.1 was fine
mapped to an interval of around 2.2 cM. Two
QTLs positioned on chromosomes 1 and 9 were
identified as major QTLs having the drought-
tolerant alleles from the S. pimpinellifolium par-
ent. This information was consequently estab-
lished in an F9 RIL population resulting from the
interspecific cross developed from the previous
study (Foolad 2007). Albert et al. (2016) phe-
notyped and genotyped a population of 119
recombinant inbred lines using 679 SNP markers
and mapped a total of 56 QTLs for several traits,
of which 11 were shared for traits associated with
different water regimes. The results suggested the
genetic control of genotype by water regime
relations in tomato and their probable usage of
S. Sharma et al.
shortage irrigation to increase tomato quality
(Albert et al. 2016). Similarly, Constantinescu
et al. (2016) identified QTLs responsible for
growth under water deficit conditions using 117
recombinant inbred lines genotyped with 501
SNP markers. Three major QTLs on chromo-
somes 2, 4 and 8 were mapped related to xylem
and phloem conductivities. Lounsbery et al.
(2016) have developed sub-near isogenic lines
from wild tomato S. habrochaites to explore the
genetic basis of tolerance to slow onset of water
stress in the field enforced by restricted irrigation.
The study has mapped 19 QTLs associated with
water stress-tolerant traits such as low C isotope
discrimination, low specific leaf area and high
shoot dry weight (Lounsbery et al. 2016).
Overall, this information will be useful for the
breeders and researchers working on developing
drought-tolerant varieties of cultivated tomato.
12.6.2 Genomic Regions Governing
Salinity Tolerance
Natural populations of cultivated tomato are
moderately sensitive to salt stress, and therefore
research in salt stress is more focused compared
to any other abiotic stresses (Foolad 2004, 2005).
Tolerance to salt stress is a more complex trait as
it is developmentally controlled. Also, onset of
stress is specific to the particular plant stage,
thus, early seedling growth and seed germination
are highly vulnerable stages (Foolad 2007).
Given this, several attempts have been completed
to recognize various genetic factors at a partic-
ular stage of plant development, such as different
QTLs specifically for salt stress tolerance
throughout the germination of seed, at vegetative
development as well as in advanced periods in
tomato fruit development (Table 12.2). Identifi-
cation of these stage-specific QTLs for salt tol-
erance will facilitate the introgression of this trait
to desired genetic backgrounds of cultivated
tomato through gene pyramiding and develop
salt-tolerant varieties using marker-assisted
selection. Wild tomato cultivars including S.
pimpinellifolium, S. chilense, S. cheesmaniae, S.
galapagenese S. pennellii and S. peruvianum
12 Genomics Resources for Abiotic Stress Tolerance in Solanaceae Crops
which are naturally tolerant to salt stress were
exploited to identify the QTLs governing this
trait (reviewed by Foolad 2004). The study
identified several species-specific as well as
conserved QTLs in the interspecific crosses
between S. lycopersicum X S. pennellii
(LA0716) and S. lycopersicum X S. pimpinelli-
folium (LA0722) (Foolad et al. 1997, 1998;
Foolad and Chen 1998). These crosses indicate
the quantitative nature of the salt tolerance in the
course of seed germination, where some major
QTLs control the phenotype. For instance, seven
QTLs were reported in S. pimpinellifolium
LA0722 for salt tolerance, of which six were
favourable (Foolad et al. 1998a). Also, compar-
ison of these interspecific cross-populations
suggests that these QTLs are stable throughout
the population and generations, and the same
QTL can contribute to different stages of salt
stress tolerance (Foolad and Jones 1991).
Foolad (2004) demonstrated that salt stress
tolerance at the vegetative development stage in
tomato is more significant and multifaceted than
tolerance throughout the germination stage, and
in a subsequent study, S. pimpinellifolium
LA0722 BC1 population were used to identify
QTLs deliberating salt tolerance in the course of
the vegetative phase (Foolad and Chen 1999;
Foolad et al. 2001). Foolad and Chen (1999)
have identified five QTLs on chromosome 1 (2
QTLs), 3, 5 and 9 (one each). Individually, these
QTLs explained 5.7% and 17.7% of the entire
phenotypic variance, and in all cases, positive
QTL alleles were derived from a salt-tolerant
parent, and digenic epistatic interactions were
also identified. Some of these QTLs were sub-
sequently confirmed using the selective geno-
typing approach (Foolad et al. 2001). Although
there are some good examples of QTL mapping
for salt tolerance during vegetative growth
(Table 12.2), further research is required in this
area to reveal the causal genetic components
responsible for salt tolerance. Different mapping
research suggests that the salt tolerance trait is a
multigene controlled throughout the vegetative
phase, and is also extremely affected by envi-
ronmental deviation (Foolad 1996, 1997).
205
There are few reports available on QTL
mapping for salt tolerance during the reproduc-
tive phase in tomato in contrast to the seed ger-
mination and vegetative stage (Breto et al. 1994;
Monforte et al. 1996, 1997, 1999; Villalta et al.
2007). In one of these studies, an F2 population
derived from a cross between S. lycopersicum cv.
Madrigal X S. pimpinellifolium (line L1) was
used to identify QTLs related to total fruit
weight, average fruit weight, and fruit number
under salinity conditions (Bretό et al. 1994;
Monforte et al. 1996). Furthermore, using marker
assisted selection along with phenotypic selec-
tion, salt-tolerant breeding lines were developed
(Monforte et al. 1996). A different
cross-combination including S. lycopersicum X
S. cheesmaniae and S. lycopersicum X S.
pimpinellifolium and their F2 populations were
studied for salt stress tolerance (Monforte et al.
1997a, b). Also, several salt tolerance QTLs were
mapped in S. lycopersicum X S. pimpinellifolium
crosses, which are known to affect fruit weight
(Monforte et al. 1997a). Subsequently, two RIL
populations were established after these F2 pop-
ulations to identify QTLs for salt tolerance in
altered salinity levels in relation to G  E
interactions (Villalta et al. 2007, 2008). Also, the
effects of salinity on 19 traits such as total fruit
weight, the number of fruit, flowering time and
chloride (Cl–) concentration were studied. The
study identified 15 QTLs under salinity stress in
both the populations, although 15 and 16 QTLs
were recognized in control conditions, in S.
pimpinellifolium and S cheesmaniae populations,
respectively. Altogether, these two populations
possess eight QTLs in common in both control
and high salinity situations; however, the con-
tribution of each QTL was low (Villalta et al.
2007, 2008). Further, Villalta et al. (2008) have
developed two RIL populations (F8 lines) to
identify the QTLs for Na+ and K+ concentrations
in stems and leaves. They discovered that the
QTL controlling these traits under salinity stress
are present on chromosome 7 with major effects.
Also, the study suggested that none of the Na+
transporters or other regulatory proteins verified
in the study were colocalized through the QTL.
206 S. Sharma et al.

Table 12.2 Summary of abiotic stress tolerance/resistance QTLs mapped onto tomato chromosomes
Stress No.of Tolerance Mapping Chromosomal Reference
QTLs source population location
Cold (low 3 S. BC1S1 1,4 Foolad et al. (1998)
temp.) pimpinellifolium
5 S. RILs 1,2,3,8,12 Foolad et al. (2003a)
pimpinellifolium
3 S. hirsutum BC1 6,7,12 Vellejos and Tanksley
(1983)
10 S. hirsutum BC1 1,3,5,6,7,9,11,12 Truco et al. (2000)
Drought 4 S. BC1S1 1,8,9,12 Foolad et al. (2003a)
pimpinellifolium
8 S. RILs 1,2,3,4,8,9,12 Foolad et al. (2003a)
pimpinellifolium
3 S. pennellii BC1S1, F3 Undetermined Martin et al. (1989)
Salt 5 S. pennellii F2 1,3,7,8,12 Foolad and jones (1993)
8 S. pennellii F2 1,2,3,7,8,9,12 Foolad et al. (1997b)
8 S. pennellii F2 1,3,5,6,8,9 Foolad and Chen (1998)
7 S. BC1S1 1,2,5,7,9,12 Foolad et al. (1998)
pimpinellifolium
8 L. RILs 1,2,3,4,8,9,12 Foolad et al. (2003a)
pimpinellifolium
4 L. BC1S1 1,5,9 Foolad and chen (1999)
pimpinellifolium
5 L. BC1 1,3,5,6,9 Foolad et al. (2001)
pimpinellifolium
7 L. RILs 1,3,4,5,7,8,9 Foolad et al. (2003a)
pimpinellifolium
6 L. pennellii F2 1,2,4,5,6,12 Zamir and Tal (1987)
Several L. F2 Undetermined Breto et al. (1994)
pimpinellifolium

Overall, these studies suggest the existence of
diverse mechanisms at a genetic and physiolog-
ical level that controls salt tolerance in tomato.
However, the identified and validated QTLs may
be useful in marker-assisted breeding as well as
gene pyramiding to improve salt tolerance.
12.6.3 QTLs for Cold Tolerance
The natural population of cultivated tomatoes are
sensitive to low temperatures ranging from 0 to
15 °C (Foolad and Lin 1998). Tolerance to cold
and its physiological and genetic basis has been
explored at diverse developmental phases of
tomato (Foolad 2005). On the other hand, in
comparison to salt stress tolerance, there are few
reports on the identification of markers and their
association with genes or QTLs responsible for
cold tolerance at diverse developmental phases in
tomato (Table 12.2). In a BC1 population
developed from a cross of S. lycopersicum and S.
pimpinellifolium (LA0722), potential QTLs
responsible for cold tolerance during seed ger-
mination were reported (Foolad et al. 1998b).
These QTLs were mapped on chromosomes 1
and 4; however, a promising QTL allele derived
from S. pimpinellifolium was on chromosome 1.
The phenotypic variation explained by these
individual QTLs ranged from 11.9–33.4% of the
12 Genomics Resources for Abiotic Stress Tolerance in Solanaceae Crops
total phenotypic variation. Further, two of these
QTLs were established in a large BC1 population
(1000 individuals) and F9 RIL population (145
individuals) derived from the same cross (Foolad
2007). These two studies confirmed the QTLs
reported by Foolad et al. (1998b) and also
reported a small number of novel QTLs. Fur-
thermore, collectively findings of these studies
recommend the quantitative nature of cold tol-
erance in tomato in the course of seed germina-
tion. Comparing the stability of these QTLs
across the diverse populations of the same cross
suggests that maximum QTLs are stable
throughout the populations as well as genera-
tions, although some QTLs are specific to the
population.
There are only two reports on QTLs for cold
tolerance during the vegetative phase of tomato.
Vellejos and Tanksley (1983) identified three
QTLs in a BC1 population derived from an
interspecific cross between a cold-sensitive S.
lycopersicum and a cold-tolerant S. hirsutum, and
these QTLs are accountable for development at
low temperatures. Truco et al. (2000) identified
seven QTLs linked with root ammonium uptake
and shoot wilting under chilling temperatures in
S. lycopersicum x S. hirsutum (LA1778) BC1
population. Among the identified QTLs, four
were responsible for recovery from wilting, and
three were meant for chilling-induced shoot
wilting. In the case of studies on root chilling
tolerance, QTL stm9 was mapped on the 9th
chromosome in S. habrochaites (Arms et al.
2015). For this, recombinant sub near-isogenic
lines were used for marker selection and pheno-
typed for shoot turgor maintenance, and the QTL
was mapped to a 0.32 cM region (Arms et al.
2015). Further, Near Isogenic Lines (NILs) were
developed for the stm9 in S. lycopersicum
background, and the global transcriptional regu-
lation in response to the rapid onset of water
stress induced by root chilling was studied. Two
contrasting NILs, namely, NIL175 and NIL163
showed differential response to root chilling
stress. Interestingly, NIL175 possessed the
introgression from S. habrochaites which con-
ferred tolerance. Additionally, RNA-seq data
from the roots of these two NILs suggested a
207
complex response in NIL163 against a targeted
response of NIL175 for the root chilling (Arms et al.
2017). Nevertheless, broad research is required to
define the genuine significance of QTLs obtained
from S. hirsutum, as well as to detect and confirm
additional valuable QTLs for cold stress tolerance
in tomato for breeding purposes.
12.7 Transgene-Based Functional
Genomics Approaches
for Stress Tolerance in Tomato
Drought, salt, cold and heat stresses share com-
mon molecular mechanisms such as detoxifica-
tion of ROS, osmo-protection, protection of
enzymatic systems, and water and ion fluxes (Zhu
2002). Genes playing important roles in many of
these mechanisms have been overexpressed in
several plant systems and demonstrated to
enhance the tolerance to abiotic stresses. In
tomato, Arabidopsis CBF1 gene was overex-
pressed, and the transgenic plants were reported
to possess higher chilling tolerance. This response
was associated with a decrease of ROS and pro-
nounced tolerance to oxidative damages (Hsieh
et al. 2002a). Cold stress also induces osmotic
disorders, and thus, tolerance to cold induces the
transcription of genes encoding enzymes
responsible for the synthesis of osmoprotectants
and antioxidant defence (Goyary 2009). Osmotin
and osmotin-like proteins were found to be
accumulated in plants under a wide range of
biotic and abiotic stresses. Patade et al. (2013)
reported that transgenic tomato plants accumu-
lating osmotin and proline during cold treatment
had better protection of cell structures and higher
ROS detoxification. As opposed to cold or
freezing conditions, the production of plants tol-
erant to high temperature is of primary interest in
the context of global warming and climate chan-
ges. The response of plants to high temperatures
is characterized by metabolic changes, which aim
to protect the essential structures and function of
cells. The accumulation of polyamines such as
betaine, putrescine, spermidine or spermine is one
of these mechanisms. Certainly, betaine was
found to protect enzymes, such as photosystem II
208
of the photosynthetic machinery, against
heat-induced inactivation (Allakhverdiev et al.
1996). S-adenosyl-L-methionine decarboxylase
(SAMDC) is one of the key regulators of
polyamines synthesis. Tomatoes expressing the
SAMDC gene of S. cerevisiae accumulated sub-
stantially higher amounts of spermine and sper-
midine and were found to be more tolerant to high
temperature. Moreover, the antioxidant enzy-
matic activity and protection of lipid membranes
against peroxidation were significantly enhanced
in the transgenic plants, showing that the accu-
mulation of polyamines is a good strategy for
protection against high temperatures (Cheng et al.
2009).
As already mentioned, heat stress and all
abiotic stresses in general generate ROS, pos-
sessing highly oxidant properties. In order to
protect themselves against ROS-induced dam-
age, plants have evolved antioxidant enzymes
such as superoxide dismutase (SOD) and ascor-
bate peroxidase (APX). Overexpression of
cytosolic APX in tomato allowed the plant not
only to protect itself from damage caused by high
temperatures but also to protect itself from
damage caused by exposure to UV-B (Wang
et al. 2006). In the case of salt stress, plants have
developed several strategies to withstand the
stress, which includes sequestration of solutes,
limitation of lipid peroxidation and/or production
of osmoprotectants. The large, acidic vacuole of
plants serves for the sequestration of such dele-
terious solutes. A broad spectrum of ion trans-
porters are localized to the vacuolar membrane,
allowing the allocation of different ions and
molecules into the vacuole (Martinoia et al.
2000). In tomato, expression of Arabidopsis
vacuolar Na +/H + antiport (AtNHX1), which
drives the export of salts from the cytoplasm into
the vacuole resulted in the production of trans-
genic tomato plants able to grow in the presence
of 200 mM NaCl (Zhang and Blumwald 2001).
Another consequence of salt stress is lipid per-
oxidation with the production of methylglyoxal,
a highly mutagenic and cytotoxic compound.
The detoxification of methylglyoxal is triggered
by specific enzymes, glyoxalase I and II.
Recently, the GlyI gene from Brassica juncea
S. Sharma et al.
and the GlyII gene from Pennisetum glaucum
were simultaneously introduced into the tomato
and the transgenic plants were found to possess
reduced lipid peroxidation and peroxide pro-
duction (Álvarez-Viveros et al. 2013). Moreover,
degradation of chlorophyll due to salt stress was
limited in transgenic tomato plants. Altogether,
this led to the conclusion that engineering the
glyoxalase detoxification system is a way to
enhance tolerance to high salt concentration in
tomato (Álvarez-Viveros et al. 2013).
Moghaied et al. (2011) demonstrated that
improving the osmoprotective system is also a
good strategy to induce salt stress tolerance in
tomato. Ectoine, a common solute of halophilic
bacteria, is a good example of an osmoprotectant.
Ectoine is synthesized from L-aspartate
b-semialdehyde in a three-step reaction cat-
alyzed by enzymes encoded by ectB, ectA and
ectC genes. When the three genes were intro-
duced into tomato by Agrobacterium-mediated
transformation, the resulting transgenic plants
accumulated high amounts of ectoine in a
dose-dependent response, i.e., the higher the
concentration of salt applied, the more the
ectoine accumulated. Water uptake and transport
to leaves were higher in transgenic lines, sug-
gesting that ectoine contributes to establishing a
proper water status upon stress. As already
mentioned, salt stress negatively influences the
overall growth of the plant, inhibiting leaf growth
and inducing premature senescence.
Plant growth and development require proper
hormonal status. In salt-stressed plants, the gen-
eral hormonal status is modified, and more
specifically, the endogenous cytokinin (CK) con-
tent is decreased. Overcoming the salt-induced
reduction of CK could be a strategy to engineer
tolerance to saline stress. This can be achieved by
increasing CK synthesis via overexpression of
genes encoding enzymes for CK biosynthesis.
The constitutive expression of the IPT gene
encoding the enzyme responsible for the first step
in CK biosynthesis led to more than a 150-fold
increase of the CK content in tobacco and
cucumber but had a deleterious effect inhibiting
root growth and inducing water deficit syn-
dromes (Smigocki and Owens 1989). The role of
12 Genomics Resources for Abiotic Stress Tolerance in Solanaceae Crops
CK in salt stress tolerance in tomato was asses-
sed by two experiments (Ghanem et al. 2011). In
the first experiment, overexpression of IPT gene
was driven by a heat shock inducible promoter.
Transient root induction of IPT gene resulted in a
slight decrease in root biomass, but when the
saline stress was applied, the higher endogenous
CK content delayed stomatal closure and leaf
senescence and induced a two-fold increase in
shoot growth. In the second experiment, the same
authors grafted non-transgenic tomato plants
onto the root systems of transgenic tomato plants
(WT/35S::IPT) constitutively expressing IPT
gene. When WT/35S::IPT plants were cultivated
with moderate salt stress, the number and size of
the fruit produced were significantly enhanced
compared to the non-transgenic, non-grafted
tomato plants. These results, taken together,
show how a precise regulation of the hormonal
status can be genetically engineered in order to
produce tomato with enhanced tolerance to salt
stress.
Drought or water deficit is an important
environmental factor greatly affecting agricul-
ture, making the management of water an
important task. Genetic engineering for drought
tolerance/resistance is based on the knowledge
gained from plants developing in arid and
semi-arid regions. Plants growing in
water-limited conditions have evolved two
mechanisms which can be genetically engi-
neered: (1) delay of drought stress by developing
a deep root system, reducing transpiration or
increasing wax layers on the leaf surface, and
(2) tolerance to drought by reducing the need for
water for efficient growth (Kramer and Boyer
1995). As previously mentioned, mechanisms
conferring tolerance to one stress can also confer
tolerance to another one. In the case of the CBF1
gene, which was initially found to improve salt
tolerance in tomato, the authors also demon-
strated that the ectopic expression of Arabidopsis
CBF1 confers resistance to drought stress (Hseih
et al. 2002a, b). To withstand drought stress,
plants accumulate solutes into their vacuole,
modifying the overall osmotic status of the cell
favouring water uptake from the soil. This can be
done either by increasing the activity of the
209
vacuolar sodium/proton antiporter or by
increasing the uptake of protons into the vacuole,
energizing secondary transporters (Pasapula et al.
2011). Vacuolar proton uptake is ensured by
proton pumps (VP1). Overexpression of the
Arabidopsis vacuolar H + -pyrophosphate
(AVP1) in tomato conferred tolerance to both
salt and drought stress. This was marked by the
greater import of cations into root vacuoles and
higher root biomass (Park et al. 2005). Alto-
gether, these studies have suggested that over-
expression of potential candidate genes in tomato
enhanced the stress tolerance of the plant, which
may facilitate better survivability and produc-
tivity in challenging environments.
12.8 Conclusion
Efficient use of genomic resources for the
improvement of crop cultivars may bring back
the alleles/gene pool which was lost during the
domestication process. Application of molecular
markers has enabled the use of wild relatives for
different backcrosses (Zamir 2008).
Pre-breeding, (combining genetic resources and
plant breeding) is nowadays a vital addition to
plant breeding, which couples the new traits
from wild relatives and non-adapted popula-
tions, particularly for various abiotic stresses
(FAO 2010). On the other hand, wide-ranging
utilization of these genetic resources is limited
by problems in accurate introgression of the
targeted allele (with promising effect) minus
unfavourable ones, passed on by “linkage drag”,
leftovers. In the post-genomics period, bioin-
formatics and high-throughput sequencing plat-
forms expedite enormous intra-specific studies
in these crops, permitting a superior description
of diversity present at the genetic level. Avail-
ability of genomes of cultivated as well as wild
Solanaceae species enables the identification of
novel genes for their characterization and also
genotyping to map the genomic regions gov-
erning abiotic stress-tolerant traits using
re-sequencing and/or genotyping-by-sequencing
(GBS) approaches. (Hohenlohe et al. 2011;
Glaubitz et al. 2011).
210
In functional genomics aspects, genome-wide
approaches have expedited the studies of com-
plex stress-regulatory networks, which will assist
in the identification of key networks and their
related genes. These genes could serve as can-
didates for deploying durable tolerance to abiotic
stresses. Also, the genomic tools integrated with
conventional breeding helps in achieving
important advances in crop improvement. Func-
tional genomics coupled with bioinformatics has
enabled the identification of gene families
involved in stress-responsive machinery, char-
acterization of the members of the gene family
and expression profiling in response to abiotic
stress to pinpoint potential candidate genes.
Pyramiding of such genes will aid in the devel-
opment of the stress-tolerant crop, which is the
ultimate goal of these efforts. Although many
such genes have been identified, there are gaps in
our knowledge regarding the response mecha-
nisms. There are various challenges to be
encountered for integrated knowledge of plant
abiotic stress responses and tolerance. These
include identifying the sensors and elucidating
the signalling pathways for abiotic stresses,
understanding the cross-talk among signalling
pathways of various stresses and identifying the
molecular basis of interplay, identification of the
common key factors involved in abiotic stress
responses and developmental processes, and
examining long-term plant responses under
multiple abiotic stress conditions in nature. The
developments in the fields of omics and bioin-
formatics, in future, seem to be a promising tool
in combating these challenges and further
improving the breeding of Solanaceous crops.
Acknowledgements The authors’ work on stress biol-
ogy on tomato is supported by the Department of
Biotechnology, Government of India (Project numbers:
BT/PR7024/PBD/16/1015/2012 and BT/PR8357/PBD/
16/1033/2013). Shambhavi Sharma and Saurabh Pandey
acknowledge the junior research fellowship received from
the Department of Biotechnology, Government of India.
S. Sharma et al.
References
Adams-Phillips L, Barry C, Giovannoni J (2004) Signal
transduction systems regulating fruit ripening. Trends
Plant Sci 9:331–338
Ahn YJ, Claussen K, Zimmerman JL (2004) Genotypic
differences in the heat-shock response and thermotol-
erance in four potato cultivars. Plant Sci 166:901–911
Albert E, Gricourt J, Bertin N, Bonnefoi J, Pateyron S,
Tamby J, Bitton F, Causse M (2016) Genotype by
watering regime interaction in cultivated tomato:
lessons from linkage mapping and gene expression.
Theor Appl Genet 129:395–418
Alexander L, Grierson D (2002) Ethylene biosynthesis
and action in tomato: a model for climacteric fruit
ripening. J Exp Bot 53:2039–2055
Allakhverdiev S, Feyziev Y, Ahmed A, Hayashi H,
Aliev J, Kimlov V (1996) Stabilization of oxygen
evolution and primary electron transport reactions in
photosystem II against heat stress with glycine betaine
and sucrose. J Photochem Photobiol 34:149–157
Álvarez-Viveros M, Inostroza-Blancheteau C, Timmer-
mann T, González M, Arce-Johnson P (2013) Over-
expression of GlyI and GlyII genes in transgenic
tomato (Solanum lycopersicum M.) plants confers salt
tolerance by decreasing oxidative stress. Mol Biol Rep
40:3281–3290
Anithakumari AM, Dolstra O, Vosman B, Visser RGF,
van der Linden CG (2011) In vitro screening and QTL
analysis for drought tolerance in diploid potato.
Euphytica 181:357–369
Anithakumari AM, Nataraja KN, Visser RGF, van der
Linden CG (2012) Genetic dissection of drought
tolerance and recovery potential by quantitative trait
locus mapping of a diploid potato population. Mol
Breed 30:1413–1429
Aoki K, Ogata Y, Igarashi K, Yano K, Nagasaki H,
Kaminuma E, Toyoda A (2013) Functional genomics
of tomato in a post-genome-sequencing phase. Breed
Sci 63:14–20
Arms E, Bloom A, Clair D (2015) High-resolution
mapping of a major effect QTL from wild tomato
Solanum habrochaites that influences water relations
under root chilling. Theor Appl Genet 128:1713–1724
Arms E, Yan Z, Clair D (2017) Differential Transcrip-
tional Regulation in Roots of Tomato Near-Isogenic
Lines in Response to Rapid-Onset Water Stress. Front
Plant Sci 8:166
Baker MB, Venugopal PD, Lamp WO (2015) Climate
change and phenology: Empoasca fabae (Hemiptera:
Cicadellidae) migration and severity of impact.
PLoS ONE 10:e0124915
12 Genomics Resources for Abiotic Stress Tolerance in Solanaceae Crops
Barrientos M, Mol E, Peruzzo G, Contreras A, Alberdi M
(1994) Responses to cold of Chilean wild Solanum
species. Environ Exp Bot 34:47–54
Behnam B, Kikuchi A, Celebi-Toprak F, Kasuga M,
Yamaguchi-Shinozaki K, Watanabe KN (2007) Ara-
bidopsis rd29A: DREB1A enhances freezing tolerance
in transgenic potato. Plant Cell Rep 26:1275–1282
Bernatzky R, Tanksley SD (1986) Toward a saturated
linkage map in tomato based on isozymes and random
cDNA sequences. Genetics 112(4):887–898
Bogdanove A, Martin G (2000) Avr Pto-dependent
Pto-interacting proteins and AvrPto-interacting proteins
in tomato. Proc Natl Acad Sci USA 97:8836–8840
Bonierbale MW, Plaisted RL, Tanksley S (1988) RFLP
maps based on a common set of clones reveal modes
of chromosomal evolution in potato and tomato.
Genetics 120:1095–1103
Bouaziz D, Pirrello J, Charfeddine M, Hammami A,
Jbir R, Dhieb A, Bouzayen M, Gargouri-Bouzid R
(2013) Overexpression of StDREB1 transcription
factor increases tolerance to salt in Transgenic Potato
plants. Mol Biotechnol 54:803–817
Bretό M, Asins M, Carbonell E (1994) Salt tolerance in
Lycopersicon species. III. Detection of quantitative
trait loci by means of molecular markers. Theor Appl
Genet 88:395–401
Brummell D, Harpster M (2001) Cell wall metabolism in
fruit softening and quality and its manipulation in
transgenic plants. Plant Mol Biol 47:311–340
Burlingame B, Mouille B, Charrondiere R (2009) Nutri-
ents, bioactive non-nutrients and anti-nutrients in
potatoes. J Food Compos Anal 22:494–502
Charfeddine M, Saïdi MN, Charfeddine S, Hammami A,
Gargouri Bouzid R (2015) Genome-wide analysis and
expression profiling of the ERF transcription factor
family in potato (Solanum tuberosum L.). Mol
Biotechnol 57(4):348–358
Chen H-H, Li PH (1980) Characteristics of cold accli-
mation and deacclimation in tuber-bearing Solanum
species. Plant Physiol 65(6):1146–1148
Cheng L, Zou Y, Ding S, Zhang J, Yu X, Cao J et al
(2009) Polyamine accumulation in transgenic tomato
enhances the tolerance to high temperature stress.
J Integr Plant Biol 51(5):489–499
Coleman, Warren K (2008) Evaluation of wild Solanum
species for drought resistance: 1. Solanum gandaril-
lasii Cardenas. Environ Exp Botany 62(3): 221–230
Constantinescu D, Memmah M, Vercambre G, Génard M,
Baldazzi V, Causse M, Albert E, Brunel B, Valsesia P,
Bertin N (2016) Model-assisted estimation of the
genetic variability in physiological parameters related
to Tomato fruit growth under contrasted water condi-
tions. Front Plant Sci 7:1841
Costa Dalla, Luisa G Delle, Vedove G, Gianquinto R
Giovanardi, Peressotti A (1997) Yield, water use
211
efficiency and nitrogen uptake in potato: influence of
drought stress. Potato Res 40(1):19–34
Deblonde PMK, Ledent JF (2001) Effects of moderate
drought conditions on green leaf number, stem height,
leaf length and tuber yield of potato cultivars. Eur J
Agron 14(1):31–41
Donnelly DJ, Prasher SO, Patel RM (2007) Towards the
development of salt-tolerant potato. Potato Biol
Biotechnol Adv Perspect 415
Ekanayake IJ, De Jong JP (1992) Stomatal response of
some cultivated and wild tuber-bearing potatoes in
warm tropics as influenced by water deficits. Ann Bot
70(1):53–60
Evers D, Lefèvre I, Legay S, Lamoureux D, Hausman J-F,
Rosales ROG, Marca LRT, Hoffmann L, Bonier-
bale M, Schafleitner R (2010) Identification of
drought-responsive compounds in potato through a
combined transcriptomic and targeted metabolite
approach. J Exp Bot 61(9):2327–2343
FAO (2010) Plant genetic ressource for food and
agriculture. Food and Agriculture Organisation of
the United Nations, Rome
FAOSTAT http://faostat3.fao.org/home/index.html
Feingold S, Lloyd J, Norero N, Bonierbale M, Lorenzen J
(2005) Mapping and characterization of new
EST-derived microsatellites for potato (Solanum
tuberosum L.). Theor Appl Genet 111(3):456–466
Fernandez-Pozo N, Menda N, Edwards JD, Saha S,
Tecle IY, Strickler SR, Bombarely A, Fisher-York T,
Pujar A, Foerster H, Yan A, Mueller LA (2015) The
Sol Genomics Network (SGN)—from genotype to
phenotype to breeding. Nucleic Acids Res. 43
(Database issue): D1036–D1041
Fernie A, Willmitzer L (2001) Molecular and biochemical
triggers of potato tuber development. Plant Physiol
127:1459–1465
Finkers R, De Weerd H et al (2011) Bree DB: A database
suppporting quantitative aspects of plant breeding.
Plant and Animal Genomes XIX, San Diego
Flinn B, Rothwell C, Griffiths R, Lägue M, DeKoeyer D,
Sardana R, Audy P et al (2005) Potato expressed
sequence tag generation and analysis using standard and
unique cDNA libraries. Plant Mol Biol 59(3):407–433
Food, Royal Norvegian Ministry of Agriculture (2008)
Svalbard global seed vault—more about the construc-
tion from the directorate of public construction and
property: 27
Foolad M (1996) Genetic analysis of salt tolerance during
vegetative growth in tomato Lycopersicon esculentum
M. Plant Breed 115(4):245–250
Foolad M (2005) Breeding for abiotic stress tolerances in
tomato, in Abiotic Stresses: plant resistance through
breeding and molecular approaches. In: Ashraf E,
Harris PJC (eds). The Haworth Press, New York, NY,
USA, pp 613–684
212
Foolad M, Jones R (1991) Genetic analysis of salt
tolerance during germination in Lycopersicon. Theor
Appl Genet 81(3):321–326
Foolad MR (1999a) Comparison of salt tolerance during
seed germination and vegetative growth in tomato by
QTL mapping. Genome 42:727–734
Foolad MR (1999b) Genetics of salt tolerance and cold
tolerance in tomato: quantitative analysis and QTL
mapping. Plant Biotechnol 16:55–64
Foolad MR (2004) Recent genetic advances in genetics of
salt tolerance in tomato. Plant Cell Tiss Org Cult
76:101–119
Foolad MR (2007) Genome mapping and molecular
breeding of tomato. Int J Plant Genomics. doi:10.
1155/2007/64358
Foolad MR, Chen FQ (1998) RAPD markers associated
with salt tolerance in an interspecific cross of tomato
(Lycopersicon esculentum x L. pennellii). Plant Cell
Rep 17:306–312
Foolad MR, Chen FQ (1999) RFLP mapping of QTLs
conferring salt tolerance during vegetative stage in
tomato. Theor Appl Genet 99:235–243
Foolad MR, Chen FQ, Lin GY (1998a) RFLP mapping of
QTLs conferring salt tolerance during germination in
an interspecific cross of tomato. Theor Appl Genet
97:1133–1144
Foolad MR, Chen FQ, Lin GY (1998b) RFLP mapping of
QTLs conferring cold tolerance during seed germina-
tion in an interspecific cross of tomato. Mol Breed
4:519–529
Foolad MR, Chen FQ, Lin GY (1998c) RFLP mapping of
QTLs conferring salt tolerance during germination in
an interspecific cross of tomato. Theor Appl Genet 97
(7):1133–1144
Foolad MR, Jones RA (1993) Mapping salt-tolerance
genes in tomato (Lycopersicon esculentum) using
trait-based marker analysis. Theor Appl Genet
87:184–192
Foolad MR, Lin GY (1998) Genetic analysis of low
temperature tolerance during germination in tomato,
Lycopersicon esculentum M. Plant Breed 117:171–176
Foolad MR, Lin GY, Chen FQ (1999) Comparison of
QTLs for seed germination under nonstress, cold
stress and salt stress in tomato. Plant Breed 118:167–
173
Foolad MR, Stoltz T, Dervinis C, Rodriguez RL,
Jones RA (1997a) Mapping QTLs conferring salt
tolerance during germination in tomato by selective
genotyping. Mol Breed 3:269–277
Foolad MR, Stoltz T, Dervinis C, Rodriguez Raymond L,
Jones RA (1997b) Mapping QTLs conferring salt
tolerance during germination in tomato by selective
genotyping. Mol Breeding 3(4):269–277
Foolad MR, Zhang LP, Lin GY (2001a) Identification and
validation of QTLs for salt tolerance during vegetative
growth in tomato by selective genotyping. Genome
44:444–454
Foolad MR, Zhang LP, Lin GY (2001b) Identification and
validation of QTLs for salt tolerance during vegetative
S. Sharma et al.
growth in tomato by selective genotyping. Genome 44
(3):444–454
Foolad MR, Zhang LP, Subbiah P (2003a) Genetics of
drought tolerance during seed germination in tomato:
inheritance and QTL mapping. Genome 46:536–545
Foolad MR, Zhang LP, Subbiah P (2003b) Relationships
among cold, salt and drought tolerance during seed
germination in tomato: inheritance and QTL mapping.
Acta Hort 618:47–57
Fray R, Grierson D (1993) Molecular genetics of tomato
fruit ripening. Trends Genet 9:438–443
Gangadhar BH, JW Yu, Sajeesh Kappachery, Park SW
(2014) A systematic exploration of high-temperature
stress-responsive genes in potato using large-scale
yeast functional screening. Mol Genet Genomics 289
(2):185–201
Gebhardt C, Valkonen J (2001) Organization of genes
controlling disease resistance in the potato genome.
Annu Rev Phytopathol 39:79–102
Gebhardt CH, Ritter E, Barone A, Debener T, Walke-
meier B, Schachtschabel U, Kaufmann H et al (1991)
RFLP maps of potato and their alignment with the
homoeologous tomato genome. Theor Appl Genet 83
(1):49–57
Gebhardt C, Ritter E, Debener T, Schachtschabel U,
Walkemeier B, Uhrig H, Salamini F (1989) RFLP
analysis and linkage mapping in Solanum tuberosum.
Theor Appl Genet 78(1):65–75
Ghanem M, Albacete A, Smigocki A, Frébort I,
Pospíšilová H, Martínez-Andújar C (2011)
Root-synthesized cytokinins improve shoot growth
and fruit yield in salinized tomato (Solanum lycoper-
sicum L.) plants. J Exp Bot 62:125–140
Giovannoni J (2004) Genetic regulation of fruit develop-
ment and ripening. Plant Cell (Suppl) 16:S170–S180
Gong L, Zhang H, Gan X, Zhang L, Chen Y, Nie F, Shi L
et al (2015) Transcriptome profiling of the potato
(Solanum tuberosum L.) plant under drought stress
and water-stimulus conditions. PLoS ONE 10(5):
e0128041
Goyary D (2009) Transgenic crops, and their scope for
abiotic stress environment of high altitude: biochem-
ical and physiological perspectives. DRDO Sci Spectr
195–201
Gray J, Picton S, Shabbeer J, Schuch W, Grierson D
(1992) Molecular biology of fruit ripening and its
manipulation with antisense genes. Plant Mol Biol
19:69–87
Hamilton A, Fray R, Grierson D (1995) Sense and
antisense inactivation of fruit ripening genes in
tomato. Curr Top Microbiol Immunol 197:77–89
Hardigan MA, Crisovan E, Hamilton JP et al (2016)
Genome reduction uncovers a large dispensable
genome and adaptive role for copy number variation
in asexually propagated Solanum tuberosum. Plant
Cell 28:388–405
Haverkort AJ, Fasan T, Van de Waart M (1991) The
influence of cyst nematodes and drought on potato
growth. 2. Effects on plant water relations under
12 Genomics Resources for Abiotic Stress Tolerance in Solanaceae Crops
semi-controlled conditions. Eur J Plant Pathol 97
(3):162–170
Heuer B, Nadler A (1995) Growth and development of
potatoes under salinity and water deficit. Crop and
Pasture Science 46(7):1477–1486
Hseih T, Lee J, Charng Y, Chan M (2002) Tomato plants
ectopically expressing Arabidopsis CBF1 show
enhanced resistance to water deficit stress. Plant
Physiol 130:618–626
Hsieh T, Lee J, Yang P, Chiu L, Charng Y, Wang Y
(2002) Heterology expression of the Arabidopsis
C-repeat/dehydration response element binding factor
1 gene confers elevated tolerance to chilling and
oxidative stresses in transgenic tomato. Plant Physiol
129:1086–1094
Jacobs JME, Van Eck HJ, Arens P, Verkerk-Bakker B, te
Lintel Hekkert B, Bastiaanssen HJM, El-Kharbotly A,
Pereira A, Jacobsen E, Stiekema WJ (1995) A genetic
map of potato (Solanum tuberosum) integrating
molecular markers, including transposons, and classi-
cal markers. Theor Appl Genet 91(2):289–300
Jia XX, Li YT, Qi EF et al (2016) Overexpression of the
Arabidopsis DREB1A gene enhances potato
drought-resistance. Russ J Plant Physiol 63:523
Katerji N, Van Hoorn JW, Hamdy A, Mastrorilli M
(2003) Salinity effect on crop development and yield,
analysis of salt tolerance according to several classi-
fication methods. Agric Water Manag 62(1):37–66
Kishor PKB, Hong Z, Miao G-H, Hu C-AA, Verma DPS
(1995) Overexpression of D1-pyrroline-5-carboxylate
synthetase increases proline production and confers
osmotolerance in transgenic plants. Plant Physiol 108
(4): 1387–1394
Khan et al (2015) Multiple QTLs linked to
Agro-Morphological and physiological traits related
to drought tolerance in Potato. Plant Mol Biol Rep 33
(5):1286–1298
Kikuchi A, Huynh HD, Endo T, Watanabe K (2015)
Review of recent transgenic studies on abiotic stress
tolerance and future molecular breeding in potato.
Breed Sci 65(1):85–102
Kim JI, Baek D, Park HC, Chun HJ, Oh DH, Lee MK,
Cha JY, Kim WY, Kim MC, Chung WS, Bohnert HJ,
Lee SY, Bressan RA, Lee SW, Yun DJ (2013)
Overexpression of Arabidopsis YUCCA6 in potato
results in high-auxin developmental phenotypes and
enhanced resistance to water deficit. Mol Plant 6
(2):337–349
Kim DY, Yi KW, Kwon HB, Byun MO (2003a)
Expression pattern of potato (Solanum tuberosum)
genes under cold stress by using cDNA microarray.
Gene Genomics 25(4):345–352
Kim K-Y, Kwon S-Y, Lee H-S, Hur Y, Bang J-W, Kwak
S-S (2003b) A novel oxidative stress-inducible perox-
idase promoter from sweet potato: molecular cloning
and characterization in transgenic tobacco plants and
cultured cells. Plant Mol Biol 51(6):831–838
Kirtman B, Power SB, Adedoyin AJ, Boer GJ, Bojariu R,
Camilloni I, Doblas-Reyes F et al (2013) Near-term
climate change: projections and predictability
213
Kloosterman B, De Koeyer D, Griffiths R, Flinn B,
Steuernagel B, Scholz U, Sonnewald S et al (2008)
The potato transcriptome: a new look at transcriptional
changes during tuber development using the POCI
array. Comp Funct Genomics 8:329–340
Kloosterman B, Vorst O, Hall RD, Visser RGF,
Bachem CW (2005) Tuber on a chip: differential gene
expression during potato tuber development. Plant
Biotechnol J 3(5):505–519
Knapp S (2002) Tobacco to tomatoes: a phylogenetic
perspective on fruit diversity in the Solanaceae. J Exp
Bot 53:2001–2022
Kramer P, Boyer J (1995) Water relations of plants and
soils. Academic Press, San Diego
Lee WY et al (2003) Over-expressed rice
ADP-ribosylation factor 1 (RARF1) induces
pathogenesis-related genes and pathogen resistance
in tobacco plants. Physiol Plant 119:573–581
Levy D (1985) The response of potatoes to a single
transient heat or drought stress imposed at different
stages of tuber growth. Potato Research 28(4):415–
424
Levy D, Tai GCC (2013) Differential response of potatoes
(Solanum tuberosum L.) to salinity in an arid
environment and field performance of the seed tubers
grown with fresh water in the following season. Agric
Water Manag 116:122–127
Levy D, Veilleux RE (2007) Adaptation of potato to high
temperatures and salinity-a review. Am J Potato Res
84(6):487–506
Li L, Li C, Howe G (2001) Genetic analysis of wound
signaling in tomato. Evidence for a dual role of
Jasmonic acid in defense and female fertility. Plant
Physiol 127:1414–1417
Lounsbery J, Arms E, Bloom A, Clair D (2016)
Quantitative Trait Loci for water-stress tolerance traits
localize on Chromosome 9 of Wild Tomato. Crop Sci
56:1514–1525. doi:10.2135/cropsci2015.07.0432
Maas EV, Hoffman GJ (1977) Crop salt tolerance\-current
assessment. J Irrig Drainage Div 103(2):115–134
MacKerron DKL, Jefferies RA (1986) The influence of
early soil moisture stress on tuber numbers in potato.
Potato Res 29(3):299–312
Martin B, King J, Schaefer A (1989) Restriction fragment
length polymorphisms associated with water use
efficiency in tomato. Science 243(4899):1725–1728
Martinez CA, Maestri M, Lani EG (1996) In vitro salt
tolerance and proline accumulation in Andean potato
(Solanum spp.) differing in frost resistance. Plant Sci
116(2): 177–184
Martinoia E, Massonneau A, Frangne N (2000) Transport
processes of solutes across the vacuolar membrane of
higher plants. Plant Cell Physiol 41:1175–1186
Massa AN, Childs KL, Robin Buell C (2013) Abiotic and
biotic stress responses in group Phureja DM1-3 516
R44 as measured through whole transcriptome
sequencing. Plant Genome 6(3):0001
Massa AN, Childs KL, Lin H, Bryan GJ, Giuliano G,
Robin Buell C (2011) The transcriptome of the
reference potato genome Solanum tuberosum Group
214
Phureja clone DM1-3 516R44. PLoS ONE 6(10):
e26801
Mendoza HA, Estrada RN (1979) Breeding potatoes for
tolerance to stress: heat and frost. Stress Physiol Crop
Plants 227–262
Milbourne D, Meyer RC, Collins AJ, Ramsay LD,
Gebhardt C, Waugh R (1998) Isolation, characterisa-
tion and mapping of simple sequence repeat loci in
potato. Mol General Genetics MGG 259(3):233–245
Monforte A, Asìns M, Carbonell E (1996a) Salt tolerance
in Lycopersicon species. IV. High efficiency of
marker-assisted selection to obtain salt-tolerant breed-
ing lines. Theor Appl Genet 93:765–772
Monforte A, Asìns M, Carbonell E (1997a) Salt tolerance
in Lycopersicon species. V. Does genetic variability at
quantitative trait loci affect their analysis? Theor Appl
Genet 95:284–293
Monforte A, Asìns M, Carbonell E (1997b) Salt tolerance in
Lycopersicon species. VI. Genotype by salinity inter-
action in quantitative trait loci detection: constitutive
and response QTLs. Theor Appl Genet 95:706–713
Monforte A, Asìns M, Carbonell E (1999a) Salt tolerance
in Lycopersicon spp. VII. Pleiotropic action of genes
controlling earliness on fruit yield. Theor Appl Genet
98:593–601
Monforte A, Asıns M, Carbonell E (1996) Salt tolerance
in Lycopersicon species. IV. Efficiency of
marker-assisted selection for salt tolerance improve-
ment. Theor App Genetics 93(5–6): 765–772
Monforte A, Asins M, Carbonell E (1999b) Salt tolerance
in Lycopersicon spp. VII. Pleiotropic action of genes
controlling earliness on fruit yield. Theor Appl Genet
98(3–4):593–601
Monforte A, Asıns, Carbonell E (1997) Salt tolerance in
Lycopersicon species. V. Does genetic variability at
quantitative trait loci affect their analysis? Theor Appl
Genetics 95(9): 284–293
Monneveux P, Ramírez DA, Khan MA, Raymundo RM,
Loayza H, Quiroz R (2014) Drought and heat
tolerance evaluation in potato (Solanum tuberosum
L.) Potato Res 57(3–4): 225–247
Morin RD, Bainbridge M, Fejes A, Hirst M, Krzywin-
ski M, Pugh TJ, McDonald H, Varhol R, Jones SJM,
Marra MA (2008) Profiling the HeLa S3 transcriptome
using randomly primed cDNA and massively parallel
short-read sequencing. Biotechniques 45(1):81
Movahedi S, Sayed Tabatabaei BE, Alizade H,
Ghobadi C, Yamchi A, Khaksar G (2012) Constitutive
expression of Arabidopsis DREB1B in transgenic
potato enhances drought and freezing tolerance. Biol
Plant 56(1):37–42
Mueller L, Solow T, Taylor N, Skwarecki B, Buels R,
Binns J, Lin C, Wright M, Ahrens R, Wang Y,
Herbst E, Keyder E, Menda N, Zamir D, Tanksley S
(2005a) Plant Physiol 138:1310–1317
Mueller LA, Solow TH, Taylor N, Skwarecki B, Buels R,
Binns J, Lin C et al (2005b) The SOL genomics
network. A comparative resource for Solanaceae
biology and beyond. Plant Physiol 138(3):1310–1317
S. Sharma et al.
Nahirñak V, Rivarola M, Gonzalez de Urreta M et al
(2016) Genome-wide analysis of the Snakin/GASA
Gene Family in Solanum tuberosum cv. Kennebec
Am J Potato Res 93:172
Park S, Li J, Pittman J, Berkowitz G, Yang H, Undur-
raga S (2005) Up-regulation of a H + -pyropho-
sphatase (H + -PPase) as a strategy to engineer
drought-resistant crop plants. Proc Natl Acad Sci U
S A 102:18830–18835
Pasapula V, Shen G, Kuppu S, Paez-Valencia J, Men-
doza M, Hou P (2011) Expression of an Arabidopsis
vacuolar H + -pyrophosphatase gene (AVP1) in cot-
ton improves droughtand salt tolerance and increases
fibre yield in the field conditions. Plant Biotechnol J
9:88–99
Patade V, Khatri D, Kumari M, Grover A, Gupta S and
Ahmed Z (2013) Cold tolerance in Osmotin transgenic
tomato (Solanum lycopersicum L.) is associated with
modulation in transcript abundance of stress respon-
sive genes. Springer Plus 2: 17
Paterson AH, Tanksley SD, Sorrells ME (1991) DNA
markers in plant improvement. Adv Agron 46:39–90
Pedley K, Martin GB (2003) Molecular basis of
Pto-mediated resistance to bacterial speck disease in
tomato. Annu Rev Phytopathol 41:215–243
Pino MT, Skinner JS, Park EJ, Jeknić Z, Hayes Patrick M,
Thomashow MF, Chen THH (2007) Use of a stress
inducible promoter to drive ectopic AtCBF expression
improves potato freezing tolerance while minimizing
negative effects on tuber yield. Plant Biotechnol J 5
(5):591–604
Prat S, Frommer W, Hofgen R, Keil M, Kossmann J,
Koster-Topfer M, Liu X, Muller B, Pena-Cortes H,
Rocha-Sosa M (1990) Gene expression during tuber
development in potato plants. FEBS Lett 268:334–338
Rahnama H, Vakilian H, Fahimi H, Ghareyazie B (2011)
Enhanced salt stress tolerance in transgenic potato
plants (Solanum tuberosum L.) expressing a bacterial
mtlD gene.Acta Physiologiae Plantarum 33(4): 1521–
1532
Rensink W, Hart A, Liu J, Ouyang S, Zismann V, Robin
Buell C (2005) Analyzing the potato abiotic stress
transcriptome using expressed sequence tags. Genome
48(4):598–605
Ritter E, Barandalla L, López R, de Galarreta JIR (2008)
Exploitation of exotic, cultivated Solanum germplasm
for breeding and commercial purposes. Potato Res 51
(3–4): 301-311
Roviglioni, R., M. C. De Vicente, N. Dudnik, and T.
Hodgkin (2000) Molecular methods in the conserva-
tion and use of plant genetic resources. In International
symposium on molecular markers for characterizing
genotypes and identifying cultivars in Horticulture
546: 107–118
Ryu SB, Costa A, Xin Z, Li PH (1995) Induction of cold
hardiness by salt stress involves synthesis of cold-and
abscisic acid-responsive proteins in potato (Solanum
commersonii Dun). Plant Cell Physiol 36(7):1245–
1251
12 Genomics Resources for Abiotic Stress Tolerance in Solanaceae Crops
Schafleitner R (2009) Growing more potatoes with less
water. Trop Plant Biol 2(3–4):111–121
Schafleitner R, Gutierrez R, Espino R, Gaudin A, Pérez J,
Martínez M, Domínguez A et al (2007a) Field
screening for variation of drought tolerance in
Solanum tuberosum L. by agronomical, physiological
and genetic analysis. Potato Res 50(1):71–85
Schafleitner R, Rosales ROG, Gaudin A, Aliaga CAA,
Martinez GN, Marca LRT, Bolivar LA, Delgado FM,
Simon R, Bonierbale M (2007b) Capturing candidate
drought tolerance traits in two native Andean potato
clones by transcription profiling of field grown plants
under water stress. Plant Physiol Biochem 45(9):673–
690
Schauer N, Zamir D, Fernie A (2005) Metabolic profiling
of leaves and fruit of wild species tomato: a survey of
the Solanum lycopersicum complex. J Exp Bot
56:297–307
Sharma SK, Bolser D, de Boer J. (2013) Construction of
reference chromosome-scale pseudomolecules for
potato: integrating the potato genome with genetic
and physical maps. G3 Genes Genomes Genet 3:
2031–2047
Shin D, Moon SJ, Han S, Kim BG, Park SR, Lee SK,
Yoon HJ, Lee HE, Kwon HB, Baek D, Yi BY,
Byun MO (2011) Expression of StMYB1R-1, a novel
potato single MYB-like domain transcription factor,
increases drought tolerance. Plant Physiol 55(1):421–
432
Sievers N, Muders K, Henneberg M, Klähn S, Effmert M,
Junghans H, Hagemann M (2013) Establishing glu-
cosylglycerol synthesis in potato (Solanum tuberosum
L. cv. Albatros) by expression of the ggpPS gene from
Azotobacter vinelandii. J Plant Sci Mol Breed 2(1): 1
Simmonds NW (1971) Potential of potatoes in the tropics.
Trop Agr St Augustine
Smigocki A, Owens L (1989) Cytokinin-to-auxin ratios
and morphology of shoots and tissues transformed by
a chimeric isopentenyl transferase gene. Plant Physiol
91:808–811
Spooner DM, Salas A (2006) Structure, biosystematics,
and genetic resources of potato. Handbook Potato
Prod Improv Post-Harvest Manage 1–39.
Staub JE, Serquen FC, Gupta M (1996) Genetic markers,
map construction, and their application in plant
breeding. HortScience 31(5):729–741
Stiller I, Dulai S, Kondrák M, Tarnai R, Szabó L, Toldi O,
Bánfalvi Z (2008) Effects of drought on water content
and photosynthetic parameters in potato plants
expressing the trehalose-6-phosphate synthase gene
of Saccharomyces cerevisiae. Planta 227(2):299
Szalonek M, Sierpien B, Rymaszewski W, Gieczewska K,
Garstka M, Lichocka M et al (2015) Potato Annexin
STANN1 Promotes Drought Tolerance and Mitigates
Light Stress in Transgenic Solanum tuberosum L.
Plants. PLoS ONE 10(7):e0132683
Ta J, Kaushik SK, Minhas JS, Bhardwaj V (2003) The
potato: breeding for biotic and abiotic stress. Mehta,
New Delhi, p 446
215
Tang R, Zhu W, Song X, Lin X, Cai J, Wang M, Yang Q
(2016) Genome-wide identification and function anal-
yses of heat shock transcription factors in Potato.
Front. Plant Sci. 7:490
Tang L, Kim MD, Yang K-S, Kwon S-Y, Kim S-H, Kim
J-S, Yun D-J, Kwak S-S, Lee H-S (2008) Enhanced
tolerance of transgenic potato plants overexpressing
nucleoside diphosphate kinase 2 against multiple
environmental stresses. Transgenic Res 17(4):705–
715
Tanksley S (2004) The genetic, developmental, and
molecular bases of fruit size and shape variation in
tomato. Plant Cell (Suppl) 16:S181–S189
The Potato Genome Sequencing Consortium (2011)
Genome sequence and analysis of the tuber crop
potato. Nature 475:189–195
The Tomato Genome Consortium (2012) The tomato
genome sequence provides insights into fleshy fruit
evolution. Nature 485:635–641
Tourneux C, Devaux A, Camacho M, Mamani P, Ledent
J-F (2003) Effects of water shortage on six potato
genotypes in the highlands of Bolivia (I): morpholog-
ical parameters, growth and yield. Agronomie 23
(2):169–179
Truco M, Randall L, Bloom A, Clair D (2000) Detection
of QTLs associated with shoot wilting and root
ammonium uptake under chilling temperatures in an
interspecific backcross population from Lycopersicon
esculentum  L. hirsutum. Theor Appl Genet 101
(7):1082–1092
Tseng MJ, Li PH (1990) Alterations of gene expression in
potato (Solanum commersonii) during cold acclima-
tion. Physiol Plant 78(4):538–547
Upadhyaya CP, Young KE, Akula N, soon Kim H,
Heung JJ, Oh OM, Aswath CR, Chun SC, Kim DH,
Park SW (2009) Over-expression of strawberry
D-galacturonic acid reductase in potato leads to
accumulation of vitamin C with enhanced abiotic
stress tolerance. Plant Sci 177(6): 659–667
Upadhyaya CP, Akula N, Young KE, Chun SC, Kim DH,
Park SW (2010) Enhanced ascorbic acid accumulation
in transgenic potato confers tolerance to various
abiotic stresses. Biotech Lett 32(2):321–330
Vellejos C, Tanksley S (1983) Segregation of isozyme
markers and cold tolerance in an interspecific back-
cross of tomato. Theor Appl Genet 66(3–4):241–247
Van Berkel J, Salamini F, Gebhardt C (1994) Transcripts
accumulating during cold storage of potato (Solanum
tuberosum L.) tubers are sequence related to
stress-responsive genes. Plant Physiol 104(2): 445–452
Van Dam J, Kooman PL, Struik PC (1996) Effects of
temperature and photoperiod on early growth and final
number of tubers in potato (Solanum tuberosum L.).
Potato Research 39(1):51–62
van Eck HJ, Rouppe J, van der Voort J, Draaistra P, van
Zandvoort E, van Enckevort B, Segers JP, Jacobsen E,
Helder J, Bakker J (1995) The inheritance and
chromosomal localization of AFLP markers in a
non-inbred potato offspring. Mol Breed 1(4):397–410
216
Van Os H, Andrzejewski S, Bakker E, Barrena I,
Bryan GJ, Caromel B, Ghareeb B et al (2006)
Construction of a 10,000-marker ultradense genetic
recombination map of potato: providing a framework
for accelerated gene isolation and a genomewide
physical map. Genetics 173(2):1075–1087
Vasquez-Robinet C, Mane SP, Ulanov AV, Watkinson JI,
Stromberg VK, De Koeyer D, Schafleitner R et al
(2008) Physiological and molecular adaptations to
drought in Andean potato genotypes. J Exp Bot 59
(8):2109–2123
Vega SE, Bamberg JB (1995) Screening the US potato
collection for frost hardiness. Am Potato J 72(1):13–21
Villalta I, Bernet G, Carbonell E, Asins M (2007)
Comparative QTL analysis of salinity tolerance in
terms of fruit yield using two Solanum populations of
F7 lines. Theor Appl Genet 114:1001–1017
Villalta I, Reina-Sánchez A, Bolarín M, Cuartero J,
Belver A, Venema K, Carbonell E, Asins M (2008)
Genetic analysis of Na(+) and K(+) concentrations in
leaf and stem as physiological components of salt
tolerance in tomato. Theor Appl Genet 116:869–880
Wang W, Vinocur B, Altman A (2003) Plant responses to
drought, salinity and extreme temperatures: towards
genetic engineering for stress tolerance. Planta 218:1–14
Wang Y, Wisniewski M, Meilan R, Cui M, Fuchigami L
(2006) Transgenic tomato (Lycopersicum esculentum)
overexpressing cAPX exhibits enhanced tolerance to
UV-B and heat stress. J Appl Hortic 8:87–90
Wang Zhong, Gerstein Mark, Snyder Michael (2009)
RNA-Seq: a revolutionary tool for transcriptomics.
Nat Rev Genet 10(1):57–63
S. Sharma et al.
Watanabe Kazuo (2015) Potato genetics, genomics, and
applications. Breed Sci 65(1):53–68
Watkinson JI, Hendricks L, Sioson AA, Vasquez-Robinet
C, Stromberg V, Heath LS, Schuler M, Bohnert HJ,
Bonierbale M, Grene R (2006) Accessions of Solanum
tuberosum ssp. andigena show differences in
photosynthetic recovery after drought stress as
reflected in gene expression profiles. Plant Sci 171
(6): 745–758
Weisz R, Kaminski J, Smilowitz Z (1994) Water
deficit effects on potato leaf growth and
transpiration: utilizing fraction extractable soil water
for comparison with other crops. Am J Potato Res 71
(12):829–840
Youm JW, Jeon JH, Choi D, Yi SY, Joung H, Kim HS
(2008) Ectopic expression of pepper CaPF1 in potato
enhances multiple stresses tolerance and delays initi-
ation of in vitro tuberization. Planta 228(4):701–708
Zamir D, Tal M (1987) Genetic analysis of sodium,
potassium and chloride ion content in Lycopersicon.
Euphytica 36:187–191
Zamir D (2008) Plant breeders go back to nature. Nature
Genet 40(3):269–270
Zhang H, Blumwald E (2001) Transgenic salt-tolerant
tomato plants accumulate salt in foliage but not in
fruit. Nat Biotechnol 19:765–768
Zhang N, Si H-J, Wen G, Hong-Hui D, Liu B-L, Wang D
(2011) Enhanced drought and salinity tolerance in
transgenic potato plants with a BADH gene from
spinach. Plant Biotechnol Rep 5(1):71–77
Zhu J (2002) Salt and drought stress signal transduction in
plants. Annu Rev Plant Biol 53:247–253
 Somatic Cell Genetics and Its
Application in Potato Breeding 13
Ramona Thieme and Elena Rakosy-Tican

Abstract
This chapter presents a summary of published work on the development,
achievements and interconnections of research on potato somatic cell
genetics. To maintain genetic stability the main topics include the
establishment and maintenance of in vitro cultures, micropropagation,
shoot and meristem culture, somatic embryogenesis, production of micro-
and mini-tubers and conservation of germplasm. In the second section, the
methods presented are based on the induction and utilization of genetic
variability (diversity): production of haploids, somatic hybridization via
protoplast fusion, somaclonal variation and gene transfer. Another
significant aspect of this review is the presentation of numerous methods
used in clonal propagation, the production of healthy plants, germplasm
conservation for medium-term and long-term storage, potato breeding and
utilization of germplasm for the production of advanced breeding clones
and potato cultivars with improved resistance to pathogens, pests and
abiotic stress, and of high quality and with other specific traits for other
purposes. Finally, new methods of breeding, including molecular marker
development and genome editing, are briefly described to indicate the
potential of somatic cell genetics for the future improvement of potato.

13.1 Introduction

R. Thieme (&) Each plant cell contains one complete set of

Julius Kühn Institut (JKI), Federal Research Centre
for Cultivated Plants, Institute for Breeding Research
on Agricultural Crops, Quedlinburg, Germany
e-mail: ramona.thieme@julius-kuehn.de
E. Rakosy-Tican
Plant Genetic Engineering Group,
Faculty of Biology and Geology, Babes-Bolyai
University, Cluj-Napoca, Romania
chromosomes with the genetic information for
the development of an individual plant, which is
the basis of the ability to regenerate a plant from
cells in culture. Starting with the first report of
the cultivation of potato plants in vitro (Stewart
and Caplin 1951) diverse biotechnological tech-
niques have been successfully used for more than

© Springer International Publishing AG 2017 217

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_13
218
65 years. These techniques are generally referred
to as somatic cell genetics, which both increase
the supply of genetic diversity and make selec-
tion more efficient. Potato can be cultivated
in vitro and is amenable to biotechnological
improvement (Barrell et al. 2013). Somatic cell
genetics has developed since the demonstration
of potato cell totipotency in vitro, i.e. plant
regeneration from isolated protoplasts (Shepard
and Totten 1977). The definition of plant somatic
cell genetics includes all in vitro genetic tech-
niques that can be used to culture organs, tissues,
cells and isolated protoplasts and obtain insights
into the genetics of plant somatic cells (Terzi
et al. 1985). Some of them are routinely used for
many practical applications in potato breeding,
maintenance and production. Micropropagation
using two node explant culture and development
of micro-tubers is today commonly used in all
tissue culture laboratories for the propagation and
medium-term preservation of potato germplasm.
Cryopreservation techniques are used for the
long-term conservation of potatoes and wild
species of Solanum (Li et al. 2016). In vitro
selection of somaclones and protoclones of
potato has been successfully used as well as
genetic manipulation through gene transfer or
protoplast fusion to bypass sexual incompatibil-
ity and introgress many of the resistance genes of
wild species to improve potato (Rokka 2015).
New biotechnological techniques such as
CRISPR-Cas9 can be used to genetically
manipulate potato, which opens up new horizons
for potato improvement (Wang et al. 2015).
Relevant biotechnological methods and approa-
ches for the development of potato based on
somatic cell genetics are summarized in
Fig. 13.1.
In this chapter the use of potato somatic cell
genetics is discussed and brought up to date
regarding the latest achievements and introduc-
tion of new techniques such as iRNA and gen-
ome editing and the prospects of potato somatic
cell genetic studies for potato crop improvement.
With the broadening of the genetic knowledge
and approaches, like genomic selection, gene
editing, transformation and hybrid breeding,
gene identification and diagnostic molecular
R. Thieme and E. Rakosy-Tican
marker techniques, it will be possible to manip-
ulate and successfully control and change the
patterns of development of tissues to suit our
interests and needs. In particular, DNA markers
for the precise characterization of germplasm, the
construction of saturated linkage maps, defined
molecular markers for marker-assisted gene
pyramiding and alien gene introgression should
improve the breeding of potatoes. Cell and tissue
culture techniques are invaluable in achieving
these goals.
13.2 Methods of Maintaining
Genetic Stability
13.2.1 Micropropagation: Shoot,
Meristem Tip Culture,
Somatic Embryogenesis,
Micro- and Mini-tubers
and Their Use in Potato
Breeding
13.2.1.1 In Vitro Multiplication
and Shoot Culture
Methods of plant tissue culture include the
growing of plant cells, tissues or organs isolated
from a plant on artificial media under axenic
conditions in a suitable environment. One prac-
tical objective is the rapid clonal propagation of
potato. Micropropagation is a much faster and
more efficient way of asexually propagating
in vitro plantlets of single shoot cuttings on
artificial media than the traditional propagation
by cuttings in soil in a glasshouse. The shoots are
cut into single node explants, each containing an
axillary bud and cultivated individually in glass
tubes or vessels of different sizes. After transfer
to a fresh medium, which supports shoot elon-
gation and rooting, the axillary buds of these
explants rapidly develop into rooted plantlets
consisting of several internodes within 3–
4 weeks. The culture of shoots is the basic
technique for establishing in vitro cultures using
shoot tips, or apexes, and material for use in
other techniques such as cell, tissue and organ
culture, protoplast culture, somatic embryogene-
sis and transformation. Other methods of
13 Somatic Cell Genetics and Its Application in Potato Breeding 219

Valuable gene variants for improving potato

Resistance to pathogens, pests, abiotic stress, quality, specific traits, raw material: Advanced breeding clones

Maintenance of genetic stability Exploitation of somatic genome variation

Pre-breeding material
Improved growing system In vitro mutagenesis
Mini-tubers Genome editing
Hydroponics, aeroponics TILLING, TALENs, ZFNs
Encapsulated somatic embryos CRISPR-Cas9
True potato seeds

Pathogen-free plants Gene transfer

Meristem(tip) culture Transgenesis
Chemo-, thermo-therapy Cisgenesis

Micro-propagation Molecular farming

Shoot culture Cell suspension
Embryo culture Bioreactor
Micro-tubers

Somatic hybridization
Protoplast fusion
Conservation
Cold storage Genetic fingerprinting / Molecular markers
Micro-tubers Haploid production
Growth retardants Molecular and genetic trait analysis
Osmotic stress
Cryopreservation Estimation of characters / Selection Ploidy manipulation
Resistance, yield, quality

Genetic resources of potato

Wild species, Genebank accessions, Collections

Fig. 13.1 Approaches and manipulation steps for improvement of potato based on somatic cell genetics

propagation, like multiple shoot production by
activating axillary buds, were favoured in the
1970s (Westcott et al. 1977; Roca et al. 1978)
and used for transferring genetic resources into
potato (Roca et al. 1979).
A lot of research has been undertaken to
determine the main factors for ideal propagation,
including media for the production and mainte-
nance of potato shoot cultures (details in Vin-
terhalter et al. 2008). The MS medium, as
described by Murashige and Skoog (1962),
contains carbohydrates (sucrose), macro and
microelements, vitamins, but no plant growth
regulators, like phytohormones, and is still the
best and most widely used medium for potato
propagation. Mainly during the 1970s and up to
the beginning of 2000, the effect of medium
supplements and various cultural conditions that
affect the growth of in vitro plants were being
intensively investigated. The use of liquid, agar
or gelrite-solidified media, mineral nutrition and
specific substances and inoculation density
(overview in Vinterhalter et al. 2008) was
investigated. Different types of closures for tubes
and vessels were used for analysing growth and
morphology of potato shoots in vitro
(Chanemougasoundharam et al. 2004; Genound-
Gourichon et al. 1993). Based on these studies
and our experience we recommend cotton wool
plugs, which in terms of avoiding morphological
abnormalities, are the best type of closure.
Seabrook (2005) reviews the studies on the
effects of irradiance, photoperiod and spectral
composition of light on potato growing in vitro.
Recently, trials were carried out on the use of
LED light for growing potato plants and tissue
in vitro to minimize the energy costs of climate
rooms for propagation and storage (Jao and Fang
2004; Luz et al. 2016; Da Rocha et al. 2015).
An efficient method for mass propagation of
single-leaf cuttings is published by Haapala
(2005). Other details were published, like using
220
food containers as a cheaper alternative to the
traditional culture vessels, which can also be
effectively sterilized using NaOCl solution,
which significantly reduces the costs of micro-
propagation (Weber et al. 2015). Temperature
pre-treatment of transplants from in vitro plant-
lets influences their growth and yield in the field
(Tadesse et al. 2001). Attempts were made to
automate micropropagation using robots moni-
tored by cameras and computer programs
(Aitken-Christie et al. 1995). This interesting
approach was not generally accepted because of
problems involved in arriving at accurate deci-
sions about how to manipulate plant material.
Recently the main use for shoot cultures is
clonal propagation but it is also the basic tech-
nique of other biotechnological methods. This
method of shoot culture guarantees, when
development of callus tissue is avoided, high
multiplication rates and the production of genetic
identical, healthy and stable potato plants.
Therefore the term ‘rapid or mass propagation’ is
generally used.
13.2.1.2 Meristem Tip Culture
The essence of meristem-tip culture is the exci-
sion of an organized shoot apex, 0.3–1.0 mm in
length from a donor plant for subsequent culture
in vitro. An apical meristem includes the apical
dome and a limited number, mostly two to four of
the youngest leaf primordia and no differentiated
provascular or vascular tissues. Meristem tips are
removed by sterile dissection under a microscope
and cultured in a liquid medium with filter paper
bridge supports or on an agar-solidified medium
containing low concentrations of plant growth
regulators. There are a lot of studies on meristem
tip culture but only a few will be mentioned in this
chapter. An advantage is a genetic stability
inherent in this technique, since plantlet devel-
opment is from an already undifferentiated apical
meristem and the development of shoots directly
from the meristem avoids callus tissue formation
and adventitious organogenesis. A major advan-
tage of working with such small explants is the
potential this has for excluding pathogenic
organisms that may have been present in the
donor plants. Therefore, this technique is used to
R. Thieme and E. Rakosy-Tican
eradicate harmful viruses, based on the observa-
tion that only a few virus particles are present in
meristem cells. Using very small explants, the
chance of producing a virus-free plant is high, but
the survival rate is directly proportional to the size
of the explant. The efficiency of virus eradication
depends on the type of virus, potato variety or
genotype. To increase the probability of suc-
cessfully producing virus-free material, ther-
motherapy can be used separately or in
combination with meristem tip culture as the
second step in the procedure (Stace Smith and
Mellor 1968; Šip 1972; Faccioli 2001). For
thermotherapy, ex vitro or in vivo plants or tubers
are kept at a high temperature of 32–36 °C.
Another method of virus eradication is
chemotherapy: media are supplemented with
viricidal substances, like ribavirin (Klein and
Livingstone 1982; Faccioli and Colalongo 2002)
or jasmonic acid (Ravnikar and Gogala 1989). All
these methods could be used for the mass pro-
duction of virus-free potato plants, which could
be used as seed for the routine establishment of
potato crops in the field.
Based on demand, meristem tip culture is used
by breeding companies in combination with
thermo- and chemotherapy to eliminate virus
diseases to produce virus-free (disease-free)
plants.
13.2.1.3 Somatic Embryogenesis
Somatic embryogenesis is the development of a
bipolar structure consisting of both a root and a
shoot, from any sporophyte cell via the same key
stages of embryo development as zygotic
embryogenesis via globular, hart and or torpedo
stages. The cells first de-differentiate and then
re-differentiate towards the embryogenic path-
way. Somatic embryos are produced using dif-
ferent media and explants like: cotyledons/
hypocotyls or shoot/leaf explants (Pret’ová and
Dedicova 1992; De García and Martínez 1995;
JayaSree et al. 2001) or suspension cultures
(Vargas et al. 2005). An efficient system for
inducing somatic embryogenesis in potato is
reported by Seabrook and Douglass (2001) and
Sharma and Millam (2004), with the potential for
mass clonal propagation. The internodal
13 Somatic Cell Genetics and Its Application in Potato Breeding
segments are subjected to a three-stage culturing
regime of shoot multiplication, the induction of
somatic embryogenesis and the regeneration of
somatic embryos using specific culture media.
After transferring explants from an initial incu-
bation on a medium containing auxin to an
auxin-free medium, embryos develop within
three weeks, which is confirmed by histological
studies. It is reported that this unicellular mode of
origin can successfully be used to produce such
embryos (Sharma and Millam 2004; Sharma
et al. 2007a). After transferring to a plant growth
regulator-free medium, the resulting plantlets
develop into potato plants, which produce tubers
of good quality when grown in a glasshouse. The
use of somatic embryogenesis by regenerating
from single cells is an interesting tool for pro-
ducing seed material and propagation of trans-
genic potato plants. Producing synthetic seeds by
encapsulating somatic embryos could have
advantages for handling, storage and transporta-
tion (Sharma et al. 2007b). Furthermore, it is a
novel biological system for studies on gene
expression and regulation. The use of somatic
embryogenesis for potato improvement is sum-
marized by Nassar et al. (2015).
13.2.1.4 Micro-tubers
Induction and Propagation
Micro-tubers are produced in vitro by culturing
shoots. Their size is between 4 and 15 mm
depending on cultural conditions and potato
genotype. The fresh weight varies from 100 to
400 mg. Several different in vitro culture systems
are used in tuberization studies (Ewing 1987).
The most common method uses shoot cultures
involving at least one subculturing to develop
tubers. For practical purposes it is necessary to
understand each of the different phases in the
production of micro-tubers: initial explants, tuber
induction, and dormancy response, development
of new plants and abiotic factors and conditions.
Hussay and Stacey (1984) studied tuberization in
single node cuttings of several potato cultivars.
Their results were confirmed by later studies and,
therefore, are described here in more detail. On a
medium containing 2.0 mg/l BA and 6%
221
sucrose, micro-tubers develop after 6–8 weeks.
The upright leafy shoots develop on horizontally
growing stolons. Photoperiod also affects tuber-
ization as under long-day conditions stolons form
tubers in the medium and under short-day con-
ditions most tubers develop above the solidified
agar medium. All tuberization-inducing factors
are inhibitors of gibberellin biosynthesis. The
presence of GAs inhibits tuberization and pro-
motes the elongation of stolons (Kumar and
Wareing 1972; Vreugdenhill and Struik 1989;
Xu et al. 1998).
Using this single-node tuberization system has
revealed that in vitro tuberization is stimulated by
increasing the sucrose concentration to 5–8%
compared to glucose, fructose, maltose (Khuri
and Moorby 1995; Fufa and Diro 2013) or
mannitol (Lo et al. 1972) and by the addition of
2–10 mg/l cytokinins (Wang and Hu 1982;
Abbott and Belcher 1986; Estrada et al. 1986;
Gopal et al. 2004) and supplementary nutrients
(Dhital and Lim 2011). Fluctuating temperature
also affects the in vitro production of
micro-tubers (Otroshi et al. 2009).
By adding various compounds, such as the
plant growth inhibitor CCC (Hussay and Stacey
1984; Estrada et al. 1986; Lentini and Earle
1991), auxins (Ewing 1987; Dragićević et al.
2008), coumarin (Stallknecht 1972), jasmonic
acid (JA, Pelacho and Mingo-Castel 1991),
activated charcoal (AC, Bizarii et al. 1995) or
hydrogen peroxide (López-Delgado et al. 2012)
to a medium, it is also possible to stimulate the
induction and development of micro-tubers.
Dormancy and Mass Propagation of
Micro-tubers
Dormancy of micro-tubers is strongly dependent
on genotype (Leclerc et al. 1995; Pruski et al.
2003) and tuber size. Small micro-tubers mani-
fest a greater tendency to become dormant than
large tubers (Ranalli et al. 1994; Leclerc et al.
1995). Lê (1999) presents data that indicates that
a period in cold storage decreases the tendency to
become dormant. Micro-tubers produced in cul-
tures exposed to light had a short dormancy and
sprouted prematurely (Gopal et al. 1997).
Short-day treatments reduce the duration of
222
dormancy compared to tubers developed in
darkness (Coleman and Coleman 2000).
Micro-tubers produced under long-day condi-
tions tend to sprout more readily than those kept
under short-day conditions (Vecchio et al. 2000).
These results demonstrate that the dormancy of
micro-tubers ranges from strong to completely
absent (Leclerc et al. 1995; Coleman et al. 2001).
Therefore, they are clearly not similar to
field-grown plants (Coleman et al. 2001). Sum-
marizing, dormancy is determined by the method
of production. Before selecting a procedure for
producing micro-tubers, it is important to con-
sider the reason for producing them. Other traits
of micro-tubers are essential for the propagation
of healthy material for transfer into glasshouses
or grown on in the field. Liquid MS medium in
fermenters has been used for the large-scale
production of micro-tubers (Akita and Takayama
1988). This involves a two-step method starting
with the cultivation of single node cuttings in 2
litres of liquid medium containing 3% sucrose
contained in jars exposed to weak light until they
produced shoots. In the second step, when the
shoots were 20 mm long, the medium is replaced
by one containing 9% sucrose and cultivated in
darkness. Within two weeks this results in the
production of 223 tubers per fermenter. The
production of micro-tubers using different types
of bioreactors is reviewed by Piao et al. (2002).
13.2.1.5 Mini-tubers
Mini-tubers are mostly 5–30 mm in diameter and
weigh 0.5–5 g, and are larger than micro- tubers,
but smaller than seed tubers, which weigh about
50–70 g. Mini-tuber production is based on the
rapid in vitro propagation of a virus-free stock of
micro-plants and their subsequent culturing
hydroponically or other similar derived tech-
nologies (Ahloowalia 1999). It is used as the
starting point for a field multiplication system.
After acclimation, in vitro propagated plants or
micro-tubers develop their own system of stolons
and tubers after they are transferred to glass-
houses or net-houses. The production of
pathogen-free mini-tubers is possible within 70–
90 days of growing them in soil under protected
and controlled conditions. Some commercial
R. Thieme and E. Rakosy-Tican
companies quote rates of up to 1000 mini-tubers
per square metre following non-destructive har-
vesting every 40–50 days from a crop derived
from a single micro-plant under optimal glass-
house conditions (http:www.quantumtubers.com/
techinfo.htm).
The larger the mini-tubers, the easier they are
to handle and select because the characters of
parental cultivars expressed in the tubers, like
shape, skin colour and texture, are more easily
visible. The effectiveness of using these tubers
for selecting for agronomic characters is
demonstrated by Gopal et al. (2002). The age of
transplants from in vitro derived potato plantlets
affects crop growth and seed tuber production in
the field (Milinkovic et al. 2012; Lommen 2015).
Healthy mini-tubers are the basis of seed multi-
plication programmes, as this reduces the number
of multiplications and hence the risk of contam-
ination of diseases and pests in the field. For the
large-scale production of mini-tubers, growing
them hydroponically in a nutrient solution is an
efficient technique (Lommen 2007). The roots of
the plants are enclosed in a water-filled container
and the liquid nutrient solution is directly taken
up by the roots. The shoots develop well under
controlled temperature conditions. The
mini-tubers repeatedly can be harvested as they
can be removed from the plants once they have
grown to a minimum size. This leads to the ini-
tiation of new extra tubers (Lommen 2007).
Muro et al. (1997) compared two contrasting
culture systems for propagating first generation
potatoes: a system using peat or sand mixed with
mineral fertilizers and a hydroponic culture
method using perlite as a matrix and a nutrient
solution. The total production and number of
tubers were significantly higher in the hydro-
ponic cultures. Compared to this, an aeroponic
system, in which nutrients are applied as mist to
the root system is more efficient for producing
mini-tubers, but they have a lower average
weight (Ritter et al. 2001). Hydroponic or aero-
ponic systems for producing disease-free
mini-tubers for pre-basic seed production are
used in countries where the climatic conditions
are very unfavourable, such as high temperatures
and humidity during the vegetation period, as in
13 Somatic Cell Genetics and Its Application in Potato Breeding
Latin America (Mateus-Rodriguez et al. 2013),
Africa (Vanderhofstadt 1999; Mbiyu et al. 2012;
Prossy et al. 2014) and South Korea (Chang et al.
2011). Because the roots of the plants are cooled
by the culture medium, the plants develop well
and quickly. Several cycles of potato production
per year is possible, resulting in a highly pro-
ductive system.
Potato breeding companies commonly use
in vitro cultures of plants, micro-tubers and
mini-tubers to rapidly multiply their varieties and
to maintain a collection of disease-free, and true
breeding material. The mini-tubers can be clas-
sified as Elite Seed and used for the production of
certified seed.
13.2.1.6 Long-Term Storage
for Conservation
of Potato Germplasm
and Plant Genetic
Resources, (Living
Collection, Gene Bank)
Maintenance of Cultures of in Vitro Plants
The standard duration of the subculture of potato
in a MS medium is 4–6 weeks at 20 °C and with
a photoperiod of 16 h. This has been the standard
procedure for the clonal propagation of potato
plants since it was used successfully in the 1970s
(Westcott et al. 1977). For a large collection of
valuable genotypes, this method is expensive in
terms of time and labour. The growth of the
plants is determined by the number in a cultural
vessel (Sarkar et al. 1994), but there are more
efficient methods of prolonging the period for
which cultures of shoots can be stored.
In vitro techniques for the medium- to
long-term storage of potato tissue must satisfy
the following requirements (Thieme 1992):
• extended storage life of the material must not
be associated with reduced viability;
• low material, energy and labour inputs;
• can be used for a wide range of genotypes;
• no greater risk to the genetic stability of the
stored material than growing in the field.
223
Investigations on how to fulfil these criteria
resulted in the development of protocols, which
require subculturing once per year or more and
guarantee the genetic identity and a high per-
centage survival of explants.
Micro-tuber Induction and Storage
Nodal parts of in vitro plants are cut and trans-
planted into an MS-medium enriched with 8–10%
sucrose but without phytohormones and culti-
vated under long-day conditions at 20 °C. After
two to three weeks, culturing continues under
tuber-inducing conditions at 9 °C under short-day
conditions of 8/16 h light/dark cycle. Two to four
months later during tuber formation the stems
slowly die. The micro tubers left in the tubes are
stored in the dark at 4 °C. Tubers are examined
after 16 months (of total culturing time) and their
germination and preservation status are assessed.
Propagation involves cutting and transferring
germinated stem parts from the old tuber to a
fresh medium (Thieme 1992). At each stage in the
storage cycle, first, the young stems and later the
sprouting tubers can be harvested and used as the
first step in their rapid propagation.
To produce a stock or living collection,
micro-tuberization of tuber-bearing cultivars and
genotypes is widely used (Donnelly et al.
2003; Pett and Thieme 1982; Kwiatkowski et al.
1988; Lizarraga et al. 1989).
Plant Growth Retardants
A simple, efficient and cheap method for reduc-
ing growth is to use plant growth retardants,
which are routinely employed for small collec-
tions of germplasm (Dodds et al. 1991). Sub-
stances such as abscisic acid (ABA, Westcott
1981b), chlorcholine chloride (CCC, Miller et al.
1985) and acetylsalicylic acid (ASA, López-
Delgado et al. 1998) can extend subculture
duration by up to 12 months.
Reduction of Nutrition and Manipulation of
Osmotic Stress
Reduced carbohydrate and mineral nutrition
induces a slower growth of shoots in vitro. Sugar
224
alcohols, like sorbitol or mannitol are used
instead of sucrose, which increases the osmotic
value of the medium (Westcott et al. 1977). The
best result is 18 months storage without
sub-culturing and a 58% survival of potato
micro-plants, which was achieved by growing
them in an MS medium supplemented with
20 g/l of sucrose and 40 g/l sorbitol at a low
temperature (Gopal and Chauhan 2010). Shoot
tips encapsulated in calcium alginate beads
(Nyende et al. 2003) can be stored at 10 and 4 °C
for 180 and 270 days, respectively.
Cold Storage and Cryopreservation
A reduction in the temperature from 22 to 6–12 °C
can extend the subculture duration from 4 weeks
up to 12 months (Westcott 1981a). This method is
used for the medium-term storage of a living
collection.
The best option for the long-term maintenance
of vegetative propagated plants is cryopreserva-
tion, using storing explants in or above liquid
nitrogen, which has been intensively studied.
There are numerous reviews and articles on the
theoretical and methodological aspects of cold
storage and cryopreservation (Harding 2004;
Halmagyi et al. 2005; Benson et al. 2006; Ben-
son 2008a, b; Harding et al. 2009; Sakai and
Engelmann 2007; Benson and Keith 2012; Panta
et al. 2015) and the details of the techniques used
for potato are cited by Bajaj (1977, 1995), Grout
and Henshaw (1978), Towill (1984), Keller et al.
(2008), and Wang et al. (2008), which focus on
currently used potato cryopreservation protocols.
Kaczmarczyk et al. (2011) indicate the histori-
cally important, currently used and most recent
advances in potato tip cryopreservation of vari-
ous species and varieties of potato.
Basically this approach includes the main
steps and modifications in the techniques (men-
tioned below) for the propagation and prepara-
tion of donor plants, isolation of explants (tuber
sprouts, axillary buds and apical shoot tips),
pre-culture, dehydration, cooling, storage,
rewarming, regeneration (of explants) and
propagation.
R. Thieme and E. Rakosy-Tican
Different techniques have been successfully
used for the cryopreservation of a wide range of
species (Kaczmarczyk et al. 2011):
• two-step cooling
• ultra-rapid cooling
• droplet freezing
• vitrification
• droplet vitrification
• encapsulation/dehydration
• encapsulation/vitrification.
The advantages and disadvantages of these
methods based on a lot of single observations are
discussed. The parameters that affect cryopreser-
vation, such as the physiological state of the donor
plants and shoot tips and their pre-culture, and
specific cryogenic factors, type of cryoprotectants,
the cooling and rewarming process or media and
light regime for further cultivation of plants after
recovery are summarized by Kaczmarczyk et al.
(2011).
Based on studies on genomic DNA stability,
no genetic changes occur in plants after cryop-
reservation (Benson et al. 1996; Harding and
Benson 2000). Harding and Benson (2001)
demonstrate that stable somatic inheritance of
genomic regions occurs by means of
microsatellite profiles, which are identical in the
regenerated material, the parental plants and their
progeny. The successful conservation of charac-
teristics of cultivars is confirmed, by estimating
the ploidy level or by AFLP, RAPD or
inter-simple sequence repeat (ISSR) markers
(Zarghami et al. 2008; Hirai and Sakai 1999; Li
et al. 2016).
There are cryopreserved collections of potato
cultivars and accessions of wild species of potato
in different countries: the Czech Republic
(Zámečnik et al. 2007), Germany (Keller and
Dreiling 2003; Kaczmarczyk et al. 2009), Peru
(Panta et al. 2006; Gonzalez-Arnao et al. 2008),
South Korea (Kim et al. 2006), Spain (Barandalla
et al. 2003), the UK (http://www.scri.ac.uk) and
USA (http://www.ars.usda.gov; http://www.ars-
grin.gov/nr6), preserved using different
13 Somatic Cell Genetics and Its Application in Potato Breeding
cryopreservation methods. The regeneration
capacities of cryopreserved genotypes, which is
the key factor in this approach, vary widely from
0 to 93%. The DMSO droplet method, improved
by the use of alternating temperatures during pre-
culture and a solid medium for regeneration is
currently successfully used for storing 1119
accessions at IPK Gatersleben, for which the
mean regeneration capacity is 46% (Kaczmar-
czyk et al. 2011).
A problem with this technique still remains
the genotype-dependent ability to regenerate
after cryopreservation. But one should bear in
mind that none of the conservation strategies,
like cryopreservation, cell and tissue culture and
field culture, are completely safe (Kaczmarczyk
et al. 2011). A selection of conservation tech-
niques should be recommended based on the
kind and number of potato genotypes, the length
of time for which they are to be stored, the
existing technical equipment and staff and other
specific aspects of the research.
Cryopreservation can also be used to eradicate
viruses, because many viruses are unable to
survive or multiply under freezing conditions
(Benson 2008b; Wang and Valkonen 2009).
Potato leaf roll virus (PLRV), Potato virus Y
(PVY), Potato virus M (PVM) and Potato virus S
(PVS) are eliminated by the cryotherapy of
virus-infected potato shoot tips (Wang et al.
2006) and in combination with ribavirin treat-
ment (Kushnarenko et al. 2015), respectively.
Ukhatova et al. (2016) used cryotherapy and
complex chemo- and thermotherapies to eradi-
cate PLRV in Chilean samples of Solanum
tuberosum.
Potential applications of cryogenic technolo-
gies for plant genetic improvement and pathogen
eradication are summarized by Wang et al. (2014).
225
13.3 Methods of Inducing
and Utilizing Genetic
Variability (Diversity)
13.3.1 Organ Culture
13.3.1.1 Production of Haploids
To obtain haploid cells and plants, gametophytes
are cultured in vitro. In androgenesis it is the young
anthers, pollen or microspores from flower buds
that are cultured, in gynogenesis it is the ovules. In
nutritional media containing phytohormones
mitotic activity is induced in the haploid nucleus of
gamethophytic cells. The resulting cells, tissues,
embryos and plants can be haploid, but also
diploid or polyploid. Haploid plants are weaker
than diploid plants and are also sterile. The treat-
ment of their meristems with the alkaloid colchi-
cine induces endomitosis and the production of
diploid fertile shoots, which are homozygotes. The
results of the detailed studies carried out in the
1970s are summarized by Bajaj and Sopory
(1986). The androgenic regenerants are very
variable and ‘androgenic competence’ reduces the
success of this method. Androgenesis protocols in
terms of media and method were significantly
improved by Uhrig (1985). A positive androgenic
response was obtained by adding cytokinins and
auxins alone or in combination. More recent
results in potato androgenesis are reviewed by
Pret’ová and Dedicova (2006).
Gynogenesis can be obtained by cross-
pollination using S. phureja as a pollen donor.
Seed is produced parthenogenetically by the
mother plants. Using this method 500 monohaploid
plants (2n = x = 12) from 2 million seeds were
identified based on the colour of the spots at the
base of the leaves (Uijtewaal et al. 1987) and stored
in vitro. Androgenic monoploids are superior in
226
terms of most agronomic traits, including leaf size
and tuber yield (Lough et al. 2001).
Anther culture is an alternative to selfing for
the production of inbred lines of potato. Andro-
genesis does not require completely functional
gametes to generate monoploid plants. The
doubled monoploids could be used as female
plants in hybrid schemes but male fertility is
lacking (Paz and Veilleux 1999). Although this
approach is limited, anther culture remains a tool
for germplasm development in the conversion of
potato into diploid crops (Jansky et al. 2016).
Diploid inbred line breeding of potato was star-
ted and proved by Lindhout et al. (2011).
13.3.1.2 Embryo Rescue and Seed
Culture
Embryo rescue techniques are based on the iso-
lation of embryos from seeds and their cultiva-
tion on artificial media in vitro. It is used in
potato after specific crosses to save embryos
from ovules, which are fertilized but do not
develop into viable seed (Singsit and Hanneman
1991). The fruit is removed over a period of ca.
20 days and embryo rescue conducted after the
berries are surface-sterilized with ethanol. Using
a scalpel and dissecting needles, seeds and
embryos are isolated and placed in glass tubes
containing MS media. Depending on the size and
stage of development of the embryo (Thieme
1991), a plant develops after culturing for eight
weeks the root system of which is robust enough
for the plants to be grown on in a glasshouse
(Ramon and Hanneman 2002). To overcome
hybridization barriers, potato embryo rescue
alone or in combination with other methods, such
as mentor pollination, hormone treatment and
reciprocal crosses can be used (Jansky 2006).
Successful crossing between non-tuber-bearing
and tuber-bearing species of Solanum is also
possible (Watanabe et al. 1995) and is used to
produce novel inter-series hybrids of Solanum
(Dinu et al. 2005) and for the introgression of
late blight resistance of 1EBN wild species
Solanum pinnatisectum into S. tuberosum
(Ramon and Hanneman 2002).
To obtain important offspring from crosses
between partners that are ‘difficult’ to cross,
R. Thieme and E. Rakosy-Tican
immature seeds from recently harvested berries
or dried stored seeds can be isolated, sterilized
and cultivated in vitro, and can result in two to
six weeks in the development of plants.
In addition to somatic hybridization, embryo
rescue and seed culture have been successfully
used to acquire interspecific and intergeneric
hybrids for use as pre-breeding material in potato
breeding programmes.
13.3.2 Somaclonal and Epigenetic
Variation
13.3.2.1 General Aspects: Definition,
Origin and Causes,
Mechanisms
and Molecular Basis
Somaclonal variation is defined as genetic and
phenotypic variation among clonally propagated
plants from a single donor clone resulting from
the use of tissue culture. This phenomenon is
recorded for many crop plants (Larkin and
Scowcroft 1981, 1983; Ahloowalia 1986; Kaep-
pler et al. 1998, 2000; Veilleux and Johnson
1998). It is manifested as cytological abnormal-
ities, frequent qualitative and quantitative phe-
notypic variations, DNA sequence changes, gene
activation and silencing (Kaeppler et al. 2000).
Somaclonal variation mimics induced mutations.
Only a few of these mutations are expressed as
phenotypic and cytogenetic changes in the
regenerated plants (Jain et al. 1998).
There are discussions in the literature about
the different mechanisms that result in somaclo-
nal variation including point mutations induced
by exogenous factors such as radiation and
chemical mutagens, changes in chromosome
number and structure, changes in organelle
DNA, somatic crossing-over and sister chromatid
exchange, chromosome breakage and rearrange-
ment, somatic gene rearrangements, DNA
amplification, DNA methylation, epigenetic
variation, that may result from micro-
environmental conditions in tissue culture, his-
tone modification and RNA interference (iRNA),
segregation of pre-existing chimeric tissues and
insertion or excision of transposable elements or
13 Somatic Cell Genetics and Its Application in Potato Breeding
non-specific interaction inducing changes in gene
expression (Jain et al. 1998; Kaeppler et al. 1998,
2000; Krishna et al. 2016). Transposable ele-
ments can be activated by tissue culture. Inser-
tions of these elements and retrotransposons can
function as insertional mutagens of plant gen-
omes, which may also cause chromosomal rear-
rangements (Tanurdzic et al. 2008). Li (2016)
points out that the role of de-differentiation and
re-differentiation during cell culture can con-
tribute to the detected ploidy variation, given that
different culture methods often induce different
frequencies of somaclonal variation. The
expression of genes that are responsible for
centromere and ploidy stability are expected to
change during de-differentiation and
re-differentiation and may therefore result in a
variation in the number of chromosomes in some
cultured cells. The epigenetic changes in gene
expression may last for many mitotic genera-
tions, may even be heritable over a certain
number of reproductive generations, and may
consequently still cause genome instability in the
original and the immediately following genera-
tions of regenerated plants (Li 2016).
Recently, epigenetic variation in in vitro cul-
tures of potato cells has attracted interest.
Demarly and Sibi (1989) coined the term ‘epi-
genetic variation’ for this somaclonal variation,
the inheritance of which is neither Mendelian nor
cytoplasmic. Epigenetic control of gene expres-
sion is defined as a somatically or meiotically
heritable alteration in gene expression that is
potentially reversible and is not due to a DNA
sequence modification. It involves gene silencing
or gene activation that is not due to chromosomal
aberrations or sequence changes, which might be
unstable or reversible somatically or through
meiosis (Kaeppler et al. 2000). Authors point out
that these epigenetic changes could be mani-
fested in the activation of quiescent loci or as an
epimutation of loci sensitive to chromatin-level
control of expression. They suggest that soma-
clonal variation is manifested as quantitative and
qualitative trait mutations, karyotype changes
and sequence modification. More aspects of the
epigenetics of somaclonal variation in plants are
discussed by Kaeppler et al. (2000). Epigenetic
227
events defined as structural adaptations of chro-
mosomal regions that register, signal, or perpet-
uate altered states of activity have also to be
considered (Bird 2007).
The analysis of DNA methylation is a
well-described epigenetic mechanism for detect-
ing and evaluating epigenetic variation in in vitro
cultures of plant cells (Miguel and Marum 2011).
For potato, amplified fragment-length polymor-
phism (AFLP) and methylation-sensitive ampli-
fied polymorphism (MSAP) are used to study
variation in micro-plant morphology (Siobhan
and Cassells 2002), somatic embryos (Sharma
et al. 2007b) and cryopreserved shoot tips
(Kaczmarczyk et al. 2010). Furthermore modifi-
cations of histones and small RNAs are reported
occurring in cell suspension cultures of potato
(Law and Suttle 2005). In general, advances that
have uncovered highly dynamic mechanisms of
chromatin remodelling occurring during cell
de-differentiation and differentiation processes on
which the in vitro adventitious plant regeneration
are based, are presented in Miguel and Marum
(2011).
Li (2016) introduces an interesting concept of
genome network to describe different types of
variations as natural attributes of somatic gen-
omes in crops and horticultural plants and
reviews the agricultural implications of these
variations. He proposes the term ‘somatic gen-
ome variation’ which covers the variation in an
organism and the generation of new genotypes
through somatic means from a sexually produced
individual. He assumes that it displays many
more attributes than genetic mutation and is
important for agriculture.
13.3.2.2 Callus, Cell Suspension
and Protoplast Culture
Somaclonal variation occurs in plants obtained
by using tissue culture (Larkin and Scowcroft
1981). Plants regenerated from various cells and
tissues, such as cultures of protoplasts (proto-
clones, Shepard 1980), apical meristems (meri-
clones), anthers or microspores (gametoclones),
callus (calluclones) and leaf and stem tissue
(somaclones) vary. Callus is defined as an
unorganized mass of tissue growing on a solid
228
substrate. In liquid media, callus quickly dis-
solves into small aggregates of cells called a cell
suspension (Bajaj and Dionne 1967; Lam 1977).
Cell suspensions are used as starting material for
protoplast culture (Opatrny et al. 1980) and the
production of somatic embryos (Vargas et al.
2005).
During the 1960 to the 1980s research focused
on methodologies to produce somaclones and
factors that influence their variability or stability.
The external application of plant growth regula-
tors to a callus induces it to differentiate organs
in vitro like shoots, leaves, roots or other organs.
Induction of callus was first reported by Stewart
and Caplin (1951) and further studied by Bajaj
and Dionne (1967), Skirvin et al. (1975) and
Roest and Bokelmann (1976). The effect of
indolyle-3-acetic acid (IAA), indole-3-butyric
acid (IBA), naphthyl acetic acid (NAA),
2,4-dichlorophenoxy acetic acid (2,4-D) and
kinetin was investigated by Okazawa et al.
(1967). Calluses on potato tuber explants usually
form after about one to two weeks of culturing on
media with the auxins, 2,4-D and NAA. The
conditions and balance of plant growth regulators
in cultures were measured in terms of successful
direct shoot regeneration from tuber discs or leaf
explants of a number of cultivars (Okazawa et al.
1967; Lam 1975; Skirvin et al. 1975; Jarret et al.
1980a, b; Mix and Sixin 1983; Kikuta and
Okazawa 1984; Esna-Ashari and Villiers 1998;
Wheeler et al. 1985). Shoot regeneration is a
two-stage procedure (Webb et al. 1983) involv-
ing different plant growth regulators. In the first
stage the media are supplemented with NAA, BA
and GA3, and in the second stage, with GA3.
Thieme and Griess (2005) used leaf and stem
explants from 17 potato cultivars and breeding
clones for callus induction on MS medium with
0.2 mg/l NAA, 2 mg/l zeatin and 5 mg/l GA3.
After two weeks, the explants were transferred
into a shoot induction medium (Webb et al.
1983; Wheeler et al. 1985). Then the successful
shoot regeneration of leaf and petiole explants in
combination with a wide range of plant growth
regulators can be analysed (Park et al. 1995;
Hansen et al. 1999; Yee et al. 2001).
R. Thieme and E. Rakosy-Tican
In the 1990s, somaclonal variation was stud-
ied in terms of estimating the changes in traits
after growing them in the field and its application
in potato breeding. This revealed that tissue
culture per se appears to be an unexpectedly rich
and novel source of genetic variability generated
during the tissue culture cycle (Larkin and
Scowcroft 1981). This tissue culture cycle starts
with the establishment of a de-differentiated cell
or tissue culture, the proliferation of cells for a
number of cell generations and the subsequent
regeneration of plants. The expectation was that
the somaclonal variation recorded for many
crops, such as potato, may result in genetically
stable and useful genotypes with novel or chan-
ged traits useful for breeding programmes.
Investigations indicate that the source of the
explant (Sree Ramulu et al. 1986), the culture
medium, the age of the donor plants, the duration
of the culture and the genotype itself are impor-
tant factors affecting the extent and frequency of
somaclonal variation.
The chromosome stability of somaclonal
variants has been investigated. Polyploidy, ane-
uploidy and structural changes including chro-
mosomal deletions, inversions and translocations
occur in plants regenerated from callus culture
(Ahloowalia 1986). Sree Ramulu et al. (1986)
indicate that the initial ploidy of the donor plants
influences the degree of polyploidization that
occurs during protoplast isolation and culture.
All protoclones derived from diplopid donor
clones become tetraploid or aneuploid. A high
frequency of protoclones of cv. Bintje retain
tetraploidy but are morphologically abnormal.
Munir et al. (2011) demonstrate somaclonal
variation in cv. Désirée by using random ampli-
fication of polymorphic DNA (RAPD) markers.
Callus induction, maintenance and shoot
regeneration were the basis of protocols for
Agrobacterium-mediated transformation of
potato at the end of the 1980s. The practical
application of callus culture, however, is uncer-
tain because high genomic instability of the
regenerated shoots resulted mostly in aberrant
plants unsuitable for breeding purposes and clo-
nal propagation. Somaclonal variation is
13 Somatic Cell Genetics and Its Application in Potato Breeding
undesirable for large-scale mass propagation of
clones, germplasm preservation and production
of transgenic plants. For this, genetic uniformity
of the plants at an early stage is essential. The
genetic fidelity of plants can be revealed using
morpho-physiological, biochemical, cytological
and DNA-based, molecular markers. Krishna
et al. (2016) review the strengths and weaknesses
of the different marker systems including mor-
phological traits, cytological, isoenzyme and
DNA markers. Next-generation sequencing
technology is used to realize the whole-genome
sequencing of individual plants (Miyao et al.
2012). New technologies will help in arriving at
a better understanding of somaclonal variation
and its potential use in crop improvement.
13.3.2.3 Success in Inducing
Somaclonal Variation
for Potato Breeding
In this review the terms protoclones are used for
clones derived from protoplasts and somaclones
for those derived from any other tissues.
There are relatively few experiments on the
use of somaclonal variation for the improvement
of potato cultivars and breeding lines for breed-
ing purposes (Table 13.1). The objective of these
studies is to analyse somaclones of cultivars or
breeding clones derived from protoplasts,
explants and callus culture, including mutagenic
treatment and in vitro selection, in the field in
terms of their suitability to improve agronomic
traits of potato. Shepard et al. (1980) found
clones with different types of morphology in a
population of 10,000 protoplast-derived clones of
the cv. Russet Burbank. Protoclones with
improved characteristics had deficiencies in other
agronomic traits, with some of them being more
resistant to diseases than their parents. Sebastiani
et al. (1994) report the potential of somaclonal
variation in producing potato clones resistant to
Verticillium dahlia and Cassells et al. (1991)
discuss the resistance in the field of somaclones
of potato to late blight in potato associated with
instability and pleiotropic effects. Secor and
Shepard (1981) document differences in 22 of 35
traits of protoclones, which are associated with
variation in the starch content of the protoclones.
229
Extensive morphological variation occurs in
protoclones of cv. Maris Bard (Thomas et al.
1982). Of 33 protoclones from cv. Crystal, none
have a higher tuber yield, but are better in terms
of tuber bruising, resistance to tuber soft rot and
chip colour. Rietveld et al. (1991, 1993) used
somaclones of three potato cultivars derived from
tuber discs explants. A multistage selection pro-
cedure used to characterize these somaclones in
field plots over five generations at three locations
revealed less variation in tuber shape than in
other traits, but they produce longer tubers, as
previously reported by Pavek and Corsini (1982)
and Cassels et al. (1986). A higher mean tuber
number for somaclones compared to controls is
recorded (Rietveld et al. 1991; Thieme and
Griess 1996, 2005). The latter authors studied
13,000 somaclones of 17 potato donor cultivars
or breeding clones, transferred the in vitro plants
to a glasshouse, followed by several generations
grown in a field and a multistage selection pro-
cedure commonly used in potato breeding. Over
a period of five years and three field generations,
yield, tuber characters, haulm growth, earliness,
starch content, starch yield and tuber appearance
of somaclones were assessed and compared with
that of the controls. This revealed that these traits
varied depending on donor genotype. The haulm
growth, yield and tuber quality of the majority of
the somaclones were poorer than in control.
Earliness varied in one maturity group. There
was no variation in the skin and flesh colour of
tubers. In the second field generation, the fre-
quencies of negative variants for individual
donor genotypes ranged between 0.7 and 22%, of
invariants between 71 and 98% and strong pos-
itive variants between 0 and 9%. Summarizing
all results depending on trait, the average per-
centage for all donor genotypes ranged between
0.1 and 1.4% for positive variants (Thieme and
Griess 2005). These results led to the conclusion
that somaclonal variation can be used to modify
one or few traits in a commercial cultivar while
preserving other important traits. Therefore, this
variation should be exploited in potato breeding
as an additional tool to improve specific agro-
nomic traits of specific cultivars. For example, a
cultivar that has desirable agronomic traits could
230 R. Thieme and E. Rakosy-Tican

Table 13.1 Utilization of somaclonal variation to improve commercial varieties/breeding clones of potato, including
somatic cell selection
Source of Potato cultivar Character of somaclones References
explants/culture, or clone
mutagenic treatment
Leaf/culture filtrate, 6 dihaploid Improved resistance to Phytophthora infestans, Behnke (1979,
callus, regeneration clones Fusarium species 1980)
Mesophyll Russet Burbank Increased tuber number, starch content, lower Secor and
protoplasts/callus, proportion of ‘crull’ Shepard (1981)
regeneration
Leaf, rachis, Désirée High yield, increased resistance to Streptomyces Evans et al.
stem/callus, scabies, higher dry matter content (1986)
regeneration
Protoplasts/callus, Feltwell, Maris Improved yield, tuber appearance, resistance to Thomson et al.
regeneration Piper, Foxton common scab, PVY, PLRV (1986)
Protoplasts/pathogen Dihaploid Non-significant improvement in resistance to Wenzel and
filtrate/callus, clones Fusarium species (F. sulphureum, F. coeruleum), Foroughi-Wehr
regeneration Phytophthora infestans (1990)
Internodes/adventitious Bintje Improved stable resistance to Phytophthora Cassells et al.
regeneration infestans in the field (but mutants often appear at (1991)
maturation)
Tuber discs/callus, Superior Stable improved yield, tuber number and shape, Rietveld et al.
adventitious and enhanced vigour (1991)
regeneration
Tuber discs/callus, Kennebec, High total tuber number and weight, earlier Rietveld et al.
adventitious Russet maturing and a more elongated tuber shape (1993)
regeneration Burbank,
Superior
Mesophyll Crystal Improved resistance to tuber bruising, bacterial Taylor et al.
protoplasts/callus, soft rot, enhanced chip colour and processing (1993)
regeneration quality
Mesophyll Irish Cobbler Non-browning cv. White Baron Arihara et al.
protoplasts/callus, (1995)
regeneration
Stem/callus, 17 cvs. and Improved tuber number and size, starch content Thieme and
regeneration breeding clones and yield, early maturing Griess (1996,
2005)
Leaf/callus, Kennebec Salt tolerant plants Ochatt et al.
regeneration (1998)
Stem Golden Wonder Improved yield and resistance to Phytophthora Kowalski and
segments/irradiation, infestans (foliage blight) Cassells (1999)
adventitious
regeneration
Stem/mutagenesis by Kufri Jyoti, Improved heat tolerance Das et al. (2000)
irradiation Kufri
Chandramukhi
Stem, tuber, Bintje Alterations in general appearance, leaf Jelenić et al.
protoplasts/callus, morphology, tuber characteristics, unstable (2001)
regeneration
Callus culture/in vitro Désirée Improved resistance to Alternaria solani and Veitia-Rodriguez
mutagenesis Streptomyces scabies et al. (2002)
(continued)
13 Somatic Cell Genetics and Its Application in Potato Breeding 231

Table 13.1 (continued)

Source of Potato cultivar Character of somaclones References
explants/culture, or clone
mutagenic treatment
Leaves, irradiated Désirée Improved resistance to Alternaria solani Rodríguez et al.
callus, culture (2007)
filtrate/regeneration
Cells/pathotoxins, Iwa, Russet Improved resistance to Streptomyces spec., high Wilson et al.
callus, regeneration, Burbank tuber weight (2009, 2010a, b)
selection
Meristem Reet Positive differences in yield, tuber number and Rosenberg et al.
tissue/regeneration after weight, and resistance to late blight (2010)
thermotherapy
Tuber tissue/somatic Russet Burbank Superior processing qualities Nassar et al.
embryogenesis (2011)
Tuber Red Nordland Improved skin colour, resistance to Strepto-myces Waterer et al.
sprouts/spontaneous scabies, Spongospora subterranea (2011)
chimeras
Cells/thaxtomin A, Russet Burbank Improved resistance to common scab and Tegg et al. (2013)
callus culture, powdery scab
regeneration
Tuber Cardinal, High yielding Hoque and
sprouts/mutagenesis by Diamant, Morshad (2014)
chemicals Asterix
Tuber tissue/somatic Russet Burbank High content of phytonutrients and antioxidants Nassar et al.
embryogenesis (2014)

be improved by increasing tuber number per
plant, starch content or earliness.
Mixoploidy and chimeric structures in nine
somaclones of cv. Bintje are associated with
alterations in its appearance, leaf morphology
and tuber characteristics. This phenotypic insta-
bility is correlated with aneuploidy or poly-
ploidy, which can be detected at high frequencies
in the chromosome counts of root tips of these
somaclones (Jelenić et al. 2001).
After eradicating viruses, using thermother-
apy, meristem culture regenerated plants of the
variety Reet differ in yield, number and weight of
tubers and resistance to late blight, and meristem
clones also deviate in otherwise invariable mor-
phological characteristics (Rosenberg et al.
2010). A high-yielding genotype obtained by
using chemical mutagens (Hoque and Morshad
2014) and the non-browning cv. White Baron
was developed by using somaclonal variants of
cv. Irish Cobbler (Arihara et al. 1995).
Of 800 somaclones of cv. Russet Burbank
produced using somatic embryogenesis, 25 lines
were selected on the basis of their yield and
processing quality, which indicates that soma-
clonal selection offers clear benefits for phy-
tonutrient improvement and in improving the
processing quality of potato (Nassar et al. 2011,
2014). Three somaclones derived from cv.
Désirée are more resistant to Alternaria solani
and Streptomyces scabies (Veitia-Rodriguez
et al. 2002). The best cultivar, with the smallest
somaclonal variation, for producing synthetic
seed was selected based on the results of a RAPD
analysis (Bordallo et al. 2004).
If naturally occurring mutations in potato are
stable and beneficial, they can be used in
breeding programmes. In field trials, over 30
lines derived from chimeric tubers of the cultivar
Red Norland were studied, and new lines
developed from plants exhibiting spontaneous
mutations that caused chimeras in terms of tuber
232
skin colour with the dark red coloration stable
over several generations of vegetative propaga-
tion and were higher yielding than the original
cultivar (Waterer et al. 2011). In vegetatively
propagated potato plants, some traits resulting
from somaclonal variation, such as chip colour
quality, are quite stable over at least several
generations of vegetative propagation (Nassar
et al. 2011). Gamma-irradiation can be used
during in vitro propagation of plants to induce
heat tolerance mutants in two commercial potato
cultivars (Das et al. 2000). There have been
attempts to select salt-tolerant potato cell lines
and plants (Ochatt et al. 1998; Queiros et al.
2007). Potter and Jones (1991) confirm that
plants of cv. Désirée produced by multiplication
of organized meristems or serial subculture of
stem nodes using morphological and RFLP
analysis are genetically stable. Plants derived
from regeneration after a short leaf callus phase
vary in banding patterns and morphology. Sig-
nificant differences between clones derived from
meristem tips of four potato cultivars after field
experiments at different locations persist for
several years (Nielsen et al. 2007). This variation
was in the number of plants per plot, maturity,
skin and flesh colour, tuber form, time of emer-
gence, flowering, number of stems and tubers per
plant.
The genetic and phenotypic stability of potato
plants of the cv. Désirée obtained using four
different propagation methods have been com-
pared (Sharma et al. 2011). Plants from synthetic
seed (somatic embryos), axillary buds,
micro-tubers and true potato seed have been
analysed phenotypically, cytologically and using
AFLP markers. Compared to clonally propagated
plants that do not vary phenotypically, plants
from true potato seed show phenotypic segrega-
tion. None of these plants varied in genome
constitution, assessed using flow cytometry. In
plants regenerated by means of axillary bud
proliferation, the AFLP-marker profile was
identical but there were some differences among
the somatic embryo and micro-tuber-derived
plants (Sharma et al. 2011). To discriminate
intra-clonal variants of cv. Russet Norkotah,
there are AFLP and microsatellite markers,
R. Thieme and E. Rakosy-Tican
which are suitable for detecting epigenetic dif-
ferences (Hale et al. 2005).
Based on published results (summary in
Table 13.1), somaclones of potato can be used as
a source of new variation (Karp 1995). There are
suitable tools for detecting, evaluating, identify-
ing and improving traits in order to realize the
benefits of these variations. But the former very
optimistic appreciation of their practical utiliza-
tion (Bottino 1975; Larkin and Scowcroft 1981)
has not been confirmed. There is a need for
further attempts to improve potato in terms of
agronomic traits and resistance to biotic and
abiotic stresses.
It is recognized that the recovery of soma-
clones exhibiting beneficial traits without any
negative side effects is rare. For many applica-
tions somaclonal variation is something to be
avoided (Barrell et al. 2013; Dann and Wilson
2011). Methods aimed at producing uniform
plants from cell and tissue culture, such as for the
large-scale clonal propagation and multiplication
after virus/pathogen elimination (Rosenberg et al.
2010), long-term storage (Dann and Wilson
2011), cell screening and polyploidization
(Chauvin et al. 2003), cell fusion (Kumar 1994)
or gene transformation (Dale and McPartlan
1992; Heeres et al. 2002) are examples of when
somaclonal variation is undesirable. There are no
ways to avoid the production of somaclonal
variants in transgenic potato lines (Meiyalaghan
et al. 2011; Barrell and Conner 2011). Therefore,
the exploitation of somaclonal variation is cur-
rently not widely used in potato breeding
programmes.
Plant tissue culture has resulted in the devel-
opment of many novel tools, which have recently
been used by potato breeders. Nevertheless, a
combination of biotechnological methods such as
cell and tissue culture, genetic engineering,
marker- and genome-assisted technologies have a
high potential to improve potato crops.
Advances in the use of new techniques, like
DNA microarrays, RNA transcriptomic, meta-
bolomic and proteomic approaches and the
identification of genes will help in resolving the
challenge of providing enough food in the future
for the ever-growing world population.
13 Somatic Cell Genetics and Its Application in Potato Breeding
13.3.3 Somatic Hybridization
via Protoplast Fusion
13.3.3.1 Protoplast Isolation
and Culture
Plant protoplasts are cells from which the cell
wall has been removed by dissection or enzy-
matic digestion (Davey et al. 2005). Mechanical
procedures involving slicing of plasmolyzed tis-
sues are today rarely used for protoplast isola-
tion. Plant protoplasts isolated from somatic cells
are still totipotent and can produce, in suitable
culture conditions, a new cell wall, colonies of
cells, micocalluses, calluses and finally new
plants. Lacking a cell wall, protoplasts are very
good systems for gene transfer, induced fusion
(also called somatic hybridization), targeted
mutagenesis and somatic cell genetic research
(Davey et al. 2005). Potato was one of the first
plants to be used in protoplast culture and
somatic hybridization. After the discovery of the
utility of enzymes like cellulases and pectinases
for plant protoplast isolation (Cocking 1960) and
their use for tobacco protoplast isolation and
plant regeneration (Carlson et al. 1972), potato
was one of the next species that proved amenable
to protoplast isolation and culture (Shepard and
Totten 1977; Zuba and Binding 1989). This
opened the way for using isolated potato proto-
plasts in somatic hybridization and gene transfer.
Protoplasts are versatile cell systems that can be
used to manipulate the genome of the somatic
cells of potato (Solanum tuberosum L.
2n = 4x = 48) including its monoploids
(2n = 1x = 12), (di) haploids (2n = 2x = 24) and
related wild diploid species (2n = 2x = 24) of
Solanum (Wenzel 2006). Since the 1980s, many
laboratories have optimized the methods for
protoplast isolation and culture of crop potatoes
and many of its wild relatives (Zuba and Binding
1989). Nowadays these methods are well refined
and routinely used for culturing many wild spe-
cies and crop potatoes (Thieme et al. 1997;
Sharma et al. 2011; Rokka 2015).
After many years of research on different tis-
sues, like leaves of glasshouse-grown plants,
mesophyll tissue of in vitro shoots, single cell
suspensions (Jones et al. 1989a, b), in
233
vitro-induced micro-tubers (Jones et al. 1989a)
and true potato seedlings derived from hypocotyl
tissues (Dai and Sun 1994), the tissue of choice is
leaf mesophyll harvested from three-week-old
shoots of in vitro plants (Thieme et al. 1997).
Protoplast yield and viability are greater for
potato and wild Solanum shoots cultured in jars
than in test tubes. This may be due to the greater
volume of the jars and the resultant lower levels
of ethylene. When STS (silver thiosulphate), an
inhibitor of ethylene biosynthesis, is added to the
culture media, it stimulates leaf area growth in
Solanum chacoense (Rakosy-Tican et al. 2011).
Mesophyll tissue can yield approximately
106 pp ml−1 g−1 fresh weight. The key factors
for good protoplast yield are: the source and age
of the donor tissue, the growth conditions (vig-
orous plants with well-developed leaves), tissue
slicing and enzyme solution. For the digestion of
leaf tissue, proper enzyme solutions have to be
developed for each species or genotype. Digest-
ing solution contains mainly two enzymes: Cel-
lulase R-10 (1%) and Macerozyme R-10 (0.5%),
but adding slightly lower concentrations of dif-
ferent and very active digestive enzymes like
Pectolyase Y-23 or Driselase may improve cell
wall removal. In order to maintain protoplast
integrity, mannitol, sorbitol or sucrose at
iso-osmolar concentration need to be added to
the enzyme solution. Macroelements or some-
times microelements might also improve proto-
plast viability after isolation, at least the presence
of Ca ions is essential for membrane stability
(Davey et al. 2005). The incubation in the
enzyme solution is also a critical step, incubation
at room temperature overnight (16 h) being the
most convenient. After incubation, protoplast
release from mesophyll tissue can be improved
by shaking at a high temperature and low rotation
for at least 30 min and up to 1–2 h. Protoplast
isolation has to be checked using an inverted
microscope and can be further improved by
squeezing the tissue. After removing undigested
tissue by filtration and cellular debris by two to
three centrifugation steps in an iso-osmolar
solution, depending on the protocol (Rokka
2015), the protoplasts can be counted by using a
haemocytometer and cell viability can be
234
evaluated by using FDA (fluorescence diacetate
assay) (Rakosy-Tican et al. 1988 and references
herein). The viable protoplasts are then mixed for
further use in somatic fusion experiments, gene
transfer, somatic cell genetics or other basic
studies.
If protoplasts are to be cultured to regenerate
plants or to induce protoclonal variation, differ-
ent cultural steps have to be followed. At each
step different media and plant growth regulators
(PGRs) are used. There are many reports on
potato protoplast culture in the literature, starting
with the first successful plant regeneration from
mesophyll protoplasts (Shepard and Totten
1977), followed by many improvements made by
many groups as presented in a previous review
(Vinterhalter et al. 2008). Today, there are pro-
tocols for plant regeneration from mesophyll
protoplasts, as described by Thieme et al. (1997),
which involve mainly four steps:
1. Cultivation up to visible cell colonies from
isolated protoplasts in the dark at 25 °C on
liquid VKM-media.
2. Transfer of cell colonies to solid CUL-media
kept under fluorescent light, at a photoperiod
of 16 h and 25 °C, until a macro-callus
develops.
3. Cultivation of the callus on JKM-media for
initiation of shoot regeneration.
4. Transfer of shoots to propagation media (MS
modified by reducing the NH4NO3 content to
1.2 g/l).
This method for protoplast regeneration is
widely used for many combinations of somatic
fusion and is a reliable and useful way of
regenerating a large number of somatic hybrids
(Thieme et al. 2008, 2010; Rakosy-Tican et al.
2015).
Two main issues are encountered in protoplast
culture: protoclonal variation caused by callus
genetic instability and genotype-dependent
response to protoplast culture (see Sect. 13.3.2).
When maximum genetic variation is required,
somaclonal variation provides a useful tool for
the more technologically demanding approaches
like somatic hybridization and transformation.
R. Thieme and E. Rakosy-Tican
The attraction of protoclonal variation is that it
requires no knowledge of the genetic basis of a
specific trait, it needs no recombinant DNA, it
does not require mutagenesis, specialized
equipment or containment measures and can be
exploited by using standard in vitro culture pro-
cedures. In contrast, when the production of
true-to-type plants is the goal, clonal propagation
from protoplasts assures the cloning is of single
cells.
Although the genotype effect in protoplast
regeneration occurs in potato and its wild rela-
tives, the optimization of culture media made it
possible to use similar media to regenerate cell
colonies, calluses and shoots from protoplasts for
several species of Solanum. These standard cul-
ture conditions (media and physical factors) are
useful for isolated protoplasts and somatic
hybrids or fusion products and intra as well as
interspecific combinations (Thieme et al. 1997,
2008, 2010), but the efficiency of regeneration
varies for each particular fusion combination
(Rakosy-Tican et al. 2015).
13.3.3.2 Protoplast Fusion and Somatic
Hybridization
Plant protoplasts might fuse spontaneously dur-
ing protoplast isolation due to plasmodesmata
enlargement between adjacent cells, but this
spontaneous homo-specific fusion occurs at a
low frequency. There are chemical, physical and
a few biological tools used to induce protoplasts
to fuse (Davey et al. 2005). These techniques
were developed to induce protoplasts with neg-
ative charges, the so-called zeta potential, to
attract each other. The fusion can be achieved
only when protoplasts are first forced to agglu-
tinate and further factors will result in the dis-
organization of protoplast membranes leading to
fusion or merging of two or more agglutinated
cells. Fused cells can belong to the same
(homo-specific) or different (hetero-specific)
species. Protoplast fusion can be induced in any
combination of intra-, interspecific, inter-generic
or even cells of organisms belonging to different
kingdoms. But, the fusion products can only
express totipotency when phylogenetic relation-
ships are close. Closely related species generate
13 Somatic Cell Genetics and Its Application in Potato Breeding
fusion products that can de-differentiate and
finally regenerate new plants. Although many
different fusion methods are used in laboratories,
only two are widely used, i.e. electrofusion and
PEG (polyethylene glycol) induced fusion
(Davey et al. 2005). Electrofusion is by far the
preferred method since its discovery in 1979
(Senda et al. 1979). It consists of protoplast
agglutination induced by the use of an alternating
current (AC) field, the so-called dielectrophoresis
or pearl chain formation driven by the mutual
attraction of protoplasts based on electrical
charges and their movement towards each other
and to the electrodes (Zimmermann and
Scheurich 1981). In the second phase of elec-
trofusion, the agglutinated aligned protoplasts are
induced to fuse by using direct current
(DC) square wave pulses with a high intensity
(2000 V cm−1) and very short duration (10–
100 ls) (Rakosy-Tican et al. 1998). Electrofused
plant protoplasts are also influenced by these
electric fields in a stimulatory way, although the
so-called electrostimulation effect is not well
understood, with the responses expressed in the
first and a few subsequent generations of plants
(Goldsworthy 1996; Davey et al. 1996). Elec-
trostimulation attracted interest during the 1990s
but these methods for stimulating the growth of
protoplasts and other plant tissues have received
less attention in the past few decades. This is an
area, which deserves more investigation in the
future, mainly in relation to plant regeneration
from recalcitrant protoplasts, but also from a
basic point of view. Understanding the cellular
and molecular mechanisms involved in plant
cells or other responses of cells to electromag-
netic fields is, in our opinion, worth investigating
for future use in such fields for stimulating cell
development. The culture media used to stimu-
late protoplast response and regeneration of
protoplasts from other species contain different
additives (Davey et al. 2005). The division of
potato protoplasts, isolated from cell suspen-
sions, is enhanced by the addition of Erythro-
genTM, an oxygen carrier, when the protoplasts
are embedded in agarose semi-solid droplets
(Power et al. 2003).
235
Moreover, the electrofusion of preselected
pairs of protoplasts of tobacco (Rakosy-Tican
et al. 2001) is a more refined technique, in which
the two protoplasts to be fused are selected using
micromanipulation and the electrofusion is
induced in a controlled manner. The electrofu-
sion of preselected pairs of potato protoplasts is
not used as the mass fusion is preferred to scale
up somatic hybridization experiments in the case
of this important tuberous crop. PEG-induced
fusion generally has a similar efficiency as elec-
trofusion in inducing double fusion of proto-
plasts, especially when washed with calcium
solution (Davey et al. 2005). The value of the
fusion efficiency is around 45%, but higher val-
ues are reported for electrofusion, which depends
on species, fusion chamber, number of DC pulses
and protoplast lysis dependent on electrofusion
parameters, as shown for cereal mesophyll pro-
toplasts (Rakosy-Tican et al. 1988, 1998).
After fusion, fusion products have to be
selected or regenerated plants have to be anal-
ysed for hybridity using molecular and cytoge-
netic techniques. Over the last decade selection
of potato somatic hybrid cells was mainly based
on the presumption of vigorous growth, which is
revealed by using green fluorescent protein (gfp)
reporter genes when potato is electrofused with
transgenic Solanum chacoense expressing gfp
(Rakosy-Tican and Aurori 2015). For the char-
acterization of somatic hybrid plants, there are
many PCR-based molecular tools, such as Ran-
dom Amplification of Polymorphic DNA
(RAPD), Simple Sequence Repeats (SSR),
Interspaced Simple Sequence Repeats (I-SSR),
Amplified Fragment Length Polymorphism
(AFLP), Restriction Fragment Length Polymor-
phism (RFLP) or Microsatellite-anchored frag-
ment length polymorphism (MAFLP) (Baird
et al. 1992; Thieme et al. 2008; Iovene et al.
2012). Due to their stability and universality SSR
markers are widely used (see Tables 13.2 and
13.3) (Eeckhaut et al. 2013; Thieme et al. 2008,
2010). Recently the application of Diversity
Array Technology (DaRT) has made it possible
to characterize completely the composition of the
genome of somatic hybrids between potato and
236
Table 13.2 Inter- and intra-specific somatic hybrids of potato, Solanum tuberosum (S. tbr), the techniques used for
their characterization and/or selection, traits of interest and references, in the interval 2003–2017
Combination Tools for characterization
and/or selection
Interspecific somatic hybrids
S. tbr (+) Glycoalkaloid aglicones
S. acaule
S. tbr (+) ISSR, cytoplasmic DNA, FC
S. berthaultii
S. berthaultii (+) NS
S. etuberosum
S. tbr (+) RFLP, GISH, FISH
S. brevidens RAPD, GISH, FISH
(S. palustrae)
Laboratory and field
resistance tests
S. tbr (+) RAPD chromosome specific
S. bulbocastanum
Laboratory and field
resistance tests
MAS for RB gene (Rpi-blb1)
GISH, cytoplasmic DNA
MAS RMc1(blb)
Anther culture of 4 somatic
hybrids
ISSR, microsporogenesis,
anther culture
SSR, cytogenetics, Rpi-blb1;
Rpi-blb3 gene
S. tbr (+) Morphology, chromosome
S. cardiophyllum number, RAPD
RAPD
SSR, AFLP, MFLP, ploidy
RAPD, SSR, ISSR, AFLP,
cyto-plasmic type molecular
markers, FC
S. tbr (+) Morphology, RAPD,
S. circaeifolium chromosomes
S. tbr (+) RAPD, morphology
S. chacoense SSR, cytoplasm type, MAS,
BC1 characterization
MMR deficiency, SSR,
RAPD marker for leptines
S. tbr (+) Southern analysis of
S. commersonii organelles
R. Thieme and E. Rakosy-Tican
Traits of interest—resistance References
or other traits
Clavibacter Rokka et al. (2005)
Salt tolerance, tuber yield Bidani et al. (2007)
Phytophthora erythroseptica, Thomson et al. (2007)
Pythium ultimum
Tuber soft rot, early blight Tek et al. (2004)
Addition and substitution Dong et al. (2005)
lines
Streptomyces Ahn and Park (2013)
Loss of one specific Bołtowicz et al. (2005)
chromosome
Meloidogyne chitwoodi (Mc) Brown et al. (2006)
MAS applied to Pi resistance Colton et al. (2006), Iovene
Genetic characterization et al. (2007)
Selection of breeding lines Zhang et al. 2007
resistant to Mc
Haploidization for breeding Yermishin et al. (2008)
Haploidization for breeding Iovene et al. (2012)
Pi Rakosy-Tican et al. (2015)
(genes and resistance, under
publication)
Characterization Shi et al. (2006)
CPB, Pi Chen et al. (2007)
PVY, CPB, Pi Thieme et al. (2010)
Pi Chandel et al. (2015)
Pi Espejo et al. (2008)
Pi Chen et al. (2007)
Bacterial wilt Chen et al. (2013, 2016)
CPB (antibiosis and Molnár et al. (2016)
antixenosis)
Verticillium wilt Kim-Lee et al. (2005)
(continued)
13 Somatic Cell Genetics and Its Application in Potato Breeding 237

Table 13.2 (continued)

Combination Tools for characterization Traits of interest—resistance References
and/or selection or other traits
S. tbr (+) RAPD, SSR, GISH, PVY Gavrilenko et al. (2003)
S. etuberosum cytoplasm type
Characterization of BC PRLV Novy et al. (2007)
populations
Cytoplasm type, FC, RAPD, PVY Tiwari et al. (2010)
SSR
S. tbr x NS PVX, PVY, PRLV, green Novy et al. (2004, 2006)
S. berthaultii (+) peach and potato aphids,
S. etuberosum CPB, wireworm
S. tbr (+) Ploidy, RAPD Pi Szczerbakowa et al. (2010)
S. x DaRT Pi Smyda et al. (2013),
michoacanum Smyda-Dajmund et al. (2016)
S. tbr (+) Morphology, ploidy, RAPD Pi Szczerbakowa et al. (2003)
S. nigrum
S. tbr (+) RAPD, cytological analysis, No resistance Szczerbakowa et al. (2005)
S. pinnatisectum Pi resistance analysis
RAPD, morphology Pi, CPB Chen et al. (2007)
Ploidy, cytoplasm type Pi Polzerova et al. (2011)
RAPD, SSR, cytoplasm type, Pi Sarkar et al. (2011), Tiwari
FC et al. (2013)
S. tbr (+) Isoenzymes, SSR, Ralstonia solanacearum Fock et al. (2007)
S. stenotonum PEPC/RUBISCO ratio
S. tbr (+) S. tarnii SSR, AFLP PVY, Pi Thieme et al. (2008)
S. tbr (+) Isozymes, RAPD, I-SSR, Recombinant plastome Trabelsi et al. (2005)
S. vernei
S. tbr (+) RAPD Pi Greplova (2010)
S. verrucosum
S. tbr (+) RAPD, GISH, ROS Pi Tarwacka et al. (2013)
S. villosum
Intraspecific somatic hybrids
S. tbr cvs. Isoenzymes, SSR, ISSR PVY, Pythium Nouri-Ellouz et al. (2006)
Aminca (+) aphanidermatum
Cardinal Cardinal
(+) Nicola
NS not specified; Pi Phytophthora infestans (late blight); CPB Colorado potato beetle; PRLV potato leaf roll virus;
PVX potato virus X; PVY potato virus Y; PEPC phosphoenolpyruvate carboxylase, RUBISCO
ribulose-1,5-bisphosphate carboxylase oxygenase, FC flow cytometry, SSR Simple Sequence Repeats
(microsatellites), I-SSR Inter SSR, MAS marker assisted selection

S. x michoacanum (Smyda-Dajmund et al. 2016),
which demonstrates that all the chromosomes of
both species are present in the hybrids but many
markers are still missing.
Cytogenetic characterization of potato somatic
hybrids depends on indirect and direct methods
of assessing the ploidy level. Molecular cytoge-
netic methods are used to determine the compo-
sition of genomes. An example of an indirect
method is the flow cytometry determination of
DNA, which in combination with the quantity of
parental DNA can be used to obtain a good
238 R. Thieme and E. Rakosy-Tican

Table 13.3 Molecular approaches for the selection and characterization of somatic hybrids during 2004–2017 (after
Chao and Park 2004, up-dated)
Approaches References
Isozyme analysis Trabelsi et al. (2005), Nouri-Ellouz et al. (2006)
Flow cytometry analysis Cai et al. (2004), Tek et al. (2004), Trabelsi et al. (2005), Bidani et al.
(2007), Greplová et al. (2008), Thieme et al. (2008, 2010), Tiwari et al.
(2010), Polzerova et al. (2011), Sarkar et al. (2011), Ahn and Park (2013),
Yu et al. (2013), Rakosy-Tican et al. (2015)
Indirect cytogenetics tools/number of Sarkar et al. (2011), Denes (2015), Molnár (2017)
chloroplasts per guard cell
Chromosome counting Tek et al. (2004), Boltowicz et al. (2005), Nouri-Ellouz et al. (2006), Shi
et al. (2006), Przetakiewicz et al. (2007), Chen et al. (2008b), Espejo et al.
(2008), Szczerbakowa et al. (2010), Ahn and Park (2013), Tarwacka et al.
(2013), Yu et al. (2013), Rakosy-Tican et al. (2015)
SSR markers Cai et al. (2004), Tek et al. (2004), Trabelsi et al. (2005), Nouri-Ellouz
et al. (2006), Bidani et al. (2007), Lightbourn and Veilleux (2007),
Thieme et al. (2008, 2010), Tiwari et al. (2010), Polzerova et al. (2011),
Sarkar et al. (2011), Iovene et al. (2012), Ahn and Park (2013), Chen
et al. (2013), Smyda et al. (2013), Yu et al. (2013), Rakosy-Tican et al.
(2015), Molnár et al. (2016)
AFLP/MAFLP markers Tek et al. (2004), Thieme et al. (2010), Ahn and Park (2013)
RAPD markers Cai et al. (2004), Boltowicz et al. (2005), Rokka et al. (2005), Trabelsi
et al. (2005), Shi et al. (2006), Przetakiewicz et al. (2007), Chen et al.
(2008b), Espejo et al. (2008), Greplova et al. (2008), Szczerbakowa et al.
(2010), Tiwari et al. (2010), Polzerova et al. (2011), Sarkar et al. (2011),
Ahn and Park (2013), Smyda et al. (2013), Tarwacka et al. (2013),
Molnár et al. (2016)
RFLP markers Tek et al. (2004), Przetakiewicz et al. (2007)
CAPS/SCAR markers Nouri-Ellouz et al. (2006), Sarkar et al. (2011), Smyda et al. (2013), Yu
et al. (2013)
DNA sequence analysis Bidani et al. (2007)
Fluorescence in situ hybridization Tek et al. (2004)
(FISH)
Genomic in situ hybridization (GISH) Tek et al. (2004), Iovene et al. (2012), Tarwacka et al. (2013), Yu et al.
(2013), Denes (2015), Molnár (2017)
Diversity array technology (DArT) Smyda-Dajmund et al. (2016)
Cytoplasmic DNA markers Smyda-Dajmund et al. (2016)

estimate of the ploidy level of potato somatic
hybrids (Thieme et al. 2008, 2010; Rakosy-Tican
et al. 2015). Flow cytometry has proved very
useful for selecting hexaploid or near hexaploid
shoots after the electrofusion of tetraploid potato
cultivars with diploid Solanum wild species in
many combinations (Thieme et al. 2004, 2008,
2010; Rakosy-Tican et al. 2015). An example of
an indirect method is the correlation between
chloroplast counts in guard cells or the number of
guard cells per area of abaxial epidermis, and
somatic hybrid ploidy (Sharma et al. 2011).
Direct estimation of ploidy relies on chromosome
counts in root meristems after staining with
DAPI (Rakosy-Tican et al. 2015), or other
non-fluorescent stains used in classical cytoge-
netic studies (aceto-carmine or orceine) (Prze-
takiewicz et al. 2007). The most widely used,
simple and reliable method for the rapid esti-
mation of ploidy is the number of chloroplasts
per guard cell. Recently it was shown that counts
of chloroplasts in guard cells obtained using a
13 Somatic Cell Genetics and Its Application in Potato Breeding
fluorescence microscope (Molnár 2017) correlate
with chromosome counts in root meristems
(Molnár 2017, Sharma et al. 2011). Flow
cytometry can be used on the first shoots pro-
duced by protoplast-derived calluses (Thieme
et al. 2008; Rakosy-Tican et al. 2015). This
technique is useful for selecting the hexaploid
shoots after the fusion of tetraploid potato culti-
vars with different diploid wild species. Although
the selection reduces the number of shoots
transferred and maintained in vitro, the ploidy
level might change after a long time in in vitro
micro-propagation and micro-tuber storage, as is
the case of the somatic hybrids between potato
tetraploid cultivars and S. bulbocastanum
(Rakosy-Tican et al. 2015). This genome insta-
bility and chromosome loss after long-term cul-
ture and repeated back-crosses might make it
possible to eliminate the inheritance of
non-desired traits from the wild parent
(Rakosy-Tican et al. submitted). It is now pos-
sible to increase the homeologous recombination
by inducing mismatch DNA repair (MMR) defi-
ciency using AtMSH2 antisense or a dominant
negative gene. The Agrobacterium-mediated
transfer of these genes into S. chacoense
(Rakosy-Tican et al. 2004), followed by somatic
hybridization through electrofusion, reveals that
Colorado potato beetle resistance traits can be
introgressed into somatic hybrids (Molnár et al.
2016). There are few studies on the composition
of the genome of potato somatic hybrids using
in situ hybridization techniques: genome in situ
hybridization (GISH), or fluorescence in situ
hybridization (FISH). Potato and its related wild
species of Solanum have very small somatic
chromosomes of 1.0–3.5 lm in length (Dong
et al. 2000) and show slight differences in their
morphology, so classical cytogenetic methods,
are not very useful for the genome analysis of
potato somatic hybrids (Gavrilenko 2007). Con-
sequently, normal cytogenetic techniques like C
banding cannot be used to determine the com-
position of the genome of somatic hybrids of
potato. Genome in situ hybridization (GISH) has
been used to distinguish the genomes of the two
species in some somatic hybrid combinations,
such as potato (+): S. brevidens (Dong et al.
239
1999; Gavrilenko et al. 2002) S. bulbocastanum
(Iovene et al. 2007; Denes 2015), S. etuberosum
(Gavrilenko et al. 2003) and S. nigrum (Horsman
et al. 2001).
GISH was first used to distinguish chromo-
somes and fragments of chromosomes in potato
by Schwarzacher et al. (1989) and its use in
analysing the composition of genomes in somatic
hybrids depends mainly on genome sequence
complementarity and stringency conditions
(Gavrilenko 2007). The standard GISH protocol
differentiates chromosomes when genome com-
plementarity is 80–85% or less, but more similar
genomes are difficult to distinguish, as in the case
of the somatic hybrid Solanum tuberosum (+) S.
chacoense, which is partially identified by using
multicolour (mc) GISH and high stringency
conditions (Molnár 2017). GISH can be suc-
cessfully used to determine the genome compo-
sition of somatic hybrid clones and their
descendants (back-crosses), and also to discrim-
inate between intra- and/or inter-genomic pairing
in wide hybridizations, in order to study genome
interactions such as chromosome specific elimi-
nations and inter-genomic translocations (Gavri-
lenko 2007 and references).
Fluorescence in situ hybridization (FISH) has
also been used for identification and physical
gene positional mapping in potato and its somatic
hybrids (Gavrilenko 2007). FISH helped to
clarify, for instance, the genome composition of
the somatic hybrids with S. brevidens, by using
the clone pST3 that signals only the telomeric
regions of S. brevidens chromosomes (Rokka
et al. 1998). FISH with tandemly repeated
species-specific DNA sequences has also been
used for comparative karyotyping and studying
introgressions in the genome of potato. The use
of FISH with genome DNA inserted into large
vectors such as bacterial artificial chromosomes
(BACs), a technique also called BAC-FISH, has
been used successfully to map small sections
(only a few kilobases long) of physical chro-
mosomes (Jiang et al. 1995). Subsequently, Jiang
and colleagues were able to use RFLP-marker
specific BAC clones as FISH probes to identify
each potato chromosome in a haploid comple-
ment (Dong et al. 2000). This made it possible
240
using other specific probes and multiple in situ
hybridization cycles to identify the chromosomes
of a species in hybrids using FISH (Dong et al.
2000). Although there are fewer cytogenetic
studies using modern molecular tools on meiotic
chromosomes, the development of FISH and
more recently the so-called Fiber-FISH has
enabled the comparative analysis of single
chromosomes (Lou et al. 2010).
There are other genomic techniques that have
been less used to investigate potato somatic
hybrids, although they have yielded very inter-
esting results in studies of other species of plants
(Eeckhaut et al. 2013). Transcriptomic studies
using micro- and macro-arrays or RT-qPCR are
likely to provide a better understanding of the
genetics of somatic cells and the complex inter-
action between the fused protoplasts of two
species. Moreover, next-generation sequencing
or high resolution melting analysis are currently
the most likely to provide advances in somatic
hybrid characterization and practical exploitation
in breeding.
Intraspecific and Interspecific Hybridization
The production of somatic hybrids from proto-
plasts, which circumvents pre- and post-zygotic
crossing barriers, can be used to insert resistance
to stress into vegetative propagated crops (Lössl
et al. 1999) and might be widely accepted by
breeders (Hofferbert 1996). It has a greater
potential for self-generating biodiversity in
numerous nuclear and cytoplasmic genome
combinations than sexual hybridization (Kumar
and Cocking 1987). It also provides an oppor-
tunity for initiating recombination events
between parental genomes. Moreover, homeolo-
gous recombinations can also be increased by
inducing a DNA repair deficiency, for instance,
mismatch repair deficiency (MMR,
Rakosy-Tican et al. 2004, 2016; Molnár et al.
2016). Potato is a good example of the avail-
ability of a great genetic diversity in related wild
species, more than 200 of which occur in the area
from which potato originated (Bradshaw et al.
2006). This diversity of resistance genes cannot
be exploited by crossing the species sexually
because of many barriers, including the
R. Thieme and E. Rakosy-Tican
endosperm balance number (see Rokka 2015).
Somatic hybridization can contribute to over-
coming these barriers in potato-wide
hybridization.
The first intergeneric somatic hybrid was
produced between potato and tomato (Melchers
et al. 1978), called ‘pomato or topato’, but the
regenerated plants produced fibrous-like tubers
and were sterile or set only parthenocarpic fruit.
Although from a practical point of view these
hybrids are a great disappointment, they indicate
that although complex somatic incompatibility
prevents the somatic hybridization of distantly
related species, it might be more successful in
hybridizing more closely related species. More-
over, many subsequent studies on inter-generic
hybrids provide a better understanding of
somatic cell genetics and cytoplasmic inheritance
in somatic hybrids (Guri et al. 1991). The next
somatic hybrid of potato was S. chacoense Bitt.
(+) S. tuberosum (Butenko and Kuchko 1979)
and S. nigrum L. (+) S. tuberosum (Binding et al.
1982). Potato breeders were more interested in
both of these hybrids because of their resistance
to diseases and the possibility of using them to
produce breeding clones. Since the 1980s, dif-
ferent wild Solanum species have been hybri-
dized with potato using protoplast fusion, and
many of them express various traits, including
resistance to viruses (Thach et al. 1993; Pehu
et al. 1990), bacteria (Austin et al. 1988), fungi
(Mattheij et al. 1992) or insect pests
(Cooper-Bland et al. 1994; Molnár et al. 2016).
Recent data are presented in Table 13.2. A pre-
vious review presented an extensive list of potato
somatic hybrids (Orczyk et al. 2003), but after
14 years this information needs to be up-dated.
In Table 13.2 there are many examples of the
transfer of resistance traits and multiple resis-
tance genes conferring resistance to the most
important potato pathogens and pests, like late
blight caused by Phytophthora infestans (Pi),
viruses (PVY, PVX, PRLV, etc.) or the most
voracious pest of potato, Colorado potato beetle
(CPB). Furthermore, multiple resistance can be
transferred from wild relatives into the potato
gene pool (Thieme et al. 2010) and even more
somatic hybrids of species can be produced, as in
13 Somatic Cell Genetics and Its Application in Potato Breeding
the case of the tri-species somatic hybrids (Novy
et al. 2006). Pathogens and pests are considered
to be responsible for at least a 22% loss of yield
in potato worldwide (Aversano et al. 2007).
Indeed, some potato pathogens and pests can
completely destroy the plants, especially the
voracious and adaptable CPB, which is notorious
for its resistance to almost all of the pesticides
currently used (approximately 53 insecticides
based on different active components, Alyokhin
et al. 2008). One of the first very successful
examples of how somatic hybridization might be
used for potato improvement and in studies of
somatic cell genetics are the somatic hybrids
between the incompatible species S. bulbocas-
tanum and cultivated tetraploid potato (Helgeson
et al. 1998), which were first assayed for late
blight resistance caused by Phytophthora infes-
tans in the laboratory and then in a field under
intense disease pressure. These somatic hybrids
were back-crossed with potato cultivars and
shown to carry durable resistance to this disease.
Subsequently, a gene involved in durable resis-
tance, was characterized, isolated, sequenced and
located on chromosome VIII (Song et al. 2003).
Transgenic plants with this gene, first known as
RB, were regenerated after Agrobacterium–me-
diated transfer and durable resistance was
maintained in transgenic plants (Lozoya-Saldana
et al. 2005). Since these first results with this
wild species that demonstrate its value as a
resource of durable resistance genes against late
blight, there has been an increasing interest in
transferring these resistance traits to cultivated
potato (Naess et al. 2001; Iovene et al. 2007).
RB gene was the first durable resistance gene
described for late blight but soon many other
genes were discovered both in Solanum bulbo-
castanum and other wild species. In S. bulbo-
castanum to date there are four characterized
resistance genes: Rpi-blb1 (formerly RB), Rpi-
blb2, Rpi-blb3 and Rpi-bt1 (van der Vossen et al.
2003; Song et al. 2003; Oosumi et al. 2009;
Lokossou et al. 2009; Orbegozo et al. 2016). In
addition, late blight resistance from other sources
was also accessed by means of interspecific
somatic hybrids with the wild species S. pinna-
tisectum (Sarkar et al. 2011), S. tarnii (Thieme
241
et al. 2008), S. cardiophyllum (Thieme et al.
2010) and more recently S. x microachanum, a
wild diploid derived from a spontaneous cross
between S. bulbocastanum and S. pinnatisectum
(Smyda et al. 2013). All these new somatic
hybrids were tested in the field and shown to be
resistant after two or three years of assessement,
hence they are suitable for breeding. Somatic
hybrid lines originating from fusion between
potato and S. bertaultii are more tolerant of salt
stress (Bidani et al. 2007). As a source of
resistance to bacterial wilt caused by Ralstonia
solanacearum, another wild species, S. stenoto-
mum, was used (Fock et al. 2001). All the
somatic hybrids tested were as resistant as the
wild species (Fock et al. 2001). Similarly, S.
chacoense was explored for molecular markers
associated with bacterial wilt resistance, and for
introgressing resistance into the potato gene pool
(Chen et al. 2013) (see Table 13.2). A very
successful approach involving the transgenesic
induction of MMR deficiency in a high
leptine-producing accession of S. chacoense,
followed by somatic hybridization, generated
many plants exhibiting both antixenosis and
antibiosis against Colorado potato beetle
(Molnár et al. 2016).
In any scheme of introgressive hybridization,
restoration of agronomically acceptable cultivars
often requires one or more back-crosses of the
somatic hybrid with cultivars, along with selec-
tion for a trait of interest and against undesirable
traits and inappropriate ‘wild’ to ‘cultivar’ gen-
ome or gene interactions (Thieme et al. 2008,
2010). With increasing restrictions on the use of
pesticides to control potato diseases and pests,
deployment of resistance genes from wild species
will likely assume greater importance in the
future. While it is clear that resistance genes can
be introgressed from wild species into potato by
somatic hybridization, the processes of intro-
gression and related mechanisms and their
interactions are not completely understood
(Rieseberg and Wendel 1993). Studies on
hybridization followed by gene introgression
indicate that these processes may have played a
significant role in the evolution of many plant
taxa (Heiser 1973). Moreover, as suggested by
242
other authors, there is currently an increase in the
interest for genomic and functional genomic
analysis of the somatic hybrids of different crop
plants (Eeckhaut et al. 2013), analyses that have
yet not been used in studies on potato.
Starting in the 1990s, somatic hybridization
was used to study different dihaploid lines of
potato generated by sexual crossing with S.
phureja (Rokka 2009) or pollen and anther
in vitro culture. The results of the protoplast
fusion of two dihaploid potato lines were at first
not very promising, but the restoration of tetra-
ploids from two dihaploid lines with valuable
yield and resistance traits soon proved to be a
valuable approach to potato breeding
(Table 13.2). Resistance to nematodes, viruses
(PVY) and Phytium bacterial diseases was com-
bined by intra-specific protoplast fusion
(Cooper-Bland et al. 1994; Nouri-Ellouz et al.
2006).
Symmetric and Asymmetric Somatic Hybrids:
Basic and Practical Achievements
Fusion of two different species results in sym-
metric hybrids with the combined genomes from
both species. Incorporation of the genomes of
both parents, especially their nuclear genomes, in
a hybrid has two obvious disadvantages:
(1) transfer of too much exotic, wild species,
genetic material along with the gene(s) of the
desirable trait; and (2) genetic imbalance leading
to somatic incompatibility. These limitations
result either in abnormal growth and develop-
ment of the somatic hybrids, or regeneration of
infertile plants. In the case of potato there are
many reports of symmetric somatic interspecific
somatic hybridization between diploid wild spe-
cies and potato dihaploid lines (Rokka 2015).
Although genetically more stable, many of these
hybrids are infertile and hence it is not possible
to introgress resistance genes from a wild parent.
For this reason symmetric somatic hybridization
between tetraploid potato cultivars and diploid
wild species became more popular (Helgeson
and Haberlach 1999). Many such 4x (+) 2x so-
matic hybrids, in addition to being hexaploid,
were also aneuploid or mixoploid (Rakosy-Tican
et al. 2015). Genetically, such hybrids may be
R. Thieme and E. Rakosy-Tican
unstable and eliminate wild species chromo-
somes during the next stages of tissue culture, as
occurs in potato and S. bulbocastanum hybrids.
But, after two back-crosses with cultivated
potato, many of them re-stabilize at a tetraploid
level (Rakosy-Tican et al. 2015; under publica-
tion). Theoretically hexaploid or near hexaploid
somatic hybrids of potato will tend to eliminate,
after two back-crosses with potato tetraploid
cultivars, wild species chromosomes and main-
tain very few alien chromosomes or introgress
some genes from the wild parent (Fig. 13.2).
Chromosome elimination in some interspecific
somatic hybrids of potato largely depends on the
phylogenetic relationship, type of genome: A, B,
C, D and P (Gavrilenko 2007), cell cycle syn-
chronization after fusion and two species chro-
mosome interaction during mitosis, to name but a
few of the mechanisms responsible for the
instability of the fusion products (Orczyk et al.
2003). The elimination of chromosomes by
somatic hybrids of many crop plants has stimu-
lated interest in directing and possibly controlling
this process. Therefore, efforts were made to
reduce the proportion of the wild relative’s
nuclear genome in the hybrid.
Asymmetric fusion allows the transfer of part
of the nuclear genome of one species into another.
Somatic asymmetric hybrids can result after
symmetric fusion or can be induced by frag-
menting the donor species DNA by using the
donor-recipient method (Lakshmanan et al.
2013). In most protocols (Fig. 13.2), both donor
and recipient species are treated to reduce a
genome’s participation in the fusion product, but
it is also possible to treat the donor protoplasts in
order to direct their elimination of the genome
(Grosser and Gmitter 2011). Usually, the donor
protoplasts are treated with sub-lethal doses of
ionizing irradiation, such as gamma or X rays
(Dudits et al. 1987; Oberwalder et al. 1998) or
UV irradiation (Hall et al. 1992a), in order to
induce double-stranded breaks and hence partial
genome elimination (Gleba et al. 1988). It was
initially thought that there is a direct correlation
between irradiation dose and the amount of DNA
fragmentation and elimination, but this is only the
case for up to approximately 65% of nuclear
13 Somatic Cell Genetics and Its Application in Potato Breeding 243

SYMMETRIC FUSION (* without IOA ASYMMETRIC FUSION – donor (A)

tratment) A + B recipient (B) method

(IOA)*
Gamma
X, UV

B A
A

FUSION

Symmetric
hybrid =
heterokaryon

Spontaneous chromosome
Asymmetric hybrid Cybrid
eliminaƟon

Asymmetric hybrid

Fig. 13.2 Comparision between symmetric and asymmetric protoplast fusion and resultant hybrid cells from the
perspective of nuclear and cytoplasmic genome fate

DNA elimination (Hall et al. 1992a, b). Further
increase in irradiation dose did not increase the
sorting out of donor DNA. In addition to irradi-
ation, chemical agents can be used to induce
chromosome elimination, such as restriction
endonucleases, spindle toxin or chromosome
condensation agents (Ramulu et al. 1994). Using
these methods, asymmetric potato hybrids with
some wild Solanum species (Valkonen et al.
1994) and intergeneric somatic hybrids can be
produced (Wolters et al. 1993; Ali et al. 2000).
When the genome of the recipient species, potato,
is eliminated, this treatment targets the cytoplas-
mic genome and iodoacetic acid (IA), iodoac-
etamide (IOA) and actinomycin D can be used
(Liu et al. 2005). If both treatments are used,
cybrids will be regenerated. Potato cybrids pro-
duced by using the donor-recipient method have a
nuclear genetic constitution from one parent in
combination with cytoplasmic genomes of the
other parent (Perl et al. 1990). Cybrid plants are
used to produce new genetic diversity and
understanding the interrelations between nuclear
genes and cytoplasmic DNA and for the transfer
of cytoplasmic inherited traits such as male
sterility (Melchers et al. 1992; Liu et al. 2005).
Characterization of Cytoplasmic DNA
In comparison to other techniques of chromoso-
mal and gene engineering, somatic hybridization
is unique in its potential to simultaneously
transfer both nuclear and cytoplasmic genes.
Therefore, it is relevant to analyse the new
genetic configuration of hybrid DNA in order to
confirm not only the hybrid status, but also to
follow the segregation of organelles after merg-
ing the protoplasts of two species. In potato
interspecific somatic hybrids, the fate of
244
organelles after fusion is assessed by using dif-
ferent molecular markers of chloroplast and
mitochondrial DNA (Lössl et al. 1999). As a
general rule, the organelles in somatic hybrids
segregate independently, chloroplasts sorting out
but the mitochondria of both parents often
combining (Sheahan et al. 2005). Such common
features are frequently reported, and also occur in
potato somatic hybrids (Lössl et al. 1994; Iovene
et al. 2007). There are a few exceptions to the
general interaction and segregation of organelles,
for example, in somatic hybrids between culti-
vated potato and a wild species of potato, Sola-
num verneï, where recombination between the
chloroplast genomes of both parents occurs
(Trabelsi et al. 2005). Similarly, in somatic
hybrids between potato and S. berthaultii, both
co-existence and recombination of chloroplast
DNA occur (Bidani et al. 2007). Co-existence of
mitochondrial DNA is also recorded (Sarkar
et al. 2011). Scotti et al. (2007) identified a
molecular mitochondrial region, rpl5-rps14, as a
hotspot for mitochondrial DNA rearrangements
in potato somatic hybrids. Moreover, in the
somatic hybrids between five potato tetraploid
cultivars and one cloned accession of S. bulbo-
castanum, in addition to the elimination of the
wild species chromosomes depending on recipi-
ent cultivar, the type of chloroplast DNA in the
two parents plays an important role in the
regeneration capacity and genetic stability of the
resulting somatic hybrids (Rakosy-Tican et al.
2015). Haplotype w of chloroplasts in potato cvs.
Delikat and Rasant, as in S. bulbocastanum,
increases the incidence of plant regeneration in
these fusion combinations (Rakosy-Tican et al.
2015). Reduction in the survival of somatic
hybrids when nucleo-cytoplasmatic incompati-
bility is present is also reported for other fusion
combinations (Leon et al. 1998; Orczyk et al.
2003). In future, more detailed studies on several
fusion combinations and their contribution to
nuclear and cytoplasmic DNA should shed some
more light on the complex mechanisms involved
in the six different genome interactions after two
protoplast fusions. Different haplotypes of
chloroplast (ct), mitochondrial (mt) and nuclear
(n) DNA, analyzed using RFLP and/or SSR
R. Thieme and E. Rakosy-Tican
markers are extensively used in phylogenetic and
co-evolutionary studies on cultivated potato
accessions and their wild relatives (Hosaka 2002;
Hosaka and Sanetomo 2009). A 241 bp deletion
in ctDNA as well as a shorter deletion of 41 bp
(Ames et al. 2007), indicate that some popula-
tions of the diploid S. tarijense are the maternal
parent of cultivated potato. In addition, phylo-
genetic studies reveal the co-evolution of
chloroplasts and mitochondrial genomes and that
the correlation between nDNA and ctDNA is
even closer. Recently Sanetomo and Gebhardt
(2015) analyzed different types of cytoplasmic
DNA in European potatoes and correlated them
with some agronomic traits such as tuber starch
content and late blight resistance. Such basic
studies are a good starting point for breeding
better potatoes both by classical and biotechno-
logical means.
Future Application in Potato Breeding
After the intensive efforts during the last century
to further increase the yield of potato cultivars
failed (Douches et al. 1996), the main objectives
of the potato breeding switched to improving
processing attributes and resistance to diseases
and pests, while maintaining or even improving
such traits as tuber colour, shape, quality and/or
yield. Over the past fifty years these objectives
have mainly been achieved by using wild species
of Solanum as resources of resistance and other
new traits via classical breeding. The number of
wild species that could be integrated into potato
breeding was and is quite limited because of
sexual incompatibility, although there are tech-
niques other than sexual crosses, such as manip-
ulations of ploidy levels (Jansky 2009), breeding
2n gametes or using bridging species to integrate
genes from 25 wild Solanum species into modern
cultivars (Ross 1986). The main source of resis-
tance genes is still S. demissum, with more than
half of the modern cultivars with introgressions
from this species (Ross 1986). The main limita-
tions to the classical breeding of potato are tetra-
ploidy and heterozygosity, which make breeding
very complex (Muthoni et al. 2015). Millions of
progeny have to be screened to detect one line
with the potential for a new cultivar and this may
13 Somatic Cell Genetics and Its Application in Potato Breeding
take more than 11 years (Plaisted et al. 1984;
Barrell et al. 2013). Moreover, when genes from
an incompatible wild species have to be exploited,
as is the case of S. bulbocastanum, which is a
source of genes for durable resistance to late
blight, the use of a bridging species to produce
new cultivars took 49 years and then only one
gene was integrated into the potato gene pool, i.e.
Rpi-blb2, producing two new cvs. Bionica and
Toluca (Haverkort et al. 2009).
Over the last six decades plant biotechnology
has contributed many new less time-consuming
opportunities for potato improvement and has
provided valuable solutions to conventional
breeding difficulties (Barrell et al. 2013; Luthra
et al. 2016).
Somatic hybridization has also resulted in the
production of many resistant somatic hybrids,
integrating multiple genes and traits or even
multiple species hybrids as detailed in this sec-
tion. The limitation of somatic hybridization is
that it can result in the production of somatic
hybrids that are resistant but sometimes have
misshapen tubers or the initial somatic hybrids
have poor fertility. Solutions to these disadvan-
tages have been proposed, such as haploidization
and the use of intra-specific hybridization of
dihaploid potato lines (Rokka 2009), or the use
of somatic fusion in which tetraploid potato
Fig. 13.3 Schematic
representation of a general
combinatorial biotechnology Wild Solanum species, accessions from
approach involving somatic gene banks-Assessing resistance to stress
hybridization and additional
in vitro techniques as well as Accession cloning
analytic biochemistry
methods and phenotyping
aiming to transfer resistance Protoplast fusion (i.e. 2x + 4x)
traits into potato crop
Resistance
analysis in
laboratory
Resistance
analysis in
a field
Back-crossing
Embryo
rescue
INTEGRATION IN BREEDING
245
cultivars are fused with sexually incompatible
diploid wild species. The resulting hexaploids are
often fertile and crossable with other tetraploid
cultivars (Thieme et al. 2008, 2010;
Rakosy-Tican et al. 2015).
A new concept for exploiting all new and old
technologies to improve potato in a concerted
way is combinatorial biotechnology (Rakosy-
Tican 2012) and schemes for its application are
proposed (Rakosy-Tican et al. 2016). A general
scheme for the application of combinatorial
biotechnology to improve potato is presented in
Fig. 13.3. The main goal of such schemes is to
transfer several genes and traits from wild rela-
tives of potato into potato cultivars by first using
the somatic hybridization of the wild donor with
potato tetraploid cultivars and then integrating
other in vitro techniques like transgenesis,
embryo rescue, in vitro or marker-assisted
selection, etc. and different analytical, biochem-
ical, biophysical and genomic and phenome
analyses. There is scope in the future for
improving such schemes by using new omic
approaches and genomic technologies like next
generation sequencing, micro and macro-arrays
or directed mutagenesis (Eeckhaut et al. 2013).
A successful use of somatic hybridization in
potato breeding is the release of a new cultivar
‘Jeseo’ which was produced in Korea (Jeju
TRANSGENESIS OF WILD PARENT
Ex. MMR deficency
Hybridity-
Molecular and
cytogeneƟc
analysis
Markers for resistant
trait - MAS
Selection/analysis
Analysis of signal
Phenotyping molecules –
for abioƟc biochemical analysis,
stress FTIR, HPLC etc.
246
Special Self-governing Province Agricultural
Research & Extension Services). This cultivar
was obtained after two back-crosses of a somatic
hybrid clone with cv. Dejima. The new cultivar is
highly resistant to potato common scab (Strep-
tomyces scabies, S. turgidiscabie and S. acidis-
cabie), soft rot and potato leaf roll virus (PLRV).
However, it is susceptible to potato virus Y
(PVY) and late blight (Phytophthora infestans).
The tubers of this cultivar are round, with shal-
low eyes, yellow skin and a short dormant period
and the yield, although lower than that of the
cultivated parent, reaches 38.8 t/ha (Kim et al.
2013).
13.3.4 Transfer of Genes into Crop
Potatoes
The potato was one of the first crops transformed
successfully using the Agrobacterium-mediated
transformation of many potato cultivars (An et al.
1986; Sheerman and Bevan 1988; Stiekema et al.
1988). There are many examples of attempts to
transfer and integrate economically important
genes into crop potatoes and some of the previ-
ous reviews have presented the state of the art for
this tuberous crop (Kumar 1995; Solomon-
Blackburn and Barker 2001; Christou et al.
2006; Mullins et al. 2006; Millam 2007;
Rakosy-Tican 2013). Agrobacterium tumefa-
ciens-mediated transformation works well with
many cultivars of potato and a few wild species
of the genus Solanum (Rakosy-Tican et al. 2004,
2007). The efficiency of this method of trans-
ferring genes varies depending on the genotype,
with cv. Désirée the model variety (Stiekema
et al. 1988; Sheerman and Bevan 1988;
Rakosy-Tican et al. 2007). Transformation effi-
ciency was improved by using particular marker
genes, the most frequently used being the nptII
gene (bacterial neomycin phosphotransferase
gene). Later on reporter genes were also trans-
ferred into the potato. The most commonly used
reporter gene is gus (glucuronidase gene), but in
the last few years green fluorescent protein (gfp)
was also frequently used to transform different
species of plants including potato and some of its
R. Thieme and E. Rakosy-Tican
wild relatives (Rakosy-Tican et al. 2007;
Rakosy-Tican 2013). Both gfp and nptII com-
bined in a binary vector to improve the transge-
nesis of potato cultivars and dihaploid lines as it
makes it easier to identify chimeras and escapes,
which are quite common when the selection is
only based on the use of the resistance to
antibiotics, such as kanamycin (Rakosy-Tican
et al. 2007). This strategy enabled us to achieve a
high efficiency in Agrobacterium-mediated gene
transfer into potato cultivars and one dihaploid
line. These cultivars were then used to transform
a marker-free hairpin construct containing two
antisense coat protein (CP) genes separated by an
intron and then generate hairpin structures and
posttranscriptional gene silencing, which resulted
in cultivars resistant to PVY (Rakosy-Tican et al.
2010).
Worldwide, transgenic plants with a number of
different traits are being developed: (1) resistance
to herbicides; (2) pollination control mechanisms
—CMS (cytoplasmic male sterility); (3) insect
resistance (genes from bacteria and plants);
(4) virus resistance, including reverse genetics;
(5) resistance to fungi (antifungal proteins or R
genes); (6) nutritional improvement—Golden
potato; (7) senescence retardation; (8) tolerance
of abiotic stresses; and (9) production of valuable
pharmaceuticals and secondary metabolites (use
of plants as bioreactors). The application of gene
transfer and the results obtained using crop plants
were recently reviewed by Davey et al. (2010)
and Rashid and Lateef (2016) and for only potato
by Rakosy-Tican (2013), and in this section, the
results obtained in the last few years are high-
lighted and presented in Tables 13.4 and 13.5.
The disadvantages of transgenesis are the con-
straints on transferring genes between species, the
possibility that only a limited number of cloned
genes can be transferred, and the concern of
consumers over their introduction as human food
have all increased the interest in developing new
strategies like cisgenesis and transfer of genes
between the plants of the same species (see
Jacobsen and Schouten 2008; Haverkort et al.
2008). Unfortunately, scientists were not able to
convince the European Commission on the
non-GMO status of plants generated by
13 Somatic Cell Genetics and Its Application in Potato Breeding
transferring genes from the same species or a
related inter-crossable species of plants (http://
www.efsa.europa.eu/en/efsajournal/pub/2561.
htm). In the frame of the DuRPh Project in the
Netherlands, Zhu et al. (2012) stacked three late
blight-resistance genes: Rpi-sto1 (S. stoloni-
ferum) homologue of Rpi-blb1, Rpi-vnt1.1 (S.
venturii) and Rpi-blb3 (S. bulbocastanum), and
put them into a single binary vector pBINPLUS.
The susceptible cv. Désirée was transformed and
that the stacked genes functioned was revealed by
using a detached leaf assay (DLA) and field
assays over a period of two years (Zhu et al. 2012;
Haesaert et al. 2015). Thus cisgenesis might
prove very useful if exempted from GMO rules in
Europe. Such a strategy could be used to stack
dominant genes in a variety that improves its
resistance to late blight and other diseases. For all
quantitative traits, which depend on multiple
genes, somatic hybridization and combinatorial
biotechnology may be a better way of improving
potato.
13.4 New Breeding Technologies
Used for Improving Potato
In recent years new biotechnological techniques
have been adopted for plant breeding which
make use of RNAi (RNA interference) or
miRNA (micro RNA) and which allow for pre-
cise gene editing via directed mutagenesis. In
potato, hundreds of miRNAs have been identi-
fied (Zhang et al. 2013; Kim et al. 2011).
Methods like targeting induced local lesions in
genomes (TILLING), mega nucleases, zinc fin-
ger nucleases (ZFNs), transcription activator-like
effector nucleases (TALENs) and the bacterial
clustered regularly interspaced short palindromic
repeats associated with protein 9 nuclease
(CRISPR-Cas9) have lately been applied to dif-
ferent crops. These technologies achieve specific
and precise silencing or knockout of a given gene
or its activation and carry a huge potential for
understanding gene function and regulatory
processes in different organisms including plants.
Precise genome engineering like TALENs or
CRISPR-Cas9 makes use of isolated protoplasts
247
and bacterial systems to induce directed muta-
genesis. Compared to earlier technologies like
ZFNs or TALENs, CRISPR-Cas9 proves to be
easier and more efficient and hence has been
widely used in recent years (Gaj et al. 2013). The
Cas9 endonuclease is driven by a 20-base pair
(bp) sequence at the end of the single-guide RNA
(sgRNA), which acts as a guide to a specific site
of the genome. Once the genome is targeted, the
nuclease Cas9 is able to cleave double-stranded
DNA, leading to deletion, substitution or inser-
tion at the target site (Sander and Joung 2014).
Genome editing tools provide a potential alter-
native to traditional Agrobacterium-mediated
introduction of a gene of interest (Halterman
et al. 2016).
Since 2013, CRISPR/Cas9 has been applied
either in transient expression and/or stable
transgenesis in several plant species, such as
Arabidopsis thaliana and Nicotiana benthami-
ana, as well as in several crops like rice, wheat,
maize, and tomato (Brooks et al. 2014; Jiang
et al. 2013; Li et al. 2013; Miao et al. 2013;
Nekrasov et al. 2013; Shan et al. 2013). It has
been also shown that mutations generated in the
primary transgenic plants by the CRISPR/Cas9
system can be stably transmitted to the next
generation (Brooks et al. 2014; Feng et al. 2014).
Thus, the CRISPR/Cas9 system is becoming a
powerful tool for genome editing in plants,
whereas the reports of the usage and efficiency of
the CRISPR/Cas9 system-mediated plant gen-
ome engineering are still limited.
In potato, reverse genetics was applied to
induce virus resistance by transgenesis (Missiou
et al. 2004), also in combination with marker-free
gene transfer (Bukovinszki et al. 2007;
Rakosy-Tican et al. 2010). Elias et al. (2009)
showed the utility of enzymatic mismatch
cleavage for TILLING and ECOTILLING in
three varieties of potato. The three mutant culti-
vars exhibit salinity tolerance after treatments
with gamma irradiation. This method allowed a
rapid germplasm characterization. For identifi-
cation of novel starch variants in potato dihap-
loid, seeds were treated with
ethylmethanesulphonate (EMS) for 16 h. By
using a granule-bound starch synthase I gene
248 R. Thieme and E. Rakosy-Tican

Table 13.4 Transgenesis and cisgenesis used to improve potato tubers or their use as bioreactors: a synthesis of the
more recent results
Goal Specific trait Genes Results References
transferred
Tuber Glycoalkaloid content Sgt1 Reduced tuber toxicity McCue et al. (2005)
quality Reduction of GmSTM1 Study of sterol Arnqvist et al. (2003)
a-solanine/increase biosynthesis
a-chaconine
Protein content Amaranth Increase in protein and Chakraborty et al.
albumin gene- essential amino acids (2000)
AmA1
Cysteine and glutathione SAT-coding Increase in essential Stiller et al. (2007)
content cysE gene amino acids-healthier
tubers
Increase in 14-3-3 isoforms Proteins Increase in antioxidants Łukaszewicz et al.
14-3-3; CHS, (2002, 2004)
CHI, DFR
Increase in flavonols and DFR, UGT Better tuber content with Aksamit-Stachurska
anthocyanins same yield and starch et al. (2008)
content
Carotene and lutein—Golden crtB, crtl, crty Golden potato rich in A Diretto et al. (2007,
potato vitamin 2010)
Biofortification in vitamin E At-HPPD, At- Increase in vitamin E Crowell et al. (2008)
HPT
Waxy starch Not the case Low amylose McPherson and Jane
(1999)
High amylopectin starch GBSS Change in starch Visser et al. (1991)
composition
Biofortification in inulin 1-FFT, 1-SST Inulin synthesis— Hellwege et al. (2000)
healthier tubers
Tuber storage qualities LbPFK with Reduction in low Navrátil et al. (2007)
tuber-specific temperature sweetening
promoter
RNAi Reduction in low Chen et al. (2008a)
temperature sweetening
Processing low acrylamidea Two Reduced acryl-amide in Rommens et al. (2008)
asparagine chips and French fries
synthetase
genes
Tuber Tuber number OsSUT5Z and Increase in yield Sun et al. (2011)
yield OsSUT2M
Tuber development AtPAP2 Carbon metabolism and Zhang et al. (2014)
yield
(continued)
13 Somatic Cell Genetics and Its Application in Potato Breeding 249

Table 13.4 (continued)

Goal Specific trait Genes Results References
transferred
Potato Surface antigen for hepatitis HBsAg Vaccines Guan et al. (2010),
plants as B Thanavala and Lugade
bio-reactor (2010a, b)
Producing salmon interferon Interferon gene Interferon biosynthesis Fukuzawa et al. (2010)
Vaccines Rotavirus CP Trials on mice Yu and Langridge
VP6 (2003)
Papilloma Vaccines for papilloma Biemelt et al. (2003)
virus genes virus
Human serum albumin HSA Human serum Farran et al. (2002)
production
Human tumour necrosis TNF-a Cancer therapy Ohya et al. (2002)
factor
Antibodies IgGs and Fab Production of antibodies DeWilde et al. (2002)
fragments of
genes
Production of diagnostic SimpliREDTM HIV diagnosis Schunmann et al.
reagent (2002)
Staphylokinase SAK Plasminogen activator— Gerszberg et al. (2012)
overexpression treatment of poor blood
circulation
a
All-native DNA transformation

(waxy), a series of point mutations were identi-
fied that affect gene expression for enzyme
function. It was possible to establish elite
breeding lineages lacking granule-bound starch
synthase (GBSS) I protein activity and producing
high amylopectin-starch (Muth et al. 2008).
TALENs was used to improve cold storage
and processing traits in potato (Clasen et al.
2015). The CRISPR/Cas9 system was estab-
lished in potato recently (Wang et al. 2015).
Altered starch quality with full knockout of
GBSS gene function in potato was achieved
using CRISPR-Cas9 through transient transfec-
tion and regeneration from isolated protoplasts
(Andersson et al. 2017). The authors have
demonstrated that this system is an effective tool
in potato, and can promote functional studies of
hitherto uncharacterized genes.
Aside from these novel technologies, some
other aspects and approaches have to be taken
into consideration if the breeding system of
potato is to be improved (Jansky et al. 2016):
• management of the nearly 100 crop wild
relatives mostly sexually compatible with
cultivated potato at diploid level;
• production of inbred lines by selfing for sys-
tematically combining genes or alleles of
interest, as well as for exploiting heterosis;
• production of near-isogenic or other intro-
gression lines;
• hybrid production supported by a cytoplasmic
male sterility system;
• successful TPS (true potato seed)-based cul-
tivars with improved heterosis, uniformity,
cytoplasm male sterility, combining ability,
disease resistance, or seedling vigour;
• stacking of new genes into well-established
inbred lines;
• cybrid production by protoplast fusion
between male sterile cytoplasic sources and
male fertile cultivars to change male fertile
potato cultivars into male sterile ones without
altering the nuclear genome as a step in
developing TPS parents (Perl et al. 1990);
250 R. Thieme and E. Rakosy-Tican

Table 13.5 Examples of transgenesis and cisgenesis results in improving biotic and abiotic stress in potato during
2003–2017
Goal Trait Genes used Results References
Biotic Insect cry1Ac9 Resistance to tuber moth Davidson et al.
stress resistance (2004)
resistance Hybrid Bt endotoxin Resistance to both coleopteran and Naimov et al.
lepidopteran pests (2003)
Cysteine Pls Resistance to Western flower thrips Outchkourov
et al. (2004)
Resistance 5-UGT Tuber yield, starch and anthocyanin Lorenc-Kukuła
to bacteria increase, resistance to Erwinia et al. (2005)
carotovora
ScSN1 Resistance to Erwinia carotovora and Almasia et al.
Rhizoctonia solani (2008)
Resistance Rpi-vnt1.1 Increased yield and Pi resistance in field Jones et al.
to late trials (2014)
blight Rpi-vnt1.1 and Rpi-sto1 Cisgenic marker-free Pi resistant cvs. Jo et al. (2014)
RB (Rpi-blb1) Tolerance to Pi and gene stability Listanto et al.
(2015)
Rpi-vnt1.1, Rpi-sto1, Stacking three cisgenes—durable Zhu et al.
Rpi-blb3 resistance Pi (2012)
Resistance MsrA2 Broad-spectrum fungal and bacterial Osusky et al.
to diseases resistance (2005)
MsrA3 with Mitigates biotic and abiotic responses Goyal et al.
tissue-specific promoter (2013)
Nematode Peptide-disrupting Globodera pallida resistance—no side Green et al.
resistance chemoreception of effects on non-targets (2012)
nematodes
Virus dsRNA PVY coat RNAi-induced resistance to PVY Missiou et al.
resistances protein (CP) (2004)
shRNA with ipt gene Resistance to PVYNTN in a marker-free Bukovinszki
system et al. (2007)
CP gene Resistance to PVY in the field Dusi et al.
(2009)
shRNA with I Resistance to PVYNTN in a marker-free Rakosy-Tican
system et al. (2010)
shRNA Resistance to PVY Tabassum et al.
(2016)
(continued)
13 Somatic Cell Genetics and Its Application in Potato Breeding 251

Table 13.5 (continued)

Goal Trait Genes used Results References
Abiotic Heat CaPF1 Tolerance to high temperature Youm et al.
stress tolerance (2008)
tolerance AtCBF3 Heat tolerance Dou et al.
(2015)
Freezing Atrd29A::DREB1A Tolerance to freezing Behnam et al.
tolerance (2007)
Drought ScTPS Studies on water content and Stiller et al.
tolerance photosynthesis (2008)
ggpPS Increased glucosyl-glycerol in Sievers et al.
tubers/drought, salt tolerance (2013)
PaSOD Increased photosynthesis under drought Pal et al. (2013)
TPS1 Trehalose increase and tolerance to Kondrak et al.
drought (2012)
Two stress BADH Drought and salt tolerance Zhang et al.
factors (2011)
StEREBP1 Cold and salt tolerance Lee et al. 2007
SOD, APX Tolerance to oxidative stress and high Tang et al.
temperature (2006)
At DREB1B Drought and freezing tolerance Movahedi et al.
(2012)
StDREB1 or StDREB2 Salt or drought tolerance Bouaziz et al.
(2012, 2013)
GB Salt and cold tolerance Ahmad et al.
(2014)
Multiple StnsLTP1 Multiple tolerance to heat, salt and Gangadhar
stresses drought et al. (2016)
CodA/chloroplast Tolerance to oxidative, salt, and drought Ahmad et al.
stresses (2008)
SOD, APX, CodA/ Tolerance to oxidative, salt, and drought Ahmad et al.
chloroplast stresses (2010)
At DREB1B dehydration response element B 1B; CodA choline oxidase; GB glycinebetaine; BADH betaine aldehyde
dehydrogenase; MsrA2 gene for frog antimicrobial peptide; SOD superoxide dismutase; APX ascorbate peroxidase; Pi
Phytophthora infestans; Pls protease inhibitors; ScTPS Saccharomyces cerevisiae trehalose-6-phosphate synthase gene;
ScSN1 Snakin-1, a cysteine-rich peptide from Solanum chacoense; StEREBP1 Solanum tuberosum ethylene responsive
element binding protein 1; TPS1 yeast trehalose-6-phosphate synthase 1; 5-UGT anthocyanin 5-O-Glucosyltransferase

• mapping and sequencing male-fertility genes
in diploids, using CRISPR-Cas9 to create
male sterile plants for use as female parents in
hybrid production (Belhaj et al. 2015);
• the dominant self-incompatibility inhibitor
(Sli) gene, identified in the sexually compat-
ible wild species S. chacoense should be used
to produce inbred lines (Hosaka and Hanne-
man 1998);
• use of back-cross breeding to introgress small
chromosome regions from wild species into a
cultivated background.
When comparing the main classical techniques
for potato improvement with the modern ones
based on biotechnology and genome editing
(Fig. 13.4), one has to weigh up the advantages
and drawbacks in applying them in practice.
252 R. Thieme and E. Rakosy-Tican

Basic Conventional and Biotechnological Approaches Used for Potato Improvement

Conventional breeding Genetic engineering Genome

editing

Cross Mutagenesis Protoplast Gene transfer Cisgenesis CRISPR/Cas9

fusion

Mutagens _ Alien gene Solanum ssp.

chemical, own gene
irradiation etc. Agro- Agro-
X bacterium bacterium

Crossing,
selection
11 years
Selection Targeted
mutagenesis
Transgenic Cisgenic
plant with plant with
Characterization, improved improved
back-crosses, trait / traits trait / traits
selection
New
New mutant plant
cultivar Modified cultivar New cultivar Modified cultivar Modified cultivar

Fig. 13.4 Valuable conventional and biotechnological techniques for potato improvement

Classical breeding still is a time-consuming pro-
cess, which involves many years of selecting a
huge number of clones. Classical mutagenesis is
based on chemical or physical treatment acting
randomly and at multiple sites in the genome.
Biotechnological tools were developed to bypass
these drawbacks. In this chapter we tried to show
the advantages and state of the art in using in vitro
techniques in potato improvement and somatic
cell genetic studies. The main approaches to
increase genetic variability and select improved
varieties as for productivity and resistance to biotic
and abiotic stress are presented in Fig. 13.4.
Somatic hybridization through protoplast fusion
allows sexual incompatibilities to be bypassed and
the transfer of both multiple genes and traits from
wild relatives into the potato crop genome. It still
needs back-crossing for at least two or more gen-
erations and selection for the desired traits. Gene
transfer from distant or related species needs a
good knowledge of dominant genes and their
transfer into well-characterized potato varieties.
Stacking of transgenes or cisgenes has proven its
utility in potato crop but it is still not well accepted
by the consumer in Europe. One better way to
achieve the goals of improving the crop resistance
traits is combinatorial biotechnology already dis-
cussed in this chapter as a complex combination of
different biotechnological and analytic tools in
accordance with the classical and newest genome
studies. The latest technologies of reverse genetics
and targeted mutagenesis have already proved to
be very precise and have apparently no drawbacks
but are still in the beginning and will most prob-
ably contribute to new achievements at the basic
research level and applied potato improvement in
the future.
From a practical point of view and to achieve
the goals of our actual agriculture challenged by
climate change and the exponential increase of
world population, we have to bear in mind that
all possible modern and classical tools are nee-
ded to improve crops and assure food and
resources for the next generation.
13 Somatic Cell Genetics and Its Application in Potato Breeding
References
Abbott AJ, Belcher AR (1986) Potato tuber formation
in vitro. In: Withers LA, Alderson PG (eds) Plant
tissue culture and its agricultural applications. Butter-
worths, London, pp 113–122
Ahloowalia BS (1986) Limitations to the use of
somaclonal variation in crop improvement. In: Vari-
ation Somaclonal, Improvement Crop (eds) Semal.
Martinus Nijhoff, Boston, pp 14–27
Ahloowalia BS (1999) Production of mini-seed tubers
using modular system of plant micropropagation.
Potato Res 42:569–575
Ahmad R, Kim MD, Back KH et al (2008) Stress-induced
expression of choline oxidase in potato plant chloro-
plasts confers enhanced tolerance to oxidative, salt,
and drought stresses. Plant Cell Rep 27:687–698
Ahmad R, Kim YH, Kim MD et al (2010) Simultaneous
expression of choline oxidase, superoxide dismutase
and ascorbate peroxidase in potato plant chloroplasts
provides synergistically enhanced protection against
various abiotic stresses. Physiol Plant 138:520–533
Ahmad R, Hussain J, Jamil M et al (2014) Glycinebetaine
synthesizing transgenic potato plants exhibit enhanced
tolerance to salt and cold stresses. Pak J Bot 46
(6):1987–1993
Ahn YK, Park T-H (2013) Resistance to common scab
developed by somatic hybrids between Solanum
brevidens and Solanum tuberosum. Acta Agric Scand
Sect B 63(7):595–603
Aitken-Christie J, Kozai T, Takayama S (1995) Automa-
tion in plant tissue culture—general introduction and
overview. In: Aitken-Christie J, Kozai T, Smith L
(eds) Automation and Environmental control in plant
tissue culture. Kluwer Academic Publishers, Dor-
drecht, The Netherlands, pp 1–18
Akita M, Takayama S (1988) Mass propagation of potato
tubers using jar fermentor techniques. Acta Hortic
230:55–61
Aksamit-Stachurska A, Korobczak-Sosna A, Kulma A,
Szopa J (2008) Glycosyltransferase efficiently controls
phenylpropanoid pathway. BMC Biotechnol 8(25):1–
16
Ali SNH, Juigen DJ, Ramanna MS, Jacobsen E, Vis-
ser RGF (2000) Genomic in situ hybridization analysis
of a trigenomic hybrid involving Solanum and
Lycopersicon species. Genome 44:299–304
Almasia NI, Bazzini AA, Esteban Hopp H,
Vazquez-Rovere C (2008) Overexpression of
snakin-1 gene enhances resistance to Rhizoctonia
solani and Erwinia carotovora in transgenic potato
plants. Mol Plant Pathol 9(3):329–338
Alyokhin A, Baker M, Mota-Sanchez D, Dively G,
Grafius E (2008) Colorado potato beetle resistance to
insecticides. Am J Pot Res 85:395–413
Ames M, Salas A, Spooner DM (2007) The discovery and
phylogenetic implications of a novel 41 bp plastid
DNA deletion in wild potatoes. Pl Syst Evol 268:159–
175
253
An G, Watson BD, Chiang CC (1986) Transformation of
tobacco, tomato, potato, and Arabidopsis thaliana
using a binary Ti vector system. Plant Physiol 81:301–
305
Andersson M, Turesson H, Nicolia A et al (2017)
Efficient targeted multiallelic mutagenesis in tetraploid
potato (Solanum tuberosum) by transient
CRISPR-Cas9 expression in protoplasts. Plant Cell
Rep 36:117–128
Arihara A, Kita T, Igarashi S, Goto M, Irikura Y (1995)
White Baron: a non-browning somaclonal variant of
Danshakuimo (Irish cobbler). Am Potato J 72
(11):701–705
Arnqvist L, Dutta PC, Jonsson L, Sitbon F (2003)
Reduction of cholesterol and glycoalkaloid levels in
transgenic potato plants by overexpression of a Type 1
Sterol Methyltransferase cDNA. Plant Physiol
131:1792–1799
Austin S, Lojkowska E, Ehlenfeldt MK, Kelman A,
Helgeson JP (1988) Fertile interspecific somatic
hybrids of Solanum: a novel source of resistance to
Erwinia soft rot. Phytopathology 78:1216–1220
Aversano R, Ercolano MR, Frusciante L et al (2007)
Resistance traits and AFLP characterization of diploid
primitive tuber-bearing potatoes. Genet Resour Crop
Evol 54(8):1797–1806
Baird E, Cooper-Bland S, Waugh R, DeMaine M,
Powell W (1992) Molecular characterization of inter-
and intra-specific somatic hybrids of potato using
randomly amplified polymorphic DNA (RAPD) mark-
ers. Mol Gen Genet 233:469–475
Bajaj YPS (1977) Initiation of shoots and callus from
potato-tuber sprouts and axillary buds frozen at
−196 °C. Crop Improv 4:48–53
Bajaj YPS (1995) Cryopreservation of germplasm of
potato (Solanum tuberosum L.) and cassava (Manihot
esculenta Cratz). In: Baja YPS (ed) Biotechnology in
agriculture and forestry vol 32 cryopreservation of
plant germplasm I. Springer, Berlin, pp 398–416
Bajaj YPS, Dionne LA (1967) Growth and development
of potato callus in suspension cultures. Can J Bot
45:1927–1931
Bajaj YPS, Sopory SK (1986) Biotechnology of potato
improvement. In: Bajaj YPS (ed) Biotechnology in
agriculture and forestry, vol 2. Crops 1. Springer,
Berlin, pp 429–454
Barandalla L, Sánchez I, Ritter E, Ruiz de Galarreta JI
(2003) Conservation of potato (Solanum tuberosum
L.) cultivars by cryopreservation. Span J Agric Res
1:9–13
Barrell P, Conner A (2011) Facilitating the recovery of
phenotypically normal transgenic lines in clonal crops:
a new strategy illustrated in potato. Theor Appl Gent
12:1171–1177
Barrell PJ, Meiyalaghan S, Jeanne ME, Jacobs JME,
Conner AJ (2013) Applications of biotechnology and
genomics in potato improvement. Plant Biotech J
11:907–920
Behnam B, Kikuchi A, Celebi-Toprak F et al (2007)
Arabidopsis rd29A:DREB1A enhances freezing
254
tolerance in transgenic potato. Plant Cell Rep
26:1275–1282
Behnke M (1979) Selection of potato callus for resistance
to culture filtrates of Phytophthora infestans and
regeneration of resistant plants. Theor Appl Genet
55:69–71
Behnke M (1980) Selections of dihaploid potato callus for
resistance to the culture filtrate of Fusarium oxyspo-
rum. Zeitschr Pflanzenzüchtg 85:254–258
Belhaj K, Chaparro-Gaecia Kamoun S et al (2015)
Editing plant genomes with CRISP/Cas9. Curr Opin
Biotechnol 32:76–84
Benson EE (2008a) Cryopreservation of phytodiversity: a
critical appraisal of theory practice. Crit Rev Plant Sci
27:141–219
Benson EE (2008b) Cryopreservation theory. In:
Reed BM (ed) Plant cryopreservation: a practical
guide. Springer, New York, pp 15–32
Benson EE, Keith H (2012) Cryopreservation of shoot
tips and meristems: an overview of contemporary
methodologies. Method Mol Biol 877:192–226
Benson EE, Johnston J, Muthusamy JA, Harding K
(2006) Physical and engineering perspectives of
in vitro plant cryopreservation. In: Gupta SD,
Ibaraki Y (eds) Plant tissue culture engineering.
Springer, Dordrecht, pp 441–476
Benson EE, Wilkinson M, Todd A, Ekuere U, Lyon J
(1996) Development compete and ploidy stability in
plants regenerated from cryopreserved potato
shoot-tips. Cryo-Letters 17:119–128
Bidani A, Nouri-Ellouz O, Lakhoua L et al (2007)
Interspecific potato somatic hybrids between Solanum
berthaultii and Solanum tuberosum L. showed recom-
binant plastome and improved tolerance to salinity.
Plant Cell Tiss Organ Cult 91:179–189
Biemelt S, Sonnewald U, Gaimbacher P, Willmitzer L,
Muller M (2003) Production of human papillomavirus
type 16 viral-like particles in transgenic plants. J Virol
77:9211–9220
Binding H, Jain SM, Finger J et al (1982) Somatic
hybridization of an atrazine resistant biotype of
Solanum nigrum with Solanum tuberosum. Part 1.
Clonal variation in morphology and in atrazine
sensitivity. Theor Appl Genet 63:273–277
Bird A (2007) Perceptions of epigenetics. Nature
447:396–398
Bizarii M, Borghi L, Ranalli P (1995) Effect of activated
charcoal effects on induction and development of
microtubers in potato (Solanum tuberosum L.). Ann
Appl Biol 127:175–181
Bołtowicz D, Szczerbakowa A, Wielgat B (2005) RAPD
analysis of the interspecific somatic hybrids Solanum
bulbocastanum (+) S. tuberosum. Cell Mol Biol Lett
10:151–162
Bordallo PN, Silva DH, Maria J, Cruz CD, Fontes EP
(2004) Somaclonal variation on in vitro cultured
potato cultivars. Hortic Bras 22:1–6
Bottino PJ (1975) The potential of genetic manipulation
in plant cell cultures for plant breeding. Radiation Bot
15:1–16
R. Thieme and E. Rakosy-Tican
Bouaziz D, Pirrello J, Amor HB et al (2012) Ectopic
expression of dehydration responsive element binding
proteins (StDREB2) confers higher tolerance to salt
stress in potato. Plant Physiol Bioch 60:98–108
Bouaziz D, Pirrello J, Charfeddine M et al (2013)
Overexpression of StDREB1 transcription factor
increases tolerance to salt in transgenic potato plants.
Mol Biotechnol 54:803–817
Bradshaw JE, Bryan GJ, Ramsay G (2006) Genetic
resources (including wild and cultivated Solanum
species) and progress in their utilisation in potato
breeding. Potato Res 49:49–65
Brown CT, Mojtahedi H, James S, Novy RG, Love S
(2006) Development and evaluation of potato breed-
ing lines with introgressed resistance to Columbia
root-knot nematode (Meloidogyne chitwoodi). Am J
Potato Res 83(1):1–8
Brooks C, Nekrasov V, Zachary B, Lippman ZB, Van
Eck J (2014) Efficient gene editing in tomato in the
first generation using the CRISPR/Cas9 system. Plant
Physiol 166:1292–1297
Bukovinszki A, Diveki Z, Csanyi M, Palkovics L,
Balazs E (2007) Engineering resistance to PVY in
different potato cultivars in a marker-free transforma-
tion system using a ‘shooter mutant’ A. tumefaciens.
Plant Cell Rep 26:459–465
Butenko RG, Kuchko AA (1979) Pysiological aspects of
isolation, cultivation and hybridization of potato
protoplasts. Fiziol Rastenii 26:1110–1119
Cai X, Liu J, Xie C (2004) Mesophyll protoplast fusion of
Solanum tuberosum and Solanum chacoense and their
somatic hybrid analysis. Acta Hort Sinica 31:623–626
Carlson PS, Smith HH, Dearing RD (1972) Parasexual
plant hybridization. Proc Natl Acad Sci USA
69:2292–2294
Cassells AC, Deadman ML, Brown CA, Griffin E (1991)
Field resistance to late blight (Phytophthora infestans
(Mont.) De Bary) in potato (Solanum tuberosum L.)
somaclones associated with instability and pleiotropic
effects. Euphytica 56:75–80
Cassels AC, Austin S, Goetz EM (1986) Variation in
tubers in single cell-derived clones of potato in
Ireland. In: Baja YPS (ed) Biotechnology in agricul-
ture and forestry 3. Potato, Springer Verlag, Berlin,
pp 375–391
Chakraborty S, Chakraborty N, Datta A (2000) Increased
nutritive value of transgenic potato by expressing a
nonallergenic seed albumin gene from Amaranthus
hypochondriacus. Proc Natl Acad Sci USA 97
(7):3724–3729
Chandel P, Tiwari JK, Ali N et al (2015) Interspecific
potato somatic hybrids between Solanum tuberosum
and S. cardiophyllum, potential sources of late blight
resistance breeding. Plant Cell Tiss Organ Cult
123:579–589
Chanemougasoundharam A, Sakar D, Pandey SK et al
(2004) Culture tube closure type affects potato
plantlets growth and chlorophyll contents. Biol Plant
48:7–11
13 Somatic Cell Genetics and Its Application in Potato Breeding
Chang DC, Cho IC, Suh J-T, Kim SJ, Lee YB (2011)
Growth and yield response of three aeroponically
grown potato cultivars (Solanum tuberosum L.) to
different electrical conductivities of nutrient solution.
Am J Potato Res 88:450–458
Chauvin JE, Souchet C, Dantec JP, Ellissèche D (2003)
Chromosome doubling of 2x Solanum species by
oryzalin: method development and comparison with
spontaneous chromosome doubling in vitro. Plant Cell
Tiss Organ Cult 73:65–73
Chao K-S, Park T-H (2014) Potato breeding via protoplast
fusion. J Plant Biotechnol 41:65–72
Chen Q, Li H-Y, Shi YZ et al (2007) Development of an
effective protoplast fusion system for production of
new potatoes with disease and insect resistance using
Mexican wild potato species as gene pools. Can J
Plant Sci 88(4):611–619
Chen S, Hajirezaei MR, Zanor M-I et al (2008a) RNA
interference-mediated repression of
sucrose-phosphatase in transgenic potato tubers (Sola-
num tuberosum) strongly affects the hexose-to-sucrose
ratio upon cold storage with only minor effects on total
soluble carbohydrate accumulation. Plant, Cell Envi-
ron 31:165–176
Chen Q, Li HY, Shi YZ et al (2008b) Development of an
effective protoplast fusion system for production of
new potatoes with disease and insect resistance using
Mexican wild potato species as gene pools. Can J
Plant Sci 88:611–619
Chen L, Guo X, Xie C et al (2013) Nuclear and
cytoplasmic genome components of Solanum tubero-
sum + S. chacoense somatic hybrids and three SSR
alleles related to bacterial wilt resistance. Theor Appl
Genet 126(7):1861–1872
Chen L, Guo X, Wang H et al (2016) Tetrasomic
inheritance pattern of the pentaploid Solanum cha-
coense (+) S. tuberosum somatic hybrid (resistant to
bacterial wilt) revealed by SSR detected alleles. Plant
Cell Tiss Organ Cult 127:315–323
Christou P, Capell T, Kohli A, Gatehouse JA, Gate-
house AMR (2006) Recent developments and future
prospects in insect pest control in transgenic crops.
Trends Plant Sci 11(6):302–308
Clasen BM, Stoddard TJ, Luo S et al (2015) Improving
cold storage and processing traits in potato through
targeted gene knockout. Plant Biotech J. doi:10.1111/
pbi.12370
Cocking EC (1960) A method for the isolation of plant
protoplasts and vacuoles. Nature 187:927–929
Coleman WK, Coleman SE (2000) Modification of potato
microtuber dormancy during induction and growth
in vitro or ex vitro. Am J Potato Res 78:47–55
Coleman WK, Donelly DJ, Coleman SE (2001) Potato
microtubers as research tools: a review. Am J Potato
Res 78:47–55
Colton LM, Groza HI, Wielgus SM, Jiang J (2006)
Marker-assisted selection for the broad-spectrum
potato late blight resistance conferred by gene RB
derived from a wild potato species. Crop Sci 46:589–
594
255
Cooper-Bland S, DeMaine MJ, Fleming ML et al (1994)
Synthesis of intraspecific somatic hybrids of Solanum
tuberosum: assessments of morphological, biochemi-
cal and nematode (Globodera pallida) resistance
characteristics. J Exp Bot 45:1319–1325
Crowell EF, McGrath JM, Douches DS (2008) Accumu-
lation of vitamin E in potato (Solanum tuberosum)
tubers. Transgenic Res 17:205–217
Da Rocha PSG, De Oliveira RP, Scivittaro WB (2015)
New light sources for in-vitro potato micropropaga-
tion. Biosci J 31(5):1312–1318
Dai C-X, Sun S-D (1994) Culture of cotyledon and
hypocotyl protoplasts from true potato seedlings in
Solanum tuberosum L. Acta Bot Sin 36:671–678
Dale PJ, MCPartlan HC (1992) Field performance of
transgenic potato plants compared with controls
regenerated from tuber discs and shoot cuttings. Theor
Appl Genet 84:585–591
Dann AL, Wilson CR (2011) Comparative assessment of
genetic and epigenetic variation among regenerants of
potato (Solanum tuberosum) derived from long-term
nodal tissue-culture and cell selection. Plant Cell Rep
30:631–639
Das A, Gosal SS, Sidhu JS, Dhaliwal HS (2000)
Induction of mutations for heat tolerance in potato
by using in vitro culture and radiation. Euphytica
114:205–209
Davey MR, Blackhall NW, Lowe KC, Power JB (1996)
Stimulation of plant cell division and organogenesis
by short term, high-voltage electrical pulses. In:
Lynch PT, Davey MR (eds) Electrical manipulation
of cells. USA Chapman and Hall, New York, pp 273–
286
Davey MR, Anthony P, Power BJ, Lowe KC (2005) Plant
protoplasts: status and biotechnological perspectives.
Biotechnol Adv 23(2):131–171
Davey MR, Soneji RJ, Rao MN et al (2010) Generation
and deployment of transgenic crop plants: an over-
view. In: Kole et al (ed) Transgenic crop plant-
s.1-Principles and development. Springer, Berlin,
pp 1–29
Davidson MM, Takla MFG, Jacobs JME et al (2004)
Transformation of potato (Solanum tuberosum) culti-
vars with a cry1Ac9 gene confers resistance to potato
tuber moth (Phthorimaea operculella). New Zealand J
Crop Hort Sci 32(1):39–50
De García E, Martínez S (1995) Somatic embryogenesis
in Solanum tuberosum L. cv. Désirée from stem nodal
sections. Plant Physiol 145:526–530
Demarly Y, Sibi M (1989) Amélioration des plantes et
biotechnologies. John Libbey Eurotext, Paris
Denes T-E (2015) Genetic stability of somatic hybrids
between Solanum tuberosum cv. Delikat + Solanum
bulbocastanum and their response to different stress
factors. Ph.D. thesis Babeş-Bolyai University
Cluj-Napoca, Romania
DeWilde C, Peeters K, Jacobs A, Peck I, Depicker A
(2002) Expression of antibodies and Fab fragments in
transgenic potato plants: a case study for bulk
production in crop plants. Mol Breed 9:271–282
256
Dhital SP, Lim HT (2011) Microtuberization of potato
(Solanum tuberosum L.) as influenced by supplemen-
tary nutrients, plant growth regulators, and in vitro
culture conditions. Potato Res 55:97–108
Dinu II, Hayes RJ, Kynast RG, Phillips PL, Thill CA
(2005) Novel inter-series hybrids in Solanum, section
Petota. Theor Appl Genet 110:403–415
Diretto G, Al-Babili S, Tavazza R et al (2007) Metabolic
engineering of potato carotenoid content through
tuber-specific overexpression of a bacterial minipath-
way. PLoS ONE2, e350, doi:10.1371/journcolab.
Pone 0000350 (www.plosone.org)
Diretto G, Al-Babili S, Tavazza R et al (2010)
Transcriptional-metabolic networks in
b-carotene-enriched potato tubers: the long and wind-
ing road to the golden phenotype. Plant Physiol
154:899–912
Dodds JH, Huaman Z, Lizarraga R (1991) Potato
germplasm conservation. In: Dodds JH (ed) In vitro
methods or conservation of plant genetic resources.
Chapman and Hall, London, UK, pp 93–109
Dong F, Novy JP, Helgeson JP, Jiang J (1999) Cytolog-
ical characterization of potato—Solanum etuberosum
somatic hybrids and their backcross progenies by
genomic in situ hybridization. Genome 42:987–992
Dong F, Song J, Naess SK et al (2000) Development and
applications of a set of chromosome-specific cytoge-
netic DNA markers in potato. Theor Appl Genet
101:1001–1007
Dong F, Tek AL, Frasca ABL, McGrath JM, Wielgus SM,
Helgeson JP, Jiang J (2005) Development and char-
acterization of potato—Solanum brevidens chromoso-
mal addition/substitution lines. Cytogenet Genome
Res 109:368–372
Donnelly DJ, Coleman WK, Coleman SE (2003) Potato
microtuber production and performance: a review.
Am J Potato Res 80:103–115
Dou H, Xv K, Meng Q, Li G, Yang X (2015) Potato
plants ectopically expressing Arabidopsis thaliana
CBF3 exhibit enhanced tolerance to high temperature
stress. Plant, Cell Environ 38:61–72
Douches DS, Maas D, Jastrzebski K, Chase RW (1996)
Assessment of potato breeding progress in the USA
over the last century. Crop Sci 36:1544–1552
Dragićević I, Konjević R, Vinterhalter B, Vinterhalter D,
Nešković M (2008) The effect of IAA and tetcyclacis
on tuberization in potato (Solanum tuberosum L.)
shoot culture in vitro. Plant Growth Regul 54:189–193
Dudits D, Maroy E, Praznovszky T et al (1987) Transfer
of resistance traits from carrot into tobacco by
asymmetric somatic hybridization: regeneration of
fertile plants. Proc Natl Acad Sci USA 84:8434–8438
Dusi AN, Lopes de Oliveira C, de Melo PE, Torres AC
(2009) Resistance of genetically modified potatoes to
Potato virus Y under field conditions. Pesq Agropec
Bras Brasília 44(9):1127–1130
Eeckhaut T, Lakshmanan PS, Deryckere D, Van Bock-
staele E, Van Huylenbroeck J (2013) Progress in plant
protoplast research. Planta 238(6):991–1003
R. Thieme and E. Rakosy-Tican
Elias R, Till BJ, Mba C, Al-Safadi B (2009) Optimizing
Tilling and Exotilling techniques for potato (Solanum
tuberosum L.). BMC Res Notes 2:141
Esna-Ashari M, Villiers TA (1998) Plant regeneration
from tuber discs of potato (Solanum tuberosum L.)
using 6-benzylaminopurine (BAP). Potato Res
341:371–382
Espejo R, Cipriani G, Rosel G, Golmirzaie A, William
Roca W (2008) Somatic hybrids obtained by proto-
plast fusion between Solanum tuberosum L.
subsp. tuberosum and the wild species Solanum
circaeifolium Bitter. Rev Peru Biol 15(1):73–78
Estrada R, Tovar P, Dodds JH (1986) Induction of in vitro
tubers in a broad range of potato genotypes. Plant Cell
Tiss Organ Cult 7:3–10
Evans NE, Foulger D, Farrer L, Bright SWJ (1986)
Somaclonal variation in explants-derived potato
clones over three tuber generations. Euphytica
35:353–361
Ewing EE (1987) The role of hormons in potato (Solanum
tuberosum L.) tuberization. In: Davies PL (ed) Plant
hormones and their role in plant growth and develop-
ment. Martinus Nijhoff Publishers, Boston, pp 515–
538
Faccioli G (2001) Control of potato viruses using
meristem and stem-cutting culture, thermotherapy
and chemotherapy. In: Loebestein G (ed) Virus and
virus-like diseases of potatoes and production of seed.
Kluwer Academic Publishers, Dortrecht, The Nether-
lands, pp 365–390
Faccioli G, Colalongo MC (2002) Eradication of potato
virus Y and potato leafroll virus by chemotherapy of
infected potato stem cuttings. Phytopathologia
Mediterranea 41:76–78
Farran I, Sanchez-Serrano JJ, Medina JF, Prieto J,
Mingo-Castel AM (2002) Targeted expression of
human serum albumin to potato tubers. Transgenic
Res 11:337–346
Feng Z, Mao Y, Xu N et al (2014) Multigeneration
analysis reveals the inheritance, specificity, and pat-
terns of CRISPR/Cas-induced gene modifications in
Arabidopsis. Proc Natl Acad Sci USA 111:4632–4637
Fock I, Collonnier C, Lavergne D et al (2007) Evaluation
of somatic hybrids of potato with Solanum stenoto-
mum after a long-term in vitro conservation. Plant
Physiol Biochem 45(3–4):209–215
Fock I, Collonnier C, Luisetti J et al (2001) Use of
Solanum stenotomum for introduction of resistance to
bacterial wilt in somatic hybrids of potato. Plant
Physiol Biochem 39:899–908
Fufa M, Diro M (2013) The effects of sucrose on in vitro
tuberization of potato cultivars. Adv Crop Sci Tech
1:114
Fukuzawa N, Tabayashi N, Okinaka Y et al (2010)
Production of biologically active Atlantic salmon
interferon in transgenic potato and rice plants.
J Biosci Bioeng 110(2):201–207
Gaj T, Gersbach CA, Barbas CF (2013) ZFN, TALEN
and CRISPR/Cas-based methods for genome engi-
neering. Trends Biotechnol 31(7):397–405
13 Somatic Cell Genetics and Its Application in Potato Breeding
Gangadhar BH, Sajeesh K, Venkatesh J et al (2016)
Enhanced tolerance of transgenic potato plants
over-expressing non-specific Lipid Transfer Protein-1
(StnsLTP1) against multiple abiotic stresses. Frontiers
Plant Sci 7:1228
Gavrilenko T (2007) Potato cytogenetics. In: Vreugden-
hil D (ed) Potato biology and biotechnology:
Advances and perspectives. Elsevier BV, Amsterdam,
pp 203–216
Gavrilenko T, Larkka J, Pehu E, Rokka V-M (2002)
Identification of mitotic chromosomes of tuberous and
nontuberous Solanum species (Solanum tuberosum
and Solanum brevidens) by GISH (genome in situ
hybridization) in their interspecific hybrids. Genome
45:442–449
Gavrilenko T, Thieme R, Heimbach U, Thieme T (2003)
Fertile somatic hybrids of Solanum etuberosum (+)
dihaploid Solanum tuberosum and their backcrossing
progenies: relationships of genome dosage with tuber
development and resistance to potato virus Y. Euphyt-
ica 131:323–332
Genound-Gourichon C, Veisseire P, Coudret A (1993)
Effects of pre-treatment temperature and cap closure
on photosynthesis potentialities of potato cultivated
in vitro. Photosynthetica 29:73–79
Gerszberg A, Wiktorek-Smagur A, Hnatuszko-Konka K,
Łuchniak P, Kononowicz AK (2012) Expression of
recombinant staphylokinase, a fibrin-specific plas-
minogen activator of bacterial origin, in potato
(Solanum tuberosum L.) plants. World J Microbiol
Biotechnol 28:1115–1123
Gleba YY, Hinnisdaels S, Sidorov VA et al (1988)
Intergeneric asymmetric hybrids between Nicotiana
plumbaginifolia and Atropa belladonna obtained by
gamma-fusion. Theor Appl Genet 76(5):760–766
Goldsworthy A (1996) Electrostimulation of cells by
weak electric currents. In: Lynch PT, Davey MR
(eds) Electrical manipulation of cells. USA Chapman
and Hall, New York, pp 249–272
Gonzalez-Arnao MT, Panta A, Roca WM, Escobar RH,
Engelmann F (2008) Development and large scale
application of cryopreservation techniques for shoot
and somatic embryo cultures of tropical crops. Plant
Cell Tiss Organ Cult 92:1–13
Gopal J, Chamail A, Sarkar D (2004) In vitro production
of microtubers for conservation of potato germplasm:
effect of genotype, abscisic acid and sucrose. In vitro
Cell Dev Biol—Plant 40:485–490
Gopal J, Chauhan NS (2010) Slow growth in vitro
conservation of potato germplasm at low temperature.
Potato Res 53:141–149
Gopal J, Kumar R, Kang GS (2002) The effectiveness of
using a minituber crop for selection of agronomic
characters in potato breeding programmes. Potato Res
45:145–151
Gopal J, Minocha JL, Sidhu JS (1997) Comparative
performance of potato crops raised from microtubers
induced in the dark versus microtubers induced in
light. Potato Res 40:407–412
257
Goyal RK, Hancock REW, Mattoo AK, Misra S (2013)
Expression of an engineered heterologous antimicro-
bial peptide in potato alters plant development and
mitigates normal abiotic and biotic responses.
PLoS ONE 8(10):e77505
Green J, Wang D, Lilley CJ, Urwin PE, Atkinson HJ
(2012) Transgenic potatoes for potato cyst nematode
control can replace pesticide use without impact on
soil quality. PLoS ONE 7(2):e30973
Greplová M, Polzerová H, Vlastníková H (2008) Elec-
trofusion of protoplasts from Solanum tuberosum, S.
bulbocastanum and S. pinnatisectum. Acta Physiol
Plant 30:787–796
Greplova M (2010) Isolation, cultivation and fusion of
protoplasts of Solanum genera. Ph.D. thesis Palacký
University Olomouc, Czech Republic
Grosser JW, Gmitter FG (2011) Protoplast fusion for
production of tetraploids and triploids: applications for
scion and rootstock breeding in citrus. Plant Cell,
Tissue Organ Cult 104:343–357
Grout BWW, Henshaw GG (1978) Freeze preservation of
potato shoot-tip cultures. Ann Bot 42:1227–1229
Guan ZJ, Guo B, Huo YL, Guan ZP, Wei YH (2010)
Overview of expression of hepatitis B surface antigen
in transgenic plants. Vaccine 28(46):7351–7362
Guri A, Dunbar LJ, Sink KC (1991) Somatic hybridiza-
tion between selected Lycopersicon and Solanum
species. Plant Cell Rep 10:76–80
Haapala T (2005) Use of single-leaf cuttings of potato for
efficient mass propagation. Potato Res 48:201–214
Haesaert G, Vossen JH, Custers R et al (2015) Transfor-
mation of potato variety Désirée with single or
multiple resistance genes increases resistance to late
blight under field conditions. Crop Prot 77:163–175
Hale AL, Miller JC, Renganayaki K et al (2005)
Suitability of AFLP and microsatellite marker analysis
for discriminating intraclonal variants of the potato
cultivar Russet Norkotah. J Amer Soc Hort Sci 130
(4):624–630
Hall RD, Rouwendal GJA, Krens FA (1992a) Asymmet-
ric somatic cell hybridization in plants. I. The early
effects of (sub)lethal doses of UV and gamma
irradiation on the cell physiology and DNA integrity
of cultured sugarbeet (Beta vulgarris L.) protoplasts.
Mol Gen Genet 234:306–314
Hall RD, Rouwendal GJA, Krens FA (1992b) Asymmet-
ric somatic cell hybridization in plants. II. Elec-
trophoretic analysis of radiation-induced DNA
damage and repair following the exposure of sugar-
beet (Beta vulgaris L.) protoplasts to UV and gamma
rays. Mol Gen Genet 234:315–324
Halmagyi A, Deliu C, Coste A (2005) Plant regrowth
from potato shoot tips cryopreserved by a combined
vitrification-droplet method. Cryo Lett 26:313–322
Halterman D, Guenther L, Collinge S et al (2016) Biotech
potatoes in the 21st century: 20 years since first
biotech potato. Am J Potato Res 93:1–20
Hansen J, Nielsen B, Nielsen SVS (1999) In vitro shoot
regeneration of Solanum tuberosum cultivars:
258
interactions of medium components and leaf, leaflet,
and explant position. Potato Res 42:141–151
Harding K (2004) Genetic integrity of cryopreserved plant
cells: a review. Cryo-Letters 25:3–22
Harding K, Benson EE (2000) Analysis of nuclear and
chloroplast DNA in plants regenerated from cryopre-
served shoot-tips of potato. Cryo-Letters 21:279–288
Harding K, Benson EE (2001) The use of microsatellite
analysis in Solanum tuberosum L. in vitro plantlets
derived from cryopreserved germplasm. Cryo-Letters
22:199–208
Harding K, Johnston JW, Benson EE (2009) Exploring
the physiological basis of cryopreservation success
and failure on clonally propagated in vitro crop plant
germplasm. Agr Food Sci 18:3–16
Haverkort AJ, Boonekamp PM, Hutten R et al (2008)
Societal costs of late blight in potato and prospects of
durable resistance through cisgenic modification.
Potato Res 51:47–57
Haverkort AJ, Struik PC, Visser RGF, Jacobsen E (2009)
Applied biotechnology to combat late blight in potato
caused by Phytophthora infestans. Potato Res 52:249–
264
Heeres P, Schippers-Rosenboom Jacobsen E, Visser RGF
(2002) Transformation of a large number of potato
varieties: genotype-dependent variation in efficiency
and somaclonal variability. Euphytica 124:13–22
Heiser CB Jr (1973) Introgression re-examined. Botanical
Rev 39:347–366
Helgeson JP, Haberlach GT (1999) Somatic hybrids of
Solanum tuberosum and related species. In: Altman A,
Ziv M, Izhar S (eds) Plant biotechnology and in vitro
biology in the 21st century, current plant science and
biotechnology in agriculture, vol 36. Springer, The
Netherlands, pp 151–154
Helgeson JP, Pohlman JD, Austin S et al (1998) Somatic
hybrids between Solanum bulbocastanum and potato:
a new source of resistance to late blight. Theor Appl
Genet 96:738–742
Hellwege EM, Czapla S, Jahnke A, Willmitzer L,
Heyer AG (2000) Transgenic potato (Solanum tubero-
sum) tubers synthesize the full spectrum of inulin
molecules naturally occurring in globe artichoke
(Cynara scolymus) roots. Proc Nat Acad Sci USA
97(15):8699–8704
Hirai D, Sakai A (1999) Cryopreservation of in vitro-
grown meristems of potato (Solanum tuberosum L.)
by encapsulation-vitrification. Potato Res 42:153–160
Hofferbert RH (1996) Erstellung und Selektion dihap-
loider Genotypen zur gezielten Kombinationszüch-
tung bei Kartoffeln, Ph.D. Thesis, Technische
Universität München, Deutschland
Hoque ME, Morshad MN (2014) Somacloal variation in
potato (Solanum tuberosum L.) using chemical muta-
gens. Agriculturists 12(1):15–25
Horsman K, Gavrilenko T, Bergervoet M et al (2001)
Alteration of the genomic composition of Solanum
nigrum (+) potato backcross derivatives by somatic
hybridization: selection of fusion hybrids by DNA
measurements and GISH. Plant Breed 120:201–207
R. Thieme and E. Rakosy-Tican
Hosaka K (2002) Distribution of the 241 bp deletion of
chloroplast DNA in wild potato species. Am J Potato
Res 79:119–123
Hosaka K, Sanetomo R (2009) Comparative differentia-
tion in mitochondrial and chloroplast DNA among
cultivated potatoes and closely related wild species.
Genes Genet Syst 84:371–378
Hosaka K, Hanneman RE (1998) Genetics of
self-compatibility in a self-incompatible wild diploid
potato species Solanum chacoense. 1. Detection of an
S locus inhibitor (Sli) gene. Euphytica 99:191–197
Hussay G, Stacey NL (1984) Factors affecting the
formation of in vitro tubers of potato (Solanum
tuberosum L.). Ann Bot 53:565–578
Iovene M, Savarese S, Cardi T et al (2007) Nuclear and
cytoplasmic genome composition of Solanum bulbo-
castanum (+) S tuberosum somatic hybrids. Genome
50:443–450
Iovene M, Aversano R, Savarese S et al (2012)
Interspecific somatic hybrids between Solanum bul-
bocastanum and S. tuberosum and their haploidization
for potato breeding. Biol Plant 56 (1):1–8
Jacobsen E, Schouten HJ (2008) Cisgenesis, a new tool
for traditional plant breeding, should be exempted
from the regulation on genetically modified organisms
in a step by step approach. Potato Res 51:75–88
Jain SM, Ahloowalia BS, Veilleux RE (1998) Somaclonal
variation in crop improvement. In: Jain BS, Brar DS,
Ahloowalia BS (eds) Somaclonal variation and
induced mutations in crop improvement. Current plant
science and biotechnology in agriculture, vol. 32,
Kluwer Academic Publishers, Dordrecht, The Nether-
lands, pp 203–218
Jansky S (2006) Overcoming hybridization barriers in
potato. Plant Breed 125:1–12
Jansky S (2009) Breeding, genetics and cultivar develop-
ment. In: Singh J, Kaur L (eds) Advances in potato
chemistry and technology. Academic Press, Burling-
ton, VT, pp 27–62
Jansky SH, Charkowski AO, Douches DS et al (2016)
Reinventing potato as a diploid inbred line—based
crop. Crop Sci 56:1–11
Jao R-C, Fang W (2004) Growth of potato plantlets
in vitro is different when provided concurrent versus
alternating blue and red light photoperiods. Hort Sci
39(2):380–382
Jarret RL, Hasegawa PM, Erickson HT (1980a) Factors
affecting shoot initiation from tuber discs of potato
(Solanum tuberosum). Physiol Plant 49:177–184
Jarret RL, Hasegawa PM, Erickson HT (1980b) Effect of
medium components on shoot formation from cultured
tuber discs of potato. J Am Soc Hort Sci 105:238–242
JayaSree T, Pavan U, Ramesh M et al (2001) Somatic
embryogenesis from leaf cultures of potato. Plant Cell
Tiss Organ Cult 64:13–17
Jelenić S, Berljak J, Papeš D, Jelaska S (2001) Mixo-
ploidy and chimeric structures in somaclones of potato
(Solanum tuberosum L.) cv. Bintje. Food Technol
Biotechnol 39(1):13–17
13 Somatic Cell Genetics and Its Application in Potato Breeding
Jiang JM, Gill BS, Wang GL, Ronald PC, Ward DC
(1995) Metaphase and interphase fluorescence in situ
hybridization mapping of the rice genome with
bacterial artificial chromosomes. Proc Natl Acad
Sci USA 92:4487–4491
Jiang W, Zhou H, Bi H et al (2013) Demonstration of
CRISPR/Cas9/sgRNA-mediated targeted gene modi-
fication in Arabidopsis, tobacco, sorghum and rice.
Nucleic Acids Res 41:e188
Jo et al (2014) Development of late blight resistant
potatoes by cisgene stacking. BMC Biotechnol 14:50
Jones H, Karp A, Jones MGK (1989a) Isolation, culture,
and regeneration of plants from potato protoplasts.
Plant Cell Rep 8:307–311
Jones H, Ooms G, Jones MGK (1989b) Transient gene
expression in electroporated Solanum protoplasts.
Plant Mol Biol 13:503–511
Jones JDG et al (2014) Elevating crop disease resistance
with cloned genes. Phil Trans R Soc B 369:20130087
Kaczmarczyk A, Grübe M, Keller ERJ (2009) History and
development of the potato cryopreservation method
and the cryopreserved collection at the IPK Gater-
sleben, ‘Meeting of the WG2, COST Action 871
‘Cryopreservation of Crop Species in Europe’, Gaterl-
sleben, 9.-11.09.2009, p 37
Kaczmarczyk A, Houben A, Keller ERJ, Mette MF
(2010) Influence of cryopreservation on the cytosine
methylation state on potato genomic DNA. Cryo-Lett
31:380–391
Kaczmarczyk A, Rokka V-M, Keller ER (2011) Potato
shoot tip cryopreservation: A review. Potato Res
54:45–79
Kaeppler SM, Kaeppler HF, Rhee Y (2000) Epigenetic
aspects of somaclonl variation in plants. Plant Mol
Biol 43:179–188
Kaeppler SM, Phillips RL, Olhoft P (1998) Molecular
basis of heritable tissue culture-induced variation in
plants In: Jain BS, Brar DS, Ahloowalia BS
(eds) Somaclonal variation and induced mutations in
crop improvement. Current plant science and biotech-
nology in agriculture, vol. 32. Kluwer Academic
Publishers, Dordrecht, The Netherlands, pp 465–484
Karp A (1995) Somaclonal variations as tool for crop
improvement. Euphytica 85:295–302
Keller ERJ, Dreiling M (2003) Potato cryopreservation in
Germany—using the droplet method for the establish-
ment of a new large collection. Acta Hort 623
(ISHS):193–200
Keller ERJ, Senula A, Kaczmarcyk Y (2008) Cryopreser-
vation of herbaceous dicots. In: Reed BM (ed) Plant
cryopreservation: a practical guide. Springer, New
York, pp 281–332
Khuri S, Moorby J (1995) Investigation into the role of
sucrose in potato cv. Estima microtuber production
in vitro. Ann Bot 75:295–303
Kikuta Y, Okazawa Y (1984) Control of root and
shoot-bud formation from potato tuber tissue cultured
in vitro. Physiol Plant 61:8–12
Kim HH, Yoon JW, Park YE et al (2006) Cryopreserva-
tion of potato cultivated varieties and wild species:
259
critical factors in droplet vitrification. Cryo-Lett
27:223–234
Kim SR, Ahn YK, Kim TG et al (2013) Breeding of a
new cultivar ‘Jeseo’ with resistance to common scab.
Korean J Breed Sci 45(4):468–473
Kim HJ, Baek KH, Lee BW, Choi D, Hur CG (2011) In
silico identification and characterization of micro-
RNAs and their putative target genes in Solanaceae
plants. Genome 54:91–98
Kim-Lee H, Moon JS, Hong YJ, Kim MS, Cho HM
(2005) Bacterial wilt resistance in the fusion hybrids
between haploid of potato and Solanum commersonii.
Am J Potato Res 82:129–137
Klein RE, Livingstone CH (1982) Eradication of potato
virus X from potato by ribavirin treatment of cultures
potato shoot tips. Am Potato J 59:359–365
Kondrak M, Marincs F, Antal F, Juhasz Z, Banfalvi Z
(2012) Effects of yeast trehalose-6-phosphate synthase
1 on gene expression and carbohydrate contents of
potato leaves under drought stress conditions. BMC
Plant Biol 12:74
Kowalski B, Cassells AC (1999) Mutation breeding for
yield and Phytophthora infestans (Mont.) De Bary
foliar resistance in potato (Solanum tuberosum L. cv.
Golden Wonder) using computerized image analysis
in selection. Potato Res 42:121–130
Krishna H, Alizadeh M, Singh D, Singh U, Chauhan N,
Eftekhari M, Sadh RK (2016) Somaclonal variation
and their applications in horticultural crops improve-
ment. 3. Biotech 6:54
Kumar A (1994) Somaclonal variation. In: Bradshaw JE,
Mackay GR (eds) Potato genetics. CAB International,
Wallingford, UK, pp 197–213
Kumar A, Cocking EC (1987) Protoplast fusion, a novel
approach to organelle genetics in higher plants. Am J
Bot 74:1289–1303
Kumar D, Wareing PF (1972) Factors controlling stolon
development in the potato plant. New Phytol 71:639–
648
Kumar A (1995) Agrobacterium-mediated transformation
of potato genotypes. In: Gartland KMA, Davey MR
(eds) Methods in molecular biology, vol 44. Humana
Press Inc, New York, Totowa, pp 121–128
Kushnarenko S, Romadanova N, Bekebayeva MO,
Reed BM (2015) Combined ribavirin treatment and
cryotherapy for efficient potato virus M and potato
virus S eradication in potato in vitro plantlets.
Cryobiology 71(3):569–570
Kwiatkowski S, Martin MW, Brown CR, Sluis CJ (1988)
Serial microtuber formation as a long-term conserva-
tion method for in vitro potato germplasm. Am
Potato J 65:369–375
Lakshmanan PS, Eeckhaut T, Deryckere D, Van Bock-
staele E, Van Huylenbroeck J (2013) Asymmetric
somatic plant hybridization: status and applications.
Am J Plant Sci 4:1–10
Lam S-L (1975) Shoot formation in potato tuber discs in
tissue culture. Am Pot J 52:103–106
Lam S-L (1977) Regeneration of plantlets from single
cells in potatoes. Am Pot J 54:575–580
260
Larkin PJ, Scowcroft WR (1981) Somaclonal variation—
a novel source of variability from cell cultures for
plant improvement. Theor Appl Genet 60:197–214
Larkin PJ, Scowcroft WR (1983) Somaclonal variation
and crop improvement. In: Kosuge T et al
(eds) Genetic Engineering of plants: an agricultural
perspective. Plenum, New York, pp 298–314
Law RD, Suttle JC (2005) Chromatin remodeling in plant
cell culture: patterns of DNA methylation and histone
H3 and H4 acetylation vary during growth asyn-
chronous potato cell suspensions. Plant Physiol
Biochem 43:527–534
Lê CL (1999) In vitro microtuberization: an evaluation of
culture conditions for the production of virus-free seed
potatoes. Potato Res 42:489–498
Leclerc Y, Donelly DJ, Coleman WK, King RR (1995)
Microtuber dormancy in three potato cultivars. Am J
Potato Res 72:215–223
Lee HE, Shin D, Park SR et al (2007) Ethylene responsive
element binding protein 1 (StEREBP1) from Solanum
tuberosum increases tolerance to abiotic stress in
transgenic potato plants. Biochem Biophys Res Com-
mun 353(4):863–868
Lightbourn GJ, Veilleux RE (2007) Production and
evaluation of somatic hybrids derived from monoploid
potato. Amer J of Potato Res 84:425–435
Lentini Z, Earle ED (1991) In vitro tuberization of potato
clones from different maturity groups. Plant Cell Rep
9:691–695
Leon P, Arroyo A, Mackenzie S (1998) Nuclear control of
plastid and mitochondrial development in higher
plants. Ann Rev Plant Physiol 49:453–480
Li JW, Chen HY, Li XY et al (2016) Cryopreservation
and evaluations of vegetative growth, microtuber
production and genetic stability in regenerants of
purple-fleshed potato. Plant Cell Tiss Organ Cult 128
(3):641–653
Li JF, Norville JE, Aach J et al (2013) Multiplex and
homologous recombination mediated genome editing
in Arabidopsis and Nicotiana benthamiana using
guide RNA and Cas9. Nat Biotechnol 31:688–691
Li X-Q (2016) Natural attributes and agricultural impli-
cations of somatic genome variation. Curr Issues Mol
Biol 20:29–46
Lindhout P, Meijer D, Schotte D et al (2011) Towards F1
hybrid seeds potato breeding. Potato Res 54:301–312
Listanto E, Riyanti EI, Santoso TJ, Hadiarto T, Ambar-
wati AD (2015) Genetic stability analysis of RB gene
in genetically modified potato lines tolerant to
Phytophthora infestans. Indonesian J Agric Sci 16
(2):51–58
Liu J, Xu X, Deng X (2005) Intergeneric somatic
hybridization and its application to crop genetic
improvement. Plant Cell Tiss Organ Cult 82:19–44
Lizarraga R, Human Z, Dodds JH (1989) In vitro
conservation of potato germplasm at the International
Potato Center. Am Potato J 66:253–269
Lo FM, Irvine BR, Barker WG (1972) In vitro tuberiza-
tion of the common potato (Solanum tuberosum) is not
R. Thieme and E. Rakosy-Tican
a response to the osmotic concentration of the
medium. Can J Bot 50:603–605
Lokossou AA, Park T-H, van Arkel G et al (2009)
Exploiting knowledge of R/Avr genes to rapidly clone
a new LZ-NBS-LRR family of late blight resistance
genes from potato linkage group IV. Mol
Plan-Microbe Interact 22(6):630–641
Lommen WJM (2007) The canon of potato science: 27.
Hydroponics. Potato Res 50:315–318
Lommen WJM (2015) How age of transplants from
in vitro derived potato plantlets affects crop growth
and seed tuber yield after field transplanting. Potato
Res 58:343–360
López-Delgado HA, Jimenez-Casas M, Scott IM (1998)
Storager of potato microplants in vitro in the presence
of acetylsalicylic acid. Plant Cell Tiss Organ Cult
54:145–152
López-Delgado HA, Sánchez-Rojo S, Mora-Herrera ME,
Martínez-Gutierrez R (2012) Micro-tuberization as a
long term effect of hydrogen peroxide on potato
plants. Am J Potato Res 89:240–244
Lorenc-Kukuła K, Jafra S, Oszmiański J, Szopa J (2005)
Ectopic expression of anthocyanin
5-O-glucosyltransferase in potato tuber causes
increased resistance to bacteria. J Agric Food Chem
53(2):272–281
Lössl A, Frei U, Wenzel G (1994) Interaction between
cytoplasmic composition and yield parameters in
somatic hybrids of S. tuberosum L. Theor Appl Genet
89:873–878
Lössl A, Adler N, Horn R, Frei U, Wenzel G (1999)
Chondriome-type characterization of potato: mt a, b,
d, r, e and novel plastid-mitochondrial configurations
in somatic hybrids. Theor Appl Genet 98:1–10
Lou Q, Iovene M, Spooner DM, Buell CR, Jiang J (2010)
Evolution of chromosome 6 of Solanum species
revealed by comparative fluorescence in situ
hybridization mapping. Chromosoma 119:435–442
Lough RC, Varrieur JM, Veilleux RE (2001) Selection
inherent in monoploid derivation mechanisms for
potato. Theor Appl Genet 103:178–184
Lozoya-Saldana H, Belmar-Diaz C, Bradeen JM,
Helgeson JP (2005) Characterization of Phytophthora
infestans isolates infecting transgenic and somatic
hybrid potatoes resistant to the pathogen in the Toluca
Valley. Mexico. Am J Potato Res 82:79
Łukaszewicz M, Matysiak-Kata I, Aksamit A, Osz-
miański J, Szopa J (2002) Protein regulation of the
antioxidant capacity of transgenic potato tubers. Plant
Sci 163(1):125–130
Łukaszewicz M, Matysiak-Kata I, Skała J et al (2004)
Antioxidant capacity manipulation in transgenic
potato tuber by changes in phenolic compounds
content. J Agric Food Chem 52:1526–1533
Luthra SK, Tiwari JK, Lal M, Chandel P, Kumar V
(2016) Breeding potential of potato somatic hybrids:
Evaluations for adaptability, tuber traits, late blight
resistance, keeping quality and backcross (BC1)
progenies. Potato Res 59:375–391
13 Somatic Cell Genetics and Its Application in Potato Breeding
Luz TCLA, Cardoso LD, Alves RBN, Matsumoto K
(2016) Effect of LED lighting on in vitro growth and
long term survivial of shoot cultures of potato and
Brazilian ginseng. Acta Hortic 1113:211–218
Mateus-Rodriguez JR, de Haan S, Andrade-Piedra JL et al
(2013) Technical and economic analysis of aeroponics
and other systems for potato mini-tuber production in
Latin America. Am J Potato Res 90:357–368
Mattheij WM, Eijlander R, De Koning JRA, Louwes KW
(1992) Interspecific hybridisation between the culti-
vated potato Solanum tuberosum subspecies tubero-
sum L. and the wild species S. ciraeifolium subsp
ciraeifolium Bitter exhibiting resistance to Phytoph-
thora infestans (Mont.) de Bary and Globodera
pallida (Stone) Behrens. I. Somatic hybrids. Theor
Appl Genet 83:459–466
Mbiyu MW, Muthoni J, Kabira J et al (2012) Use of
aeroponics technique for potato (Solanum tuberosum)
minitubers production in Kenya. J Hort For 4
(11):172–177
McCue KF, Shepherd LVT, Allen PV et al (2005)
Metabolic compensation of steroidal glycoalkaloid
biosynthesis in transgenic potato tubers: using reverse
genetics to confirm the in vivo enzyme function of a
steroidal alkaloid galactosyltransferase. Plant Sci
168:267–273
McPherson AE, Jane J (1999) Comparison of waxy potato
with other root and tuber starches. Carbohydr Polym
40(1):57–70
Meiyalaghan S, Barrell P, Jacobs JME, Conner AJ (2011)
Regeneration of multiple shoots from transgenic
potato events facilitates the recovery of phenotypically
normal lines: assessing a cry9Aa2 gene conferring
insect resistance. BMC Biotechnol 11(93):1–10
Melchers G, Mohri Y, Watanabe K, Wakabayashi S,
Harada K (1992) One-step generation of cytoplasmic
male sterility by fusion of mitochondria-inactivated
tomato protoplasts with nuclear-inactivated Solanum
protoplasts. Proc Natl Acad Sci USA 89:6832–6836
Melchers G, Sacristán MD, Holder AA (1978) Somatic
hybrid plants of potato and tomato regenerated from
fused protoplasts. Carlsberg Res Commun 43:203–
218
Miao J, Guo D, Zhang J et al (2013) Targeted mutage-
nesis in rice using CRISPR-Cas system. Cell Res
23:1233–1236
Miguel C, Marum L (2011) An epigenetic view of plant
cells cultured in vitro: somaclonal variation and
beyond. J Exp Bot 62(11):3713–3725
Milinkovic M, Horstra CB, Rondoni BC, Nicolas ME
(2012) Effects of age and pretreatment of
tissue-cultured potato plant on subsequent minituber
production. Potato Res 55:15–25
Millam S (2007) Developments in transgenic biology and
the genetic engineering of useful traits. In: Vreugden-
hil D (ed) Potato biology and biotechnology: advances
and perspectives. Elsevier BV, Amsterdam, pp 669–
686
Miller PR, Amirouche L, Stuchbury T, Matthews S
(1985) The use of plant growth regulators in
261
micropropagation of slow-growing potato cultivars.
Potato Res 28:479–486
Missiou A, Kalantidis K, Boutla A et al (2004) Gener-
ation of transgenic potato plants highly resistant to
potato virus Y (PVY) through RNA silencing. Mol
Breed 14:185–197
Mix G, Sixin S (1983) Regenration von in vitro-Pflanzen
aus Kartoffelknollengewebe. Landbauforschung
Völkenrode 33:264–266
Miyao A, Nakagome M, Ohnuma T et al (2012)
Molecular spectrum of somaclonal variation in regen-
erated rice revealed by whole-genome sequencing.
Plant Cell Physiol 53:256–264
Molnár I (2017) The complex analysis of the resistance
traits and genomic composition in the somatic hybrids
between Solanum tuberosum and Solanum chacoense,
with or without deficiency in DNA mismatch repair
system. Ph.D. thesis Babeş-Bolyai University
Cluj-Napoca, Romania
Molnár I, Besenyei E, Thieme R et al (2016) Mismatch
repair deficiency increases the transfer of antibiosis
and antixenosis properties against Colorado potato
beetle in somatic hybrids of Solanum tuberosum + S.
chacoense. Pest Manag Sci doi:10.1002/ps.4473
Movahedi S, Tabatabaei BES, Alizade H et al (2012)
Constitutive expression of Arabidopsis DREB1B in
transgenic potato enhances drought and freezing
tolerance. Biol Plant 56:37–42
Mullins E, Milbourne D, Petti C, Doyle-Prestwich BM,
Meade C (2006) Potato in the age of biotechnology.
Trends Plant Sci 11(5):254–260
Munir F, Naqvi SMS, Mahmood T (2011) In vitro
culturing and assessment of somaclonal variation of
Solanum tuberosum var. Desiree. Turk J Biochem 36
(4):296–302
Murashige T, Skoog F (1962) A revised medium for rapid
growth and bioassays with tobacco tissue cultures.
Physiol Plant 15:473–497
Muro J, Diaz V, Goni JL, Lamsfus C (1997) Comparison
of hydroponic culture and culture in a peat/sand
mixture and the influence of nutrient solution and
plant density on seed potato yields. Potato Res
40:431–438
Muth J, Hartje S, Twymann RM et al (2008) Precision
breeding for novel starch variants in potato. Pant
Biotechnol J 6:576–584
Muthoni J, Kabira J, Shimelis H, Melis R (2015)
Tetrasomic inheritance in cultivated potato and impli-
cations in conventional breeding. Aust J Crop Sci 9
(3):185–190
Naess S, Bradeen J, Wielgus S et al (2001) Analysis of the
introgression of Solanum bulbocastanum DNA into
potato breeding lines. Mol Genet Genom 265:694–704
Naimov S, Dukiandjiev S, de Maagd RA (2003) A hybrid
Bacillus thuringiensis deltaendotoxin gives resistance
against a coleopteran and a lepidopteran pest in
transgenic potato. Plant Biotechnol J 1:51–57
Nassar AM, Abdulnour J, Leclerc YN, Li XQ, Don-
nelly DJ (2011) Intraclonal selection for improved
262
processing of NB ‘Russet Burbank’ potato. Am J
Potato Res 88:387–397
Nassar AM, Kubow S, Leclerc YN, Donnelly DJ (2014)
Somatic mining for phytonutrient improvement of
‘Russet Burbank’ potato. Am J Potato Res 91:89–100
Nassar AMK, Kubow S, Donnelly DJ (2015) Somatic
embryogenesis for potato (Solanum tuberosum L.)
improvement. In: Li X-Q et al (eds) Somatic genome
manipulation. Springer, Berlin, pp 169–196
Navrátil O, Fischer L, Čmejlová V, Linhart M, Vacek J
(2007) Decreased amount of reducing sugars in
transgenic potato tubers and its influence on yield
characteristics. Biol Plant 51(1):56–60
Nekrasov V, Staskawicz B, Weigel D, Jones JD,
Kamoun S (2013) Targeted mutagenesis in the model
plant Nicotiana benthamiana using Cas9 RNA-guided
endonuclease. Nat Biotechnol 31:691–693
Nielsen SL, Bång H, Kotkas K et al (2007) Variation of
growth and disease characters between clones of
potato (Solanum tuberosum L.). Potato Res 50:97–114
Nouri-Ellouz O, Gargouri-Bouzid R, Sihachakr D et al
(2006) Production of potato intraspecific somatic
hybrids with improved tolerance to PVY and Pythium
aphanidermatum. J Plant Physiol 163(12):1321–1332
Novy RG, Alvarez JM, Corsini DL et al (2004) Resis-
tance to PVY, PLRV, PVX, green peach aphid,
Colorado potato beetle, and wireworm in the progeny
of a tri-species somatic hybrid. Am J Potato Res 81
(1):77–78
Novy RG, Alvarez JM, Sterret SB, Kuhar TP, Horton DR
(2006) Progeny of a tri-species potato somatic hybrid
express resistance to wireworm in eastern and western
potato production regions of the US. Am J Potato Res
83(1):126
Novy RG, Gillen AM, Whitworth JL (2007) Character-
ization of the expression and inheritance of potato
leafroll virus (PLRV) and potato virus Y (PVY) resis-
tance in three generations of germplasm derived from
Solanum etuberosum. Theor App Genet 114:1161–
1172
Nyende AB, Schittenhelm S, Mix-Wagner G, Greef J-M
(2003) Production storability, and regeneration of
shoot tips of potato (Solanum tuberosum L.) encap-
sulated in calcium alginate hollow beads. In Vitro Cell
Dev Biol Plant 39:540–544
Oberwalder B, Schilde-Rentschler L, Ruo B, Witte-
mann S, Ninnemann H (1998) Asymmetric protoplast
fusion between wild species and breeding lines of
potato—effect of recipients and genome stability.
Theor Appl Genet 97:1347–1354
Ochatt SJ, Marconi PL, Radice S, Arnozis PA, Caso OH
(1998) In vitro recurrent selection of potato: produc-
tion and characterization of salt tolerant cell lines and
plants. Plant Cell Tiss Organ Cult 55:1–8
Ohya K, Itchoda N, Ohashi K et al (2002) Expression of
biologically-active human tumor necrosis factor-alpha
in transgenic potato plant. J Interferon Cytokine Res
22:371–378
Okazawa Y, Katsura N, Tagawa T (1967) Effects of auxin
and kinetin on the development and differentiation of
R. Thieme and E. Rakosy-Tican
potato tissue cultured in vitro. Physiol Plant 20:862–
869
Oosumi T, Rockhold D, Maccree M et al (2009) Gene
Rpi-bt1 from Solanum bulbocastanum confers resis-
tance to late blight in transgenic potatoes. Am J Potato
Res 86:456–465
Opatrny Z, Schumann U, Takousky S, Koblitz H (1980)
The role of some exogenous and endogenous factors
in the isolation of protoplasts from potato cell culture
and their recovery in cell colonies. Biol Plant 22:107–
116
Orbegozo J, Roman ML, Rivera C et al (2016) Rpi-blb2
gene from Solanum bulbocastanum confers extreme
resistance to late blight disease in potato. Plant Cell
Tiss Organ Cult 125(2):169–281
Orczyk W, Przetakiewicz J, Nadolska-Orczyk A (2003)
Somatic hybrids of Solanum tuberosum— application
to genetics and breeding. Plant Cell Tiss Organ Cult
74:1–13
Osusky M, Osuska L, Kay W, Misra S (2005) Genetic
modification of potato against microbial diseases:
in vitro and in planta activity of a dermaseptin B1
derivative, MsrA2. Theor Appl Genet 111:711–722
Otroshi M, Nazarian F, Struik PC (2009) Effects of
temperature fluctuation during in vitro phase on
in vitro microtuber production in different cultivars
of potato (Solanum tuberosum L.). Plant Cell Tiss
Organ Cult 98:213–218
Outchkourov NS, de Kogel WJ, Schuurman-de Bruin A,
Abrahamson M, Jongsma MA (2004) Specific cys-
teine protease inhibitors act as deterrents of western
flower thrips, Frankliniella occidentalis (Pergande), in
transgenic potato. Plant Biotech J 2:439–448
Pal AK, Acharya K, Vats SK, Kumar S, Ahuja PS (2013)
Over-expression of PaSOD in transgenic potato
enhances photosynthetic performance under drought.
Biol Plant 57(2):359–364
Panta A, Panis B, Ynouye C et al (2006) Improvement of
potato cryopreservation for the long-term conservation
of Andean landraces at the International Potato Center
(CIP). Cryobiology 53:401
Panta A, Panis B, Ynouye C et al (2015) Improved
cryopreservation method for long-term conservation
of the world potato germplasm collection. Plant Cell
Tiss Organ Cult 120:117–125
Park YD, Ronis DH, Boe AA, Cheng ZM (1995) Plant
regeneration from leaf tissues of four North Dakota
genotypes of potato (Solanum tuberosum L.). Am
Potato J 72:329–338
Pavek JJ, Corsini DL (1982) Field performance of clones
from regenerated protoplasts of Russet Burbank. Am
Pot J 59:482
Paz M, Veilleux R (1999) Influence of culture medium
and in vitro conditions on shoot regeneration in
Solanum phureja monoploids and fertility of regener-
ation. Plant Breed 118:53–57
Pehu E, Gibson RW, Jones MGK, Karp A (1990) Studies
on the genetic basis of resistance to potato leaf roll
virus Y and potato virus X in Solanum brevidens using
13 Somatic Cell Genetics and Its Application in Potato Breeding
somatic hybrids of Solanum brevidens and Solanum
tuberosum. Plant Sci 69:95–101
Pelacho AM, Mingo-Castel AM (1991) Jasmonic acid
induced tuberization of potato stolons cultured
in vitro. Plant Physiol 97:1253–1255
Perl A, Aviv D, Galun E (1990) Protoplast-fusion derived
Solanum cybrids: application and phylogenetic limi-
tations. Theor Appl Genet 79:632–640
Pett B, Thieme R (1982) Untersuchungen zur Depothal-
tung eines Kartoffelsortimentes in vitro. Potato Res
24:105–110
Piao XC, Chakrabarty D, Hahn EJ, Paek KY (2002) A
simple method for mass propagation of potato micro-
tubers using a bioreactor system. Curr Sci 84:1129–
1132
Plaisted RL, Thurston HD, Brodie BB, Hoopes RW
(1984) Selecting for resistance to diseases in early
generations. Am Pot J 61:395–399
Polzerova P, Patzak J, Greplova M (2011) Early charac-
terization of somatic hybrids from symmetric proto-
plast electrofusion of Solanum pinnatisectum Dun.
and Solanum tuberosum L. Plant Cell Tiss Organ Cult
04:163–170
Potter R, Jones MGK (1991) An assessment of genetic
stability of potato in vitro by molecular and pheno-
typic analysis. Plant Sci 76:239–248
Power JB, Davey MR, Sadia B, Anthony P, Lowe KC
(2003) Haemoglobin-enhanced mitosis in cultured
plant protoplasts. Adv Exp Med Biol 540:201–206
Pret’ová A, Dedicova B (1992) Somatic embryogenesis in
Solanum tuberosum L. cv. Désirée from unripe
zygotic embryos. Plant Physiol 139:539–542
Pret’ová A, Dedicova Z (2006) Haploid formation in
maiz, barley, flax, and potato. Protoplasma 228:107–
114
Przetakiewicz J, Nadolska-Orczyk A, Kuć D, Orczyk W
(2007) Tetraploid somatic hybrids of potato (Solanum
tuberosum L.) obtained from diploid breeding lines.
Cell Mol Biol Lett 12(2):253–267
Prossy N, Peter N, Benon M, Alex B (2014) In vitro
agronomic performance and mini-tuber production of
potato varieties. J Agr Sci Tech 1(1):65–71
Pruski K, Astatkie T, Duplesis P, Nowak J, Struik PC
(2003) Manipulation of microtubers for direct field
utilization in seed production. Am J Potato Res
80:173–181
Queiros F, Fidalgo F, Santos I, Salema R (2007) In vitro
selection of salt tolerant cell lines in Solanum
tuberosum L. Biol Plant 57:728–734
Rakosy-Tican E (2012) Combining different biotechno-
logical tools for better introgression of resistance
genes into crops: the case of potato. J Biotech 161
(suppl.):18 (abstr)
Rakosy-Tican E (2013) Genetic engineering in potato
improvement. In: Barth D (ed) OMICS applications in
crop science. CRC Press, Taylor & Francisco, Boca
Raton, pp 139–161
Rakosy-Tican E, Aurori A (2015) Green fluorescent
protein (GFP) supports the selection based on callus
vigorous growth in the somatic hybrids Solanum
263
tuberosum L. + S. chacoense Bitt. Acta Physiol Plant
37:201–205
Rakosy-Tican L, Lucaciu CM, Turcu I et al (1988)
Viability of wheat mesophyll protoplasts and homo-
karyons in response to electrofusion parameters. Rev
Roum Biol, Ser Biol Veget 33:121–126
Rakosy-Tican L, Turcu I, Lucaciu MC (1998) Quantita-
tive evaluation of yield and lysis in electrofusion of
oat and wheat mesophyll protoplasts. Rom Agri Res
9–10:27–33
Rakosy-Tican L, Hornok M, Menczel L (2001) An
improved procedure for protoplast microelectrofusion
and culture of Nicotiana tabacum intraspecific somatic
hybrids: plant regeneration and initial proofs on
organelle segregation. Plant Cell Tiss Organ Cult
67:153–158
Rakosy-Tican L, Aurori A, Aurori CM, Ispas G, Fame-
laer I (2004) Transformation of wild Solanum species
resistant to late blight by using reporter gene gfp and
msh2 genes. Plant Breed Seed Sci (Warszawa)
50:119–128
Rakosy-Tican L, Aurori CM, Dijkstra C et al (2007) The
usefulness of reporter gene gfp for monitoring
Agrobacterium-mediated transformation of potato
dihaploid and tetraploid genotypes. Plant Cell Rep
26:661–671
Rakosy-Tican E, Aurori A, Dijkstra C, Maior MC (2010)
Generating marker free transgenic potato cultivars
with an hairpin construct of PVY coat protein. Rom
Biotech Lett 15 (1 Suppl):63–71 http://www.rombio.
eu/rbl1vol15Supplement/cuprinsSupplement1.htm
Rakosy-Tican E, Aurori CM, Aurori A (2011) The effects
of cefotaxime and silver thiosulphate on in vitro
culture of Solanum chacoense. Rom Biotech Lett 16
(4):6369–6377. http://www.rombio.eu/rbl4vol16/11%
20Elena%20Rakosy.pdf
Rakosy-Tican E, Thieme R, Aurori A et al (2016) The
application of combinatorial biotechnology in improv-
ing potato resistance to biotic and abiotic stress. Studia
Universitatis Babeş-Bolyai Biologia 59(1):79–88
Rakosy-Tican E, Thieme R, Nachtigall M, Molnar I,
Denes T-E (2015) The recipient potato cultivar
influences the genetic makeup of the somatic hybrids
between five potato cultivars and one cloned accession
of sexually incompatible species Solanum bulbocas-
tanum Dun. Plant Cell Tiss Organ Cult 122:395–407
Ramon M, Hanneman RE (2002) Introgression of resis-
tance to late blight (Phytophthora infestans) from
Solanum pinnatisectum into S. tuberosum using
embryo rescue and double pollination. Euphytica
127:421–435
Ramulu KS, Dijkhuis P, Famelaer I, Cardi T, Verho-
even HA (1994) Cremart: a new chemical for efficient
induction of micronuclei in cells and protoplasts for
partial genome transfer. Plant Cell Rep 13:687–691
Ranalli P, Bassi F, Ruaro G, del Re P, Di Candilo M,
Mandolino G (1994) Microtuber and minituber pro-
duction and field performance compared with normal
tubers. Potato Res 37:383–391
264
Rashid AHA, Lateef DD (2016) Novel techniques for
gene delivery into plants and its applications for
disease resistance in crops. Am J Plant Sci (AJPS)
7:181–193
Ravnikar M, Gogala N (1989) The influence of jasmonic
acid on the development of virus-free potato plants
in vitro. Bioloski Vestnik 37:79–88
Rieseberg LH, Wendel JF (1993) Introgression and its
consequences in plants. In: Harrison RG (ed) Hybrid
zones and evolutionary process. New-York Oxford,
pp 70–109
Rietveld RC, Bressan RA, Hasegawa PM (1993)
Somaclonal variation in tuber disc-derived populations
of potato. II. Differential effect of genotypes. Theor
Appl Genet 87:305–313
Rietveld RC, Hasegawa PM, Bressan RA (1991)
Somaclonal variation in tuber disc-derived populations
of potato. I. Evidence of genetic stability across tuber
generations and divers locations. Theor Appl Genet
82:430–440
Ritter E, Angulo B, Riga P et al (2001) Comparison of
hydroponic and aeroponic cultivation systems for the
production of potato minitubers. Potato Res 44:127–
135
Roca WM, Bryan JE, Roca MR (1979) Tissue culture for
the international transfer of potato genetic resources.
Am Potato Journal 56:1–10
Roca WM, Espinoza NO, Roca MR, Bryan JE (1978) A
tissue culture method for the rapid propagation of
potatoes. Am Potato Journal 55:69–701
Rodríguez NV, Kowalski B, Rodríguez LG et al (2007) In
vitro and ex vitro selection of potato plantlets for
resistance to early blight. J Phytopathol 155:582–586
Roest S, Bokelmann GS (1976) Vegetative propagation of
Solanum tuberosum L. in vitro. Potato Res 19:173–
178
Rokka V-M (2009) Potato Haploids and Breeding. In:
Touraev A, Forster BP, Jain SM (eds) Advances in
haploid production in higher plants. Springer, The
Netherlands, pp 199–208
Rokka V-M (2015) Protoplast technology in genome
manipulation of potato through somatic cell fusion. In:
Li X-Q, Donnelly D, Jensen TJ (eds) Somatic genome
manipulation—advances, methods and applications.
Springer, New-York, pp 217–235
Rokka V-M, Clark MS, Knudson DL, Pehu E, Lapi-
tan NLV (1998) Cytological and molecular character-
ization of repetitive DNA sequences of Solanum
brevidens and Solanum tuberosum. Genome 41
(4):487–494
Rokka VM, Laurila J, Tauriainen A et al (2005)
Glycoalkaloid aglycone accumulations associated with
infection by Clavibacter michiganensis ssp. sepe-
donicus in potato species Solanum acaule and
Solanum tuberosum and their interspecific somatic
hybrids. Plant Cell Rep 23(10–11):683–691
Rommens CM, Yan H, Swords K, Richael C, Ye J (2008)
Low-acrylamide French fries and potato chips. Plant
Biotech J 6:843–853
R. Thieme and E. Rakosy-Tican
Rosenberg V, Tsahkna A, Kotkas K et al. (2010) Soma-
clonal variation in potato meristem culture and
possibility to use this phenomenon in seed potato
production and breeding. Agron Res 8 (Special
issue):697–704
Ross H (1986) Potato breeding-problems and perspec-
tives. Springer, Berlin
Sakai A, Engelmann F (2007) Vitrification,
encapsulation-vitrification and droplet-vitrification: a
review. Cryo-Letters 28:151–172
Sander JD, Joung JK (2014) CRISPR-Cas systems for
editing, regulating and targeting genomes. Nat
Biotechnol 32(4):347–355
Sanetomo V, Gebhardt C (2015) Cytoplasmic genome
types of European potatoes and their effects on
complex agronomic traits. BMC Plant Biol 15:162.
doi 10.1186/s12870-015-0545-y
Sarkar D, Chandra R, Naik PS (1994) Effect of inocula-
tion density on potato micropropagation. Plat Cell Tiss
Organ Cult 48:63–66
Sarkar D, Tiwari JK, Sharma S et al (2011) Production
and characterization of somatic hybrids between
Solanum tuberosum L. and S. pinnatisectum Dun.
Plant Cell Tiss Organ Cult 107:427–440
Schunmann PHD, Coia G, Waterhouse PM (2002)
Biopharming the SimpliREDTM HIV diagnostic
reagent in barley, potato and tobacco. Mol Breed
9:113–121
Schwarzacher T, Leitch AR, Bennett MD et al (1989) In
situ localization of parental genomes in a wide hybrid.
Ann Bot 64:315–324
Scientific opinion addressing the safety assessment of
plants developed through cisgenesis and intragenesis
(2012) EFSA Journal 10:2561. doi:10.2903/j.efsa.
2012.2561
Scotti N, Cozzolino S, Cardi T (2007) Mitochondrial DNA
variation in cultivated and wild potato species
(Solanum spp.). Genome 50(8):706–713
Seabrook JE (2005) Light effects on the growth and
morphogenesis of potato (Solanum tuberosum)
in vitro: a review. Am J Potato Res 82:353–367
Seabrook JEA, Douglas LK (2001) Somatic embryoge-
nesis on various potato tissues from a range of
genotypes and ploidy levels. Plant Cell Rep 20:175–
182
Sebastiani L, Lenzi A, Pugliesi C, Fambrini M (1994)
Somaclonal variation for resistance to Verticillium
dahlia in potato (Solanum tuberosum L.) plants
regenerated from callus. Euphytica 80:5–11
Secor GA, Shepard JF (1981) Variability of
protoplast-derived potato clones. Crop Sci 21:102–
105
Senda M, Takeda J, Abe S, Nakamura T (1979) Induction
of cell fusion of plant protoplasts by electrical
stimulation. Plant Cell Physiol 20:1441–1443
Shan Q, Wang Y, Li J et al (2013) Targeted genome
modification of crop plants using a CRISPR-Cas
system. Nat Biotechnol 31:686–688
Sharma S, Sarkar D, Pandey SK, Chandel P, Tiwari JK
(2011) Stoloniferous shoot protoplast, an efficient cell
13 Somatic Cell Genetics and Its Application in Potato Breeding
system in potato for somatic cell genetic manipula-
tions. Sci Hort 128:84–91
Sharma SK, Bryan GJ, Millam S (2007a) Auxin pulse
treatment hold the potential to enhance efficiency and
practicability of somatic embryogenesis in potato.
Plant Cell Rep 26:945–950
Sharma SK, Bryan GJ, Winfield MO, Millam S (2007b)
Stability of potato (Solanum tuberosum L.) plants
regenerated via somatic embryos, axillary bud prolif-
erated shoots, microtubers and true potato seeds: a
comparative phenotypic, cytogenetic and molecular
assessment. Planta 226:1449–1458
Sharma SK, Millam S (2004) Somatic embryogenesis in
Solanum tuberosum L. a histological examination of
key developmental stages. Plant Cell Rep 23:115–119
Sheahan MB, McCurdy DW, Rose RJ (2005) Mitochon-
dria as a connected population: ensuring continuity of
the mitochondrial genome during plant cell dediffer-
entiation through massive mitochondrial fusion.
Plant J 44(5):744–755
Sheerman S, Bevan MW (1988) A rapid transformation
method for Solanum tuberosum using binary Agrobac-
terium tumefaciens vectors. Plant Cell Rep 7:13–16
Shepard JK (1980) Abscisic acid-enhanced shoot initia-
tion in protoplast-derived calli of potato. Plant Sci Lett
18:327–333
Shepard JF, Totten RE (1977) Mesophyll cell protoplasts
of potato. Isolation, proliferation and plant regenera-
tion. Plant Physiol 60:313–316
Shepard JF, Bidney D, Shadin E (1980) Potato protoplast
in crop improvement. Science NY 208:17–24
Shi YZ, Chen Q, Li HY, Beasley D, Lynch DR (2006)
Somatic hybridization between Solanum tuberosum
and S. cardiophyllum. Can J Plant Sci 86:539–545
Sievers N, Muders K, Henneberg M et al (2013)
Establishing glucosylglycerol synthesis in potato
(Solanum tuberosum L. cv. Albatros) by expression
of the ggpPS gene from Azotobacter vinelandii.
J Plant Sci Mol Breed 2:1
Singsit C, Hanneman RE (1991) Rescuing abortive
inter-EBN potato hybrids through double pollination
and embryo culture. Plant Cell Rep 9:475–478
Siobhan M, Cassells AC (2002) Variation in potato
microplant morphology in vitro and DNA methyla-
tion. Plant Cell Tiss Organ Cult 70:125–137
Šip V (1972) Eradication of potato virus A and S by
thermotherapy and sprout tip culture. Potato Res
15:270–273
Skirvin RM, Lam SL, Janick J (1975) Plantlet formation
from potato callus in vitro. Hort Science 10:413
Smyda P, Jakuczun H, Dębski K et al (2013) Develop-
ment of somatic hybrids Solanum  michoacanum
Bitter. (Rydb.) (+) S. tuberosum L. and autofused
4  S. michoacanum plants as potential sources of
late blight resistance for potato breeding. Plant Cell
Rep 32:1231–1241
Smyda-Dajmund P, Sliwka J, Wasilewicz-Flis I,
Jakuczun H, Zimnoch-Guzowska E (2016) Genetic
composition of interspecific potato somatic hybrids
and autofused 4x plants evaluated by DArT and
265
cytoplasmic DNA markers. Plant Cell Rep 35:1345–
1358
Solomon-Blackburn RM, Barker H (2001) Breeding virus
resistant potatoes (Solanum tuberosum): a review of
traditional and molecular approaches. Heredity 86:17–
35
Song J, Bradeen JM, Naess SK et al (2003) Gene RB
cloned from Solanum bulbocastanum confers broad
spectrum resistance to potato late blight. Proc Natl
Acad Sci USA 100:9128–9133
Sree Ramulu K, Dijkhus P, Roest S, Bokelmann GS,
DeGroot B (1986) Variation in phenotype and chro-
mosome number of plants regenerated from protoplast
of dihaploid and tetraploid potato. Plant Breed
97:119–128
Stace Smith R, Mellor FC (1968) Eradication of potato
virus X and S by thermotherapy and axillary bud
culture. Phytopathology 58:199–203
Stallknecht GF (1972) Coumarin-induced tuber formation
on excised shoots of Solanum tuberosum L. cultures
in vitro. Plant Physiol 50:412–413
Stewart FC, Caplin SM (1951) A tissue culture from
potato tuber: The synergistic action of 2,4-D and of
coconut milk. Science 111:518–520
Stiekema WJ, Heidekamp F, Louwerse JD, Verho-
even HA, Dijkhuis P (1988) Introduction of foreign
genes into potato cultivars Bintje and Desiree using an
Agrobacterium tumefaciens binary vector. Plant Cell
Rep 7:47–50
Stiller I, Dancs G, Hesse H, Hoefgen R, Banfalvi ZS
(2007) Improving the nutritive value of tubers:
Elevation of cysteine and glutathione contents in the
potato cultivar White Lady by marker-free transfor-
mation. J Biotechnol 128:335–343
Stiller I, Dulai S, Kondrak M et al (2008) Effects of
drought on water content and photosynthetic param-
eters in potato plants expressing the
trehalose-6-phosphate synthase gene of Saccha-
romyces cerevisiae. Planta 227:299–308
Sun A, Dai Y, Zhang X et al (2011) A transgenic study on
affecting potato tuber yield by expressing the rice
sucrose transporter genes OSSUT5Z and OSSUT2M.
J Integr Plant Biol 53(7):586–595
Szczerbakowa A, Maciejewska U, Zimnoch-Guzowska E,
Wielgat B (2003) Somatic hybrids Solanum nigrum
(+) S. tuberosum: morphological assessment and
verification of hybridity. Plant Cell Rep 21:577–584
Szczerbakowa A, Boltowicz D, Lebecka R, Radomski P,
Wielgat B (2005) Characteristics of the interspecific
somatic hybrids Solanum pinnatisectum (+) S. tubero-
sum H-8105. Acta Physiol Plant 3:265–273
Szczerbakowa A, Tarwacka J, Oskiera M, Jakuczun H,
Wielgat B (2010) Somatic hybridization between the
diploids of S. x michoacanum and S. tuberosum. Acta
Physiol Plant 32:867–873
Tabassum B, Nasir IA, Khan A et al (2016) Short hairpin
RNA engineering: In planta gene silencing of potato
virus Y. Crop Protection 86:1–8
Tadesse M, Lommen WJM, Struik PC (2001) Effects of
temperature pre-treatment of transplants from in vitro
266
produced potato plantlets on transplant growth and
yield in the field. Potato Res 44:173–185
Li Tang, Kwon S-K, Kim S-H et al (2006) Enhanced
tolerance of transgenic potato plants expressing both
superoxide dismutase and ascorbate peroxidase in
chloroplasts against oxidative stress and high temper-
ature. Plant Cell Rep 25:1380–1386
Tanurdzic M, Vaughn MW, Jiang H et al (2008)
Epigenomic consequences of immortalized plant cell
suspension culture. PLoS Biol 6(12):2880–2895
Tarwacka J, Polkowska-Kowalczyk L, Kolano B, Śliwka
J, Wielgat B (2013) Interspecific somatic hybrids
Solanum villosum (+) S. tuberosum, resistant to
Phytophthora infestans. J Plant Physiol 170
(17):1541–1548
Taylor RJ, Secor GA, Ruby L, Orr PH (1993) Tuber
yields, soft rot resistance, bruising resistance and
processing quality in a population of potato (cv.
Crystal) somaclones. Am Potato J 70:117–130
Tegg RS, Thangavel T, Aminian H, Wilson CR (2013)
Somaclonal selection in potato for resistance to
common scab provides concurrent resistance to pow-
dery scab. Plant Pathol 62:922–931
Tek AL, Stevenson WR, Helgeson JP, Jiang J (2004)
Transfer of tuber soft rot and early blight resistances
from Solanum brevidens into cultivated potato. Theor
Appl Genet 109:249–254
Terzi M, Sung RZ, Widholm J (1985) Somatic cell
genetics of plants. Critical Rev Biotech 3(4):303–330
Thach NQ, Frei U, Wenzel W (1993) Somatic fusion for
combining virus resistance in Solanum tuberosum L.
Theor Appl Genet 85:863–867
Thanavala Y, Lugade AA (2010) Oral transgenic
plant-based vaccine for hepatitis B. Immunol Res 46
(1–3):4–11
Thieme R (1991) Embryo- und Samenkultur bei der
Kartoffel. Vortr Pflanzenzüchtg 21:125–129
Thieme R (1992) An in vitro potato cultivar collection:
microtuberization and storage of microtubers. Plant
Genet Resour Newsl 88(90):17–19
Thieme R, Darsow U, Gavrilenko T, Dorokhov D,
Tiemann H (1997) Production of somatic hybrids
between S. tuberosum L. and late blight resistant
Mexican wild potato species. Euphytica 97:189–200
Thieme R, Darsow U, Rakosy-Tican L et al (2004) Use of
somatic hybridization to transfer resistance to late
blight and potato virus Y (PVY) into cultivated potato.
Plant Breed Seed Sci 50:113–118
Thieme R, Griess H (1996) Somaclonal variation of
haulm growth, earliness, and yield in potato. Potato
Res 39:355–365
Thieme R, Griess H (2005) Somaclonal variation in tuber
traits of potato. Potato Res 48:153–165
Thieme R, Rakosy-Tican E, Gavrilenko T et al (2008)
Novel somatic hybrids (Solanum tuberosum L. +
Solanum tarnii) and their fertile BC1 progenies
express extreme resistance to potato virus Y and late
blight. Theor Appl Genet 116:691–700
Thieme R, Rakosy-Tican E, Nachtigall M et al (2010)
Characterization of the multiple resistance traits of
R. Thieme and E. Rakosy-Tican
somatic hybrids between Solanum cardiophyllum
Lindl. and two commercial potato cultivars. Plant
Cell Rep 29:1187–1201
Thomas E, Bright SW, Franklin J, Lancaster VA, Miflin
BJ (1982) Variation amongst protoplast-derived potato
plants (Solanum tuberosum cv. Maris Bard). Theor
Appl Genet 62:65–68
Thomson AJ, Gunn RE, Jellis, GJ, Boulton RE,
Lacey CND (1986) The evaluation of potato soma-
clones. In: Sema (ed) Somaclonal variation and crop
improvement. Marinus Nijhoff Publishers, Boston,
pp 236–243
Thomson AJ, Taylor RT, Pasche JS, Novy RG, Gudmes-
tad NC (2007) Resistance to Phytophthora erythrosep-
tica and Pythium ultimum in a potato clone derived
from S. berthaultii and S. etuberosum. Am J Potato
Res 84:149–160
Tiwari JK, Poonam Sarkar D et al (2010) Molecular and
morphological characterization of somatic hybrids
between Solanum tuberosum L. and S. etuberosum
Lindl. Plant Cell Tiss Organ Cult 103:175–187
Tiwari JK, Poonam, Kumar V et al (2013) Evaluation of
potato somatic hybrids of dihaploid S. tuberosum (+)
S. pinnatisectum for late blight resistance. Potato J 40
(2):176–179
Towill LE (1984) Survival at ultra-low temperatures of
shoot tips from Solanum tuberosum groups Andigena,
Phureja, Stenotomum, Tuberosum, and other
tuber-bearing Solanum species. Cryo-Letters 5:319–
326
Trabelsi S, Gargouri-Bouzid R, Vedel F et al (2005)
Somatic hybrids between potato Solanum tuberosum
and wild species Solanum verneï exhibit a recombi-
nation in the plastome. Plant Cell, Tissue Organ Cult
83:1–11
Uhrig H (1985) Genetic selection and liquid medium
conditions improve the yield of androgenetic plants
from diploid potatoes. Theor Appl Genet 71:455–460
Uijtewaal BA, Huigen DJ, Hermsen JGTH (1987)
Production of potato monohaploids (2n = x = 12)
through prickle pollination. Theor Appl Genet
73:753–758
Ukhatova YV, Antonova OY, Gavrilenko TA (2016)
Eradication of potato leafroll virus in Chilean samples
of Solanum tuberosum using cryotherapy and complex
chemo- and thermotherapies. Dostzheniya nauki i
tekhniki APK 30(10):64–68
Valkonen JPT, Xu Y-S, Rokka V-M, Puili S, Pehu E
(1994) Transfer of resistance to potato leaf roll virus,
potato virus Y and potato virus X from Solanum
brevidens to S. tuberosum through symmetric and
designed asymmetric somatic hybridization. Ann Appl
Biol 124:351–362
Vanderhofstadt B (1999) Pilot units of potato seed
production in Mali, using in vitro material:
micro/minitubers. Potato Res 42:593–600
Van der Vossen EAG, Sikkema A, Lintel Hekkert B et al
(2003) An ancient R gene from the wild potato species
Solanum bulbocastanum confers broad-spectrum
13 Somatic Cell Genetics and Its Application in Potato Breeding
resistance to Phytophthora infestans in cultivated
potato and tomato. Plant J 36:867–882
Vargas TE, Garcia ED, Oropeza M (2005) Somatic
embryogenesis in Solanum tuberosum from cell
suspension cultures: histological analysis and extra-
cellular protein patterns. Plant Physiol 162:449–456
Vecchio V, Benedettelli S, Andrenelli L, Palchetti E,
Espen L (2000) Inductive and noninductive conditions
on in vitro tuberisation and microtuber dormancy in
potato (Solanum tuberosum subspecies tuberosum and
subspecies andigena). Potato Res 43:115–123
Veilleux RE, Johnson AT (1998) Somaclonal variation:
molecular analysis, transformation interaction, and
utilization. Plant Breed Rev 16:229–268
Veitia-Rodriguez N, Francisco-Cardoso J, Perez JN et al
(2002) Evaluations in field of somaclones of Irish
potatoes (Solanum tuberosum L.) of the variety
Desiree obtained by somaclonal variation and
in vitro mutagenesis. Biotechnol Veg 2:21–26
Vinterhalter D, Dragićeević I, Vinterhalter B (2008)
Potato in vitro culture techniques and biotechnology.
Fruit, vegetable and cereal science and biotechnology,
global science books 2 (Special issue 1):16–45
Visser RGF, Somhorst I, Kuipers GJ et al (1991)
Inhibition of the expression of the gene for
granule-bound starch synthase in potato by antisense
constructs. Mol Gen Genet 225(2):289–296
Vreugdenhill D, Struik PC (1989) An integrated view of
the hormonal regulation of tuber information in potato
(Solanum tuberosum). Physiol Plant 75:525–531
Waara S, Wallin A, Eriksson T (1991) Production and
analysis of intraspecific somatic hybrids of potato
(Solanum tuberosum L.). Plant Sci 75:107–115
Wang B, Wang R-R, Cui Z-H et al (2014) Potential
applications of cryogenic technologies to plant genetic
improvement and pathogen eradication. Biotechn Adv
32:583–595
Wang B, Yin Z, Feng C et al (2008) Cryopreservation of
potato shoot tips. Fruit, Vegetable and Cereal Sci
Biotechnol 2 (Special Issue I):46–53
Wang PJ, Hu CY (1982) In vitro mass tuberization and
virus-free seed potato production in Taiwan. Am
Potato J 59:33–39
Wang Q, Liu Y, Xie Y, You M (2006) Cryotherapy of
potato shoot tips for efficient elimination of potato
leafroll virus (PLRV) and potato virus Y (PVY).
Potato Res 49:119–129
Wang Q, Valkonen JPT (2009) Cryotherapy of shoot tips:
novel pathogen eradication method. Trends Plant Sci
14:119–122
Wang S, Zhang S, Wang W et al (2015) Efficient targeted
mutagenesis in potato by the CRISPR/Cas9 system.
Plant Cell Rep 34:1473–1476
Watanabe KN, Orrillo M, Vega S et al (1995) Overcom-
ing crossing barriers between nontuber-bearing and
tuber-bearing Solanum species: towards potato germ-
plasm enhancement with a broad spectrum of solana-
ceous genetic resources. Genome 38:27–35
Waterer D, Elsadr H, McArthur M-L (2011) Skin color,
scab sensitivity and field performance of lines derived
267
from spontaneous chimeras of Red Norland potato.
Am J Potato Res 88:199–206
Webb KJ, Osifo EO, Henshaw GG (1983) Shoot regen-
eration from leaflet discs of six cultivars of potato
(Solanum tuberosum subsp. tuberosum). Plant Sci Lett
30:1–8
Weber BN, Witherell RA, Charkowski AO (2015)
Low-cost potato tissue culture with microwave and
bleach media preparation and sterilization. Am J
Potato Res 92:128–137
Wenzel G (2006) Biotechnology in potato improvement.
In: Gopal J, Khurana SM (eds) Handbook of potato
production, improvement and postharvest manage-
ment. The Haworth Press Inc, New York, pp 109–146
Wenzel G, Foroughi-Wehr B (1990) Progeny tests of
barley, wheat and potato regenerated from
cell-cultures after in vitro selection for disease resis-
tance. Theor Appl Genet 80:359–365
Westcott RJ (1981a) Tissue culture storage of potato
germplasm. 1. Minimal growth storage. Potato Res
24:331–342
Westcott RJ (1981b) Tissue culture storage of potato
germplasm. 2. Use of growth retardants. Potato Res
24:343–352
Westcott RJ, Henshaw GG, Roca WM (1977) Tissue
culture storage of potato germplasm: culture initiation
and plant regeneration. Plant Sci Lett 9:309–315
Wheeler VA, Evans NE, Foulger D (1985) Shoot
formation from explant cultures of 14 potato cultivars
and studies of the cytology of regenerated plants. Ann
Bot 55:309–320
Wilson CR, Luckman GA, Tegg RS et al (2009)
Enhanced resistance to common scab of potato
through somatic cell selection in cv. Iwa with the
phytotoxin thaxtomin. Plant Pathol 58:137–144
Wilson CR, Tegg RS, Hingston LH (2010a) Yield and
cooking qualities of somaclonal variants of cv. Russet
Burbank selected for resistance to common scab
disease of potato. Ann Appl Biol 157:283–297
Wilson CR, Tegg RS, Wilson AJ et al (2010b) Selection
of extreme resistance to common scab through
somatic cell selection in Russet Burbank. Phytopathol-
ogy 100:460–467
Wolters AMA, Koornneef M, Gilissen LJW (1993) The
chloroplast and mitochondrial DNA type are corre-
lated with the nuclear composition of somatic hybrid
calli of Solanum tuberosum and Nicotiana
plumbaginifolia. Curr Genet 24:260–267
Xu X, van Lammeren AM, Vermeer E, Vreugdenhil D
(1998) The role of gibberellin, abcisic acid and
sucrose in the regulation of potato tuber formation
in vitro. Plant Physiol 117:575–584
Yee S, Stevens B, Coleman S, Seabrook JEA, Li X-Q
(2001) High efficiency regeneration in vitro from
potato petioles with intact leaflets. Amer J Potato Res
78:151–157
Yermishin AP, Makhan’ko OV, Voronkova EV (2008)
Production of potato breeding material using somatic
hybrids between Solanum tuberosum L. dihaploids
268
and the wild diploid species Solanum bulbocastanum
Dunal. from Mexico. Russ J Genet 44(5):559–566
Youm JW, Jeon JH, Choi D et al (2008) Ectopic
expression of pepper CaPF1 in potato enhances
multiple stresses tolerance and delays initiation of
in vitro tuberization. Planta 228:701–708
Yu J, Langridge W (2003) Expression of rotavirus capsid
protein VP6 in transgenic potato and its oral immuno-
genicity in mice. Transgenic Res 12:163–169
Yu Y, Ye W, He L et al (2013) Introgression of bacterial
wilt resistance from eggplant to potato via protoplast
fusion and genome components of the hybrids. Plant
Cell Rep 32:1687–1701
Zámečnik L, Faltus M, Bilavčik A (2007) Cryoprotocols
used for cryopreservation of vegetatively propagated
plants in the Czech cryobank. Adv Hortic Sci 21:247–
250
Zarghami P, Pirseyedi M, Hasrak S, Sardrood BP (2008)
Evaluation of genetic stability in cryopreserved
Solanum tuberosum. Afr J Biotechnol 7:2798–2802
Zhang L-H, Mojtahedi H, Kuang H, Baker B, Brown CR
(2007) Marker-assisted selection of Columbia
root-knot nematode resistance introgressed from
Solanum bulbocastanum. Crop Sci 47:2021–2026
Zhang R, Marshall D, Bryan GJ, Hornyik C (2013)
Identification and characterization of miRNA
R. Thieme and E. Rakosy-Tican
transcriptome in potato by high-throughput sequenc-
ing. PLoS ONE 8:e57233
Zhang N, Si HJ, Wen G et al (2011) Enhanced drought
and salinity tolerance in transgenic potato plants with
a BADH gene from spinach. Plant Biotechnol Rep
5:71–77
Zhang Y, Sun F, Fettke J et al (2014) Heterologous
expression of AtPAP2 in transgenic potato influences
carbon metabolism and tuber development. FEBS Lett
588:3726–3731
Zhu S, Li Y, Vossen JH et al (2012) Functional stacking
of three resistance genes against Phytophthora infes-
tans in potato. Transgenic Res 21:89–99
Zimmermann U, Scheurich P (1981) High frequency
fusion of plant protoplasts by electric fields. Planta
151:26–32
Zuba M, Binding H (1989) Isolation and culture of potato
protoplasts. In: Bajaj YPS (ed) Biotechnology in
agriculture and forestry, plant protoplasts and genetic
engineering I, vol 8. Springer, Berlin, pp 187–194
http://www.quantumtubers.com/techinfo.htm
http://www.efsa.europa.eu/en/efsajournal/pub/2561.htm
http://www.scri.ac.uk
http://www.ars.usda.gov
http://www.ars-grin.gov/nr6
 Structural Analysis of Resistance
(R) Genes in Potato (Solanum 14
Species) Genome

Soma S. Marla

Abstract
Late blight pathogenesis involves active interplay between effector
proteins secreted by the oomycete Phytophtera infestans and immune
receptors coded by resistance (R) genes in potato plant. This chapter
discusses how computational structural studies of P. infestans effector and
potato immune receptor molecules can assist in understanding this
molecular cross-talk. Structural modeling and building three-dimensional
structures of effector and resistant proteins enable analysis of their
structures, compositions, and variability and can elucidate their functions
involved in late blight pathogenesis. Predicted pathogen or
enzyme-binding sites and molecular docking partially explain the
mechanisms underlying virulence and the possible recognition or
avoidance of P. infestans effector molecules. Predicted effector functions
from the sequenced P. infestans genome and a comparison with available
Solanacae gene databases enable germplasm screening and identification
of corresponding new candidate R genes. Some clues obtained from
bioinformatics structural investigations may potentially enrich our
knowledge of the co-evolution of pathogen and host plant in late blight
infection.

14.1 Introduction

Modern agriculture is characterized by monocul-

S. S. Marla (&)
Genomic Resources Division, ICAR-National
Bureau of Plant Genetic Resources, New Delhi,
India
e-mail: soma.marla@icar.gov.in
ture and cultivation of only a few crops in large
areas and thus shrinking the biodiversity. Con-
sequently, some pathogens have gained a bigger
foothold and rapidly have spread in the ecosys-
tem, resulting in the wide incidence of serious
diseases such as late blight caused by oomycete
Phytophtera infestans. Potato resistance, as in

© Springer International Publishing AG 2017 269

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_14
270
other plants, subscribes to gene-for-gene interac-
tions between host resistance (R) genes and cor-
responding pathogen avirulence (Avr) genes (Flor
1974). Late blight pathogen P. infestans secretes
effector proteins that enter and alter the host
plant’s metabolism, defeating its immune system
to advance the infection. The development of
potato cultivars possessing durable resistance
mandates has detailed the study of various
molecular processes underlying host–pathogen
interaction. Genomes of P. infestans (Haas et al.
2009) and potato (Potato Genome Sequencing
Consortium 2011) have been sequenced. Genome
data analysis using next-generation sequencing
techniques allows identification of putative
pathogen effectors, their diversity and their cor-
responding to candidate R genes. Application of
computational techniques such as structure mod-
eling helps in the comparison of effector homo-
logues, the identification of ligand or
enzyme-binding sites and may provide func-
tional information about key enzymes involved in
various processes such as host cell wall destruc-
tion, effector entry into the host cytoplasm or their
recognition by NBS-LRR immune receptors and
host proteases. The analysis of the structural
biology of individual effectors (or matching the
host receptors) in isolation or interaction with
target molecules may provide valuable insights
into understanding of host-pathogen interaction
during late blight infection. The structural biology
of pathogen effectors and their matching host
immunity receptors may also possibly explain the
molecular basis for effector recognition by
NBS-LRR protein complexes, thus predicting
various virulence functions. A major resource for
in silico investigations is the availability of de-
posited crystal structural data in the Protein Data
Bank (PDB) of at least a few effectors of
P. infestans. Computational studies allow map-
ping of effector amino acid residues involved in
interactions with NBS-LRRs receptors. Modeling
three-dimensional structures of both effector and
host R proteins that are docked help to predict
pathogen/enzyme binding sites, and map the key
amino acid residues or alleles guilty for possible
loss of resistance functions in R genes
(Fig. 14.1).
S. S. Marla
Fig. 14.1 Identification of sequence motifs, W, Y and L
showing conserved pattern of amino acids in RXLR
domains of Avr3a effectors in P. infestans (MEME tool
output) (unpublished, personal communication)
Late blight pathogen P. infestans thrives on
the host potato plant for nutrition and survival.
To infect the host, P. infestans secretes
extra-cellular effector proteins that enter the host
plant and alter its metabolism to promote its own
growth. Potato plants in turn have developed a
complex and multilayered resistance mechanism
to counter the invading pathogen. The outcome
of this cross-talk between these two actors
defines the incidence or avoidance of the disease.
Host plant resistance to microbial diseases com-
prises two mechanisms. The first is basal
defense, manifesting actions of the plant immune
system, activated in response to elicitors or
microbe-associated molecular patterns
(MAMPS), such as fungal chitins, polysaccha-
rides, elongation factors or heptaglucosides.
These elicitors are the gene products of the
attacking pathogen (Jones and Takemoto 2004).
The second mechanism is based on the actions of
the triggered adaptive immune system after the
detection of the cytoplasmic effectors called
nucleotide-binding and Leu-rich repeat
(NBS-LRR) protein domains, coded by resis-
tance (R) genes, and it represents R genes where
they deploy their gene products against Avr
genes as products of the pathogen. The basal
defense of the host immune system can be acti-
vated upon recognition of the pathogen elicitor.
The second part of the host immune system
includes activation of the resistance (R) genes.
These R proteins initiate host immune responses
conferring a resistant phenotype on the plant.
A series of interactions taking place between the
host R genes and the pathogen-secreted Avr
effectors basically subscribes to the
14 Structural Analysis of Resistance (R) Genes in Potato … 271

gene-for-gene theory (Flor 1974). Continuously
co-evolving against pathogen effectors, host
plants also have developed an innate adaptive
immune system. On the other hand, the pathogen
also undergoes adaptive selection to outsmart the
host and induce successful infection (Fig. 14.2).
Historically, the race-specific resistance based
on gene-for-gene relationship was initially iden-
tified in hexaploid wild species of S. dimessum.
The identified genes exhibited a hyper-sensitive
tissue response to all races of P. infestans that did
not possess the corresponding virulence to the R
gene. By the middle of the last century, 11 R
genes from S. dimessum (Black et al. 1953) had
been identified. Many of these genes were
extensively used in commercial breeding pro-
grammes world-wide, including India, and
resulted in development of an array of resistant
potato varieties. However, deployed resistance
was overcome in due course by the development
of new complex matching virulence in
P. infestans owing to its diversity, plasticity and
adoptive ability. This led to a change in breeding
strategies and potato breeders started looking for
horizontal resistance conferred by a group of
genes (including minor genes with adoptive
affects). Potato breeders even resorted to the
development of R gene-free populations
throughout the second half of the last century. Of
course, this strategy was found to be unsuccess-
ful and late blight resistance remains a challenge
to scientists across the globe (Fig. 14.3).
However, our understanding of the various
mechanisms underlying the pathogen-host plant
interaction is supported by the molecular and
genomic investigations undertaken during the
last two decades. A few mapping populations
were created, quantitative trait loci (QTLs) for
late blight resistance were identified, the genome
of S. Phureja was sequenced. Consequently,
nearly 21 R genes have been identified, confer-
ring resistance to different races of P. infestans

Fig. 14.2 RXLR effectors AVR3a11 and PexRD2 adopt a structurally conserved but adaptable fold. a Oomycete
RXLR effectors are modular proteins comprising a secretion signal (cyan), RXLR translocation motif (purple), and an
effector domain (green). b Structural alignment and secondary structure elements of the effector domains of AVR3a11
and PexRD2. W-motifs (cyan) and Y-motifs (lilac) are colored, with key residues (as discussed under “Results and
Discussion”) boxed. c The structure of AVR3a11 is a monomeric four-helix bundle with a hydrophobic core. Carbon
atoms of key residues in the W- and Y-motifs are colored as boxed in b; loop-3 is shown in purple. d PexRD2 is a dimer
with a hydrophobic interface, including residues Val73, Asp74, Ala77, Thr83, Ile86, Ala90, Met96, Gly100, Met105, Leu108,
Leu109, and Leu112 (shown for one monomer only). a-Helices are labeled to correspond to equivalent positions in
AVR3a11. e The AVR3a11/PexRD2-monomer overlay generated using SSM, showing the conserved fold. Protein
structures are colored as in c and d with key residues of the W- and Y-motifs colored as in b. (Published with
permission from Boutemy et al. 2011)
272
Fig. 14.3 3-D structure of R3 resistant protein from S.
tuberosum, P-loops belonging to LRR are shown in light
brown. Energy Values: 34962.695 kJ/mol (Modeler out-
put) (unpublished, personal communication)
(Spooner and Bamberg 1994; Douches et al.
2001; Hijmans et al. 2003). Recently a new R
gene was isolated simultaneously—RB (Gen-
Bank accession number AAP45164; Song et al.
2003) and Rpi-blb1 (GenBank accession number
AY42659; Van der Vossen et al. 2005) from
Solanum bulbocastanum by employing
map-based cloning and PCR techniques. The RB
gene also comprises NBS-LRR functional
domains typical of other R genes and was found
to possess broader resistance against many races
of P. infestans (Fig. 14.4). Potato breeders
around the world are presently working on
strategies to incorporate the RB gene into potato
cultivars by using both conventional breeding as
well as modern biotechnological approaches.
Recently the RB gene was introduced into a
popular Indian cultivar using transgenic methods,
resulting in high levels of resistance against late
blight (Shandil et al. 2017). Of late, the RB gene
also has started becoming susceptible to late
blight. This development again forced potato
Fig. 14.4 3-D structure of, Rpi-blb1, R gene isolated
from S. bulbocastratum. Functional domains coil-coil
(shown in pink), NBS (yellow) and LRR (blue) are shown
(Modeler output)
S. S. Marla
breeders and pathologists to explore other
strategies. Recent sequencing of the genome of
P. infestans (T-30; Haas et al. 2009) and the
availability of functional data on various effector
proteins (targeting especially the structure of
regions known for virulence) assisted by in silico
structural studies appears to be promising.
All the identified R genes belong to the
NBS-LRR superfamily (Marone et al. 2013).
They are one of the largest gene families in
plants with more than 650 R genes mapped and
sequenced so far. NBS-LRRs are known for their
pathogen recognition functions inside the cell
and are very adaptive in tune with the selective
pathogen pressure. The nucleotide binding site
along with other domains belongs to the
NB-ARC complex. NBS-LRR proteins are clas-
sified into two types: TIR-NBS-LRR (TNL) that
contain a Toll-like domain and CC-NBS-LRR
(CNL) proteins. CNLs are characterized by their
unique coiled-coil nature of the structure (see
Fig. 14.4).
A major function of the LRR domain is the
recognition of specific effectors secreted by
P. infestans. The modeled structure of the
R-proteins reveals new functions of LRR
domains with identified P-loops, Kinase-2 and
Gly-Leu-Pro-Leucin and other motifs that are
associated with signaling during effector identi-
fication (Marone et al. 2013). LRR domains are
structurally very dynamic and facilitate high
levels of adaptation to suit the demands of the
host immune system as part of co-evolution.
Adoptive plasticity of LRR domains arises from
their selective protein-protein interactions that
yield different active site binding conformations.
Predicted solvent-exposed residues of LRR
domains provide space for variable binding sites,
thus allowing variability and diversity to com-
pete with evolving pathogen effectors (Figs. 14.5
and 14.6). Sub-cellular placement of NBS-LRR
proteins is essential for resistance phenotypes
and plays an important role in the identification
of individual P. infestans and conferring resis-
tance against them. NBS-LRR proteins are
shown to be localized mostly in nucleus and
cytoplasm (Shen 2007; Meyers et al. 2003).
Apart from P. infestans, different alleles of
14 Structural Analysis of Resistance (R) Genes in Potato …
Fig. 14.5 3-D structure of P. infestans effector Avr3a1, Ribbon display of Modeler output, showing P-loop from LRR
region four helix bundles
Fig. 14.6 Molecular docking of P. infestans effector
Avr3a and R3 proteins a Mapped amino acids residues
from binding site (shown inside the circle),
NBS-LRR provide resistance also to other
pathogens such as viruses and nematodes.
Recent reports provide information about the
underlying molecular mechanisms that activate
NBS-LRR proteins upon pathogen invasion. It is
interesting to know what molecular mechanism
facilitates NBS-LRR host receptors to recognize
an individual pathogen. Of late, data obtained
from modeled three-dimensional structures of
NBS-LRR proteins have given some clues and
throw some light on this recognition mechanism.
For example, effector Avr3 corresponds to the
popular R3a gene in potato. Of the two alleles of
Avr3, AVR3aKI only is reported to be recog-
nized, and the other allele AVR3aEM avoids
recognition by the potato immune receptor.
273
b Diagram showing presence of RXLR motif in red
color. HEX output, (Marla 2016) (Color figure online)
Modeled three-dimensional structures of both
Avr3a and the NBS-LRR protein may potentially
illustrate this, while docking involving both these
allelic forms thus explains recognition or eva-
sion. According to the proposed “jack-knife”
model, the Avr effector disrupts the existing
intra-molecular associations and liberates the CC,
NB and or LRR domains, allowing them to
interact with other proteins. An exchange of
NBS-ARC domains between related other pro-
teins and resulting in new conformational chan-
ges enables the freshly bound nucleotide to
recognize the attacking Avr protein (Dodds et al.
2006). Nucleotide-dependent conformational
changes and the subsequent oligomerization
activate, forming a scaffold of signaling
274
components that finally trigger cell death (Mestre
and Baulcombe 2006).
14.2 P. infestans Genome
Organization
and Composition
The genome of P. infestans is 240 Mb in size
and was sequenced by the Broad Institute in the
USA in 2012 (Haas et al. 2009). Nearly 18,000
genes were predicted from the assembled gen-
ome. Mapped predicted genes revealed interest-
ing facts about their composition and
organization. P. infestans contains a total of 560
RXLR and 180 CRN effector genes secreted
(Haas et al. 2009). Most of the
pathogenesis-related genes were found to be
located in gene-sparse areas of the chromosomes.
An Indian strain of P. infestans HP 1031 was
sequenced and computationally analyzed in our
lab at ICAR.NBPGR, New Delhi, employing
NGS techniques. A few effectors, AVR1, AVR2,
AVR3a, AVR4, IPI-O1 (AVR-blb1), AVR-blb2
and AVR-vnt1, were identified (Vleeshouwers
et al. 2011). The majority of secreted effectors
contain one RXLR motif, located on the
N-terminal (Fig. 14.2), that is only activated
upon recognition by the corresponding R gene
from the host plant, and two W motifs and one Y
motif on the C-terminal domain. The located
RXLR motif on the N-terminal is only activated
upon recognition by the corresponding R gene
and the C-terminal motifs define the activity of
the latter (Rehmany et al. 2005).
14.3 Plasticity and Adoptability
in P. Infestans Effectors
MEME tool was employed to identify similar
patterns in selected RXLR effectors in predicted
P. infestans strain HP 103. Three conserved
sequence motifs, W, Y and L, amino acids are
arranged in a strict conserved pattern (Fig. 14.1).
As reported, these repeat-rich, gene-sparse
regions housing W, Y and L sequence patterns
are supposed to promote evolutionary plasticity
S. S. Marla
and variation in Avr genes, facilitating higher
pathogenocity and host-specificity (Raffaels et al.
2010).
At present, a total of 11 P. infestans
race-specific R genes have been mapped, isolated
and cloned from wild potato species S. demissum
that correspond to P. infestans secreted effectors.
14.4 Genomic Organization
of NBS-LRR Genes in Potato
Genome sequencing of nuclear and organellar
genomes of S. tuberosum, Phureja DM has
reported on the prediction and mapping of 500
NBS candidate genes (Potato Genome Sequenc-
ing Consortium 2011). The sequenced DM gen-
ome (844 Mb) contains 408 NBS-LRR, 51 TIR
and other non-TIR domains of R genes.
NBS-LRR genes are not uniformly distributed
across all the chromosomes in potato. A large
number of them (nearly 15%) are mapped onto
chromosomes 4 and 11 and a few are located
(1%) on chromosome 3 (Jupe et al. 2012; Lozano
et al. 2012). In the potato genome, NBS-LRR
genes are organized either as isolated genes or in
clusters, presumed to be the result of rapid R
gene evolution against the challenged stress
factors (Hulbert et al. 2001). In potato, 73% of
mapped genes are found to be located in 63
clusters (Wan 2008). Compared to the TNL
class, the CNL class of NBS-LRR genes are in
the majority (85%) and mostly located in differ-
ent clusters across the chromosomes.
14.5 R and Avr Pairs
14.5.1 R1-Avr1
R1 is the first R gene isolated from S. demissum
using map-based cloning. The gene was isolated,
and cloned using map-based cloning and mapped
onto the short arm of chromosome V (Ballova
et al. 2002). R1 gene codes a polypeptide of 1293
amino acids that belong to the CC-NBS-LRR
class of plant R genes (Dongl and Jones 2001).
The gene has three haplotypes. Although R1 was
14 Structural Analysis of Resistance (R) Genes in Potato …
one of the first R genes to be introduced into
potato cultivars, it soon was overcome by
P. infestans. The Avr1 gene matches the R1 gene
in Solanum and was isolated using map-based
cloning and codes 208 amino acids (Guo 2008).
14.5.2 R2-Avr2
R2 gene (Genbank ac. JX313794) is a member of
a wider family providing resistance to several
strains of P. infestans. Eleven orthologues of R2
gene were isolated and mapped onto chromo-
some 4 from various wild species of potato, S.
demissum, S. bulbocastanum, S. bjertingii, S.
edinense, S. scbenckii and S. microdonatum.
They include R2, R2-like, Rpi-blb3, Rpi-abpt,
Rpi-mcd1, Rpi-snk1.1, Rpi-snk 1.2, Rpi-edn1.1,
Rpi-bjt1.1, Rpi-bjt1.2, Rpi- and Rpi-bjt1.3
(Hermsen 1973; Champouret 2010). Interest-
ingly, most of these R2 gene homologues
(R2GH) were isolated using effector screens. In
no time, almost all the R2 genes homologues
were defeated in the field by various strains of
P. infestans.
14.5.3 R3A-Avr3a
R3 was isolated from S. dimessum and mapped
onto the short arm of chromosome XI (Huang
et al. 2004). Detailed fine mapping studies fur-
ther revealed that the phenotypic resistance was
due to two tightly linked R3 genes, R3a and R3b.
R3 gene-coded protein is made up of 1283 amino
acids and belongs to CC-NB-LRR class
(Fig. 14.3). Other homologues of R3 were also
isolated from S. stoloniferum (Rpi-sto2) using
Avr3 functional screens. However, R3 was also
defeated by fast-evolving races of P. infestans.
Avr3a was isolated from P. infestans using
potato genotypes carrying various R genes from
S. demissum (Armstrong et al. 2005). Avr3
encodes typical RXLR cytoplasmic effectors.
Homologues of Avr3a were also identified in
P. sojae and P. capsici. P. infestans populations
have two alleles of Avr3a expressing two hap-
lotypes, Avr3a KI and Avr3a FM, two secretary
275
protein effectors with the ability to suppress cell
death immune response reaction in potato host
plants (Armstrong et al. 2005). These alleles
identified in the Avr3 locus differ in their amino
acid positions 80 and 103 respectively. The
crystal structure of Avr3a protein is available in
the Protein databank (PDB# 2NAR; Fig. 14.5).
Avr3a was found to suppress immunity by
binding to host E3 ubiquitin ligase CMPG1
(Yaeno et al. 2011). It appears to be a promising
way to unlock (engineer) this binding so as to
achieve durable resistance against P. infestans.
Today the main strategy is targeted search for
new R genes and integrate them to confer
broad-spectrum resistance to late blight (Park
et al. 2009; Song et al. 2003; Van der Vossen
et al. 2005) from Mexican wild species S. bul-
bocastanum (2n = 24). The RB gene is reported
to confer broad resistance against a majority of
screened strains of P. infestans. The RB gene
encodes a protein of 970 amino acids long and
belongs to the CC-NBS-LRR class (Song et al.
2003). Incidentally RB also belongs to the same
cluster on chromosome V along with R1 and
other R genes. Figure 14.5 shows the presence of
the four layered RXLR bundles and the beta
sheet recognition receptor fold comprising beta
sheets as shown in modeled structures of Rpi-
blb1 (Fig. 14.4).
The vast majority of effectors secreted by
oomycetes belong to the RXLR class. Each
individual effector is specific and matches a
corresponding R gene in the host potato plant.
They are characterized by the presence of RXLR
motif, Arg-Xaa-Leu-Arg. So far, 563 RXLR
effectors have been predicted from the sequenced
genome of P. infestans, T-30-4 (Haas et al.
2009). By genome analysis of the P. infestans
strain HP-1031 (ICAR.IIPR, Shimla), using the
RXLR motif signature from T-304, we identified
380 RXLR effectors in our laboratory. Assembly
of 42,000 contigs yielded a total of nearly 13,000
Avr genes. Annotation of predicted Avr genes in
P. infestans strain HP 1031 revealed their
functions.
RXLRs are a major class of P. infestans
effectors that mediate delivery to the host cyto-
plasm. However, the molecular mechanism
276
underlying the entry of pathogen into the host
cell is yet to be understood. Bioinformatics and
structural analysis describing the mapping sur-
face topology of amino acid residues and their
changed conformations during interaction, and
recognition of effector molecules by host recep-
tors, and resulting in the induction of immune
responses, may potentially enrich our under-
standing of late blight pathogenesis.
Crystal structures of five oomycete RXLR
effector proteins are deposited in the RCSB
Protein databank in the public domain. Among
them we selected three templates. AVR3a4
(PDB# 2LC2), AVR3a11 (PDB# 3ZRG),
PexRD2 from Phytopthora infestans (PDB#
3ZRG.1). All the reported structures comprise a
three alpha-helix fold called the WY domain,
containing the conserved Trp and Tyr residues
which interact to form a stable hydrophobic core
(Fig. 14.6). When checked against the target
structures, only a few structures deposited in
PDB showed < 20% sequence similarity. How-
ever, the modeled structures (using the found
targets) showed that the WY fold is well con-
served but in monomeric forms (in AVR3a4 and
AVR3a11) as a four-helix model (Boutemy et al.
2011). It is reported that residues present on the
C-terminal play vital roles in both avoidance by
host receptor and also later in suppressing the
immune responses of the latter (Boutemy et al.
2011). While analyzing the RXLR effector AVR3
(# HP.1.468) identified from P. infestans strain
HP 1031, the observed WY fold may provide a
flexible, stable scaffold that supports existing
polymorphisms, reflecting the structural diversity
among different effectors. Plasticity and adopt-
ability are gained chiefly by resorting to changes
in core folds (amino acid replacements) in WY in
the alpha helices, thus enabling avoidance of host
recognition. The process involves adoption of
new loop regions in the alpha helices, by virtue
of acquired insertions or depletions or point
mutations resulting from replacement of surface
amino acids viz. tryptophan, leucin and argenin
(Boutemy et al. 2011).
Another key question seeking answers is how
the effector protein after entry into the host
cytoplasm interacts with host cell targets at the
S. S. Marla
molecular level. Structural studies, for example,
direct recognition of fungal and oomycete effec-
tors by NBS-LRR receptors can be investigated
to answer some of these questions. In our study
we mapped polymorphic residues on the surface
of P. infestans Avr3a and depicted one site
responsible for recognition of this effector by
NBLRR proteins of R3. Polymorphic residues
are mapped to the four helix bundles as expected.
The mapped surface region in Avr3a is important
for recognition by NBS-LRR proteins of R3a.
A structural understanding of how NB-LRRs
directly interact with effectors is important in the
prediction of active binding sites.
The availability of sequenced information of
the P. infestans genome allows elucidation of the
functions of various avirulent molecules involved
in late blight infection and the suppression of
host plant immune activity. For example, a
P. infestans T30-4 strain has been sequenced and
assembled, however, of the suspected presence
of *17,000 coded effector genes, only a few
hundred have been annotated, revealing their
molecular and biological functions (http://www.
broadinstitute.org/scientific-community/software
). The information available on genome organi-
zation and structure helped isolate many aviru-
lent factors involved in late blight infection. The
availability of literature reporting various inves-
tigations on functional genomics, structures of
modeled molecules and efficient computational
ontology tools and pipelines facilitate further
elucidation of functions of different effector
genes involved in late blight pathogenesis. In our
laboratory we analyzed the sequence raw data
and identified 390 effectors. The identified
effectors belong to both types—apoplastic and
cytoplasmic—presumed to be involved in early
cyst germination and entry and establishment of
zoospores, cell wall degradation, host enzyme
inhibition, and nacrosis.
In the present study, raw sequence data of
Phytophthora infestans strain HP 1031,
sequenced at the Central Potato Research Insti-
tute (CPRI), Shimla, was assembled and sear-
ched for potential effectors among the predicted
coding genes. Sequenced genome analysis was
done employing next-generation sequencing
14 Structural Analysis of Resistance (R) Genes in Potato …
tools: CLC Bio Work bench, Velvet and
Augustus, yielded 13,262 coded proteins from
the 42,000 assembled contigs. We predicted a
significant number of RXLR class of effectors,
i.e. 392 in P. infestans HP 1031 as against 563
RXLR effectors reported with P. infestans
T-30-4. Of these, we selected three effectors
(AVR3, AVR3a and AVR2) belonging to the
RXLR class among the predicted effector
sequence of P. infestans strain HP 1031 and
conducted sequence, structure analysis. Similarly
seven Solanum R proteins (R2, R3, R3a and
SHO 10 from S. demissum and BSL.1 from S.
tuuberosum and Rpi-blb3 from S. bulbocas-
todium) were downloaded from NCBI and used
for sequence and structure analysis. Effector
protein domain analysis confirmed the presence
of a conserved N-terminus that carries a secretary
signal peptide and two repeating sequence motifs
RXLR and dEER, combined with a highly
divergent C-terminus, housing the vital elicitor
domains. RXLR (Arf-Xaa-Leu-Arg) is found to
be a strictly conserved domain, as reported ear-
lier (Vleeshowers et al. 2008) in the analyzed
P. infestans genome data. This domain is repor-
ted to be chiefly responsible for translocation
inside host plant cells and primarily influences
virulence. Further, sequence analysis of RXLR
effectors revealed the presence of repeating
sequence motifs “W”, “Y” and “L” representing
amino acids conserved at a certain position in the
C-terminal region. Occurrence of these repeating
sequence motifs in a characteristic fashion is
supposed to contribute to the rapid evolution and
expansion of the RXLR superfamily under
Fig. 14.7 Avr3a and R3 Docking with H bonds showing functional amino acids, suspected to be linked to SNPs to
gain adaptation, HEX output
277
selection pressure and aids in adaptation
(Vleeshowers et al. 2008).
Protein 3D structures of both effector proteins
and Solanum R proteins, Avr3a and R3a respec-
tively, were modeled and refined, employing
structural parameters. The modeled ligand (effec-
tor molecule and receptor Solanum R proteins)
were docked using CDOCK and AutoDOCK and
HEX software tools. The obtained elicitor and host
receptor docking was verified with energy
parameters to define the binding strength (the
efficiency of virulence) and were computed using
Schroedinger Package. The obtained docking
results helped us to successfully establish a viable
effector, Solanum R protein interactions occurring
between pairing sets AVR3 and R3a (S. demis-
sum); AVR3a and R3 S. tuberosum); AVR and
BSL.1 (S.tuberosum); and AVR2 and RPiblb3 (S.
bulbocastodium). We demonstrated the working
of the developed effector structure-based profiling
of Solanum R proteins for screening individual
P. infestans strains (Fig. 14.7).
14.6 Identification Effector
Functions
As described above, P. infestans secretes several
extra-cellular effectors to infect and establish
itself in host potato plant. We annotated the
predicted effectors employing Blast2Go,
InterProScan tools to deduce their molecular and
biological functions. We identified several
effectors responsible for such vital functions as
plant cell wall-degrading enzyme functions,
278
Fig. 14.8 Function
annotation of sequenced
genome of P. infestans strain
HP 1031 (India), predicted
protein domains and other
functions
endoglucanases, PGIP, poly galacturanasesinose,
endopolygalactinases, Pectate lysae (the
polysaccharide group), cellulose binding genes;
plant enzyme inhibitors belonging to Cystins,
serines; the UIP1 protease family (involved in
host plant tissue degeneration),
sodium/potassium transport with ATPase signa-
ture; Myb-like chromatin binding proteins
(FDNA); histone methylation (for cell cycle
regulation), Crinkler family proteins (related to
RXLRs for spore transmission), NEP1 ortho-
logues for necrosis induction, protein
kinase-related calcineurin-like phosphoesterase-1
(vital for plasticity and adoption), CRN protein
family effectors (play a major role in host plant
infection and manipulation of metabolic path-
ways) and several others (Fig. 14.8).
For example, the predicted CRN effectors,
after transport into the host cytoplasm start
manipulating its cellular processes, resulting in
cell death, chlorosis and tissue browning (Bout-
emy et al. 2011). Effectors belonging to various
families are annotated from sequenced P. infes-
tans strain HP. A detailed biochemical study
coupled with pathogenic verification of these
effector functions may enrich our present
understanding of late blight pathogenesis and the
interplay between P. infestans and its host.
S. S. Marla
14.7 Databases and Other
Computational Resources
Thanks to the untiring efforts of potato
researchers around the world, a wealth of infor-
mation is being deposited to disseminate the
results to the potato research community. Some
of the databases provide information relating to
maps of all 12 potato chromosomes with mapped
candidate R genes, mapped markers, sequence
data, putative gene functions, SNP and Indel
information from different diploid and tetraploid
potato genotypes, and publication references.
Apart from the widely available GenBank (http://
www.ncbi.nlm.nih.gov/) and SGN (Solanaceae
Genomics Network, http://www.sgn.cornell.edu/
), many other resources are being reported in
public domain repositories. Some of the notable
resources include SolGene (https://solgenomics.
net/), an online database to explore
disease-resistant genes in Solanum species. Apart
from providing data on R genes, QTLs, and
molecular markers, SolRgene also has informa-
tion on phylogeny, crossability among Solanum
species, genotype-based resistance information
(though only for a few important ones), genetic
maps, allele mining, and above all facilitates
14 Structural Analysis of Resistance (R) Genes in Potato …
graphical visualization of these available
resources. Other notable resources are SPUD
(Hirsch et al. 2014) and PoMaMO (https://gabi.
rzpd.de/PoMaMo.html; Meyer et al. 2005), a
comprehensive database for potato genome data.
Embedded in PoMaMO is YAMB, a genome
browser that lets the user explore the genetic
maps and visualize them. PFGD is integrated
with the Solanacae Genomics database (SolGD;
http://www.solgd.org) and provides a compar-
ison between effector and their matching receptor
molecules from the Solanacae species, enabling
the exploration of host-pathogen interactions.
The Phytophthora database (https://data.nal.
usda.gov/dataset/phytophthora-database/
resource/) supported by USDA. AFRI is a won-
derful resource providing information on world
collections of Phytopthora species, a referral
global atlas. The Phytophthora Functional Gen-
ome Database PFGD (http://www.pfgd.org) is
another information resource on P. infestans
containing transcripts, genomics, gene expres-
sion, and functional assay data.
14.8 Effectors in R Gene Screens
A viable option to perform late blight manage-
ment in potato, while incurring minimal losses,
appears to be by building durable broad spec-
trum resistance pyramiding multiple R candidate
genes as well as other genes with minor com-
plementary effects. The sequenced genomic
information and the associated gene lists with
specific trait functions provide a logical platform
for selection and comparison of effectors and
their corresponding host resistance partners.
SolGD is one such computational platform
described above. Sequencing of a native strain
HP of P. infestans enabled the identification of
effectors for various functions involved in
pathogenesis, such as host cell wall degradation,
kinase signaling, potassium transport, and serine
protease inhibition (see Fig. 14.8). Many of the
predicted effectors are supposed to possess
remarkable ability to manipulate biochemical,
physiological and morphological processes in
host plants. Use of effectors to screen Solanum
279
germplasm to identify matching resistance
molecules is a promising approach in late blight
diagnostics. Apart from the use of effectors for
generation of quantitative resistance data (Hunag
et al. 2005), they are successfully employed in
the identification of candidate R genes from wild
Solanum species. R genes conferring resistance
to P. infestans (Rpi) have been successfully iso-
lated from S. bulbocastanum and S. venture (Van
der Voosen et al. 2005; Foster et al. 2009).
14.9 Conclusion
Computational structural biology has provided
key advances in our understanding of
plant-pathogen interactions in recent years, there
has already been available data generated to
enrich our current understanding of identification
of new and corresponding candidate R genes,
and understand the molecular mechanisms
underlying infection. Structural studies of mod-
eled effector molecules provide information
especially about effector diversity, how effector
plasticity leads to diversity and aids to avoid host
recognition. Some of the computational tools
facilitate graphical visualization of virulence and
many other aspects related to adoption, host
recognition and other interesting aspects. Some
of the structure-related studies may lead to
identification of new genetic targets (pathogen
recognition binding sites) for the efficient man-
agement of late blight, to help in the develop-
ment of resistant potato varieties.
Acknowledgements Author greatfully
acknowledges the support from ICAR-CPRI,
Shimla, and the financial support from
NAIP-ICAR for this project.
References
Armstrong MR, Whisson SC, Pritchard L, Bos JI, Ven-
ter E, Avrova AO, Rehmany AP et al (2005) An
ancestral oomycete locus contains late blight aviru-
lence gene Avr3a, encoding a protein that is
280
recognized in the host cytoplasm. Proc Nat Acad
Sci USA 102:7766–7771
Ballvora A et al (2002) The R1 gene for potato resistance
to late blight (Phytophthora infestans) belongs to the
leucine zipper/NBS/LRR class of plant resistance
genes. Plant J 30:361–371
Black W, Mastenbroek C, Mills WR, Peterson LC (1953)
A proposal for an international nomenclature of races
of Phytophthora infestans and of genes controlling
immunity in Solanum demissum derivatives. Euphyt-
ica 2:173–178
Boutemy LS, Stuart R, King F, Win J, Richard K,
Hughes K, Thomas A, Clark MT, Blumenschein A,
Kamoun S, Banfield MJ (2011) Structures of Phy-
tophthora RXLR effector proteins: a conserved but
adoptable fold underpins functional diversity. J Biol
Chem 286:35834–35842
Champouret N (2010) Functional genomics of Phytoph-
thora infestans effectors and Solanum resistance
genes. Ph.D. Thesis University of Wageningen
Dodds PN, Lawrence GJ, Catanzariti AM, Teh T,
Wang CI, Ayliffe MA, Kobe B, Ellis JG (2006)
Direct protein interaction underlies gene-for-gene
specificity and coevolution of the flax resistance genes
and flax rust avirulence genes. Proc Natl Acad
Sci USA 103:8888–8893
Dongl JL, Jones JD (2001) Plant pathogens and integrated
defense responses to infection. Nature 411:826–833
Douches D, Bamberg J, Ir W, Jastrzebasi K, Neimira B
(2001) Evaluation of wild Solanum species for
resistance to the US-8 genotype of Phytophtera
infestans utilizing a fine screening technique. Am J
Potato Res 78:159–165
Flor FH (1974) Current status of the gene-for-gene
concept. Annu Rev Phytopathol 78:275–298
Foster SJ, Park TH, Pel M, Brigneti G, Sliwka J, Jagger L,
Van der Vossen EAG, Jones JDG (2009) Rpi-Vnt1.1,
a TM-22 a homolog from Solanum venturii, confers
resistance to potato late blight. Mol Plant-Microbe
Interact 22:601–615
Guo J (2008) Phytophthora infestans avirulence genes;
mapping, cloning and diversity in field isolates. Ph.D.
thesis, Wageningen University, The Netherlands,
p. 138
Haas et al (2009) Genome sequence and analysis of the
Irish potato famine pathogen Phytophthora infestans.
Nature 461:393–398
Hermsen JGTRM (1973) Double-bridge hybrids of
Solanum bulbocastanum and cultivars of Solanum
tuberosum. Euphytica 22:457–466
Hijmans RJ, Jacobs M, Bamberg JB, Spooner DM (2003)
Frost resistance in wild potato species: assessing the
predictability of taxonomic, geographic, ecological
factors. Euphytica 130:47–59
Hirsch CD, Hamilton JP, Childs KL, Cepela J, Crisovan E,
Vaillancourt B, Hirsch CN, Habermann M, Neal B,
Buell CR (2014) Spud DB: a resource for mining
sequences, genotypes, and phenotypes to accelerate
potato breeding. Plant Genome 7(1):0
S. S. Marla
Huang S, Van der Vossen EAG, Kuang H, Vleeshouw-
ers VGAA, Zhang N, Borm TJA, Van ECKHJ,
Backer B, Jackbsen E, Visser RGF (2005) Compar-
ative genomics enabled the isolation of R3a late blight
resistance gene in potato. Plant J 45:251–265
Huang S, Vleeshouwers VG, Werij JS, Hutten RC, van
Eck HJ, Visser RG, Jacobsen E (2004) The R3
resistance to Phytophthora infestans in potato is
conferred by two closely linked R genes with distinct
specificities. Mol Plant-Microbe Interact 17:428–435
Hulbert SH, Webb CA, Smith SM, Sun Q (2001)
Resistance gene complexes: evolution and utilization.
Annu Rev Phytopathol 39:285–312
Jones DA, Takemoto D (2004) Plant innate immunity-
direct and indirect recognition of general and specific
pathogen-associated molecules. Curr Opin Immunol
16:48–62
Jupe F, Pritchard L, Ehrington GJ (2012) Identification
and localization of the NBS-LRR gene family within
the potato genome. BMC Genom 13:75
Lozano R, Ponce O, Ramirez M, Mostazo N, Orzeda G
(2012) Genome wide identification and mapping of
NBS encoding resistance genes in Solanum tuberosum
group Phureja. PLoS ONE 7(4):e3475
Marone D, Russo MA, Laido A, Leonardis MD, Mas-
trangelo AM (2013) Plant nucleotide binding site–
leucine-rich repeat (NBS-LRR) genes: active guar-
dians in host defense responses. Inter J Mol Sci
14:7302–7326
Mestre P, Baulcombe DC (2006) Elicitor-mediated
oligomerization of the tobacco n disease resistance
protein. Plant Cell 18:491–501
Meyer M, Nagel A, Gebhardt C (2005) PoMaMo—a
comprehensive database for potato genome data.
Nucleic Acids Res 33:D666–D670
Meyers BC, Kozik A, Griego A, Kuang H, Michel-
more RW (2003) Genome-wide analysis of
NBS-LRR–encoding genes in Arabidopsis. Plant Cell
15:809–814
Park TH, Vleeshouwers VGAA, Jacobsen E, Visser RGF,
Van der Vossen EAG (2009) Molecular breeding for
resistance to Phytophthora infestans in potato. Plant
Breed 128:109–117
Potato Genome Sequencing Consortium (2011) Genome
sequence and analysis of the tuber crop potato. Nature
475:189–195
Raffaeles S, Win J, Cano I, Kamoun S (2010) Analysis of
genome architecture and gene expression revel novel
candidate virulence factors in the seccretome of
Phytophtera infestans. BMC Genom 11:637
Rehmany AP, Gordon A, Rose LE, Allen RL, Arm-
strong MR, Whisson SC, Kamoun S, Tyler BM,
Birch PRJ, Beynon JL (2005) Differential recognition
of highly divergent downy mildew avirulence gene
alleles by RPP1 resistance genes from two Arabidop-
sis lines. Plant Cell 17:1839–1850
Shandil RK, Chakrabharti SK, Singh BP, Sharma S,
Sunderasha S, Kaushik SK, Bhat KA, Sharma NN
(2017) Genotypic background of the recipient plant is
14 Structural Analysis of Resistance (R) Genes in Potato …
crucial for conferring RB gene mediated late blight
resistance in potato. BMC Genet 18:22
Shen QH (2007) Nuclear activiMLA immune receptors
links isolate-specific and basal disease resistance
responses. Science 315:1098–1103
Song J, Bradeen JM, Naes KS, Raasch JA, Weilgus SM,
Haberlach T, Liu JL, Kuang H, Austin-Philips S,
Buell RC, Helgeson JP, Jiang J (2003) Gene RB
cloned from Solanum bulbocastanum confers broad
spectrum resistance to potato late blight. Proc Natl
Acad Sci USA 100:9128–9133
Spooner DM, Bamberg JB (1994) Potato genetic
resources: sources of resistance and systematic. Am
Potato J 71:325–327
Van der Vossen EA, Gros J, Sikkema A, Muskens M,
Wouters D, Wolters P, Pereira A, Allefs S (2005) The
Rpi-blb2 gene from Solanum bulbocastanumis an
Mi-1 gene homolog conferring broad-spectrum late
blight resistance in potato. Plant J 44:208–222
Vleeshouwers VGAA, Raffaels S, Vossen JH (2011)
Understanding and exploiting late blight resistance in
281
the age of effectors. Annu Rev Phytopathol 49:507–
531
Vleeshouwers VGAA, Rietman H, Krenek P, Cham-
pouret N, Young C, Oh SK, Wang M,
Bouwmeester K, Vosman B, Visser RGF et al
(2008) Effector genomics accelerates discovery and
functional profiling of potato disease resistance and
Phytophthora infestans avirulence genes. PLoS ONE
3:e2875
Wan J (2008) A LysM receptor-lie kinase plays a critical
role in chitin signaling and fungal resistance in
Arabidopsis. Plant Cell 20:471–481
Yaeno T, Li H, Chapparo-Garcia A, Schornak S,
Koshiba S, Watanabe S, Kigawa T, Kamoun S,
Shirasu K (2011) Phosphatidylinositol
monophosphate-binding interface in the oomycete
RXLR effector AVR3a is required for its stability in
host cells to modulate plant immunity. Proc Nat Acad
Sci USA 108:14682–14687
 Genotyping-by-Sequencing in Potato
15
Chiheb Boudhrioua, Maxime Bastien, Gaétan Légaré,
Sonia Pomerleau, Jérôme St-Cyr, Brian Boyle
and François Belzile

Abstract
Genotyping-by-sequencing (GBS) is one of the most cost-effective
approaches to sequencing in potato (SNP) discovery and genotyping.
The reduction of genome complexity that is central to the GBS approach is
useful in the analysis of many plant genomes in which large size and
polyploidy can prove challenging. In previous work in our lab, GBS has
been explored and optimized on a tetraploid potato using two different
enzymatic approaches (ApeKI and PstI/MspI) and two modes of
genotyping (diploid and tetraploid) (Bastien et al., Submitted). This
chapter describes the GBS process, starting with library preparation to
sequencing data analysis and single nucleotide polymorphism (SNP) call-
ing and filtering of GBS-derived markers. It also presents examples of the
obtained results, an assessment of marker quality and their potential uses.

many crop species. Potato, with a genome

15.1 Introduction
Large genomes and polyploidy, either recent or
due to more ancient events, are two factors that
contribute to the complexity of genome analysis in
C. Boudhrioua
M. Bastien
F. Belzile (&)
Département de Phytologie and Institut de Biologie
Intégrative et Des Systèmes (IBIS), Université Laval,
Quebec City, QC G1V 0A6, Canada
e-mail: francois.belzile@fsaa.ulaval.ca
G. Légaré
S. Pomerleau
J. St-Cyr
B. Boyle
Plateforme d’Analyses Génomiques, Institut de
Biologie Intégrative et des Systèmes (IBIS),
Université Laval, Quebec City, QC G1V 0A6,
Canada
of *800 Mb is not particularly large, but its
autotetraploid nature does represent a challenge
for many analyses (Barrell et al. 2013). With four
allelic copies of each gene, there is the potential for
more than two alleles at a given locus, there are
five possible genotypic classes (AAAA, AAAB,
AABB, ABBB and BBBB) for each locus and,
because it is reproduced clonally, heterozygosity
is very common, contrary to the situation in spe-
cies in which varieties are fixed lines.
For these reasons, the development of efficient
large-scale genotyping approaches in potato is
somewhat lagging behind many other important
crops. In terms of highly parallel and high-
throughput assays, the two most commonly used

© Springer International Publishing AG 2017 283

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_15
284
approaches in crops are genotyping arrays (“SNP
chips”) and next-generation sequencing of a
selected fraction of the genome (“complexity
reduction” methods) (Bajgain et al. 2016). To
date, there have been two arrays developed for
genotyping potato. The Infinium 8303 Potato
Array (also known as the “SolCap array”) was
the first developed using sequencing data
obtained from the transcriptomes of six varieties
(Felcher et al. 2012). In total, this number of
SNPs was distributed in about 4500 genes as, on
average, 1.8 SNP markers/genes were included
in the array design. More recently, a 20 K Infi-
nium array (aka the “SolSTW array”) was
developed (Vos et al. 2015). The latter comprises
4454 SNPs from the SolCAP array as well as an
additional 15,138 SNPs derived from the targeted
sequencing of 807 genes (Uitdewellingen et al.
2013). It must be remembered, however, that
even in relatively large sets of accessions, not all
of these SNPs will prove informative. For
example, of the over 8 K SNPs on the SolCAP
array, only 3763 yielded a complete characteri-
zation of all five possible genotypes (“tetraploid
mode”) among a set of 250 potato clones (Hirsch
et al. 2013). Similarly, for the SolSTW array,
Vos et al. (2015) successfully called genotypes at
slightly over 15 K SNPs among a large and
diverse set of 569 potato clones.
Complexity reduction approaches typically
rely on capturing a reproducible subset of the
genome, usually through the use of restriction
enzymes (Davey et al. 2011). Although there are
slight differences in methodology, both
genotyping-by-sequencing (GBS) and RAD-Seq
rely on the sequencing of a set of restriction
fragments of a given size (usually between 150
and 400 bp). In potato, two such complexity
reduction approaches have been published to
date. Uitdewellingen et al. (2013) used a some-
what atypical GBS approach in which DNA was
fragmented and captured via in-solution
hybridization using probes derived from selec-
ted genes. Sequencing the captured genomic
segments from 84 potato accessions allowed the
detection of close to 130 K variants located
within a limited set of 807 genes. This represents
an atypical GBS approach as it relied on
C. Boudhrioua et al.
sequence capture to restrict the sequencing effort
to a non-random portion of the genome (i.e.
807 genic regions). In a recent RAD-Seq effort
reported by Jiang et al. (2016), the authors sought
to identify optimal enzyme combination leading
to the minimization of chloroplast and rDNA
sequences in their RAD-Seq libraries. The most
favourable enzyme combination (EcoRI and
MspI) made it possible to call *5 K informative
SNPs in a set of 12 potato genotypes.
In our own GBS work, we have explored
different enzyme combinations and determined
the number, read depth and amount of missing
data that result from these in potato (Bastien et al.
submitted). In addition, we have examined how
the chosen genotyping mode (diploid or tetra-
ploid) affects the number of informative SNP
markers obtained, as well as the ability to impute
missing data among the resulting data sets. As
described in what follows, we recommend the
use of the ApeKI protocol in diploid SNP calling
mode (i.e. AA, AB, BB) when there is a need to
maximize the number of SNPs and genome
coverage (e.g. for GWAS), albeit at the expense
of a full resolution of the genotypic state. When
it is important to benefit from a full characteri-
zation of the genotypic state (tetraploid mode)
(e.g. for QTL mapping), we recommend a
two-enzyme protocol (PstI/MspI); although it
results in fewer informative SNP loci, each of
these benefits from deep read coverage sufficient
to call the full array of possible genotypes.
The description of the GBS approach pro-
vided here will be subdivided into five major
procedures: (1) DNA extraction; (2) GBS library
preparation; (3) sequencing; (4) GBS data anal-
ysis; and (5) further SNP filtering. We will
conclude this chapter by an example in order to
illustrate the results that can be obtained.
15.2 Materials
15.2.1 DNA Extraction
1. Reagents
– DNeasy 96 plant kit, Qiagen or equivalent
– Liquid nitrogen
15 Genotyping-by-Sequencing in Potato 285

2. Required lab equipment complementary pairs and must be

– Equipment for tissue grinding:
TissueLyser
– Water bath or heating block (65 °C)
– Vortexer
– Centrifuge with Plate Rotor 2  96 (max.
6000 rpm).
15.2.2 GBS Library Preparation
and Sequencing
1. Oligonucleotides
– The oligonucleotides used to prepare
barcoded adapters are ordered as normal
oligonucleotides at the 25-nM scale with
standard desalting (to be shipped dried).
Order oligonucleotides to prepare bar-
coded oligonucleotides in complementary
plates, one for the top and one for the
bottom strand. Having corresponding
wells in two different plates makes the
production of double-stranded adapters
much easier (Tables 15.1 and 15.2).
– The oligonucleotides used to prepare the
common adapter are ordered as normal
oligonucleotides at the 1-µmole scale with
standard desalting. For each adapter, two
oligonucleotides are ordered in
annealed to form the double-stranded
adapter (Table 15.1).
2. Enzymes
We purchase MspI (R0106L), Hi-fidelity PstI
(R3140L), ApeKI (R0643L), T4 DNA ligase
(M0202L) and Q5 High-fidelity polymerase
(M0491L) from New England Biolabs.
3. Solutions
– Elution buffer (EB): 10 mM Tris-Cl pH
8.0
– 10X Annealing buffer (10X AB): 500 mM
NaCl, 100 mM Tris-Cl pH 8.0
– 80% ethanol freshly prepared
4. Other reagents
– Qiaquick PCR Purification Kit or
equivalent
– Axygen PCR Clean Up kit or equivalent
– Quant-iT Picogreen dsDNA assay kit or
equivalent
5. Required lab equipment
– Thermocycler
– Magnet for magnetic bead purification
– BluePippin or Pippin prep
– Bioanalyzer or equivalent
– Ion Proton sequencer
6. Recommended lab equipment
– Mix mate
– Repeater stream with advanced combitips
– Ion CHEF

Table 15.1 Oligonucleotide sequences

Oligonucleotide
Top barcoded oligo PstI
Bottom barcoded oligo PstI
Top common adapter MspI
Bottom common adapter MspI
Top barcoded oligo ApeKI
Bottom barcoded oligo ApeKI
Top common adapter ApeKI
Bottom common adapter
ApeKI
Ion forward PCR primer
Ion reverse PCR primer
Sequence
5’-CCCTGCGTGTCTCCGACTCAG-[Barcode]-GATTGCA
5’-ATC-[Barcode Reverse Complement]-CTGAGTCGGAGACACGCAGGG
5’-CGAGATCGGAAGAGCGGGGAGCTTAAGC
5’-CCTCTCTATGGGCAGTCGGTGATCCCGCTCTTCCGATCT
5’-CCCTGCGTGTCTCCGACTCAG-[Barcode]-GAT
5’-CWGATC-[Barcode Reverse Complement]-
CTGAGTCGGAGACACGCAGGG
5’-CWGAGATCGGAAGAGCGGGGAGCTTAAGC
5’-CCTCTCTATGGGCAGTCGGTGATCCCGCTCTTCCGATCT
5’-CCATCTCATCCCTGCGTGTCTCCGACTCAG
5’-CCACTACGCCTCCGCTTTCCTCTCTCTATGGGCAGTCGGTGAT
 286

Table 15.2 Barcode sequences

CTAAGGTAAC TCTATTCGTC TCGCATCGTTC CGGACAATGGC TTCCTACCAGTC CTAGGACATTC
TAAGGAGAAC AGGCAATTGC TAAGCCATTGTC TTGAGCCTATTC TCAAGAAGTTC CTTCCATAAC
AAGAGGATTC TTAGTCGGAC AAGGAATCGTC CCGCATGGAAC TTCAATTGGC CCAGCCTCAAC
TACCAAGATC CAGATCCATC CTTGAGAATGTC CTGGCAATCCTC CCTACTGGTC CTTGGTTATTC
CAGAAGGAAC TCGCAATTAC TGGAGGACGGAC TCCACCTCCTC TGAGGCTCCGAC TTGGCTGGAC
CTGCAAGTTC TTCGAGACGC TAACAATCGGC CAGCATTAATTC CGAAGGCCACAC CCGAACACTTC
TTCGTGATTC TGCCACGAAC CTGACATAATC TCTGGCAACGGC TCTGCCTGTC TCCTGAATCTC
TTCCGATAAC AACCTCATTC TTCCACTTCGC TCCTAGAACAC CGATCGGTTC CTAACCACGGC
TGAGCGGAAC CCTGAGATAC AGCACGAATC TCCTTGATGTTC TCAGGAATAC CGGAAGGATGC
CTGACCGAAC TTACAACCTC CTTGACACCGC TCTAGCTCTTC CGGAAGAACCTC CTAGGAACCGC
TCCTCGAATC AACCATCCGC TTGGAGGCCAGC TCACTCGGATC CGAAGCGATTC CTTGTCCAATC
TAGGTGGTTC TCGACCACTC TGGAGCTTCCTC TTCCTGCTTCAC CAGCCAATTCTC TCCGACAAGC
TCTAACGGAC CGAGGTTATC TCAGTCCGAAC CCTTAGAGTTC CCTGGTTGTC CGGACAGATC
TTGGAGTGTC TCCAAGCTGC TAAGGCAACCAC CTGAGTTCCGAC TCGAAGGCAGGC TTAAGCGGTC
TCTAGAGGTC TCTTACACAC TTCTAAGAGAC TCCTGGCACATC CCTGCCATTCGC TTCGCAATGAAC
TCTGGATGAC TTCTCATTGAAC TCCTAACATAAC CCGCAATCATC TTGGCATCTC TTCCGCACGGC
CGAAGGCCACAC TTGGAGGCCAGC TTGGCCAATTGC TCTAGTTCAAC
C. Boudhrioua et al.
15 Genotyping-by-Sequencing in Potato
15.3 Methods
15.3.1 DNA Extraction
1. High molecular weight genomic DNA is
extracted from 50 mg (fresh weight) of young
leaves. If used fresh, tissues need to be frozen
(with liquid nitrogen) just prior to sample
grinding. More conveniently, leaf samples
(cuttings, punches) are dried directly in
wells/Eppendorf tubes in the presence of sil-
ica gel. Grinding is performed either with
small disposable plastic pestles in Eppendorf
tubes or using a mixer mill for 96-well plates,
in which case one tungsten bead is included
in each well containing leaf tissue. DNA of
the highest purity can be obtained using a
commercial kit, but CTAB-based protocols
can also be used successfully.
2. The DNA concentration (ng/µL) of each
sample is measured with a spectrophotometer
(Nanodrop 1000, Fisher Scientific) for sam-
ples devoid of RNA contamination (prepared
with a kit). For samples obtained with
CTAB-based protocol, we may have some
residual RNA. In the latter case, using a
fluorometric quantification method (e.g.
PicoGreen) may prove more precise (see note
1). A total of 200 ng per sample is used for
the preparation of the GBS libraries.
15.3.2 GBS Library Preparation
This part will consist of (1) common and bar-
coded adapter preparation (see note 2); (2) com-
plexity reduction using enzymes; and
(3) multiplexing using barcoded adapters. The
described protocol is largely inspired from the
original procedure developed in the Poland Lab
(Poland et al. 2012). We have mainly optimized
and improved the procedure over time. In what
follows, we will describe a “standard” procedure
based on 96-plex library preparation and
sequencing (see note 3).
287
1. Double-stranded barcoded adapter prepara-
tion (Stock BC adapter plate—0.1 µM final)
– Re-suspend dried single-stranded
oligonucleotides to 100 uM in EB.
– In a PCR plate, make 100 µl of 10 µM
double-stranded barcoded adapters by
mixing:
• 10 µL of top single-stranded oligo at
100 µM
• 10 µL of bottom single-stranded oligo
at 100 µM
• 10 µL of 10X AB
• 70 µL of H20
– Seal the plate, mix using a mixmate, then
spin down.
– In a thermocycler, heat to 95 °C for
1 min, then cool down to 30 °C at the rate
of 1 °C per minute, then hold at 4 °C. (see
note 4).
– Dilute 1/10 using 1X AB (see note 5).
– Repeat step 4 once to bring barcoded
adapters to 0.1 µM.
2. Common adapter preparation (10 µM final):
– Re-suspend dried single-stranded
oligonucleotides to 100 µM in EB.
– In a PCR plate, make 100 µL of 10 µM
double-stranded common adapter by
mixing:
• 10 µL of top single-stranded oligo at
100 µM
• 10 µL of bottom single-stranded oligo
at 100 µM
• 10 µL of 10X AB
• 70 µL of H20
– Seal the plate, mix with mixmate, then
spin down.
– In a thermocycler, heat to 95 °C for 1 min
and then cool at the rate of 1 °C per
minute, then hold at 4 °C.
3. Make working adapter plates:
– Each well in the working adapter plates
will have 0.02 µM of a unique barcoded
adapter and 1 µM of the common adapter.
– In a 96-well plate, add:
• 20 µL barcoded adapters at 0.1 µM
(from 1)
288
• 10 µL common adapter at 10 µM
(from 2)
• 10 µL 10X AB
• 60 µL water
– Mix well and spin down.
4. Normalize DNA and prepare sample plates:
– Quantify sample genomic DNA (see
note 1).
– Prepare sample plates so each well con-
tains 10 µL of DNA at a 20 ng/µL con-
centration (200 ng total). These plates will
be used directly for further steps so ensure
they are compatible with available
thermocyclers.
5. Restriction digest:
This protocol uses a double-digest with PstI
and a second enzyme MspI. Barcoded adap-
ters will be ligated to the PstI overhang while
the common adapter will be ligated to the
MspI overhang (see note 6).
– To each well of the sample plates prepared
in 4 add (see note 7):
• 3 µL CutSmart buffer (supplied with
NEB restriction enzymes)
• 5 units PstI HiFi
• 5 units MspI
• Complete to 30 µL with water
– Mix well and spin down.
– Incubate in a thermocycler at 37 °C for
2 h, then hold at 8 °C (see note 8).
– Proceed immediately with adapter
ligation.
6. Ligate adapters to cut genomic DNA:
The ligation is carried out directly in the same
reaction plate without the need for reaction
clean-up.
– To each well of the restriction digest
plates prepared in 5, add (see note 9):
• 5 µL of 10X T4 DNA ligase reaction
buffer (supplied with T4 DNA ligase)
• 400 units of T4 DNA ligase
• 5 µL from the corresponding well of
the working adapter plate prepared in
step 3 (see note 10)
• Complete to 50 µL with water
– Mix well, spin down, and incubate at 22 °C
for 2 h, then 65 °C for 20 min and hold at
8 °C when completed (see note 11).
C. Boudhrioua et al.
7. Pool and clean samples:
– Pool 5 µL from 48 reaction wells into a
1.7 mL tube (columns 1–6).
– Repeat step 1 for the other 48 reaction
wells (columns 7–12).
– Add 1.2 mL of Qiagen PB buffer to each
1.7 mL tube.
– Mix well using a vortex and spin down.
– Load 750 µL on a Qiaquick column.
– Spin for 15 s.
– Discard flow-through.
– Repeat steps 5–7 until the complete vol-
ume from the two tubes has been loaded
to the column.
– Wash column with 750 µL of PE, spin
1 min, discard flow-through.
– Rotate column and spin 1 min to remove
all traces of PE.
– Transfer column in a new 1.7 mL tube.
– Add 30 µL of EB to the center of the
column, let stand for 1 min., then spin
1 min to elute the pooled library.
8. Size the library using a BluePippin:
– Add 10 µL of BluePippin buffer to the
eluted library from 7.
– Follow BluePippin instructions for load-
ing on a 2% cassette (BEF2010).
– We set elute times from 46–60 min.
– You should retrieve about 50–60 µL per
library that would be sufficient for multi-
ple PCR reactions.
9. PCR amplification and enrichment:
Appropriate primers complementary to the
ligated adapters are added and PCR is per-
formed to amplify the pool of restriction
fragments (see note 12).
– For each library prepare the amplification
mix:
• 22.9 µL of water
• 10 µL of 5X Q5 buffer
• 10 µL of Q5 enhancer solution
• 1 µL of 10 mM Dntp
• 0.3 µL of 10 µM FWD IonExpress
Primer
• 0.3 µL of 10 µM REV IonExpress
Primer
• 5 µL of DNA from step 3.2.8
• 0.5 µL of Q5 polymerase
15 Genotyping-by-Sequencing in Potato 289

– Mix well and spin down. – Re-suspend dried beads in 30 µL of EB,

– Run the following PCR Program: let stand for 2 min.
• 75 °C for 5 min. – Put on magnet and wait 5 min for beads to
• 5 cycles of: pellet.
98 °C 10 s – Transfer your eluted library to a new tube.
55 °C 30 s Be careful not to carry over beads.
72 °C 30 s 10. Quality control:
• 7 cycles of: – We perform a Nanodrop quantification
98 °C 10 s right after purification. Expect between 5
65 °C 30 s and 20 ng/µL.
72 °C 30 s – The most important quality control is a
• 72 °C 5 min Bioanalyzer trace (or equivalent). High
• Hold at 4 °C quality libraries will look like Bart
– Add 50 µL of Axygen PCR clean-up kit Simpson’s hairdo, meaning relatively
and mix well, transfer to a 1.5 mL tube. sharp edges with spikes on top. There
– Let stand for 5 min at room temperature. should be no primer dimers located
– Put on magnet for 2 min. around 100–110 nt. Background after
– Remove the liquid without disturbing the 400 bases should be flat. A large
magnetic beads. camelback hump from 500–2000 bases is
– While keeping the tube on the magnet, indicative of PCR over-cycling
wash the pellet twice with 1 mL of freshly (Fig. 15.1).
prepared 80% ethanol. – Quantify the library with PicoGreen or
– Remove all traces of ethanol and let dry equivalent (see note 13). Convert con-
for 10–15 min. centration from ng/µL to nM (see note
– Remove from magnet. 14). Dilute library to 200 pM.

Fig. 15.1 An example of a high quality library

290
15.3.3 Sequencing
Typically, each 96-plex library is sequenced on a
single Ion PI chip yielding >70 M reads with a
median length of 140–160 bp. If deeper coverage
is required, the same library can be loaded onto
additional chips to provide a larger number of
reads per sample.
1. Load Ion CHEF and perform Ion Proton
Sequencing:
The sequencing reaction will proceed from
the barcoded adapter. Follow the manufac-
turer’s instructions to load the Ion CHEF and
Ion Proton Sequencer.
– Load 25 µL of a 200 pM GBS library.
Our experience has shown that it gener-
ates good sequencing runs (Fig. 15.2).
– Run the FastqCreator plugin when the
sequencing run is completed to generate
the fastq file.
– Compress the fastq file using gzip to move
the data from the Ion Server to the data
analysis server.
15.3.4 GBS Data Analysis
For this analysis, two different modes can be
used to call variants: a diploid mode or a tetra-
ploid mode (see note 15). This step is carried out
Fig. 15.2 A run summary for one chip Ion Torrent (Proton)
C. Boudhrioua et al.
using various bioinformatics tools (SABRE,
BWA, PLATYPUS, VCFtools, etc.) included in
the Fast-GBS pipeline (https://bitbucket.org/
jerlar73/fastgbs). For calling SNPs in tetraploid
mode, an additional software, Freebayes (https://
github.com/ekg/freebayes), is needed.
Prior to feeding the fastq files into the pipe-
line, check the quality (see note 16) of the raw
sequences using FastQC (http://www.
bioinformatics.babraham.ac.uk/projects/fastqc/)
or Galaxy (https://usegalaxy.org/).
1. Diploid mode:
– As explained in the Fast-GBS page, we
first need to create four directories: re-
fgenome, data, barcodes and results and
put the appropriate files in the first three:
(i) the reference genome with the com-
panion index file; (ii) the raw Fastq
sequences in compressed format (.gz); and
(iii) the barcode sequences with the cor-
responding sample name.
– Using the appropriate parameter file, the
Fast-GBS pipeline is run. Default options
can be used, however, one can change
them depending on the nature of the data.
Also, some basic filtrations are included in
the pipeline by default:
• Minimum read length to keep: 50
nucleotides
• Minimum size of bam file (per sam-
ple): 3000 kilobytes
15 Genotyping-by-Sequencing in Potato
• Sequencing depth (minimum number
of reads supporting a variant): two
reads
• Maximum amount of missing data
tolerated per locus: 80%
• The Fast-GBS variant file (.vcf) is
stored in the results directory already
created. By default, with Fast-GBS,
genotypes are called in diploid mode.
2. Tetraploid mode:
– As in diploid mode, the same steps are
used to run Fast-GBS but only to generate
the alignment files (.s4.bam) needed for
the rest of the analysis.
– Using the alignment files (.s4.bam) as an
input, genotype calls in tetraploid mode
are conducted using the default parameters
of Freebayes. The ploidy level must be set
to four and a minimum of three reads
supporting an alternate allele is required to
call a polymorphism.
15.3.5 Further SNP Filtering
Using VCFtools (http://vcftools.sourceforge.net/)
and an in-house script (see note 17), quality fil-
ters are applied to the raw variants file in order to
select SNPs of superior quality. In potato, it
depends on the enzymatic approach, the geno-
type mode and the eventual use of these variants.
The main filters used are:
– Preserve SNP markers only, i.e. eliminate
indels.
– A filter based on the number of reads sup-
porting each genotype call. When using the
ApeKI GBS protocol, 11 reads are required to
call a genotype in either diploid or tetraploid
mode. Using PstI/MspI, a more stringent filter
can be applied in tetraploid mode with 11
reads supporting a homozygote and 53 reads
per heterozygous genotype.
– A filter based on the proportion of missing
data. The thresholds for missing data can be
fixed between 10–20%. The choice of
threshold depends on the population and the
291
number of markers needed. For example, if
we are studying a panel of cultivated potato,
linkage disequilibrium (LD) can be much
shorter compared to a population derived
from a biparental cross, thus more markers
are needed.
– The minor allele frequency (MAF) is the
frequency of the less common allele in a
population. The choice of the MAF threshold
will depend on the nature of your population
and eventual use of the data. To describe
population structure and kinship, we may be
interested in keeping even rare alleles as these
may refine the relationships between lines. In
such a case, we can use a MAF as low as 1%.
For an association panel, we more typically
use minimal MAF values between 5 and
10%.
15.3.6 Example
To illustrate the type of results obtained with
such a protocol, we applied GBS on two sets of
potato germplasm. To first compare the efficacy
of two different GBS library preparation proto-
cols (ApeKI and PstI/MspI), we used a small set
of 8 clones (Set A). In a second stage, we
genotyped a much larger collection (Set B) of
375 clones representing the extent of diversity
present in a public potato breeding program in
the province of Quebec in Canada.
1. DNA was extracted from 50 mg of fresh
young leaves using the DNeasy 96 Plant kit
(Qiagen). DNA concentrations were normal-
ized to 20 ng/µl and subsequently used for
library preparation.
2. Eight potato samples (Set A) were sequenced
as part of a 48-plex GBS library. The GBS
libraries were prepared with both the ApeKI
and PstI/MspI enzymes.
3. For set B (375 clones), three 96-plex and one
87-plex ApeKI libraries were prepared.
4. For all libraries, single-end sequencing was
performed on an Illumina HiSeq 2000. Since
this initial work, we have adopted the Ion
292 C. Boudhrioua et al.

Torrent sequencing technology, and the pro-
tocols described herein are for this type of
sequencing.
5. For Set A, sequencing yielded approximately
19.1 million reads and 19.6 million reads in
total with ApeKI and PstI/MspI respectively.
About 72.1% and 75.4% of the reads were
successfully mapped to the potato reference
genome v.4.03.
6. These reads obtained after preparing and
sequencing GBS libraries with two different
restriction-enzyme combinations (ApeKI and
PstI/MspI) were used to call genotypes in
either diploid or tetraploid mode. We kept
only SNPs with fewer than 12.5% missing
data. SNPs with a minor allele frequency
below 10% (diploid) or a minor allele count
(tetraploid) below three were also removed 9. A total of 670.3 million reads obtained for GBS
(Fig. 15.3).
7. In diploid mode, 11 reads were required to
keep a genotype with the two
restriction-enzyme combinations. Markers
were then filtered on the percentage of miss-
ing data from 0 to 50% (Table 15.3). In
general, ApeKI yielded 2.5 to 3 times more
markers than PstI/MspI but these genotype
calls were based on 2 to 3 times fewer reads. 10. To assess the accuracy of GBS-derived
8. In tetraploid mode, a stringent filter was
applied with 11 reads required to support a
homozygous call and 53 reads needed to
distinguish the three heterozygous genotype
classes. Markers were then filtered according
to the percentage of missing data, from 0–
50% (Table 15.4). This filter considerably
reduced the number of markers obtained
using ApeKI compared to PstI/MspI. These
results are due to the fact that this enzyme
cuts frequently in the genome, thereby
increasing the number of loci examined and
concomitantly reducing the number of reads
supporting a genotype call at each locus.
Thus, under conditions used in this study,
PstI/MspI would be recommended over
ApeKI to call genotypes in tetraploid mode,
while the ApeKI protocol maximizes the the
number of markers that can be called in
diploid mode.
libraries prepared for Set B (375 lines) were
used to call markers in diploid mode. After
removing genotype calls supported by fewer
than 11 reads, indels and markers with more
than 20% missing data, 42,786 markers were
left. Markers having a minor allele frequency
below either 1% or 5% were also eliminated,
yielding respectively 22,545 and 15,424 SNPs.
genotype calls, we selected 52 lines from
Set B. Among these, 126 markers with
diploid genotype calls for these lines were in

35
30
Thousads of SNP

25
20
15
10
5
0
ApeKI PstI/MspI ApeKI PstI/MspI
Diploid mode Tetraploid mode

Fig. 15.3 Number of informative SNP markers obtained among eight potato genotypes using two restriction-enzyme
combinations and two SNP-calling modes. In all cases, SNP markers with fewer than 12.5% missing data and with a
minor allele frequency above 10% (diploid) or a minor allele count (tetraploid) above three were kept
 15 Genotyping-by-Sequencing in Potato 293

Table 15.3 Number of markers and depth of coverage per scored genotype in diploid mode as a function of the
percentage of missing data
% missing ApeKI PstI/MspI
data Number of Mean read depth per Number of Mean read depth per
markers genotype markers genotype
0 27,263 33 15,615 112
 12.5 40,631 30 18,682 103
 25 51,943 28 20,961 98
 50 74,308 26 24,817 92

Table 15.4 Number of markers and depth of coverage per scored genotype in tetraploid mode as a function of the
percentage of missing data
% missing ApeKI PstI/MspI
data Number of Mean read depth per Number of Mean read depth per
markers genotype markers genotype
0 199 98 6024 170
 12.5 461 78 7335 157
 25 753 70 8133 150
 50 1621 62 9148 144

common with the Infinium 8 K array. Com- frequency above 5% (Fig. 15.4). The tree
parison between the two approaches was showed that clones belonging to the same
conducted on this data set and showed a market classes tended to group together.
match rate of 90.4% between the two geno- 12. SNP catalogues obtained via a GBS approach
typing approaches. can be used for several analyses and appli-
11. A phylogenetic tree for these 52 lines was cations in potato such as association analysis,
created based on 15,202 high-quality markers analysis of genetic diversity and structure
with diploid genotype call and a minor allele (Bastien et al., submitted).
294 C. Boudhrioua et al.

Fig. 15.4 Neighbour-Joining tree of 52 potato lines based on 15,202 SNP markers with diploid genotype calls.
Color-coding reflects major market classes (red: chip processing; purple: pigmented; green: French fry processing; light
blue: round white table; brown: table Russet; yellow: yellow flesh)

Notes appropriate primers. Table 15.2 lists adapter

1. DNA concentration and quality are critical in
order to produce a stable number of sequence
tags from each sample. It is recommended
that DNA be quantified using a
florescence-based quantification method such
as PicoGreen and Qubit. DNA quality can be
assessed using a spectrophotometer and the
observation of the 260/230 and 260/280 ratios
which should be above 1.7. Do not neces-
sarily throw away DNAs that do not meet the
highest standards, ensure that they are well
quantified and they might just work.
2. Table 15.1 lists primer sequences for both the
ApeKI and PstI/MspI procedures. Use
sequences, adapter sequences containing bold
characters are not suitable for the ApeKI
procedure, therefore additional barcode
sequences were added.
3. Different levels of multiplexing can be used:
48-plex, 96-plex, 192-plex and 384-plex. The
choice will depend on the depth of coverage
you want to achieve (decreases with increased
multiplexing) and the budget you have (cost
per sample decreases with increasing multi-
plexing). For Illumina library preparation,
follow the procedures described either in
Elshire et al. (2011) (ApeKI) or Poland et al.
(2012) (PstI/MspI). To improve data quality,
add a size-selection step using a BluePippin
15 Genotyping-by-Sequencing in Potato
apparatus (step 8 from our procedure) with
time settings from 50–65 min because Illu-
mina adapters are longer than Ion proton
adapters.
4. Annealed oligonucleotides at a 10 µM con-
centration are very stable and can be stored at
−20 °C indefinitely.
5. The original procedure recommended that
adapters should be quantified after annealing
to ensure that the double-stranded DNA for-
mation was complete and they are at the
correct concentration. Uniform concentration
of adapters was believed critical to producing
uniform numbers of reads between samples
when sequencing the multiplexed library. We
have not observed significant differences
between wells and no longer perform quan-
tification at this stage. Uniformity could be
linked to the choice of the oligonucleotide
provider.
6. For the ApeKI single digest, barcoded adap-
ters will be ligated to one end of fragments
while the common adapter will be ligated to
the other end. Only those fragments will
amplify at the PCR stage. Fragments with
other combinations (barcoded-barcoded or
common-common) will be lost. To each well
of the sample plates prepared in step 4 add
(see note 5):
– 3 µL NEB 3.1 buffer (supplied with NEB
ApeKI)
– 5 Units ApeKI
– Complete to 30 µL with water.
– Mix well and spin down.
– Incubate in a thermocycler at 75 °C for
2 h, then hold at 8 °C (see note 5).
– Proceed immediately with adapter
ligation.
7. It is easier to prepare a master mix (buffer,
enzymes and water), then add 20 µL of it to
each well of the samples plates. Prepare at
least an extra 10% of the master mix. We use
an Eppendorf stream repeater with 1 mL
combitips advanced to distribute the
mastermix.
8. The original procedure had a 20 min at 80 °C
step to heat-inactivate the restriction
enzymes. PstI HiFi, MspI and ApeKI cannot
295
be heat-inactivated so this step is not
required. Also note that adapters, by design,
do not contain sites for restriction enzymes
used and once ligated to a matching end, they
are designed not to be recleaved.
9. It is easier to prepare a master mix (buffer,
enzymes and water), then add 15 µL of it to each
well of the samples plates. Prepare at least an
extra 10% of the master mix. We use an
Eppendorf stream repeater with 1 mL combitips
advanced to distribute the mastermix. Remem-
ber that adapters must be added separately.
10. The original procedure called for adjusting
adapter concentration depending on the spe-
cies. We have used the specified concentra-
tions of adapters with over 100 species
covering a large portion of the life kingdom
that includes fungi, insects, plants and ani-
mals without a single adjustment. However,
restriction enzyme combinations might not be
optimal for all species and this becomes
particularly true when the restriction enzymes
hit highly repeated elements, in this case,
changing the restriction enzyme combinations
is a better choice than trying to adjust the
concentration of adapters. Also note that it is
essential that the common adapter is added to
at least 20-fold excess compared to the bar-
coded adapter to cover the difference in cut
frequency between PstI and MspI.
11. Completed ligation can be safely stored at
−20 °C.
12. Only fragments that have ligated adapters to
both a PstI cut-site and an MspI cut-site will
amplify. Keep the number of PCR cycles low
to avoid undetectable PCR duplication
events. It is better to perform multiple PCR
reactions to increase yield rather than
increasing the number of PCR cycles. We
routinely perform three or four PCR reactions
per GBS library. It is highly recommended to
physically isolate pre-PCR and post-PCR
operations to prevent contamination.
13. It is important to quantify libraries using a
standardized methodology as this measure-
ment will be used to load the precise amount
of molecules on the sequencing instrument.
Therefore, ensure that the methodology is
 296
sensitive and falls well within the linear
quantification range.
14. To convert ng/µL DNA concentration to nM:
[nM DNA] = DNA concentration (ng/µL) x
106 (µL/L)/(Sample fragment size in bp x
656.4 (g/mole)).
15. A diploid model defines three marker classes
for each SNP (AA, AB and BB); a tetraploid
model has five marker classes (AAAA,
AAAB, AABB, ABBB and BBBB).
16. The scoring system of each base is known as
the Phred score. This score ranges from 0–64.
17. In-house scripts must be used to filter variants
in tetraploid mode according to number of
reads supporting the genotype and the minor
allele frequency (MAF). Filtering according
to missing data is possible using VCFtools.
References
Bajgain P, Rouse MN, Anderson JA (2016) Comparing
Genotyping-by-Sequencing and single nucleotide
polymorphism chip genotyping for quantitative trait
loci mapping in wheat. Crop Sci 56(1):232–248
Barrel PJ, Meiyalaghan S, Jacobs JME, Conner AJ (2013)
Applications of biotechnology and genomics in potato
improvement. Plant Biotechnol J 11(8):907–920
Bastien M, Boudhrioua C, Fortin G, Belzile F Exploring
the potential and limitations of genotyping-
by-sequencing for SNP discovery and genotyping in
tetraploid potato. Submitted to Genome.
C. Boudhrioua et al.
Davey JW, Hohenlohe PA, Etter PD, Boone JQ,
Catchen JM, Blaxter ML (2011) Genome-wide genetic
marker discovery and genotyping using next-
generation sequencing. Nat Rev Genetics 12:499–510
Elshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K
et al (2011) A robust, simple genotyping-
by-sequencing (GBS) approach for high diversity
species. PLoS ONE 6(5):e19379
Felcher KJ, Coombs JJ, Massa AN, Hansey CN, Hamil-
ton JP, Veilleux RE, Buell CR, Douches DS (2012)
Integration of two diploid potato linkage maps with
the potato genome sequence. PLoS ONE 7(4):e36347
Hirsch CN, Hirsch CD, Felcher K, Coombs J, Zarka D,
Van Deynze A, De Jong W, Veilleux RE, Jansky S,
Bethke P, Douches DS, Buell CR (2013) Retrospec-
tive view of north American potato (Solanum tubero-
sum L.) breeding in the 20th and 21st centuries. G3
(Bethesda):1003–1013
Jiang N, Zhang F, Wu J, Chen Y, Hu X, Fang O,
Leach LJ, Wang D, Luo Z (2016) A highly robust and
optimized sequence-based approach for genetic poly-
morphism discovery and genotyping in large plant
populations. Theor Appl Genet 129:1739–1757
Poland J, Endelman J, Dawson J, Rutkoski J, Wu S,
Manes Y, Dreisigacker S, Crossa J, Sánchez-Villeda
H, Sorrells M, Jannink JL (2012) Genomic selection in
wheat breeding using genotyping-by-sequencing. The
Plant Genome 5(3):103–113
Uitdewilligen JGAML, Wolters A-MA, D’hoop BB,
Borm TJA, Visser RGF, van Eck HJ (2013) A Next-
Generation Sequencing Method for Genotyping-by-
Sequencing of Highly Heterozygous Autotetraploid
Potato. PLoS ONE 8(5):e62355
Vos PG, Uitdewilligen JGAML, Voorrips RE, Vis-
ser RGF, van Eck HJ (2015) Development and
analysis of a 20 K SNP array for potato (Solanum
tuberosum): an insight into the breeding history. Theor
Appl Genet 128:2387–2401
 Genomics in True Potato Seed
(TPS) Technology: Engineering 16
Cloning Through Seeds

Jagesh Kumar Tiwari, Satish K. Luthra, Vinod Kumar,

Vinay Bhardwaj, R.K. Singh, J. Sridhar, Rasna Zinta
and Shambhu Kumar

Abstract
Tuber is the main planting material for commercial potato production.
Besides, true potato seed (TPS), i.e. true botanical seed is another
technology of potato. The TPS-raised crop has several advantages over the
tuber-raised crops but due to the certain limitations of the conventional
TPS technology, it could not be popularized, as expected the world over.
The major drawbacks are non-uniformity of crop and tuber characters,
lengthy crop duration, and labour-intensive farming due to seedling
raising and transplanting. To address these issues, this chapter highlights a
brief overview of the production of hybrid TPS, applying genomics
approaches to engineer cloning through apomixis seeds, and offers the
prospect of F1 hybrid potato technology.

16.1 Introduction

Global annual potato crop production has had a

massive increase from 160 to 374 million tonnes
with a slight increase in its productivity (12.4–
J. K. Tiwari (&)
V. Bhardwaj
R. K. Singh
J. Sridhar
R. Zinta 19.4 t/ha) during the last six decades. Potato is
ICAR-Central Potato Research Institute, Shimla mainly propagated through tubers. The tuber is
HP, India the most cost-intensive input which amounts to
e-mail: jageshtiwari@gmail.com nearly half of the total production cost. Due to
S. K. Luthra high production costs, the bulky nature of tubers,
ICAR-Central Potato Research Institute Campus, the logistic problems in storage and transport,
Modipuram, Meerut, UP, India
and the inadequate availability of quality seed
V. Kumar tubers, the replacement rate is very low and
ICAR-Central Potato Research Station,
Kufri-Shimla, HP, India therefore the previous season’s old tubers are
grown, especially in the developing nations. As a
S. Kumar
ICAR-Central Potato Research Station, Patna result, viral diseases perpetuate in the infected
Bihar, India tubers and ultimately result to loss of crop yield.

© Springer International Publishing AG 2017 297

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_16
298
Although to produce quality planting materials in
a country like India, seed tubers are produced
through a seed-plot technique in the plains under
a low aphid period zone to minimize virus-vector
transmission and minimal viral infections.
Besides, such natural conditions are also found in
the high hills (>2000 m above mean sea level)
where quality seed production is practised.
However, due to the low multiplication rate
(usually 6–8 times), this is less than can meet the
seed demands of the country (Upadhyay 1983).
Moreover, in the changing climatic scenario, the
window for seed production is likely to shrink
and the pressure of pathogens might increase in
the near future, which will limit the production of
quality planting material. Alternatively, true
potato seed (TPS) is a promising technology
which has shown potential to produce both
disease-free planting material in true seeds form
and in a form easy to carry like tomato seeds.
Conventional TPS technology has not been
proved successful. Therefore, this chapter high-
lights applications of new genomics tools via
apomixis technology and F1 hybrid technology
in potato production.
16.2 Conventional TPS Technology
True potato seed (TPS) is the botanical seed of
potato, which is produced by bi-parental sexual
crossing. TPS is extracted from a fruit called the
‘berry’ and *200–250 seeds could be found in a
single berry, and 1 g TPS weigh up to *1500–
2000 seeds. In India, there are three hybrid TPS
populations: TPS C3 (JT/C-107  EX/A-680-16),
HPS-1/13 (MF-1  TPS-13), and 92-PT-27
(83-P-47  D-150), which are recommended for
commercial potato cultivation in the country. These
are mainly grown in the north-eastern states of the
country, where quality seed tubers are not available.
Breeding, production and agronomy of TPS are
beyond the scope of this chapter, so can be refer-
enced elsewhere (Gaur 1999; Almekinders et al.
2009; Kumar et al. 2009). Figure 16.1 shows the
potato flower, fruit (berry) and TPS.
J. K. Tiwari et al.
16.2.1 Advantages of Conventional
TPS
There are several advantages of TPS technology,
as given below:
• TPS is a healthy and disease-free planting
material, however, it may transmit potato spin-
dle tuber viroid (PSTVd) and potato virus T.
• TPS is cheaper (nearly 1/10 cost of seed
tubers) and affordable for small and marginal
farmers.
• It is easy to store for planting, lasting even up
to 8–10 years in a refrigerator (4–10 °C) at 3–
5% moisture.
• Total cost of potato production using TPS is
nearly half that of tubers with equivalent
yield.
• Multiplication of quality planting material
using TPS is faster.
• Crop production using TPS can be followed
by direct seedling, nursery beds and brick-bed
tuber-lets methods.
16.2.2 Disadvantages
of Conventional TPS
Besides several advantages of the conventional
TPS technology, there are several disadvantages
of this technology for commercial crop produc-
tion, as given below.
• TPS-raised crops raised are not uniform in
various parameters such as emergence, plant
type, tuber traits (shape, size and colour) and
crop maturity, and differ compared to
tuber-raised crops.
• TPS crop is more labour-intensive especially
during seedling raising, transplanting, and
further establishment of the commercial crop.
• TPS has a long natural dormancy period of up
to one year, and therefore dormancy of fresh
seeds is broken with hormonal (GA3)
treatment.
16 Genomics in True Potato Seed (TPS) Technology …
Fig. 16.1 Potato: a Flower,
b fruits (berries), c seeds in
berries, d true potato seeds
(TPS)
• A commercial crop raised by TPS takes 15–
20 days extra to mature as compared to a
tuber-raised crop.
16.3 Prospects of Apomixis in TPS
Technology
In flowering plants, two pathways of reproduc-
tion exist: (1) sexual, and (2) asexual or apo-
mixis, i.e. asexual reproduction through seeds.
The former (sexual) is largely exploited by
breeders to breed new varieties though a
crossing/hybridization system and also in con-
ventional TPS production, whereas, the latter
(apomixis) is continuously receiving increasing
attention from both scientific and industrial sec-
tors, as described below.
299
16.3.1 Synthetic Clonal Reproduction
Through Apomixis
Hybrid technology has been exploited from a
long time, largely for a tremendous yield increase
in seed (sexual) crops like cereals and vegetables.
However, hybrid seed has not been used in
potato cultivation so far, maybe due to complex
genetics and vegetative propagules like tubers.
Hence, hybrid technology via synthesis of
apomictic TPS could be generated to break the
yield barriers in potato, which adds several
advantages of TPS. Barring a few exceptions in
some forage grasses and fruit trees, apomixis is
not a common feature among crops, including
potato species. So based on the recent advances
in apomixis in Arabidopsis applying genome
engineering technology, potato holds great pro-
mise for the new technology of growing potatoes
300
from botanical seeds instead of tubers. In the
coming decades, hybrid potato will play a key
role in sustainable agricultural production
through the massive multiplication of
disease-free and quality potato production to feed
billions of people. Thus, the apomixis TPS
technology has great potential in the future for
the improvement of potato production technol-
ogy (Barcaccia and Albertini 2013).
Apomixis is a genetically controlled repro-
ductive process by which embryos and seeds
develop in the ovule without fertilization. The
fixation of a given genotype occurs naturally in
species that exhibit an asexual type of seed pro-
duction termed apomixis. Apomixis produces
seed progeny that are exact replicas of the mother
plant because embryos are derived from the
parthenogenic development of egg cells. Apo-
mixis may be regarded as a consequence of
sexual failure rather than as a recipe for clonal
success. The major advantage of apomixis over
sexual reproduction is the possibility of selecting
individuals with desirable gene combinations and
to propagate them as clones through seeds. In
contrast to clonal propagation through in vitro
multiplication, apomixis does not need costly
processes such as tissue culture for multiplica-
tion. It simplifies the processes of commercial
hybrid and cultivar production and enables
large-scale seed production economically in both
seed and vegetatively propagated crops. In veg-
etatively propagated crops like potato, the main
benefits of apomixis are the avoidance of
phyto-sanitary threats and incompatibility barri-
ers (Barcaccia and Albertini 2013).
Apomixis is not a common feature among
crop species. Although components of apomixis
are found in potatoes, no apomictic potato has
been reported so far. Introgression of apomixis
from wild relatives into crop species and the
transformation of sexual genotypes into
apomictically reproducing genotypes are
long-held goals of plant breeding. Breeders
believe that the introduction of apomixis into
agronomically important crops will have revo-
lutionary implications for agriculture. The
potential benefits of harnessing apomixis are
many and vary from full exploitation of heterosis
J. K. Tiwari et al.
by reseeding the best hybrids to clonal propa-
gation of the superior genotypes in
seed-propagated out-crossing crops. The stabi-
lization of heterozygous genotypes via apomixis
would make breeding programmes faster and
cheaper. The impact of apomixis in agriculture
would be comparable to, or even greater than, the
impact of the Green Revolution, especially in
Third World countries. Hence, exploitation of
apomixis in TPS technology could be an option
to break the yield barriers in potato. Apomixis
technology could make true potato seeds a more
attractive option for potato breeders and culti-
vators and would return similar benefits to
growers.
Harnessing apomixis either through natural or
synthetic methods is the major goal in applied
plant genetic engineering. Because of its poten-
tial in crop improvement and global agricultural
production, apomixis is now receiving increasing
attention from both scientific and industrial sec-
tors. In this regard, efforts are being focused on
genetic studies to analyse apomictic reproduction
and to identify the key regulatory genes and
mechanisms underlying these processes. Also,
investigations on the components of apomixis,
i.e. apomeiosis, parthenogenesis, and endosperm
development without fertilization, genetic
screens for apomictic mutants and transgenic
approaches to modify sexual reproduction by
using various regulatory genes are receiving
major attention. These can open up new avenues
for transfer of the apomixis trait to important
crop species and will have far-reaching potential
in crop improvement. Since natural apomixis is
not observed in many of the crop species, and
based on the recent advances in de novo syn-
thesis of apomixis in model crop species like
Arabidopsis, applying genome engineering
technology, there is a great promise for applica-
tion of this novel apomixis technology in potato.
16.3.2 Methods of Apomictic Seed
Production
Earlier a few studies have been conducted to
demonstrate apomictic seed development in
16 Genomics in True Potato Seed (TPS) Technology …
various crops. The recent advance in meiosis
(recombination, cell cycle and chromosome dis-
tribution) has been reviewed by Crismani et al.
(2013), that can be applied to create apomixis
and propagate new crop species. Notably,
apomictic seeds of Arabidopsis were developed
by crossing MiMe and GEM (dyad/CENH3)
mutants that produce diploid clonal gametes,
chromosomes are engineered to be eliminated
after fertilization. Up to 34% of the progeny were
clones of their parent, demonstrating the con-
version of clonal female or male gametes into
seeds. Clonal reproduction through seeds can
therefore be achieved in a sexual plant by
manipulating two to four conserved genes
(Marimuthu et al. 2011). Haploid Arabidopsis
plants were produced through seeds by manipu-
lating the centromere-specific histone protein
CENH3. When CENH3 null mutants expressing
altered CENH3 proteins are crossed with wild
type, the chromosomes from the mutant are
eliminated, producing haploid progeny (Ravi and
Chan 2010). As CENH3 is universal in eukary-
otes, this method may be extended to produce
haploids in any plant species. To achieve this,
d’Erfurth et al. (2009) created a genotype called
MiMe (mitosis instead of meiosis) by combining
three genes (SPO11-1, REC8 and OSD1) in
which meiosis is totally replaced by mitosis. The
obtained plants produce functional diploid
gametes that are genetically identical to their
mother, which is an important step towards
understanding and engineering apomixes. Ravi
et al. (2008) demonstrated that mutation of the
Arabidopsis gene DYAD, a regulator of meiotic
chromosome organization, leads to apomeiosis, a
major component of apomixis. Most fertile
ovules in dyad plants form seeds that are triploid
and that arise from the fertilization of an unre-
duced female gamete by a haploid male gamete.
The experiments showed that the alteration of a
single gene in a sexual crop can bring about
functional apomixis.
Engineering cloning through seeds (apomixis)
in food crops would help agriculture by fixing
hybrid vigour and allow perpetual multiplication
of elite heterozygous genotypes. Recent advan-
ces in the field of genome engineering are the key
301
to enabling site-directed genome modifications
and are sequence-specific nucleases that generate
targeted double-stranded DNA breaks in genes of
interest, including targeted mutations, gene
insertions, and gene replacements. This new
technology can be used to knock out the multiple
gene of interest rather than introduce foreign
genes into plant chromosomes and elucidate gene
function and develop new and valuable traits.
One of the potential advantages of genome
engineering is that one can create a plant that has
novel genetic variation and does not have a
transgene. Researchers have used
meiosis-specific OSD1, SPO11-1 and REC8
genes through genome engineering tools such as
ZFNs and TALENs in a model crop plant to
develop apomictic seeds. Recently, synthetic
clonal reproduction through apomictic seeds has
been demonstrated in Arabidopsis through gen-
ome engineering techniques. Procedures adopted
from Marimuthu et al. (2011) are briefly shown
in Fig. 16.2. The brief methodology of apomixis
(synthetic clonal reproduction through seeds) in
Arabidopsis (diploid) is described, which can be
attempted in potato as well (Fig. 16.3).
16.3.2.1 Step I
The first step in this process is development of
MiMe (mitosis instead of meiosis) (or dyad)
mutant for the production of genetically identical
diploid gametes.
• During the cell cycle of sexual organism,
meiosis reduces the number of chromosomes
from diploid to haploid gametes, while, in
contrast, mitosis produces two identical
daughter cells.
• During meiosis, two rounds of chromosome
segregation follow a single round of replica-
tion. At meiosis I, homologous chromosomes
recombine and are separated, while meiosis II
is similar to mitosis (resulting in an equal
number of sister chromatids).
• During mitosis, for example, diploid cell
chromosomes replicate and sister chromatids
segregate to generate daughter cells that are
diploid and genetically identical to the initial
cell.
302 J. K. Tiwari et al.

Fig. 16.2 Sexual, natural Mother cell

apomixis and synthetic clonal
reproduction systems (main
procedures adapted from Sexual reproduction Natural Apomixis Synthetic clonal reproduction
Marimuthu et al. (2011))
Meiosis Apomeiosis MiMe, dyad
Clonal diploid Clonal diploid
Haploid female
gametes gametes
gametes
Haploid male gamete Haploid GEM male
gamete

Fertilization No Fertilization Fertilization

Elimination
of haploid
GEM
Hybrid embryo/seed Clonal embryo/seed Synthetic clonal embryo/seed

Fig. 16.3 Hypothesis of Apomixis in common tetraploid potato

synthetic clonal reproduction
(apomixis) in the common
tetraploid potato

MiMe or dyad GEM

Production of MiMe mutant plant Production of GEM plant

Clonal tetraploid (4x) female gametes Dihaploid (2x) male gametes

Fertilization

Elimination of dihaploid (2x) GEM

chromosomes after fertilization

Synthetic clonal 4x embryo

(Apomixis seed)

• In a sexual plant like Arabidopsis, a triple
genes mutant called MiMe (or dyad mutant) is
developed by manipulation of three genes in
which meiosis is totally replaced by mitosis.
In this process, one gene eliminates recom-
bination and the other modifies chromatid
segregation.
• The MiMe mutant is comprised of three
genes, namely, osd1, Atrec8 and Atspo11-1 in
which meiosis is completely replaced by
mitosis. A mutant of the two genes Atspo11-1
and Atrec8 causes mitosis-like first meiotic
division, while the osd1 mutant prevents a
second meiotic division and produces viable
diploid male and female gametes. As a result,
MiMe mutant plant produces diploid (male
and female) gametes that are genetically
identical to their diploid parent.
• The identical female gametes produced by the
MiMe (or dyad) mutant are used for crossing
with male gametes produced from the GEM
(genome elimination mutant) parent.
16 Genomics in True Potato Seed (TPS) Technology …
However, these MiMe clonal gametes partic-
ipate in normal fertilization but give rise to
more chromosome numbers than their parent.
Therefore, the MiMe clonal gametes would be
turned into clonal seeds if fertilized by a
genotype whose chromosomes are eliminated
after the fertilization from the resultant
progenies.
• The replacement of meiosis by mitosis is one
of the key components of apomixis, or clonal
reproduction through seeds.
16.3.2.2 Step II
The second step in this method is development of
a GEM (genome elimination mutant) plant
whose chromosomes are eliminated after
fertilization.
• Haploids are generally produced by two
methods: (1) tissue culture of gametophyte
cells, but this may be limited to certain spe-
cies and genotypes, and (2) haploid are
induced from interspecific crosses, in which
one parental genome is eliminated after fer-
tilization. In potato, for example, Solanum
phureja can be used as a male parent for the
induction of haploid plant.
• The molecular basis for parental genome
elimination is not well understood. However,
one theory hypothesizes that centromere from
two parents interact unequally with a mitotic
spindle in selective chromosome elimination.
• Haploid Arabidopsis plants (F1 paternal or
maternal) are produced by crossing the GEM
plant and the wild type. The GEM plant is
generated through manipulating chromo-
somes containing the altered
centromere-specific histone protein CENH3,
whose chromosomes are eliminated after
fertilization from the progeny. As CENH3 is
universal in eukaryotes, this method may be
extended to produce haploids in any plant
species. The haploid Arabidopsis plants can
easily be converted into diploid through
somatic chromosome doubling with colchi-
cine treatment.
• The GEM is fertile as male or female, and
shows efficient genome elimination when
303
crossed with a parent that produces diploid
gametes.
16.3.2.3 Step III
In the process the final step is the production of
apomixis seed by fertilization of Arabidopsis
MiMe or dyad mutants with GEM plant.
• The clonal diploid female gametes from
MiMe mutant are crossed with haploid male
gametes from the GEM plant.
• Complete elimination of all the GEM parent
chromosomes in the zygote during mitotic
divisions.
• Production of clonal embryo identical to
mother (female) plant by elimination of GEM
male gametes.
Thus, based on the study demonstrated in the
model crop Arabidopsis, it can be hypothesized
that a MiMe mutant can be generated from
common tetraploid (4x) potato for the production
of (tetraploid) gametes. Besides, a GEM mutant
would produce dihaploid male gamete, and it
could also be generated, whose chromosome
would be eliminated after fertilization with the
MiMe parent. Then, a tetraploid apomixis clonal
seed could be produced by crossing MiMe (fe-
male) with the GEM (male) parent, as outlined in
Fig. 16.3. Nevertheless, this concept has yet to
be proven in various crop species including
potato.
16.4 F1 Hybrid Potato
Potato is complicated with its complex genetics,
autotetraploid, highly heterozygous, acute
inbreeding depression and clonal propagation.
Unlike cereals and other vegetable crops, it is
evident that hybrid F1 hybrid technology in potato
has not been commercially successful so far.
However, theoretically, by using homozygous
lines through bi-parental crossing, it is now pos-
sible to produce F1 hybrid seeds. The idea of
developing an F1 hybrid is not new but was
proved realistic by Lindhout et al. (2011). Acute
inbreeding depression and self-incompatibility of
304 J. K. Tiwari et al.

diploid germplasm lines blocked the development
of inbred lines. However, back-crossing with
lines possessing the Sli gene inhibiting gameto-
phytic self-incompatibility produced
self-compatible progenies. They demonstrated
that fixation of homozygous donor allele is now
possible with improvement for tuber traits. To
achieve the F1 hybrid seeds, the development of
diploid self-compatible inbred line (M6) is cru-
cial. M6 is a vigorous, fertile (both male and
female) line. This homozygous breeding line was
derived by selfing of the wild potato species
Solanun chacoense for many generations, which
possess the dominant self-incompatibility inhi-
bitor gene Sli and has several desirable traits. M6
can be used to develop recombinant inbred lines
for the production of hybrid potato (Jansky et al.
2014). An overview of the procedure of hybrid
potato technology is depicted in Fig. 16.4. This
elaborates the production of diploid F1 hybrid
potato by crossing homozygous diploid parents
and expecting hybrid vigour. Parent 1 (diploid,
fertile and self-compatible like M6) is crossed
with Parent 2 (diploid parent: D1, D2 and D3) and
advance breeding lines were developed for
desirable traits by crossing designs (selfing,
back-crossing, F3, etc.). Then an F1 hybrid potato
is produced by crossing F3 materials generated
from the cross between Parent 1  Parent 2.
Yield attributes claimed are about 200 g/plant
(Patent US 2014/0115736A1). Applying the
above concepts, Solynta, a leading potato seed
breeding company based in Wageningen in the
Netherlands, has developed hybrid potato tech-
nology (http://solynta.com/).
16.5 Conclusion
The TPS technology is scientifically sound,
technically feasible, economically viable and
eco-friendly. TPS provides an opportunity even
to small farmers to generate high quality planting
material and assures high yields with low inputs
as compared to the tuber seed of unknown health
status. Although there are some bottlenecks that
hinder the adoption of TPS among farmers, those
could be overcome by further improvement in
parental lines by the introgression of desired
traits from diverse genetic resources and adjust-
ing the planting dates, as well as agronomic
practices according to the local conditions.
The TPS systems have encountered major prob-
lems such as poor germination rates,
non-uniform tubers, long dormancy and
increased irrigation needs. Finally, TPS technol-
ogy remains to be seen as a ready-to-use tech-
nology with the economic comparison of TPS
versus seed tubers in the dynamics of cropping
system for potato production.

Fig. 16.4 Procedure of F1

Potato germplasm lines
hybrid potato seed production
using self-compatible diploid
inbred lines (original
Self-compatible diploid potato lines with Sli gene
procedures adapted from
Patent Application
Publication: US
2014/0115736A1) Homozygous and fertile compatible diploid potato lines

Vigorous highly fertile homozygous self compatible diploid potato lines

Diploid potato breeding lines

Elite diploid breeding lines

Potato F1 hybrids
16 Genomics in True Potato Seed (TPS) Technology …
In the era of modern genomics tools, produc-
tion of apomictic seed holds great promise for
growing potato from botanical seeds instead of
tubers. It is explained that apomixis results from
the combination of abnormal meiosis, abnormal
fertilization and parthenogenesis. The apomictic
seed production technology could make TPS a
more attractive option for potato breeders and
growers and such an approach would assist the
expansion of potato acreage in the tropics.
Although novel genomics tools have been tested
so far only in the model plant Arabidopsis, this
concept of apomictic seed development in potato
remains elusive. Engineering cloning through
apomictic TPS in potato would revolutionize
agriculture by fixing hybrid vigour and allowing
the perpetuation of elite heterozygous genotypes.
To develop an F1 hybrid potato, the fixation of
homozygous donor alleles has been demonstrated
using Sli (S-locus inhibitor) gene donor parents
that gives a self-compatible potato in the diploid
breeding programmes. In addition, an F1 hybrid
potato would be likely to become more important
and increase potato research and development.
References
Almekinders CJM, Chujoy E, Thiele G (2009) The use of
true potato seed as pro-poor technology: the efforts of
305
an international agricultural research institute to
innovating potato production. Potato Res 52:275–293
Barcaccia G, Albertini E (2013) Apomixis in plant
reproduction: a novel perspective on an old dilemma.
Plant Reprod 26:159–179
Crismani W, Girard C, Mercier R (2013) Tinkering with
meiosis. J Exp Bot 64:55–65
d’Erfurth I, Jolivet S, Froger N, Catrice O,
Novatchkova M, Mercier R (2009) Turning meiosis
into mitosis. PLoS Biol 7:e1000124
Gaur PC (1999) Manual for true potato seed (TPS) pro-
duction and utilization. Extension Bulletin No. 30 (E).
ICAR-Central Potato Research Institute, Shimla, India
Jansky SH, Chung YS, Kittipadukal P (2014) M6: A diploid
potato inbred line for use in breeding and genetics
research. J Plant Reg. doi:10.3198/jpr2013.05.0024crg
Kumar S, Singh AN, Pande PC, Pandey SK, Gaur PC,
Prasad B (2009) Notification of true potato seed
(TPS) population 92PT-27. Indian J Genet Plant Breed
69:261–262
Lindhout P, Meijer D, Schotte T, Hutten RCB, Vis-
ser RGF, van Eck HJ (2011) Towards F1 Hybrid seed
potato breeding. Potato Res 54:301–312
Marimuthu MPA, Jolivet S, Ravi M, Pereira L, Davda JN,
Cromer L, Wang L, Nogué F, Chan SWL, Siddiqi I,
Mercier R (2011) Synthetic clonal reproduction
through seeds. Science 331:876
Ravi M, Chan SWL (2010) Haploid plants produced by
centromere-mediated genome elimination. Nature
464:615–618
Ravi M, Marimuthu MPA, Siddiqi I (2008) Gamete
formation without meiosis in Arabidopsis. Nature
451:1121–1124
Upadhyay MD (1983) Studies on potato reproductive
biology for TPS research in the year 2000. In:
Hooker WJ (ed) Research for the potato in the year
2000. CIP, Lima, Peru, pp 180–183
 Genome Sequence-Based Marker
Development and Genotyping 17
in Potato

Sanjeev Kumar Sharma and Glenn J. Bryan

Abstract
Potato (Solanum tuberosum L.) is one of the world’s most economically
important food crops and holds major significance for future food security.
Despite its importance, the study of potato genetics and breeding has lagged
behind mainly due to its polyploid genome and high levels of heterozygos-
ity. Conventional marker and genotyping approaches have been helpful in
progressing potato genetic research but have also had limitations in
exploiting the outcome from these studies for gene discovery and applied
research applications. The sequencing of the potato genome, followed by
advancements in marker and genotyping technologies, has brought a step
change in the way potato genetic studies are conducted. Potato is now
amenable to modern sequence-based marker and genotyping methods with
their increased ability to put thousands of markers on any population of
interest without a priori knowledge. This has increased the precision and
resolution of genetic studies previously not feasible in potato. A diverse
range of fixed and flexible genotyping platforms, for a wide variety of
research and breeding applications, are now available. Concerted research
efforts are now needed to screen the available genetic diversity for this
important crop to identify novel and beneficial trait alleles in order to enable
efficient and precise introgression breeding permitting breeding of climate
smart, and resilient, potato cultivars. This chapter provides an overview of
sequence-based marker development and genotyping methods along with
their implications for potato research and breeding in the post-genomics era.

Keywords
Genome sequence
Genotyping
Marker development
Potato

S. K. Sharma (&)
G. J. Bryan

Cell and Molecular Sciences,
The James Hutton Institute, Invergowrie,
Dundee DD2 5DA, Scotland, UK
e-mail: sanjeev.sharma@hutton.ac.uk;
sanjeevksha@gmail.com

© Springer International Publishing AG 2017 307

S. K. Chakrabarti et al. (eds.), The Potato Genome,
Compendium of Plant Genomes, https://doi.org/10.1007/978-3-319-66135-3_17
308
17.1 Introduction
Since the beginning of civilization, domestica-
tion of plants and crop improvements happened
through conscious, as well as subconscious,
human effort. Early on, the process involved
selection on the basis of a visual assessment of a
plant along with individual preferences. Later,
with the advent of the development of this field
of science, the process gradually became more
systematic. Various tools and techniques for
selecting desirable or superior plant types came
to the fore with main developments happening in
the genotyping of the germplasm. Presently, the
capability to sequence the whole blueprint of an
organism has brought a paradigm shift in the way
genotyping and crop improvement are under-
taken. Genome sequencing initiatives in model
plants (Kaul et al. 2000; Matsumoto et al. 2005)
have paved the way for the generation of a large
number of genomic markers for marker-assisted
selection (MAS) in the breeding of vegetable and
cereal crops (Varshney et al. 2005). Insights from
these early sequencing initiatives provided the
impetus to undertake similar efforts in crop
plants. The last decade witnessed the availability
of genome sequences for various important crops
such as apple (Velasco et al. 2010), banana
(D’Hont et al. 2012), cacao (Argout et al. 2011),
Chinese cabbage (Wang et al. 2011), cucumber
(Huang et al. 2009), grape (Jaillon et al. 2007),
maize (Schnable et al. 2009), melon (Garcia-Mas
et al. 2012), papaya (Ming et al. 2008), pigeon
pea (Varshney et al. 2012), sorghum (Paterson
et al. 2009), soybean (Schmutz et al. 2010),
strawberry (Shulaev et al. 2011), hot pepper
(Kim et al. 2014), tomato (Sato et al. 2012), and
potato (Potato Genome Sequencing Consortium
2011).
The sequencing of the genome for such a key
crop as potato holds immense importance in
terms of world food security. Potato is ranked
third after rice and wheat in terms of human
consumption, and annually over 382 million
tonnes of potatoes are produced worldwide
(http://www.fao.org/faostat/en/#data/QC 2014s).
The cultivated potato Solanum tuberosum
S. K. Sharma and G. J. Bryan
(ssp. Tuberosum) is an autotetraploid
(2n = 4x = 48) possessing four alleles per locus,
a condition which provides considerable chal-
lenges in performing trait genetics. Moreover,
potatoes are outbred which generates a high level
of heterozygosity and also leads to inbreeding
depression, a hindrance to obtaining homozy-
gous lines. Early in the twentieth century, the
issues posed by polyploidy were circumvented
by developing suitable techniques to manipulate
ploidy levels (ploidy reduction from tetraploid
level to diploid level) in potato (Dunwell and
Sunderland 1973; Gebhardt 2007; Hermsen and
Verdeniu 1973; Hougas and Peloquin 1957;
Ivanovsakaja 1939; Peloquin and Hougas 1958;
Powell and Uhrig 1987). The next most impor-
tant technical development enabling extensive
genetic studies in potato was the advent of
DNA-based genetic markers. Following this,
numerous DNA marker types were developed
and deployed to advance the genetic study of,
and enhance breeding efficiencies in, this
important crop. These mainly included applica-
tions linked to the construction of genetic linkage
maps contributing to quantitative trait locus
(QTL) and gene mappings for agronomically
important and tuber-processing related traits, as
well as to comparative studies involving other
solanaceaous crop plants. Traditionally, DNA
markers have mainly been developed from ran-
domly selected clones from genomic and cDNA
libraries or polymerase chain reaction (PCR)
with random primers. This approach is time and
labour intensive and requires the allocation of
larger financial resources especially in studies
where a higher number of markers are needed.
However, with the availability of the potato
genome sequence and high-throughput sequenc-
ing and genotyping methods, genome-wide DNA
polymorphism can be detected relatively easily
by using next-generation sequencing
(NGS) methods for genome-scale genetic analy-
ses such as genomics-assisted breeding, genomic
selection (GS), and genome-wide association
studies (GWAS). In this chapter, we discuss the
status and opportunities for genome
sequence-based marker development and
17 Genome Sequence-Based Marker Development and Genotyping …
genotyping in potato after the availability of the
reference genome sequence. In addition, we
describe the future for potato breeding using
advanced DNA markers and genotyping
technologies.
17.2 Markers and Genotyping
Methods in the Pre-genome
Era
Over a period of time the choice of markers for
performing molecular-genetic studies has
evolved from one type to another. During the last
three decades, the potato research community has
applied a range of markers with several genetic
maps being generated involving many traits of
interest. Early marker studies in potato were
effectively supported by the information avail-
able for the model solanaceous plant tomato. The
first potato genetic map was constructed using a
few isozymes and tomato RFLP (restriction
fragment length polymorphism) markers
(Bonierbale et al. 1988a, b). This was also the
first comparative mapping effort in plants and
revealed a high level of similarity between the
potato and tomato genomes along with some
major differences in the form of paracentric
inversions on three chromosomes. The RFLPs
were used in many more studies, highlighting
different molecular-genetic aspects of potato,
such as higher heterozygosity levels reported in
diploid potato lines (Gebhardt et al. 1989), potato
genetic mapping with an increased number of
mapped loci (Gebhardt et al. 1991), development
of a highly saturated map for comparison
between potato and tomato (Tanksley et al.
1992), and the integration of known marker loci
with new marker types (transposons, isozymes)
(Jacobs et al. 1995). Subsequently, RFLP was
replaced by AFLP (amplified fragment length
polymorphism) as the marker of choice for con-
ducting genetic studies. These AFLP markers
provided increased mapping resolution and also
higher marker transferability between different
potato populations (Rouppe van der Voort et al.
1997, 1998; van Eck et al. 1995; Vos et al.
1995). Such AFLPs were used to construct a
309
potato ultra-high-density (UHD) genetic linkage
map based on a diploid S. tuberosum cross
(SH  RH) (Isidore et al. 2003; van Os et al.
2005a, b). They were also instrumental in con-
structing a linkage map using a tetraploid map-
ping population (Meyer et al. 1998). Further
progress was seen with the use of microsatellite
markers (SSRs, simple sequence repeats; ISSRs,
inter-simple sequence repeats) in potato mapping
and DNA fingerprinting studies (Bradshaw et al.
2004; Ghislain et al. 2001; Milbourne et al. 1998;
Prevost and Wilkinson 1999; Provan et al.
1996a, b). Ghislain et al. (2004) provided a set of
highly informative and user-friendly SSRs for
genotype identification in cultivated potato.
Feingold et al. (2005) extended applicability of
SSRs to expressed sequence tag (EST)-derived
sequences for potato mapping studies. A few
studies also reported deployment of random
amplified polymorphic DNA (RAPD) markers
for potato genotyping (Hosaka and Hanneman
1998b; McGregor et al. 2000). McGregor et al.
(2000) also compared the performance of dif-
ferent markers (ISSR, SSR, RAPD, AFLP) and
found AFLP to be superior for DNA finger-
printing over other markers tested. Sliwka et al.
(2012) extended the use of Diversity Array
Technology (DArT; Jaccoud et al. 2001) markers
to potato. Using DArT markers on a mapping
population between Solanum x michoacanum
these authors were able to locate the late blight
resistance gene Rpi-mch1 on potato chromosome
VII. De Koeyer et al. (2010) and McCord et al.
(2012) demonstrated that high-resolution melting
(HRM) genotyping assays (Wittwer et al. 2003)
are able to reveal allele dosage and discriminate
between different haplotypes in potato.
Lindqvist-Kreuze et al. (2013) applied the tomato
Conserved Ortholog Set (COS) markers (Fulton
et al. 2002; Wu et al. 2006) to 300 single-copy
potato genes in 8 accessions of tuber-bearing
solanum species and corroborated the corre-
spondence between tomato and potato genomes
with some loci showing repetitiveness and
unpredicted locations in the potato genome. The
initial single nucleotide polymorphism
(SNP) markers for this crop were designed using
the sequence data from ESTs and PCR amplicons
310
available in public repositories and were used in
deriving initial estimates of SNP density and
extent of linkage disequilibrium (LD) in potato
(Rickert et al. 2003; Simko et al. 2006).
17.3 Transition from Conventional
Markers to Sequence-Based
Markers
The initial assembly of the potato genome had
resulted in several unorientated and unordered
superscaffolds (Potato Genome Sequencing
Consortium 2011). These assembled pieces of
the genome were further structured into well
annotated and orientated chromosome-scale
pseudomolecules using a de novo sequence tag-
ged sites (STS) marker-based linkage map
including some other available resources
(Sharma et al. 2013). A diploid segregating
population [referred to as DMDD, further details
are provided in Sharma et al. (2013)] was
genotyped with several types of markers notably,
AFLPs, SNPs, SSRs, and DArTs; all of which
except AFLPs were
sequence-based/sequence-derived markers.
The SNP genotyping was achieved using Illu-
mina GoldenGate™ oligonucleotide pool assays
(OPAs) (Fan et al. 2003). The OPAs were
designed by selecting 1920 SNPs from a set of
69,011 high-confidence SolCAP SNPs (Hamil-
ton et al. 2011) screened using six potato culti-
vars against the draft DM potato reference
genome. Another set of 384 SNPs was derived
from pre-existing potato ESTs in public data-
bases. These 2304 SNPs were incorporated into
six 384-plex potato OPAs (POPAs) and used for
high-throughput genotyping using an Illumina
BeadXpress platform. This also represents the
first example of high-throughput SNP genotyp-
ing in potato. The SSRs were designed de novo
using an early draft of the assembled potato
genome (DM assembly version 1). Additionally,
Sharma et al. (2013) also converted previously
reported sets of SSRs (Feingold et al. 2005;
Ghislain et al. 2009; Milbourne et al. 1998; Tang
et al. 2008; Veilleux et al. 1995) to STS marker
types by locating their physical locations in the
S. K. Sharma and G. J. Bryan
potato genome. Further genotyping was under-
taken using hybridization-based marker technol-
ogy by employing a high-resolution potato
genotyping array containing 7680 DArT probes
(Sliwka et al. 2012). These DArT probes were
sequenced and their locations were identified in
the DM genome, thereby, enhancing the utility of
these markers. By adopting this strategy, Sharma
et al. (2013) were able to construct a
new *936 cM DMDD linkage map equalling
the status of a physical map. This genome
ordering and anchoring process demonstrates a
clear example of transitioning from conventional
markers to using sequence-based markers in
potato genetic studies. The details of these STS
markers along with several other potato genome
features are available at http://solanaceae.
plantbiology.msu.edu/. The availability of this
vast resource provided a step change in the way
genetics, genomics, and breeding research is
undertaken in potato and is indispensable to the
development of further molecular markers.
17.4 Emerging Trends in DNA
Marker Development
and Genotyping Methods
in Potato
With the advent of NGS and high-throughput
genotyping platforms coupled with the avail-
ability of whole genome sequences, genome
research in potato, including other
sequenced-species, has advanced to new levels.
Conventional markers such as SSRs, besides
being labour intensive and having limited scope
for multiplexing, are constrained by low
throughput and higher costs. Moreover, there are
limited numbers of SSR motifs in the genome
which becomes an impediment when aiming to
saturate a region with markers or when trying to
identify gene-based markers. Therefore, the
focus from low-throughput conventional geno-
typing methods has shifted to the
high-throughput sequence-tagged or
sequence-based genotyping (SBG) technologies
broadly classified into two types, fixed and
flexible platforms, respectively. Irrespective of
17 Genome Sequence-Based Marker Development and Genotyping …
the platforms, SNPs have become the preferred
markers for modern genetics. They provide sev-
eral advantages over the traditional markers such
as flexibility, speed, cost-effectiveness, ease in
data management, high-throughput, abundant
availability, robust and comparable genotype
calls across different groups due to their bi-allelic
status, and potential for high levels of multi-
plexing. The other major advantages are that
SNPs are amenable to a range of genotyping
platforms designed to address varying needs for
different marker densities and costs per sample
(Thomson 2014). Nowadays, SNPs are predom-
inantly discovered through NGS data alignments
to the reference genome or de novo assemblies
following a complex bioinformatics pipeline.
Briefly, NGS reads are mapped to the reference
genome with mapping tools, for example, BWA
(Li and Durbin 2009) or Bowtie2 (Langmead and
Salzberg 2012) for the Illumina platform (Illu-
mina Inc., San Diego, USA) and MIRA (Chev-
reux et al. 2004) or the GS reference mapper
(Roche Applied Science, Mannheim, Germany)
for the 454 GS FLX + system (Roche Applied
Science). The alignments are processed for read
depth and coverage including several other
parameters followed by variant calling. Many
programmes are available for variant discovery
such as Samtools (Li 2011; Li et al. 2009),
Freebayes (Garrison and Marth 2012), and
GATK (McKenna et al. 2010). The identified
SNPs can be directly used for various down-
stream applications and can also be exploited for
designing genotyping platforms. As SNPs are
discovered in alignment with the reference gen-
ome (or de novo assembled genome), their pre-
cise physical locations, subject to correct read
alignments, are always available.
17.4.1 Fixed Platforms –
High-Density
Genotyping Arrays
The use of NGS technologies has also provided
the basis for the development of high-density
SNP genotyping platforms as a modern tool for
the genetic analysis of experimental material and
311
breeding populations (Ganal et al. 2012).
High-capacity SNP arrays have become available
for a broad range of plant species and are widely
used in research and breeding of major crops.
Currently, the Infinium platform (Illumina Inc.,
San Diego, CA) and the Axiom technology
(Affymetrix Inc., Santa Clara, CA) are the two
most widely used platforms for largescale SNP
genotyping in crop plants (Thomson 2014).
The alignment of transcriptome data from six
tetraploid cultivars to the reference DM genome
led to the identification of 69,011
high-confidence SNPs (Hamilton et al. 2011).
These SNPs were instrumental to the design of
the first publicly available high-density geno-
typing array in potato, containing 8303 SNPs
with known physical positions and flanking
sequences in the reference potato genome (Fel-
cher et al. 2012). The 8K SNP array employs
Illumina Infinium assay technology which relies
on a two-colour, single-base extension from a
single hybridization probe per target SNP (Stee-
mers et al. 2006). This resource provides a much
needed boost to potato research and offers a
bench-marked and reproducible platform for
different genetic studies to be carried out and
compared. The 8k SNP array has been exten-
sively used in several genetic studies involving
germplasm characterisation (Esnault et al. 2016;
Hardigan et al. 2015; Hirsch et al. 2013; Kolech
et al. 2016; Stich et al. 2013), linkage mapping
(Obidiegwu et al. 2015; Prashar et al. 2014),
inbred line development (Jansky et al. 2014),
gene sequence diversity (Manrique-Carpintero
et al. 2013), and association mapping (Mosquera
et al. 2016; Rosyara et al. 2016). This initial
SolCAP array was further extended to a 20K
Infinium SNP array (SolSTW array) by Vos et al.
(2015) by merging a non-redundant subset
(15,138) of their previously identified SNPs with
4454 SNPs retained from the original SolCAP
Infinium array. They genotyped a total of 569
potato genotypes using the SolSTW array and
observed interesting footprints of the breeding
history in contemporary breeding material such
as identification of introgression segments,
selection, and founder signatures. By comparing
the genetic composition of modern cultivars with
312
those released before 1945, they inferred that
genetic erosion is nearly absent in potato. A fur-
ther effort to extend this platform by including
SNPs identified through NGS of a diverse set of
tetraploid germplasm (Sharma et al., in prepara-
tion), wild potato species (Lim et al., in prepa-
ration), additional SNPs identified by the
SolCAP group, and retaining the effective set of
SNPs from SolSTW array (Douches, personal
communication), is underway. This effort is
expected to expand the total number of SNPs on
the array to *40 K. The existing high-density
SNP arrays have already proven highly useful for
a range of analyses as described above, and
further addition of informative SNPs from other
diverse germplasm will make the Infinium SNP
array genotyping in potato much more powerful
and eminently suitable for diversity analysis and
performing genome-wide scale studies such as
GWAS.
Fixed SNP genotyping platforms provide
several advantages such as higher multiplexing
levels providing rapid high-density genome
scans, robust genotype calling with high call
rates, low missing data rates, and reduced cost
per data point when assaying large numbers of
SNPs. In addition to these benefits, analysis of
data from fixed arrays is less complex and
requires minimal bioinformatics input. For these
reasons, these platforms are often preferred over
flexible genotyping technologies for generating
structured data sets of common sequence variants
at low cost (Varshney et al. 2014). However, a
certain level of caution must be exercised before
choosing the genotyping platform. For fixed
arrays to be broadly useful, they must be devel-
oped using SNPs derived from a wide range of
diverse genotypes available in the target species.
Due attention has to be paid if the germplasm to
be genotyped is represented in the available fixed
platform or not. In other words, if the alleles of
the SNPs included in the chip are representative
for a diverse germplasm or at least the germ-
plasm in question. Therefore, it is essential to
assess specific genotyping needs to avoid issues
originating from ascertainment bias.
Fixed SNP arrays also have certain other
drawbacks. The initial cost to design a custom
S. K. Sharma and G. J. Bryan
SNP array is high and also requires a large initial
commitment to avail volume discounts for
increasing cost-effectiveness. It is difficult to
keep a balance between the wider usability of the
chip and still include rare SNPs across multiple
germplasm groups. The latter will make the
universal design too large and expensive in
addition to the accumulation of several
monomorphic loci for non-target germplasm
groups. Moreover, inclusion of select informative
SNPs for different germplasm groups can also
lead to ascertainment bias as these highly selec-
ted SNPs do not represent a set of random and
neutral loci but exhibit a biased view of genetic
relationships depending on the criteria used to
select the informative SNPs (Thomson 2014).
Despite these shortcomings, fixed SNP platforms
will continue to play a significant role in the
years ahead due to the several advantages they
provide as outlined above.
17.4.2 Flexible Platforms
The highly parallel and high-throughput NGS
technology provides the unprecedented oppor-
tunity to perform whole genome sequencing
(WGS), ranging from shallow to deep-coverage
sequencing. Broadly, all NGS-based
re-sequencing and genotyping strategies follow
a standard data analysis pipeline involving data
quality checks, assignment of reads to their
respective samples, read trimming and filtering,
read mapping to the reference genome or de
novo assembly if the latter is not available fol-
lowed by variant (mainly SNPs) calling. Ideally,
if cost is not a constraint, deep coverage WGS is
desirable for comparing different genotypes as
this leads to robust variant calls and examines all
regions of the genome. This approach was used
by Kaminski et al. (2015, 2016) to study genetic
elements controlling water use efficiency and
gycoalkaloid content in potato. They performed
WGS on a potato mapping population including
parents and compared two extreme bulks of
clones for both traits for differences in allele
frequencies for the SNPs identified in the par-
ental clones to find QTL regulating the studied
17 Genome Sequence-Based Marker Development and Genotyping …
traits. Using this approach Kaminski et al. (2015)
observed two highly resolved QTL on chromo-
somes 1 and 9, and were further able to identify
three candidate genes possibly regulating water
use efficiency response in potato. Using a similar
approach Kaminski et al. (2016) were able to
identify genomic regions and candidate genes
responsible for differential glycoalkaloid content
within the studied potato mapping population.
Despite the potential the WGS approach carries,
not many studies in potato have employed WGS
for genotyping. With the continuous decline in
‘per base’ sequencing cost, the scenario of WGS
becoming routine for genotyping is not far away.
Currently, however, WGS libraries are expensive
to prepare and, with the prevailing sequencing
costs, too costly to apply merely for genotyping
purposes. Low coverage WGS can be applied for
genotyping but it distributes the sequence reads
across the whole genome, thereby, posing diffi-
culties in SNP calling due to reduced coverage at
any specific locus. Additionally, WGS data
requires assembly, data analysis is complicated
and time consuming especially for the highly
heterozygous and tetraploid species like potato.
Moreover, WGS is not always needed and many
studies such as population genetics, gene/QTL
mapping, phylogenetics, and linkage mapping
can still be performed by genotyping a reduced
fraction of the genome. The concept of genome
complexity reduction and reduced representation
typically invloves interrogating the same subset
of genome in the targeted number of individuals
from a set of population. This strategy also
brings the genotyping cost down considerably,
which is one of the critical factors for the success
of any routine genotyping method. Further
reduction in genotyping cost is achieved through
multiplexing, i.e., processing a large number of
samples in a single sequencing lane of an NGS
machine. This is achieved by first adding unique
sequence codes (barcodes) to each sample before
pooling them for multiplexing. The same codes
are then used to deconvolute the sequence-reads
to their respective samples. The reduced repre-
sentation genome sequencing approach is more
efficient and is simpler (than WGS) if a reference
genome is available, but this is not essential. The
313
main techniques adopted for genome complexity
reduction are based on (1) restriction enzyme
methods, (2) sequence capture, and (3) RNA
sequencing (RNA-Seq). The first two approaches
are more predominantly used for SNP discovery
and/or genotyping than RNA-Seq as alleles may
exhibit variation at the transcription level across
different genes, tissues, and plant stages; and
thus may lead to inaccuracies in genotyping.
Nevertheless, RNA-Seq is very useful for gene
expression studies and to demarcate gene
start/stop and exon/intron boundaries besides
other very specific objectives outwith the scope
of this chapter.
17.4.2.1 Restriction Enzyme-Based
Methods
In parallel to fixed array platforms, the use of
NGS for low-cost genotyping is becoming
increasingly popular. Most SBG techniques
involve restriction enzyme digestion, followed
by adapter ligation, sample pooling, PCR, and
sequencing. Many variants of the technique
exist, the two most commonly used are
restriction-site associated DNA sequencing
(RAD-Seq) (Baird et al. 2008) and
Genotyping-By-Sequencing (GBS) (Elshire
et al. 2011). The GBS technique does not
require any DNA size fractionation and, thus,
offers a simplified library preparation procedure
over RAD-seq. Restriction enzyme-based SBG
provides several advantages such as (1) simul-
taneous marker discovery and genotyping,
(2) complexity reduction is easy, rapid, specific,
and highly reproducible, (3) highly multiplexed
and less expensive, (4) reduced sample han-
dling, and (5) few PCR and purification steps
(Elshire et al. 2011). The original GBS protocol
involved restriction digestion using a single
enzyme which was later modified to include
two restriction enzymes by Poland et al.
(2012b). They used a combination of rare cutter
and frequent cutter restriction enzymes besides a
few other refinements in the adapter design.
Researchers at the James Hutton Institute (JHI)
were probably the first to successfully exploit
the GBS methodology in potato (Sharma et al.,
in preparation). A PstI/MseI enzyme
314
combination was used to construct GBS librar-
ies for genotyping a diverse potato association
panel comprising tetraploid cultivars and
advance breeding lines including a few wild
species. By adopting this procedure, they were
able to generate over 200,000 high-quality
SNPs. A subset of these SNPs was further
used for GWAS for more than 20 potato traits
and many key marker-trait associations were
identified (Sharma et al. 2014a, b). As described
above, a subset of SNPs identified through GBS
analysis is also included in the next version of
the Illumina Infinium SNP array. The GBS
approach in potato has really taken off and is
being exploited worldwide by several other
groups to meet their genotyping requirements.
There are certain issues with GBS which need
careful consideration—it can induce ascertain-
ment bias due to differential methylation of the
restriction sites if methylation sensitive restriction
enzymes are used. On the other hand, by includ-
ing methylation sensitive restriction enzymes,
repetitive regions of the genome can be avoided
which helps when scanning interesting regions of
the genome. Therefore, choice of enzymes is
crucial for developing GBS libraries. Equal
attention has to be paid for the collection of
experimental material for DNA isolation. It must
be collected from synchronized growth staged
plants and similar tissues should be used to avoid
variation arising due to differential methylation
patterns. In addition, GBS is affected by large
amounts of missing data as is any other NGS
technique. This can happen due to
presence/absence variation, a polymorphic/
methylated restriction site, library complexity,
and poor read coverage in the affected regions.
The issue can be alleviated to some extent by
imputation, a procedure where missing SNP calls
are imputed to fill in the gaps. In inbred species,
this approach has been shown to work quite
efficiently (Swarts et al. 2014). However, for
heterozygous and polyploid species like potato
S. K. Sharma and G. J. Bryan
the imputation of missing data still remains
challenging.
17.4.2.2 Targeted Sequence-Based
Genotyping
Restriction enzyme-based SBG approaches are
highly efficient and economical but only a very
limited control can be applied to target specific
regions of the genome for genotyping. This may
include GBS optimization using different sets of
restriction enzymes and also to apply fragment
size-based selection criterion to sequence only a
subset of the constructed GBS library. Largely
this approach scans random genome-wide loci in
the genome. In contrast to this, SBG also pro-
vides several targeted re-sequencing approaches
that can be suitably applied for SNP discovery
and genotyping.
Amplicon Sequencing
NGS-based amplicon sequencing has emerged as
a cost-effective and high-throughput alternative
to SNP variant detection using expensive and
low-throughput Sanger sequencing of PCR
amplicons. Efforts are underway to maximize the
number of samples and amplicons that can be
pooled into a single NGS run. Bybee et al. (2011)
have developed a novel method for Targeted
Amplicon Sequencing (TAS). The process of
TAS employs a two-step PCR process to amplify
specific targets across the genome followed by
uniquely barcoding individual samples in a
multiplex setup before pooling and sequencing.
Clarke et al. (2014) further revised TAS to a
one-step PCR method for generation of amplicon
tags for sequencing. Custom amplicon sequenc-
ing kits are also available from commercial
vendors, such as Illumina’s TruSeq Custom
Amplicon panel, Ion AmpliSeq custom DNA
panel, and Access ArrayTM from Fluidigm.
PacBio Systems also offers barcoding strategies
for sample multiplexing and has been validated
with amplicons up to 10 kb in length. This
approach can be used for read phasing and
17 Genome Sequence-Based Marker Development and Genotyping …
determining haplotypes which hold immense
importance for genetic studies in potato. Though
amplicon sequencing provides suitable alterna-
tives for genotyping novel and known SNPs for
regions of interest, it is still too expensive to
apply in routine genotyping applications.
Sequence Capture
The power of NGS can also be directed to
sequence the specific target regions in the gen-
ome in a highly parallel and high-throughput
manner. This leads to considerable
cost-effectiveness in variant discovery and
genotyping as compared to WGS. Additionally,
it enhances accuracy by improving the read depth
coverage and also reducing the complexity of the
genome to be sequenced. Target-enrichment can
be applied at a varying scale ranging from
smaller sets of genes or genomic regions to
sequencing the entire exome component of the
genome. Oligo probes specific to these target
regions are designed to construct a synthetic
library complementary to the regions of interest.
For achieving target enrichment in the experi-
mental material, short-fragment libraries typi-
cally up to few hundred base pairs are prepared
from the chosen genotypes and hybridized to a
synthetic oligo pool either on an array or in
solution. The reduction in cost per sample is
achieved by adopting a suitable sample pooling
and indexing strategy. For capture design,
researchers can either opt for preset targeted
enrichment regions (if available for their target
crop species) or develop probes against their own
custom enrichment regions. These services are
available through various commercial companies
such as Agilent (SureSelect), NimbleGen (Seq-
Cap EZ), and Illumina (Nextera).
A study by Uitdewilligen et al. (2013) used
the SureSelect in-solution hybridization method
to enrich their DNA sequencing libraries for 807
single copy genes distributed across the potato
genome. They employed this design to discover
and compare variants across the genomes of 83
tetraploid cultivars for their targets of interest.
The sample libraries were indexed, multiplexed
keeping 12 samples in a pool, and were
paired-end sequenced using Illumina
315
HiSeq 2000. This capture design was able to
narrow down the genotyping region to 2.1 Mb of
the potato reference genome with a median
average read depth of 63x per cultivar. The study
detected 129,156 sequence variants including
their allele dosages across the genotyped culti-
vars and reported a variant density of 1 SNP per
24 bp in exons and 1 SNP per 15 bp in introns.
The authors further utilized these SNPs to per-
form GWAS and identified alleles strongly
influencing maturity and flesh colour in potato.
Another very novel use of target capture is
reported in studying plant disease resistance
which in the majority of cases is conferred by
dominant disease resistance (R) genes. Jupe et al.
(2013) reported an NB-LRR (nucleotide
binding-site leucine-rich repeat) gene-specific R
gene enrichment and sequencing (RenSeq)
method for the discovery and annotation of
pathogen resistance gene family members in
plant genome sequences. They demonstrated the
utility of RenSeq in re-annotating the NB-LRR
gene complements from completely or partially
assembled genomes using targeted re-sequencing
taking tomato and potato as examples. Applica-
tion of RenSeq to the sequenced potato S.
tuberosum reference clone DM led to an increase
in the number of reported NB-LRRs from 438 to
755. Similarly, in tomato the count of NB-LRRs
was increased to 394 loci. RenSeq was also
successfully applied for the rapid identification of
molecular markers co-segregating with resis-
tances towards the late blight pathogen Phy-
tophthora infestans in two independent
segregating populations involving wild solanum
species (Jupe et al. 2013). A further development
has seen the modification of the RenSeq analyt-
ical pipeline to allow the detection of known
functional resistance genes. This method, known
as diagnostic RenSeq (DRenSeq), operates by
greatly increasing the mapping stringency to
allow detection of known sequenced functional
resistance genes in any DNA sample (Van
Weymers et al. 2016). In addition to a subset of
genes or regions, designing capture to scan the
entire gene space of a species is also feasible.
This strategy involves designing hybridization
probes against all exons present in the genome
316
and is referred to as whole exome capture
(WEC). No published reports of WEC analysis
are yet available in potato. Researchers at JHI
have developed a NimbleGen SeqCap EZ whole
exome capture for potato and are using it for trait
genetic and other related studies; other similar
efforts have commenced elsewhere (personal
communication).
The main technical features to consider for
adopting any targeted enrichment technique are
enrichment factor, specificity (ratio of sequence
reads on/off target region), coverage (read depth),
uniformity of coverage across the enriched
region, method reproducibility, input DNA nee-
ded, and the overall cost per target base of useful
sequence data. These features pose major chal-
lenges in targeted enrichment and require critical
assessment before embarking upon any of such
methods; the important considerations for these
features have been aptly reviewed by Mertes
et al. (2011). Undoubtedly, target enrichment
significantly decreases the genome component to
be sequenced and, thus, involves reduced
downstream processing for data analysis and
storage for yielding high coverage sequence data.
On the other hand, WGS is continually becoming
more economical, simpler, and faster. Under this
scenario, for targeted enrichment to hold its
long-term relevance and effectiveness, the
method would need to continuously improve
upon the aforementioned factors; keeping its
affordability over WGS by bringing innovative
and economical strategies for sample pooling and
further simplifying the NGS library preparation
procedures especially for routine genotyping
requirements. Further scope for improvement is
to include the sequencing of larger size fragments
in the enrichment library preparation procedure.
Current capture methods largely depend upon
fragmentation of genomic DNA prior to ampli-
fication which limits their utility in characterizing
complex genomic loci. Sequencing of large DNA
templates is now feasible with the advent of
newer sequencing platforms which have the
capacity to generate significantly larger read
lengths (McCarthy 2010; Mikheyev and Tin
2014; Rhoads and Au 2015). Sequencing at
longer read lengths can be very advantageous in
S. K. Sharma and G. J. Bryan
characterizing structural variants and haplotype
phasing, which in turn are very critical factors for
potato genetic studies. Along similar lines, an
improved RenSeq method to capture and
sequence larger size molecules has been reported
(Giolai et al. 2016). The modified method
enables full contig assemblies covering entire
R-gene clusters including exonic, intronic, and
intergenic regions.
SBG has now become the preferred method of
choice for high-throughput low-cost genotyping
as compared to array technologies due to the
several advantages it provides. This includes
greater flexibility and scalability, and the capa-
bility to scan polymorphisms without prior
knowledge of them, characteristic of an ‘open
system’ genotyping platform. However, the two
different routes to perform SBG described above
are marred by some limitations. A major limita-
tion of the restriction enzymes based methods is
that they scan the genome at random loci.
However, for many applications such as GS, fine
mapping, etc., genotyping at specific loci, genes,
or genomic regions is more critical. On the other
hand, genotyping at specific target regions using
enrichment technologies is not as cost effective
as the former approach, library preparation is
more laborious and time consuming, and only
provides limited multiplexing options. Recently,
a novel and unique strategy for large-scale tar-
geted genotyping based on single primer
enrichment technology (SPET; Nugen Inc.) has
been developed. This technology provides a very
efficient enrichment system and claims to cir-
cumvent some of the limitations mentioned
above by combining an array-like target SNP
strategy along with the random sampling of
variants of traditional GBS methods (Scaglione
et al. 2017).
Overall with the unprecedented progress in
DNA marker development and genotyping as
described in the preceding sections, low-cost and
high-throughput discovery of sequence variation
and genotyping have become accessible for
potato. A diverse range of fixed and flexible
genotyping platforms are now available to
choose from depending on the aim of the study
and degree of the throughput required. For
17 Genome Sequence-Based Marker Development and Genotyping …
example, a re-sequencing strategy using NGS
can be employed when the purpose is to detect a
large number of SNPs in a small number of
samples. Conversely, when the aim is to screen a
small number of SNPs in a large number of
samples, for example, cultivar identification and
MAS, low-cost single-plexing techniques may be
more preferable. On the other hand, when the
goal is to combine high-throughput SNP analysis
with a large number of samples, high-density
SNP array and SBG platforms will be more
rewarding.
17.5 Applications in Potato
Breeding
Potato breeding is challenged by the outcrossing
tetraploid nature of the cultivated potato, pres-
ence of limited variability for economically
important traits in adapted breeding clones, and
the requirement to meet desirable standards for
over 50 traits needed for the successful release of
new cultivars. Additionally, breeding potato is
becoming more complex because of the growing
number of requirements for new varieties, com-
pounded by the additional concerns for devel-
oping resilience in potato against climate
variability. Potato breeding has suffered from a
genetic bottleneck due to the limited number of
introductions from South America in the six-
teenth century (including some occasional intro-
ductions in the seventeenth and eighteenth
centuries) into Europe with simultaneous spread
to the rest of the world. Due to this, potato lacked
sufficient genetic variation to withstand the
threats posed by a number of important pest and
diseases notably potato cyst nematodes and late
blight. To overcome this weakness, potato
breeders, during the last hundred or more years,
have been introgressing genetic elements for
disease and pest resistance into tuberosum
background from the wild and cultivated species
of Central and South America. With the expan-
sion of markets in the fresh and processed sec-
tors, and the continuous challenge from existing
and emerging disease threats and changing cli-
mate, constant progress in breeding and
317
developing new and improved potato cultivars
has to be achieved. This requires an integrated
breeding strategy that makes use of the diversity
available in the entire potato gene pool in com-
bination with the latest advancements in molec-
ular breeding.
Despite the identification of many trait QTL,
mainly through bi-parental linkage mapping
procedures, only a few have proven to be truly
diagnostic and exploited in potato breeding. This
is mainly because marker alleles found to be
tightly linked to trait alleles in bi-parental crosses
often have limited transferability to wider germ-
plasm pools. On the other hand, marker-trait
associations observed through association map-
ping studies have the greater potential to be
diagnostic across a wider germplasm and diverse
breeding populations. Because of this, and sev-
eral other advantages offered by genome-wide
association mapping over bi-parental popula-
tions, the use of this approach has expanded
significantly in a number of crop plants. In order
to realise the true potential of GWAS, availabil-
ity of high-throughput and marker-dense geno-
typic platforms is a must. With the sequencing of
the potato genome, these impediments have been
alleviated, and potato has become amenable to
the latest genomic approaches on par with other
model species. The first high-throughput SNP
genotyping resource developed in potato (Infi-
nium 8K Potato array; Felcher et al. 2012;
Hamilton et al. 2011) has been used in a number
of genetic and breeding studies involving char-
acterization of cultivated and wild germplasm,
bi-parental and association mapping studies,
characterization of genes, etc. (Esnault et al.
2016; Hardigan et al. 2015; Hirsch et al. 2013;
Jansky et al. 2014; Kolech et al. 2016;
Manrique-Carpintero et al. 2013; Mosquera et al.
2016; Obidiegwu et al. 2015; Rosyara et al.
2016; Stich et al. 2013). Several new diploid and
tetraploid genetic maps have been constructed
and exploited to identify QTL for important traits
(Felcher et al. 2012; Hackett et al. 2013; Prashar
et al. 2014). The NGS data has also been used to
design Intron Length Polymorphic (ILP) markers
in potato. Intronic markers are characteristically
flanked by exons which provide conserved
318
primer sites and lend high evolutionary rates to
the interspersed intronic markers. The study by
Ahmadvand et al. (2014) used ILP markers to
examine diversity in different potato genotypes
and cross transferability among other solanum
species, demonstrating their utility in diverse
molecular analyses, including cross-species
studies. High-density SNP markers from both
fixed and flexible marker platforms have been
deployed to perform GWAS in potato (Kloost-
erman et al. 2013; Lindqvist-Kreuze et al. 2014;
Rosyara et al. 2016). Such studies have led to
significant findings of marker alleles associated
with important potato traits such as late blight
resistance (Lindqvist-Kreuze et al. 2014) and
starch content (Schonhals et al. 2016). Most
notable among these findings is the identification
of the CDF1 gene (a circadian clock gene)
underlying a major-effect QTL for plant maturity
and initiation of tuber development (Kloosterman
et al. 2013).
With these advances the wealth of
sequence-based marker QTL in potato is fast
accumulating, additionally where possible phys-
ical locations for the conventional
marker-derived QTL are also being extracted. As
the position on the reference genome for
NGS-derived SNPs or STS markers is readily
available, regions under the identified QTL can
be examined for the presence of candidate causal
genes using annotation provided by the Potato
Genome Sequencing Consortium (2011) for all
39K genes present in the potato genome. For
example, the potato genome greatly facilitated
identification of the tuber initiation gene
(StSP6A; Navarro et al. 2011) and the plant
maturity phenotype regulating gene (StCDF1;
Kloosterman et al. 2013). The variants identified
within the genes controlling traits of interest can
be exploited to design functional markers.
Deployment of functional markers has a greater
potential to enhance efficiency in MAS than
using conventional anonymous molecular mark-
ers which are likely to get affected by genetic
recombination events possibly resulting in false
positives or false negatives. Due to the avail-
ability of a genome sequence, the development
of such functional markers is relatively easier in
S. K. Sharma and G. J. Bryan
potato and other sequenced species than in other
crops lacking such a resource. Furthermore, the
significant marker-trait associations identified
through linkage or association mapping can be
converted to allele-specific PCR-based fluores-
cently labelled SNP assays such as KASPTM
(https://www.lgcgroup.com) and TaqManTM
(http://www.thermofisher.com). The diagnostic
power of such assays can be exploited in
marker-assisted breeding for screening elite
germplasm for the presence of beneficial alleles
or against undesirable alleles, to identify
favourable allele combinations leading to preci-
sion breeding. These assays can be suitably
designed to distinguish between the two alleles
present in a bi-allelic SNP and can also be opti-
mized to infer allele dosage which is highly
informative when working with tetraploid mate-
rial. Researchers at JHI frequently deploy KASP
assays for lower cost single-plex genotyping for
validating their trait/QTL findings and screening
germplasm/parental lines for the desired
objectives.
Currently, breeding a successful potato variety
takes around 10–13 years. The majority of potato
breeding programmes assess thousands of seed-
ling genotypes every year and the selection
mainly relies on the breeder’s eye (selection by
visual appearance) with a discard rate of over
99%. Only during the later generations, follow-
ing a significant reduction in the number of
retained genotypes, the selection for disease
resistance, tuber quality, and other important
traits is carried out. However, to derive maxi-
mum benefits from the starting genetic variabil-
ity, and taking only the superior genotypes
forward for further testing, targeted selection at
an early generation is highly desirable. This can
be achieved by implementing MAS or GS in
potato breeding. Germplasm screening using
MAS will be more effective for simple or
monogenic traits. Most of the traits the com-
mercially viable varieties need to display are
complex in nature indicating the regulation of
these traits by multiple genetic and environ-
mental factors (Mackay 2001). For implementing
an early selection strategy for such traits, GS may
be more rewarding. Again for performing GS the
17 Genome Sequence-Based Marker Development and Genotyping …
availability of high-density and high-throughput
marker platforms is essential. They aid finely
dissecting the polygenic traits for the small
effects contributed from several different loci
across the genome. This information can be used
to develop appropriate statistical models that can
efficiently predict hybrid performance based on
genome-wide marker combinations without the
need to perform any phenotyping. GS is
increasingly applied in the breeding of many
important crops (Lin et al. 2014; Poland et al.
2012a; Riedelsheimer et al. 2012), and recently
reports on its application in potato have also
appeared (Slater et al. 2016). Characterizing
parents and progeny clones early during the
selection cycle, using MAS or GS, can reduce the
extent of the number of genotypes that are taken
to laborious and costly field trials, leading to
considerable time and resource efficiency in
potato breeding.
Assessment and characterization of the avail-
able genetic diversity is essential for the contin-
uous improvement of crop plants. Before the
genomics era, genetic resources available for
potato were not well characterized at the
molecular level. However, with recent develop-
ments this scenario is rapidly changing. Many
wild species of solanum possess a wide spectrum
of resistances to different pests and species, dis-
play varying levels of tolerances to abiotic stress
including many other novel traits (Plaisted and
Hoopes 1989). Thus, wild relatives of potato
represent an excellent genetic resource to rein-
state the loss of variation in cultivated potato
which was caused by strong man-made selection
during domestication and the spreading of potato
outside its region of origin. Exploitation of these
genetic resources is now ever more critical to
safeguard potato cultivation against changing
climate and ensure its contribution towards food
security. Crossing cultivated potato with its wild
relatives is feasible and has been used historically
to bring novel disease resistance traits into the
elite germplasm. Rich germplasm resources are
readily available in various gene banks which
can be deployed to transfer useful traits to the
cultivated germplasm. Despite this, only a lim-
ited fraction of the available resources has so far
319
been exploited for breeding objectives. More-
over, breeders are often skeptical to introgress
completely novel diversity from distant/wild
gene pools due to their lack of adaptation and
the consequent adverse effects on variety per-
formance. This represents an opportunity for
recent developments in genomics and marker
development in potato to play a revolutionary
role. For example, re-sequencing and
high-density marker profiling of the available
diverse germplasm and pre-breeding material can
augment more targeted germplasm interchange
between gene pools for bringing novel disease
resistance and other desired traits with minimal
linkage drag. A very timely and ambitious
movement in this direction has been made by the
European G2P-SOL initiative on ‘Linking
genetic resources, genomes and phenotypes of
Solanaceous crops’ (http://www.g2p-sol.eu/).
The G2P-SOL project aims to provide a
high-resolution connection between genotype
and phenotype for four major Solanaceous crops,
namely, tomato, pepper, eggplant, and potato.
The project aims to screen a vast majority of
genetic diversity present in each species through
sequence-based genotyping approaches and
exploit the identified variants for characterizing
the analysed germplasm followed by phenotyp-
ing and marker-trait analysis on the
non-redundant core set of genotypes for each
crop included. This example provides a glimpse
of how the advancements in genomics and mar-
ker technologies are empowering the field of
plant genetics and breeding.
A vast majority of potato genomic resources
are hosted at http://potato.plantbiology.msu.edu/,
featuring a genome browser with 94 tracks of
genome annotation, sequence variants, and gene
expression profiles. This site also hosts a
resource database (Spud DB; Hirsch et al. 2014)
that links potato genomic resources with pheno-
typic and genotypic data from a large collection
of potato genotypes and is very useful for potato
breeders and geneticists. It provides an interac-
tive web tool (Breeder’s Assistant) to retrieve
relevant phenotypic and genotypic data in a
user-guided manner. This tool also allows
querying polymorphic markers such as SNPs and
320
SSRs to obtain custom sets of markers for a gene
or region of interest.
Lastly, the availability of recombinant inbred
lines has played a key role in advancing breeding
and genetics in other major crops and inbred
species. However, development of such resour-
ces was not possible in potato breeding until the
discovery of the self-incompatibility inhibitor
gene Sli (Hosaka and Hanneman 1998a, b).
Recent efforts (Jansky et al. 2014; Lindhout et al.
2011) have successfully manipulated the domi-
nant Sli gene to develop potato inbred lines. The
rapid screening and characterization of homozy-
gous inbred lines was facilitated by the increased
availability of high-density genome-wide and
high-throughput SNP markers. These develop-
ments have paved the way for creating genetic
resources previously unavailable to the potato
community such as introgression lines and
recombinant inbred lines, indeed very useful
developments for advancing potato genetics and
breeding.
17.6 Challenges
Despite significant developments in the field of
genetics and genomics, there is a clear gap
between the discovery of QTL and their actual
exploitation in crop improvement and breeding
programmes. There has not been much gain in
potato yield over the last 100 years of intensive
breeding efforts and old potato varieties are still
used predominantly. Therefore, the real chal-
lenge is to overcome the gap between genome
research and the required breeding applications.
Identifying informative marker assays from
the abundantly available list of SNPs provides
several challenges. The re-sequencing strategy
encompasses mapping of the sequences obtained
from the whole genome, complexity-reduced
genomes, or from a transcribed part of the gen-
ome to the reference genome. These processes
help with the discovery of hundreds and thou-
sands of genome-wide SNPs. However, these
SNPs discovered by in silico approaches fre-
quently contain false positives due to the errors
in the processes of sequencing and/or mapping.
S. K. Sharma and G. J. Bryan
Careful laboratory validation is needed to deploy
these SNPs, identified in QTL studies, for
breeding. Moreover, knowledge on allelic vari-
ants that control the traits of interest for cultivar
development is scant. Therefore, it is challenging
to design true diagnostic or functional markers
for relevant traits.
With the arrival of NGS, it has become
increasingly easy, cost effective, and routine to
obtain partial or WGS data for potato. Extracting
meaningful information from the continuously
increasing stacks of sequencing data can be
overwhelming. Due to polyploidy and high
levels of heterozygosity, screening of beneficial
alleles using single SNPs can be misleading as
these may not be diagnostic for their respective
traits in all cases, especially when dealing with
complex traits such as tuber yield, processing
quality, and dry matter. Therefore, it is essential
to be able to identify true alleles present at the
trait regulating loci rather than simple bi-allelic
SNP variants. Due to the high mutation rate in
potato it is very difficult to identify tag-SNPs
whose alleles can effectively predict the prevail-
ing haplotypes, as single SNPs are often not in
complete LD with the trait even when located in
extremely close physical vicinity. Therefore,
defining a subset of informative SNPs across the
genome can provide useful leads for potato
breeding in the interim term, but the major
impact will come from haplotype-based selection
targeting a combination of multiple SNPs in the
desired region, which is to a large extent the
‘holy grail’ of potato genetics. ‘Haplotype’ here
means a set of SNPs on the individual chromo-
somes that are linked together in similar phase.
This haplotype phasing information for a long
stretch of heterozygous chromosome is not
readily observed from the read lengths normally
applied in NGS. At best these inferences can be
drawn within the boundaries of the short-read
sequences ranging up to a few hundred bases.
Currently, technology for sequencing longer
reads of up to a few kilobases is available (Pac-
Bio, etc.), but their use is mainly restricted to
ordering of genome scaffolds and correcting
assemblies. Their low throughput nature does not
make them attractive for genotyping purposes
17 Genome Sequence-Based Marker Development and Genotyping …
which require high-throughput sequencing at
greater read depths for robust variant calling. The
availability of a reference genome and akin
developments has given momentum to potato
genetics, however, the next big leap will come
from resolving key challenges such as predicting
long-range haplotyping in potato. Deciphering
haplotypes in diploids is relatively less complex
but for polyploids the level of complexity
increases exponentially. Nevertheless, a number
of tools for implementing haplotype phasing in
polyploids are available, and efforts to achieve
this in potato are also emerging. A recent study
by Motazedi et al. (2017) reported a simulation
pipeline (haplosim) for evaluating the perfor-
mance of haplotype estimation algorithms for
polyploids taking potato as an example. Their
results indicate that large insert-size Illumina
reads and 1 kb PacBio CCS (Circular Consensus
Sequencing) reads are comparable for imple-
menting haplotyping. Such developments pro-
vide the necessary impetus for putting resolute
effort into solving the haplotyping puzzle in
polyploids.
In addition, NGS-derived data analysis and
marker development involves many technical
and management challenges. The outcome from
the modern sequencing platforms is in gigabytes
and terabytes. Analysing such data sets is com-
putationally very intensive and requires complex
bioinformatics workflows. The size of the data
sets increases manyfold once data processing
starts. To deal with such data sets dedicated data
storage and analysis facilities are required with
appropriate data-backup arrangements. For
genetical analysis, most of the available statisti-
cal tools are not suitable for polyploids. This
raises additional challenges for data analysis and
interpretation in autotetraploid potato. For
researchers and breeders, sequencing and geno-
typing data analysis is very demanding and often
involves a steep learning curve. With the pro-
gress in genomics and allied technologies, there
is a growing need for training next-generation
breeders/researchers who can appreciate the
gravity of such data sets and judiciously exploit
them for their research needs.
321
Re-sequencing offers great opportunities for
enhancing the outcome of plant breeding but also
has some drawbacks. First, due to uneven cov-
erage across different genomic regions, and also
among different genotypes, NGS variant calling
is affected by large amounts of missing data.
Moreover, alignment of the true alleles of each
single locus in heterozygous and polyploid gen-
omes poses great difficulties and induces erro-
neous results. In restriction enzyme-based NGS
libraries, the polymorphism at the recognition
sites will lead to the absence of sequencing data
from such loci leading to false NULL allele calls.
Additionally, genotyping results will also be
affected by the nature of restriction enzymes
used, for example, for methylation sensitive
restriction enzymes (PstI, etc.,) digestion is
affected by differential DNA methylation patterns
which in turn are affected by different plant
developmental stages. So, for genotyping studies
using such systems, the tissue sampling must be
done using synchronized plant material. Never-
theless, despite these issues and challenges, the
advantages provided by modern high-throughput
sequencing and genotyping systems outweigh the
drawbacks encountered; and they remain prefer-
able over the conventional low-throughput mar-
ker systems.
Finally, despite recent advances there are
many challenges ahead for potato genetics. The
published DM genome represents but a single
sequence haplotype from an incredibly diverse
plant species. Moreover, it is known that potato
possesses very high levels of structural haplo-
typic diversity (Hardigan et al. 2016). Further
sequencing and haplotypic analysis of highly
heterozygous material remains a major challenge.
17.7 Conclusions
Conventional molecular genetic markers have
given significant insight into potato genetic
research and breeding but also have limitations
being low-throughput with very limited multi-
plexing options. More importantly, knowledge
acquired through such markers does not easily
and accurately translate back to the actual
322
physical regions of the genome. However, the
sequencing of the potato genome, accompanied
by further developments in marker and geno-
typing technologies, have drastically changed the
landscape for those wishing to engage in genetic
studies of potato. These developments provide an
unprecedented opportunity to develop large
numbers of sequence-based DNA markers com-
paratively easily, and have even made potato
amenable to a generation of new genotyping
methods without the involvement of
pre-identified DNA markers. The
sequence-based markers, as well as genetic maps
constructed using these markers, can be aligned
to the potato reference genome sequence, thus
providing physical coordinates to any genetic
map and facilitating comparisons between dif-
ferent maps sharing common markers including
the possibility to integrate these maps to produce
a potato ‘consensus map’. Moreover, as the
positions of the *39,000 protein-coding genes
present within the potato genome are precisely
known, it is now possible to identify which
potato genes fall into any particular genetic
interval. This holds significant utility for trait
analysis and the identification of candidate causal
genes for any particular trait in question.
Advances in the development of
next-generation (sequence-based) markers have
enabled prompt genome profiling of the germ-
plasm at constantly shrinking costs, providing
detailed and high-resolution molecular informa-
tion for research and breeding. A diverse range of
fixed and flexible genotyping platforms are now
available for performing genomic diversity
studies, assessing relationships among germ-
plasm, DNA fingerprinting varieties, GWAS,
GS, etc. Now the research outcomes from these
advances need to be translated into tangible
products to accelerate progress in potato breed-
ing. Potato is a key crop to ensure future food
security and therefore breeding efforts need to be
intensified to shorten the cultivar release time and
mitigate challenges posed by climate change and
the requirement for sustainable food production
for the world’s ever-growing population.
Next-generation breeding heavily relies on the
combined strengths of genotyping and
S. K. Sharma and G. J. Bryan
phenotyping. The latter in potato largely relies on
imprecise, intensive, and laborious
low-throughput visual inspection methods and,
therefore, is a critical impediment to the pro-
jected progress of genomics-assisted breeding. In
order to complement the advancements in
genomic applications, efforts to develop
high-throughput and precise phenotyping meth-
ods, along with powerful statistical approaches
especially for polyploids, are urgently required
for realizing the true goal of potato genetics and
breeding.
References
Ahmadvand R, Poczai P, Hajianfar R, Kolics B,
Gorji AM, Polgar Z, Taller J (2014) Next generation
sequencing based development of intron-targeting
markers in tetraploid potato and their transferability
to other Solanum species. Gene 540(1):117–121
Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G et al
(2011) The genome of Theobroma cacao. Nat Genet
43(2):101–108
Baird NA, Etter PD, Atwood TS, Currey MC, Shiver AL
et al (2008) Rapid SNP discovery and genetic
mapping using sequenced RAD markers. PLoS ONE
3(10):e3376
Bonierbale MW, Plaisted RL, Tanksley SD (1988a)
Construction of a genetic-map of potato based on
molecular markers from tomato. Am Potato J 65
(8):471–472
Bonierbale MW, Plaisted RL, Tanksley SD (1988b)
RFLP maps based on a common set of clones reveal
modes of chromosomal evolution in potato and
tomato. Genetics 120(4):1095–1103
Bradshaw JE, Pande B, Bryan GJ, Hackett CA,
McLean K, Stewart HE, Waugh R (2004) Interval
mapping of quantitative trait loci for resistance to late
blight Phytophthora infestans (Mont.) de Bary, height
and maturity in a tetraploid population of potato
(Solanum tuberosum subsp tuberosum). Genetics 168
(2):983–995
Bybee SM, Bracken-Grissom H, Haynes BD, Her-
mansen RA, Byers RL et al (2011) Targeted amplicon
sequencing (TAS): a scalable next-gen approach to
multilocus, multitaxa phylogenetics. Genome Biol
Evol 3:1312–1323
Chevreux B, Pfisterer T, Drescher B, Driesel AJ,
Muller WEG, Wetter T, Suhai S (2004) Using the
miraEST assembler for reliable and automated mRNA
transcript assembly and SNP detection in sequenced
ESTs. Genome Res 14(6):1147–1159
Clarke LJ, Czechowski P, Soubrier J, Stevens MI,
Cooper A (2014) Modular tagging of amplicons using
17 Genome Sequence-Based Marker Development and Genotyping …
a single PCR for high-throughput sequencing. Mol
Ecol Resour 14(1):117–121
De Koeyer D, Douglass K, Murphy A, Whitney S,
Nolan L, Song Y, De Jong W (2010) Application of
high-resolution DNA melting for genotyping and
variant scanning of diploid and autotetraploid potato.
Mol Breed 25(1):67–90
D’Hont A, Denoeud F, Aury JM, Baurens FC, Carreel F
et al (2012) The banana (Musa acuminata) genome
and the evolution of monocotyledonous plants. Nature
488:213–217
Dunwell JM, Sunderland N (1973) Anther culture of
Solanum tuberosum L. Euphytica 22(2):317–323
Elshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K,
Buckler ES, Mitchell SE (2011) A robust, simple
genotyping-by-sequencing (GBS) approach for high
diversity species. PLoS ONE 6(5):e19379
Esnault F, Pelle R, Dantec JP, Berard A, Le Paslier MC,
Chauvin JE (2016) Development of a potato cultivar
(Solanum tuberosum L.) core collection, a valuable
tool to prospect genetic variation for novel traits.
Potato Res 59(4):329–343
Fan JB, Oliphant A, Shen R, Kermani BG, Garcia F et al
(2003) Highly parallel SNP genotyping. Cold Spring
Harb Symp Quant Biol 68:69–78
Feingold S, Lloyd J, Norero N, Bonierbale M, Lorenzen J
(2005) Mapping and characterization of new
EST-derived microsatellites for potato (Solanum
tuberosum L.). Theor Appl Genet 111(3):456–466
Felcher KJ, Coombs JJ, Massa AN, Hansey CN, Hamil-
ton JP et al (2012) Integration of two diploid potato
linkage maps with the potato genome sequence.
PLoS ONE 7(4):e36347
Fulton TM, Van der Hoeven R, Eannetta NT,
Tanksley SD (2002) Identification, analysis, and
utilization of conserved ortholog set markers for
comparative genomics in higher plants. Plant Cell 14
(7):1457–1467
Ganal MW, Polley A, Graner EM, Plieske J, Wieseke R,
Luerssen H, Durstewitz G (2012) Large SNP arrays
for genotyping in crop plants. J Biosci 37(5):821–828
Garcia-Mas J, Benjak A, Sanseverino W, Bourgeois M,
Mir G et al (2012) The genome of melon (Cucumis
melo L.). Procd Natl Acad Sci USA 109(29):11872–
11877
Garrison E, Marth G (2012) Haplotype-based variant
detection from short-read sequencing. arXiv preprint
arXiv 1207.3907 [q-bio.GN]
Gebhardt C (2007) Chapter 5—molecular markers, maps
and population genetics. In: Vreugdenhil D, Brad-
shaw J, Gebhardt C, Govers F, Taylor MA, MacKer-
ron DKL, Ross HA (eds) Potato biology and
biotechnology. Elsevier Science B.V, Amsterdam,
pp 77–89
Gebhardt C, Ritter E, Debener T, Schachtschabel U,
Walkemeier B, Uhrig H, Salamini F (1989) RFLP
analysis and linkage mapping in Solanum tuberosum.
Theor Appl Genet 78(1):65–75
Gebhardt C, Ritter E, Barone A, Debener T, Walke-
meier B et al (1991) RFLP maps of potato and their
323
alignment with the homoeologous tomato genome.
Theor Appl Genet 83(1):49–57
Ghislain M, Trognitz B, Herrera MD, Solis J, Casallo G
et al (2001) Genetic loci associated with field resis-
tance to late blight in offspring of Solanum phureja
and S. tuberosum grown under short-day conditions.
Theor Appl Genet 103(2–3):433–442
Ghislain M, Spooner DM, Rodriguez F, Villamon F,
Nunez J et al (2004) Selection of highly informative
and user-friendly microsatellites (SSRs) for genotyp-
ing of cultivated potato. Theor Appl Genet 108
(5):881–890
Ghislain M, Nunez J, Herrera MR, Pignataro J, Guzman F,
Bonierbale M, Spooner DM (2009) Robust and highly
informative microsatellite-based genetic identity kit
for potato. Mol Breed 23(3):377–388
Giolai M, Paajanen P, Verweij W, Percival-Alwyn L,
Baker D et al (2016) Targeted capture and sequencing
of gene-sized DNA molecules. Biotechniques 61
(6):315–322
Hackett CA, McLean K, Bryan GJ (2013) Linkage
analysis and QTL mapping using SNP dosage data
in a tetraploid potato mapping population. PLoS ONE
8(5):e63939
Hamilton JP, Hansey CN, Whitty BR, Stoffel K,
Massa AN et al (2011) Single nucleotide polymor-
phism discovery in elite North American potato
germplasm. BMC Genom 12:302
Hardigan MA, Bamberg J, Buell CR, Douches DS (2015)
Taxonomy and genetic differentiation among wild and
cultivated germplasm of Solanum sect. Petota. Plant
Genome 8(1):1–16
Hardigan MA, Crisovan E, Hamilton JP, Kim J, Laim-
beer P et al (2016) Genome reduction uncovers a large
dispensable genome and adaptive role for copy
number variation in asexually propagated Solanum
tuberosum. Plant Cell 28(2):388–405
Hermsen JGT, Verdeniu J (1973) Selection from Solanum
tuberosum group Phureja of genotypes combining
high-frequency haploid induction with homozygosity
for embryo-spot. Euphytica 22(2):244–259
Hirsch CN, Hirsch CD, Felcher K, Coombs J, Zarka D
et al (2013) Retrospective view of North American
potato (Solanum tuberosum L.) breeding in the 20th
and 21st centuries. G3-Genes Genomes. Genetics 3
(6):1003–1013
Hirsch CD, Hamilton JP, Childs KL, Cepela J, Crisovan E
et al (2014) Spud DB: a resource for mining
sequences, genotypes, and phenotypes to accelerate
potato breeding. Plant Genome 7(1):1–12
Hosaka K, Hanneman RE (1998a) Genetics of
self-compatibility in a self-incompatible wild diploid
potato species Solanum chacoense. 1. Detection of an
S locus inhibitor (Sli) gene. Euphytica 99(3):191–197
Hosaka K, Hanneman RE (1998b) Genetics of
self-compatibility in a self-incompatible wild diploid
potato species Solanum chacoense. 2. Localization of
an S locus inhibitor (Sli) gene on the potato genome
using DNA markers. Euphytica 103(2):265–271
324
Hougas RW, Peloquin SJ (1957) Haploid plant of the
potato variety Katahdin. Nature 180:1209–1210
Huang SW, Li RQ, Zhang ZH, Li L, Gu XF et al (2009)
The genome of the cucumber, Cucumis sativus L. Nat
Genet 41(12):1275–1281
Isidore E, van Os H, Andrzejewski S, Bakker J, Barrena I
et al (2003) Toward a marker-dense meiotic map of
the potato genome: lessons from linkage group I.
Genetics 165(4):2107–2116
Ivanovsakaja EV (1939) A haploid plant of S. tuberosum.
CR Acad Sci USSR 24:517–520
Jaccoud D, Peng KM, Feinstein D, Kilian A (2001)
Diversity arrays: a solid state technology for sequence
information independent genotyping. Nucleic Acids
Res 29(4):E25
Jacobs JME, Vaneck HJ, Arens P, Verkerkbakker B,
Hekkert BTL et al (1995) A genetic-map of potato
(Solanum tuberosum) integrating molecular markers,
including transposons, and classical markers. Theor
Appl Genet 91(2):289–300
Jaillon O, Aury JM, Noel B, Policriti A, Clepet C et al
(2007) The grapevine genome sequence suggests
ancestral hexaploidization in major angiosperm phyla.
Nature 449(7161):463–467
Jansky SH, Chung YS, Kittipadukal P (2014) M6: a
diploid potato inbred line for use in breeding and
genetics research. J Plant Regist 8(2):195–199
Jupe F, Witek K, Verweij W, Sliwka J, Pritchard L et al
(2013) Resistance gene enrichment sequencing
(RenSeq) enables reannotation of the NB-LRR gene
family from sequenced plant genomes and rapid
mapping of resistance loci in segregating populations.
Plant J 76(3):530–544
Kaminski KP, Korup K, Andersen MN, Sonderkaer M,
Andersen MS et al (2015) Cytosolic glutamine
synthetase is important for photosynthetic efficiency
and water use efficiency in potato as revealed by
high-throughput sequencing QTL analysis. Theor
Appl Genet 128(11):2143–2153
Kaminski KP, Korup K, Andersen MN, Sonderkaer M,
Andersen MS et al (2016) Next generation sequencing
bulk segregant analysis of potato support that differ-
ential flux into the cholesterol and stigmasterol
metabolite pools is important for steroidal glycoalka-
loid content. Potato Res 59(1):81–97
Kaul S, Koo HL, Jenkins J, Rizzo M, Rooney T et al
(2000) Analysis of the genome sequence of the
flowering plant Arabidopsis thaliana. Nature 408
(6814):796–815
Kim S, Park M, Yeom SI, Kim YM, Lee JM et al (2014)
Genome sequence of the hot pepper provides insights
into the evolution of pungency in Capsicum species.
Nat Genet 46(3):270–278
Kloosterman B, Abelenda JA, Gomez MDC, Oortwijn M,
de Boer JM et al (2013) Naturally occurring allele
diversity allows potato cultivation in northern lati-
tudes. Nature 495:246–250
Kolech SA, Halseth D, Perry K, Wolfe D, Douches DS
et al (2016) Genetic diversity and relationship of
Ethiopian potato varieties to germplasm from North
S. K. Sharma and G. J. Bryan
America, Europe and the International Potato Center.
Am J Potato Res 93(6):609–619
Langmead B, Salzberg SL (2012) Fast gapped-read
alignment with Bowtie 2. Nat Methods 9(4):357–359
Li H (2011) A statistical framework for SNP calling,
mutation discovery, association mapping and popula-
tion genetical parameter estimation from sequencing
data. Bioinformatics 27(21):2987–2993
Li H, Durbin R (2009) Fast and accurate short read
alignment with Burrows-Wheeler transform. Bioinfor-
matics 25(14):1754–1760
Li H, Handsaker B, Wysoker A, Fennell T, Ruan J et al
(2009) The sequence alignment/map format and
SAMtools. Bioinformatics 25(16):2078–2079
Lin Z, Hayes BJ, Daetwyler HD (2014) Genomic
selection in crops, trees and forages: a review. Crop
Pasture Sci 65(11):1177–1191
Lindhout P, Meijer D, Schotte T, Hutten RCB, Vis-
ser RGF, van Eck HJ (2011) Towards F1 hybrid seed
potato breeding. Potato Res 54(4):301–312
Lindqvist-Kreuze H, Cho K, Portal L, Rodriguez F,
Simon R et al (2013) Linking the potato genome to the
conserved ortholog set (COS) markers. BMC Genet
14:51
Lindqvist-Kreuze H, Gastelo M, Perez W, Forbes GA, de
Koeyer D, Bonierbale M (2014) Phenotypic stability
and genome-wide association study of late blight
resistance in potato genotypes adapted to the tropical
highlands. Phytopathology 104(6):624–633
Mackay TFC (2001) The genetic architecture of quanti-
tative traits. Annu Rev Genet 35:303–339
Manrique-Carpintero NC, Tokuhisa JG, Ginzberg I, Hol-
liday JA, Veilleux RE (2013) Sequence diversity in
coding regions of candidate genes in the glycoalkaloid
biosynthetic pathway of wild potato species.
G3-Genes Genomes Genet 3(9):1467–1479
Matsumoto T, Wu J, Kanamori H, Katayose Y, Fuji-
sawa M et al (2005) The map-based sequence of the
rice genome. Nature 436(7052):793–800
McCarthy A (2010) Third generation DNA sequencing:
Pacific biosciences’ single molecule real time tech-
nology. Chem Biol 17(7):675–676
McCord P, Zhang LH, Brown C (2012) The incidence
and effect on total tuber carotenoids of a recessive
zeaxanthin epoxidase allele (Zep1) in yellow-fleshed
potatoes. Am J Potato Res 89(4):262–268
McGregor CE, Lambert CA, Greyling MM, Louw JH,
Warnich L (2000) A comparative assessment of DNA
fingerprinting techniques (RAPD, ISSR, AFLP and
SSR) in tetraploid potato (Solanum tuberosum L.)
germplasm. Euphytica 113(2):135–144
McKenna A, Hanna M, Banks E, Sivachenko A, Cibul-
skis K et al (2010) The genome analysis toolkit: a
mapreduce framework for analyzing next-generation
DNA sequencing data. Genome Res 20(9):1297–1303
Mertes F, ElSharawy A, Sauer S, van Helvoort J, van der
Zaag PJ, Franke A, Nilsson M, Lehrach H,
Brookes AJ (2011) Targeted enrichment of genomic
DNA regions for next-generation sequencing. Brief
Funct Genomics 10(6):374–386
17 Genome Sequence-Based Marker Development and Genotyping …
Meyer RC, Milbourne D, Hackett CA, Bradshaw JE,
McNichol JW, Waugh R (1998) Linkage analysis in
tetraploid potato and association of markers with
quantitative resistance to late blight (Phytophthora
infestans). Mol General Genet 259(2):150–160
Mikheyev AS, Tin MMY (2014) A first look at the
Oxford Nanopore MinION sequencer. Mol Ecol
Resour 14(6):1097–1102
Milbourne D, Meyer RC, Collins AJ, Ramsay LD,
Gebhardt C, Waugh R (1998) Isolation, characterisa-
tion and mapping of simple sequence repeat loci in
potato. Mol General Genet 259(3):233–245
Ming R, Hou SB, Feng Y, Yu QY, Dionne-Laporte A
et al (2008) The draft genome of the transgenic
tropical fruit tree papaya (Carica papaya L.). Nature
452(7190):991–996
Mosquera T, Alvarez MF, Jimenez-Gomez JM, Muk-
tar MS, Paulo MJ et al (2016) Targeted and untargeted
approaches unravel novel candidate genes and diag-
nostic SNPs for quantitative resistance of the potato
(Solanum tuberosum L.) to Phytophthora infestans
causing the late blight disease. PLoS ONE 11(6):
e0156254
Motazedi E, Finkers R, Maliepaard C, Ridder dD (2017)
Exploiting next-generation sequencing to solve the
haplotyping puzzle in polyploids: a simulation study.
Brief Bioinform bbw 126:1–17.
doi:10.1093/bib/bbw126
Navarro C, Abelenda JA, Cruz-Oro E, Cuellar CA,
Tamaki S, Silva J, Shimamoto K, Prat S (2011)
Control of flowering and storage organ formation in
potato by FLOWERING LOCUS T. Nature 478
(7367):119–122
Obidiegwu JE, Sanetomo R, Flath K, Tacke E, Hoffer-
bert HR et al. (2015) Genomic architecture of potato
resistance to Synchytrium endobioticum disentangled
using SSR markers and the 8.3 k SolCAP SNP
genotyping array. BMC Genet 16.
doi:10.1186/s12863-015-0195-y
Paterson AH, Bowers JE, Bruggmann R, Dubchak I,
Grimwood J et al (2009) The Sorghum bicolor
genome and the diversification of grasses. Nature
457(7229):551–556
Peloquin SJ, Hougas RW (1958) Fertility in 2 haploids of
Solanum tuberosum. Science 128(3335):1340–1341
Plaisted RL, Hoopes RW (1989) The past record and
future-prospects for the use of exotic potato germ-
plasm. Am Potato J 66(10):603–627
Poland J, Endelman J, Dawson J, Rutkoski J, Wu SY et al
(2012a) Genomic selection in wheat breeding using
genotyping-by-sequencing. Plant Genome 5(3):103–
113
Poland JA, Brown PJ, Sorrells ME, Jannink JL (2012b)
Development of high-density genetic maps for barley
and wheat using a novel two-enzyme genotyping-
by-sequencing approach. PLoS ONE 7(2):e32253
Potato Genome Sequencing Consortium (2011) Genome
sequence and analysis of the tuber crop potato. Nature
475(7355):189–195
325
Powell W, Uhrig H (1987) Anther culture of solanum
genotypes. Plant Cell Tiss Org Cult 11(1):13–24
Prashar A, Hornyik C, Young V, McLean K, Sharma SK
et al (2014) Construction of a dense SNP map of a
highly heterozygous diploid potato population and
QTL analysis of tuber shape and eye depth. Theor
Appl Genet 127(10):2159–2171
Prevost A, Wilkinson MJ (1999) A new system of
comparing PCR primers applied to ISSR fingerprinting
of potato cultivars. Theor Appl Genet 98(1):107–112
Provan J, Powell W, Waugh R (1996a) Analysis of
cultivated potato (Solanum tuberosum) using intermi-
crosatellite amplification. Genome 39(4):767–769
Provan J, Powell W, Waugh R (1996b) Microsatellite
analysis of relationships within cultivated potato (Sola-
num tuberosum). Theor Appl Genet 92(8):1078–1084
Rhoads A, Au KF (2015) PacBio sequencing and its
applications. Genom Proteom Bioinform 13(5):278–
289
Rickert AM, Kim JH, Meyer S, Nagel A, Ballvora A,
Oefner PJ, Gebhardt C (2003) First-generation
SNP/InDel markers tagging loci for pathogen resistance
in the potato genome. Plant Biotech J 1(6):399–410
Riedelsheimer C, Czedik-Eysenberg A, Grieder C,
Lisec J, Technow F et al (2012) Genomic and
metabolic prediction of complex heterotic traits in
hybrid maize. Nat Genet 44(2):217–220
Rosyara UR, De Jong WS, Douches DS, Endelman JB
(2016) Software for genome-wide association studies
in autopolyploids and its application to potato. Plant
Genome 9(2):1–10
Rouppe van der Voort JNAM, van Zandvoort P, van
Eck HJ, Folkertsma RT, Hutten RCB et al (1997) Use
of allele specificity of comigrating AFLP markers to
align genetic maps from different potato genotypes.
Mol Gen Genet 255(4):438–447
Rouppe van der Voort JNAM, van Eck HJ, Draaistra J,
van Zandvoort PM, Jacobsen E, Bakker J (1998) An
online catalogue of AFLP markers covering the potato
genome. Mol Breed 4(1):73–77
Sato S, Tabata S, Hirakawa H, Asamizu E, Shirasawa K,
Isobe S et al (2012) The tomato genome sequence
provides insights into fleshy fruit evolution. Nature
485(7400):635–641
Scaglione D, Allwright M, Scalabrin S, Smith HK,
Emiliani G et al. (2017) Targeted genotyping-
by-sequencing with single primer enrichment technol-
ogy (SPET). A case study in black poplar. Paper
presented at the Plant & Animal Genome XXV, San
Diego, CA, 13–18 Jan 2017
Schmutz J, Cannon SB, Schlueter J, Ma JX, Mitros T et al
(2010) Genome sequence of the palaeopolyploid
soybean. Nature 463(7278):178–183
Schnable PS, Ware D, Fulton RS, Stein JC, Wei F et al
(2009) The B73 maize genome: complexity, diversity,
and dynamics. Science 326(5956):1112–1115
Schonhals E, Ortega F, Barandalla L, Aragones A, de
Galarreta JIR et al (2016) Identification and repro-
ducibility of diagnostic DNA markers for tuber starch
and yield optimization in a novel association mapping
326
population of potato (Solanum tuberosum L.). Theor
Appl Genet 129(4):767–785
Sharma SK, Bolser D, de Boer J, Sonderkaer M,
Amoros W et al (2013) Construction of reference
chromosome-scale pseudomolecules for potato: inte-
grating the potato genome with genetic and physical
maps. G3-Genes Genomes Genet 3(11):2031–2047
Sharma SK, Bayer M, McLean K, MacKenzie K,
Daniels S, Dale MFB, Bryan G (2014a) Application
of genotyping-by-sequencing for identifying SNP
variation and performing genome-wide association
studies in a tetraploid potato association panel. Paper
presented at the 19th triennial conference of the
European Association for Potato Research (EAPR),
Brussels, Belgium, 6–11 July 2014
Sharma SK, Bayer M, McLean K, MacKenzie K,
Daniels S, Dale MFB, Bryan G (2014b)
Genotyping-by-sequencing and genome-wide associ-
ation analysis in tetraploid potato. Paper presented at
the 11th Solanaceae conference (SOL 2014), Porto
Seguro-BA, Brazil, 2–6 Nov 2014
Shulaev V, Sargent DJ, Crowhurst RN, Mockler TC,
Folkerts O et al (2011) The genome of woodland
strawberry (Fragaria vesca). Nat Genet 43(2):109–
116
Simko I, Haynes KG, Jones RW (2006) Assessment of
linkage disequilibrium in potato genome with single
nucleotide polymorphism markers. Genetics 173
(4):2237–2245
Slater AT, Cogan NOI, Forster JW, Hayes BJ,
Daetwyler HD (2016) Improving genetic gain with
genomic selection in autotetraploid potato. Plant
Genome 9(3):1–15
Sliwka J, Jakuczun H, Chmielarz M, Hara-Skrzypiec A,
Tomczynska I, Kilian A, Zimnoch-Guzowska E
(2012) A resistance gene against potato late blight
originating from Solanum X michoacanum maps to
potato chromosome VII. Theor Appl Genet 124
(2):397–406
Steemers FJ, Chang WH, Lee G, Barker DL, Shen R,
Gunderson KL (2006) Whole-genome genotyping
with the single-base extension assay. Nat Methods 3
(1):31–33
Stich B, Urbany C, Hoffmann P, Gebhardt C (2013)
Population structure and linkage disequilibrium in
diploid and tetraploid potato revealed by
genome-wide high-density genotyping using the
SolCAP SNP array. Plant Breed 132(6):718–724
Swarts K, Li HH, Navarro JAR, An D, Romay MC et al
(2014) Novel methods to optimize genotypic imputa-
tion for low-coverage, next-generation sequence data
in crop plants. Plant Genome 7(3):1–12
Tang JF, Baldwin SJ, Jacobs JME, van der Linden CG,
Voorrips RE et al (2008) Large-scale identification of
polymorphic microsatellites using an in silico
approach. BMC Bioinform 9:374
Tanksley SD, Ganal MW, Prince JP, Devicente MC,
Bonierbale MW et al (1992) High-density molecular
linkage maps of the tomato and potato genomes.
Genetics 132(4):1141–1160
Thomson MJ (2014) High-throughput SNP genotyping to
accelerate crop improvement. Plant Breed Biotech 2
(3):195–212
S. K. Sharma and G. J. Bryan
Uitdewilligen J, Wolters AMA, D’Hoop BB, Borm TJA,
Visser RGF, van Eck HJ (2013) A next-generation
sequencing method for genotyping-by-sequencing of
highly heterozygous autotetraploid potato. PLoS ONE
8(5):e62355
van Eck HJ, van der Voort JR, Draaistra J, van
Zandvoort P, van Enckevort E et al (1995) The
inheritance and chromosomal localization of AFLP
markers in a noninbred potato offspring. Mol Breed 1
(4):397–410
van Os H, Stam P, Visser RGF, van Eck HJ (2005a)
RECORD: a novel method for ordering loci on a
genetic linkage map. Theor Appl Genet 112(1):30–40
van Os H, Stam P, Visser RGF, van Eck HJ (2005b)
SMOOTH: a statistical method for successful removal
of genotyping errors from high-density genetic link-
age data. Theor Appl Genet 112(1):187–194
van Weymers PSM, Baker K, Chen XW, Harrower B,
Cooke DEL et al. (2016) Utilizing “Omic” technolo-
gies to identify and prioritize novel sources of
resistance to the oomycete pathogen Phytophthora
infestans in potato germplasm collections. Front Plant
Sci 7. doi:10.3389/fpls.2016.00672
Varshney RK, Graner A, Sorrells ME (2005) Genomics-
assisted breeding for crop improvement. Trend Plant
Sci 10(12):621–630
Varshney RK, Chen WB, Li YP, Bharti AK, Saxena RK
et al (2012) Draft genome sequence of pigeon pea
(Cajanus cajan), an orphan legume crop of
resource-poor farmers. Nat Biotech 30(1):83–89
Varshney RK, Terauchi R, McCouch SR (2014) Har-
vesting the promising fruits of genomics: applying
genome sequencing technologies to crop breeding.
PLoS Biol 12(6):e1001883
Veilleux RE, Shen LY, Paz MM (1995) Analysis of the
genetic composition of anther-derived potato by
randomly amplified polymorphic DNA and simple
sequence repeats. Genome 38(6):1153–1162
Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A
et al (2010) The genome of the domesticated apple
(Malus x domestica Borkh.). Nat Genet 42(10):833–
839
Vos P, Hogers R, Bleeker M, Reijans M, Vandelee T et al
(1995) AFLP—a new technique for DNA-
fingerprinting. Nucleic Acids Res 23(21):4407–4414
Vos PG, Uitdewilligen J, Voorrips RE, Visser RGF, van
Eck HJ (2015) Development and analysis of a 20 K
SNP array for potato (Solanum tuberosum): an insight
into the breeding history. Theor Appl Genet 128
(12):2387–2401
Wang X, Wang H, Wang J, Sun R, Wu J et al (2011) The
genome of the mesopolyploid crop species Brassica
rapa. Nat Genet 43(10):1035–1039
Wittwer CT, Reed GH, Gundry CN, Vandersteen JG,
Pryor RJ (2003) High-resolution genotyping by
amplicon melting analysis using LCGreen. Clin Chem
49(6):853–860
Wu FN, Mueller LA, Crouzillat D, Petiard V,
Tanksley SD (2006) Combining bioinformatics and
phylogenetics to identify large sets of single-copy
orthologous genes (COSII) for comparative, evolu-
tionary and systematic studies: a test case in the
euasterid plant clade. Genetics 174(3):1407–1420